Modified Propan-2-ol-producing Clostridium bacteria, their preparation and uses.

BR112025020927A2Pending Publication Date: 2026-08-25
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
BR112025020927
Authority / Receiving Office
BR · BR
Patent Type
Applications
Publication Date
2026-08-25

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

1 / 43 Modified Propan-2-ol-producing Clostridium bacteria, their preparation and uses.

[0001] The present invention relates to the genetic modification of bacteria of the genus Clostridium, typically solutogenic bacteria of the genus Clostridium. In particular, the inventors disclose methods, tools and kits for removing or modifying sequence(s) that encode or control the transcription of sequence(s) that encode(s) an enzyme with 3-hydroxybutyryl-CoA dehydrogenase (Hbd) activity, an NADPH-dependent alcohol dehydrogenase (BdhB) and / or a pyruvate NADP ferredoxin oxidoreductase, or for adding a sequence that encodes a secondary alcohol dehydrogenase (Adh). The genetically modified bacteria thus obtained are also disclosed, as well as uses thereof, in particular for the production of propan-2-ol or a mixture comprising propan-2-ol and ethanol. Technological background

[0002] Bacteria belonging to the genus Clostridium are strictly anaerobic Gram-positive bacilli, capable of forming endospores and belonging to the phylum Firmicutes. This genus contains many species studied for their pathogenic character or for their industrial and medical interest.

[0003] Non-pathogenic Clostridium species of industrial interest are capable of producing compounds of interest, such as acids and solvents, from a wide variety of sugars and substrates, ranging from glucose to cellulose. The growth of solvent-producing Clostridium bacteria (solventogenic or acidogenic) is called biphasic. Acids are produced during the acidogenesis phase, which corresponds to the exponential growth phase. When cell growth stops and the bacteria enter the stationary phase, they enter the solvogenesis phase, reassimilate the acids produced, and convert them into solvents. Petition 870250088213, dated 09 / 29 / 2025, p. 14 / 77 2 / 43

[0004] Clostridium acetobutylicum is naturally capable of producing a mixture of ethanol, acetone, and n-butanol during a fermentation known as ABE (Figure 1). Certain strains of Clostridium beijerinckii are also capable of reducing all or part of the acetone to propan-2-ol. This is the case of the DSM 6423 strain, which has in its genome a gene (adh) (Ismail AA et al., 1993) that encodes a secondary alcohol dehydrogenase that catalyzes the reduction of acetone to propan-2-ol.

[0005] C. acetobutylicum is considered a model organism for the study of solvetogenic microorganisms, due to the relatively high titers obtained during fermentations. Many genetic tools have been developed specifically to perform metabolic engineering, allowing the reorientation of its metabolic pathways. In 2011, Lehmann and Lütke-Eversloh described the generation of a Δhbd mutant that no longer produced butyrate or butanol as fermentation end products due to the absence of an enzyme with 3-hydroxybutyryl-CoA dehydrogenase activity in this mutant. The resulting mutant mainly produces ethanol and also a small amount of acetone. At the same time, Collas et al., Dusseaux et al., and Lee et al. They described the heterologous expression of the adh gene from C. beijerinckii DSM 6423 in C. acetobutylicum with the aim of obtaining a microorganism that produces a mixture of ethanol, propan-2-ol and n-butanol (Collas F. et al., 2012; Dusséaux S. et al., 2013; Lee J. et al., 2012).

[0006] In the context of the present invention, the inventors disclose the combination of genetic modifications that allow the creation of a strain producing a mixture of ethanol and propan-2-ol, and also genetic modifications and tools that surprisingly allow advantageously improving the (acetone + propan-2-ol) / ethanol ratios (C3 / C2 ratio) compared to a simple Δhbd mutant expressing the adh gene. Petition 870250088213, dated 09 / 29 / 2025, page 15 / 77 3 / 43 Summary of the invention

[0007] The inventors disclose, in the context of the present invention, bacteria of the genus Clostridium, typically solventogenic bacteria, in particular mutants of C. acetobutylicum that no longer produce butanol or butyrate and that produce propan-2-ol or a mixture comprising propan-2-ol and ethanol with a significantly improved C3 / C2 ratio compared to the Δhbd mutant described in the literature.

[0008] The inventors, in particular, disclose a genetically modified bacterium belonging to the genus Clostridium, in particular a solvenogenic bacterium, whose hbd and bdhB genes have been inactivated. This genetically modified bacterium is a bacterium that does not express the products of the hbd and bdhB genes, in particular the products of the genes with sequences SEQ ID NO: 39 and SEQ ID NO: 36, or expresses non-functional versions of said products. These bacterial mutants are identified respectively in this text as mutant Δhbd and mutant ΔbdhB.

[0009] A specific bacterium disclosed by the inventors in this text either does not express the CA_C0764 gene with sequence SEQ ID NO: 37 or expresses a non-functional version thereof.

[0010] Bacteria that do not express the products of the hbd and bdhB genes, or express non-functional versions of said products, can be advantageously used to obtain a bacterium that also does not express the CA_C0764 gene with sequence SEQ ID NO: 37 or expresses a non-functional version thereof.

[0011] The genetically modified bacteria that are particularly preferred according to the invention correspond to the strain identified in this descriptive report as IFP 971 and registered on February 17, 2023 under deposit number LMG P-32995 with collection BCCM-LMG (also identified in this text as Δhbd ΔbdhB::adh ΔΟΆ_Ο0764) Petition 870250088213, dated 09 / 29 / 2025, p. 16 / 77 4 / 43 and to the strain identified in this descriptive report as IFP 970, as registered on February 17, 2023 under deposit number LMG P-32994 with the BCCM-LMG collection (also identified in this text as Δhbd ΔbdhB::adh), which can be used to prepare a strain equivalent to the IFP 971 strain. The invention also relates to any derived bacteria, clone, mutant or genetically modified version thereof.

[0012] Another preferred genetically modified bacterium disclosed by the inventors is the strain identified in this description as IFP 969 registered on February 17, 2023 under deposit number LMG P-32993 with the BCCM-LMG collection (also identified in this text as Δhbd), which can be used to prepare strains equivalent to strains IFP 970 and IFP 971. This descriptive report also refers to any derived bacterium, clone, mutant or genetically modified version thereof.

[0013] The inventors also disclose processes for producing a recombinant bacterium as disclosed in this text, in particular processes comprising deletion or inactivation of the hbd and bdhB genes, and optionally also the CA_C0764 gene, in order to prevent or reduce the expression of corresponding functional proteins, preferably a process involving CRISPR-Cas technology, and also the genetically modified bacteria obtained by this process, of which the bacteria IFP 969, IFP 970 and IFP 971 are examples.

[0014] They also disclose the use of a genetically modified bacterium belonging to the genus Clostridium, characterized by not expressing the products of the hbd and / or bdhB genes, and optionally, also the CA_C0764 gene, or expressing a non-functional version of the products of the hbd and bdhB genes, and optionally, also the CA_C0764 gene, such as the IFP 971 strain, to prepare a genetically modified bacterium according to Petition 870250088213, dated 09 / 29 / 2025, p. 17 / 77 5 / 43 with the invention that does not express the products of the hbd, bdhB and CA_C0764 genes, or expresses non-functional versions thereof.

[0015] The inventors also disclose the pGRNA-Δhbd plasmids with sequence SEQ ID NO: 31, pGRNA-ΔbdhB::adh with sequence SEQ ID NO: 33 and pGRNA^CA_C07 64 with sequence SEQ ID NO: 35, and the use of one, multiple or all of them to transform, and preferably genetically modify, a bacterium of the genus Clostridium in order to improve its ability to produce propan-2-ol or a mixture of propan-2-ol and ethanol.

[0016] Also disclosed are a process for transforming and preferably genetically modifying a bacterium of the genus Clostridium, as well as the genetically modified bacterium of the genus Clostridium obtained by the method. This process comprises a step of transforming the bacterium by introducing into said bacterium a plasmid selected from the pGRNA-Δhbd plasmid with sequence SEQ ID NO: 31, the pGRNA-ΔbdhB::adh plasmid with sequence SEQ ID NO: 33 and the pGRNA^CA_C07 64 plasmid with sequence SEQ ID NO: 35.

[0017] The inventors also disclose the use of a bacterium according to the invention to produce a bio-based molecule, for example, a solvent, a biofuel or any (bio)chemical intermediate, in particular propan-2-ol or a mixture of propan-2-ol and ethanol.

[0018] These bacteria can be advantageously used to produce a solvent or a mixture of solvents, particularly on an industrial scale.

[0019] The invention also relates to a fermentation process involving the use of a genetically modified bacterium, as disclosed in this text.

[0020] Finally, the inventors disclose kits, in particular a kit for transforming and preferably genetically modifying a bacterium belonging to the genus Clostridium and a kit for producing a bio-based molecule, for example, Petition 870250088213, dated 09 / 29 / 2025, page 18 / 77 6 / 43 a solvent, a biofuel or any intermediate (bio)chemical product, using a bacterium belonging to the genus Clostridium, in particular propan-2-ol, or a mixture of propan-2-ol and ethanol, said kit comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the invention and ii) a preservation medium or a culture medium for said bacterium, in particular a suitable culture medium containing a sugar or a mixture of sugars, preferably a hexose and / or a pentose, more preferably glucose and / or arabinose and / or xylose. Detailed description of the invention

[0021] Although they have been used in industry for over a century, knowledge about bacteria belonging to the genus Clostridium, particularly solutogenic bacteria, remains very limited.

