RNAI agent to inhibit the expression of a gene of the hepatitis B virus (HBV), composition comprising the same and uses thereof to treat chronic HBV infection.

Description

RNAi agent to inhibit the expression of a gene of the hepatitis B virus (HBV), composition comprising the same and uses thereof to treat chronic HBV infection. Divided from BR 11 2019 002117 5, deposited on 04 / 08 / 2017. Reference to related Deposit requests

[001] This application claims priority over U.S. Provisional Patent Application Serial No. 62 / 540,639, filed August 3, 2017, U.S. Provisional Patent Application Serial No. 62 / 534,733, filed July 20, 2017, and U.S. Provisional Patent Application Serial No. 62 / 370,754, filed August 4, 2016, the contents of each of which are incorporated herein by reference in their entirety. Field of invention

[002] RNA interference agents (RNAi) for inhibiting hepatitis B virus gene expression, compositions including HBV RNAi agents, and methods of using them are disclosed here. Background

[003] Hepatitis B virus (HBV) is a strict hepatotrophic virus that contains double-stranded DNA. Although DNA is the genetic material, the replication cycle involves a reverse transcription step to copy pre-genomic RNA into the DNA. Hepatitis B virus is classified as a member of the hepadnaviruses and belongs to the Hepadnaviridae family. Primary infection of adult humans with hepatitis B virus causes acute hepatitis with symptoms of organ inflammation, fever, jaundice, and elevated liver transaminases in the blood. Patients who are unable to overcome the viral infection suffer a chronic progression of the disease over many years with an increased risk of developing liver cancer or cirrhotic liver. Perinatal transmission from mothers infected with hepatitis B virus to newborns also leads to chronic hepatitis. Petition 870250071938, dated 08 / 14 / 2025, page 13 / 535 2 / 233

[004] After uptake by hepatocytes, the nucleocapsid is transferred to the nucleus and the DNA is released. There, DNA strand synthesis is completed and gaps repaired to provide the 3.2 kb covalently closed circular (ccc) DNA. The cccDNA serves as a template for transcription of five major viral mRNAs, which are 3.5, 3.5, 2.4, 2.1, and 0.7 kb in length. All mRNAs are capped at the 5' end and polyadenylated at the 3' end. There is sequence overlap at the 3' end between all five mRNAs.

[005] A 3.5 kb mRNA serves as a template for the production of core protein and polymerase. In addition, the same transcript serves as a pregenomic replication intermediate and allows the viral polymerase to initiate reverse transcription into DNA. The core protein is required for nucleocapsid formation. The other 3.5 kb mRNA encodes the precore, secretable e-antigen (HBeAg). In the absence of replication inhibitors, the abundance of e-antigen in the blood correlates with hepatitis B virus replication in the liver and serves as an important diagnostic marker for monitoring disease progression.

[006] The 2.4 and 2.1 kb mRNAs carry the pre-S1, pre-S2, and S open reading frames (ORFs) for the expression of large, medium, and small viral surface antigens. The s-antigen is associated with infectious and complete particles. In addition, the blood of infected patients also contains non-infectious particles derived from the s-antigen alone, devoid of genomic DNA or polymerase. The function of these particles is not fully understood. Complete and lasting depletion of detectable s-antigen in the blood is considered a reliable indicator of hepatitis B virus clearance.

[007] The 0.7 kb mRNA encodes protein X. This gene product is important for the efficient transcription of viral genes and also acts as a transactivator in host gene expression. This latter activity appears to be Petition 870250071938, dated 08 / 14 / 2025, page 14 / 535 3 / 233 important for the transformation of hepatocytes during the development of liver cancer.

[008] Patients with s-antigen, e-antigen, and / or viral DNA in the blood for more than 6 months are considered chronically infected. Nucleoside analogs such as reverse transcriptase inhibitors are typically the first-line treatment for many patients. Administration of lamivudine, tenofovir, and / or entecavir has been shown to suppress hepatitis B virus replication, sometimes to undetectable levels, with improved liver function and reduced liver inflammation typically seen as the most important benefits. However, only a few patients achieve complete and lasting remission after the end of treatment. Furthermore, the hepatitis B virus develops drug resistance with increasing treatment duration. This is especially difficult for patients co-infected with hepatitis B virus and human immunodeficiency virus (HIV). Both viruses are susceptible to nucleoside analog drugs and can develop resistance.

[009] A second treatment option is the administration of interferon-alpha. Here, patients receive high doses of interferon-alpha over a period of 6 months. The Asian B genotype produces very low response rates. Co-infection with hepatitis D virus (HDV) or human immunodeficiency virus has been shown to render interferon-alpha therapy completely ineffective. Patients with severe liver damage and severe fibrotic conditions are not eligible for interferon-alpha therapy.

[010] Certain RNA interference (RNAi) agents specific to the hepatitis B virus have been shown to inhibit HBV gene expression. For example, US patent application publication No. 2013 / 0005793, by Chin et al., which is incorporated herein by reference in its entirety, discloses certain molecules Petition 870250071938, dated 08 / 14 / 2025, p. 15 / 535 4 / 233 of double-stranded ribonucleic acid (dsRNA) to inhibit the expression of the hepatitis B virus gene. Summary

[011] There is a need for novel hepatitis B virus (HBV) specific DNA interfering agents (RNAi) (also referred to herein as RNAi agents, RNAi triggers, or triggers) that are capable of selectively and efficiently inhibiting the expression of a hepatitis B virus (HBV) gene. Additionally, there is a need for combinations of novel HBV-specific RNAi agents for the treatment of HBV infection and prevention of HBV-associated diseases.

[012] Specific HBV RNAi agents are described herein that are capable of selectively and efficiently decreasing the expression of an HBV gene. The HBV RNAi agents described may be used in methods for the treatment and / or prevention of symptoms and diseases associated with HBV infection, including, but not limited to, chronic liver diseases / disorders, inflammations, fibrotic conditions, proliferative disorders (including cancers such as hepatocellular carcinoma), hepatitis D virus (HDV) infection, and acute HBV infection. In some embodiments, HBV RNAi agents may be used in methods for the therapeutic treatment and / or prevention of symptoms and diseases associated with chronic HBV infection and / or HDV infection. Such methods comprise the administration of one or more HBV RNAi agents, as described herein, to an individual, for example, a human or animal individual.

[013] Additionally, compositions comprising one or more of the disclosed HBV RNAi agents capable of selectively and efficiently decreasing the expression of an HBV gene are described herein. Compositions comprising one or more HBV RNAi agents may be administered to an individual as Petition 870250071938, dated 08 / 14 / 2025, p. 16 / 535 5 / 233 a human or animal individual, for the treatment and / or prevention of symptoms and diseases associated with HBV infection.

[014] Each HBV RNAi agent disclosed in the present invention includes at least one sense strand and one antisense strand. The sense strand and the antisense strand may be partially, substantially, or wholly complementary to each other. Each sense and antisense strand of the RNAi agent described herein may be 16 to 30 nucleotides long. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides long. In some embodiments, the sense and antisense strands are independently 19 to 26 nucleotides long. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides long. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotides long. The sense and antisense strands may be of equal or different lengths.The HBV RNAi agents disclosed in the present invention were designed to include antisense strand sequences that are at least partially complementary to a sequence in the HBV genome that is conserved in most known HBV serotypes. The RNAi agents described herein, upon release onto an HBV-expressing cell, inhibit the expression of one or more HBV genes in vivo or in vitro.

[015] An HBV RNAi agent includes a sense strand (also called a passenger strand) that includes a first sequence, and an antisense strand (also called a guide strand) that includes a second sequence. A sense strand of the HBV RNAi agents described herein includes a core stretch that has at least about 85% identity with a nucleotide sequence of at least 16 consecutive nucleotides in an HBV mRNA. In some embodiments, the core nucleotide stretch of the sense strand having at least about 85% identity with a sequence in an HBV mRNA has 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. Petition 870250071938, dated 08 / 14 / 2025, p. 17 / 535 6 / 233 nucleotides in length. An antisense strand of an HBV RNAi agent comprises a nucleotide sequence that has at least about 85% complementarity in a core stretch of at least 16 consecutive nucleotides with a sequence in an HBV mRNA and the corresponding sense strand. In some embodiments, the antisense strand's core nucleotide sequence has at least about 85% complementarity with a sequence in an HBV mRNA or the corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[016] Examples of sense and antisense strands of the HBV RNAi agent that can be used in RBV RNAi agents are provided in Tables 3 and 4. Examples of HBV RNAi agent doublets are provided in Table 5. Examples of 19-nucleotide core sequence stretches that consist of or are included in the sense and antisense strands of the HBV RNAi agents disclosed in the present invention are provided in Table 2.

[017] In some embodiments, one or more HBV RNAi agents are delivered to target cells or target tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, proteinaceous vectors, or dynamic polyconjugates (DPCs) (see, for example, WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, each of which is incorporated herein by reference). In some modalities, an HBV RNAi agent is released to target cells or target tissues by covalent binding of the RNAi agent to a targeting group.In some embodiments, the targeting group may include a cell receptor ligand, such as an asialoglycoprotein receptor ligand. Petition 870250071938, dated 08 / 14 / 2025, p. 18 / 535 7 / 233 (ASGPr). In some embodiments, an ASGpr ligand includes or consists of a galactose-derived cluster. In some embodiments, a galactose-derived cluster includes an N-acetylgalactosamine trimer or an N-acetylgalactosamine tetramer. In some embodiments, a galactose-derived cluster is an N-acetylgalactosamine trimer or an N-acetylgalactosamine tetramer.

[018] A targeting group can be attached to the 3' or 5' end of a sense strand or an antisense strand of an HBV RNAi agent. In some embodiments, a targeting group is connected to the 3' or 5' end of the sense strand. In some embodiments, a targeting group is connected to the 5' end of the sense strand. In some embodiments, a targeting group is connected to the RNAi agent via a connector.

[019] A steering group, with or without a connector, may be attached to the 5' or 3' end of any of the sense and / or antisense tapes disclosed in Tables 2, 3 and 4. A connector, with or without a steering group, may be attached to the 5' or 3' end of any of the sense and / or antisense tapes disclosed in Tables 2, 3 and 4.

[020] In some embodiments, compositions are described here that include one or more HBV RNAi agents that have the duplex sequences revealed in Table 5.

[021] In some embodiments, compositions are described here that include a combination or cocktail of at least two HBV RNAi agents having different nucleotide sequences. In some embodiments, the two or more different HBV RNAi agents are each separately and independently linked to targeting groups. In some embodiments, the two or more different HBV RNAi agents are each linked to targeting groups comprising N-acetylgalactosamines. In some embodiments, when two Petition 870250071938, dated 08 / 14 / 2025, p. 19 / 535 8 / 233 or more RNAi agents are included in a composition, each of the RNAi agents is linked to the same targeting group. In some embodiments, when two or more RNAi agents are included in a composition, each of the RNAi agents is linked to different targeting groups, such as targeting groups with different chemical structures.

[022] In some embodiments, targeting groups are linked to RBV RNAi agents without the use of an additional connector. In some embodiments, the targeting group is designed having a readily available connector to facilitate binding to an HBV RNAi agent. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents may be linked to targeting groups using the same connectors. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents are linked to targeting groups using different connectors.

[023] In some embodiments, compositions are described herein that include a combination of at least two HBV RNAi agents having different sequences, each HBV RNAi agent targeting a different site or region of an HBV gene. In some embodiments, compositions are described herein that include a combination of at least two HBV RNAi agents, each HBV RNAi agent designed to target a different HBV transcript (for example, a composition that includes two HBV RNAi agents, the first HBV RNAi agent including an antisense strand that is at least partially complementary to a nucleotide sequence located in the S ORF of an HBV gene, while the second HBV RNAi agent includes an antisense strand that is at least partially complementary to a nucleotide sequence located in the X ORF of an HBV gene). As used herein, an agent Petition 870250071938, dated 08 / 14 / 2025, p. 20 / 535 9 / 233 of RNAi that includes an antisense strand at least partially complementary to a nucleotide sequence located in ORF S targets a portion of the HBV genome from SEQ ID NO: 1 between positions 1 to 1307 and 3185 to 3221. As used in the present invention, an RNAi agent that includes an antisense strand at least partially complementary to a nucleotide sequence located in ORF X targets a portion of the HBV genome from SED ID NO: 1 between positions 1308 to 1930.

[024] HBV mRNA is known to be polycistronic, resulting in the translation of multiple polypeptides, and separating mRNAs with overlapping RNA sequences, therefore a single RNAi agent targeting the HBV gene can result in the inhibition of all or almost all HBV transcripts.However, without wishing to adhere to any particular theory, it is hypothesized that a composition that includes two or more HBV RNAi agents targeting different sites or regions of an HBV gene (and in particular, two more HBV RNAi agents, one targeting ORF S and a second targeting ORF X) may provide additional advantages over a composition that includes only a single HBV RNAi agent, such as (a) ensuring that all HBV viral transcripts are targeted (i.e., 3.5 kb pregenomic RNA; 3.5 kb pre-core mRNA; 2.4 kb pre-S1 mRNA; and 2.1 kb preS2 / S mRNA; 0.7 kb X mRNA; as well as any mRNAs expressing the s-antigen produced from integrated HBV DNA); (b) serving to expand genotype coverage to potentially treat a larger patient population; and / or (c) potentially decreasing viral resistance due to mutations in the siRNA binding site.

[025] In some embodiments, compositions are described here that include a combination of an HBV RNAi agent that targets the S ORF of an HBV RNA (i.e., having an antisense strand that targets the S transcripts (S, pre-S1, Petition 870250071938, dated 08 / 14 / 2025, p. 21 / 535 10 / 233 and pre-S2), the pregenomic RNA (core and polymerase) and the pre-core transcripts (HBeAg) of an HBV genome), and an HBV RNAi agent that targets the X ORF of an HBV RNA (i.e., that has an antisense strand that targets the X transcript of an HBV genome, the S transcripts (S, pre-S1, and pre-S2), the pregenomic RNA (core and polymerase) and the pre-core transcripts (HBeAg) of an HBV genome). In some embodiments, the compositions described herein include at least one HBV RNAi agent containing a sequence that targets the S ORF of an HBV gene, and a second HBV RNAi agent containing a sequence that targets the X ORF of an HBV gene.

[026] Methods for inhibiting the expression of an HBV gene are disclosed in the present invention, and the method comprises administering one or more HBV RNAi agents having an antisense strand comprising the sequence of any of the sequences in Table 3.

[027] Methods for inhibiting the expression of an HBV gene are disclosed in the present invention, and the method comprises administering one or more HBV RNAi agents having a sense strand comprising the sequence of any of the sequences in Table 4.

[028] The present invention discloses methods for inhibiting the expression of an HBV gene, wherein the method comprises administering one or more HBV RNAi agents having an antisense strand comprising the sequence of any of the sequences in Table 3, and a sense strand comprising the sequence of any of the sequences in Table 4 that is at least partially complementary to the antisense strand.

[029] Methods for inhibiting the expression of an HBV gene are disclosed in the present invention, and the method comprises administering one or more HBV RNAi agents having an antisense strand consisting of the sequence of any of the Petition 870250071938, dated 08 / 14 / 2025, p. 22 / 535 11 / 233 sequences in Table 3, and a sense strip consisting of any sequence from Table 4 that is at least partially complementary to the antisense strip.

[030] The present invention discloses methods for inhibiting the expression of an HBV gene in a cell, wherein the method comprises administering one or more HBV RNAi agents having the duplex structure of Table 5.

[031] The present invention discloses methods for treating an HBV infection or for preventing disease or symptoms caused by an HBV infection, wherein the method comprises administering one or more HBV RNAi agents having an antisense strand comprising the sequence of any of the sequences in Table 3.

[032] The present invention discloses methods for treating an HBV infection or for preventing disease or symptoms caused by an HBV infection, wherein the method comprises administering one or more HBV RNAi agents having a sense strand comprising the sequence of any of the sequences in Table 4.

[033] The present invention discloses methods for treating an HBV infection or preventing disease or symptoms caused by an HBV infection, wherein the method comprises administering one or more HBV RNAi agents having an antisense strand comprising the sequence of any of the sequences in Table 3, and a sense strand comprising the sequence of any of the sequences in Table 4 that is at least partially complementary to the antisense strand.

[034] The present invention discloses methods for treating an HBV infection or preventing disease or symptoms caused by an HBV infection, wherein the method comprises administering one or more HBV RNAi agents having an antisense strand consisting of the sequence of any of Petition 870250071938, dated 08 / 14 / 2025, p. 23 / 535 12 / 233 sequences in Table 3, and a sense strip consisting of any sequence in Table 4 that is at least partially complementary to the antisense strip.

[035] The present invention discloses methods for treating an HBV infection or preventing disease or symptoms caused by an HBV infection, wherein the method comprises administering one or more HBV RNAi agents having the duplex structure of Table 5.

[036] Methods for inhibiting the expression of an HBV gene are disclosed in the present invention, and the method comprises administering (i) an HBV RNAi agent having an antisense strand comprising or consisting of any of the sequences in Table 2 or Table 3, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of any of the sequences in Table 2 or Table 3.

[037] The present invention discloses methods for treating an HBV infection or preventing disease or symptoms caused by an HBV infection, wherein the method comprises administering (i) an HBV RNAi agent having an antisense strand comprising or consisting of any of the sequences in Table 2 or Table 3, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of any of the sequences in Table 2 or Table 3.

[038] The present invention discloses methods for inhibiting the expression of an HBV gene, wherein the method comprises administering (i) a first HBV RNAi agent having an antisense strand comprising or consisting of any of the sequences in Table 2 or Table 3, and a sense strand comprising or consisting of any of the sequences in Table 2 or Table 4 that is at least partially complementary to the antisense strand of the first HBV RNAi agent, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of any of the sequences Petition 870250071938, dated 08 / 14 / 2025, p. 24 / 535 13 / 233 in Table 2 or Table 3, and a sense strand comprising or consisting of any of the sequences in Table 2 or Table 4 that is at least partially complementary to the antisense strand of the second HBV RNAi agent.

[039] The present invention discloses methods for treating an HBV infection or preventing disease or symptoms caused by an HBV infection, wherein the method comprises administering (i) a first HBV RNAi agent having an antisense strand comprising or consisting of any of the sequences in Table 2 or Table 3, and a sense strand comprising or consisting of any of the sequences in Table 2 or Table 4 that is at least partially complementary to the antisense strand of the first HBV RNAi agent, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of any of the sequences in Table 2 or Table 3, and a sense strand comprising or consisting of any of the sequences in Table 2 or Table 4 that is at least partially complementary to the antisense strand of the second HBV RNAi agent.

[040] In some embodiments, an HBV RNAi agent disclosed in the present invention comprises: a. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AUUGAGAGAAGUCCACCAC (SED ID NO: 7), and a sense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUggUggacUUcUcUcaaU (SEQ ID NO: 34); or b. an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UUUGAGAGAAGUCCACCAC (SED ID NO: 8), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUggUggacUUcUcUcaaA (SEQ ID NO: 35); or Petition 870250071938, dated 08 / 14 / 2025, p. 25 / 535 14 / 233 c. an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or d. an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40); or e. an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or f. an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45); or g. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') ACCAAUUUAUGCCUACAGC (SEQ ID NO: 22), and a sense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 49); or h. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the (5'^3') sequence Petition 870250071938, dated 08 / 14 / 2025, page 26 / 535 15 / 233 UCCAAUUUAUGCCUACAGC (SEQ ID NO: 23), and a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 50); or i. an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or j. an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or k. an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56). [0 41] In some embodiments, compositions are disclosed herein for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises an HBV RNAi agent. [0 42] In some embodiments, compositions for inhibiting HBV gene expression in a cell are disclosed herein, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises: i) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AAUUGAGAGAAGUCCACCA Petition 870250071938, dated 08 / 14 / 2025, page 27 / 535 16 / 233 (SEQ ID NO: 12), and a sense tape comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or ii) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40); and with a second HBV RNAi agent comprising: i) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or ii) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or iii) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

[043] In some embodiments, compositions for inhibiting HBV gene expression in a cell are disclosed herein, the composition comprising Petition 870250071938, dated 08 / 14 / 2025, page 28 / 535 17 / 233 two or more HBV RBAi agents, with a first HBV RNAi agent comprising: i) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or ii) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45); and with a second HBV RNAi agent comprising: i) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or ii) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or iii) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a sense strand comprising the Petition 870250071938, dated 08 / 14 / 2025, page 29 / 535 18 / 233 nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

[044] In some embodiments, compositions are disclosed herein for inhibiting HBV gene expression in a cell, wherein the composition comprises two or more HBV RBAi agents, wherein a first HBV RNAi agent comprises: i) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or ii) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40); and whereby a second HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to a portion of the ORF X of an HBV mRNA.

[045] In some embodiments, compositions are disclosed herein for inhibiting HBV gene expression in a cell, wherein the composition comprises two or more HBV RBAi agents, wherein a first HBV RNAi agent comprises: i) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a sense strand comprising the nucleobase sequence that Petition 870250071938, dated 08 / 14 / 2025, p. 30 / 535 19 / 233 differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or ii) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45); and whereby a second HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to a portion of the ORF X of an HBV mRNA:

[046] In some embodiments, compositions are disclosed herein for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to a portion of the ORF S of an HBV mRNA, and wherein a second HBV RNAi agent comprises: i) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or ii) an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a sense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or Petition 870250071938, dated 08 / 14 / 2025, page 31 / 535 20 / 233 iii) an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the (5'^3') sequence UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56). [04 7] In some embodiments, an HBV RNAi agent disclosed in the present invention comprises: a. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the (5'^3') sequence UACCAAUUUAUGCCUACAGGCCUUAU (SEQ ID NO: 149); or b. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the (5'^3') sequence UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150); or c. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the (5'^3') sequence UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 151); or d. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the (5'^3') sequence UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 152); or e. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154); or f. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUUGAGAGAAGUCCACCACG (SEQ ID NO: 160); or Petition 870250071938, dated 08 / 14 / 2025, p. 32 / 535 21 / 233 g. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162); or h. an antisense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163); or I. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 170); or j. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171); or k. an antisense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 172); or l. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 173); or m. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 174); or n. an antisense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175); or o. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 178); or Petition 870250071938, dated 08 / 14 / 2025, p. 33 / 535 22 / 233 p. an antisense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCACUU (SEQ ID NO: 179); or q. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO: 180); or r. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 181); or s. an antisense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 182); or t. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 183); or u. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 184); or v. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the (5'^3') sequence UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 185); or w. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 186); or x. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 187); or Petition 870250071938, dated 08 / 14 / 2025, page 34 / 535 23 / 233 y. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188); or z. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO: 189); or aa. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 190); or bb. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 191); or cc. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 192); or dd. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 193); or ee.an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 194); and whereby the HBV RNAi agent further comprises a sense strand that is at least partially complementary to its antisense strand.

[048] In some embodiments, an HBV RNAi agent disclosed in the present invention comprises: Petition 870250071938, dated 08 / 14 / 2025, p. 35 / 535 24 / 233 a. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGGCCUUAU (SEQ ID NO: 149); or b. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150); or c. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 151); or d. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 152); or e. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154); or f. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUUGAGAGAAGUCCACCACG (SEQ ID NO: 160); or g. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162); or h. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163); or I. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 170); or Petition 870250071938, dated 08 / 14 / 2025, p. 36 / 535 25 / 233 j. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171); or k. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 172); or l. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 173); or m. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 174); or n. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175); or o. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 178); or p. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCACUU (SEQ ID NO: 179); or q. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO: 180); or r. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 181); or Petition 870250071938, dated 08 / 14 / 2025, p. 37 / 535 26 / 233 s. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 182); or t. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 183); or u. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 184); or v. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 185); or w. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 186); or x. an antisense ribbon consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 187); or y. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188); or z. an antisense strand consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO: 189); or aa. an antisense strand consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 190); or Petition 870250071938, dated 08 / 14 / 2025, page 38 / 535 27 / 233 bb. an antisense strand consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 191); or cc. an antisense strand consisting of a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 192); or dd. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 193); or. ee. an antisense ribbon consisting of the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 194); and whereby the HBV RNAi agent further comprises a sense strand that is at least partially complementary to its antisense strand.

[049] In some embodiments, an HBV RNAi agent disclosed in the present invention comprises: i. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfccsusuAu (SEQ ID NO: 61); or ii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfcscsu (SEQ ID NO: 62); or iii. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfccsu (SEQ ID NO: 63); or Petition 870250071938, dated 08 / 14 / 2025, page 39 / 535 28 / 233 iv. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc (SEQ ID NO: 64); or v. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 68); or vi. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscscaauUfuAfuGfcCfuacagcsc (SEQ ID NO: 85); or vii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfsusugagAfgAfaGfuCfcaccacsg (SEQ ID NO: 94); or viii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgsa (SEQ ID NO: 98); or ix. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgcsc (SEQ ID NO: 102); or x. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgcusu (SEQ ID NO: 103); or xi. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgccsu (SEQ ID NO: 104); or xii. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgccusu (SEQ ID NO: 105); or Petition 870250071938, dated 08 / 14 / 2025, page 40 / 535 29 / 233 xiii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 107); or xiv. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') cPrpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg (SEQ ID NO: 108); or xv. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfausu (SEQ ID NO: 109); or xvi. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsg (SEQ ID NO: 110); or xvii. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsusu (SEQ ID NO: 111); or xviii.an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsgsa (SEQ ID NO: 112); or xix. an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacusu (SEQ ID NO: 120); or xx. an antisense ribbon comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 125);. xxi. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 126); or Petition 870250071938, dated 08 / 14 / 2025, page 41 / 535 30 / 233 xxii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu (SEQ ID NO: 127); or xxiii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc (SEQ ID NO: 128); or xxiv. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 129); or xxv. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 130); or xxvi. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO: 131); or xxvii.an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 132); or xxviii. an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusc (SEQ ID NO: 133); or xxix. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO: 134); or xxx. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 135); or. Petition 870250071938, dated 08 / 14 / 2025, page 42 / 535 31 / 233 xxxi. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 136); or xxxii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 137); or xxxiii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 138); or xxxiv. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsu (SEQ ID NO: 139); or xxxv. an antisense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140); or xxxvi.an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') asAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 141); or xxxvii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuUfUfAfuGfcCfuAfcAfgusu (SEQ ID NO: 142); or xxxviii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgCfsc (SEQ ID NO: 143); or xxxix. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') asCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 144); or. Petition 870250071938, dated 08 / 14 / 2025, page 43 / 535 32 / 233 xl. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 145); or xli. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') asCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 146); or xlii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 147); or xliii. an antisense strand comprising a sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsg (SEQ ID NO: 148); wherein a, g, ceu are nucleotides modified with 2'-O-methyl (2'-OMe); Af, Cf, Gf, and Uf are nucleotides modified with 2'-fluoro; s is a phosphorothiate internucleotide linkage and the remaining nucleotide monomers are linked by phosphodiester bonds; and cPrpu is a nucleotide modified with 5'-cyclopropylphosphate-2'-O-methyl; and wherein the HBV RNAi agent further comprises a sense strand at least partially complementary to the respective antisense strand.

