Innovative bacterium belonging to the genus Bifidobacterium.

Description

1 / 30 “INNOVATIVE BACTERIA BELONGING TO THE GENUS BIFIDOBACTERIUM” TECHNICAL FIELD

[001] The present invention relates to a bacterium belonging to the genus Bifidobacterium which is classified as Bifidobacterium pseudocatenulatum. BACKGROUND OF THE TECHNIQUE

[002] It is presumed that one of the factors influencing the physiological functions of the hosts is the fact that probiotics metabolize carbohydrate sources that remain in the digestive tract and produce short-chain fatty acids, such as lactic acid and acetic acid. Previous studies have revealed that the genome of a dominant bifidobacteria species in the adult intestinal tract is rich in genes involved in the metabolism of indigestible plant-derived polysaccharides, particularly xylans abundantly contained in adult diets, compared to the genomes of bifidobacteria species derived from infants.

[003] The present applicant has previously discovered a bacterium belonging to the genus Bifidobacterium that possesses the xylanase gene in its genome and can utilize xylans efficiently (Patent Literature 1). This bacterium belonging to the genus Bifidobacterium is expected to proliferate in the intestines of adults and have a high capacity to produce organic acids, and is therefore a promising candidate for probiotics intended for adults. LIST OF CITATIONS Patent Literature Patent Literature 1: WO 2020 / 203782 SUMMARY OF THE INVENTION TECHNICAL PROBLEM

[004] Bifidobacterium pseudocatenulatum YIT 11057 described in Patent Literature 1 has the xylanase gene and is expected to actively metabolize carbohydrates in the intestines and produce organic acids. However, considering its use in the production of fermented milk, it has been found that YIT 11057 does not always have Petition 870250087651, dated 09 / 26 / 2025, p. 48 / 91 2 / 30 sufficient viability in a medium containing a milk component. Consequently, the present invention relates to providing an innovative bacterium belonging to Bifidobacterium pseudocatenulatum that is capable of utilizing xylans and exhibits excellent viability in a medium containing a milk component. SOLUTION TO THE PROBLEM

[005] The present inventors conducted diligent studies and, consequently, obtained an innovative bacterium belonging to Bifidobacterium pseudocatenulatum that can utilize xylans efficiently and exhibits excellent viability in a medium containing a milk component.

[006] Specifically, the present invention provides the following [1] to [6].

[007] [1] A bacterium belonging to Bifidobacterium pseudocatenulatum, wherein the bacterium has the xylanase gene in one genome and has greater viability in a medium containing milk components than Bifidobacterium pseudocatenulatum YIT 11057 (NITE BP-02930).

[008] [2] The bacterium according to [1], in which the xylanase gene is a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 1 or a polynucleotide that has 70% or more identity to the nucleotide sequence and that encodes a protein that has xylanase activity.

[009] [3] The bacterium according to [1], in which the survival rate is 20% or more when the bacterium is cultured in a medium containing milk component for 24 hours and then preserved at low temperature for 2 weeks.

[010] [4] Bifidobacterium pseudocatenulatum Y 51493 (NITE BP-03852), Bifidobacterium pseudocatenulatum YIT 13179 (NITE BP-03853), or a bacterial strain closely related to it.

[011] [5] A beverage or food product comprising the bacteria according to any one of [1] to [4].

[012] [6] The beverage or food product according to [5] that is a beverage Petition 870250087651, dated 09 / 26 / 2025, p. 49 / 91 3 / 30 or fermented milk food product. ADVANTAGEOUS EFFECTS OF THE INVENTION

[013] The innovative bacterium belonging to Bifidobacterium pseudocatenulatum according to the present invention has the ability to degrade and utilize xylans, particularly arabinoxylan, abundantly contained in adult diets, and exhibits excellent viability in a medium containing a milk component. Thus, it is expected that the bacterium of the present invention will proliferate in the intestines of adults and have a high capacity to produce organic acids and, as such, can be used as probiotics for adults in medicines, foods or beverages and the like. BRIEF DESCRIPTION OF THE DRAWINGS

[014] Figure 1 illustrates the change in the number of viable bacteria at the time of preservation of Y 51493 and YIT 11057 cultured in a medium containing a milk component.

[015] Figure 2 illustrates the change in survival rate at the time of preservation of Y 51493 and YIT 11057 cultured in a medium containing a milk component.

[016] Figure 3 illustrates an example of the genomic structure of a strain that has acquired the xylanase (transforming) gene from Bifidobacterium pseudocatenulatum. The corresponding single nucleotide polymorphisms (SNPs) of each strain are indicated by the gray line.

[017] Figure 4 illustrates the proliferation curves of a donor (Bifidobacterium pseudocatenulatum YIT 11027), a recipient (Bifidobacterium pseudocatenulatum YIT 11956) and the strain that acquired the gene (transformant) in the mPY-AX medium.

[018] Figure 5 illustrates the proliferation curves of a donor (Bifidobacterium pseudocatenulatum YIT 11027), a recipient (Bifidobacterium pseudocatenulatum YIT 11956) and the strain that acquired the gene (transformant) in the mPY-Starch medium. Petition 870250087651, dated 09 / 26 / 2025, pp. 50 / 91 4 / 30

[019] Figure 6 illustrates the colony formation of a donor (Bifidobacterium pseudocatenulatum YIT 4072T), a recipient (Bifidobacterium pseudocatenulatum YIT 12824) and the strain that acquired the gene (transforming) in Tc-mGAML medium.

[020] Figure 7 illustrates the transformation frequencies when (A) viable bacterial cells or dead bacterial cells, (B) viable bacterial cells, genomic DNA or PCR products, and (C) viable bacterial cells treated with DNase were used as donors.

[021] Figure 8 illustrates the change in the number of viable bacteria at the time of preservation of YIT 13179 and Y 51493 cultured in a medium containing a milk component and their survival rates on day 28 of preservation. DESCRIPTION OF THE MODALITIES

[022] The bacterium of the present invention is a bacterium belonging to Bifidobacterium pseudocatenulatum that has the xylanase gene in its genome and exhibits excellent viability in a medium containing a milk component. In one aspect, the bacterium of the present invention is a bacterium belonging to Bifidobacterium pseudocatenulatum, and the bacterium has the xylanase gene in its genome and exhibits greater viability in a medium containing a milk component than Bifidobacterium pseudocatenulatum YIT 11057 (NITE BP-02930). YIT 11057 has the xylanase gene in its genome. YIT 11057 was filed on March 25, 2019, with the National Institute of Technology and Evaluation - Patent Microorganism Depository (No. 122, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Japan).

[023] The xylanase gene refers to a gene encoding xylanase classified as GH10 (endo-1,4-beta-xylanase A; xynA). The “xylanase gene” possessed in the genome by the bacterium belonging to Bifidobacterium pseudocatenulatum according to the present invention specifically encompasses a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 1 or a polynucleotide having 70% or more, preferably 90% or more, more preferably 95% or more, more preferably 98% or more, more preferably 99% or more of Petition 870250087651, dated 09 / 26 / 2025, pp. 51 / 91 5 / 30 identity with the nucleotide sequence and that codes for a protein that has xylanase activity.