[0022] The bacterium Clostridium acetobutylicum is currently considered a representative model of Clostridium solvetogens. Despite the difficulties, well known to those skilled in the art, encountered in the genetic modification of bacteria belonging to the genus Clostridium, the inventors have succeeded, for the first time in the context of the present invention, in obtaining C. acetobutylicum bacteria capable of producing propan-2-ol (also identified herein as isopropanol) or a mixture of propan-2-ol and ethanol with significantly improved C3 / C2 ratios compared to the ratio that can be obtained using the Δ hbd mutant known to those skilled in the art (described in 2011 by Lehmann and Lütke-Eversloh). In a preferred embodiment, these mutants no longer produce butanol or butyrate.

[0023] The inventors discovered and thus show for the first time that the joint inactivation of the hbd genes encoding an enzyme with 3-hydroxybutyryl-CoA dehydrogenase activity and bdhB genes encoding an alcohol dehydrogenase Petition 870250088213, dated 09 / 29 / 2025, page 19 / 77 The NADPH-dependent 7 / 43 mutation, combined with heterologous expression of the adh gene product of C. beijerinckii DSM 6423 in C. acetobutylicum, makes it possible to obtain a strain capable not only of producing propan-2-ol, but of producing it in a substantially greater quantity than is possible with a mutant expressing the adh gene product of C. beijerinckii DSM 6423 in which only the hbd gene is inactivated, or in other words, in which the bdhB gene product is still functionally expressed. In fact, the experimental part of this description shows that the amount of propan-2-ol produced by the Δhbd mutant containing the pFC002 plasmid (containing the adh gene of C. beijerinckii DSM 6423) is half the amount of acetone produced by the same mutant containing the empty pEC500E plasmid. This indicates that the combination of hbd gene deletion and adh gene expression in C. beijerinckii DSM 6423 in C.acetobutylicum DSM 792 does not make it possible to obtain a high-performance producer of propan-2-ol.

[0024] An object disclosed by the inventors is therefore directed to a genetically modified bacterium belonging to the genus Clostridium, in particular, a Clostridium species of industrial interest, in particular, C. acetobutylicum, characterized by i) not expressing the products of the hbd genes, preferably with sequence SEQ ID NO: 39 when the bacterium in question is C. acetobutylicum, and bdhB, preferably with sequence SEQ ID NO: 36 when the bacterium in question is C. acetobutylicum, or expressing non-functional versions thereof, and ii) expressing the adh gene of C.beijerinckii with sequence SEQ ID NO: 38.

[0025] In the context of the present invention, the term hbd gene refers, in particular, to the sequence SEQ ID NO: 39 (CA_C2708). The term hbd gene also refers to variants of said sequence SEQ ID NO: 39, in particular, variants that exhibit sequence homology with said sequence SEQ ID NO: 39. Petition 870250088213, dated 09 / 29 / 2025, p. 20 / 77 8 / 43

[0026] In the context of the present invention, the term bdhB gene refers, in particular, to the sequence SEQ ID NO: 36 (CA_C3298) or to a variant of said sequence, in particular, a variant that exhibits sequence homology with said sequence SEQ ID NO: 36.

[0027] In the context of the present invention, the term gene CA_C0764 refers, in particular, to the sequence SEQ ID NO: 37 or to a variant of said sequence, in particular, a variant that exhibits sequence homology with said sequence SEQ ID NO: 37.

[0028] A typical example of a variant according to the invention exhibits sequence homology with sequence SEQ ID NO: 39, with SEQ ID NO: 36 or with sequence SEQ ID NO: 37, between 95% and 100% and preferably between 96% and 100%. Sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37 and their variants are, for example, homologous to at least 95%, for example, to at least 96%, to at least 97%, to at least 98% or to at least 99%. According to a preferred embodiment, sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37 and their variants exhibit sequence homology to at least 96%, at least 97% or at least 98%.

[0029] The term hbd gene also refers to a sequence that encodes a functional variant or fragment of the (S)-3-hydroxybutyryl-CoA dehydrogenase (Hbd) protein (enzyme), in particular, a protein capable of performing / able to perform (S)-3-hydroxybutyryl-CoA dehydrogenase activity.

[0030] In a specific embodiment, the term hbd gene also refers to a sequence that encodes a functional variant or fragment of the Hbd protein, in particular, a protein capable of performing (S)3-hydroxybutyryl-CoA dehydrogenase activity.

[0031] The term bdhB gene also refers to a sequence that encodes a functional variant or fragment of the protein. Petition 870250088213, dated 09 / 29 / 2025, p. 21 / 77 9 / 43 (enzyme) butanol dehydrogenase B (BdhB) dependent on NADPH, in particular, a protein capable of performing / able to perform an NADPH-dependent alcohol dehydrogenase activity.

[0032] In a specific embodiment, the term bdhB gene also refers to a sequence that encodes a functional variant or fragment of the BdhB protein, in particular, a protein capable of performing / able to perform NADPH-dependent alcohol dehydrogenase activity.

[0033] The term CA_C0764 gene also refers to a sequence that encodes a functional variant or fragment of ferredoxin-NADP+oxidoreductase (CAC0764).

[0034] In a specific embodiment, the term CA_C0764 gene also refers to a sequence that encodes a functional variant or fragment of the CAC0764 protein, in particular, a protein capable of performing / able to perform ferredoxin-NADP+ oxidoreductase activity.

[0035] The term adh gene also refers to a sequence that encodes a functional variant or fragment of an NADP-dependent isopropanol dehydrogenase (Adh) protein (enzyme), in particular, a protein capable of performing / able to perform an enzymatic activity that catalyzes the reduction of acetone to propan-2-ol.

[0036] In a specific embodiment, the term adh gene also refers to a sequence that encodes a functional variant or fragment of the Adh protein, in particular, a protein capable of performing / able to perform NADPH-dependent isopropanol dehydrogenase activity.

[0037] When this text refers to a genetically modified bacterium belonging to the genus Clostridium, characterized by not expressing the products of the hbd, bdhB and / or CA_C0764 genes, or expressing non-functional versions thereof, the expression non-functional version of the hbd, bdhB or CA_C0764 gene product denotes a protein, typically a protein Petition 870250088213, dated 09 / 29 / 2025, p. 22 / 77 10 / 43 identified in this text as Hbd, BdhB or CAC0764, which is non-functional, that is, incapable of performing the function of the protein encoded by the wild-type version of the target gene.

[0038] The term Clostridium genus bacteria is understood, in particular, to mean Clostridium species referred to as being of industrial interest, typically solutogenic or acetogenic bacteria of the genus Clostridium. The expression Clostridium genus bacteria includes wild-type bacteria as well as strains derived from them, genetically modified to improve their performance.

[0039] A Clostridium species of industrial interest or Clostridium bacteria of industrial interest is understood to be a species capable of producing, by fermentation, solvents such as ethanol, butanol, acetone or isopropanol and / or acids such as butyric acid, acetic acid or lactic acid, from sugars or monosaccharides, typically sugars with 5 carbon atoms such as xylose, arabinose or fructose, sugars with 6 carbon atoms such as glucose or mannose, polysaccharides such as cellulose or hemicellulose, and / or any other carbon source that can be assimilated and used by bacteria of the genus Clostridium (CO, CO2 and methanol, for example).Examples of solventogenic bacteria of interest are bacteria of the genus Clostridium that produce acetone, butanol, ethanol, and / or isopropanol (propan-2-ol), such as the strains identified in the literature as ABE strains [strains that perform fermentations that allow the production of acetone, butanol, and ethanol], IBE strains [strains that perform fermentations that allow the production of isopropanol (or propan-2-ol) by reduction of acetone, butanol, and ethanol], and AIBE strains [strains that perform fermentations that allow the production of acetone, isopropanol (or propan-2-ol), butanol, and ethanol]. Without limitation, solventogenic bacteria of the genus Clostridium can be selected, for example, from C. acetobutylicum, C. cellulolyticum, C. Petition 870250088213, dated 09 / 29 / 2025, page 23 / 77 11 / 43 phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum and C. tyrobutyricum, preferably from C. acetobutylicum, C. beijerinckii, C. butyricum, C. tyrobutyricum and C. cellulolyticum and more preferably from C. acetobutylicum and C. beijerinckii.

[0040] Acetogenic bacteria of interest are bacteria that produce acids and / or solvents from CO2 and H2. Acetogenic bacteria of the genus Clostridium can be selected, for example, from C. aceticum, C. thermoaceticum, C. ljungdahlii, C. autoethanogenum, C. difficile, C. scatologenes and C. carboxivorans.