[050] In some embodiments, an HBV RNAi agent disclosed in the present invention comprises: i. an antisense tape consisting of the sequence (5'^3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfccsusuAu (SEQ ID NO: 61); or ii. an antisense tape consisting of the sequence (5'^3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfcscsu (SEQ ID NO: 62); or iii. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfccsu (SEQ ID NO: 63); or Petition 870250071938, dated 08 / 14 / 2025, page 44 / 535 33 / 233 iv. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc (SEQ ID NO: 64); or v. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 68); or vi. an antisense tape consisting of the sequence (5'^3') usAfscscaauUfuAfuGfcCfuacagcsc (SEQ ID NO: 85); or vii. an antisense tape consisting of the sequence (5'^3') usAfsusugagAfgAfaGfuCfcaccacsg (SEQ ID NO: 94); or viii. an antisense tape consisting of the sequence (5'^3') usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgsa (SEQ ID NO: 98); or ix. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgcsc (SEQ ID NO: 102); or x. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgcusu (SEQ ID NO: 103); or xi. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgccsu (SEQ ID NO: 104); or xii. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgccusu (SEQ ID NO: 105); or xiii. an antisense tape consisting of the sequence (5'^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 107); or xiv. an antisense tape consisting of the sequence (5'^3') cPrpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg (SEQ ID NO: 108); or xv. an antisense tape consisting of the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfausu (SEQ ID NO: 109); or xvi. an antisense tape consisting of the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsg (SEQ ID NO: 110); or Petition 870250071938, dated 08 / 14 / 2025, p. 45 / 535 34 / 233 xvii. an antisense tape consisting of the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsusu (SEQ ID NO: 111); or xviii. an antisense tape consisting of the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsgsa (SEQ ID NO: 112); or xix. an antisense tape consisting of the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacusu (SEQ ID NO: 120); or xx. an antisense tape consisting of the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 125); xxi. an antisense tape consisting of the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 126); or xxii. an antisense tape consisting of the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu (SEQ ID NO: 127); or xxiii. an antisense tape consisting of the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc (SEQ ID NO: 128); or xxiv. an antisense tape consisting of the sequence (5'^3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 129); or xxv. an antisense tape consisting of the sequence (5'^3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 130); or xxvi. an antisense tape consisting of the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO: 131); or xxvii. an antisense tape consisting of the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 132); or xxviii. an antisense tape consisting of the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusc (SEQ ID NO: 133); or xxix. an antisense tape consisting of the sequence (5'^3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO: 134); or Petition 870250071938, dated 08 / 14 / 2025, p. 46 / 535 35 / 233 xxx. an antisense tape consisting of the sequence (5'^3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 135); or xxxi. an antisense tape consisting of the sequence (5'^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 136); or xxxii. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 137); or xxxiii. an antisense tape consisting of the sequence (5'^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 138); or xxxiv. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsu (SEQ ID NO: 139); or xxxv. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140); or xxxvi. an antisense tape consisting of the sequence (5'^3') asAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 141); or xxxvii. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuUfUfAfuGfcCfuAfcAfgusu (SEQ ID NO: 142); or xxxviii.a nonsense tape consisting of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgCfsc (SEQ ID NO: 143); or xxxix. a nonsense tape consisting of the sequence (5'^3') asCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 144); or xl. a nonsense tape consisting of the sequence (5'^3') usCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 145); or xli. a nonsense tape consisting of the sequence (5'^3') asCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 146); or xlii. an antisense tape consisting of the sequence (5'^3') usCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 147); or. Petition 870250071938, dated 08 / 14 / 2025, page 47 / 535 36 / 233 xliii. an antisense tape consisting of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsg (SEQ ID NO: 148); wherein a, g, ceu are nucleotides modified with 2'-O-methyl (2'-OMe); Af, Cf, Gf, and Uf are nucleotides modified with 2'-fluoro; s is a phosphorothiate internucleotide linkage and the remaining nucleotide monomers are linked by phosphodiester bonds; and cPrpu is a nucleotide modified with 5'-cyclopropylphosphate-2'-O-methyl; and wherein the HBV RNAi agent further comprises a sense strand at least partially complementary to the respective antisense strand.

[051] In some embodiments, an HBV RNAi agent disclosed in the present invention comprises: a. a sense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UUGCCUGUAGGCAUAAAUUGGUAUT (SEQ ID NO: 275); or b. a sense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UAUAUGCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 276); or c. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 278); or d. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 285); or e. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CGUGGUGGACUUCUCUCAAUA (SEQ ID NO: 289); or Petition 870250071938, dated 08 / 14 / 2025, page 48 / 535 37 / 233 f. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292); or g. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294); or h. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UCGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 300); or i. a sense tape comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); or j. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 303); or k. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 304); or l. a sense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 306); or m. a sense tape comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5ↆ3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); or n. a sense tape comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AAUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 308); or Petition 870250071938, dated 08 / 14 / 2025, p. 49 / 535 38 / 233 o. a sense tape comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 318); or p. a sense tape comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 319); or q. a sense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320); or r. a sense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCA (SEQ ID NO: 321); or s. a sense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322); or t. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 323); or u. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GAGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 324); or v. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325); or w. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 326); or Petition 870250071938, dated 08 / 14 / 2025, page 50 / 535 39 / 233 x. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 327); or y. a sense ribbon comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328); or z. a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGUU (SEQ ID NO: 329); or aa. an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 330); or bb. a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 331); or cc. a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 332); or dd. a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 333); or ee. a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 334); and whereby the HBV RNAi agent additionally comprises an antisense strand that is at least partially complementary to the respective antisense strand. Petition 870250071938, dated 08 / 14 / 2025, p. 51 / 535 40 / 233

[052] In some embodiments, an HBV RNAi agent disclosed in the present invention comprises: a. a sense tape consisting of the nucleobase sequence (5'^3') UUGCCUGUAGGCAUAAAUUGGUAUT (SEQ ID NO: 275); or b. a sense tape consisting of the nucleobase sequence (5'^3') UAUAUGCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 276); or c. a sense tape consisting of the nucleobase sequence (5'^3') CUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 278); or d. a sense tape consisting of the nucleobase sequence (5'^3') CGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 285); or e. a sense tape consisting of the nucleobase sequence (5'^3') CGUGGUGGACUUCUCUCAAUA (SEQ ID NO: 289); or f. a sense tape consisting of the nucleobase sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292); or g. a sense tape consisting of the nucleobase sequence (5'^3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294); or h. a sense tape consisting of the nucleobase sequence (5'^3') UCGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 300); or I. a sense tape consisting of the nucleobase sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); or j. a sense tape consisting of the nucleobase sequence (5'^3') GCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 303); or k. a sense tape consisting of the nucleobase sequence (5'^3') GGCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 304); or l. a sense tape consisting of the nucleobase sequence (5'^3') UGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 306); or Petition 870250071938, dated 08 / 14 / 2025, p. 52 / 535 41 / 233 m. a sense ribbon consisting of the nucleobase sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); or n. a sense tape consisting of the nucleobase sequence (5'^3') AAUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 308); or o. a sense ribbon comprising the nucleobase sequence (5'^3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 318); or p. a sense tape consisting of the nucleobase sequence (5'^3') GGUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 319); or q. a sense ribbon consisting of the nucleobase sequence (5'^3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320); or r. a sense ribbon consisting of the nucleobase sequence (5'^3') GUGGACUUCUCUCAAUUUUCA (SEQ ID NO: 321); or s. a sense tape consisting of the nucleobase sequence (5'^3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322); or t. a sense tape consisting of the nucleobase sequence (5'^3') GGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 323); or u. a sense ribbon consisting of the nucleobase sequence (5'^3') GAGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 324); or v. a sense ribbon consisting of the nucleobase sequence (5'^3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325); or w. a sense ribbon consisting of the nucleobase sequence (5'^3') GGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 326); or x. a sense ribbon consisting of the nucleobase sequence (5'^3') AGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 327); or y. a sense ribbon consisting of the nucleobase sequence (5'^3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328); or Petition 870250071938, dated 08 / 14 / 2025, page 53 / 535 42 / 233 z. a sense strand consisting of the nucleobase sequence (5'^3') GGCUGUAGGCAUAAAUUGGUU (SEQ ID NO: 329); or aa. an antisense strand that comprises the nucleobase sequence (5'^3') AGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 330); or bb. a sense strand consisting of the nucleobase sequence (5'^3') AGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 331); or cc. a sense strand consisting of the nucleobase sequence (5'^3') CGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 332); or dd. a sense strand consisting of the nucleobase sequence (5'^3') CGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 333); or ee. a sense tape consisting of the nucleobase sequence (5'^3') CCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 334); and whereby the HBV RNAi agent additionally comprises an antisense strand that is at least partially complementary to the respective antisense strand.

[053] In some embodiments, compositions are disclosed herein for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the (5'^3') sequence. Whereas a second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein a second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292). Petition 870250071938, dated 08 / 14 / 2025, page 54 / 535 43 / 233

[054] In some embodiments, compositions are disclosed herein for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'^3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense strand consisting of the nucleobase sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and whereby a second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'^3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand consisting of the nucleobase sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).

[055] In some embodiments, compositions are disclosed herein for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and whereby a second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).

[056] In some embodiments, compositions for inhibiting the expression of an HBV gene in a cell are disclosed herein, the composition comprising Petition 870250071938, dated 08 / 14 / 2025, p. 55 / 535 44 / 233 two HBV RNAi agents, with a first HBV RNAi agent comprising an antisense strand consisting of the nucleobase sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand consisting of the nucleobase sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'^3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a sense strand consisting of the nucleobase sequence (5'^3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).

[057] In some embodiments, compositions are disclosed herein for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the (5'^3') sequence. AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294).

[058] In some embodiments, compositions are disclosed herein for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand consisting Petition 870250071938, dated 08 / 14 / 2025, p. 56 / 535 45 / 233 in the nucleobase sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand consisting of the nucleobase sequence (5'^3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294).

[059] In some embodiments, compositions are disclosed herein for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the (5'^3') sequence. AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and with a second HBV RNAi agent comprising an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).

[060] In some embodiments, compositions are disclosed herein for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand consisting of the nucleobase sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and a second HBV RNAi agent comprising an antisense strand consisting of the nucleobase sequence (5'^3') Petition 870250071938, dated 08 / 14 / 2025, p. 57 / 535 46 / 233 UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense ribbon consisting of nucleobase sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SED ID NO: 307).

[061] In some embodiments, the present invention discloses compositions for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in the sense strand are modified and / or all or substantially all nucleotides in the antisense strand in the first and / or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the (5'^3') sequence. Whereas the second agent comprises an antisense RNAi hepatitis B virus comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein the second agent comprises an antisense RNAi hepatitis B virus comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGUU (SED ID NO: 154), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).

[062] In some embodiments, the present invention discloses compositions for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in the sense strand are modified and / or all or substantially all nucleotides in the antisense strand in the first and / or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the (5'^3') sequence. Petition 870250071938, dated 08 / 14 / 2025, page 58 / 535 47 / 233 AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and the second agent comprising an antisense RNAi hepatitis B virus comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).

[063] In some embodiments, the present invention discloses compositions for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in the sense strand are modified and / or all or substantially all nucleotides in the antisense strand in the first and / or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302);and whereby the second agent comprises an antisense RNAi hepatitis B virus comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294). Petition 870250071938, dated 08 / 14 / 2025, page 59 / 535 48 / 233

[064] In some embodiments, the present invention discloses compositions for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in the sense strand are modified and / or all or substantially all nucleotides in the antisense strand in the first and / or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the (5'^3') sequence. AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and with the second agent comprising an antisense RNAi hepatitis B virus comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).

[065] In some embodiments, the present invention discloses compositions for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in the sense strand are modified and / or all or substantially all nucleotides in the antisense strand in the first and / or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the (5'^3') sequence. UAUUGAGAGAAGUCCACCACUU (SED ID NO: 175), and a sense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2, or 3 nucleobases from Petition 870250071938, dated 08 / 14 / 2025, p. 60 / 535 49 / 233 sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein the second agent comprises an antisense RNAi hepatitis B virus comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292), and wherein the sense strand of the first HBV RNAi agent and the sense strand of the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetylgalactosamine.

[066] In some embodiments, the present invention discloses compositions for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in the sense strand are modified and / or all or substantially all nucleotides in the antisense strand in the first and / or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302);and wherein the second agent comprises an antisense RNAi hepatitis B virus comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328), and wherein the sense strand of the first HBV RNAi agent and the sense strand of the; Petition 870250071938, dated 08 / 14 / 2025, page 61 / 535 50 / 233 second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetylgalactosamine.

[067] In some embodiments, the present invention discloses compositions for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in the sense strand are modified and / or all or substantially all nucleotides in the antisense strand in the first and / or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the (5'^3') sequence. AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense ribbon comprising the sequence of nucleobases that differs by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and with the second agent comprising an antisense RNAi hepatitis B virus comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294), wherein the sense strand of the first HBV RNAi agent and the sense strand of the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetylgalactosamine.

[068] In some embodiments, the present invention discloses compositions for inhibiting the expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in the sense strand are modified and / or all or substantially all nucleotides in the antisense strand in the first and / or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent Petition 870250071938, dated 08 / 14 / 2025, page 62 / 535 51 / 233 comprises an antisense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand comprising the nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and with the second agent comprising an antisense RNAi hepatitis B virus comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307), wherein the sense strand of the first HBV RNAi agent and the sense strand of the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetylgalactosamine.

[069] In some embodiments, methods of treating an HBV infection or preventing disease or symptoms caused by an HBV infection are disclosed in the present invention, comprising administering to an individual in need of such treatment an effective amount of AD04872 and an effective amount of AD05070. In some embodiments, the ratio between AD04872 and AD05070 administered to an individual in need is about 2:1. In some embodiments, the ratio between AD04872 and AD05070 administered to an individual in need is about 3:1. In some embodiments, the ratio between AD04872 and AD05070 administered to an individual in need is about 1:1. In some embodiments, the ratio between AD04872 and AD05070 administered to an individual in need is about 4:1. In some modalities, the ratio between AD04872 and AD05070 administered to an individual who needs it is approximately 5:1.In some modalities, the ratio between AD04872 and AD05070 administered to an individual who needs it is approximately 1:2. Petition 870250071938, dated 08 / 14 / 2025, p. 63 / 535 52 / 233

[070] In some embodiments, approximately 1 mg / kg (mpk) of AD04872 and approximately 1 mg / kg of AD05070 are administered to an individual who needs them. In some embodiments, approximately 1.5 mg / kg of AD04872 and approximately 1.5 mg / kg of AD05070 are administered to an individual who needs them. In some embodiments, approximately 2.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD05070 are administered to an individual who needs them. In some embodiments, approximately 3.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD05070 are administered to an individual who needs them. In some embodiments, approximately 3.2 mg / kg of AD04872 and approximately 0.8 mg / kg of AD05070 are administered to an individual who needs them. In some modalities, approximately 2.7 mg / kg of AD04872 and approximately 1.3 mg / kg of AD05070 are administered to an individual who needs them.In some embodiments, approximately 4.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD05070 are administered to an individual who needs them. In some embodiments, approximately 3.3 mg / kg of AD04872 and approximately 1.7 mg / kg of AD05070 are administered to an individual who needs them. In some embodiments, between approximately 0.05 and approximately 5 mg / kg of AD04872 and between approximately 0.05 and approximately 5 mg / kg of AD05070 are administered to an individual who needs them. In some embodiments, approximately AD04872 and approximately AD05070 are administered separately (e.g., in separate injections). In some embodiments, the respective dose of AD04872 and the respective dose of AD05070 are administered together (e.g., in the same injection). In some embodiments, the respective dose of AD04872 and the respective dose of AD05070 are prepared in a single pharmaceutical composition.

[071] In some embodiments, methods of treating an HBV infection or preventing disease or symptoms caused by an HBV infection are disclosed in the present invention, comprising administering to an individual in need of such treatment an effective amount of AD04872 and a Petition 870250071938, dated 08 / 14 / 2025, p. 64 / 535 53 / 233 effective amount of AD04776. In some modalities, the ratio between AD04872 and AD04776 administered to an individual who needs it is approximately 2:1. In some modalities, the ratio between AD04872 and AD04776 administered to an individual who needs it is approximately 3:1. In some modalities, the ratio between AD04872 and AD04776 administered to an individual who needs it is approximately 4:1. In some modalities, the ratio between AD04872 and AD04776 administered to an individual who needs it is approximately 1:1. In some modalities, the ratio between AD04872 and AD04776 administered to an individual who needs it is approximately 5:1. In some modalities, the ratio between AD04872 and AD04776 administered to an individual who needs it is approximately 1:2.

[072] In some embodiments, approximately 1 mg / kg (mpk) of AD04872 and approximately 1 mg / kg of AD04776 are administered to an individual who needs them. In some embodiments, approximately 1.5 mg / kg of AD04872 and approximately 1.5 mg / kg of AD04776 are administered to an individual who needs them. In some embodiments, approximately 2.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD04776 are administered to an individual who needs them. In some embodiments, approximately 3.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD04776 are administered to an individual who needs them. In some embodiments, approximately 3.2 mg / kg of AD04872 and approximately 0.8 mg / kg of AD04776 are administered to an individual who needs them. In some modalities, approximately 2.7 mg / kg of AD04872 and approximately 1.3 mg / kg of AD04776 are administered to an individual who needs them.In some embodiments, approximately 4.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD04776 are administered to an individual who needs them. In some embodiments, approximately 3.3 mg / kg of AD04872 and approximately 1.7 mg / kg of AD04776 are administered to an individual who needs them. In some embodiments, between approximately 0.05 and approximately 5 mg / kg of AD04872 and between approximately 0.05 and approximately 5 mg / kg of AD04776 are administered. Petition 870250071938, dated 08 / 14 / 2025, p. 65 / 535 54 / 233 administered to an individual who needs them. In some embodiments, the respective doses of AD04872 and AD04776 are administered separately (e.g., in separate injections). In some embodiments, the respective doses of AD04872 and AD04776 are administered together (e.g., in the same injection). In some embodiments, the respective doses of AD04872 and AD04776 are prepared in a single pharmaceutical composition.

[073] In some embodiments, methods of treating an HBV infection or preventing disease or symptoms caused by an HBV infection are disclosed in the present invention, comprising administering to an individual in need of such treatment an effective amount of AD04872 and an effective amount of AD04982. In some embodiments, the ratio between AD04872 and AD04982 administered to an individual in need is about 2:1. In some embodiments, the ratio between AD04872 and AD04982 administered to an individual in need is about 3:1. In some embodiments, the ratio between AD04872 and AD04982 administered to an individual in need is about 4:1. In some embodiments, the ratio between AD04872 and AD04982 administered to an individual in need is about 1:1. In some modalities, the ratio between AD04872 and AD04982 administered to an individual who needs it is approximately 5:1.In some modalities, the ratio between AD04872 and AD04982 administered to an individual who needs it is approximately 1:2.

[074] In some embodiments, approximately 1 mg / kg (mpk) of AD04872 and approximately 1 mg / kg of AD04982 are administered to an individual who needs them. In some embodiments, approximately 1.5 mg / kg of AD04872 and approximately 1.5 mg / kg of AD04982 are administered to an individual who needs them. In some embodiments, approximately 2.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD04982 are administered to an individual who needs them. In some embodiments, approximately 3.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD04982 are Petition 870250071938, dated 08 / 14 / 2025, p. 66 / 535 55 / 233 administered to an individual who needs them. In some embodiments, approximately 3.2 mg / kg of AD04872 and approximately 0.8 mg / kg of AD04982 are administered to an individual who needs them. In some embodiments, approximately 2.7 mg / kg of AD04872 and approximately 1.3 mg / kg of AD04982 are administered to an individual who needs them. In some embodiments, approximately 4.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD04982 are administered to an individual who needs them. In some embodiments, approximately 3.3 mg / kg of AD04872 and approximately 1.7 mg / kg of AD04982 are administered to an individual who needs them. In some embodiments, between approximately 0.05 and approximately 5 mg / kg of AD04872 and between approximately 0.05 and approximately 5 mg / kg of AD04982 are administered to an individual who needs them. In some embodiments, the respective doses of AD04872 and AD04982 are administered separately (e.g., in separate injections).In some embodiments, the respective doses of AD04872 and AD04982 are administered together (e.g., in the same injection). In some embodiments, the respective doses of AD04872 and AD04982 are prepared in a single pharmaceutical composition.

[075] In some embodiments, methods of treating an HBV infection or preventing disease or symptoms caused by an HBV infection are disclosed in the present invention, comprising administering to an individual in need of such treatment an effective amount of AD04580 and an effective amount of AD04585. In some embodiments, the ratio of AD04580 to AD04585 administered to an individual in need is about 2:1. In some embodiments, the ratio of AD04580 to AD04585 administered to an individual in need is about 3:1. In some embodiments, the ratio of AD04580 to AD04585 administered to an individual in need is about 4:1. In some embodiments, the ratio of AD04580 to AD04585 administered to an individual in need is about 5:1. In some Petition 870250071938, dated 08 / 14 / 2025, p. 67 / 535 In 56 / 233 dosage forms, the ratio between AD04580 and AD04585 administered to an individual who needs it is approximately 1:1. In some dosage forms, the ratio between AD04580 and AD04585 administered to an individual who needs it is approximately 1:2. In some dosage forms, approximately 1 mg / kg (mpk) of AD04580 and approximately 1 mg / kg of AD04585 are administered to an individual who needs them. In some dosage forms, approximately 1.5 mg / kg of AD04580 and approximately 1.5 mg / kg of AD04585 are administered to an individual who needs them. In some dosage forms, between approximately 0.05 and approximately 5 mg / kg of AD04580 and between approximately 0.05 and approximately 5 mg / kg of AD04585 are administered to an individual who needs them.

[076] In some embodiments, an HBV RNAi agent disclosed herein consists of or comprises AD05070 linked to (NAG37)s shown as a sodium salt having the structure represented by the following: Petition 870250071938, dated 08 / 14 / 2025, p. 68 / 535 57 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 69 / 535 58 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 70 / 535 59 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 71 / 535 60 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 72 / 535 61 / 233

[077] In some embodiments, an HBV RNAi agent disclosed herein consists of or comprises AD05070 linked to (NAG25)s shown as a sodium salt having the structure represented by the following: Petition 870250071938, dated 08 / 14 / 2025, p. 73 / 535 62 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 74 / 535 63 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 75 / 535 64 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 76 / 535 65 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 77 / 535 66 / 233

[078] In some embodiments, an HBV RNAi agent disclosed herein consists of or comprises AD05070 linked to (NAG37)s shown as a free acid having the structure represented by the following: Petition 870250071938, dated 08 / 14 / 2025, p. 78 / 535 67 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 79 / 535 68 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 80 / 535 69 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 81 / 535 70 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 82 / 535 71 / 233

[079] In some embodiments, an HBV RNAi agent disclosed herein consists of or comprises AD04580 linked to (NAG31)s shown as a sodium salt having the structure represented by the following: Petition 870250071938, dated 08 / 14 / 2025, p. 83 / 535 72 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 84 / 535 73 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 85 / 535 74 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 86 / 535 75 / 233

[080] In some embodiments, an HBV RNAi agent disclosed herein consists of or comprises AD04585 linked to (NAG25)s shown as a sodium salt having the structure represented by the following: Petition 870250071938, dated 08 / 14 / 2025, p. 87 / 535 76 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 88 / 535 77 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 89 / 535 78 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 90 / 535 79 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 91 / 535 80 / 233

[081] In some embodiments, an HBV RNAi agent disclosed herein consists of or comprises AD04872 linked to (NAG37)s shown as a sodium salt having the structure represented by the following: Petition 870250071938, dated 08 / 14 / 2025, p. 92 / 535 81 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 93 / 535 82 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 94 / 535 83 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 95 / 535 84 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 96 / 535 85 / 233

[082] In some embodiments, an HBV RNAi agent disclosed herein consists of or comprises AD04872 linked to (NAG25)s shown as a sodium salt having the structure represented by the following: Petition 870250071938, dated 08 / 14 / 2025, p. 97 / 535 86 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 98 / 535 87 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 99 / 535 88 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 100 / 535 89 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 101 / 535 90 / 233

[083] In some embodiments, an HBV RNAi agent disclosed herein consists of or comprises AD04872 linked to (NAG37)s shown as a free acid having the structure represented by the following: Petition 870250071938, dated 08 / 14 / 2025, p. 102 / 535 91 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 103 / 535 92 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 104 / 535 93 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 105 / 535 94 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 106 / 535 95 / 233

[084] In some embodiments, the described HBV RNAi agents are optionally combined with one or more additional therapeutic agents (i.e., second, third, etc.). A second therapeutic agent may be another HBV RNAi agent (e.g., an HBV RNAi agent targeting a different sequence within an HBV genome). An additional therapeutic agent may also be a small molecule drug, antibody, antibody fragment, and / or vaccine. HBV RNAi agents, with or without one or more additional therapeutic agents, may be combined with one or more excipients to form pharmaceutical compositions.

[085] In some embodiments, the described HBV RNAi agents are optionally combined with one or more therapeutic agents, the additional therapeutic agent being a nucleoside inhibitor or nucleotide inhibitor. In some embodiments, the described HBV RNAi agents are optionally combined with one or more therapeutic agents, the additional therapeutic agent being entecavir, tenofovir, tenofovir alafenamide, tenofovir disoproxil, lamivudine, or another antiviral therapeutic agent. In some embodiments, the described HBV RNAi agents are optionally combined with one or more therapeutic agents, the additional therapeutic agent being an interferon. In some embodiments, the described HBV RNAi agents are optionally combined with one or more therapeutic agents, the additional therapeutic agent being interferon-alpha.In some embodiments, the described HBV RNAi agents are optionally combined with one or more HBV therapeutic agents, and the therapeutic agent is an HBV vaccine.

[086] In some embodiments, the described HBV RNAi agents are optionally combined with one or more therapeutic agents in a single-dose form (i.e., cocktail included in a single injection). In some embodiments, the described HBV RNAi agents may be administered Petition 870250071938, dated 08 / 14 / 2025, p. 107 / 535 96 / 233 separately from one or more optional additional therapeutic agents. In some embodiments, the described HBV RNAi agents are administered to an individual in need via subcutaneous injection, and one or more optional additional therapeutic agents are administered orally, which together provide a treatment regimen for diseases and conditions associated with HBV infection. In some embodiments, the described HBV RNAi agents are administered to an individual in need via subcutaneous injection, and one or more optional additional therapeutic agents are administered via a separate subcutaneous injection.

[087] In some embodiments, compositions are disclosed herein for releasing an HBV RNAi agent to a liver cell in vivo, with the composition including an HBV RNAi agent conjugated to or linked to a targeting group. In some embodiments, the targeting group is an asialoglycoprotein receptor ligand. In some embodiments, compositions are described for releasing an HBV RNAi agent to a liver cell in vivo, and the composition includes an HBV RNAi agent linked to a targeting ligand consisting of N-acetylgalactosamine.

[088] In some embodiments, one or more of the described HBV RNAi agents are administered to a mammal in a pharmaceutically acceptable vehicle or diluent. In some embodiments, the mammal is a human.

[089] The use of hepatitis B virus RNAi agents provides methods for the therapeutic and / or prophylactic treatment of diseases / disorders associated with HBV infection. The HBV RNAi agents described mediate RNA interference to inhibit the expression of one or more genes necessary for hepatitis B virus replication and / or pathogenesis. In particular, for example, HBV RNAi agents can inhibit viral polymerase, core protein, surface antigen, the Petition 870250071938, dated 08 / 14 / 2025, page 108 / 535 97 / 233 antigen-e and / or protein X, in a cell, tissue, or mammal. HBV RNAi agents can be used to treat HBV infection. HBV RNAi agents can also be used to treat or prevent chronic liver diseases / disorders, inflammation, fibrotic conditions, and proliferative disorders, such as cancers, associated with HBV infection. In some embodiments, the methods further comprise the treatment of hepatitis D virus (HDV) in the individual. Such methods comprise the administration of HBV RNAi agent to a human or animal infected with HBV. In addition, compositions for the delivery of HBV RNAi agents to liver cells in vivo are described.