[024] In this context, the polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 1 refers to the xylanase gene possessed by YIT 11057.

[025] The identity of nucleotide sequences is a value obtained by aligning both nucleotide sequences so that the two nucleic acid sequences to be compared have as much correspondence with each other as possible, dividing the number of matching bases by the total number of bases and expressing the quotient as a percentage. Those skilled in the art can appropriately set parameters in software such as BLAST, ClustalX, or Genetyx to determine the identity of nucleotide sequences.

[026] Xylanase activity means hydrolysis activity of the xylose main chain of xylans with xylans as substrate to produce xylooligosaccharide and xylose (xylan hydrolytic activity).

[027] In this context, examples of xylans include xylan, arabinoxylan, glucuronoxylan, glucuronoarabinoxylan and acetylxylan. Xylan and arabinoxylan are preferred.

[028] Thus, the bacterium belonging to Bifidobacterium pseudocatenulatum that has the xylanase gene in its genome is, in other words, a bacterium belonging to Bifidobacterium pseudocatenulatum that has the ability to degrade the xylose main chain of xylans.

[029] As used in this document, “having the ability to utilize xylans” refers to having the ability to proliferate with xylans as a carbon source. Specifically, this phrase refers, for example, to the ability to proliferate in a medium containing xylans as only one carbon source. For example, this phrase means that the turbidity, for example, in terms of ODgqq increase, is 0.1 or more when the culture is carried out in a medium containing only xylans as a carbon source. Petition 870250087651, dated 09 / 26 / 2025, p. 52 / 91 6 / 30 carbohydrate for 72 hours. Turbidity is preferably 0.3 or higher, more preferably 0.4 or higher, in terms of increase in OD600. If the change in turbidity cannot be measured, for example, due to a medium supplemented with xylans rich in insoluble fractions, the phrase means that the amount of short-chain fatty acids produced, for example, the total amount of lactic acid, acetic acid, and formic acid produced, is 10 mM or more in a culture supernatant obtained by culturing for 72 hours. The amount of short-chain fatty acids produced is preferably 20 mM or higher, more preferably 40 mM or higher in total.

[030] A carbohydrate-free medium supplemented with xylans can be used as a culture medium for use in a xylan utilization capacity test. The composition of the carbohydrate-free medium can be the composition of MILS medium, Peptone-Yeast (PY) medium, or similar.

[031] The amount of xylans added to the medium is preferably from 0.01 to 10% by mass, more preferably from 0.05 to 5% by mass, and even more preferably from 0.1 to 1% by mass, in the medium. For a control, it is desirable to cultivate the target bacterium belonging to Bifidobacterium pseudocatenulatum in the medium without a carbohydrate source and confirm the OD value.

[032] “Milk component” means a material containing a milk-derived component, including raw milk or animal milk, such as cow’s milk, goat’s milk or sheep’s milk, heated milk, skimmed milk powder, whole milk powder, fresh cream or whey. Of these, skimmed milk powder is preferred. “Whey” is obtained by removing the fat and casein from milk.

[033] “Medium containing a milk component” cannot be limited, provided that the medium contains a milk component. The medium containing the milk component may additionally contain an additional component, such as carbohydrates, vitamins, protein hydrolysates, amino acids, minerals, salts, surfactants, fatty acids or metals. The additional component is not particularly limited and consists Petition 870250087651, dated 09 / 26 / 2025, pp. 53 / 91 7 / 30 in, preferably, carbohydrates such as glucose, galactose, lactose or fructose.

[034] The milk component content in the medium is not particularly limited and is preferably from 1 to 50% by mass (hereinafter, the simple term “%” means % by mass), more preferably from 2 to 10%, based on the solids content.

[035] Viability in a medium containing a milk component indicates how many viable bacteria are present when the target bacterium, Bifidobacterium pseudocatenulatum, is cultured in a medium containing a milk component for 24 hours and then preserved at low temperature for 2 weeks. The number of viable bacteria can be determined according to a routine method. The number of viable bacteria in the medium containing a milk component can be determined, for example, by a colony counting method. Furthermore, the survival rate can be represented by the ratio between the number of viable bacteria after preservation at low temperature for 2 weeks and the number of viable bacteria immediately after culture for 24 hours. In this context, low temperature refers to a temperature range generally used in the preservation of microbes and is preferably 10 °C or less.

[036] “Greater viability in a medium containing a milk component than Bifidobacterium pseudocatenulatum YIT 11057 means more specifically that a survival rate is preferably 20% or more, more preferably 40% or more, and even more preferably 50% or more, when the bacterium belonging to Bifidobacterium pseudocatenulatum is cultured in a medium containing a milk component for 24 hours and then preserved at low temperature for 2 weeks.

[037] The bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, has the xylanase gene in its genome and has the ability to degrade and utilize xylans, and can therefore contribute to the supply of short-chain fatty acids, such as acetic acid, lactic acid and formic acid, produced by the degradation of xylans. The bacterium belonging to Bifidobacterium Petition 870250087651, dated 09 / 26 / 2025, pp. 54 / 91 8 / 30 pseudocatenulatum, according to the present invention, has high viability in a medium containing a milk component and can therefore effectively exert the physiological effects of the bacterium and is useful in the production of medicines, food or beverages and the like.

[038] The bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, can be obtained, for example, by screening bacteria belonging to Bifidobacterium pseudocatenulatum present in the intestines of humans (e.g., adults or infants), with the presence of the xylanase gene or the ability to utilize xylans and viability in a medium containing the milk component mentioned above as an index.Alternatively, the bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, can be obtained, for example, by screening bacteria prepared by a known breeding method using, as a parental strain, an arbitrary bacterium belonging to Bifidobacterium pseudocatenulatum as a bacterium belonging to Bifidobacterium pseudocatenulatum present in the intestines of humans (e.g., adults or infants); screening prepared bacteria by subjecting the parental strain to treatment with ultraviolet irradiation or a mutagenesis inducer, such as nitrosoguanidine (NTG) or ethyl methanesulfonate (EMS); or screening prepared bacteria by altering the genome of the parental strain by a known site-directed mutagenesis or similar, with the presence of the xylanase gene or the ability to utilize xylans and viability in a medium containing the milk component mentioned above as an index.Alternatively, the bacterium belonging to Bifidobacterium pseudocatenulatum according to the present invention can be obtained, for example, by screening bacteria prepared by a method for transforming a bacterium belonging to the genus Bifidobacterium mentioned in detail in Reference Example 1 or 2 described later using, as a recipient (parental strain), an arbitrary bacterium belonging to Bifidobacterium pseudocatenulatum as a bacterium belonging to Bifidobacterium. Petition 870250087651, dated 09 / 26 / 2025, pp. 55 / 91 9 / 30 pseudocatenulatum present in the intestines of humans (e.g., adults or infants), with the presence of the xylanase gene or the ability to utilize xylans and viability in a medium containing the milk component mentioned above as an index. In this context, the parental strain is preferably a bacterium belonging to Bifidobacterium pseudocatenulatum that has the xylanase gene in its genome, most preferably YIT 11057.