[0041] In a particular embodiment, the bacterium of the genus Clostridium in question is an ABE strain, preferably the bacterium C. acetobutylicum, for example, the DSM 792 strain (also called ATCC 824 or LMG 5710) of C. acetobutylicum.

[0042] In another particular embodiment, the bacterium of the genus Clostridium in question is an “ABE strain”, preferably the bacterium C. beijerinckii, for example, the NCIMB 8052 strain of C. beijerinckii.

[0043] In another specific embodiment, the bacterium of the genus Clostridium in question is an IBE strain, preferably a subclade of C. beijerinckii selected from DSM 6423, LMG 7814, LMG 7815, NRRL B-593 and NCCB 27006.

[0044] Thus, according to a preferred embodiment, the bacterium according to the invention belonging to the genus Clostridium is a Clostridium bacterium of industrial interest, in particular a solvetogenic bacterium capable, in the wild type state, of producing solvents and / or acids by fermentation from a carbon source, said carbon source being chosen, for example, from sugar, CO, CO2, alcohol and an organic acid. In a specific preferred embodiment, the carbon source is a sugar, in particular a sugar comprising 5 Petition 870250088213, dated 09 / 29 / 2025, p. 24 / 77 12 / 43 carbon atoms, such as xylose or arabinose, a sugar comprising 6 carbon atoms, such as glucose, fructose, or mannose, or a polysaccharide, such as cellulose or hemicellulose.

[0045] A particularly preferred bacterium belongs to the species C. acetobutylicum and, as explained above, does not express the gene products of sequence SEQ ID NO: 39 (CA_2708) (or a sequence homologous to at least 95%, for example, to at least 96%, at least 97% or at least 98% with it), of sequence SEQ ID NO: 36 (CA_3298) (or a sequence homologous to at least 95%, for example, to at least 96%, at least 97% or at least 98% with it) and, preferably, of sequence SEQ ID NO: 37 (CA_0764) (or a sequence homologous to at least 95%, for example, to at least 96%, at least 97% or at least 98% with it) or expresses non-functional versions of said expression products. This genetically modified bacterium also expresses the functional product of the adh gene from C. beijerinckii with SEQ ID NO: 38.

[0046] The bacteria thus modified, which are particularly preferred, have the technical capabilities described above, namely, they are capable of producing propan-2-ol (also identified in this text as isopropanol) or a mixture of propan-2-ol and ethanol. Some are capable of producing a mixture of propan-2-ol and ethanol with much better C3 / C2 ratios compared to the ratio that can be obtained using the Δhbd mutant known to those skilled in the art (described in 2011 by Lehmann and Lütke-Eversloh).

[0047] These strains are characterized for the first time in the context of this patent application.

[0048] One of these strains was registered on February 17, 2023 under deposit number LMG P-32995 in the BCCMLMG collection (IFP 971, Δhbd ΔbdhB::adh ΔOA_O0764). In this strain, the hbd, bdhB, and CA_C0764 genes were (jointly) inactivated. This strain still expresses the adh gene. The description also refers to Petition 870250088213, dated 09 / 29 / 2025, p. 25 / 77 13 / 43 any bacterium derived from, cloned, mutant or genetically modified version of the same, typically lacking the hbd, bdhB and CA_C07 64 genes, or in which said genes have also been inactivated, and expressing a functional version of the adh gene product.

[0049] A second strain was registered on February 17, 2023 under deposit number LMG P-32994 in the BCCMLMG collection (IFP 970, Δhbd ΔbdhB:: adh). In this strain, the hbd and bdhB genes have been (jointly) inactivated. This strain also expresses the adh gene. The description also refers to any derived bacterium, clone, mutant or genetically modified version thereof, typically lacking the hbd and bdhB genes, or in which said genes have also been inactivated, and expressing a functional version of the adh gene product.

[0050] A third strain was registered on February 17, 2023 under deposit number LMG P-32993 in the BCCM-LMG collection (IFP 969, Δhbd). In this strain, the hbd gene has been inactivated. The description also refers to any derived bacterium, clone, mutant, or genetically modified version thereof, typically lacking the hbd gene, or in which said gene has also been inactivated.

[0051] Another objective of the invention is directed to the use of a bacterium according to the invention to produce propan-2-ol or a mixture comprising propan-2-ol and ethanol. In a specific embodiment, the bacterium according to the invention is, for example, capable of producing a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio greater than 0.10, for example 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18 or 0.19. In a preferred specific embodiment, the bacterium according to the invention is capable of producing a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio greater than or equal to 0.20, for example 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28 or 0.29, greater than or equal to 0.30, for example 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38 or 0.39, greater than or equal to 0.40, Petition 870250088213, dated 09 / 29 / 2025, p. 26 / 77 14 / 43 for example 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48 or 0.49, greater than or equal to 0.50, for example 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58 or 0.59, or greater than or equal to 0.60, for example 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68 or 0.69, more preferably greater than or equal to 0.70, for example 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, greater than or equal to 0.80, for example 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89 or greater than or equal to 0.90, for example 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98 or 0.99.

[0052] The genetically modified bacteria according to the invention can be advantageously used to produce a solvent, for example, a biofuel, preferably propan-2-ol, or a mixture of solvents, for example, a mixture of biofuels, preferably a mixture comprising propan-2-ol and ethanol, particularly on an industrial scale.

[0053] The invention also relates to a fermentation process, typically an industrial process, involving the use of a bacterium according to the invention.

[0054] By virtue of the present invention, the production of propan-2-ol is not only possible, but also greatly facilitated, as well as the production of a mixture comprising propan-2-ol and ethanol. The present invention offers an advantageous solution that allows optimizing the production of propan-2-ol, and obtaining a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio greater than 0.10.

[0055] A genetically modified bacterium according to the invention can also be advantageously used to produce a bio-based molecule, for example, a solvent, a biofuel or any (bio)chemical intermediate product, from biomass or from a dedicated energy crop.

[0056] In the context of the present invention, the term "biologically based molecule" is understood to mean a molecule of Petition 870250088213, dated 09 / 29 / 2025, p. 27 / 77 15 / 43 type alcohol or ketone, whose particular characteristic is that the raw material used for its production is necessarily derived from plant biomass, for example, lignocellulosic biomass, and not from fossil resources such as petroleum, coal or natural gas. These are, for example, alcohols derived from the fermentation of liquors containing sugars, notably in C5 (with 5 carbons) and / or in C6 (with 6 carbons), carried out by solventogenic strains of the genus Clostridium. Examples of bio-based molecules that can be produced by virtue of the present invention are ethanol (which can be used as a biofuel), or propan-2-ol, 1,3-butanediol and 2,3-butanediol.

[0057] The invention is further directed to a process for producing a recombinant bacterium according to the invention, comprising deleting or inactivating the hbd, bdhB and / or CA_C0764 genes in order to prevent or reduce the expression of functional Hbd and BdhB proteins, and preferably also CA_C0764, and transforming and genetically modifying the bacterium in order to enable it to express a functional Adh protein.

[0058] The known modification processes that offer the highest performance for obtaining genetically modified lines are based on homologous recombination events, allowing for precise and stable genome modification.

[0059] A specific production process according to the invention comprises a step of transforming the bacteria by introducing a nucleic acid of interest into said bacteria.

[0060] For the purposes of the invention, the term nucleic acid is understood to mean any natural, synthetic, semi-synthetic or recombinant DNA or RNA molecule that has optionally been chemically modified (i.e., comprises non-natural bases, modified nucleotides comprising, for example, a modified bond, modified bases and / or sugars). Petition 870250088213, dated 09 / 29 / 2025, page 28 / 77 16 / 43 modified), or optimized so that the codons of the transcripts synthesized from the coding sequences are the codons most frequently found in a bacterium of the genus Clostridium, aiming at their use in it. In the case of the genus Clostridium, the optimized codons are typically codons rich in adenine (A) and thymine (T) bases.

[0061] In the peptide sequences described in this document, amino acids are represented by their one-letter code according to the following nomenclature: C: cysteine; D: aspartic acid; E: glutamic acid; F: phenylalanine; G: glycine; H: histidine; I: isoleucine; K: lysine; L: leucine; M: methionine; N: asparagine; P: proline; Q: glutamine; R: arginine; S: serine; T: threonine; V: valine; W: tryptophan and Y: tyrosine.

[0062] In a specific embodiment described, the nucleic acid of interest comprises at least two regions, each complementary to a target sequence, 100% identical or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical, to said targeted DNA region / portion / sequence within the bacterial genome. These regions are capable of hybridizing with all or part of a complementary sequence of said region / portion / sequence, typically with a sequence as described above, comprising at least 1 nucleotide, preferably at least 100 nucleotides, typically between 100 and 1000 nucleotides. The target sequence complementary regions present in the nucleic acid of interest may preferably target the 5' and 3' flanking regions of the targeted sequence in a genetic modification tool known to those skilled in the art, such as any tool based on homologous recombination.

[0063] In a preferred specific embodiment, a portion of the nucleic acid of interest also recognizes (at least partially binds to) and preferably targets, i.e., Petition 870250088213, dated 09 / 29 / 2025, p. 29 / 77 17 / 43 recognizes and allows the breaking of, in the genome of a Clostridium bacterium of interest, at least one strand of i) a target sequence, ii) a sequence that controls the transcription of a target sequence, or iii) a sequence that flanks a target sequence. The recognized sequence is also identified in this text as the target sequence or directed sequence.