[090] Pharmaceutical compositions comprising one or more HBV RNAi agents may be administered in various ways depending on whether local or systemic treatment is desired. Administration may be, but is not limited to, intravenous, intra-arterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[091] HBV RNAi agents and / or compositions including them may be used in methods for the therapeutic treatment of HBV infection or disease or conditions caused by HBV infection. Such methods include administering an HBV RNAi agent, as described herein, to an individual, for example, a human or animal individual.

[092] As used in the present invention, the terms oligonucleotide and polynucleotide mean a polymer of linked nucleosides, each of which may be independently modified or unmodified.

[093] As used herein, an RNAi agent or RNAi trigger means a composition containing an RNA oligonucleotide molecule or RNA-like molecules (e.g., chemically modified RNA) that is capable of degrading or Petition 870250071938, dated 08 / 14 / 2025, page 109 / 535 98 / 233 inhibit the translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence-specific manner. As used in the present invention, RNAi agents can operate via the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA-induced silencing complex or RISC of mammalian cells), or by any alternative mechanisms or pathways. Although RNAi agents, as the term is used in the present invention, are believed to operate primarily via the RNA interference mechanism, the disclosed RNAi agents are not linked by, or limited to, any particular pathway or mechanism of action. The RNAi agents disclosed in the present invention comprise a sense strand and an antisense strand, and include, but are not limited to: short interfering RNAs (siRNAs), double-stranded RNAs (dsRNAs), micro RNAs (miRNAs), short hairpin RNAs (shRNAs), and dicer substrates.The antisense strand of the RNAi agents described here is at least partially complementary to the mRNA being targeted. The RNAi agents may comprise modified nucleotides and / or one or more non-phosphodiester bonds.

[094] As used herein, the terms silencing, reducing, inhibiting, downregulating, or reduction when referring to the expression of a particular gene, mean that the expression of the gene, as measured by the content of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from mRNA in a cell, group of cells, tissue, organ, or individual in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or individual is treated with oligomeric compounds, such as RNAi agents, described in the present invention compared with a second cell, group of cells, tissue, organ, or individual that has not been so treated.

[095] As used herein, the term sequence or sequence of nucleotides means a succession or order of nucleobases or nucleotides, described with a succession of letters using standard nomenclature. Petition 870250071938, dated 08 / 14 / 2025, page 110 / 535 99 / 233

[096] As used in the present invention, a nucleotide base or nucleobase is a pyrimidine or heterocyclic purine compound, which is a standard constituent of all nucleic acids, and includes the bases that form the nucleotides adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). A nucleobase may also be modified to include, without limitation, universal bases, hydrophobic bases, promiscuous bases, expanded-size bases, and fluorinated bases.

[097] As used herein, and except where otherwise indicated, the term complementary, when used to describe a first nucleotide sequence (e.g., a sense strand of RNAi agent or a targeted mRNA) in relation to a second nucleotide sequence (e.g., an antisense strand of RNAi agent or a single antisense strand oligonucleotide), means the ability of an oligonucleotide or polynucleotide that includes the first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) and to form a duplex or double helical structure under certain conditions with an oligonucleotide or polynucleotide that includes the second nucleotide sequence.Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimetics, at least to the extent that the hybridization requirements above are met. Sequence identity or complementarity is independent of modification. For example, ae and Af are complementary to U (or T) and identical to A for the purpose of determining identity or complementarity.

[098] As used in the present invention, perfectly complementary or totally complementary means that all (100%) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases. Petition 870250071938, dated 08 / 14 / 2025, page 111 / 535 100 / 233 in a contiguous sequence of a second polynucleotide. The contiguous sequence may comprise all or part of a first or second nucleotide sequence.

[099] As used in the present invention, partially complementary means that in a hybridized pair of nucleobase sequences, at least 70%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide.

[0100] As used in the present invention, substantially complementary means that in a hybridized pair of nucleobase sequences, at least about 85%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The terms complementary, fully complementary, and substantially complementary of the present invention may be used in relation to base matching between the sense strand and the antisense strand of a double-stranded RNAi agent, between the antisense strand of an RNAi agent and a sequence of a target mRNA, or between a single-stranded antisense oligonucleotide and a sequence of a target mRNA.

[0101] As used in the present invention, the term substantially identical or substantially identity, as applied to nucleic acid sequences, means that a nucleic acid sequence comprises a sequence that has at least about 85% sequence identity or more, preferably at least 90%, at least 95%, or at least 99%, compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences in a comparison window. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences. Petition 870250071938, dated 08 / 14 / 2025, page 112 / 535 101 / 233 to generate the number of paired positions, dividing the number of paired positions by the total number of positions in the comparison window and multiplying the result by 100 to obtain the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences substantially identical to those disclosed in the present invention, for example, in Tables 2, 3, and 4. In some embodiments, the sequences disclosed in the present invention are exactly identical, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to those disclosed in the present invention, for example, in Tables 1, 2, 3, and 4.

[0102] As used in the present invention, the terms treat, treatment and the like, mean the methods or steps taken to provide relief or alleviation of the number, severity and / or frequency of one or more symptoms of a disease or condition in an individual.

[0103] As used in the present invention, the term "introduce into a cell," when referring to an oligomeric compound, means functionally releasing the oligomeric compound into a cell. The term "functional release" means releasing the oligomeric compound into the cell in a manner that enables the oligomeric compound to have the expected biological activity, for example, specific sequence inhibition of gene expression.

[0104] Except where otherwise specified, the use of the symbol , as used in the present invention, means that any group or groups may be linked to it that is consistent with the scope of the inventions described herein.

[0105] As used in the present invention, the term isomers refers to compounds that have identical molecular formulas but differ in the nature or sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms are called stereoisomers. Stereoisomers that are not mirror images of each other Petition 870250071938, dated 08 / 14 / 2025, page 113 / 535 102 / 233 are called diastereomers, and stereoisomers that are non-superimposable mirror images of each other are called enantiomers. A carbon atom bonded to four non-identical substituents is called a chiral center.

[0106] As used in the present invention, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers are present and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed in the present invention are intended to encompass mixtures of diastereomers as well as single stereoisomers.

[0107] As used in a claim of the present invention, the expression consisting of excludes any element, step or ingredient not specified in the claim. When used in a claim of the present invention, the expression consisting of essentially limits the scope of a claim to specific materials or steps and does not materially affect the basic and novel features of the claimed invention.

[0108] Those skilled in the art would readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending on the environment in which the compound or composition is placed. Consequently, as used in the present invention, the structures disclosed in the present invention provide that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The present disclosure is intended to cover the disclosed compounds and compositions regardless of their protonation state based on Petition 870250071938, dated 08 / 14 / 2025, page 114 / 535 103 / 233 in the environment (as pH), as would be readily understood by one skilled in the art.

[0109] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art. Although methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, exemplary materials and methods are described herein. All publications, patent applications, patents and other references mentioned in the present invention are incorporated herein in their entirety by reference. In case of conflict, this descriptive report, including definitions, shall prevail. Furthermore, the materials, methods and examples are for illustrative purposes only and are not intended to be limiting.

[0110] Other features, objectives and advantages of the present invention will become apparent from the detailed description below, and the claims. Detailed Description

[0111] RNAi agents for inhibiting hepatitis B virus (HBV) expression (referred to in the present invention as HBV RNAi agents or HBV RNAi triggers) are described herein. Each HBV RNAi agent comprises a sense strand and an antisense strand. The sense strand and the antisense strand may each be 16 to 30 nucleotides long. In some embodiments, the sense and antisense strands may each be 17 to 26 nucleotides long. The sense and antisense strands may be the same length or may be different lengths. In some embodiments, the sense and antisense strands are each independently 17 to 26 nucleotides long. In some embodiments, the sense and antisense strands are each independently 17 to 21 nucleotides long. In some forms, both the sense strand and the antisense strand are each 21 to 26 nucleotides long. In some Petition 870250071938, dated 08 / 14 / 2025, p. 115 / 535In 104 / 233 embodiments, the sense strand is about 19 nucleotides long, and the antisense strand is about 21 nucleotides long. In some embodiments, the sense strand is about 21 nucleotides long, and the antisense strand is about 23 nucleotides long. In some embodiments, both the sense and antisense strands are each 26 nucleotides long. In some embodiments, the sense and antisense strands of the RNAi agent are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides long. In some embodiments, a double-stranded RNAi agent has a duplex approximately 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length.This region of perfect or substantial complementarity between the sense strand and the antisense strand is typically 15 to 25 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides long and occurs at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly or substantially complementary).

[0112] The sense strand and the antisense strand each contain a core sequence that is 16 to 23 nucleobases long. A core sequence on the antisense strand is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (sometimes referred to as, for example, a target sequence) present in the HBV target mRNA. A core sequence on the sense strand is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core sequence on the antisense strand, and thus the core sequence on the sense strand is perfectly identical or at least about 85% identical to a nucleotide sequence (target sequence) present in the HBV target mRNA. A core sequence on the sense strand may have the same length as a corresponding antisense core sequence or it may have a different length. In Petition 870250071938, dated 08 / 14 / 2025, p. 116 / 535 105 / 233 In some embodiments, the core sequence of the antisense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides long. In some embodiments, the core sequence of the sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides long.

[0113] Examples of nucleotide sequences of the sense and antisense strands used in the formation of HBV RNAi agents are provided in Tables 3 and 4. Examples of RNAi agent doublets, which include the nucleotide sequences in Tables 3 and 4, are provided in Table 5.

[0114] The sense and antisense strands of the HBV RNAi agent anneal to form a duplex. A sense strand and an antisense strand of an HBV RNAi agent may be partially, substantially, or fully complementary to each other. In the complementary duplex region, the core sequence of the sense strand is at least about 85% or 100% complementary to the core sequence of the antisense strand.In some embodiments, the core sense strand sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that is at least about 85% or 100% complementary to a complementary 16, 17, 18, 19, 20, or 21 nucleotide sequence of the core antisense strand sequence (that is, the sense and antisense core strand sequences of an HBV RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that has at least 85% base pairing or 100% base pairing).

[0115] In some embodiments, the antisense strand of an HBV RNAi agent disclosed in the present invention differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an HBV RNAi agent disclosed in the present invention differs by Petition 870250071938, dated 08 / 14 / 2025, p. 117 / 535 106 / 233 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.

[0116] The length of the sense and antisense strands of the HBV RNAi agent described herein can be from 16 to 30 nucleotides (in length). In some embodiments, the sense and antisense strands independently have lengths of 17 to 26 nucleotides. In some embodiments, the sense and antisense strands have lengths of 19 to 26 nucleotides. In some embodiments, the sense and antisense strands of the RNAi agent independently have lengths of 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides. The sense and antisense strands may have the same length or may have different lengths. In some embodiments, one sense strand and one antisense strand are each 26 nucleotides long. In some embodiments, a sense strand is 23 nucleotides long and an antisense strand is 21 nucleotides long. In some embodiments, a sense strand is 22 nucleotides long and an antisense strand is 21 nucleotides long.In some embodiments, a sense strand is 21 nucleotides long and an antisense strand is 21 nucleotides long. In some embodiments, a sense strand is 19 nucleotides long and an antisense strand is 21 nucleotides long.

[0117] The sense strand and / or the antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, the 5' end, or both the 3' and 5' ends of the core sequences. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the corresponding sequence in an HBV mRNA. The additional nucleotides of the sense strand, if present, may or may not be complementary to the corresponding sequence in an HBV mRNA. The additional nucleotides of the antisense strand, if present, may Petition 870250071938, dated 08 / 14 / 2025, page 118 / 535 107 / 233 or not be complementary to the additional nucleotides of the corresponding sense strand, if present.

[0118] As used in the present invention, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the core sequence of the sense strand and / or the core sequence of the antisense strand. The nucleotides of the extension on a sense strand may or may not be complementary to the nucleotides, either the nucleotides of the core sequence or the nucleotides of the extension, on the corresponding antisense strand. Conversely, the nucleotides of the extension on an antisense strand may or may not be complementary to the nucleotides, either the nucleotides of the core sequence or the nucleotides of the extension, on the corresponding sense strand. In some embodiments, both the sense and antisense strands of an RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' nucleotides of one strand have bases paired with one or more 5' nucleotides of the other strand.In other embodiments, one or more of the 3' extension nucleotides of one strand do not have bases paired with one or more 5' extension nucleotides of the other strand. In some embodiments, an HBV RNAi agent has an antisense strand having a 3' extension and a sense strand having a 5' extension.

[0119] In some embodiments, an HBV RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an HBV RNAi agent comprises an antisense strand that has a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary to a corresponding HBV mRNA sequence. In some embodiments, a 3' antisense strand extension includes or consists of, but does not consist of Petition 870250071938, dated 08 / 14 / 2025, page 119 / 535 108 / 233 limits to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each engraving from 5' to 3').

[0120] In some embodiments, the 3' end of the antisense strand may include additional abasic nucleosides (Ab). In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand.

[0121] In some embodiments, an HBV RNAi agent comprises an antisense strand having a 5' extension of 1, 2, 3, 4, or 5 nucleotides in length. In other embodiments, an HBV RNAi agent comprises an antisense strand having a 5' extension of 1 or 2 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary to a corresponding HBV mRNA sequence. In some embodiments, the 5' antisense strand extension includes or consists of, but is not limited to, UA, TU, U, T, UU, TT, CUC (each a 5' to 3' recording). An antisense tape may have any of the 3' extensions described above in combination with any of the 5' antisense tape extensions described, if present.

[0122] In some embodiments, an HBV RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more nucleotides of the sense strand extension comprise the nucleotides adenosine, uracil, or thymidine, AT dinucleotide, or nucleotides that correspond to the nucleotides in the HBV mRNA sequence. In some embodiments, the 3' extension of the sense strand includes or consists of, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (written from 5' to 3').

[0123] In some embodiments, the 3' end of the sense strand may include additional abasic nucleosides. In some embodiments, UUAb, UAb, or Ab may be added to the 3' end of the sense strand. In some embodiments, one or more abasic nucleosides added to the 3' end of the sense strand may Petition 870250071938, dated 08 / 14 / 2025, p. 120 / 535 109 / 233 be inverted (invAb). In some embodiments, one or more inverted abasic nucleosides may be inserted between the targeting ligand and the nucleobase sequence of the RNAi agent's sense strand. In some embodiments, the inclusion of one or more inverted abasic nucleosides at or near the terminal end or ends of the sense strand of an RNAi agent may enable enhanced activity or other desired properties of an RNAi agent.

[0124] In some embodiments, an HBV RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides that correspond to nucleotides in the HBV mRNA sequence. In some embodiments, the 5' extension of the sense strand may be, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (written from 5' to 3'). A sense strand may have a 3' extension and / or a 5' extension.

[0125] In some embodiments, the 5' end of the sense strand may include an additional abasic nucleoside (Ab) or nucleosides (AbAb). In some embodiments, the one or more abasic nucleosides added to the 5' end of the sense strand may be inverted (invAb). In some embodiments, one or more inverted abasic nucleosides may be inserted between the targeting ligand and the nucleobase sequence of the RNAi agent's sense strand. In some embodiments, the inclusion of one or more inverted abasic nucleosides at or near the terminal end or ends of the sense strand of an RNAi agent may enable enhanced activity or other desired properties of an RNAi agent.

[0126] Examples of nucleotide sequences used in the formation of HBV RNAi agents are provided in Tables 3 and 4. In some embodiments, Petition 870250071938, dated 08 / 14 / 2025, p. 121 / 535 110 / 233 An antisense strand of the HBV RNAi agent includes a nucleotide sequence from any of the sequences in Table 3. In some embodiments, an antisense strand of the HBV RNAi agent includes the nucleotide sequence 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 from any of the sequences in Table 3. In some embodiments, a sense strand of the HBV RNAi agent includes the nucleotide sequence from any of the sequences in Table 4. In some In various forms, a sense strand of HBV RNAi agent includes the nucleotide sequence 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25, 2-26, 3-20, 3-21, 3-22, 3-23, 3-24, 3-25, 3-26, 4-21, 4-22, 4-23, 4-24, 4-25, 4-26, 5-22, 5-23, 5-24, 5-25, 5-26, 6-23, 6-24, 6-25, 6-26, 7-24, 7-25, 7-25, 8-25, 8-26 from any of the sequences in Table 4.

[0127] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form a blunt end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is a blunt end. As used in the present invention, a blunt end refers to an end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base pair).In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form a frayed end. In some embodiments, the 3' end of... Petition 870250071938, dated 08 / 14 / 2025, p. 122 / 535 111 / 233 The sense strand and the 5' end of the antisense strand of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used in the present invention, frayed end refers to a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands form a pair (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). As used in the present invention, an overhang is a stretch of one or more unpaired nucleotides at the end of a strand of a double-stranded RNAi agent. The unpaired nucleotides may be on the sense strand or the antisense strand, creating 3' or 5' overhangs.In some embodiments, the RNAi agent contains: one blunt end and one worn end, one blunt end and one 5' protruding end, one blunt end and one 3' protruding end, one worn end and one 3' protruding end, two 5' protruding ends, two 5' protruding ends, one 5' protruding end and one 3' protruding end, two worn ends, or two blunt ends.

[0128] A nucleotide base (or nucleobase) is a heterocyclic pyrimidine or purine compound that is a constituent of all nucleic acids and includes adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). As used in the present invention, the term nucleotide may include a modified nucleotide (such as, for example, a nucleotide mimetic, an abasic (Ab) site, or a substituent moiety). Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can preserve the activity of the compound in cells while simultaneously increasing the serum stability of these compounds, and can also minimize the possibility Petition 870250071938, dated 08 / 14 / 2025, page 123 / 535 112 / 233 activation of interferon activity in humans through administration of the polynucleotide or oligonucleotide construct.

[0129] In some embodiments, an HBV RNAi agent is prepared or provided as a salt, mixed salt, or a free acid. In some embodiments, an HBV RNAi agent is prepared as a sodium salt. These forms are within the scope of the inventions disclosed herein. Modified nucleotides

[0130] In some embodiments, an HBV RNAi agent contains one or more modified nucleotides. As used herein, a modified nucleotide is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used in the present invention, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimetics, abasic nucleotides (represented herein as Ab), 2'-modified nucleotides, 3'-to-3' (inverted) linkage nucleotides (represented herein as invdN, invN, invn, invAb), nucleotides comprising unnatural bases, bridging nucleotides, peptide nucleic acids (PNAs), 2', 3'-dry nucleotide mimetics (unlocked nucleobase analogs, represented herein as NUNA or NUNA).Locked nucleotides (represented here as NLNA or NLNA), 3'-O-methoxy (2'-internucleoside-linked) nucleotides (represented here as 3'-OMen), 2'-F-arabino nucleotides (represented here as NfANA or NfANA), 5'-Me, 2'-fluoronucleotide (represented here as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented here as vpdN), vinyl phosphonate-containing nucleotides, and cyclopropyl phosphonate-containing nucleotides (cPrpN). 2'-modified nucleotides (i.e., a nucleotide with a group other than one, Petition 870250071938, dated 08 / 14 / 2025, page 124 / 535 113 / 233 hydroxyl group at the 2' position of the 5-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (represented here with a lowercase 'n' in a nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (represented here as Nf, represented here as 2'-fluoro nucleotide), 2'-deoxy nucleotides (represented here as dN), 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (represented here as NM or 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. It is not necessary that all positions in a given compound be modified uniformly. On the other hand, more than one modification may be incorporated into a single HBV RNAi agent or even into a single nucleotide thereof. The sense and antisense strands of the HBV RNAi agent can be synthesized and / or modified by methods known in the art. Modification to one nucleotide is independent of modification to another nucleotide.

[0131] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine or guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propinyl uracil, 5-propinyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-aza-adenine,7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0132] In some embodiments, all or substantially all nucleotides of an RNAi agent are modified nucleotides. As used in Petition 870250071938, dated 08 / 14 / 2025, page 125 / 535 114 / 233 present invention, an RNAi agent in which substantially all the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense and antisense strands that are ribonucleotides. As used in the present invention, a sense strand in which substantially all the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are ribonucleotides. As used in the present invention, an antisense strand in which substantially all the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is a ribonucleotide. Modified internucleoside bonds

[0133] In some embodiments, one or more nucleotides of an HBV RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleosidic linkages or backbones). In some embodiments, a modified internucleosidic linkage is a covalent internucleosidic linkage not containing phosphates.Modified internucleosidic linkages or main chains include, but are not limited to, 5'-phosphorothioate groups (represented here as the letter s), phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methylphosphonates or 3'-alkylen-phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidates, or thionophosphoamidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates having inert polarity in which the adjacent pairs of nucleosidic units are 3'-5' to 5'-3' or 2'-5' to 5'-2' linked. In some embodiments, a modified internucleosidic bond or backbone. Petition 870250071938, dated 08 / 14 / 2025, page 126 / 535 115 / 233 does not have a phosphorus atom. Modified internucleosidic bonds that do not have a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar bonds, mixed heteroatom and alkyl or cycloalkyl intersugar bonds, or intersugar bonds of one or more short heteroatomic or heterocyclic chains. In some embodiments, the modified internucleosidic backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0134] In some embodiments, a sense strand of an HBV RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an HBV RNAi may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense and antisense strands independently may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, a sense strand of an HBV RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, an antisense strand of an HBV RNAi may contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense and antisense strands may contain 1, 2, 3, or 4 phosphorothioate linkages.

[0135] In some embodiments, an antisense strand of the HBV RNAi agent contains at least two phosphorothioate internucleosidic bonds. In some embodiments, the at least two phosphorothioate internucleosidic bonds are between nucleotides at positions 1 to 3 from the 3' end of the sense strand. In some embodiments, the at least two phosphorothioate internucleosidic bonds are between nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand. In some embodiments, an antisense strand of the agent Petition 870250071938, dated 08 / 14 / 2025, p. 127 / 535 116 / 233 HBV RNAi contains four phosphorothioate internucleosidic bonds. In some embodiments, the four phosphorothioate internucleosidic bonds are between nucleotides at positions 1 to 3 from the 5' end of the sense strand and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, an HBV RNAi agent contains at least two phosphorothioate internucleosidic bonds on the antisense strand and three or four phosphorothioate internucleosidic bonds on the antisense strand.

[0136] In some embodiments, an HBV RNAi agent contains one or more modified nucleotides and one or more modified internucleoside bonds. In some embodiments, a 2'-modified nucleoside is combined with a modified internucleoside bond. HBV RNAi agents

[0137] In some embodiments, the HBV RNAi agents disclosed herein target an HBV gene at or near the HBV genome positions shown in Table 1 below. In some embodiments, the antisense strand of an HBV RNAi agent disclosed herein includes a core stretch sequence that is wholly, substantially, or at least partially complementary to an HBV 19 mer target sequence disclosed in Table 1. Table 1. Example of 19-mer HBV cDNA target sequences for HBV RNAi agents (obtained from hepatitis B virus (subtype ADW2), genotype A, GenBank complete genome AM282986.1 (SEQ ID NO:1)). SEQ ID NO: 19 mer (5'^3') HBV target sequences. Position in the genome of SEQ ID NO: 1 Targeted HBV gene region 2 GTGGTGGACTTCTCTCAAT 256-274 ORF S 3 TGGTGGACTTCTCTCAATT 257-275 ORF S 4 GGACTTCTCTCAAIIIICI 261-279 ORF S 5 GCTGTAGGCATAAATTGGT 1780-1798 ORF X Petition 870250071938, dated 08 / 14 / 2025, p. 128 / 535 117 / 233 SEQ ID NO: 19 mer (5'—3') HBV target sequences. Position in the genome of SEQ ID NO: 1 Targeted HBV gene region 6 CTGTAGGCATAAATTGGTC 1781-1799 ORF X

[0138] In some embodiments, an HBV RNAi agent includes an antisense strand, with position 19 of the antisense strand (5'^3') being able to form a base pair with position 1 of a 19-mer target sequence shown in Table 1. In some embodiments, an HBV RNAi agent includes an antisense strand, and position 1 of the antisense strand (5' -» 3') is able to form a base pair with position 19 of the 19-mer target sequence shown in Table 1.

[0139] In some embodiments, an HBV RNAi agent includes an antisense strand, with position 2 of the antisense strand (5' → 3') being able to form a base pair with position 18 of the 19-mer target sequence shown in Table 1. In some embodiments, an HBV RNAi agent includes an antisense strand, with positions 2 to 18 of the antisense strand (5' → 3') being able to form base pairs with each of the respective complementary bases located at positions 18 to 2 of the 19-mer target sequence shown in Table 1.

[0140] In some embodiments, HBV RNAi agents include the 19 mer key nucleotide sequences shown in Table 2 below. Table 2. Core segment sequences of the sense and antisense strands of the HBV RNAi agent (N=any nucleotide). SEQ ID NO: Antisense sequence (5' - 3') (19-mer) SEQ Sense sequence ID NO: (5' — 3') (19-mer) Position in the genome of SEQ ID NO: 1 7 AU UGAGAGAAG UCCACC AC GUGGUGGACUUCUCUCA 34 AU 256-274 8 UUU GAGAGAAG UCCAC CAC -- GUGGUGGACUUCUCUCA 35 AA 256-274 Petition 870250071938, dated 08 / 14 / 2025, p. 129 / 535 118 / 233 SEQ ID NO: Anti-sense sequence (5' - 3') (19-mer) SEQ ID NO: Sense sequence (5' - 3') (19-mer) Genome position of SEQ ID NO: HOUSEHOLD 37 NUMBER 256-274 CAN AA 11 NEW HOUSEHOLD UCCAC 38 HOUSEHOLD 256-274 CAN AN 12 HOUSEHOLD 39 HOUSE1-HOUSE35252 UGAGAGAAG UCCAC 40 UGAGAGAAG UCCAC 257-275 CA UA 14 AAUUGAGAGAG UCCACAC 41 DAYS 257-275 CN UU 15 UAU UGAGAGAAG UCCAC 42 DAYS 5617UA27 UCCAC 43 YEARS OLD 257-275 CN UN 17 YEARS OLD 261-279 CC CU 18 YEARS OLD 45 YEARS OLD-2991 YEARS OLD U 46 261-279 CN CU 20 YOUNG 261-279 CN CA 21 YOUNG 261-261-261 49 GCUGUAGGCAUAAAUUG 1780-1798 GC GU 23 UCCAAUUUAUGCCUACA 50 GCUGUAGGCAUAAAUUG 1780-1798 GC GA 24ACCAAUUUAUGCCUACA 51 NCUGUAGGCAUAAAUUG 1780-1798 GN GU 25 UCCAAUUUAUGCCUACA 52 NCUGUAGGCAUAAAUUG 1780-1798 GN GA 26 NCCAAUUUAUGCCUACA 53 NCUGUAGGCAUAAAUUG 1780-1798 GN GN Petition 870250071938, dated 08 / 14 / 2025, page 130 / 535 119 / 233 SEQ ID NO: Antisense sequence (5' - 3') (19-mer) SEQ ID NO: Sense sequence (5' - 3') (19-mer) Position in the genome of SEQ ID NO: 1 27 GACCAAU U UAU GCCUAC AG 54 CUGUAGGCAUAAAUUGG UC 1781-1799 28 AACCAAUUUAUGCCUAC AG 55 CUGUAGGCAUAAAUUGG UU 1781-1799 29 UACCAAUUUAUGCCUAC AG 56 CUGUAGGCAUAAAUUGG UA 1781-1799 30 GACCAAU U UAU GCCUAC AN 57 NUGUAGGCAUAAAUUGG UC 1781-1799 31 AACCAAUUUAUGCCUAC AN 58 NUGUAGGCAUAAAUUGG UU 1781-1799 32 UACCAAUUUAUGCCUAC AN 59 NUGUAGGCAUAAAUUGG UA 1781-1799 33 NACCAAUUUAUGCCUAC AN 60 NUGUAGGCAUAAAUUGG UN 1781-1799

[0141] The sense and antisense strands of the HBV RNAi agent comprising or consisting of the nucleotide sequences in Table 2 may be modified or unmodified nucleotides. In some embodiments, the HBV RNAi agents having sense and antisense strand sequences comprising or consisting of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.