[039] As shown in Example 1 described later, the present inventors created YIT 11057 as a parent strain by UV irradiation and long-term subculture to obtain Y 51493 with higher viability in a medium containing a milk component than YIT 11057. As shown in Example 2 described later, Y 51493 was transformed to obtain YIT 13179 with equivalent viability in a medium containing a milk component to Y 51493. The bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, is not limited to this, provided that the bacterium has the xylanase gene in its genome and has higher viability in a medium containing a milk component than YIT 11057. The bacterium belonging to Bifidobacterium pseudocatenulatum encompasses bacterial strains closely related to these strains biologically and genetically.The bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, may be a naturally occurring strain or it may be a mutant or a genetically modified strain of the natural strain, provided that the bacterium has the xylanase gene in its genome and has greater viability in a medium containing a milk component than YIT 11057.

[040] Y 51493 and YIT 13179 were filed on March 13, 2023 at the National Institute of Technology and Evaluation - Patent Microorganism Depository (No. 122, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Japan), as shown below. Bifidobacterium pseudocatenulatum Y 51493 (NITE BP-03852), and Bifidobacterium pseudocatenulatum YIT 13179 (NITE BP-03853). Petition 870250087651, dated 09 / 26 / 2025, pp. 56 / 91 10 / 30

[041] Among these, YIT 13179 or its closely related bacterial strain is preferred from the point of view of its ability to utilize xylans, from the point of view of its viability in a medium containing a milk component, and from the point of view of additionally having the ability to utilize glucose. The glucose-utilizing strain is expected to produce organic acids from polysaccharides or oligosaccharides that have glucose as a constituent saccharide.

[042] In this context, the ability to use glucose refers to the ability to proliferate with glucose as a carbon source.

[043] A closely related bacterial strain refers to a bacterial strain that has matching sequences in the multilocus sequence analysis (MLSA) method for evaluating a plurality of maintenance gene sequences.

[044] Specifically, the full-length sequences of DNA gyrase B subunit (gyrB), 50S ribosomal protein L2 (rplB), amidophosphoribosyltransferase (purF), DNA-directed RNA polymerase beta subunit (rpoB), ATP-dependent Clp protease, ATP-binding ClpC1 subunit (clpC), elongation factor G (fusA), and isoleucine-tRNA ligase (ileS) reported as suitable genes for MLSA analysis in bifidobacteria (International Journal of Systematic and Evolutionary Microbiology (2006), 56, 2783-2792) are obtained and all genes are ligated for each bacterial strain. Then, sequence matching between the strains to be compared is tested using a program such as VSEARCH or BLAST. When the sequence identity is 90% or more, preferably 95% or more, most preferably 98% or more, most preferably 99% or more, it can be determined that the bacterial strains are closely related species.

[045] The nucleotide sequences of gyrB, rplB, purF, rpoB, clpC, fusA and ileS in YIT 11057 are shown in the Sequence Listing (gyrB: SEQ ID NO: 2, rplB: SEQ ID NO: 3, purF: SEQ ID NO: 4, rpoB: SEQ ID NO: 5, clpC: SEQ ID NO: 6, Petition 870250087651, dated 09 / 26 / 2025, pp. 57 / 91 11 / 30 fusion: SEQ ID NO: 7, ileS: SEQ ID NO: 8).

[046] The form of application of the bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, is not particularly limited, and it can be lyophilized or cultures containing the bacterium can be used. In either form, the bacterium is preferably in the state of a viable bacterium.

[047] The bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, can be mixed with a non-toxic solid or liquid carrier for a medicament and used in the form of a common pharmaceutical preparation. Examples of such preparations include solid formulations, such as tablets, granules, powders and capsules, liquid formulations, such as solutions, suspensions and emulsions, and lyophilized preparations. These preparations can be prepared by usual pharmaceutical approaches. Examples of non-toxic carriers for a medicament include glucose, lactose, sucrose, starch, mannitol, dextrin, fatty acid glyceride, polyethylene glycol, hydroxyethyl starch, ethylene glycol, polyoxyethylene sorbitan fatty acid ester, amino acids, gelatin, albumin, water and saline solution. If necessary, a common additive, such as a stabilizer, a wetting agent, an emulsifier, a binder, a tonicity agent, or an excipient, may be added appropriately.

[048] The bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, can not only be prepared as described above, but also mixed into a beverage or food product and used. The bacterium, when mixed into a beverage or food, can be contained as is or in combination with various nutrients. Specifically, in the case of mixing the bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, into a beverage or food product, the bacterium can be transformed into a form suitable for consumption, i.e., granules, grains, tablets, capsules, a paste or the like, by using a common approach using appropriately Petition 870250087651, dated 09 / 26 / 2025, pp. 58 / 91 12 / 30 an additive that can be used for beverages or food products, or can be added for use in various food products, for example, processed meat food products such as ham and sausage, processed seafood food products such as Kamaboko (fish paste) and Chikuwa (fish sausage), bread, confectionery, butter or milk powder, or can be added for use in beverages such as water, fruit juice, milk, soft drinks or teas. The beverage or food product also includes animal feed.

[049] A fermented milk beverage or food product, or a fermented beverage or food, such as fermented soy milk, fermented fruit juice, or fermented vegetable juice, containing the bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, in the state of a viable bacterium, is suitably used as a beverage or food product. In particular, it is preferable to use a fermented milk beverage or food product. The fermented milk beverage or food product can be produced according to a routine method. For example, in the case of the production of fermented milk, the bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, is inoculated and cultivated in a sterilized milk medium, alone or in combination with another microbe, and the result is homogenized to obtain a fermented milk base.Next, a separately prepared syrup solution is added and mixed with the base, and the mixture is homogenized using a homogenizer or similar device. Additional flavoring may be added to prepare a final product. The resulting fermented milk beverage or food product can be prepared as a product in any form, such as plain type without syrup (sweetener), soft type, fruit-flavored type, solid state, or liquid state.