[0064] In this same preferred specific embodiment, the nucleic acid of interest comprises at least one region complementary to the target sequence that is 100% identical or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the targeted DNA region / portion / sequence within the bacterial genome and is capable of hybridizing with all or part of the complementary sequence of said region / portion / sequence, typically with a sequence comprising at least 5 nucleotides, preferably at least 5, 10, 14, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 15 and 30 nucleotides, preferably with a sequence comprising 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.

[0065] The nucleic acid(s) of interest, as described in the context of the present invention, are capable of deleting the said target sequence(s) from the bacterial genome or modifying its / their expression(s), for example, modulating / regulating it / them, in particular inhibiting it / them, preferably modifying it / them so as to render said bacteria incapable of expressing one or more proteins, in particular one or more functional proteins, from said sequence(s).

[0066] According to another aspect of the invention, the nucleic acid(s) of interest, as described in the context of the present invention, are capable of introducing a sequence of interest into the genome of the bacterium so as to make said bacterium capable of expressing one or more proteins, in particular, Petition 870250088213, dated 09 / 29 / 2025, p. 30 / 77 18 / 43 one or more functional proteins, from the referenced sequence(s).

[0067] The nucleic acids of interest, typically cassettes or expression vectors, can be generated by conventional techniques well known to those skilled in the art and may include one or more promoters, bacterial origins of replication (ORI sequences), termination sequences, selection genes, for example, antibiotic resistance genes, and sequences (flanking regions) that allow targeted insertion of the cassette or vector. The ORI sequences of interest may, for example, be chosen from pIP404, ρAMβI, repH (origin of replication in C. acetobutylicum), ColE1 or rep (origin of replication in E. coli), or any other origin of replication that allows the vector, usually the plasmid, to be maintained within a bacterial cell belonging to the genus Clostridium.The termination sequences of interest can be chosen, for example, from those of the adc, thl genes, the bcs operon, or any other terminator well known to those skilled in the art, allowing transcription to be interrupted within a bacterial cell belonging to the genus Clostridium. The selection genes (resistance genes) of interest can be chosen from ermB, catP, bla, tetA, tetM, and / or any other gene for resistance to ampicillin, erythromycin, chloramphenicol, thiamphenicol, spectinomycin, tetracycline, or any other antibiotic well known to those skilled in the art, which can be used to select bacteria of the genus Clostridium.

[0068] The nucleic acid of interest may be a natural or synthetic RNA or one produced by means of a recombination technique. This nucleic acid of interest may be prepared by any method known to those skilled in the art, for example, chemical synthesis, in vivo transcription or amplification techniques. When the nucleic acid(s) of Petition 870250088213, dated 09 / 29 / 2025, page 31 / 77 19 / 43 of interest are introduced into the cell directly in the form of RNA molecules (mature or precursor), for example, guide RNA (gRNA). These molecules may contain modified nucleotides or chemical modifications that allow them, for example, to increase their resistance to nucleases and thus increase their lifespan in the cell. They may, in particular, comprise at least one modified or unnatural nucleotide, such as a nucleotide comprising a modified base, such as inosine, methyl-5-deoxycytidine, dimethylamino-5-deoxyuridine, deoxyuridine, diamino-2,6-purine, bromo-5-deoxyuridine, or any other modified base that allows hybridization.

[0069] The nucleic acids of interest used according to the invention can also be modified at the internucleotide linkage level, for example, as phosphorothioates, H-phosphonates or alkylphosphonates, or at the core structure level, for example, as alpha-oligonucleotides, 2'-O-alkyl riboses or PNAs (peptide nucleic acids) (Egholm et al., 1992).

[0070] In the context of this descriptive report, a specific example of a nucleic acid of interest, used to transform and / or genetically modify a bacterium of interest, is a DNA fragment that i) recognizes a coding sequence; ii) controls the transcription of a coding sequence; or iii) flanks a sequence that codes for the enzyme Hbd (3-hydroxybutyryl-CoA dehydrogenase), the enzyme BdhB (NADPH-dependent alcohol dehydrogenase), the pyruvate NADP ferredoxin oxidoreductase, or the protein Adh (secondary alcohol dehydrogenase).

[0071] A specific nucleic acid of interest described by the inventors is, for example, a vector, preferably a plasmid, for example, the pGRNA-Δhbd plasmid with sequence SEQ ID NO: 31, the pGRNA-ΔbdhB::adh plasmid with sequence SEQ ID NO: Petition 870250088213, dated 09 / 29 / 2025, page 32 / 77 20 / 43 or the pGRNA-ACA_C0764 plasmid with sequence SEQ ID NO: 35, described in the experimental section of this descriptive report.

[0072] One or more of the recognized sequences (target sequence(s)) is preferably one of the sequences SEQ ID NO: 39, SEQ ID NO: 36, or SEQ ID NO: 37, corresponding to the hbd, bdhB, and CA_C0764 genes that encode the Hbd protein, the BdhB protein, and the CAC0764 protein, respectively, or an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, or 95% identical to said protein, or a sequence comprising all or at least 95%, 96%, 97%, 98%, or 99% of sequence SEQ ID NO: 39, SEQ ID NO: 36, or SEQ ID NO: 37. In other words, the recognized sequence may be a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1 and 40 nucleotides, preferably a sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides with sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37.

[0073] According to another specific example, the target sequence can also be a sequence that controls the transcription of a coding sequence as described above, typically a promoter sequence, for example, the promoter sequence of the hbd gene (CA_C2708, SEQ ID NO: 39), that of the bdhB gene (CA_C3298, SEQ ID NO: 36) or that of the CA_C0764 gene (SEQ ID NO: 37). The nucleic acid of interest then recognizes and is therefore typically able to bind to a sequence that controls the transcription of a coding sequence, as described above.

[0074] According to another specific example, the target sequence may be a sequence that flanks an encoding sequence as described above, for example, a sequence that flanks the sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37, or a sequence that is at least 70% identical to it. Such a flanking sequence typically comprises between 1, Petition 870250088213, dated 09 / 29 / 2025, page 33 / 77 21 / 43 or 20 and 1000 nucleotides, for example between 1, 10 or 20 and 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, between 1, 10 or 20 and 100 nucleotides, between 1, 10 or 20 and 50 nucleotides, or between 1, 10 or 20 and 40 nucleotides, for example between 10 and 40 nucleotides, between 10 and 30 nucleotides, between 10 and 20 nucleotides, between 20 and 30 nucleotides, between 15 and 40 nucleotides, between 15 and 30 nucleotides, or between 15 and 20 nucleotides.

[0075] According to a specific aspect, the target sequence corresponds to the pair of sequences that flank such a coding sequence, each flanking sequence typically comprising at least 20 nucleotides, typically between 100 and 1000 nucleotides, preferably between 200 and 800 nucleotides.

[0076] Preferably, the process according to the invention for producing a recombinant bacterium comprises transforming the bacterial cell using at least one nucleic acid of interest, for example, one, two, three or four nucleic acids of interest, as described above, said nucleic acid(s) of interest being capable of i) recognizing (and capable of at least partially binding to) a sequence that encodes, controls the transcription of a sequence that encodes or flanks a sequence that encodes the Hbd protein, ii) recognizing (and capable of at least partially binding to) a sequence that encodes, controls the transcription of a sequence that encodes or flanks a sequence that encodes the BdhB protein and, preferably, iii) recognizing (and capable of at least partially binding to) a sequence that encodes, controls the transcription of a sequence that encodes or flanks a sequence that encodes the CAC0764 protein.

[0077] The nucleic acid of interest, as described in the context of this invention, is preferably capable of Petition 870250088213, dated 09 / 29 / 2025, p. 34 / 77 22 / 43 delete the target sequence from the bacterial genome or modify its expression, for example, modulate / regulate it, in particular inhibit it, preferably modify it so as to render the bacterium incapable of expressing a protein (typically an Hbd, BdhB or CAC0764 protein), in particular a functional protein, from the sequence. In a particularly preferred embodiment, the nucleic acid of interest is capable of modifying the bacterium so as to render it incapable of expressing one and / or another of the Hbd, BdhB and CAC0764 proteins.

[0078] Another example of a nucleic acid of interest is the sequence that codes for the Adh protein.

[0079] According to a specific embodiment, the descriptive report is directed more particularly to the use of the pGRNA-Δhbd plasmid with sequence SEQ ID NO: 31, the pGRNA-ΔbdhB:: adh plasmid with sequence SEQ ID NO: 33 and / or the pGRNA-CA_C07 64 plasmid with sequence SEQ ID NO: 35 to transform, and preferably genetically modify, a bacterium of the genus Clostridium in order to improve its ability to produce propan-2-ol or a mixture of propan-2-ol and ethanol.