[0142] In some embodiments, the antisense strand of an HBV RNAi agent disclosed in the present invention differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an HBV RNAi agent disclosed in the present invention differs by 0, 1, 2, 3, or nucleotides from any of the sense sequences in Table 2.

[0143] The modified HBV RNAi agent antisense strand sequences, as well as their unmodified underlying sequences, are provided in Table 3. The modified HBV RNAi agent antisense strands, Petition 870250071938, dated 08 / 14 / 2025, page 131 / 535 120 / 233, as well as their underlying unmodified sequences, are provided in Table 4. In the formation of HBV RNAi agents, each of the nucleotides in each of the unmodified sequences shown in Tables 3 and 4 can be a modified nucleotide.

[0144] As used in the present invention (including in Tables 3 and 4), the following notations are used to indicate modified nucleotides, targeting groups, and linking groups. As one skilled in the art would readily understand, except where otherwise indicated by the sequence, that when present in an oligonucleotide, the monomers are mutually linked by 5'-3' phosphodiester bonds: A = adenosine-3'-phosphate; C = cytidine-3'-phosphate; G = guanosine-3'-phosphate; U = uridine-3'-phosphate n = any modified 2'-OMe nucleotide a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Nf = any modified 2'-fluoro nucleotide Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothiate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Petition 870250071938, dated 08 / 14 / 2025, page 132 / 535 121 / 233 Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dN = any 2'-deoxyribonucleotide dT = 2'-deoxythymidine-3'-phosphate Nuna = 2',3'-dry nucleotide mimetics (unlocked nucleobase analogs) Nlna = locked nucleotide NfANA = 2'-F-Arabino nucleotide nm = 2'-methoxyethyl nucleotide AM = 2'-methoxyethyladenosine-3'-phosphate AMs = 2'-methoxyethyladenosine-3'-phosphorothioate TM = 2'-methoxyethylthymidine-3'-phosphate TMs = 2'-methoxyethylthymidine-3'-phosphorothioate R = ribitol (invdN) (invAb) = any inverted deoxyribonucleotide (3'-3' linked nucleotide) = inverted abasic deoxyribonucleotide (3'-3' linked), see Table 6 (invAb) = inverted abasic deoxyribonucleotide-5'-phosphorothioate,See Table 6 (invdN) = any inverted 2'-OMe nucleotide (linked 3'-3' nucleotide) s = phosphorothioate linkage vpdN (5Me-Nf) cPrp epTcPr epTM = deoxyribonucleotide vinyl phosphate = 5'-Me, 2'-fluoronucleotide = cyclopropyl phosphonate, see Table 6 = see Table 6 = see Table 6,

[0145] Someone skilled in the art would readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically Petition 870250071938, dated 08 / 14 / 2025, page 133 / 535 122 / 233 would have a hydroxyl group (-OH) at the respective 3' position of the given monomer instead of an ex vivo phosphate moiety. Thus, for example, as shown above in the structure representation of AD05070, the modified nucleotide g at the 3' terminal end of the antisense strand of AM06606-AS has a hydroxyl group positioned at its 3' position. Except where expressly stated otherwise in the present invention, such understandings of those skilled in the art are used in describing the HBV RNAi agents and the compositions of the HBV RNAi agents disclosed in the present invention.

[0146] The directing groups and linking groups, for which their chemical structures are given below in Table 6, include the following: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense tape and / or antisense tape may have any of the above-mentioned direction groups or link groups, as well as other direction or link groups attached to the 5' and / or 3' end of the sequence. Table 3. Antisense strand sequences of the HBV RNAi agent. Antisense tape ID Modified sequence (5'^ 3') SEQ ID NO. Unmodified sequence (5'^ 3') SEQ ID NO. AM03508AS usAfscCfaAfu UfuAfuGfcCfu AfcAfgGfccsusuAu 61 UACCAAUUUAUGCCU ACAGGCCUUAU 149 AM04441AS usAfscCfaAfu UfuAfuGfcCfu AfcAfgGfcscsu 62 UACCAAUUUAUGCCU ACAGGCCU 150 AM04442AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfgGfccsu 63 UACCAAUUUAUGCCU ACAGGCCU 150 AM04443AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfgGfsc 64 UACCAAUUUAUGCCU ACAGGC 151 Petition 870250071938, dated 08 / 14 / 2025, page 134 / 535 123 / 233 AM04661AS usGfsugaAfgCfGfaaguGfc Afcacsusu 65 UGUGAAGCGAAGUGC ACACUU 152 AM04768AS usAfscCfaAfu UfuAfuGfcCfu AfcAfgCfcsusccgc 66 UACCAAUUUAUGCCU ACAGCCUCCGC 153 AM04769AS vpusAfscCfaAfu UfuAfu GfcC fuAfcAfgCfcsusccgc 67 UACCAAUUUAUGCCU ACAGCCUCCGC 153 AM05011AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfgusu 68 UACCAAUUUAUGCCU ACAGUU 154 AM05012AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfggsc 69 UACCAAUUUAUGCCU ACAGGC 151 AM05013AS vpusAfscsCfaAfu UfuAfuGfc CfuAfcAfgGfsc 70 UACCAAUUUAUGCCU ACAGGC 151 AM05014AS vpusAfscsCfaAfu UfuAfuGfc CfuAfcAfgusu 71 UACCAAUUUAUGCCU ACAGUU 154 AM05052AS asUfsusGfaGfaGfaAfgUfcC faCfcAfcGfsa 72 AUUGAGAGAAGUCCA CCACGA 155 AM05053AS asUfsusGfaGfaGfaAfgUfcC faCfcAfcgsa 73 AUUGAGAGAAGUCCA CCACGA 155 AM05054AS asUfsusGfaGfaGfaAfgUfcC faCfcAfcusu 74 AUUGAGAGAAGUCCA CCACUU 156 AM05055AS vpusUfsusGfaGfaGfaAfgUf cCfaCfcAfcGfsa 75 UUUGAGAGAAGUCCA CCACGA 157 AM05056AS asAfsusUfgAfgAfgAfaGfuCf cAfcCfaCfsg 76 AAUUGAGAGAAGUCC ACCACG 158 AM05057AS asAfsusUfgAfgAfgAfaGfuCf cAfcCfacsg 77AAUUGAGAGAAGUCC ACCACG 158 AM05058AS asAfsusUfgAfgAfgAfaGfuCf cAfcCfausu 78 AAUUGAGAGAAGUCC ACCAUU 159 AM05060AS vpusAfsusUfgAfgAfgAfaGf uCfcAfcCfaCfsg 79 WOW U GAGAGAAG UCC ACCACG 160 AM05351AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfgGfsu 80 UACCAAUUUAUGCCU ACAGGU 161 AM05608AS usAfscCfaAfu UfuAfuGfcCfu AfcAfgsusu 81 UACCAAUUUAUGCCU ACAGUU 154 AM05609AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfgcsc 82 UACCAAUUUAUGCCU ACAGCC 162 AM05610AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfgccusu 83 UACCAAUUUAUGCCU ACAGCCUU 163 Petition 870250071938, dated 08 / 14 / 2025, page 135 / 535 124 / 233 AM05611AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfgccusc 84 UACCAAUUUAUGCCU ACAGCCUC 164 AM05612AS usAfscscaauUfuAfuGfcCfu acagcsc 85 UACCAAUUUAUGCCU ACAGCC 162 AM05613AS usAfscscaauUfuAfuGfcCfu acagccusu 86 UACCAAUUUAUGCCU ACAGCCUU 163 AM05614AS usAfscscaauUfuAfuGfcCfu acagccusc 87 UACCAAUUUAUGCCU ACAGCCUC 164 AM05618AS asUfsusgagaGfaAfgUfcCfa ccacusu 88 AUUGAGAGAAGUCCA CCACUU 156 AM05621AS usUfsusGfaGfaGfaAfgUfcC faCfcAfcusu 89 UUU GAGAGAAG UCCA CCACUU 165 AM05623AS asUfsusGfaGfaGfaAfgUfcC faCfcAfcggusu 90 AUUGAGAGAAGUCCA CCACGGUU 166 AM05626AS asUfsusgagaGfaAfgUfcCfa ccacggusu 91 AUUGAGAGAAGUCCA CCACGGUU 166 AM05628AS asUfsusGfaGfaGfaAfgUfcC faCfcAfcgagsu 92 AUUGAGAGAAGUCCA CCACGAGU 167 AM05631AS usAfsusUfgAfgAfgAfaGfuCf cAfcCfaCfsg 93 UAUUGAGAGAAGUCC ACCACG 160 AM05632AS usAfsusugagAfgAfaGfuCfc accacsg 94 UAUUGAGAGAAGUCC ACCACG 160 AM05633AS usAfsusUfgAfgAfgAfaGfuCf cAfcCfaCfgusu 95 UAUUGAGAGAAGUCC ACCACGUU 168 AM05634AS usAfsusugagAfgAfaGfuCfc accacgasg 96 UAUUGAGAGAAGUCC ACCACGAG 169AM05635AS usAfsusUfgAfgAfgAfaGfuCf cAfcCfaCfgasg 97 UAUUGAGAGAAGUCC ACCACGAG 169 AM05637AS usAfsusUfgAfgAfgAfaGfuCf cAfcCfaCfgsa 98 UAUUGAGAGAAGUCC ACCACGA 170 AM05638AS usAfsusugagAfgAfaGfuCfc accacgsa 99 UAUUGAGAGAAGUCC ACCACGA 170 AM05747AS asGfsasAfaAfuugagAfgAfa GfuCfcAfsc 100 AGAAAAUUGAGAGAA GUCCAC 171 AM05849AS usAfscsCfaAfu uua uGfcCfu AfcAfgusu 101 UACCAAUUUAUGCCU ACAGUU 154 AM05850AS usAfscsCfaAfu uua uGfcCfu AfcAfgcsc 102 UACCAAUUUAUGCCU ACAGCC 162 Petition 870250071938, dated 08 / 14 / 2025, page 136 / 535 125 / 233 AM05851AS u sAfscsCfaAfu uua uGfcCfu AfcAfgcusu 103 UACCAAUUUAUGCCU ACAGCUU 172 AM05852AS u sAfscsCfaAfu uua uGfcCfu AfcAfgccsu 104 UACCAAUUUAUGCCU ACAGCCU 173 AM05853AS u sAfscsCfaAfu uua uGfcCfu AfcAfgccusu 105 UACCAAUUUAUGCCU ACAGCCUU 163 AM05854AS usAfscsCfaAfu uua uGfcCfu AfcAfgccusc 106 UACCAAUUUAUGCCU ACAGCCUC AM05855AS cPrpusAfscsCfaAfgAfgAfcAfcAfcFsg 107 UACCAAUUUAUGCCU ACAGUU 154 AM05860AS cPrpu sAfsus U fgAfgAfgAfa GfuCfcAfcCfaCfsg 108 UAUUGAGAGAAGUCC ACCACG 160 AM05862AS usAfsusUfgAfgagaaGfuCfc AfcCfausu 109 UAUUGAGAGAAGUCC ACCAUU 174 AM05863AS usAfsusUfgAfgagaaGfuCfc AfcCfacsg 110 UAUUGAGAGAAGUCC ACCACG 160 AM05864AS usAfsusUfgAfgagaaGfuCfc AfcCfacsusu 111 UAUUGAGAGAAGUCC ACCACGA 175 AM05865AS usAfsusUfgAfgagaaGfuCfc AfcCfacsgsa 112 UAUUGAGAGAAGUCC ACCACGA 170 AM05867AS vpusAfsusUfgAfgagaaGfuC fcAfcCfaCfsg 113 UAUUGAGAGAAGUCC ACCACG 160 AM05873AS usUfsusGfaGfagaagUfcCfa CfcAfcusu 114 UUUGAGAGAAGUCCA CCACUU 165 AM05874AS usUfsusGfaGfagaagUfcCfa CfcAfcgsaUUUGAGAGAAGUCCA CCACGA 157 AM05875AS usUfsusGfaGfagaagUfcCfa CfcAfcgusu 116 UUUGAGAGAAGUCCA CCACGUU 176 AM05876AS usUfsusGfaGfagaagUfcCfa CfcAfcgasg 117 UUUGAGAGAAGUCCA CCACGAG 177 AM05877AS cPrpusUfsusGfaGfaGfaAfg UfcCfaCfcAfcusu 118 UUUGAGAGAAGUCCA CCACUU 165 AM06074AS cPrpusAfsusUfgAfgagaaGf uCfcAfcCfacsusu 119 UAUUGAGAGAAGUCC ACCACUU 175 AM06142AS usAfsusUfgAfgagaaGfuCfc AfcCfacusu 120 UAUUGAGAGAAGUCC ACCACUU 175 AM06143AS usAfsusUfgAfgagaaGfuCfc AfcCfacgusu 121 UAUUGAGAGAAGUCC ACCACGUU 168 Petition 870250071938, dated 08 / 14 / 2025, page 137 / 535 126 / 233 AM06144AS usAfsusUfgAfgagaaGfuCfc AfcCfacuus (invAb) 122 UAUUGAGAGAAGUCC ACCACUU 175 AM06145AS usAfsusUfgAfgagaaGfuCfc AfcCfacgasg 123 UAUUGAGAGAAGUCC ACCACGAG 169 AM06222AS usAfsusUfgAfgAfaGfuCf cAfcCfacusu 124 UAUUGAGAGAAGUCC ACCACUU 175 AM06281AS asGfsasAfaAfu UfgAfgAfgAf aGfuCfcusu 125 AGAAAAUUGAGAGAA GUCCUU 178 AM06282AS asGfsasAfaAfu UfgAfgAfgAf aGfuCfcasc 126 AGAAAAUUGAGAGAA GUCCAC 171 AM06283AS asGfsasAfaAfu UfgAfgAfgAf aGfuCfcacusu 127 AGAAAAUUGAGAGAA GUCCACUU 179 AM06284AS asGfsasAfaAfu UfgAfgAfgAf aGfuCfcacsc 128 AGAAAAUUGAGAGAA GUCCACC 180 AM06285AS usGfsasAfaAfu UfgAfgAfgAf aGfuCfcusu 129 UGAAAAUUGAGAGAA GUCCUU 152 AM06286AS usGfsasAfaAfu UfgAfgAf aGfuCfcasc 130 UGAAAAUUGAGAGAA GUCCAC 181 AM06299AS asCfscsAfaUfuUfaUfgCfcUf aCfaGfcusu 131 ACCAAUUUAUGCCUA CAGCUU 182 AM06300AS asCfscsAfaUfuUfaUfgCfcUf aCfaGfccusu 132 ACCAAUUUAUGCCUA CAGCCUU 183 AM06301AS asCfscsAfaUfuUfaUfgCfcUf aCfaGfccusc 133 ACCAAUUUAUGCCUA CAGCCUC 184 AM06302AS usCfscsAfaUfuUfaUfgCfcUf aCfaGfccusu134 UCCAAUUUAUGCCUA CAGCUU 185 AM06303AS usCfscsAfaUfuUfaUfgCfcUf aCfaGfccusu 135 UCCAAUUUAUGCCUA CAGCCUU 186 AM06463AS cPrpusAfscsCfaAfuUfuAfu GfcCfuAfcAfgcsc 136 UACCAAUUUAUGCCU ACAGCC 162 AM06464AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfgscsc 137 UACCAAUUUAUGCCU ACAGCC 162 AM06465AS cPrpusAfscsCfaAfuUfuAfu GfcCfuAfcAfgscsc 138 UACCAAUUUAUUGCCU ACAGCC 162 AM06604AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfgcsu 139 UACCAAUUUAUGCCU ACAGCU 187 AM06606AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfgcsg 140 UACCAAUUUAUGCCU ACAGCG 188 Petition 870250071938, dated 08 / 14 / 2025, page 138 / 535 127 / 233 AM06608AS asAfscsCfaAfu UfuAfuGfcCf uAfcAfgcsc 141 AACCAAUUUAUGCCU ACAGCC 189 AM06611AS usAfscsCfaAfu UfUfAfuGfc CfuAfcAfgusu 142 UACCAAUUUAUGCCU ACAGUU 154 AM06612AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfgCfsc 143 UACCAAUUUAUGCCU ACAGCC 162 AM06614AS asCfscAfaUfuUfaUfgCfcUf aCfaGfcCfsu 144 ACCAAUUUAUGCCUA CAGCCU 190 AM06616AS usCfscAfaUfuUfaUfgCfcUf aCfaGfcCfsu 145 UCCAAUUUAUGCCUA CAGCCU 191 AM06618AS asCfscAfaUfuUfaUfgCfcUf aCfaGfccsg 146 ACCAAUUUAUGCCUA CAGCCG 192 AM06620AS usCfscAfaUfuUfaUfgCfcUf aCfaGfccsg 147 UCCAAUUUAUGCCUA CAGCCG 193 AM06751AS usAfscsCfaAfu UfuAfuGfcCf uAfcAfggsg 148 UACCAAUUUAUGCCU ACAGGG 194 Table 4. Sense strand sequences of the HBV RNAi agent. Tape ID Modified Sequence (5'^ 3') SEQ ID NO. Unmodified Sequence (5'^ 3') SEQ ID NO. AM04444SS (NAG25)uusgsccuguagGf CfAfuaaauugguaus(invdT ) 195 UUGCCUGUAGGCAUA AAUUGGUAUT 275 AM04445SS (NAG25)uauausgsccugua gGfCfAfuaaauuggu(invdA ) 196 UAUAUGCCUGUAGGC AUAAAUUGGUA 276 AM04767SS (NAG25)gcggagsgcuguag GfCfAfuaaauuggTM(invd A) 197 GCGGAGGCUGUAGGC AUAAAUUGGTA 277 AM05010SS (NAG25)scsuguagGfCfAf uaaauugguauus(invAb) 198 CUGUAGGCAUAAAUU GGUAUU 278 AM05015SS (NAG25)sgsccuguagGfCf Afuaaauuggas(invAb) 199 GCCUGUAGGCAUAAA UUGGUA 279 AM05016SS (NAG25)sgsccuguagGfCf Afuaaauuggus(invdA) 200 GCCUGUAGGCAUAAA UUGGUA 279 AM05017SS (NAG25)sgsccuguagGfCf AfuaaauugguAMs(invAb) 201 GCCUGUAGGCAUAAA UUGGUA 279 Petition 870250071938, dated 08 / 14 / 2025, page 139 / 535 128 / 233 Tape ID Modified Sequence (5'^ 3') SEQ ID NO. Unmodified Sequence (5'^ 3') SEQ ID NO. AM05018SS (NAG25)sgsccuguagGfCf AfuaaauuggTMAMs(invA b) 202 GCCUGUAGGCAUAAA UUGGTA 280 AM05019SS (NAG25)sasacuguagGfCf Afuaaauuggas(invAb) 203 AACUGUAGGCAUAAA UUGGUA 281 AM05034SS (NAG25)suscguggugGfAf Cfuucucucaaus(invAb) 204 UCGUGGUGGACUUCU CUCAAU 282 AM05046SS (NAG25)sasaguggugGfAf Cfuucucucaaus(invAb) 205 AAGUGGUGGACUUCU CUCAAU 283 AM05047SS (NAG25)suscguggugGfAf CfuucucucaAMTMs(invAb ) 206 UCGUGGUGGACUUCU CUCAAT 284 AM05048SS (NAG25)scsgugguggAfCf Ufucucucaauus(invAb) 207 CGUGGUGGACUUCUC UCAAUU 285 AM05049SS (NAG25)sasaugguggAfCf Ufucucucaauus(invAb) 208 AAUGGUGGACUUCUC UCAAUU 286 AM05050SS (NAG25)scsgugguggAfCf UfucucucaaTMTMs(invAb ) 209 CGUGGUGGACUUCUC UCAATT 287 AM05051SS (NAG25)sgsgacuucuCfUf Cfaauuuucuaas(invAb) 210 GGACUUCUCUCAAUU UUCUAA 288 AM05063SS (NAG25)scsgugguggAfCf Ufucucucaauas(invAb) 211 CGUGGUGGACUUCUC UCAAUA 289 AM05064SS (NAG25)suscguggugGfAf Cfuucucucaaas(invAb) 212UCGUGGUGGACUUCU CUCAAA 290 AM05346SS (NAG31 )sasccuguagGfCf Afuaaauuguas(invAb) 213 ACCUGUAGGCAUAAA UUGGUA 291 AM05347SS (NAG31 )s(invAb)s b) 214 CUGUAGGCAUAAAUU GGUA 292 AM05606SS (NAG25)s(invAb)scuguag GfCfAfuaaauuguas(invA b) 215 CUGUAGGCAUAAAUU GGUA 292 AM05607SS (NAG37)scuguag(scuinvAb) GfCfAfuaaauuguas(invA b) 216 CUGUAGGCAUAAAUU GGUA 292 Petition 870250071938, of 14 / 08 / 2025, p. 140 / 535 129 / 233 Fita ID Modified Sequence (5'^ 3') SEQ ID NO. Unmodified sequence (5'^3') SEQ ID NO. AM05615SS (NAG25)s(invAb)sacugua gGfCfAfuaaauugguas(inv Ab) 217 ​​ACUGUAGGCAUAAAU UGGUA 293 AM05616SS (NAG25)sgsgcuguagGfCf Afuaaauugguas(invAb) 218 ​​GGCUGUAGGCAUAAA UGGUA 294 AM05617SS (NAG37)sasaguggugGfAf Cfuucucucaaus(invAb) 219 AAGUGGUGCUCAAUS 283 AM05620SS (NAG25)sasaguggugGfAf Cfuucucucaaus(invAb) 220 AAGUGGUGCUCAAUS(invAb) AM05622SS (NAG25)scscguggugGfAf Cfucucucaus(invAb) 221 CCGUGGUGGACUCAUS 296 AM05624SS (NAG25)s(invAb)sccgugg ugGfAfCfucucuccaus(inv Ab) 222 CCGUGGUGGACUCAUS CUCKOUT 296 AM05627SS (NAG25)scsucguggugGfA fCfuckcuckoo(invAb) 223 CUCKOOCUCKOOCUCKUP UCUCAAU 297 AM05629SS (NAG25)s(invAb)sguggug GfAfCfuckcuckoo(invA b) 224 CAAU CUCKOO GUGGUG 298 AM05630SS (NAG25)s(invAb)sguggug GfAfCfucucucucauusu(inv Ab) 225 CUCKOOCUCKOO CAUUU 299 AM05636SS (NAG25)suscgugguggAfC fUfucucuccauus(invAb) 226 UCGUGGGGGGGGGGGGGGGGGGGGG out 300 AM05639SS (NAG25)s(invAb)sugguggAfCfUfucucucaauus(invA b) 227 UGGUGGACUUCUCUC AAUU 301 AM05640SS (NAG37)s(invAb)suggugg AfCfUfucucucaauus(invA b) 228 UGGUGGACUUCUCUC AAUU 3014AM05746 (NAG25)sgsuggacuuCfUf Cfucaauuuucus(invAb) 229 GUGGACUUCUCUCAA UUUUCU 302 AM05856SS (NAG25)s(invAb)scuguag GfCfAfuaaauugguausu(in vAb) 230 AGGUAGUAGUUUUU88 Petition 870250071938, of 14 / 08 / 2025, p. 141 / 535 130 / 233 Ribbon ID Modified sequence (5'^ 3') SEQ ID NO. Unmodified sequence (5'^ 3') SEQ ID NO. AM05857SS (NAG25)s(invAb)sgcugua gGfCfAfuaaauugguausu(i nvAb) 231 GCUGUAGGCAUAAAU UGGUAUU 303 AM05858SS (NAG25)s(invAb)sggcugu agGfCfAfuauguausu(i nvAb) 231 GGCUGUAGGCAUAAA UUGGUAUU 304 AM05859SS (NAG25)s(invAb)saacugu agGfCfAfuaaauugguausu( invAb) 233 AACUGUAGGCAUAAA UUGGUAUU 305 AM05868SS (NAG2Ab) fCfUfucucucaauauusu(invA b) 234 UGGUGGACUUCUCUC AAUAUU 306 AM05869SS (NAG25)s(invAb)sguggug gAfCfUfucucucaauauusu(in vAb) 235 GUGGUGGACUUCUCU3507070AMUUUU (NAG25)sasaugguggAfCf Ufucucucaauauuu(invAb) 236 AAUGGUGGACUUCUC UCAAUAUU 308 AM05871SS (NAG25)scsgugguggAfCf Ufucucucaauauuu(invAb) 237 CGUGGUGAUUCGAAUUUU309 AM05872SS (NAG31 )scsgugguggAfCf Ufucucucaauas(invAb) 238 CGUGGUGGACUUCUC UCAAUA 289 AM05879SS (NAG25)s(invAb)saagugg ugGfAfCfuucucucaus(inv29AGUUGAAUGAUGAA) 283 AM05880SS (NAG25)s(invAb)sguggug GfAfCfuucucucaaausu(inv Ab) 240 GUGGUGGACUUCUCUCAAAUU 310 AM05881SS (NAG25)s(invAb)scguggu gGfAfCfuucucaausu(i nvAb) 241 CGUGGUGGACUUCUC UCAAUU 311 AM05882SS (NAG25)sacaasagusu(2cuvAb)incuvAbGf AAGUGGUGGACUUCU CUCAAAUU 312 AM05883SS (NAG25)suscguggugGfAf Cfuucucucaausu(invAb) 243 UCGUGGUGGACUUCU CUCAAAUU 313 AM06146SS (NAG37)s(ingug37)s(invg37) gAfCfVAb(in vAb) 244 CAAUAUU STUDY 307 Petition 870250071938, of 08 / 14 / 2025, p. 142 / 535 131 / 233 Tape ID Modified Sequence (5'^ 3') SEQ ID NO. Unmodified Sequence (5'^ 3') SEQ ID NO. AM06147SS (NAG37)s(invAb)scguggu ggAfCfUfucucucaauausu(i nvAb) 245 CGUGGUGGACUUCUC UCAAUAUU 309 AM06148SS (NAG37)s(invAb)scucgug guggAfCfUfucucucaauas(i nvAb) 246 CUCGUGGUGGACUUC UCUCAAUA 314 AM06149SS (NAG37)s(invAb)scucgug guggAfCfUfucucucaauaus u(invAb) 247 CUCGUGGUGGACUUC UCUCAAUAUU 315 AM06150SS (NAG37)s(invAb)sggcugu agGfCfAfuaaauuggas(in vAb) 248 GGCUGUAGGCAUAAA UUGGUA 294 AM06151SS (NAG37)s(invAb)sgaggcu guagGfCfAfuaaauugguas( invAb) su(invAb) 250 GAGGCUGUAGGCAUA AAUUGGUAUU 317 AM06287SS (NAG37)s(invAb)sggacuu CfUfCfucaauuuucus(invA b) 251 GGACUUCUCUCAAUU UUCU 318 AM06288SS (NAG37)s(invAb)sguggac uuCfUfCfucaauuuucus(in vAb) 252 GUGGACUUCUCUCAA UUUUCU 302 AM06289SS (NAG37)s(invAb)sggugga cuuCfUfCfucaauuuucus(i nvAb) 253 GGUGGACUUCUCUCA AUUUUCU 319 AM06290SS (NAG37)s(invAb)sggacuuCfUfCfucaauuuucas(invA b) 254 GGACUUCUCUCAAUU UUCA 320 AM06291SS (NAG37)s(invAb)sguggac uuCfUfCfucaauuuucas(in vAb) 255 GUGGACUUCUCAA UUUU10406SSAM (NAG37)s(invAb)sgcugua GfGfCfauaaauuggus(invA b) 256 GCUGUAGGCAUAAAU UGGU 322 AM06305SS (NAG37)s(invAb)sggcugu aGfGfCfauaaauuggus(inv Ab) 2257 GUAGCAUGCU 32 UGGUUGGU Petition 870250071938, of 14 / 08 / 2025, p. 143 / 535 132 / 233 Fita ID Modified Sequence (5'^ 3') SEQ ID NO. Sequence not modified (5'^ 3') SEQ ID NO. AM06306SS (NAG37)s(invAb)sgaggcu guaGfGfCfauaaauuggus(i nvAb) 258 GAGGCUGUAGGCAUA AAUUGGU 324 AM06307SS (NAG37)s(invAb)sgcugua GfGfCfauaaauuggas(invA b) 259 GCUGUAGGCAUAAAU UGGA 325 AM06308SS (NAG37)s(invAb)sggcugu aGfGfCfauaaauuggas(inv Ab) 260 GGCUGUAGGCAUAAA UUGGA 326 AM06603SS (NAG37)s(invAb)sagcugu agGfCfAfuaaauugguas(in vAb) 261 AGCUGUAGGCAUAAA UUGGUA 327 AM06605SS (NAG37)s(invAb)scgcugu agGfCfAfuaaauugguas(in vAb) 262 CGCUGUAGGCAUAAA UUGGUA 328 AM06607SS (NAG37)s(invAb)sggcugu agGfCfAfuaaauugguus(in vAb) 263 GGCUGUAGGCAUAAA UUGGUU 329 AM06609SS (NAG37)s(invAb)scuguag GfCfAfuaaauugguasuus(i nvAb) 264 CUGUAGGCAUAAAUU GGUAUU 278 AM06610SS (NAG37)s(invAb)scuGfuA fgGfCfAfuAfaAfu UfgGfuas uus(invAb) 265 CUGUAGGCAUAAAUU GGUAUU 278 AM06613SS (NAG37)s(invAb)saggcug uaGfGfCfauaaauuggus(in vAb) 266 AGGCUGUAGGCAUAA AUUGGU 330 AM06615SS (NAG37)s(invAb)saggcug uaGfGfCfauaaauuggas(in vAb) 267AGGCUGUAGGCAUAA AUUGGA 331 AM06617SS (NAG37)s(invAb)scggcug uaGfGfCfauaaauuggus(in vAb) vAb) 269 CGGCUGUAGGCAUAA AUUGGA 333 AM06750SS (NAG37)s(invAb)scccugu agGfCfAfuaaauuggas(in vAb) 270 CCCUGUAGGCAUAAA UUGGUA 334 Petition 870250071938, dated 08 / 14 / 2025, page 144 / 535 133 / 233 Tape ID Modified Sequence (5'^ 3') SEQ ID NO. Unmodified Sequence (5'^ 3') SEQ ID NO. AM06752SS (NAG37)csgcuguagGfCfA fuaaauugguas(invAb) 271 CGCUGUAGGCAUAAA UUGGUA 328 AM06753SS (NAG37)csccuguagGfCfA fuaaauugguas(invAb) 272 CCCUGUAGGCAUAAA UUGGUA 334 AM06776SS (NAG25)s(invAb)sguggac uuCfUfCfucaauuuucus(in vAb) 273 GUGGACUUCUCUCAA UUUUCU 302 AM06777SS (NAG25)s(invAb)scgcugu agGfCfAfuaaauugguas(in vAb) 274 CGCUGUAGGCAUAAA UUGGUA 328