[050] An arbitrary component, such as a sweetener (for example, a syrup), an emulsifier, a thickener (or a stabilizer), or various vitamins, may be mixed into such a fermented milk beverage or food product. The following may Petition 870250087651, dated 09 / 26 / 2025, pp. 59 / 91 13 / 30 to be mixed with the same: as syrup, carbohydrates such as glucose, sucrose, fructose, high-fructose corn syrup, glucose syrup, palatinose, trehalose, lactose, xylose, galacto-oligosaccharide (GOS), xylo-oligosaccharide (XOS), arabinoxylooligosaccharide (AXOS), xylan, arabinoxylan, arabino-oligosaccharide (AOS), arabinan, maltose, honey and molasses, sugar alcohols such as sorbitol, xylitol, erythritol, lactitol, palatinite, reduced sugar syrup and reduced maltose syrup, high-intensity sweeteners such as aspartame, thaumatin, sucralose, acesulfame K and stevia, emulsifiers such as glyceryl fatty acid ester, polyglyceryl fatty acid ester, sorbitan fatty acid ester and lecithin, and thickeners (or stabilizers) such as agar, gelatin, carrageenan, guar gum, xanthan gum, pectin, locust bean gum, gellan gum, carboxymethylcellulose, soy polysaccharides, and propylene glycol alginate.In addition, the following ingredients may be mixed: vitamins such as vitamin A, vitamin B, vitamin C and vitamin E, minerals such as calcium, magnesium, zinc, iron and manganese, acidulants such as citric acid, lactic acid, acetic acid, malic acid, tartaric acid and gluconic acid, milk fats such as cream, butter and curd, flavors such as yogurt, red fruits, orange, quince, perilla, citrus, apple, mint, grape, apricot, pear, pastry cream, peach, melon, banana, tropical, herbs, black tea and coffee, herbal extracts, brown sugar extracts and the like.

[051] In the production of fermented milk beverages or food products, a microbe other than the bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, may be used in combination with it. Examples of such microbes include bacteria belonging to the genus Lacticaseibacillus such as Lacticaseibacillus paracasei, bacteria belonging to the genus Lactobacillus such as Lactobacillus caesi, L. acidophilus, L. plantarum, L. buchneri, L. gallinarum, L. amylovorus, L. brevis, L. rhamnosus, L. kefir, L. paracasei, L. crispatus, L. zeae, L. helveticus, L. salivalius, L. gasseri, L. fermentum, L. reuteri, L. delbrueckii subsp. bulgaricus, L. delbrueckii subsp. delbrueckii and L. johnsonii, bacteria belonging to Petition 870250087651, dated 09 / 26 / 2025, pp. 60-91 14 / 30 Streptococcus genus such as Streptococcus thermophilus, bacteria belonging to the Lactococcus genus such as Lactococcus lactis subsp. lactis and Lactococcus lactis subsp. cremoris, bacteria belonging to the Enterococcus genus such as Enterococcus faecalis and E. faecium, bacteria belonging to the Bacillus genus such as Bacillus subtilis, and yeasts belonging to the Saccharomyces, Torulaspora, and Candida genera such as Saccharomyces cerevisiae, Torulaspora delbrueckii, and Candida kefir. The bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, is preferably used in combination with one or more members selected from the group consisting of a bacterium belonging to the genus Lactobacillus, a bacterium belonging to the genus Streptococcus, and a bacterium belonging to the genus Lactococcus to produce a fermented milk beverage or food product due to the fact that it obtains high palatability and facilitates ingestion or consumption.

[052] In the case of using the bacterium belonging to Bifidobacterium pseudocatenulatum, according to the present invention, the dose is not strictly limited and is preferably from 105 cfu to 1013 cfu, particularly preferably from 108 cfu to 1012 cfu, per day in terms of the number of viable bacteria. EXAMPLES

[053] The present invention will now be described in greater detail with reference to the Examples. However, the present invention is in no way limited to these examples.

[054] Example 1 Preparation of bacteria belonging to Bifidobacterium pseudocatenulatum that has the xylanase gene and that has excellent viability in a medium containing a milk component - 1

[055] Bifidobacterium pseudocatenulatum YIT 11057 was created as described below as a parent strain, and the number of viable bacteria (proliferative activity) and viability in a medium containing milk component were confirmed. Petition 870250087651, dated 09 / 26 / 2025, pp. 61 / 91 15 / 30 (1) Improvement

[056] 1% of a frozen bacterial fluid from YIT 11057 was inoculated into modified GAM liquid medium (mGAM) (Nissui Pharmaceutical Co., Ltd.) and cultured statically at 37 °C for 4 hours under anaerobic conditions, and the bacterial fluid was diluted 10 times with PBS. The diluted bacterial fluid was added dropwise to the center of a Petri dish and irradiated with ultraviolet light under conditions (wavelength: 254 nm, illuminance: approximately 0.2 mW / cm2, 60 s) that yielded a survival rate of approximately 1% after ultraviolet irradiation in a preliminary study.The UV-irradiated bacterial liquid was subcultured in mother medium (12% skimmed milk powder, 0.1% yeast extract, 0.03% L-cysteine ​​hydrochloride monohydrate, 0.2% calcium carbonate, sterilization conditions: 115 °C for 20 min), statically cultured at 37 °C for 24 hours, and then refrigerated at 4 °C or 10 °C for 2 weeks. This operation was repeated 18 times (36 weeks). Refrigeration was performed in the mother medium under anaerobic conditions using Anaeropack (Mitsubishi Gas Chemical Co., Inc.).

[057] The chilled bacterial liquid was spread at an appropriate concentration onto mGAM agar plates supplemented with 1% lactose, which were adjusted to pH 4.4 or 4.6 with 4 M hydrochloric acid and cultured statically at 37 °C for 14 days under anaerobic conditions. Then, a colony was collected and inoculated onto mGAM liquid medium supplemented with 1% lactose. The colony was cultured statically at 37 °C for 20 hours under anaerobic conditions, spread onto TOS propionate agar plates and cultured statically at 37 °C for approximately 48 hours under anaerobic conditions, followed by collection of the colony and inoculation onto mGAM liquid medium supplemented with 1% lactose. This operation was repeated twice to obtain Bifidobacterium pseudocatenulatum Y 51493. (2) Confirmation of the number of viable bacteria and survival rate

[058] In the feasibility study, a bacterial liquid obtained by was used Petition 870250087651, dated 09 / 26 / 2025, pp. 62-91 16 / 30 inoculation of a frozen bacterial fluid of each of the bacterial strains YIT 11057 and Y 51493 into the stock medium, performing pre-culture at 37 °C for 24 hours, then inoculating 5% of the bacterial fluid into the stock medium and performing the main culture at 37 °C for 24 hours, followed by refrigeration at 4 °C (0, 7 and 14 days). The bacterial fluid of each of YIT 11057 and Y 51493, serially diluted with saline solution, was spread on TOS propionate agar plates and cultured at 37 °C for 48 hours under anaerobic conditions, and the number of viable bacteria was measured. The survival rate was calculated from the measured number of viable bacteria. The survival rate is indicated as a percentage of the measured number of viable bacteria divided by the number of viable bacteria at day 0 preservation. The results are shown in Figures 1 and 2.As a result, it was possible to confirm that Y 51493 obtained by reproduction was excellent both in the number of viable bacteria (proliferative activity) and in viability in a medium containing a milk component, compared to YIT 11057.