[0080] It also refers to a transformation process, and preferably genetic modification, of a bacterium of the genus Clostridium, characterized by comprising a transformation step of the bacterium by introducing into said bacterium a plasmid as described in this text, preferably a plasmid selected from the pGRNA-Δ hbd plasmid with sequence SEQ ID NO: 31, the pGRNA-ΔbdhB:: adh plasmid with sequence SEQ ID NO: 33 or the pGRNA^CA_C07 64 plasmid with sequence SEQ ID NO: 35. The descriptive report also applies to any genetically modified bacterium of the genus Clostridium obtained by such a process.

[0081] The introduction of any nucleic acid of interest into bacteria can be carried out by any direct method or Petition 870250088213, dated 09 / 29 / 2025, page 35 / 77 23 / 43 indirect known to those skilled in the art, for example, by transformation, conjugation, microinjection, transfection, electroporation, etc., and preferably by electroporation (Mermelstein et al., 1993).

[0082] Furthermore, these nucleic acids of interest (e.g., DNA fragments, RNA fragments, expression cassettes, or expression vectors) can be integrated into the bacterial genome by techniques that are also well known to those skilled in the art.

[0083] In a specific embodiment, the process for transforming, and preferably genetically modifying, a bacterium as described in this text comprises a step of transforming the bacterium by introducing into said bacterium a nucleic acid of interest according to the invention as described above and involving a genetic modification tool, for example, a genetic modification tool selected from a CRISPR tool, an insertional mutagenesis tool, for example, based on the use of type II introns (for example, the Targetron® tool or the ClosTron® tool) and an allele exchange tool (for example, the ACE® tool).

[0084] The process for transforming, and preferably also genetically modifying, a Clostridium bacterium may additionally comprise a step of obtaining, recovering, selecting or isolating the transformed bacterium, i.e., the bacterium that exhibits the desired recombinations / modifications / optimizations.

[0085] In a specific embodiment, the process according to the invention is based on the use (employs) of the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) genetic tool / technology, in particular the CRISPR-Cas (CRISPR-associated protein) genetic tool. The present invention can be implemented using a tool Petition 870250088213, dated 09 / 29 / 2025, page 36 / 77 24 / 43 Conventional CRISPR-Cas genetics using a single plasmid comprising a nuclease, a gRNA, and a repair template, as described by Wang et al. Skilled individuals can easily define the sequence and structure of the gRNAs depending on the chromosomal region or mobile genetic element to be targeted, using well-known techniques (see, for example, the article by DiCarlo et al., 2013). The inventors have developed and described a genetic tool for modifying bacteria, suitable for bacteria of the genus Clostridium, which can be used in the context of the present invention, based on the use of two plasmids (cf. WO2017 / 064439, Wasels et al., 2017).

[0086] In another embodiment, the process according to the invention is based on the use of an insertional mutagenesis tool, for example, the use of type II introns, and employs, for example, the ClosTron® genetic tool / technology or the Targetron® genetic tool.

[0087] Targetron® technology is based on the use of a reprogrammable group II intron (based on the Ll.ltrB intron from Lactococcus lactis) capable of rapidly integrating the bacterial genome into a desired locus (Chen et al., 2005, Wang et al., 2013), typically for the purpose of inactivating a target gene. The mechanisms for recognizing the edited zone and also for insertion into the genome by reverse splicing are based on the homology between the intron and said zone, on the one hand, and on the activity of a protein (LtrA), on the other.

[0088] ClosTron® technology is based on a similar approach, complemented by the addition of a selection marker in the intron sequence (Heap et al., 2007). This marker allows for the selection of intron integration into the genome and thus facilitates obtaining the desired mutants. This genetic system also uses type I introns. Specifically, the selection marker (called RAM for retrotransposition-activated marker) is interrupted by this genetic element, which prevents its Petition 870250088213, dated 09 / 29 / 2025, page 37 / 77 25 / 43 expression from the plasmid (for a more precise descriptive report of the system, see: Zhong et al.). Splicing of this genetic element is performed before integration into the genome, which allows obtaining a chromosome exhibiting an active form of the resistance gene. An optimized version of the system comprises FLP / FRT sites upstream and downstream of this gene, which allows the use of FRT recombinase to remove the resistance gene (Heap et al., 2010).

[0089] In another embodiment, the process according to the invention is based on the use of an allelic exchange tool and, for example, employs the ACE® genetic tool / technology.

[0090] The ACE® technology is based on the use of an auxotrophic mutant (for uracil in C. acetobutylicum ATCC 824 by deletion of the pyrE gene, which also causes resistance to 5-fluorourotic acid (5-FOA); Heap et al., 2012). The system utilizes the allelic exchange mechanism, which is well known to those skilled in the art. After transformation with a pseudo-suicide vector (very low copies), the integration of the latter into the bacterial chromosome through a first allelic exchange event can be verified by virtue of the resistance gene initially present in the plasmid. The integration step can be performed in two different ways, within the pyrE locus or within another locus. In the case of integration into the pyrE locus, the pyrE gene is also placed in the plasmid, but without being expressed (without a functional promoter). The second recombination restores a functional pyrE gene and it can then be selected via auxotrophy (minimal medium, not containing uracil).Since the non-functional pyrE gene also exhibits a selectable nature (sensitivity to 5-FOA), other integrations can be considered in the same model, successively alternating the state of pyrE between functional and non-functional. In the case of integration at another locus, a genomic zone that allows the expression of the counter-selection marker after recombination is targeted (typically, in an operon). Petition 870250088213, dated 09 / 29 / 2025, page 38 / 77 26 / 43 after another gene, preferably a highly expressed gene). This second recombination is then selected by auxotrophy (minimal medium not containing uracil).

[0091] In the embodiments described based on the use of type II introns and employing, for example, the ClosTron® genetic tool / technology or the Targetron® genetic tool, or based on the use of an allele exchange tool and employing, for example, the ACE® genetic tool / technology, the targeted sequence is typically one of the sequences described in this text.

[0092] The invention also relates to a kit (case) for transforming and / or genetically modifying a bacterium of the genus Clostridium comprising at least one nucleic acid of interest as described herein (for example, two or three nucleic acids of interest, typically DNA fragments, each recognizing a target sequence) for transforming and preferably genetically modifying a bacterium of the genus Clostridium, and possibly one or more selection molecules.A specific kit comprises the essential elements for the functioning of a CRISPR tool (typically at least one nucleic acid usable as gRNA, one nucleic acid usable as a repair template, at least one primer pair, and an inducer that allows the expression of a nuclease, in particular a Cas9 or Cas12 type nuclease, for example MAD7), the essential elements for the functioning of a tool based on the use of type II introns (typically at least one type II intron, at least one primer pair, and an inducer that allows the expression of a reverse transcriptase, for example LtrA RT or Tel4c RT), or the essential elements for the functioning of an allele exchange tool (typically at least two nucleic acids usable as homologous recombination templates and at least one primer pair). Petition 870250088213, dated 09 / 29 / 2025, p. 39 / 77 27 / 43

[0093] The kits according to the invention may also comprise one or more consumables, such as a preservation medium or a culture medium, at least one competent bacterium of the genus Clostridium (i.e., conditioned for transformation) or a booklet containing instructions for use.

[0094] The invention typically relates to a kit for implementing a genetic transformation and / or modification process described in this text, using a bacterium of the genus Clostridium.

[0095] The invention is particularly directed to genetically modified bacteria belonging to the genus Clostridium having as essential characteristics i) not expressing the products of the hbd and bdhB genes, and preferably CA_C0764, or expressing non-functional versions thereof, and ii) expressing the adh gene, and also any derived bacteria, clone, mutant or genetically modified version thereof, and uses thereof.

[0096] The application also discloses the IFP 969 (Δ hbd) strain, registered on February 17, 2023 under deposit number LMG P-32993 in the BCCM-LMG collection, in which the hbd gene has been inactivated, and also any derived bacteria, clone, mutant or genetically modified version thereof, typically without the hbd gene, or in which said gene has also been inactivated, preferably using CRISPR technology.

[0097] The application also discloses the IFP 970 strain (Δhbd ΔbdhB::adh), registered on February 17, 2023 under deposit number LMG P-32994 with the BCCM-LMG collection, in which the hbd and bdhB genes have been inactivated and which expresses the adh gene product, and also any derived bacteria, clone, mutant or genetically modified version thereof, typically without the hbd and bdhB genes, or in which said genes have also been inactivated and expressing the adh gene product.

[0098] It is specifically directed at the use of a genetically modified bacterium belonging to the genus Clostridium, Petition 870250088213, dated 09 / 29 / 2025, p. 40 / 77 28 / 43 characterized by not expressing the hbd gene products, or expressing a non-functional version of the hbd gene products, for example, the IFP 969 strain, registered on February 17, 2023 under deposit number LMG P-32993 with the BCCM-LMG collection, to prepare a genetically modified bacterium according to the invention that does not express the hbd and bdhB gene products, or expresses non-functional versions thereof, and expresses the adh gene product.

[0099] The application also discloses strain IFP 971 (Δhbd ΔbdhB::adh ΔOA_O0764), registered on February 17, 2023 under deposit number LMG P-32995 with the BCCMLMG collection, in which the hbd, bdhb and CA_C0764 genes have been inactivated and which expresses the adh gene product, and also any derived bacteria, clone, mutant or genetically modified version thereof, typically without the hbd, bdhb and CA_C0764 genes, or in which said genes have also been inactivated and expressing the adh gene product.