[0147] The HBV RNAi agents described here are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence shown in Table 4 can be hybridized to any antisense strand containing a sequence shown in Table 3, provided that the two sequences have a region of at least about 85% complementarity in a contiguous sequence of 16, 17, 18, 19, 20, or 21 nucleotides.

[0148] In some embodiments, the antisense strand of an HBV RNAi agent disclosed in the present invention differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of an HBV RNAi agent disclosed in the present invention differs by 0, 1, 2, or 3 nucleotides from any of the sense sequences in Table 4.

[0149] In some embodiments, an antisense strand of the HBV RNAi agent comprises a nucleotide sequence from any of the sequences in Table 3. In some embodiments, an antisense strand of the HBV RNAi agent comprises the nucleotide sequence (from the 5' end to the 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 from any of the sequences in Table 3. Petition 870250071938, dated 08 / 14 / 2025, p. 145 / 535 134 / 233

[0150] In some embodiments, a sense strand of the HBV RNAi agent comprises the nucleotide sequence of any of the sequences in Table 4. In some embodiments, a sense strand of the HBV RNAi agent comprises the nucleotide sequence (from the 5' end -> 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4-24, 1-25, 2-25, 3-25, 4-25, 1-26, 2-26, 3-26, or 4-26 from any of the sequences in Table 4.

[0151] For the HBV RNAi agents disclosed in the present invention, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) may be perfectly complementary to an HBV gene, or it may be non-complementary to an HBV gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) forms an A:U or U:A base pair with the sense strand.

[0152] In some embodiments, an antisense strand of the HBV RNAi agent comprises nucleotide sequences (from the 5' end to the 3' end) 2 to 18 or 2 to 19 of any of the antisense sequences in Table 3. In some embodiments, a sine strand of the HBV RNAi agent comprises nucleotide sequences (from the 5' end to the 3' end) 1 to 17 or 1 to 18 of any of the sense sequences in Table 4.

[0153] In some embodiments, an HBV RNAi agent includes (i) an antisense strand comprising nucleotide sequences (from the 5' end to the 3' end) 2 to 18 or 2 to 19 of any of the antisense strand sequences in Table 3, and (ii) a sense strand comprising nucleotide sequences (from the 5' end to the 3' end) 1 to 17 or 1 to 18 of any of the sense strand sequences in Table 4. Petition 870250071938, dated 08 / 14 / 2025, page 146 / 535 135 / 233

[0154] A sense strand containing a sequence shown in Table 4 can be hybridized to any antisense strand containing a sequence mentioned in Table 3, provided that the two sequences have a region of at least about 85% complementarity in a contiguous nucleotide sequence 16, 17, 18, 19, 20, or 21. Representative sequence pairings are exemplified by the ID Nos. duplicates shown in Table 5.

[0155] In some embodiments, an HBV RNAi agent comprises any of the ID Nos. doublets presented herein. In some embodiments, an HBV RNAi agent consists of any of the ID Nos. doublets presented herein. In some embodiments, an HBV RNAi agent comprises the nucleotide sequences of the sense and / or antisense strands of any of the ID Nos. doublets presented herein. In some embodiments, an HBV RNAi agent comprises the nucleotide sequences of the sense and antisense strands of any of the ID Nos. doublets shown herein and a targeting group and / or linking group in which the targeting group and / or linking group is covalently linked (i.e., conjugated) to the sense or antisense strand. In some embodiments, an HBV RNAi agent comprises the modified nucleotide sequences of the sense strand and the modified antisense strand of any of the ID Nos. doublets presented herein.In some embodiments, an HBV RNAi agent comprises the nucleotide sequences of the sense strand and the antisense strand of either of the ID Nos. doublets shown herein and a targeting group and / or linking group in which the targeting group and / or linking group is covalently attached to the sense strand or the antisense strand.

[0156] In some embodiments, an HBV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of either of the antisense / sense strand doublets in Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group. Petition 870250071938, dated 08 / 14 / 2025, p. 147 / 535 136 / 233

[0157] In some embodiments, an HBV RNAi agent comprises an antisense strand and a sense strand having nucleotide sequences from any of the antisense and / or sense strand nucleotide sequences from any of the doublets in Table 5, and further comprises a targeting group selected from the group consisting of (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s.

[0158] In some embodiments, an HBV RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the nucleotide sequences of the antisense strand and / or the sense strand of any of the doublets in Table 5.

[0159] In some embodiments, an HBV RNAi agent comprises an antisense strand and a sense strand having modified nucleotide sequences from any of the antisense strand and / or sense strand nucleotide sequences of any of the doublets in Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0160] In some embodiments, an HBV RNAi agent comprises any of the duplicates in Table 5.

[0161] In some embodiments, an HBV RNAi agent consists of any of the duplicates in Table 5. Table 5. Examples of HBV RNAi agent duplicates. Duplex ID Antisense Tape ID Sense Tape ID AD0349 AM03508-AS AM04445- 8 SS Duplex ID Antisense ID Tape ID Sense Tape AD0349 9 AM04441-AS AM04444SS Petition 870250071938, dated 08 / 14 / 2025, p. 148 / 535 137 / 233 ID Duplex Antisense Tape ID Sense Tape ID AD0350 0 AM04442-AS AM04444SS AD0350 1 AM04443-AS AM04444SS AD0373 8 AM04768-AS AM04767SS AD0373 9 AM04769-AS AM04767SS AD0396 7 AM04443-AS AM05010SS AD0396 8 AM05011-AS AM05010SS AD0396 9 AM04443-AS AM05015SS AD0397 0 AM05011-AS AM05019SS AD0397 1 AM05012-AS AM05015SS AD0397 2 AM04443-AS AM05016SS AD0397 3 AM04443-AS AM05017SS AD0397 4 AM04443-AS AM05018SS AD0397 5 AM05013-AS AM05015SS AD0397 6 AM05014-AS AM05019SS AD0397 7 AM05013-AS AM05017SS AD0397 8 AM05013-AS AM04444SS AD0400 1 AM05052-AS AM05034SS AD0400 2 AM05053-AS AM05034SS Duplex ID Antisense Tape ID Sense Tape ID AD0400 3 AM05054-AS AM05046SS AD0400 4 AM05052-AS AM05047SS AD0400 5 AM05055-AS AM05064SS AD0400 6 AM05056-AS AM05048SS AD0400 7 AM05057-AS AM05048SS AD0400 8 AM05058-AS AM05049SS AD0400 9 AM05056-AS AM05050SS AD0401 0 AM05060-AS AM05063SS AD0417 6 AM05351-AS AM05346SS AD0417 7 AM04443-AS AM05347SS AD0417 8 AM05011-AS AM05347SS AD0441 2 AM05011-AS AM05606SS AD0441 3 AM05011-AS AM05607SS AD0441 4 AM05608-AS AM05606SS AD0441 5 AM05011-AS AM05615SS AD0441 6 AM05609-AS AM05616SS AD0441 7 AM05610-AS AM05616SS AD0441 8 AM05611-AS AM05616SS Petition 870250071938, dated 08 / 14 / 2025, page 149 / 535 138 / 233 Dúplex ID Fita antissenso ID Fita senso ID AD0441 9 AM05612-AS AM05616SS AD0442 0 AM05613-AS AM05616SS AD0442 1 AM05614-AS AM05616SS AD0442 2 AM05054-AS AM05617SS AD0442 3 AM05618-AS AM05046SS AD0442 5 AM05621-AS AM05620SS AD0442 6 AM05623-AS AM05622SS AD0442 7 AM05623-AS AM05624SS AD0442 8 AM05626-AS AM05622SS AD0442 9 AM05626-AS AM05624SS AD0443 0 AM05628-AS AM05627SS AD0443 1 AM05054-AS AM05629SS AD0443 2 AM05054-AS AM05630SS AD0443 3 AM05631-AS AM05048SS AD0443 4 AM05632-AS AM05048SS AD0443 5 AM05633-AS AM05048SS AD0443 6 AM05635-AS AM05048SS AD0443 7 AM05634-AS AM05048SS Duplex ID Antisense tape ID Sense tape ID AD0443 8 AM05637-AS AM05636SS AD0443 9 AM05638-AS AM05636SS AD0444 0 AM05058-AS AM05639SS AD0444 1 AM05057-AS AM05639SS AD0444 2 AM05057-AS AM05640SS AD0451 1 AM05747-AS AM05746SS AD0457 0 AM05011-AS AM05856SS AD0457 1 AM05849-AS AM05856SS AD0457 2 AM05850-AS AM05856SS AD0457 3 AM05851-AS AM05857SS AD0457 4 AM05852-AS AM05857SS AD0457 5 AM05853-AS AM05858SS AD0457 6 AM05854-AS AM05858SS A AM0501 AM0 D04577 1-AS 5859-SS A AM0585 AM0 D04578 0-AS 5858-SS A AM0501 AM0 D04579 4-AS 5347-SS Petition 870250071938, dated 08 / 14 / 2025, page 150 / 535 139 / 233 Dúplex ID Fita antissenso ID Fita senso ID AD0458 AM05855-AS AM05347- 0 SS AD0458 AM05860-AS AM05063- 1 SS AD0458 AM05862-AS AM05868- 3 SS AD0458 AM05863-AS AM05868- 4 SS AD0458 AM05864-AS AM05869- 5 SS AD0458 AM05865-AS AM05869- 6 SS AD0458 AM05862-AS AM05870- 7 SS AD0458 AM05863-AS AM05871- 8 SS AD0459 AM05867-AS AM05063- 0 SS AD0459 AM05860-AS AM05872- 1 SS AD0459 AM05054-AS AM05879- 2 SS AD0459 AM05873-AS AM05880- 3 SS AD0459 AM05874-AS AM05880- 4 SS Dúplex ID Fita antissenso ID Fita senso ID AD0459 AM05875-AS AM05881- 5 SS AD0459 AM05876-AS AM05881- 6 SS AD0459 AM05873-AS AM05882- 7 SS AD0459 AM05874-AS AM05883- 8 SS AD0459 AM05877-AS AM05620- 9 SS AD0473 AM06074-AS AM05869- 4 SS AD0477 AM06142-AS AM06146- 1 SS AD0477 AM06143-AS AM06147- 2 SS AD0477 AM06144-AS AM06146- 3 SS AD0477 AM06145-AS AM06148- 4 SS AD0477 AM06145-AS AM06149- 5 SS AD0477 AM05850-AS AM06150- 6 SS AD0477 AM05854-AS AM06151- 7 SS Petição 870250071938, de 14 / 08 / 2025, pág. 151 / 535 140 / 233 Dúplex ID Fita antissenso ID Fita senso ID AD0477 AM05854-AS AM06152- 8 SS AD0482 AM06222-AS AM06146- 2 SS AD0482 AM05609-AS AM06150- 3 SS AD0487 AM06281-AS AM06287- 1 SS AD0487 AM06282-AS AM06288- 2 SS AD0487 AM06283-AS AM06288- 3 SS AD0487 AM06284-AS AM06289- 4 SS AD0487 AM06285-AS AM06290- 5 SS AD0487 AM06286-AS AM06291- 6 SS AD0488 AM06299-AS AM06304- 1 SS AD0488 AM06300-AS AM06305- 2 SS AD0488 AM06301-AS AM06306- 3 SS AD0488 AM06302-AS AM06307- 4 SS Dúplex ID Fita antissenso ID Fita senso ID AD0488 AM06303-AS AM06308- 5 SS AD0496 AM05864-AS AM06146- 2 SS AD0496 AM05855-AS AM05607- 3 SS AD0498 AM06463-AS AM06150- 1 SS AD0498 AM06464-AS AM06150- 2 SS AD0498 AM06465-AS AM06150- 3 SS AD0506 AM06604-AS AM06603- 9 SS AD0507 AM06606-AS AM06605- 0 SS AD0507 AM06608-AS AM06607- 1 SS AD0507 AM05011-AS AM06609- 2 SS AD0507 AM06611-AS AM06610- 3 SS AD0507 AM06612-AS AM06150- 4 SS AD0507 AM06614-AS AM06613- 5 SS Petition 870250071938, dated 08 / 14 / 2025, p. 152 / 535 141 / 233 ID Duplex Antisense Tape ID Sense Tape ID AD0507 6 AM06616-AS AM06615-SS AD0507 7 AM06618-AS AM06617-SS AD0507 8 AM06620-AS AM06619-SS AD0514 7 AM06751-AS AM06750-SS ID Duplex Antisense Tape ID Sense Tape ID AD0514 8 AM06606-AS AM06752-SS AD0514 9 AM06751-AS AM06753-SS AD0516 4 AM06282-AS AM06776-SS AD0516 5 AM06606-AS AM06777-SS

[0162] In some embodiments, an HBV RNAi agent is prepared or supplied as a salt, mixed salt, or free acid. The RNAi agents described herein, upon release into a cell expressing an HBV gene, inhibit or reduce the expression of one or more HBV genes in vivo. Targeting groups, linking groups and application vehicles

[0163] In some embodiments, an HBV RNAi agent is conjugated to one or more non-nucleotide groups including, but not limited to, a targeting group, linking group, release polymer, or a release vehicle. The non-nucleotide group may enhance the targeting, release, or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide group may be covalently linked to the 3' and / or 5' end of the sense and / or antisense strand. In some embodiments, an HBV RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5' end of a sense strand of the HBV RNAi agent. A non-nucleotide group may be linked directly or indirectly to the RNAi agent by means of Petition 870250071938, dated 08 / 14 / 2025, page 153 / 535 142 / 233 a connector / linking group. In some embodiments, a non-nucleotide group is attached to the RNAi agent via a labile, cleavable, or reversible connector or link.

[0164] In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an agent or RNAi conjugate to which it is attached in order to optimize cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, a non-nucleotide group increases the endocytosis of the RNAi agent.

[0165] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate to which they are attached to optimize cell-specific distribution and cell-specific uptake of the conjugate. A targeting group may be monovalent, divalent, trivalent, tetravalent, or have a higher valence. Representative targeting groups include, without limitation, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics with affinity for cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a connector, such as a PEG connector or one, two, or three abasic groups and / or ribitol (basic ribose). In some embodiments, a targeting group comprises a galactose-derived cluster.

[0166] The HBV RNAi agents described herein can be synthesized with a reactive group, such as an amine group, at the 5' terminus. The reactive group can be used to subsequently attach a targeting moiety using methods typical in the art.

[0167] In some embodiments, a targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, a ligand Petition 870250071938, dated 08 / 14 / 2025, page 154 / 535 143 / 233 of asialoglycoprotein receptor includes or consists of one or more galactose derivatives. As used in the present invention, the term galactose derivative includes both galactose and galactose derivatives that have an affinity for the asialoglycoprotein receptor that is equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, N-n-butanoylgalactosamine and N-iso-butanoyl gallate-amine (see, for example: Iobst, ST and Drickamer, KJBC 1996, 271, 6686). Galactose derivatives, and galactose-derived clusters, which are useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the allialoglycoprotein receptor (ASGPr) expressed on the surface of hepatocytes. The binding of ASGPr ligands to ASGPr(s) facilitates specific cell targeting to hepatocytes and endocytosis of the molecule into hepatocytes. ASGPr ligands can be monomeric (e.g., having a single galactose derivative) or multimeric (e.g., having multiple galactose derivatives). The galactose derivative or galactose-derived cluster can be attached to the 5' or 3' end of the RNAi polynucleotide using methods known in the art. The preparation of targeting groups, such as galactose-derived clusters, is described, for example, in US patent applications serial numbers 15 / 452,324 and 15 / 452,423, the contents of which are incorporated herein in their entirety.

[0168] As used in the present invention, a galactose-derived cluster comprises a molecule having two to four terminal galactose derivatives. A terminal galactose derivative is linked to a molecule through its C-1 carbon. In some embodiments, the galactose-derived cluster is a derived trimer. Petition 870250071938, dated 08 / 14 / 2025, p. 155 / 535 144 / 233 galactose (also called triantennary galactose derivative or trivalent galactose derivative). In some embodiments, the galactose-derived cluster comprises N-acetylgalactosamines. In some embodiments, the galactose-derived cluster comprises three N-acetylgalactosamines. In some embodiments, the galactose-derived cluster is a galactose-derived tetramer (also called tetraantennary galactose derivative or tetravalent galactose derivative). In some embodiments, the galactose-derived cluster comprises four N-acetylgalactosamines.

[0169] As used in the present invention, a galactose-derived trimer contains three galactose derivatives, each linked to a central branching point. As used in the present invention, a galactose-derived tetramer contains four galactose derivatives, each linked to a central branching point. The galactose derivatives can be attached to the central branching point through the C-1 carbons of the saccharides. In some embodiments, the galactose derivatives are connected to the branching point by means of connectors or spacers. In some embodiments, the connector or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, US Patent No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer.The branching point can be any small molecule that allows the binding of three galactose derivatives and also allows the attachment of the branching point to the RNAi agent. An example of a branching group is di-lysine or di-glutamate. The binding of the branching point to the RNAi agent can occur through a connector or spacer. In some embodiments, the connector or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the connector comprises a rigid connector, such as a cyclic group. In some embodiments, a galactose derivative comprises or consists of N. Petition 870250071938, dated 08 / 14 / 2025, p. 156 / 535 145 / 233 acetylgalactosamine. In some embodiments, the galactose derivative group comprises a galactose-derived tetramer, which may be, for example, an N-acetylgalactosamine tetramer.

[0170] In some embodiments, pharmaceutical compositions are described for the release of an HBV RNAi agent to a liver cell in vivo. Such pharmaceutical compositions may include, for example, an HBV RNAi agent conjugated to a galactose-derived cluster. In some embodiments, the galactose-derived group comprises a galactose-derived trimer, which may be, for example, an N-acetylgalactosamine tetramer, or a galactose derivative, which may be, for example, an N-acetylgalactosamine tetramer.

[0171] Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27)4(NAG27)s, (NAG28)4(NAG28)s, (NAG29)4(NAG29)s, (NAG30)4(NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s. Other targeting groups, including galactose cluster targeting ligands, are known in the art.

[0172] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates the covalent attachment of the agent to a targeting group or release polymer or application vehicle. The linking group may be attached to the 3' or 5' end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is attached to the antisense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' or 3' end of a sense strand of the RNAi agent. In some embodiments, a linking group is conjugated to the 5' end of a sense strand of the RNAi agent. Examples of linking groups include, but are not limited to: Petition 870250071938, dated 08 / 14 / 2025, p. 157 / 535 146 / 233 reactive groups such as primary amines and alkynes, alkyl groups, abasic nucleosides, ribitol (abasic ribose) and / or PEG groups.

[0173] A connector or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or release polymer) or segment of interest through one or more covalent bonds. A labile connection contains a labile linkage. A linkage may optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and / or length to the connection. Spacers may include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkinyl groups; each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of the description.

[0174] Any of the HBV RNAi agent nucleotide sequences mentioned in Tables 3 and 4, modified or unmodified, may contain a 3' or 5' targeting group and / or linking group. Any of the HBV RNAi agent sequences mentioned in Tables 3 and 4 that contain a 3' or 5' targeting group and / or linking group may alternatively contain no 3' or 5' targeting group and / or linking group, or may contain a different 3' or 5' targeting group and / or linking group including, but not limited to, those shown in Table 3. Any of the HBV RNAi agent duplicates mentioned in Table 5, modified or unmodified, may further comprise a targeting group and / or linking group, including, but not limited to, those shown in Table 3, and the targeting group or linking group may be attached to the 3' or 5' end of the sense and / or antisense strand of the HBV RNAi agent duplex. Petition 870250071938, dated 08 / 14 / 2025, p. 158 / 535 147 / 233

[0175] Examples of targeting groups and linking groups are provided in Table 6. Table 4 provides various embodiments of HBV RNAi sense strands that have a targeting group or linking group attached to the 5' or 3' end. Petition 870250071938, dated 08 / 14 / 2025, p. 159 / 535 148 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 160 / 535 149 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 161 / 535 150 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 162 / 535 151 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 163 / 535 152 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 164 / 535 153 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 165 / 535 154 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 166 / 535 155 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 167 / 535 156 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 168 / 535 157 / 233 (NAG32)s NAG Petition 870250071938, dated 08 / 14 / 2025, p. 169 / 535 158 / 233 (NAG34)s Petition 870250071938, dated 08 / 14 / 2025, p. 170 / 535 159 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 171 / 535 160 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 172 / 535 161 / 233 Petition 870250071938, dated 08 / 14 / 2025, p. 173 / 535 162 / 233

[0176] In each of the structures above in Table 6, NAG comprises an N-acetylgalactosamine or another ASGpr ligand, as would be understood by one skilled in the art, to be determined by the structures above and the description given herein. For example, in some embodiments, NAG in the structures given in Table 6 is represented by the following structure: (N-acetylgalactosamine)

[0177] Each (NAGx) can be attached to an HBV RNAi agent via a phosphate group (as in (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group, (as in (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group. O li I - op—I I- * THE O ii i - op—i I- * S Petition 870250071938, dated 08 / 14 / 2025, p. 174 / 535 163 / 233 Phosphate groupphosphorothioate group

[0178] Other linking groups known in the art may be used. Release vehicles

[0179] In some embodiments, a delivery vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that optimizes the delivery of the RNAi agent to a cell or tissue. A delivery vehicle may include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane-active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane-active polyamine.

[0180] In some embodiments, RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art. RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to, cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example, WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141), which are incorporated herein by reference), or other delivery systems available in the art. Pharmaceutical compositions and formulations

[0181] The HBV RNAi agents disclosed in the present invention can be prepared as pharmaceutical compositions or formulations. In some embodiments, the pharmaceutical compositions include at least one HBV RNAi agent. These pharmaceutical compositions are particularly useful in inhibiting the expression of the target mRNA in a target cell, a group of cells, a tissue, or a Petition 870250071938, dated 08 / 14 / 2025, page 175 / 535 164 / 233 organ. Pharmaceutical compositions can be used to treat an individual who has a disease or disorder that would benefit from a reduction in the level of the target mRNA, or from inhibition of the expression of the target gene. Pharmaceutical compositions can be used to treat an individual at risk of developing a disease or disorder that would benefit from a reduction in the level of the target mRNA or from an inhibition of the expression of the target gene. In one embodiment, the method includes administering an HBV RNAi agent linked to a targeting ligand, as described herein, to an individual to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents and / or delivery polymers) are added to pharmaceutical compositions including an HBV RNAi agent, thus forming a pharmaceutical formulation suitable for in vivo release to a human.

[0182] Pharmaceutical compositions that include an HBV RNAi agent and the methods disclosed in the present invention can decrease the level of the target mRNA in a cell, group of cells, tissue or individual, including: administering to the individual a therapeutically effective amount of an HBV RNAi agent described herein, thereby inhibiting the expression of a target mRNA in the individual.