[059] Reference example 1 - Verification of genomic mosaicism in bacteria belonging to the genus Bifidobacterium

[060] Analysis of the utilization capacity of indigestible polysaccharides and genomic analysis using bacterial strains belonging to Bifidobacterium pseudocatenulatum revealed that some bacterial strains exhibit the ability to utilize long-chain xylans, which is defined by the xylanase gene (BpXyn10A) resident on the chromosome; and strains that have the xylanase gene, when plotted on a phylogenetic tree prepared based on genomic information from bacterial strains belonging to Bifidobacterium pseudocatenulatum, are dispersed throughout the phylogenetic tree, rather than concentrated in a specific cluster (Non-Patent Literature 1). This suggests that the xylanase gene is horizontally transferred between bacterial strains. Thus, the xylanase gene was tested for its horizontal transfer in vitro.

[061] In general, horizontal gene transfer in bacteria is known to occur. Petition 870250087651, dated 09 / 26 / 2025, pp. 63 / 91 17 / 30 has three patterns: natural transformation by absorption of extracellular DNA, transduction by phage infection, and conjugation mediated by the transmission of plasmids or similar molecules. Thus, to allow the detection of all events, two phenotype-different strains of Bifidobacterium pseudocatenulatum were cultured individually and then co-cultured for a specific time in agar medium to test horizontal gene transfer. (1) Bacterial strain used

[062] Tetracycline (Tc) sensitive Bifidobacterium pseudocatenulatum strains with the xylanase gene (YIT 11025, YIT 11027, YIT 12242, YIT 12820, YIT 12824 and YIT 12986) were used as donor, and Tc-resistant Bifidobacterium pseudocatenulatum strains without the xylanase gene (YIT 4072T, YIT 11955, YIT 11956, YIT 12228, YIT 12818, YIT 12822 and YIT 12987) were used as recipient. (2) Methods for testing horizontal xylanase gene transfer

[063] Each of the donor and recipient bacterial strains was inoculated into modified GAM liquid medium (mGAM) (Nissui Pharmaceutical Co., Ltd.) supplemented with 0.5% by mass of glucose / lactose and cultured to the logarithmic growth phase. 200 μl of each of the donor and recipient bacterial liquids were mixed (number of bacteria: approximately 108-9 organisms) and centrifuged, followed by removal of a supernatant using a 200 μl pipette. The pellets were suspended using a very small amount of the remaining medium in a tube, and the entire amount of the suspension was then left to stand on mGAM agar medium (Nissui Pharmaceutical Co., Ltd.).After being cultured anaerobically at 37 °C for 16 to 24 hours, the bacterial cells were scraped using a calibrated 1 μl loop and inoculated into mPY-AXTc liquid medium (mPY medium; see Non-Patent Literature 1, arabinoxylan (AX): final concentration: 0.5% by mass, Tc: final concentration: 10 μg / ml) in which the donor alone or the recipient alone were unable to proliferate. The turbidity was... Petition 870250087651, dated 09 / 26 / 2025, pp. 64 / 91 18 / 30 turbidity was monitored using Eon microplate spectrophotometers (BIOTEC Co., Ltd.). Some combinations that increased turbidity in the selective medium were subcultured in a fresh medium with the same composition as above to confirm the reproducibility of the turbidity increase. This bacterial liquid was spread on mGAM agar medium containing Tc (final concentration: 10 μg / ml) and then cultured anaerobically overnight at 37 °C, and the resulting single colony was subcultured in the same agar medium as above. The following day, some bacterial cells were inoculated into mPY-AX-Tc liquid medium, while some bacterial cells were suspended in TE buffer, heated to 95 °C for 5 minutes and used as a simple model for PCR.The presence or absence of proliferation in mPY-AX-Tc medium was confirmed and, when the receptor was YIT 11956, the identification of the bacterial strain and confirmation of the presence or absence of the xylanase gene were performed by PCR using receptor-specific primers (YIT 11956) (BP28-f: GGGCAAGATCGGCATCATCTA (SEQ ID NO: 10), BP28-r:. CACATTGGTGGTGTTCACGTC (SEQ ID NO: 11)) and specific primers for the xylanase gene (pBpXyn10A-F: CGAGAATGCGAACACGTACTTC (SEQ ID NO: 12), pBpXyn10A-R: CTGCTCGGTGTTGTAATCGTTG (SEQ ID NO: 13)). A colony containing the xylanase gene was cryopreserved. (3) Genomic analysis method

[064] DNA was extracted from the bacterial cells obtained in (2), and a short reading frame and a long reading frame were obtained using a second-generation Miseq sequencer (Illumina, Inc.) and a third-generation MinION sequencer (Oxford Nanopore Technologies plc.). A complete genomic sequence was obtained by hybrid assembly. The genomic sequences of the donor strain, the recipient strain, and the gene-acquired strain were aligned using snippy (https: / / github.com / tseemann / snippy), and the alignment results were entered into fastGEAR (Mostowy et al., Molecular Biology and Evolution 34 (5), 11671182) to identify a homologous recombination region. Information about Petition 870250087651, dated 09 / 26 / 2025, pp. 65 / 91 19 / 30 single nucleotide polymorphisms (SNPs) were extracted from the genomic sequences using nucmer, delta-filter, and show-snps from the MUMMER package (Kurtz et al., Genome Biology 5, R12, 2004). The output file format was adjusted by a custom script, and the homologous recombination region was then visualized using Artemis ACT (Sanger Institute). (4) Results of tests on horizontal gene transfer of xylanase

[065] A donor and a recipient were mixed, then cultured anaerobically overnight on mGAM agar medium and inoculated into mPY-AX-Tc selective liquid medium, and proliferative activity was monitored. As a result, it was found that a plurality of donor-recipient combinations increased turbidity. As a result of genomic analysis in 13 strains that acquired the gene and were obtained with YIT 11956 or YIT 4072T as the recipient and YIT 11025, YIT 11027, YIT 12820 or YIT 12824 as the donor among the combinations, all strains that acquired the gene were confirmed as having the xylanase gene and being very closely related to the recipient, not the donor. It was found that the xylanase gene on the chromosome was transmitted from the donor, which was a strain carrying the xylanase gene, to the recipient, which was a strain without the xylanase gene (Figure 3 and Table 1).It was confirmed that the strain with the transmitted xylanase gene is able to proliferate in mPY-AX medium (Figure 4).

[066] As a result of detailed comparison of genomic sequences at the SNP level, the SNPs in regions from 16.5 to 247 kb, including the newly acquired xylanase gene, as well as its upstream and downstream sites in the gene-acquired strain, were consistent with the donor. Specifically, it was found that homologous double-crossing recombination occurs extensively in the gene-acquired strain, thus causing substitution by donor-derived genomic regions, including the xylanase gene and its upstream and downstream sites, and horizontal transfer of the xylanase gene. The substitution of genomic regions Petition 870250087651, dated 09 / 26 / 2025, pp. 66 / 91 20 / 30 occurred in a mosaic pattern across the genome, and the replacement regions also differed between bacterial strains. Specifically, donor-derived genomic regions were integrated into a maximum of seven sites per strain and in regions ranging from 0.5 to 247 kb (Figure 3). On the other hand, no trace of phages or plasmids was observed in the replacement regions.