[0100] It is directed in particular to the use of a genetically modified bacterium belonging to the genus Clostridium, characterized by not expressing the products of the hbd and bdhB genes, or expressing a non-functional version of the products of the hbd and bdhB genes, and expressing the product of the adh gene, for example, the IFP 970 strain, registered on February 17, 2023 under deposit number LMG P-32994 with the BCCM-LMG collection, to prepare a genetically modified bacterium according to the invention that does not express the products of the hbd, bdhB and CA_C0764 genes, or expresses non-functional versions thereof, and expresses the product of the adh gene.

[0101] The invention also relates to a kit for producing a bio-based molecule, for example, a solvent, a biofuel or any (bio)chemical intermediate product, using a bacterium belonging to the genus Clostridium, comprising i) a genetically modified bacterium Petition 870250088213, dated 09 / 29 / 2025, page 41 / 77 29 / 43 belonging to the genus Clostridium according to the invention, for example IFP 969, IFP 970 or IFP 971, and ii) a medium, typically a preservation medium or a culture medium for said bacteria. The kit may additionally include a booklet containing instructions for use.

[0102] The preservation or culture medium for the genetically modified bacteria (belonging to the genus Clostridium) according to the invention, present in the kit, is preferably supplemented with a carbon source composed of glucose and / or at least one pentose, preferably i) glucose and / or ii) arabinose and / or iii) xylose. This medium preferably comprises between 0.1 and 250 g / L, more preferably between 1 and 100 g / L, of said carbon source (composed of glucose and / or arabinose and / or xylose).

[0103] The preservation or culture medium for the genetically modified bacteria is preferably an RCM culture medium, more preferably a GAPES culture medium, and even more preferably a CGM culture medium.

[0104] The invention also relates to a specific kit for producing a solvent or a biofuel or a mixture of solvents or biofuels, in particular propan-2-ol or a mixture comprising propan-2-ol and ethanol, using a bacterium belonging to the genus Clostridium, said kit comprising i) a genetically modified bacterium (belonging to the genus Clostridium) according to the invention, characterized by not expressing the products of the hbd, bdhB and / or CA_C0764 genes, or expressing non-functional versions thereof, and ii) a culture medium, preferably an RCM culture medium, more preferably a GAPES culture medium, even more preferably a CGM culture medium, containing at least one carbon source, preferably glucose and / or arabinose and / or xylose. Petition 870250088213, dated 09 / 29 / 2025, page 42 / 77 30 / 43

[0105] The invention further relates to the possible uses of the process or kit according to the invention, for transforming and / or genetically modifying a bacterium of the genus Clostridium, typically a solventogenic bacterium of the genus Clostridium, for example, to generate improved variants of said bacterium.

[0106] Finally, it refers to the possible uses of the process, kit or transformed and preferably genetically modified bacterium of the genus Clostridium according to the invention, in particular to enable the production of bio-based molecules, for example, solvent(s), biofuel(s) or intermediate (bio)chemical product(s), or mixtures thereof, typically on an industrial scale.

[0107] The following examples and figure are intended to illustrate the invention more fully, without, however, limiting its scope. In particular, these examples show the obtaining and characterization of bacteria according to the invention, in which the inactivation of the hbd, bdhB and / or CA_C07 64 genes, and / or the insertion of the adh gene, is carried out according to a particular preferred embodiment using a CRISPR-Cas9 tool. Said genes can be inactivated, or introduced, according to other particular embodiments well known to those skilled in the art and based, for example, on the inactivation, or introduction, of genes by homologous recombination or by insertional mutagenesis, as explained above. Figure

[0108] Figure 1 shows the central metabolism of C. acetobutylicum. C. acetobutylicum produces acetate, butyrate, and possibly lactate during acidogenesis. During the solvogenesis phase, butyrate and acetate are reassimilated, and the carbon flow is redirected to the production of acetone, ethanol, and n-butanol. Ack, acetate kinase; Adc, acetoacetate decarboxylase; Adh, alcohol dehydrogenase; Ald, aldehyde Petition 870250088213, dated 09 / 29 / 2025, page 43 / 77 31 / 43 dehydrogenase; Aldc, acetolactate decarboxylase; Als, acetolactate synthase; Bcd, butyryl-CoA dehydrogenase; Buk, butyrate kinase; CtfA-CtfB, butyrate-acetoacetate CoAtransferase (subunits A and B); Crt, crotonase; EtfA-EtfB, electron transfer flavoprotein (subunits α and β); Fnor, ferredoxin-NAD(P)+ oxidoreductase; Hbd, 3-hydroxybutyryl-CoA dehydrogenase; HydA, hydrogenase; Ldh, lactate dehydrogenase; Pdc, pyruvate decarboxylase; Pfor, pyruvate ferredoxin oxidoreductase; Pta, phosphate acetyltransferase; Ptb, phosphate butyryltransferase; Thl, thiolase. Examples Example 1: C. acetobutylicum strain producing a mixture of propan-2-ol and ethanol. Materials and methods. Culture conditions.

[0109] C. acetobutylicum DSM 792 (Deutsche Sammlung von Mikroorganismen und Zellkulturen, DSMZ) and C. beijerinckii DSM 6423 (DSMZ) were cultured at 34 °C under anaerobic conditions (90% N2, 5% CO2, 5% N2) in 2YTG medium (tryptone at 16 gL-1, yeast extract at 10 gL-1, glucose at 5 gL-1, NaCl at 4 gL-1). Escherichia coli NEB 10-beta (New England Biolabs, NEB) was cultured at 37 °C under aerobic conditions in LB medium (tryptone at 10 gL-1, yeast extract at 5 gL-1, NaCl at 10 gL-1). Solid media were produced by adding 15 g L⁻¹ of agarose to liquid medium. When necessary, erythromycin (Em, 40 mg L⁻¹) and / or thiamphenicol (Tm, 15 mg L⁻¹) were used for C. acetobutylicum cultures. Similarly, chloramphenicol (12.5 mg L⁻¹ in liquid medium and 25 mg L⁻¹ in solid medium) and / or tetracycline (20 mg L⁻¹) were used for E. coli cultures. Nucleic acids and plasmid vectors

[0110] The list of plasmids used is presented in Table 1 below. Petition 870250088213, dated 09 / 29 / 2025, page 44 / 77 32 / 43 Table 1: Plasmids Characteristics of pEC500E (SEQ ID NO: 25) ermB, bla, ColE1, pAMB1 pFC002 (SEQ ID NO: 2) Derived from pEC500E with insertion of the adh gene (Collas F. et al.) pCas9acr (SEQ ID NO: 27) ermB, ColE1, pCB102, Pcm- tetO2 / 1-cas9, Pbgal- acrIIA4, tetR, bgaR (Wasels F. et al., 2020) pGRNAind (SEQ ID NO: 28) catP, ColE1, pIP404, gRNA expression cassette (Pcm-2tetO1 promoter) (Wasels F. et al., 2020) pAN2 (SEQ ID NO: 29) teta, p15A ori, Φ3TI (Heap JT et al.) pGRNA-hbd (SEQ ID NO: 30) Derived from pGRNAind, targeting hbd pGRNA-Δhbd (SEQ ID NO: 31) Derived from pGRNA-hbd, with Δhbd editing template pGRNA-bdhB (SEQ ID NO: 32) Derived from pGRNAind, targeting bdhB (Wasels F. et al., 2020) pGRNA-ΔbdhB::adh (SEQ ID NO: 33) Derived from pGRNA-bdhB, with ΔbdhB::adh editing template pGRNA-CA_C0764 (SEQ ID NO: 34) Derived from pGRNAind, targeting CA_C0764 pGRNA-ΔCA_C0764 (SEQ ID NO: 35) Derived from pGRNA-bdhC, with ΔCA_C0764 editing template ermB, erythromycin resistance gene; catP, thiamphenicol and chloramphenicol resistance gene; tetA, tetracycline resistance gene; ColE1 and p15A ori, origins of Petition 870250088213, dated 09 / 29 / 2025, page 45 / 77 33 / 43 replication in E. coli; pIP404, pAMB1 and pCB102, origins of replication in C. acetobutylicum.