[0183] In some embodiments, the described pharmaceutical compositions that include an HBV RNAi agent are used to treat or manage clinical presentations associated with HBV infection. In some embodiments, a therapeutically or prophylactically effective amount of one or more of the pharmaceutical compositions is administered to an individual who requires such treatment, prevention, or management. In some embodiments, administration of any of the disclosed HBV RNAi agents may be used to decrease the number, severity, and / or frequency of symptoms of a disease in an individual. Petition 870250071938, dated 08 / 14 / 2025, p. 176 / 535 165 / 233

[0184] The described pharmaceutical compositions that include an HBV RNAi agent can be used to treat at least one symptom in an individual who has a disease or disorder that would benefit from reduction or inhibition in HBV mRNA expression. In some embodiments, the individual is administered a therapeutically effective amount of one or more pharmaceutical compositions that include an HBV RNAi agent, thus treating the symptom. In other embodiments, the individual is administered a prophylactically effective amount of one or more HBV RNAi agents, thus preventing at least one symptom.

[0185] The route of administration is the way in which an HBV RNAi agent comes into contact with the body. In general, methods of administering drugs and nucleic acids for the treatment of a mammal are well known in the art and can be applied to the administration of the compositions described herein. The HBV RNAi agents disclosed in the present invention can be administered via any suitable route in a preparation appropriately tailored to the specific route. Thus, the pharmaceutical compositions described herein can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, intra-articularly, or intraperitoneally. In some embodiments, the pharmaceutical compositions described herein are administered via subcutaneous injection.

[0186] The pharmaceutical compositions that include an HBV RNAi agent described herein can be delivered to a cell, group of cells, tumor, tissue, or individual using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be achieved by local administration (e.g., direct injection, implantation, or administration). Petition 870250071938, dated 08 / 14 / 2025, page 177 / 535 topical 166 / 233), systemic administration, or subcutaneous, intravenous, intraperitoneal or parenteral routes, including intraventricular (e.g., intraventricular, intraparenchymal and intrathecal), nasal, oral, rectal or topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

[0187] Consequently, in some embodiments, the pharmaceutical compositions described herein may comprise one or more pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical compositions described herein may be formulated for administration to an individual.

[0188] As used in the present invention, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the active pharmaceutical ingredient (API, therapeutic product, e.g., HBV RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients may act to a) assist in the processing of the drug delivery system during its manufacture, b) protect, support or enhance the stability, bioavailability or patient acceptability of the API, c) assist in product identification and / or d) enhance any other general attribute of the safety, effectiveness or dispensing of the API during storage or use.A pharmaceutically acceptable excipient may or may not be an inert substance.

[0189] Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffering agents, carriers, coating agents, colorants, Petition 870250071938, dated 08 / 14 / 2025, page 178 / 535 167 / 233 release enhancers, release polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline solution, salts, solvents, sugars, suspending agents, sustained-release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water, repellent agents, and humectants.

[0190] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (if water-soluble) or sterile dispersions and powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline solution, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ, USA) or phosphate-buffered saline (PBS). It must be stable under manufacturing and storage conditions and must be preserved against contamination by microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid poly(ethylene glycol), and suitable mixtures thereof. Adequate fluidity may be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersion, and by the use of surfactants.In many cases, it will be preferable to include isotonic agents in the composition, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride. Prolonged absorption of injectable compositions can be achieved by including an absorption-delaying agent in the composition, for example, aluminum monostearate and gelatin.

[0191] Sterile injectable solutions can be prepared by incorporating the active compound in the required quantity into a suitable solvent with one or more of the ingredients listed above, if necessary, followed by sterilization by filtration. In general, dispersions are Petition 870250071938, dated 08 / 14 / 2025, page 179 / 535 168 / 233 prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the other necessary ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preparation methods include vacuum drying and lyophilization, which produce a powder of the active ingredient plus any desired additional ingredient from a solution previously sterilized by filtration thereof.

[0192] Suitable formulations for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, as an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for intra-articular and ophthalmic administration.

[0193] Active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene-vinyl acetate polymers, polyanhydrides, poly(glycolic acid), collagen, polyorthoesters, and poly(lactic acid). Methods for preparing such formulations will be evident to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in US Patent No. 4,522,811.

[0194] HBV RNAi agents may be formulated in dosage unit compositions to facilitate administration and uniformity of dosage. The term dosage unit form, as used herein, refers to physically separate units suitable as unit dosages for the individual to be treated; each unit containing a predetermined amount of compound. Petition 870250071938, dated 08 / 14 / 2025, page 180 / 535 169 / 233 active calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification of the dosage unit forms of the disclosed modalities is dictated by, and directly dependent on, the unique characteristics of the antibody and the specific therapeutic effect to be achieved, and the inherent limitations of the technique of compounding such an active compound for the treatment of individuals.

[0195] A pharmaceutical composition may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: antipruritic, astringent, local anesthetic, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also anticipated that isolated cells, tissues, or organs expressing or comprising the RNAi agents defined herein may be used as pharmaceutical compositions. As used in the present invention, pharmacologically effective amount, therapeutically effective amount, or simply effective amount refers to that amount of an RNAi agent to produce a pharmacological, therapeutic, or preventive result.

[0196] In general, an effective amount of an active compound will be in the range of about 0.1 to about 100 mg / kg body weight / day, for example, about 1.0 to about 50 mg / kg body weight / day. In some embodiments, an effective amount of an active compound will be in the range of about 0.25 to about 5 mg / kg body weight per dose. In some embodiments, an effective amount of an active ingredient will be in the range of about 0.5 to about 3 mg / kg body weight per dose. The amount administered will also likely depend on such variables as the patient's general health status, the relative biological efficacy of the released compound, the drug formulation, the presence and types of excipients in the formulation, and the route of administration. Furthermore, it should be understood that the initial dosage administered may be increased beyond the upper level above to Petition 870250071938, dated 08 / 14 / 2025, page 181 / 535 170 / 233 to rapidly reach the desired blood or tissue level, or the initial dosage may be lower than the ideal level.

[0197] For the treatment of disease or for the formation of a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein including an HBV RNAi agent may be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment and / or a vaccine.

[0198] The HBV RNAi agents described, when added to pharmaceutically acceptable excipients or adjuvants, may be packaged in kits, containers, packs or dispensers. The pharmaceutical compositions described herein may be packaged in pre-filled syringes or vials. Treatment methods and inhibition of expression

[0199] The HBV RNAi agents disclosed in the present invention can be used to treat an individual (e.g., a human or mammal) who has a disease or disorder that would benefit from administration of the compound. In some embodiments, the RNAi agents disclosed herein can be used to treat an individual (e.g., a human) having a disease or disorder that would benefit from reduction or inhibition in HBV mRNA expression. The individual is administered a therapeutically effective amount of any one or more RNAi agents. The individual may be a human patient or an animal. The individual may be an adult, adolescent, child, or infant. The pharmaceutical compositions described including an HBV RNAi agent can be used to provide methods for the therapeutic treatment of diseases. Such methods include administering a pharmaceutical composition described herein to a human or animal. Petition 870250071938, dated 08 / 14 / 2025, p. 182 / 535 171 / 233

[0200] In some embodiments, the HBV RNAi agents described herein are used to treat an individual infected with HBV. In some embodiments, the HBV RNAi agents described are used to treat at least one symptom in an individual who has an HBV infection. The individual is administered a therapeutically effective amount of any one or more of the described RNAi agents.

[0201] In some embodiments, the individual has an HBV infection and also an HDV infection. In some embodiments, the HBV RNAi agents described herein are used to treat an individual infected with both HBV and HDV. In some embodiments, the HBV RNAi agents described are used to treat at least one symptom in an individual who has either an HBV infection or an HDV infection. The individual is administered a therapeutically effective amount of any one or more of the described RNAi agents.

[0202] In some embodiments, HBV RNAi agents are used to treat or manage a clinical presentation in which an individual is infected with HBV. The individual is administered a therapeutically effective amount of one or more of the HBV RNAi agents or compositions containing the HBV RNAi agent described herein. In some embodiments, the method comprises administering a composition comprising an HBV RNAi agent described herein to an individual to be treated.

[0203] In some embodiments, the gene expression level and / or mRNA level of an HBV gene in an individual to whom a described HBV RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the individual before administration of the HBV RNAi agent or to an individual who did not receive the HBV RNAi agent. The gene expression level and / or mRNA level in the individual may be reduced Petition 870250071938, dated 08 / 14 / 2025, p. 183 / 535 172 / 233 in a cell, group of cells, and / or tissue of the individual. In some embodiments, the protein expressed level of an HBV gene in an individual to whom a described HBV RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the individual before administration of the HBV RNAi agent or to an individual who did not receive the HBV RNAi agent. The protein level in an individual can be reduced in a cell, group of cells, tissue, blood, and / or other fluid of the individual.For example, in some embodiments, the amount or level of hepatitis B surface antigen (HBsAg) in an individual to whom a described HBV RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the individual before administration of the HBV RNAi agent or to an individual who did not receive the HBV RNAi agent. In some embodiments, the amount or level of hepatitis B e antigen (HBeAg) in an individual who has been administered a described HBV RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the individual before administration of the HBV RNAi agent or to an individual who did not receive the HBV RNAi agent.In some embodiments, the amount or level of serum HBV DNA in an individual who has been administered a described HBV RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the individual before administration of the HBV RNAi agent or to an individual who did not receive the HBV RNAi agent. A reduction in the presence of serum HBV DNA, HBV gene expression, HBV mRNA, or amounts thereof. Petition 870250071938, dated 08 / 14 / 2025, page 184 / 535 173 / 233 HBV protein levels can be assessed by methods known in the art. The reduction or decrease in the amount or level of HBV mRNA, the amount or level of expressed protein, and / or the amount or level of serum HBV DNA, is collectively referred to in the present invention as a reduction or decrease in HBV or inhibition or reduction of HBV expression. Non-human cells and tissues and organisms

[0204] Non-human cells, tissues, and organisms that include at least one of the HBV RNAi agents described herein are contemplated. The non-human cell, tissue, or organism is produced by applying the RNAi agent to the non-human cell, tissue, or organism.

[0205] The modalities and items provided above are now illustrated with the following non-limiting examples. Examples Example 1. Synthesis of HBV RNAi agents.

[0206] The HBV RNAi agent duplicates shown in Table 5 were synthesized as follows: A. Synthesis. The sense and antisense strands of the HBV RNAi agents were synthesized using solid-phase phosphoramidite technology employed in oligonucleotide synthesis. Depending on the scale, a MerMade96E® X (Bioautomation), a MerMade12 X® (Bioautomation), or a Pilot OP 100 (GE Healthcare) was used. Synthesis was performed on a solid support made from controlled pore glass (CPG), 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA. The RNA and 2'-modified phosphoramidite were all acquired from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the following 2'-O-methyl-phosphoramidites were used: (5'-O-dimethoxytrityl-N6-(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxy-trityl-N4-(acetyl)-2'-O-methyl-cytidine-3'-O-(2 Petition 870250071938, dated 08 / 14 / 2025, page 185 / 535 174 / 233 cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5'-O-dimethoxytritil-N2-(isobutyryl)-2'-O-methylguanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5'-O-dimethoxytritil-2'-O-methyluridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2'-deoxy-2'-fluorophosphoramidites have the same protecting groups as the 2'-O-methylamidites. The (3'-O-dimethoxytritil-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were acquired from ChemGenes (Wilmington, (MA, USA). Phosphoramidites containing the targeting ligand were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) followed by the addition of molecular sieves (33 A). 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activation solution.The coupling times were 12 min (RNA), 15 min (targeting ligand), 90 seconds (2'OMe), and 60 seconds (2'F). To introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl-1,2,4-dithiazoline-5-one (POS, obtained from Leominster, MA, USA) in anhydrous acetonitrile was used. B. Cleavage and deprotection of the oligomer attached to the support. After completion of the solid-phase synthesis, the dry solid support was treated with a 1:1 volume solution of 40% by weight methylamine in water and 28% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30°C. The solution was evaporated and the solid residue was reconstituted in water (see below). C. Purification The crude oligomers were purified by anion-exchange HPLC using a 13 μm TSKgel SuperQ-5PW column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% acetonitrile, and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. Trace UV at 260 nm was recorded. Suitable fractions were then pooled based on size-exclusion HPLC using a GE Healthcare XK 26 / 40 column filled with fine Sephadex G-25 buffer. Petition 870250071938, dated 08 / 14 / 2025, page 186 / 535 175 / 233 continuous filtered DI water or ammonium bicarbonate 100 mm, pH 6.7 and 20% acetonitrile. D. Annealing. Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1χ²-buffered saline (Corning, Cellgro) to form RNAi agents. Some RNAi agents were lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in a UV-Vis spectrometer in 1χ²-buffered saline. The absorbance of the solution at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. Except where otherwise specified, all conversion factors were 0.037 mgZ(mL^cm). For some experiments, a conversion factor was calculated from an experimentally determined extinction coefficient. Example 2. pHBV model mice.

[0207] Six- to eight-week-old female NOD.CB17-PrkdscidZNcrCrl (NOD-SCID) mice were transiently transfected in vivo with MCHBV1.3 by hydrodynamic injection into the caudal vein (Yang PL et al. Hydrodynamic injection of viral DNA: a mouse model of acute hepatitis B virus infection, PNAS USA 2002 Vol. 99: p. 13825-13830), administered 30 to 45 days prior to administration of an HBV RNAi agent or control. MC-HBV1.3 is a plasmid-derived minicircle containing the same terminally redundant human hepatitis B virus sequence, HBV1.3, as in the pHBV1.3 plasmid and in HBV1 transgenic mice. 3.32 (GenBank accession number V01460) (Guidotti LG et al., High-level hepatitis B virus replication in transgenic mice, J Virol 1995 Vol. 69, p61586169.). 5 or 10 μg of MC-HBV1.3 in Ringer's solution in a total volume of 10% of the animal's body weight were injected into mice via a tail vein to create a pHBV model of chronic HBV infection.The solution was injected. Petition 870250071938, dated 08 / 14 / 2025, p. 187 / 535 176 / 233 via a 27-gauge needle in 5 to 7 seconds as previously described (Zhang G et al., High levels of foreign gene expression in hepatocytes after injection of nude plasmid DNA tail veins. Human Gene Therapy 1999 Vol. 10, p1735-1737). At pre-dose (day 1 pre-dose, day -1, or day -2), serum HBsAg expression levels of hepatitis B surface antigen (HBsAg) were measured by ELISA and mice were grouped according to mean HBsAg expression levels.

[0208] Analyses: On several occasions, before and after administration of HBV RNAi agents, serum levels of HBsAg, HBeAg, HBV-DNA, or HBVRNA in the liver were measured. HBV expression levels were normalized to pre-administration expression levels and control mice injected with phosphate-buffered saline (PBS).

[0209] i) Serum collection: Mice were anesthetized with 2 to 3% isoflurane and blood samples were collected from the submandibular area in serum separation tubes (Sarstedt AG & Co., Nümbrecht, Germany). The blood was kept at room temperature for 20 minutes to coagulate. The tubes were centrifuged at 8,000 xg for 3 min to separate the serum and stored at 4°C.

[0210] ii) Hepatitis B surface antigen (HBsAg) serum levels: Serum was collected and diluted 10 to 8000 times in PBS containing 5% skim milk powder. Secondary HBsAg standards diluted in skim milk solution were prepared from serum of ICR (Harlan Sprague Dawley) mice transfected with 10 μg of plasmids expressing HBsAg pRc / CMV-HBs (Aldevron, Fargo, ND, USA). HBsAg levels were determined using a GS HBsAg EIA 3.0 kit (Bio-Rad Laboratories, Inc., Redmond, WA, USA) as described by the manufacturer. Recombinant HBsAg protein, ayw subtype, also diluted in skim milk in PBS, was used as a primary standard (Aldevron). Petition 870250071938, dated 08 / 14 / 2025, page 188 / 535 177 / 233

[0211] HBsAg expression for each animal was normalized to the PBS-injected control mouse group to account for the non-treatment-related decline in MC-HBV1.3 expression. First, the HBsAg level for each animal at a point in time was divided by the pre-treatment expression level in that animal to determine the normalized-to-pre-treatment expression ratio. Expression at a specific time point was then normalized to the control group by dividing the normalized-to-pre-treatment ratio for an individual animal by the average of the normalized-to-pre-treatment ratio of all mice in the normal PBS-injected control group.

[0212] iii) Hepatitis B e antigen (HBeAg) serum levels: HBeAg analysis was performed using the HBeAg enzyme-linked immunosorbent assay (ELISA) as described by the manufacturer (DiaSorin) using serum diluted 4 to 20 times in 5% fat-free dry milk. The amount of antigen was determined in the linear range of the assay and quantified relative to HBeAg protein standards (Fitzgerald Industries International, catalog # 30-AH18, Acton, MA, USA).

[0213] HBeAg expression for each animal was normalized to the control group of mice injected with PBS to account for the non-treatment-related decline in MC-HBV1.3 expression. For the evaluation of HBeAg in serum, HBeAg is analyzed from serum samples from pooled groups or subgroups. First, the HBeAg level for each pooled group or subgroup was divided by the pre-treatment expression level in that same group or subgroup in order to determine the ratio of normalized expression to pre-treatment. Expression at a specific time point was then normalized to the control group by dividing the normalized ratio to pre-treatment for a group or subgroup by the average normalized ratio to pre-treatment of all samples from the control group injected with normal PBS. Petition 870250071938, dated 08 / 14 / 2025, page 189 / 535 178 / 233

[0214] iv) Serum HBV DNA levels: Equal volumes of serum from mice in a group or subgroup were pooled to a final volume of 100 μL. DNA was isolated from serum samples using the QIAamp MinElute Virus Spin Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. 0.9% sterile saline solution was added to each sample to a final volume of 200 μL. Serum samples were added to tubes containing buffer and protease. Carrier RNA was added to aid in the isolation of small amounts of DNA. 1 ng of pHCR / UbC-SEAP DNA plasmid (Wooddell CI, et al. Long-term RNA interference from optimized siRNA expression constructs in adult mice. Biochem Biophys Res Commun (2005) 334, 117-127) was added as a recovery control. After 15 min of incubation at 56°C, the nucleic acids were precipitated from the lysates with ethanol and the entire solution applied to a column.After washing, the samples were eluted in a volume of 50 μL of AVE buffer.

[0215] The number of HBV genome copies in DNA isolated from serum of the pHBV mouse model was determined by qPCR. The pSEAPHBV353-777 plasmid, which encodes a short segment of the HBV genome within the S gene (bases 353 to 777, GenBank accession number V01460), was used to create a six-log standard curve. Samples with DNA recovery below 2 standard deviations from the mean, based on pHCR / UbC-SEAP detection, were omitted. Primers and probes using TaqMan chemistry with fluorine / ZEN / IBFQ are used.

[0216] qPCR assays were performed on a 7500 Fast or StepOne Plus real-time PCR system (Life Technologies). For HBV DNA assessment in serum, DNA was isolated from single or duplicate purification steps from pooled serum samples. HBV DNA and recovery control plasmid quantifications were determined by reactions Petition 870250071938, dated 08 / 14 / 2025, page 190 / 535 179 / 233 qPCR tests were performed in triplicate. Probes to quantify HBV and pHCR / UbC-SEAP were included in each reaction. Example 3. HBV RNAi agents in pHBV model mice.

[0217] The pHBV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous injection of 200 μL containing 2 mg / kg (mpk) of an HBV RNAi agent formulated in phosphate-buffered saline (PBS), or 200 μL of phosphate-buffered saline without an HBV RNAi agent, to be used as a control. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugates to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. The HBV RNAi agents tested included those having the duplex numbers shown in Table 7 below. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under the loose skin in the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0218] Serum was collected on days 8, 15, 22, and 29, and serum levels of hepatitis B virus surface antigen (HBsAg) were determined according to the procedure described in Example 2 above. The experimental data are shown in the following table. Table 7. Mean normalized HBsAg levels for pre-treatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 3 (standard deviation reflected as (+ / -)).__________________________ Group Day 8 Day 15 Day 22 Day 29 PBS 1.000 ± 0.185 1.000 ± 0.288 1.000 ± 0.540 1.000 ± 0.326 AD04178 0.164 ± 0.043 0.206 ± 0.044 0.293 ± 0.050 0.348 ± 0.099 AD04579 0.083 ± 0.028 0.099 ± 0.022 0.112 ± 0.022 0.138 ± 0.056 AD04580 0.048 ± 0.007 0.073 ± 0.012 0.085 ± 0.012 0.126 ± 0.014 AD04570 0.241 ± 0.076 0.294 ± 0.071 0.276 ± 0.068 0.474 ± ​​0.092 AD04572 0.190 ± 0.040 0.279 ± 0.011 0.323 ± 0.049 0.441 ± 0.046 Petition 870250071938, dated 08 / 14 / 2025, page 191 / 535 180 / 233 AD04573 0.333 ± 0.143 0.505 ± 0.106 0.361 ± 0.060 0.444 ± 0.068 AD04574 0.291 ± 0.032 0.650 ± 0.056 0.388 ± 0.048 0.485 ± 0.070 AD04575 0.397 ± 0.189 0.514 ± 0.234 0.574 ± 0.204 0.689 ± 0.207 AD04419 0.262 ± 0.038 0.174 ± 0.042 0.258 ± 0.064 0.311 ± 0.089 AD04578 0.210 ± 0.056 0.235 ± 0.033 0.298 ± 0.035 0.336 ± 0.049

[0219] Each of the RNAi agents AD04178, AD04579, AD04580, AD04570, AD04572, AD04573, AD04574, AD04575, AD04419, and AD04578 was designed to have antisense strand sequences at least partially complementary to the X-frame open reading frame at positions 1781 to 1789 of the HBV genome shown in Tables 1 and 2 above. Each of the HBV RNAi agents showed a substantial reduction in HBsAg compared to the PBS control at all measured time points. For example, AD04580 showed a greater than 95% reduction in s-antigen levels on day 8 (HBsAg level of 0.048 ± 0.00) when normalized to pretreatment and PBS control.

[0220] Additionally, serum HBV DNA levels were determined for the PBS, AD04579, and AD04580 groups from serum samples collected on days 8, 15, 22, 29, 36, 43, and 50, according to the procedure presented in Example 2 above. The serum from each group was pooled, and then DNA was isolated from the serum with isolations performed in duplicate. The data are presented in the following table. Table 8. Mean serum HBV DNA levels normalized to pretreatment and PBS control in pHBV mice after administration of the HBV RNAi agents of Example 3 (standard deviation reflected as (+ / -)).______________ Group Day 8 Day 15 Day 22 Day 29 PBS 1.0000 ± 0.1185 1.0000 ± 0.0591 1.0000 ± 0.0322 1.0000 ± 0.0597 Petition 870250071938, dated 08 / 14 / 2025, page 192 / 535 181 / 233 AD04579 0.1541 ± 0.0070 0.1776 ± 0.0027 0.1810 ± 0.0450 0.3738 ± 0.0302 AD04580 0.0921 ± 0.0253 0.0869 ± 0.0117 0.1444 ± 0.0755 0.0950 ± 0.0026 Group Day 36 Day 43 Day 50 PBS 1.0000 ± 0.1625 1.0000 ± 0.0055 1.0000 ± 0.1484 AD04579 0.9670 ± 0.1247 0.7643 ± 0.1334 0.6299 ± 0.1319 AD04580 0.4949 ± 0.0096 0.4350 ± 0.0344 0.6819 ± 0.0266

[0221] The data in Table 8 indicate that both RNAi agents examined provided a substantial reduction in HBV DNA levels compared to the PBS group, with AD04580 achieving a slightly greater than 1 log reduction at the lowest point (e.g., mean serum DNA level of 0.0869 ± 0.0117 on day 15). Example 4. HBV RNAi agents in pHBV model mice.

[0222] The pHBV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous administration of 200 μL containing 2 mg / kg (mpk) of an HBV RNAi agent formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, to be used as a control. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugated to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. The HBV RNAi agents administered included those mentioned in Table 9 below. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under loose skin in the neck and shoulder area. Three (3) mice in each group were tested (n=3). Petition 870250071938, dated 08 / 14 / 2025, page 193 / 535 182 / 233

[0223] Serum was collected on days 8, 15, 22, and 29, and serum levels of hepatitis B virus surface antigen (HBsAg) were determined according to the procedure described in Example 2 above. The experimental data are shown in the following table. Table 9. Mean normalized HBsAg levels for pre-treatment and control (PBS) in pHBV mice after administration of the HBV RNAi agents from Example 4 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 Day 29 PBS 1.000 ± 0.085 1.000 ± 0.235 1.000 ± 0.171 1.000 ± 0.099 AD0401 0 0.229 ± 0.141 0.165 ± 0.091 0.142 ± 0.085 0.116 ± 0.076 AD0458 1 0.379 ± 0.042 0.221 ± 0.066 0.135 ± 0.040 0.112 ± 0.050 AD0459 1 0.285 ± 0.101 0.145 ± 0.064 0.086 ± 0.024 0.081 ± 0.026 AD0443 4 0.295 ± 0.041 0.191 ± 0.008 0.147 ± 0.016 0.187 ± 0.049 AD0458 3 0.488 ± 0.018 0.545 ± 0.037 0.511 ± 0.086 0.663 ± 0.112 AD0458 4 0.392 ± 0.136 0.337 ± 0.073 0.364 ± 0.075 0.515 ± 0.155 AD0458 5 0.099 ± 0.016 0.042 ± 0.014 0.030 ± 0.009 0.044 ± 0.014 AD0458 6 0.222 ± 0.056 0.107 ± 0.034 0.074 ± 0.016 0.106 ± 0.039 AD0458 8 0.255 ± 0.065 0.205 ± 0.021 0.185 ± 0.021 0.207 ± 0.024 AD0443 8 0.265 ± 0.106 0.113 ± 0.045 0.091 ± 0.031 0.130 ± 0.038

[0224] The RNAi agents AD04010, AD04581, AD04591, AD04434, AD04583, AD04584, AD04585, AD04586, AD04588, and AD04438 were designed to have antisense strand sequences that are at least partially Petition 870250071938, dated 08 / 14 / 2025, page 194 / 535 183 / 233 complementary to the open S reading frame at positions 257 to 275 of the HBV genome, as shown in Tables 1 and 2. The HBV RNAi agents shown in Table 9, directly above, showed substantial reduction in HBsAg compared to the control (PBS) at all measured time points. For example, AD04585 showed an approximately 90% reduction in HBsAg on day 8, a 95% reduction on day 15, a 97% reduction on day 22, and a 95% reduction on day 29.

[0225] Additionally, serum HBV DNA levels were determined for the PBS, AD04579, and AD04585 groups from serum samples collected on days 8, 15, 22, 29, 36, 43, and 50, according to the procedure presented in Example 2 above. The serum from each group was pooled, and then DNA was isolated from the serum with isolations performed in duplicate. The data are presented in the following table. Table 10. Mean serum HBV DNA levels normalized to pretreatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 4 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 Day 29 PBS 1.000 ± 0.248 1.000 ± 0.089 1.000 ± 0.195 1.000 ± 0.180 AD04585 0.901 ± 0.183 0.225 ± 0.003 0.187 ± 0.023 0.191 ± 0.004 Group Day 36 Day 43 Day 50 PBS 1.000 ± 0.018 1.000 ± 0.033 1.000 ± 0.778 AD04585 0.209 ± 0.017 0.171 ± 0.019 0.305 ± 0.010

[0226] The data in Table 10 indicate that the HBV RNAi agent, AD04585, provided a reduction in HBV DNA levels compared to the PBS group. Petition 870250071938, dated 08 / 14 / 2025, page 195 / 535 184 / 233 Example 5. Dose-response and combinations of HBV INR agents in pHBV model mice.