[067] To test the generality of this phenomenon, horizontal transfer tests of other genes possessed by Bifidobacterium pseudocatenulatum were also attempted. First, attention was given to the amylase gene, which defines the ability to utilize starch. A Tc-sensitive Bifidobacterium pseudocatenulatum strain with the amylase gene (YIT 11027) was used as a donor, and a Tc-resistant Bifidobacterium pseudocatenulatum strain without the amylase gene (YIT 11956) was used as a recipient. When the bacterial cells after mixing the strains were inoculated in mPY-St-Tc liquid medium (starch (St): final concentration: 0.5% by mass, Tc: final concentration: 10 μg / ml) by the same approach as in (2), a strain with the horizontally transferred amylase gene was confirmed as appearing by genomic mosaicism (Table 1). It was confirmed that the strain with the transmitted amylase gene is able to proliferate in mPY-Starch medium (Figure 5).More attention was given to the Tc resistance gene. Erythromycin-sensitive Bifidobacterium pseudocatenulatum strains (Em) that have the Tc resistance gene (YIT 4072T, YIT 11955, and YIT 12987) were used as donors, and an Em-resistant Bifidobacterium pseudocatenulatum strain without the Tc resistance gene (YIT 12824) was used as a recipient. When the bacterial cells after mixing the strains were spread on modified GAM agar medium supplemented with 0.5 wt% lactose (mGAML) and supplemented with Em (final concentration: 1 μg / ml)-Tc (final concentration: 10 μg / ml) (EmTc-mGAML) by the same approach as (2), a strain with the horizontally transferred Tc resistance gene was confirmed as appearing by genomic mosaicism (Table 1). It has been confirmed that the strain with the transmitted Tc resistance gene is capable of proliferating in Tc-mGAML medium. Petition 870250087651, dated 09 / 26 / 2025, pp. 67 / 91 21 / 30 (Figure 6). [Table 1] Donor strain Recipient strain Acquired phenotype LCX+ TcS LCX- Tcr YIT 11025 YIT 11956 LCX+ Tcr YIT 11027 YIT 11956 LCX+ Tcr YIT 12820 YIT 11956 LCX+ Tcr YIT 12824 YIT 11956 LCX+ Tcr YIT 12824 YIT 4072T LCX+ Tcr ST+ TcS ST- TCR YIT 11027 YIT 11956 ST+ TcR EmS Tcr EmR TcS YIT 11955 YIT 12824 EmR Tcr YIT 12987 YIT 12824 EmR Tcr YIT 4072T YIT12824 EmR Tcr * LCX+ / -: Possessing the BpXyn10A gene, presence / absence of the ability to utilize long-chain xylans (LCX) * TcS / R: Tetracycline sensitivity / resistance * ST+ / -: Presence / absence of the ability to utilize starch * EmS / R: Erythromycin sensitivity / resistance [ 068] Reference example 2 - Natural transformation test in bacteria belonging to the genus Bifidobacterium [ 069] The genomic mosaicism of the bacterium belonging to the genus Bifidobacterium was tested to verify whether it is attributable to natural transformation, as no trace of horizontal transfer of phages or plasmids was observed. (1) Bacterial strain used

[070] A Tc-resistant and Em-sensitive Bifidobacterium pseudocatenulatum strain YIT 4072T was used as the donor, and Tc-sensitive and Em-resistant Bifidobacterium pseudocatenulatum YIT 12824 was used as the recipient. (2) Method for extracting genomic DNA for use as a donor and preparing a PCR product

[071] YIT 4072T was grown overnight in mGAML liquid medium, Petition 870250087651, dated 09 / 26 / 2025, pp. 68 / 91 22 / 30 and high molecular weight genomic DNA was purified using NucleoBond Buffer Set III and a NucleoBond AXG20 column (Takara Bio Inc.). Double-stranded DNA was quantified using the Picogreen kit and diluted to 30 ng / L with TE buffer. Using this genomic DNA as a template, a region of approximately 20 kb containing the Tc resistance gene (tetW) was amplified by PCR. A high-fidelity enzyme, PrimeSTAR GXL DNA polymerase (Takara Bio Inc.), was used as the PCR enzyme. 0.2 μl of enzyme, 0.04 μl of each of the 50 μM primers (SEQ ID NO: 14 and 15), 1 μl of template DNA (0.02 ng / µl), 1.6 μl of a dNTP solution, and 4 μl of 5x buffer were mixed, and the amount of reaction solution per PCR tube was adjusted to 20 µl. The PCR products obtained were precipitated in ethanol and then dissolved in TE buffer. Double-stranded DNA was quantified using Picogreen and then diluted to 1 ng / µl with TE buffer, and the dilution was divided into small portions and cryopreserved.

[072] Table 2 shows the primers and PCR conditions used in this Example. [Table 2] Primer Name SEQ ID to PCR Sequence (5'-3') NO amplified product (bp) BpTy20k-F TCCTGTGGA1 1 1CGACGGTGACGAGC AG 14 BpTy20k-R 19645 1 GAGTGCGGTT 19645 1 GATGGTGCATACGGCAAG 15 PCR conditions 1.98 °C 20 s, (98 °C 10 s, 68 °C 10 min)x30, 4°C~ (3) Method for preparing dead bacterial cells

[073] YIT 4072T was cultured in 2 ml of mGAML liquid medium until the late logarithmic growth phase and washed with mPY liquid medium, and the pellets were then Petition 870250087651, dated 09 / 26 / 2025, pp. 69 / 91 23 / 30 suspended in 180 μL of the same medium as above. A 20 μL aliquot of the suspension was collected in a 1.5 mL screw-capped tube and heated to 80 °C for 10 minutes using a heating pad to prepare dead bacterial cells. It was separately confirmed that this treatment completely kills the bacterial cells. (4) Horizontal gene transfer test for antibiotic resistance with viable bacterial cell, heat-killed bacterial cell and purified DNA as donors

[074] Frozen bacterial cells of each of the bacterial strains YIT 4072Te and YIT 12824 were inoculated onto mGAML agar medium and cultured anaerobically at 37 °C, and the resulting bacterial cells were then subcultured in 400 μl of the same liquid medium described above. After culturing for 3 to 4 hours, 1600 μl of the same liquid medium described above were added, and the bacterial cells were cultured for 4 to 5 hours until the culture transitioned from the late logarithmic growth phase to the stationary phase. Each bacterial liquid was collected, washed with mPY liquid medium, collected again, and suspended in 180 μl of the same medium described above. 5 μl of recipient bacterial fluid (YIT 12824) and 5 μl of viable donor bacterial fluid (YIT 4072T), the dead bacterial fluid prepared in (3), or the purified DNA prepared in (2) were mixed (number of bacteria: approximately 107-8 organisms each), and the entire amount of the mixture was left to stand on mGAM agar medium.After being cultured anaerobically at 37 °C for 16 to 24 hours, the entire quantity of bacterial cells was scraped using a calibrated 1 μl loop, suspended in 60 μl of mPY liquid medium, serially diluted, spread on EmTc-mGAML agar medium and cultured anaerobically at 37 °C for 2 to 3 days, followed by counting the number of colonies. Some colonies were subjected to genomic analysis in the same way as in Example 1(3) to confirm that homologous recombination had occurred. (5) Test of the influence of adding DNA-degrading enzyme (DNase I) Petition 870250087651, dated 09 / 26 / 2025, pp. 70 / 91 24 / 30