[0111] The manipulated nucleic acids were purified using the QIAquick PCR Purification Kit (Qiagen), QIAprep Spin Miniprep Kit (Qiagen), and GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich). PCR amplifications were performed using Q5 High-Fidelity DNA Polymerase (NEB). The oligonucleotides used for plasmid generation are presented in Table 2 below. Table 2: Oligonucleotide Sequence (5'-3') P01 (SEQ ID NO: 1) TCATACTTGGAGCTAATCACCAA P02 (SEQ ID NO: 2) AAACTTGGGTGATTAGCTCCAAGT P03 (SEQ ID NO: 3) ATGCATGTCGACCAAAATCCTTSEATCTG P04: ID NO: GAAAAAGGTATATTCAAAATAAGTTTACAAGAATCCCC P05 (SEQ ID NO: 5) ATTTTGAATATACCTTTTTCATTAAAACAGACCTCC P06 (SEQ ID NO: 6) ATGCATGAATTCTGCAAATGTTTCTGATGATAAAATAG P07 (SEQ ID NO: 7) ATTCGAGGTATATTCAAACTGACTGACTGACTGACTCA ACGAACCCAAAAAGAAAGTTTC P08 (SEQ ID NO: 8) GTTATATTATAAACCTACCGGGGTTTGGGC P09 (SEQ ID NO: 9) AACCTTTCATTTAACCCCTCCTGTTTAG P10 (SEQ ID NO: 10) CAAGCTTGCATGCCTGCAGGTCGACTAGCTAGCTAGCTAQ P111: ID: CCCGGTAGTTTAATAATAACTACTGCTTTAATTAAGT C P12 (SEQ ID NO: 12) AGGGGTTAAAATGAAAGGTTTTGCAATGC P13 (SEQ ID NO: 13) TCATATAGTTGGAGGAGGTCCAGC P14 (SEQ ID NO: 14) AAACTCGCTGACTATTAATTAAGT P12 (SEQ ID NO: 14) 15) AAAAAAGTCGACATGCATTCGATGTAATGTACTTCAGA P16 (SEQ ID NO: 16) AATTTTATTGTTATCCATAATTAATCTCTCC TTTT P17 (SEQ ID NO: 17) TATGGATAACAATAATTAATTTGAAGTGAAATTT GGA Petition 870250088213, dated 09 / 29 / 2025, page 46 / 77 34 / 43 Oligonucleotide Sequence (5'-3') P18 (SEQ ID NO: 18) AAAAAAGGATCCCGCATTTATTAAAGACATTTGACCCC

[0112] The pGRNA-hbd plasmid (SEQ ID NO: 30) was generated by cloning the hybridization product of the P01 and P02 oligonucleotides in pGRNAind (SEQ ID NO: 28) using BsaI and T4 DNA ligase (NEB). The fragment obtained by PCR overlay of amplifications obtained from DSM 7 92 gDNA using the P03-P04 and P05-P06 oligonucleotide pairs was cloned into the BamHI and SalI sites in pGRNA-hbd to obtain pGRNA-Δhbd (SEQ ID NO: 31). The fragment obtained by PCR overlay of amplifications obtained from DSM 792 gDNA using the P07-P08 and P09-P10 oligonucleotide pairs and from DSM 6423 gDNA using the P11-P12 oligonucleotide pairs was cloned at the BamHI and SalI sites in pGRNA-bdhB (SEQ ID NO: 32) to obtain pGRNA-ΔbdhB::adh (SEQ ID NO: 33). The pGRNA-CA_C0764 plasmid (SEQ ID NO: 34) was generated by cloning the hybridization product of the P13 and P14 oligonucleotides in pGRNAind.The fragment obtained by PCR overlay of amplifications obtained from DSM 792 gDNA using the oligonucleotide pairs P15-P16 and P17-P18 was cloned into the BamHI and SalI sites in pGRNA-CA_C0764 to obtain pGRNA-ACA_C0764 (SEQ ID NO: 35). Genetic editing

[0113] Plasmid constructs were introduced into C. acetobutylicum as described by Mermelstein LD et al. Gene editing events were performed according to the protocol described by Wasels F. et al. (2020) and Wasels F. et al. (2017). The oligonucleotides used for confirmation of gene edits are presented in Table 3 below. Table 3: Oligonucleotide Locus Sequence (5'-3') hbd P19 (SEQ ID NO: 19) GTAATATTATAGCAGCTATTTTAAGTTTAC P20 (SEQ ID NO: 20) AAAGGTAAGGAAATGGCTGAG Petition 870250088213, dated 09 / 29 / 2025, page 47 / 77 35 / 43 Oligonucleotide Locus Sequence (5'-3') bdhB P21 (SEQ ID NO: 21) ACACATTGAAGGGAGCTTTT P22 (SEQ ID NO: 22) GGCAACAACATCAGGCCTTT CA_C0764 P25 (SEQ ID NO: 23) TGTTCATCGGTAACCTGTTCA P26 (SEQ ID NO: 24) ACGAAATGCCCAACTTGCAA

[0114] The use of other genetic tools, such as those based on homologous recombination or insertion of mobile genetic elements, may allow the obtaining of mutants that have equivalent genotypes, that is, that no longer express the products of the hbd, bdhB or CA_C07 64 genes, or that express a non-functional version of them. Fermentation

[0115] The fermentation performance of the microorganisms described in this example was evaluated in batch mode. Pre-cultures were carried out in an anaerobic chamber in a volume of 1 mL of CGM medium (KH2PO4 at 0.75 gL-1, K2HPO4 at 0.75 gL-1, MgSO4-H2O at 0.4 gL-1, MnSO4-H2O at 0.01 gL-1, FeSO4 · 7H2O at 0.01 gL-1, NaCl at 1.0 gL-1, Asparagine at 2.0 gL-1, Yeast extract at 5.0 gL-1, (NH4)2SO4 at 2.0 gL-1, Glucose at 80 gL-1). After incubation for 18 h, a volume of 500 pL of these pre-cultures was used to inoculate 9.5 mL of CGM medium into flasks. Once crimped, these flasks were incubated for 96 h at 34 °C, 100 rpm. At the end of fermentation, the samples were centrifuged at 5000 g for 5 minutes, and the supernatants were diluted with an internal standard (final concentration of 0.5 g L⁻¹ of n-propanol) and then filtered to 0.22 g m before being analyzed by chromatography.The solvents were detected by gas chromatography on a PoraBOND-Q column (Agilent Technologies) with a flame ionization detector. Helium was used as the carrier gas at a flow rate of 1.6 mL.min-1 and the column was heated from 50 to 250 °C over a 30-minute run. The acids were detected by high-performance liquid chromatography on an Aminex HPX-87H column (Biorad) coupled to a refractometer. Petition 870250088213, dated 09 / 29 / 2025, p. 48 / 77 36 / 43 Spectra System RI-150 and a Waters 2487 dual UV detector set to 210 nm. The mobile phase consisted of a 0.1 M sulfuric acid solution, and the column temperature was set to 60 °C. Unless otherwise indicated, the results presented are the average of at least three independent assays. Results

[0116] A Δ hbd mutant was generated in the DSM 792 strain of C. acetobutylicum. The fermentation performance of this mutant compared to the wild-type strain is presented in Table 4 below. Table 4: Strains Solvents (gL-1) Ethanol Acetone Propan-2-ol n-Butanol Total DSM 792 1.1±0.2 8.6±0.8 0.1±0.0 12.3±0.7 22.1±0.4 Δ hbd 33.3±1.3 2.9±0.2 0.0±0.0 0.0±0.0 36.3±1.5 Acids (gL-1) Acetic acid Butyric acid Lactic acid Total DSM 792 1.6±0.5 1.6±0.5 0.0±0.0 3.1±1.0 Δ hbd 0.7±0.0 0.0±0.0 0.5±0.0 1.3±0.0

[0117] As expected, this mutant is no longer able to produce n-butanol or butyrate. It allows the production of large quantities of ethanol, which becomes the predominant fermentation product. The amount of acetone produced is reduced by more than 65% compared to the wild-type strain.

[0118] To transform this mutant into a propan-2-ol producer, the pFC002 plasmid (SEQ ID NO: 26) was introduced into this mutant. The fermentation performance of the wild-type strain transformants and the Δhbd mutant containing the empty pEC500E plasmid (SEQ ID NO: 25) or the pFC002 plasmid (SEQ ID NO: 26) are presented in Table 5 below. Petition 870250088213, dated 09 / 29 / 2025, page 49 / 77 Table 5: Strains Solvents (gL-1) Ethanol Acetone Propan-2-ol n-Butanol Total DSM 792 pEC500E 1.4±0.0 7.2±0.1 0.1±0.0 13.9±0.3 22.7±0.4 DSM 792 pFC002* 1.5 0.1 7.5 16.2 25.4 Δhbd pEC500E 32.9±0.5 4.4±0.1 0.0±0.0 0.0±0.0 37.3±0.4 Δhbd pFC002* 35.7 0.2 2.3 0.0 38.2 Acids (gL-1) Acetic acid Butyric acid Lactic acid Total DSM 792 pEC500E 1.0±0.1 1.3±0.1 0.0±0.0 2.3±0.1 DSM 792 pFC002* 1.5 2.5 0.0 4 Δhbd pEC500E 0.5±0.1 0.0±0.0 0.0±0.0 0.5±0.1 Δhbd pFC002* 0.8 0.0 0.0 0.8 * The DSM 792 pFC002 and Δhbd pFC002 clones have not been tested in duplicate. 37 / 43 Petition 870250088213, dated 09 / 29 / 2025, page 50 / 77 38 / 43

[0119] The pFC002 plasmid (SEQ ID NO: 26) containing the adh gene from C. beijerinckii DSM 6423 makes it possible to transform the wild-type strain DSM 792 and also the Δhbd mutant into propan-2-ol producers. It should be noted that the amount of propan-2-ol produced by the Δhbd mutant containing the pFC002 plasmid is half the amount of acetone produced by the same mutant containing the empty pEC500E plasmid. Thus, it appears that the combination of hbd gene deletion and adh gene expression from C. beijerinckii DSM 6423 in C. acetobutylicum DSM 792 does not make it possible to obtain a high-performance propan-2-ol producer.