[0227] The pHBV mouse model described in Example 2 above was used. The mice were divided into several groups, including those presented in Table 11 below, and each mouse received a 200 μL subcutaneous injection according to the dosage regimen presented in Table 11: Table 11. pHBV mouse dosage groups for Example 5. Group Dose and RNAi Agent Dosing Regimen A PBS (without RNAi agent) Single injection on day 1 B 3.0 mg / kg AD04585 Single injection on day 1 C 3.0 mg / kg AD04585 Injection on day 1, day 8, and day 15 (i.e., three weekly injections) D 3.0 mg / kg AD04580 Single injection on day 1 E 3.0 mg / kg AD04580 Injection on day 1, day 8, and day 15 (i.e., three weekly injections) F 1.0 mg / kg AD4585 1.0 mg / kg AD04580 Injection on day 1, and another injection on day 22 G 1.0 mg / kg AD4585 1.0 mg / kg AD04580 Injection on day 1, day 8, day 15 and day 43 H 1.5 mg / kg of AD4585 + 1.5 mg / kg of AD04580 Injection on day 1, day 22 and day 43 I 1.5 mg / kg of AD4585 + 1.5 mg / kg of AD04580 Injection on day 1, day 8, day 15 and day 43 Petition 870250071938, dated 08 / 14 / 2025, page 196 / 535 185 / 233

[0228] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 11. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugated to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under loose skin in the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0229] Serum was collected on days 8, 15, 22, 29, 36, 43, 50, and 57, and serum levels of hepatitis B virus surface antigen (HBsAg) were determined according to the procedure described in Example 2 above. The experimental data are shown in the following table. Table 12. Mean normalized HBsAg levels for pre-treatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 5 (standard deviation reflected as (+ / -)).___________________________ Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.162 1.000 ± 0.138 1.000 ± 0.083 1.000 ± 0.204 B 0.060 ± 0.015 0.010 ± 0.003 0.006 ± 0.002 0.007 ± 0.002 C 0.087 ± 0.014 0.004 ± 0.001 0.001 ± 0.0003 0.0002 ± 0.0001 D 0.026 ± 0.009 0.035 ± 0.013 0.037 / 0.014 0.046 ± 0.006 E 0.023 ± 0.005 0.002 ± 0.001 0.001 ± 0.0003 0.001 ± 0.0004 F 0.063 ± 0.046 0.083 ± 0.051 0.086 ± 0.016 0.027 ± 0.006 G 0.062 ± 0.011 0.022 ± 0.008 0.009 ± 0.003 0.008 ± 0.002 H 0.055 ± 0.015 0.062 ± 0.002 0.072 ± 0.013 0.011 ± 0.001 I 0.031 ± 0.006 0.008 ± 0.001 0.003 ± 0.0004 0.003 ± 0.0003 Petition 870250071938, dated 08 / 14 / 2025, p. 197 / 535 186 / 233 Group Day 36 Day 43 Day 50 Day 57 A 1.000 ± 0.211 1.000 ± 0.189 1.000 ± 0.179 1.000 ± 0.062 B 0.013 ± 0.005 0.027 ± 0.004 0.026 ± 0.004 0.057 ± 0.012 C 0.001 ± 0.0002 0.002 ± 0.001 0.008 ± 0.004 0.020 ± 0.015 D 0.116 ± 0.019 0.214 ± 0.056 0.263 ± 0.046 0.404 ± 0.030 E 0.003 ± 0.0001 0.007 ± 0.001 0.012 ± 0.002 0.033 ± 0.011 F 0.029 ± 0.003 0.065 ± 0.005 0.064 ± 0.004 0.161 ± 0.033 G 0.014 ± 0.008 0.039 ± 0.011 0.018 ± 0.008 0.046 ± 0.008 H 0.017 ± 0.005 0.039 ± 0.008 0.007 ± 0.001 0.013 ± 0.003 I 0.007 ± 0.001 0.020 ± 0.002 0.005 ± 0.001 0.011 ± 0.002

[0230] The HBV RNAi agents, AD04580 and AD04585, individually showed substantial reduction of HBsAg compared to the PBS control at all measured time points. Furthermore, the combination treatment of AD04585 and AD04580, which as observed in the examples above targeted different regions of the HBV genome, also showed reduction of HBsAg compared to the PBS control at all measured time points.

[0231] Additionally, serum HBV DNA levels were determined for each of the groups in Table 11 from serum samples collected on days 8, 15, 22, 29, and 36, according to the procedure presented in Example 2 above. The serum from each group was pooled, and then DNA was isolated from the serum in duplicate reactions. The data are presented in the following table. Table 13. Mean serum HBV DNA levels normalized to pretreatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 5 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.063 1.000 ± 0.059 1.000 ± 0.372 1.000 ± 0.237 B 0.267 ± 0.003 0.043 ± 0.016 0.038 ± 0.008 0.044 ± 0.004 Petition 870250071938, dated 08 / 14 / 2025, page 198 / 535 187 / 233 C 0.236 ± 0.016 0.023 ± 0.001 0.004 ± 0.001 0.002 ± 0.000 D 0.058 ± 0.016 0.085 ± 0.017 0.252 ± 0.071 0.217 ± 0.009 E 0.056 ± 0.002 0.0009 ± 0.0004 0.0005 ± 0.0002 0.003 ± 0.002 F 0.298 ± 0.013 0.351 ± 0.032 0.823 ± 0.127 0.217 ± 0.007 G 0.276 ± 0.035 0.112 ± 0.020 0.061 ± 0.002 0.073 ± 0.002 H 0.232 ± 0.012 0.213 ± 0.028 0.403 ± 0.047 0.079 ± 0.005 I 0.092 ± 0.026 0.055 ± 0.000 0.002 ± 0.003 0.010 ± 0.004 Group Day 36 A 1.000 ± 0.024 B 0.046 ± 0.007 C 0.003 ± 0.000 D 0.319 ± 0.034 E 0.002 ± 0.000 F 0.122 ± 0.004 G 0.047 ± 0.006 H 0.056 ± 0.003 I 0.021 ± 0.007

[0232] The data in Table 13 indicate that the RNAi agents examined, both individually and in combination, provided a reduction in HBV DNA levels compared to the PBS group. Redosing or increasing the dose amount provided further reductions in HBV DNA. Example 6. HBV RNAi agents in pHBV mice: dose-response and combination studies.

[0233] The pHBV mouse model described in Example 2 above was used. The mice were divided into several groups, as shown in Table 14 below, and each mouse received a single subcutaneous injection of 200 μL according to the dosage regimen shown in Table 14. Petition 870250071938, dated 08 / 14 / 2025, page 199 / 535 188 / 233 Table 14. pHBV mouse dosage groups for Example 6. Group Dose and RNAi Agent Dosing Regimen A PBS (without RNAi agent) Single injection on day 1 B 4.0 mg / kg AD04981 Single injection on day 1 C 1.0 mg / kg AD04981 Single injection on day 1 D 2.0 mg / kg AD04981 Single injection on day 1 E 1.0 mg / kg AD04963 Single injection on day 1 F 2.0 mg / kg AD04963 Single injection on day 1 G 3.0 mg / kg AD04872 Single injection on day 1 H 3.0 mg / kg AD04872 + 1.0 mg / kg AD04981 Single injection on day 1 I 3.0 mg / kg AD04872 + 1.0 mg / kg AD04963 Single injection on day 1 J 3.0 mg / kg of AD04872 + 2.0 mg / kg of AD04981 Single injection on day 1

[0234] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 14. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugated to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under loose skin in the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0235] Serum was collected on day -1 before administration and then on days 8, 15, 22, 29, and 36, and serum HBsAg levels were determined according to the procedure presented in Example 2 above. The data from Petition 870250071938, dated 08 / 14 / 2025, page 200 / 535 The results of experiments 189 / 233 are shown in Table 15 below, with the mean HBsAg reflecting the mean of the normalized HBsAg values: Table 15. Mean normalized HBsAg levels for pre-treatment and PBS control in pHBV mice after administration of RNAi agents. HBV from Example 6 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 A 1.000 ± 0.068 1.000 ± 0.183 1.000 ± 0.181 B 0.085 ± 0.020 0.068 ± 0.005 0.089 ± 0.014 C 0.283 ± 0.039 0.343 ± 0.055 0.436 ± 0.004 D 0.161 ± 0.052 0.137 ± 0.036 0.190 ± 0.068 E 0.182 ± 0.040 0.233 ± 0.023 0.436 ± 0.029 F 0.078 ± 0.024 0.093 ± 0.015 0.167 ± 0.028 G 0.066 ± 0.030 0.013 ± 0.002 0.010 ± 0.002 H 0.033 ± 0.012 0.016 ± 0.005 0.020 ± 0.005 I 0.040 ± 0.011 0.028 ± 0.003 0.032 ± 0.007 J 0.035 ± 0.010 0.019 ± 0.002 0.021 ± 0.001 Group Day 29 Day 36 A 1.000 ± 0.032 1.000 ± 0.141 B 0.148 ± 0.016 0.194 ± 0.047 C 0.622 ± 0.041 0.741 ± 0.132 D 0.234 ± 0.055 0.280 ± 0.071 E 0.623 ± 0.116 0.782 ± 0.114 F 0.259 ± 0.014 0.368 ± 0.068 G 0.010 ± 0.003 0.009 ± 0.004 H 0.022 ± 0.005 0.024 ± 0.009 I 0.065 ± 0.014 0.087 ± 0.015 J 0.031 ± 0.0001 0.044 ± 0.002 Petition 870250071938, dated 08 / 14 / 2025, p. 201 / 535 190 / 233

[0236] The HBV RNAi agents tested showed a reduction in HBsAg compared to the PBS control at all measured time points. Furthermore, the combination treatment of AD04872 (which includes an antisense strand sequence that is at least partially complementary to ORF S at positions 261 to 279 of the HBV genome, as shown in Tables 1 and 2) and AD04981 or AD04963 (both of which include antisense strand sequences that are at least partially complementary to ORF X at positions 1781 to 1799 of the HBV genome, as shown in Tables 1 and 2), which are shown in groups H, I, and J of Example 6, illustrate that the combination treatment of two RNAi targeting agents, one targeting ORF S and the other targeting ORF X of the HBV genome, similarly shows a reduction in HBsAg compared to the PBS control at all measured time points.

[0237] Additionally, serum levels of hepatitis B e antigen (HBeAg) were also evaluated. Samples from mice in each respective group were first pooled, and the resulting serum samples were tested in a single assay. The experimental data are shown in the following table. Table 16. Mean normalized HBeAg levels for pre-treatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 6 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 Day 29 Day 36 A 1.000 1.000 1.000 0.183 1.000 B 0.138 0.180 0.274 0.005 0.089 C 0.316 0.376 0.588 0.055 0.436 D 0.167 0.250 0.262 0.036 0.190 E 0.301 0.327 0.447 0.023 0.436 F 0.167 0.172 0.305 0.015 0.167 G 0.275 0.135 0.158 0.002 0.010 Petition 870250071938, dated 08 / 14 / 2025, page 202 / 535 191 / 233 Group Day 8 Day 15 Day 22 Day 29 Day 36 H 0.080 0.053 0.094 0.005 0.020 I 0.165 0.124 0.185 0.003 0.032 J 0.120 0.057 0.101 0.002 0.021

[0238] As shown in Table 16, the combination of AD04872 (which targets the S ORF of the HBV genome) with AD04981 or AD04963 (both of which target the X ORF of the HBV genome) showed a further reduction in HBeAg levels compared to AD04872 alone. Example 7. HBV RNAi agents in pHBV mice: additional dose-response and combination study.

[0239] The pHBV mouse model described in Example 2 above was used. The mice were divided into several groups, as shown in Table 17 below, and each mouse received a single subcutaneous injection of 200 μL according to the dosage regimen shown in Table 17: Table 17. pHBV mouse dosage groups for Example 7. Group Dose and RNAi Agent Dosing Regimen A PBS (without RNAi agent) Single injection on day 1 B 4.0 mg / kg AD04776 Single injection on day 1 C 1.0 mg / kg AD04982 Single injection on day 1 D 2.0 mg / kg AD04982 Single injection on day 1 E 1.0 mg / kg AD04776 Single injection on day 1 F 2.0 mg / kg AD04776 Single injection on day 1 G 3.0 mg / kg AD04872 Single injection on day 1 H 3.0 mg / kg AD04872 + 1.0 mg / kg AD04982 Single injection on day 1 I 3.0 mg / kg AD04872 + Single injection on day 1 Petition 870250071938, dated 08 / 14 / 2025, page 203 / 535 192 / 233 2.0 mg / kg of AD04982

[0240] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 17. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugated to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under loose skin in the neck and shoulder area. Four (4) mice in each group were tested on day -1 (n=4) and day 8, and then one mouse per group was euthanized for histological evaluation. Three (3) mice in each group were tested on day 22 and day 29 (n=3).

[0241] Serum was collected on day -1 before administration and then on days 8, 15, 22, and 29, and serum levels of hepatitis B virus surface antigen (HBsAg) were determined according to the procedure described in Example 2 above. The experimental data are shown in Table 18 below. Table 18. Mean normalized HBsAg levels for pre-treatment (day -1) and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 7 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.347 1.000 ± 0.278 1.000 ± 0.194 1.000 ± 0.318 B 0.117 ± 0.069 0.085 ± 0.039 0.148 ± 0.045 0.198 ± 0.049 C 0.519 ± 0.058 0.375 ± 0.012 0.422 ± 0.046 0.525 ± 0.037 D 0.342 ± 0.062 0.255 ± 0.046 0.272 ± 0.122 0.314 ± 0.068 E 0.279 ± 0.057 0.245 ± 0.032 0.374 ± 0.121 0.304 ± 0.035 F 0.224 ± 0.018 0.161 ± 0.009 0.310 ± 0.016 0.482 ± 0.053 G 0.029 ± 0.010 0.005 ± 0.001 0.004 ± 0.001 0.006 ± 0.001 Petition 870250071938, dated 08 / 14 / 2025, page 204 / 535 193 / 233 H 0.016 ± 0.005 0.004 ± 0.001 0.010 ± 0.006 0.015 ± 0.008 I 0.026 ± 0.012 0.008 ± 0.001 0.010 ± 0.002 0.015 ± 0.005

[0242] The HBV RNAi agents tested showed a reduction in HBsAg compared to the PBS control at all measured time points.

[0243] Additionally, serum levels of hepatitis B e antigen (HBeAg) were also evaluated. Samples from mice in each respective group were first pooled, and the resulting serum samples were tested in a single assay. The experimental data are shown in the following table. Table 19. Mean normalized HBeAg levels for pre-treatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 7. Group Day 8 Day 15 Day 22 Day 29 Day 36 A 1.000 1.000 1.000 1.000 1.000 B 0.193 0.213 0.260 0.307 0.464 C 0.471 0.424 0.562 0.513 0.705 D 0.335 0.310 0.411 0.442 0.500 E 0.381 0.368 0.355 0.564 0.483 F 0.275 0.255 0.370 0.495 0.449 G 0.323 0.218 0.205 0.250 0.190 H 0.124 0.102 0.099 0.156 0.156 I 0.081 0.059 0.045 0.063 0.086 Table 19-1. Mean reduction in HBeAg normalized to pre-treatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 7._____________________________________________ Group Day 8 (KD) Day 15 (KD) Day 22 (KD) Day 29 (KD) Day 36 (KD) Petition 870250071938, dated 08 / 14 / 2025, p. 205 / 535 194 / 233 A 1.0 1.0 1.0 1.0 1.0 B 5.2 4.7 3.8 3.3 2.2 C 2.1 2.4 1.8 2.0 1.4 D 3.0 3.2 2.4 2.3 2.0 E 2.6 2.7 2.8 1.8 2.1 F 3.6 3.9 2.7 2.0 2.2 G 3.1 4.6 4.9 4.0 5.3 H 8.1 9.8 10.1 6.4 6.4 I 12.3 17.0 22.3 15.7 11.6

[0244] Table 19-1 reflects the HBeAg reduction ratio compared to the control, which is calculated as normalized HBeAg level of the control group (PBS) / normalized HBeAg level of the respective RNAi agent group(s) (i.e., the 1,000 / HBeAg level). The data in Table 19-1 indicate that the combination of AD04872 (which, as noted above, includes an antisense strand sequence that is at least partially complementary to ORF S at positions 261 to 279 of the HBV genome) with AD04982 (which includes an antisense strand sequence that is at least partially complementary to ORF X at positions 1781 to 1799 of the HBV genome) showed a further reduction in HBeAg levels compared to administration of the individual RNAi agents alone (see, for example, Tables 19 and 19-1 for groups H and I).Additionally, the data from this example also show that the combination of AD04872 with AD04982 resulted in a greater decrease in HBeAg than the sum of the decrease in HBeAg from AD04872 and AD04982 administered individually. For example, group I (which is the administration of 3.0 mg / kg of AD04872 + 2.0 mg / kg of AD04982) resulted in a 17.0-fold decrease in HBeAg on day 15, which is greater than the sum of the decrease for group G (3.0 mg / kg of AD04872) of 4.6 times plus the decrease for group D (2.0 mg / kg of AD04982) of 3.2 times. Petition 870250071938, dated 08 / 14 / 2025, p. 206 / 535 195 / 233

[0245] Additionally, serum HBV DNA levels were determined for each of the groups in Table 17 from serum samples collected on days -1, 8, 15, 22, 29, and 36, according to the procedure presented in Example 2 above. Serum HBV DNA was isolated from each animal at each time point. The data are shown in the following table. Table 20. Mean serum HBV DNA levels normalized to pretreatment and PBS control in pHBV mice after administration of the HBV RNAi agents of Example 7 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.493 1.000 ± 0.358 1.000 ± 0.424 1.000 ± 0.387 B 0.224 ± 0.150 0.263 ± 0.185 0.335 ± 0.204 0.449 ± 0.108 C 0.358 ± 0.207 0.428 ± 0.073 0.433 ± 0.220 0.474 ± ​​0.090 D 0.516 ± 0.163 0.523 ± 0.264 0.244 ± 0.123 0.241 ± 0.085 E 0.601 ± 0.388 0.319 ± 0.125 0.279 ± 0.138 0.506 ± 0.525 F 0.363 ± 0.128 0.374 ± 0.197 0.275 ± 0.146 0.385 ± 0.141 G 0.071 ± 0.032 0.022 ± 0.009 0.015 ± 0.015 0.025 ± 0.005 H 0.069 ± 0.070 0.018 ± 0.014 0.019 ± 0.020 0.022 ± 0.001 I 0.044 ± 0.024 0.033 ± 0.016 0.017 ± 0.012 0.022 ± 0.014 Group Day 36 A 1.000 ± 0.326 B 0.603 ± 0.068 C 0.509 ± 0.163 D 0.543 ± 0.079 E 0.444 ± 0.407 F 0.721 ± 0.043 G 0.058 ± 0.030 H 0.047 ± 0.021 I 0.058 ± 0.051 Petition 870250071938, dated 08 / 14 / 2025, p. 207 / 535 196 / 233

[0246] The data in Table 20 indicate that the RNAi agents examined, both individually and in combination, provided a reduction in HBV DNA levels compared with the PBS group, and further show that the combination of AD04872 (which targets ORF X) and AD04982 (which targets ORF X) reduces serum HBV DNA to a similar degree as an equal amount of AD04872 alone. Example 8. HBV RNAi agents in pHBV HBV mice: further dose-response and combination studies.

[0247] The pHBV mouse model described in Example 2 above was used. The mice were divided into several groups, as shown in Table 21 below, and each mouse received a single subcutaneous injection of 200 μL according to the dosage regimen shown in Table 21. Table 21. Dosage groups in pHBV mice for Example 8. Group Dose and RNAi Agent Dosage Regimen Number of animals 1 PBS (without RNAi agent) Single injection on day 1 4 2A 4.0 mg / kg AD04872 + 1.0 mg / kg AD05070 Single injection on day 1 4 2B 4.0 mg / kg AD04872 + 1.0 mg / kg AD05070 Single injection on day 1 4 3A 3.3 mg / kg AD04872 + 1.7 mg / kg AD05070 Single injection on day 1 4 3B 3.3 mg / kg AD04872 + 1.7 mg / kg AD05070 Single injection on day 1 4 4A 3.2 mg / kg AD04872 + 0.8 mg / kg of AD05070 Single injection on day 1 4 Petition 870250071938, dated 08 / 14 / 2025, page 208 / 535 197 / 233 4B 3.2 mg / kg of AD04872 + 0.8 mg / kg of AD05070 Single injection on day 1 4 5A 2.7 mg / kg of AD04872 + 1.3 mg / kg of AD05070 Single injection on day 1 4 5B: 2.7 mg / kg of AD04872 + 1.3 mg / kg of AD05070 Single injection on day 1 4 6A 4.0 mg / kg of AD05070 Single injection on day 1 4 6B 4.0 mg / kg of AD05070 Single injection on day 1 4 7A 1.7 mg / kg of AD05070 Single injection on day 1 4 7B 1.7 mg / kg of AD05070 Single injection on day 1 4 8A 0.8 mg / kg of AD05070 Single injection on day 1 4 8B 0.8 mg / kg of AD05070 Single injection on day 1 4 9 1.7 mg / kg of AD05148 Single injection on day 1 4 10 2.7 mg / kg of AD04872 Single injection on day 1 3 11 1.7 mg / kg of AD05147 Single injection on day 1 3 12 4.0 mg / kg of AD04872 Single injection on day 1 3 13 1.7 mg / kg of AD05149 Single injection on day 1 3

[0248] Additionally, the mice were subjected to programmed euthanasia according to the following schedule: • Day 11 Euthanize 2 mice from groups 2A, 3A, 4A, 5A, 6A, 7A and 8A, and sacrifice one mouse from group 9. Petition 870250071938, dated 08 / 14 / 2025, p. 209 / 535 198 / 233 • Day 14 Euthanize 2 mice from groups 2A, 3A, 4A, 5A, 6A, 7A, and 8A. • Day 21 Euthanize 2 mice from groups 2B, 3B, 4B, 5B, 6B, 7B, and 8B. • Day 28: Euthanize 2 mice from groups 1, 2B, 3B, 4B, 5B, 6B, 7B, and 8B, and all mice (4) from groups 10 and 12.

[0249] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 21. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugated to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under the loose skin in the neck and shoulder area. As shown in Table 14 above, four (4) mice in each group were tested (n=4), except for groups 10, 11, 12, and 13, in which three mice were tested (n=3).

[0250] Serum was collected on day -1 before administration and on days 8, 14, 21, and 28, and serum levels of hepatitis B virus surface antigen (HBsAg) were determined according to the procedure described in Example 2 above. The experimental data are shown in the following table. Table 22. Mean normalized HBsAg levels for pre-treatment and control (PBS) in pHBV mice after administration of the HBV RNAi agents from Example 8 (standard deviation reflected as (+ / -)). Group number Day 8 Day 14 Day 21 Day 28 1 1.000 ± 0.089 1.000 ± 0.087 1.000 ± 0.132 1.000 ± 0.138 2A 0.009 ± 0.003 0.005 ± 0.001 2B 0.006 ± 0.003 0.002 ± 0.001 0.004 ± 0.001 0.005 ± 0.001 3A 0.032 ± 0.021 0.009 ± 0.004 Petition 870250071938, dated 08 / 14 / 2025, page 210 / 535 199 / 233 3B 0.028 ± 0.027 0.008 ± 0.006 0.012 ± 0.005 0.015 ± 0.005 4A 0.036 ± 0.020 0.012 ± 0.006 4B 0.029 ± 0.025 0.010 ± 0.008 0.015 ± 0.005 0.022 ± 0.004 5A 0.027 ± 0.014 0.008 ± 0.002 5B 0.027 ± 0.013 0.007 ± 0.003 0.019 ± 0.004 0.031 ± 0.005 6A 0.058 ± 0.035 0.069 ± 0.039 6B 0.117 ± 0.058 0.079 ± 0.047 0.145 ± 0.082 0.135 ± 0.061 7A 0.189 ± 0.100 0.084 ± 0.029 7B 0.099 ± 0.010 0.147 ± 0.025 0.267 ± 0.048 0.345 ± 0.063 8A 0.355 ± 0.099 0.366 ± 0.069 8B 0.271 ± 0.058 0.334 ± 0.060 0.464 ± 0.055 0.624 ± 0.053 9 0.239 ± 0.148 0.179 ± 0.127 0.309 ± 0.213 0.345 ± 0.225 10 0.018 ± 0.009 0.005 ± 0.003 0.005 ± 0.002 0.007 ± 0.003 11 0.129 ± 0.068 0.138 ± 0.060 0.239 ± 0.092 0.315 ± 0.119 12 0.033 ± 0.022 0.002 ± 0.001 0.002 ± 0.001 0.002 ± 0.0004 13 0.200 ± 0.093 0.239 ± 0.114 0.367 ± 0.123 0.477 ± 0.125

[0251] The HBV RNAi agents tested, alone and in combination, showed a substantial reduction in HBsAg compared to the PBS control at all measured time points. Example 9. RNAi agent release:

[0252] The pHBV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous injection of 200 μL containing 10 mg / kg (mpk) of an HBV RNAi agent formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, to be used as a control. The HBV RNAi agents tested included those having the duplex numbers shown in Table 23 below, each of which included targeting ligands containing N-acetylgalactosamine conjugated to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. Injections were performed between the skin and muscle (i.e., Petition 870250071938, dated 08 / 14 / 2025, page 211 / 535 200 / 233 subcutaneous injections) under the loose skin in the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0253] Serum was collected before administration and then on days 8, 15, 22, and 29, and serum levels of hepatitis B virus surface antigen (HBsAg) were determined according to the procedure described in Example 2 above. The experimental data are shown in the following table. Table 23. Mean normalized HBsAg levels for pre-treatment and control (PBS) in pHBV mice after administration of the HBV RNAi agents from Example 9 (standard deviation reflected as (+ / -)). RNAi agent HBsAg in serum at lowest point (normal fraction) % of KD at lowest point Day of lowest point PBS 1,000 N / AN / A AD03498 0.087 ± 0.016 91.3% 8 AD03499 0.069 ± 0.011 93.1% 15 AD03500 0.095 ± 0.031 90.5% 8 AD03501 0.046 ± 0.020 95.4% 15

[0254] Each of the HBV RNAi agents shown in Table 23 above included an antisense strand sequence that is at least partially complementary to ORF X at positions 1781 to 1799 of the HBV genome. Each of the RNAi agents showed a significant reduction compared to the PBS control. Example 10. HBV RNAi agents in pHB mice: further combination studies.