[075] Viable bacterial fluids washed from YIT 4072Te and YIT 12824 were prepared in the same manner as in (4). 20 μl aliquots of the respective bacterial fluids washed from the strains were collected in a 1.5 ml tube, mixed and centrifuged, and the pellets were then suspended in 40 μl of 1x DNase I buffer (Takara Bio Inc.). 8 μl of undiluted liquid (5 U / μO) recombinant DNase I (Takara Bio Inc.) or a 1 / 10 dilution (0.5 U / μO) or a 3 / 10 dilution (1.5 U / μO) with 1 DNase I buffer was added to the suspension. 12 μl of each of the three samples per mixture condition were left to stand on mGAM agar medium. The agar medium on which the bacterial cells were left to stand was cultured anaerobically at 37 °C for 16 hours. Then, the entire quantity of bacterial cells was scraped using a calibrated 1 μl loop, suspended in 60 μl of mPY liquid medium, and then appropriately diluted using the same medium as above.To measure the number of bacteria possessing the horizontally transferred Tc resistance gene, bacterial fluid was spread on EmTc-mGAML agar medium. To detect the total number of viable bacteria of the Em-resistant strain, bacterial fluid was also spread on Em-mGAML agar medium. Each agar medium was cultured anaerobically at 37 °C for 2 to 3 days. The ratio between the number of mosaic bacteria and the total number of viable bacteria of the Em-resistant strain was considered the mosaic frequency. (6) Results

[076] Viable bacterial cells of donor YIT 4072T (Tc-resistant strain) and recipient YIT 12824 (Em-resistant strain) were mixed, cultured anaerobically overnight on mGAM agar medium, and studied to verify if a strain resistant to both antibiotics appeared in the selective medium where the donor alone or the recipient alone was unable to proliferate. As a result, colonies exhibiting resistance to both antibiotics emerged. As a result of genomic analysis in six strains thus obtained, it was confirmed that homologous recombination occurs in a mosaic pattern in a plurality of Petition 870250087651, dated 09 / 26 / 2025, pp. 71 / 91 25 / 30 regions, including the Tc resistance gene and its neighboring regions. The number of recombination regions ranged from 1 to 4, and the maximum recombination region length was 22 to 112 kb.

[077] In the case of using killed bacterial cells as a donor, horizontal transfer of the Tc resistance gene was confirmed, although the frequency decreased compared to the case of using viable bacterial cells as a donor (Figure 7A). Similarly, horizontal transfer occurred even if the donor was replaced by genomic DNA or PCR products (Figure 7B). In the case of using killed bacterial cells as a donor, the number of recombination regions was 1 to 2, and the maximum length of the recombination region was 16 to 45 kb, in two cell lines submitted to genomic analysis. In the case of using genomic DNA as a donor, the number of recombination regions was 1, and the maximum length of the recombination region was 12 to 16 kb, in two cell lines submitted to genomic analysis.In the case of using PCR products prepared with YIT 4072T genomic DNA as a template donor, the number of recombination regions was 1, and the maximum length of the recombination region was 12 kb in a strain submitted to genomic analysis. As a result of adding a DNA-degrading enzyme to the test system using viable bacterial cells as a donor, horizontal gene transfer was inhibited (Figure 7C). This revealed that the genomic mosaicism pathway involving horizontal gene transfer in the bacterium belonging to the genus Bifidobacterium was natural transformation by uptake of extracellular DNA and homologous recombination. Thus, the frequency of mosaicism described above signifies a frequency of transformation.

[078] As a result of the confirmation of the universality of natural transformation in Bifidobacterium pseudocatenulatum, horizontal transfer of the Tc resistance gene was recently confirmed in 11 strains using, as a donor, PCR products prepared with YIT 4072T genomic DNA as a template (Table 3). Petition 870250087651, dated 09 / 26 / 2025, pp. 72 / 91 26 / 30 [Table 3] Donor strain Recipient strain Acquired phenotype Tcr TcS YIT 4072T (PCR product) YIT 12989 Tcr YIT 4072T (PCR product) YIT 11952 Tcr YIT 4072T (PCR product) YIT 11953 Tcr YIT 4072T (PCR product) YIT 12145 Tcr YIT 4072T (PCR product) YIT 12203 Tcr YIT 4072T (PCR product) YIT 12232 Tcr YIT 4072T (PCR product) YIT 12817 Tcr YIT 4072T (PCR product) YIT 12819 Tcr YIT 4072T (PCR product) YIT 12820 Tcr YIT 4072T (PCR product) YIT 12821 Tcr YIT 4072T (PCR product) YIT 12985 Tcr * Tcs / r: Tetracycline sensitivity / resistance

[079] Example 2 Preparation of bacteria belonging to Bifidobacterium pseudocatenulatum that has the xylanase gene and that has excellent viability in a medium containing a milk component - 2

[080] Y 51493 obtained in Example 1 lost the ability to utilize glucose during the course of reproduction (see Table 4 below). As a result of genomic analysis, Y 51493 suffered a single nucleotide deletion of a C base at position 369 of a gene (SEQ ID NO: 9) encoding a glucose transporter (EIICBA component of the PTS beta-glycoside system). Therefore, the frameshift was considered to have significantly altered the amino acid sequence and consequently caused glucose to no longer be transported into cells. Maintaining the ability to utilize glucose from the point of view of carbohydrate metabolism in the intestines is desirable. On the other hand, restoring the base deletion by conventional UV irradiation or long-term subculture is not realistic.Thus, to restore the single nucleotide deletion of the glucose transporter gene, Y 51493 as a parental strain, i.e., a recipient, and the genomic DNA of YIT 11057 as donor DNA were subjected to the transformation method of Reference Example 2. Petition 870250087651, dated 09 / 26 / 2025, pp. 73 / 91 27 / 30 (1) Bacterial strain used

[081] Y 51493 prepared in Example 1 was used as the receiver. (2) Donor DNA

[082] YIT 11057 was cultured overnight in mGAML liquid medium, and genomic DNA was extracted from 1 ml of the resulting bacterial liquid using the phenol bead method and used. (3) Transformation and selection of bacterial cells with restored ability to use glucose