[0120] To obtain a mutant derived from Δhbd that produces isopropanol in the absence of selection pressure, a Δhbd ΔbdhB::adh mutant was generated. The bdhB gene (SEQ ID NO: 36) encodes an NADPH-dependent alcohol dehydrogenase. The fermentation performance of this mutant is presented in Table 6 below. Petition 870250088213, dated 09 / 29 / 2025, page 51 / 77 Table 6: Strains Solvents (gL-1) Propan-2-ol / ethanol ratio Ethanol Acetone Propan-2-ol Total Δhbd 33.3±1.3 2.9±0.2 0.0±0.0 36.3±1.5 0.00 Δhbd pFC002* 35.7 0.2 2.3 38.2 0.06 Δhbd ΔbdhB::adh 27.9±1.7 0.1±0.0 7.2±0.5 35.2±2.2 0.26 Acids (gL-1) Acetic acid Butyric acid Lactic acid Total Δhbd 0.7±0.0 0.0±0.0 0.5±0.0 1.3±0.0 Δhbd pFC002* 0.8 0.0 0.0 0.8 Δhbd ΔbdhB ::adh 0.8±0.1 0.0±0.0 1.2±0.2 2.0±0.3 * The clone Δhbd pFC002 has not been tested in duplicate. 39 / 43 Petition 870250088213, dated 09 / 29 / 2025, page 52 / 77 40 / 43

[0121] Surprisingly, this modification allows for an improved propan-2-ol / ethanol ratio compared to the Δ hbd mutant containing the pFC002 plasmid, which is multiplied by a factor of 4.

[0122] Other modifications were planned to further improve the C3 (acetone + propan-2-ol) / C2 (ethanol) ratio. In particular, the fermentation performance of a mutant derived from Δhbd ΔbdhB::adh, in which the CA_C0764 gene (SEQ ID NO: 37) encoding a pyruvate NADP ferredoxin oxidoreductase is deleted, is presented in Table 7. Petition 870250088213, dated 09 / 29 / 2025, page 53 / 77 Table 7: Strains Solvents (gL-1) C3 / C2 Ratio Ethanol Acetone Propan-2-ol Total Ahbd 33.3±1.3 2.9±0.2 0.0±0.0 36.3±1.5 0.09 Ahbd AbdhB::adh 27.9±1.7 0.1±0.0 7.2±0.5 35.2±2.2 0.26 Ahbd AbdhB::adhACA_C0764 17.9±0.6 4.3±0.1 9.7±0.2 32.0±0.9 0.78 Acids (gL-1) Acetic acid Butyric acid Lactic acid Total Ahbd 0.7±0.0 0.0±0.0 0.5±0.0 1.3±0.0 Ahbd AbdhB::adh 0.8±0.1 0.0±0.0 1.2±0.2 2.0±0.3 Ahbd AbdhB::adhACA_C0764 1.3±0.2 0.0±0.0 0.0±0.0 1.3±0.2 41 / 43 Petition 870250088213, dated 09 / 29 / 2025, page 54 / 77 42 / 43

[0123] The C3 (acetone + propan-2-ol) / C2 (ethanol) ratio is improved by a factor of 3 in the Δhbd ΔbdhB::adhΔOA_O0764 mutant, compared to the Δhbd ΔbdhB::adh mutant, and by a factor of 9 compared to the Δhbd mutant. Furthermore, this mutant produces a greater amount of propan-2-ol than the DSM 792 strain containing the pFC002 plasmid (Table 6). Conclusions

[0124] The results presented in this example describe the obtaining of C. acetobutylicum mutants that no longer produce butanol or butyrate and produce a propan-2-ol / ethanol mixture with an advantageous C3 / C2 ratio, greatly improved compared to the Δhbd mutant described in the literature. References

[0125] Collas F, Kuit W, Clément B, Marchal R, LópezContreras AM, Monot F. 2012. Simultaneous production of isopropanol, butanol, ethanol and 2,3-butanediol by Clostridium acetobutylicum engineered strains ATCC 824. AMB Exp 2:45. doi:10.1186 / 2191-0855-2-45.

[0126] Dusséaux S, Croux C, Soucaille P, Meynial-Salles I. 2013. Metabolic engineering of Clostridium acetobutylicum ATCC 824 for high-yield production of a biofuel composed of an isopropanol / butanol / ethanol blend. Metabolic Engineering 18:1–8. doi:10.1016 / j.ymben.2013.03.003.

[0127] Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP. 2007. The ClosTron: a universal gene knock-out system for the genus Clostridium. Journal of Microbiological Methods 70:452-464. doi:10.1016 / j.mimet.2007.05.021.

[0128] Ismaiel AA, Zhu CX, Colby GD, Chen JS. 1993. Purification and characterization of a primary-secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii. JJ Bacteriol 175:5097-5105. doi:10.1128 / jb.175.16.5097-5105.1993.

[0129] Lee J, Jang Y-S, Choi SJ, Im JA, Song H, Cho JH, Seung DY, Papoutsakis ET, Bennett GN, Lee SY. 2012. Metabolic Petição 870250088213, de 29 / 09 / 2025, pág. 55 / 77 43 / 43 engineering of Clostridium acetobutylicum ATCC 824 for isopropanol-butanol-ethanol fermentation. Applied and Environmental Microbiology 78:1416-1423. doi:10.1128 / AEM.0638211.

[0130] Lehmann D, Lütke-Eversloh T. 2011. Switching Clostridium acetobutylicum to an ethanol producer by disruption of the butyrate / butanol fermentative pathway. Metabolic Engineering 13:464-473. doi:10.1016 / j.ymben.2011.04.006.

[0131] Mermelstein LD, Papoutsakis ET. 1993. In vivo methylation in Escherichia coli by the Bacillus subtilis phage phi 3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824. Applied and Environmental Microbiology 59:1077-1081. doi:10.1128 / aem.59.4.1077-1081.1993.

[0132] Wasels F, Jean-Marie J, Collas F, López-Contreras AM, Lopes Ferreira N. 2017. A two-plasmid inducible CRISPR / Cas9 genome editing tool for Clostridium acetobutylicum. Journal of Microbiological Methods 140:5-11. doi:10.1016 / j.mimet.2017.06.010.

[0133] Wasels F, Chartier G, Hocq R, Lopes Ferreira N. 2020. The CRISPR / Anti-CRISPR Genome Editing Approach Underscores Butanol Dehydrogenase Synthesis in Clostridium acetobutylicum DSM 792. Applied and Environmental Microbiology 86. doi:10.1128 / AEM.00408-20. Petition 870250088213, dated 09 / 29 / 2025, pp. 56 / 77

Claims

1 / 2 CLAIMS 1. Genetically modified bacterium belonging to the genus Clostridium, characterized in that i) it does not express the products of the hbd gene with sequence SEQ ID NO: 39 and the bdhB gene with sequence SEQ ID NO: 36 or expresses non-functional versions thereof, and ii) it expresses the adh gene of C. beijerinckii with sequence SEQ ID NO:

38.

2. Bacteria according to claim 1, characterized in that it does not express the CA_C0764 gene with sequence SEQ ID NO:

37.

3. Bacteria according to claim 1 or 2, characterized in that it is a solventogenic bacterium, preferably C. acetobutylicum.

4. Bacteria according to claim 3, characterized in that it is the IFP970 strain registered on February 17, 2023 under number LMG P-32994 with the BCCM-LMG collection, or a genetically modified version thereof producing a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio higher than that of a Δ hbd strain.

5. Bacteria according to claim 3, characterized in that it is the IFP971 strain registered on February 17, 2023 under number LMG P-32995 with the BCCM-LMG collection or a genetically modified version thereof producing a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio higher than that of a Δ hbd strain.

6. Use of a bacterium, as defined in claim 1, characterized in that it is for obtaining a bacterium, as defined in claim 2.

7. Use of the genetically modified bacteria, as defined in any one of claims 1 to 5, characterized in that it is for producing propan-2-ol or a mixture comprising propan-2-ol and ethanol, preferably on an industrial scale. Petition 870250088213, dated 09 / 29 / 2025, pp. 61 / 77 2 / 2 8. Fermentation process, characterized in that it involves the use of a bacterium, as defined in any one of claims 1 to 5.

9. Kit for the production of propan-2-ol, or a mixture of propan-2-ol and ethanol, with the aid of a bacterium belonging to the genus Clostridium, characterized in that it comprises a genetically modified bacterium belonging to the genus Clostridium, as defined in any one of claims 1 to 5, and a preservation or culture medium for said bacterium.

10. Invention of a product, method, composition, kit or use, characterized by comprising one or more elements disclosed in this patent application. Petition 870250088213, dated 09 / 29 / 2025, pp. 62 / 77