[083] All operations were performed in an anaerobic glove box. Frozen bacterial cells of Y 51493 were inoculated onto mGAML agar medium and cultured anaerobically overnight. The following morning, a plurality of colonies were scraped off simultaneously and subcultured in 400 μl of the same liquid medium described above. After culturing for 3–4 hours, 1600 μl of the same liquid medium described above were added, and the bacterial cells were cultured for 4–5 hours. After centrifugation, the bacterial cell pellets were washed once with 500 μl of mPY liquid medium, and the pellets were resuspended in 180 μl of the same liquid medium described above.Bacterial fluid and a DNA solution (genomic DNA from YIT 11057 precipitated in ethanol and then dissolved in TE buffer) were mixed in equal volumes, and 10 μl of the mixed solution were placed on mGAM agar medium supplemented with 50 mM magnesium chloride and left to stand for several minutes until the fluid dried, followed by anaerobic culture at 37 °C. The agar medium used was sterilized in an autoclave on the day of use. 16 hours later, the entire quantity of bacterial cell pellets was scraped using a calibrated 1 μl loop and suspended in 500 μl of mPY liquid medium. A 50 μl aliquot of this suspension was collected and suspended in 640 μl of mPY liquid medium supplemented with 0.5% glucose. A 200 μl aliquot of this suspension was collected from each well of a 96-well plate, 50 μl of mineral oil was placed over it, and then a proliferation curve was obtained using a... Petition 870250087651, dated 09 / 26 / 2025, pp. 74 / 91 28 / 30 PowerWave 340 microplate reader (BIOTEC Co., Ltd.). The remaining bacterial fluid was cultured anaerobically at 37 °C in a 1.5 ml tube. When turbidity elevation was confirmed on a PC screen, 10 μl of the bacterial fluid in the 1.5 ml tube were subcultured in 500 μl of fresh liquid medium with the same composition as above and split into a 96-well plate and a 1.5 ml tube, and proliferation was monitored again. When proliferation was confirmed, the bacterial fluid in the 1.5 ml tube was then streaked onto mGAML agar medium. A single colony was isolated, then suspended in glycerol and preserved at -80 °C. Bacterial cells from the isolated strain were suspended in mPY liquid medium supplemented with 0.5% glucose to confirm proliferative activity. The complete genome of the isolated strain was determined by the procedures described in Reference Example 1(3). (4) Carbohydrate utilization capacity test

[084] Frozen bacterial cells of the isolated strain obtained in (3), Y 51493 and YIT 11057 were inoculated onto modified GAM agar medium supplemented with 1% lactose and then cultured for 2 to 3 days in an anaerobic glove box. A plurality of colonies obtained were scraped and subcultured in the same liquid medium as above. After culturing overnight at 37 °C, 5% of the culture was subcultured onto fresh medium with the same composition as above and cultured for 6 to 9 hours until reaching the mid-to-late logarithmic growth phase. 2 μl of the culture supplemented with PIPES-ILS medium to achieve ODgqq = 0.2 was added to 198 μl of PIPES-ILS medium supplemented with 0.5% of each carbohydrate dispensed to each well of a 96-well plate, and 50 μl of mineral oil were then layered, followed by culture at 37 °C under anaerobic conditions.When the increase in ODgqq was 0.1 or more 72 hours later, it was determined that there was the ability to utilize the carbohydrate. (5) Confirmation of the number of viable bacteria and viability

[085] The number of viable bacteria and the survival rate were calculated Petition 870250087651, dated 09 / 26 / 2025, pp. 75 / 91 29 / 30 for the isolated strain obtained in (3) and Y 51493 by the same method as Example 1(2), except that refrigeration was carried out for 0, 14, 21 and 28 days. (6) Analysis at the mutation site

[086] A mutation that occurred in the bacterial strain obtained in (3) was investigated using the complete genome of YIT 11057 as a reference. First, single nucleotide substitutions (SNPs) were identified using the snippy. Large-scale genomic changes and SNPs that were not detected by the snippy were visually confirmed using malva (Darling et al., Genome Research 14, 13941403). (7) Results

[087] As a result of performing the transformation using DNA extracted from YIT 11057 as the donor and viable bacterial cells from Y 51493 as the recipient, a transformant Bifidobacterium pseudocatenulatum YIT 13179 was obtained, which proliferated in liquid medium with glucose as the sole carbohydrate source. As a result of confirming the ability of YIT 13179 to utilize glucose, it was confirmed that this strain utilizes glucose (Table 4). Both YIT 13179 and Y 51493 had a survival rate of 40% or more when preserved for 2 weeks, and it was confirmed that YIT 13179 had an improved survival rate compared to Y 51493 (Figure 8).

[088] The complete genome of YIT 13179 was determined, and the nucleotide sequence of the glucose transporter gene was confirmed. As a result, the single nucleotide deletion that occurred in Y 51493 was restored in YIT 13179, which had the complete gene sequence identical to that of YIT 11057. [Table 4] Day 3 (72h) Soluble starch Wheat arabinoxylan Lactose Glucose YIT 11057 0.78 0.38 0.93 1.04 B. pseudocatenulatum Y 51493 0.71 0.37 0.88 0.01 YIT 13179 0.86 0.58 1.05 0.92 Petition 870250087651, dated 09 / 26 / 2025, pp. 76 / 91 30 / 30

[089] Y 51493, YIT 11057 and YIT 13179 had nearly equivalent capacity to use arabinoxylan, starch and lactose (Table 4).

[090] Mutations were introduced at 15 sites in the genome during the course of reproduction from YIT 11057 to Y 51493. Therefore, it is presumed that these mutations contribute to the enhancement of viability in dairy media. In YIT 13179, only one of these sites was restored to the YIT 11057 sequence. The restored mutation was the deletion of the glucose transporter gene.

[091] Four mutations, which were absent in Y 51493 compared to YIT 11057, have recently occurred in YIT 13179, but did not include any genes presumably related to safety. Although a harmful gene was searched for in more detail using MiFuP Safety, no genes that raise safety concerns were detected in YIT 13179. Petition 870250087651, dated 09 / 26 / 2025, pp. 77 / 91

Claims

1 / 1 CLAIMS 1. Bacteria CHARACTERIZED by the fact that it belongs to Bifidobacterium pseudocatenulatum, the bacterium having the xylanase gene in one genome and having greater viability in a medium containing milk component than Bifidobacterium pseudocatenulatum YIT 11057 (NITE BP-02930).

2. Bacteria, according to claim 1, CHARACTERIZED in that the xylanase gene is a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 1 or a polynucleotide that has 70% or more identity to the nucleotide sequence and that encodes a protein that has xylanase activity.

3. Bacteria, according to claim 1, CHARACTERIZED in that the survival rate is 20% or more when the bacteria is cultured in a medium containing a milk component for 24 hours and then preserved at low temperature for 2 weeks.

4. Bacteria CHARACTERIZED by the fact that it is Bifidobacterium pseudocatenulatum Y 51493 (NITE BP-03852), Bifidobacterium pseudocatenulatum YIT 13179 (NITE BP-03853), or a bacterial strain closely related thereto.

5. Beverage or food product CHARACTERIZED in that it comprises the bacteria, as defined in any one of claims 1 to 4.

6. Beverage or food product, according to claim 5, CHARACTERIZED in that it is a fermented milk beverage or food product. Petition 870250087651, dated 09 / 26 / 2025, pp. 78 / 91

Images