[0255] The pHBV mouse model described in Example 2 above was used. The mice were divided into several groups, as shown in Petition 870250071938, dated 08 / 14 / 2025, page 212 / 535 201 / 233 Table 24 below shows that each mouse received a single subcutaneous injection of 200 μL according to the dosage regimen presented in Table 24: Table 24. pHBV mouse dosage groups for Example 10. Group Dose and RNAi Agent Dosing Regimen A PBS I Group (without RNAi agent) Single injection on day 1 and day 22 B PBS II Group (without RNAi agent) Single injection on day 1 and day 22 C 3.0 mg / kg AD04585 Single injection on day 1, day 22, day 50, and day 64 D 3.0 mg / kg AD04771 Single injection on day 1 and day 22 E 3.0 mg / kg AD04580 Single injection on day 1, day 22, day 50, and day 64 F 3.0 mg / kg AD04776 Single injection on day 1 and day 22 G 1.5 mg / kg AD04585 + 1.5 mg / kg AD04580 Single injection on day 1, day 22, Day 50, and on day 64 H 1.5 mg / kg of AD04771 + 1.5 mg / kg of AD04776 Single injection on day 1 and day 22 I 2.0 mg / kg of AD04771 + 1.0 mg / kg of AD04776 Single injection on day 1 and day 22 J 2.25 mg / kg of AD04771 + 0.75 mg / kg of AD04776 Single injection on day 1 and day 22

[0256] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 24. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugates to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and the muscle (i.e., Petition 870250071938, dated 08 / 14 / 2025, page 213 / 535 202 / 233 subcutaneous injections) under the loose skin in the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0257] Serum was collected before administration and then on day -1, day 8, day 15, day 22, day 29, day 36, day 43, day 50, day 57, and day 64. Serum hepatitis B surface antigen (HBsAg) levels were determined according to the procedure described in Example 2 above. The experimental data are shown in the following table. Table 25. Mean normalized HBsAg levels for pre-treatment and PBS control (group A used as control) in pHBV mice after administration of the HBV RNAi agents from Example 10 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 A 1.000 ± 0.146 1.000 ± 0.095 1.000 ± 0.202 B 0.931 ± 0.161 1.091 ± 0.156 1.132 ± 0.259 C 0.071 ± 0.050 0.031 ± 0.022 0.024 ± 0.013 D 0.134 ± 0.035 0.130 ± 0.024 0.119 ± 0.028 E 0.015 ± 0.001 0.041 ± 0.012 0.087 ± 0.015 F 0.197 ± 0.081 0.308 ± 0.138 0.476 ± 0.156 G 0.029 ± 0.015 0.069 ± 0.029 0.094 ± 0.016 H 0.191 ± 0.057 0.315 ± 0.094 0.420 ± 0.126 I 0.153 ± 0.050 0.194 ± 0.076 0.233 ± 0.116 J 0.155 ± 0.059 0.177 ± 0.067 0.316 ± 0.117 Group Day 29 Day 36 Day 43 A 1.000 ± 0.182 1.000 ± 0.287 1.000 ± 0.298 B 1.417 ± 0.414 1.166 ± 0.248 C 0.007 ± 0.005 0.004 ± 0.003 0.006 ± 0.001 D 0.048 / 0.023 0.036 ± 0.020 0.052 ± 0.027 E 0.014 ± 0.006 0.021 ± 0.011 0.026 ± 0.011 Petition 870250071938, dated 08 / 14 / 2025, p. 214 / 535 203 / 233 F 0.246 ± 0.081 0.244 ± 0.097 0.179 ± 0.061 G 0.023 ± 0.009 0.027 ± 0.009 0.037 ± 0.013 H 0.200 ± 0.080 0.185 ± 0.081 0.194 ± 0.055 I 0.141 ± 0.082 0.133 ± 0.051 0.151 ± 0.082 J 0.133 ± 0.064 0.102 ± 0.039 0.129 ± 0.050 Group Day 50 Day 57 Day 64 A 1.000 ± 0.296 1.000 ± 0.394 1.000 ± 0.395 BC 0.015 ± 0.0001 0.002 ± 0.001 0.004 ± 0.001 DE 0.052 ± 0.015 0.009 ± 0.002 0.018 ± 0.007 FG 0.076 ± 0.020 0.012 ± 0.003 0.020 ± 0.007 HIJ

[0258] The HBV RNAi agents, AD04585 and AD04771, were designed to have antisense strand sequences that are at least partially complementary to the open S reading frame at positions 257 to 275 of the HBV genome, as shown in Tables 1 and 2. The HBV RNAi agents, AD04580 and AD04776, were designed to have antisense strand sequences that are at least partially complementary to the open X reading frame at positions 1781 to 1799 of the HBV genome, as shown in Tables 1 and 2. The tested HBV RNAi agents, alone and in combination, showed a reduction in HBsAg compared to the PBS control at all measured time points. Each subsequent dose further reduced the lowest point of HBsAg reduction.

[0259] Additionally, serum HBV DNA levels were determined for group C (3.0 mg / kg AD04585), group E (3.0 mg / kg AD04580), and group G Petition 870250071938, dated 08 / 14 / 2025, page 215 / 535 204 / 233 (1.5 mg / kg of AD04585 + 1.5 mg / kg of AD04580) in Table 24, from serum samples collected on days -1, 8, 15, 22, 29, and 36, 43, and 50 according to the procedure presented in Example 2 above. Serum HBV DNA was isolated from each animal at each time point. The data are presented in the following table. Table 26. Mean serum HBV DNA levels normalized to pretreatment and PBS controls (group A and group B of PBS B) in pHBV mice after administration of the HBV RNAi agents of Example 10 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 Day 29 A / B (PBS) 1.000 ± 0.316 1.000 ± 0.427 1.000 ± 0.428 1.000 ± 0.475 C 0.172 ± 0.151 0.142 ± 0.079 0.252 ± 0.132 0.072 ± 0.086 E 0.024 ± 0.015 0.042 ± 0.037 0.449 ± 0.184 0.053 ± 0.048 G 0.093 ± 0.053 0.083 ± 0.037 0.370 ± 0.153 0.211 ± 0.060 Group Day 36 Day 43 Day 50 A / B (PBS) 1.000 ± 0.623 1.000 ± 0.532 1.000 ± 0.532 C 0.044 ± 0.020 0.104 ± 0.033 0.156 ± 0.016 E 0.012 ± 0.004 0.061 ± 0.031 0.161 ± 0.019 G 0.048 ± 0.022 0.147 ± 0.010 0.295 ± 0.041

[0260] The data in Table 26 indicate that the HBV RNAi agents examined, both individually and in combination, provided a reduction in HBV DNA levels compared to the PBS group. Example 11. RNAi agents in pHBV HBV mice: combination studies.

[0261] The pHBV mouse model described in Example 2 above was used. The mice were divided into several groups, as shown in Petition 870250071938, dated 08 / 14 / 2025, page 216 / 535 205 / 233 Table 27, below, and each mouse received a single subcutaneous injection of 200 μL according to the dosage regimen presented in Table 27. Table 27. pHBV mouse dosage groups for Example 11. Group Dose and RNAi Agent Dosing Regimen A PBS (without RNAi agent) Single injection on day 1 B 3.0 mg / kg AD04962 Single injection on day 1 C 3.0 mg / kg AD04963 Single injection on day 1 D 1.5 mg / kg AD04962 + 1.5 mg / kg AD04963 Single injection on day 1 E 2.0 mg / kg AD04962 + 1.0 mg / kg AD04963 Single injection on day 1 F 2.25 mg / kg AD04962 + 0.75 mg / kg AD04963 Single injection on day 1 G 1.5 mg / kg AD04962 + 1.5 mg / kg AD04963 Single injection on day 1 H 3.0 mg / kg AD04962 + 3.0 mg / kg of AD04963 Single injection on day 1 I 1.5 mg / kg of AD04962 + 1.5 mg / kg of AD04963 Single injection on day 1 J 4.5 mg / kg of AD04962 + 4.5 mg / kg of AD04963 Single injection on day 1 K 3.0 mg / kg of AD04872 Single injection on day 1 L 3.0 mg / kg of AD04882 Single injection on day 1 M 3.0 mg / kg of AD04885 Single injection on day 1 Petition 870250071938, dated 08 / 14 / 2025, page 217 / 535 206 / 233

[0262] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 24. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugated to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under loose skin in the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0263] Serum was collected on day -1 before administration and then on days 8, 15, 22, 29, and 36 (except for group L (AD04882) and group M (AD04885)), and serum levels of hepatitis B virus surface antigen (HBsAg) were determined according to the procedure described in Example 2 above. The experimental data are shown in the following table. Table 28. Mean normalized HBsAg for pre-treatment and control (PBS) in pHBV mice after administration of the HBV RNAi agents from Example 11 (standard deviation reflected as (+ / -))._______________________________ Group Day 8 Day 15 Day 22 A 1.000 ± 0.048 1.000 ± 0.144 1.000 ± 0.083 B 0.125 ± 0.025 0.083 ± 0.014 0.063 ± 0.016 C 0.019 ± 0.005 0.035 ± 0.008 0.052 ± 0.009 D 0.054 ± 0.013 0.079 ± 0.009 0.108 ± 0.021 E 0.099 ± 0.025 0.098 ± 0.053 0.142 ± 0.050 F 0.070 ± 0.015 0.103 ± 0.036 0.140 ± 0.020 G 0.041 ± 0.021 0.012 ± 0.008 0.021 ± 0.013 H 0.020 ± 0.006 0.044 ± 0.010 0.062 ± 0.019 I 0.077 ± 0.017 0.019 ± 0.004 0.004 ± 0.001 J 0.012 ± 0.002 0.021 ± 0.001 0.032 ± 0.002 Petition 870250071938, dated 08 / 14 / 2025, p. 218 / 535 207 / 233 K 0.045 ± 0.014 0.013 ± 0.005 0.008 ± 0.005 L 0.106 ± 0.020 0.176 ± 0.044 0.215 ± 0.082 M 0.275 ± 0.029 0.378 ± 0.080 0.572 ± 0.043 Group Day 29 Day 36 A 1.000 ± 0.209 1.000 ± 0.270 B 0.079 ± 0.020 0.096 ± 0.007 C 0.087 ± 0.014 0.164 ± 0.026 D 0.176 ± 0.014 0.292 ± 0.030 E 0.223 ± 0.082 0.373 ± 0.150 F 0.213 ± 0.020 0.328 ± 0.034 G 0.031 ± 0.013 0.078 ± 0.064 H 0.97 ± 0.028 0.160 ± 0.060 I 0.008 ± 0.001 0.002 ± 0.0003 J 0.044 ± 0.008 0.069 ± 0.009 K 0.011 ± 0.007 0.011 ± 0.009 L 0.299 ± 0.009 M 0.792 ± 0.057

[0264] The RNAi agent AD04771 was designed to have an antisense strand sequence that is at least partially complementary to the open S reading frame at positions 257 to 275 of the HBV genome, as shown in Tables 1 and 2. The RNAi agent AD04872 was designed to have an antisense strand sequence that is at least partially complementary to the open S reading frame at positions 261 to 279 of the HBV genome, as shown in Tables 1 and 2. The RNAi agent AD04963 was designed to have an antisense strand sequence that is at least partially complementary to the open X reading frame at positions 1781 to 1799 of the HBV genome, as shown in Tables 1 and 2. The RNAi agents AD04882 and AD04885 were designed to have antisense strand sequences that are at least partially complementary to the reading frame. Petition 870250071938, dated 08 / 14 / 2025, page 219 / 535 208 / 233 open X at positions 1780 to 1798 of the HBV genome, as shown in Tables 1 and 2. The HBV RNAi agents shown in Table 9, directly above, showed a reduction in HBsAg compared to the PBS control at all measured time points, both individually and in combination. Redosing produced further reduction in HBsAg.

[0265] Additionally, serum levels of hepatitis B e antigen (HBeAg) were also evaluated for all groups, except that samples from the L and M groups of mice in each respective group were first pooled, and the resulting serum samples were tested in a single assay. The experimental data are shown in the following table. Table 29. Mean normalized HBeAg levels for pre-treatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 11. Group Day 8 Day 22 Day 29 Day 36 A 1.000 1.000 1.000 1.000 B 0.425 0.291 0.371 0.365 C 0.152 0.170 0.328 0.356 D 0.266 0.249 0.456 0.440 E 0.278 0.295 0.589 0.561 F 0.306 0.291 0.718 0.522 G 0.183 0.138 0.291 0.249 H 0.091 0.131 0.315 0.238 I 0.183 0.052 0.069 0.036 J 0.089 0.114 0.190 0.236 K 0.458 0.172 0.322 0.207

[0266] Additionally, serum HBV DNA levels were determined for each of the groups in Table 27 from serum samples collected in Petition 870250071938, dated 08 / 14 / 2025, p. 220 / 535 209 / 233 days 8, 15, 22, and 29, according to the procedure presented in Example 2 above. Serum HBV DNA was isolated from each animal at each time point. The data are shown in the following table. Table 30. Mean serum HBV DNA levels normalized to pretreatment and PBS control in pHBV mice after administration of the HBV RNAi agents of Example 7 (standard deviation reflected as (+ / -)).______________ Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.232 1.000 ± 0.463 1.000 ± 0.272 1.000 ± 0.205 B 0.577 ± 0.219 0.222 ± 0.064 0.196 ± 0.055 0.261 ± 0.117 C 0.165 ± 0.051 0.070 ± 0.042 0.142 ± 0.105 0.228 ± 0.174 D 0.343 ± 0.125 0.307 ± 0.091 0.300 ± 0.092 0.356 ± 0.032 E 0.262 ± 0.033 0.216 ± 0.018 0.227 ± 0.028 0.279 ± 0.090 F 0.320 ± 0.134 0.332 ± 0.208 0.344 ± 0.209 0.338 ± 0.211 G 0.231 ± 0.036 0.034 ± 0.024 0.069 ± 0.039 0.077 ± 0.020 H 0.229 ± 0.101 0.155 ± 0.121 0.148 ± 0.079 0.215 ± 0.035 I 0.281 ± 0.129 0.109 ± 0.071 0.023 ± 0.019 0.011 ± 0.009 J 0.078 ± 0.050 0.061 ± 0.020 0.074 ± 0.029 0.056 ± 0.030 K 0.314 ± 0.064 0.119 ± 0.043 0.076 ± 0.067 0.078 ± 0.095 L 0.295 ± 0.077 0.305 ± 0.101 0.213 ± 0.088 0.186 ± 0.084 M 0.515 ± 0.247 0.505 ± 0.293 0.488 ± 0.318 0.478 ± 0.267

[0267] The data in Table 30 indicate that the RNAi agents examined, both individually and in combination, provided a reduction in HBV DNA levels compared to the PBS group. Redosing produced a further reduction in HBV DNA. Example 12. HBV RNAi agents in pHBV mice.

[0268] The pHBV mouse model described in Example 2 above was used. The mice were divided into several groups, as shown in Petition 870250071938, dated 08 / 14 / 2025, page 221 / 535 210 / 233 Table 31, below, and each mouse received a single subcutaneous injection of 200 μL according to the dosage regimen presented in Table 31. Table 31. pHBV mouse dosage groups for Example 12. Group Dose and RNAi Agent Dosing Regimen A PBS (without RNAi agent) Single injection on day 1 B 2.0 mg / kg of AD04871 Single injection on day 1 C 2.0 mg / kg of AD04872 Single injection on day 1 D 2.0 mg / kg of AD04874 Single injection on day 1 E 2.0 mg / kg of AD04875 Single injection on day 1 F 2.0 mg / kg of AD04876 Single injection on day 1 G 2.0 mg / kg of AD04881 Single injection on day 1 H 2.0 mg / kg of AD04883 Single injection on day 1 I 2.0 mg / kg of AD04884 Single injection on day 1

[0269] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 24. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugated to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under loose skin in the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0270] Serum was collected before administration and then on days 8, 15, and 22. Serum from group A (PBS), group B (2.0 mg / kg AD04871), group C (2.0 mg / kg AD04872), group D (2.0 mg / kg AD04874), group E (2.0 mg / kg AD04876), and group F (2.0 mg / kg AD04876) was also collected on days 29, 36, 43, and Petition 870250071938, dated 08 / 14 / 2025, page 222 / 535 211 / 233 day 50. Serum levels of hepatitis B surface antigen (HBsAg) were determined according to the procedure described in Example 2 above. The experimental data are shown in the following table. Table 32. Mean normalized HBsAg for pre-treatment and control (PBS) in pHBV mice after administration of the HBV RNAi agents from Example 12 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.132 1.000 ± 0.089 1.000 ± 0.080 1.000 ± 0.098 B 0.102 ± 0.034 0.041 ± 0.021 0.049 ± 0.033 0.048 ± 0.031 C 0.153 ± 0.064 0.064 ± 0.032 0.063 ± 0.034 0.042 ± 0.017 D 0.123 ± 0.022 0.049 ± 0.017 0.039 ± 0.010 0.023 ± 0.001 E 0.190 ± 0.075 0.094 ± 0.038 0.107 ± 0.061 0.081 ± 0.051 F 0.190 ± 0.031 0.076 ± 0.035 0.084 ± 0.038 0.049 ± 0.024 G 0.159 ± 0.047 0.216 ± 0.057 0.235 ± 0.151 H 0.508 ± 0.078 0.666 ± 0.131 0.543 ± 0.048 I 0.279 ± 0.087 0.357 ± 0.078 0.614 ± 0.156 Group Day 36 Day 43 Day 50 A 1.000 ± 0.065 1.000 ± 0.242 1.000 ± 0.224 B 0.054 ± 0.038 0.064 ± 0.030 0.092 ± 0.025 C 0.049 ± 0.017 0.054 ± 0.015 0.085 ± 0.010 D 0.037 ± 0.004 0.037 ± 0.010 0.065 ± 0.012 E 0.126 ± 0.077 0.125 ± 0.063 0.170 ± 0.079 F 0.089 ± 0.044 0.082 ± 0.034 0.115 ± 0.028 GHI Petition 870250071938, dated 08 / 14 / 2025, p. 223 / 535 212 / 233

[0271] Each of the HBV RNAi agents, AD04871, AD04872, AD04874, AD04875, and AD04876, was designed to have antisense strand sequences that are at least partially complementary to the open S reading frame at positions 261 to 279 of the HBV genome, as shown in Tables 1 and 2. Each of these HBV RNAi agents showed a substantial reduction in HBsAg compared to the PBS control. For example, a single 2 mg / kg dose of each of AD04871 (Group B), AD04872 (Group C), AD04874 (Group D), and AD04876 (Group F) showed a greater than 90% reduction in HBsAg for each of the time points measured from day 15 to day 43 compared to the control. Each of the HBV RNAi agents AD04881, AD04883, AD04884 was designed to have antisense strand sequences that are at least partially complementary to the X-frame open reading frame at positions 1780 to 1798 of the HBV genome, as shown in Tables 1 and 2. Example 13. Dose-response and combinations of HBV RNAi agents in mice in an X-region knockout model.

[0272] As an alternative means of evaluating the effects of combining an RNAi agent that includes an antisense strand sequence that is at least partially complementary to a region located in the S ORF of HBV mRNA, and a second RNAi agent that includes an antisense strand sequence that is at least partially complementary to a region located in the X ORF of an HBV mRNA, a plasmid was generated that included the HBV genome with a knockout of the binding site for HBV RNAi agents targeting positions 1780 and 1781, as shown in Tables 1 and 2 (hereinafter referred to as X-region knockout mice). This model was generated by a ten (10) base mutation in the pHBV1.3 plasmid within the binding site of these RNAi agents. The remainder of the HBV mRNA, including the S region, remained functional. Thus, in this HBV mouse model, the inclusion of an RNAi agent is expected to Petition 870250071938, dated 08 / 14 / 2025, p. 224 / 535 213 / 233 HBV having an antisense strand that targets positions 1780 and 1781 of the HBV genome revealed here to be ineffective at silencing expression.

[0273] The mice were divided into several groups, including those presented in Table 33 below, and each mouse received a 200 μL subcutaneous injection according to the dosage regimen presented in the following Table: Table 33. Dosage groups of X-region knockout mice for Example 13. Group Dose and RNAi Agent Dosage Regimen Number of animals (n) 1 PBS (without RNAi agent) Single injection on day 1 4 2 2.0 mg / kg of AD04585 + 1.0 mg / kg of AD04963 Single injection on day 1 4 3 2.0 mg / kg of AD04872 + 1.0 mg / kg of AD04963 Single injection on day 1 4 4 2.5 mg / kg of AD04585 + 0.5 mg / kg of AD04963 Single injection on day 1 4 5 2.5 mg / kg of AD04872 + 0.5 mg / kg of AD04963 Single injection on day 1 4 6 3.0 mg / kg of AD04963 Single injection on day 15 1

[0274] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 33. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugates to the 5' terminal end of the sense strand, as shown. Petition 870250071938, dated 08 / 14 / 2025, page 225 / 535 214 / 233 in Tables 4 and 5. The injections were performed between the skin and the muscle (i.e., subcutaneous injections) under the loose skin in the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0275] Serum was collected on days 5, 8, 15, 22, and 29, and serum levels of hepatitis B virus surface antigen (HBsAg) were determined according to the procedure described in Example 2 above. Serum was also collected for groups 1 to 5 on days 36 and 43. The experimental data are shown in Table 34 below. Table 34. Mean normalized HBsAg for pre-treatment and control (PBS) in X-region knockout mice after administration of the HBV RNAi agents from Example 13 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 1 1.000 ± 0.186 1.000 ± 0.165 1.000 ± 0.132 2 0.061 ± 0.034 0.041 ± 0.035 0.030 ± 0.015 3 0.020 ± 0.011 0.007 ± 0.003 0.003 ± 0.002 4 0.063 ± 0.039 0.022 ± 0.011 0.029 ± 0.013 5 0.027 ± 0.014 0.003 ± 0.003 0.001 ± 0.001 6 0.948 1.360 1.652 Day 29 Day 36 Day 43 1 1.000 ± 0.059 1.000 ± 0.044 1.000 ± 0.045 2 0.051 ± 0.029 0.062 ± 0.029 3 0.004 ± 0.003 0.008 ± 0.003 0.018 ± 0.007 4 0.040 ± 0.022 0.061 ± 0.030 5 0.002 ± 0.001 0.003 ± 0.002 0.014 ± 0.006 6 1,831

[0276] As expected, group 6, which is a single dose of 3.0 mg / kg of the HBV RNAi agent, AD04963, includes an antisense strand that is at least Petition 870250071938, dated 08 / 14 / 2025, p. 226 / 535 215 / 233, partially complementary to the X open reading frame at positions 1781 to 1799 of the HBV genome, was unable to provide HBsAg reduction. Additionally, each of groups 2 to 5 provided substantial HBsAg reduction compared to the PBS control, with group 3 and group 5 both showing a greater than 2 log reduction in HBsAg at the lowest point (day 22). Example 14. Dose-response and combinations of HBV RNAi agents in mice in an X-region knockout model.

[0277] The X-region knockout mouse model described in Example 13 above was used. Mice were divided into several groups, including those presented in Table 31 below, and each mouse received a single subcutaneous injection of 200 μL according to the dosage regimen presented in Table 35. Table 35. Dosage groups of X-region knockout mice for Example 14._____________________________________________________ Group Dose and RNAi Agent Dosing Regimen 1 PBS (without RNAi agent) Single injection on day 1 2 2.0 mg / kg of AD04872 Single injection on day 1 3 2.0 mg / kg of AD04872 + 0.7 mg / kg of AD05070 Single injection on day 1 4 2.0 mg / kg of AD04872 + 1.0 mg / kg of AD05070 Single injection on day 1 5 2.0 mg / kg of AD04872 + 2.0 mg / kg of AD05070 Single injection on day 1

[0278] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 35. Each of the agents Petition 870250071938, dated 08 / 14 / 2025, page 227 / 535 216 / 233 HBV RNAi included targeting ligands consisting of N-acetylgalactosamine conjugates to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under loose skin in the neck and shoulder area. Three (3) mice in each group shown in Table 35 were tested (n=3).

[0279] Serum was collected on day 1 (pre-dose), day 8, day 15, day 22, and day 29, and serum levels of hepatitis B virus surface antigen (HBsAg) were determined according to the procedure described in Example 2 above. The experimental data are shown in the following table. Table 36. Mean normalized HBsAg for pre-treatment and PBS control in knockout mice of the X region from Example 14. Group Day 8 Day 15 Day 22 Day 29 1 1.000 ± 0.120 1.000 ± 0.255 1.000 ± 0.224 1.000 ± 0.143 2 0.104 ± 0.104 0.009 ± 0.009 0.005 ± 0.004 0.005 ± 0.003 3 0.076 ± 0.041 0.010 ± 0.009 0.006 ± 0.005 0.005 ± 0.005 4 0.036 ± 0.008 0.002 ± 0.001 0.001 ± 0.001 0.002 ± 0.001 5 0.019 ± 0.017 0.003 ± 0.002 0.003 ± 0.001 0.004 ± 0.000

[0280] Table 36 shows that the HBV RNAi agent, AD04881, administered alone, and the combination of AD04862 (which includes an antisense strand that is at least partially complementary to the open S reading frame at positions 261 to 279 of the HBV genome) and AD05070 (which includes an antisense strand that is at least partially complementary to the open X reading frame at positions 1781 to 1799 of the HBV genome), provided a significant reduction in HBsAg compared to the PBS control at each of the measured time points. The addition of 0.7 mg / kg to 2 mg / kg of the HBV RNAi agent, AD05070, for which Petition 870250071938, dated 08 / 14 / 2025, page 228 / 535 217 / 233 there was a mutated target site in this knockout model of the X region did not decrease the activity of the 2 mg / kg HBV RNAi agent, AD04872.

[0281] Additionally, serum HBV DNA levels were determined from serum samples collected on days 8, 15, and 22, according to the procedure presented in Example 2 above. The serum from each group was pooled, and then the DNA was isolated from the serum in singlet form. The data are presented in the following table. Table 37. Mean HBV DNA levels normalized to pre-treatment and PBS controls in X-region knockout mice after administration of HBV RNAi agents from Example 14 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 1 1.000 ± 0.007 1.000 ± 0.011 1.000 ± 0.066 2 0.225 ± 0.019 0.022 ± 0.001 0.036 ± 0.001 3 0.151 ± 0.002 0.029 ± 0.001 0.042 ± 0.003 4 0.140 ± 0.006 0.016 ± 0.000 0.018 ± 0.000 5 0.069 ± 0.002 0.018 ± 0.003 0.043 ± 0.002

[0282] The addition of 0.7 mg / kg to 2 mg / kg of the HBV RNAi agent, AD05070, for which there was a mutated target site in this X-region knockout model did not decrease the activity of 2 mg / kg of the HBV RNAi agent, AD04872. Example 15. HBV RNAi agents in pHBV mice.

[0283] The pHBV mouse model described in Example 2 above was used. The mice were divided into several groups, including those presented in Table 38 below, and each mouse received a single subcutaneous injection of 200 μL according to the dosage regimen presented in Table 38. Petition 870250071938, dated 08 / 14 / 2025, page 229 / 535 218 / 233 Table 38. pHBV mouse dosage groups for Example 15. Group Dose and RNAi Agent Dosing Regimen 1 PBS (without RNAi agent) Single injection on day 1 2 2.0 mg / kg of AD04776 Single injection on day 1 3 2.0 mg / kg of AD05069 Single injection on day 1 4 2.0 mg / kg of AD05070 Single injection on day 1 5 2.0 mg / kg of AD05071 Single injection on day 1 6 2.0 mg / kg of AD05073 Single injection on day 1 7 2.0 mg / kg of AD05074 Single injection on day 1 8 2.0 mg / kg of AD05075 Single injection on day 1 9 2.0 mg / kg of AD05076 Single injection on day 1 10 2.0 mg / kg of AD05077 Single injection on day 1 11 2.0 mg / kg of AD05078 Single injection on day 1 12 3.0 mg / kg of AD04872 + 1.0 mg / kg of AD04776 Single injection on day 1 13 3.0 mg / kg of AD04872 + 1.0 mg / kg of AD05069 Single injection on day 1 14 3.0 mg / kg of AD04872 + 1.0 mg / kg of AD05070 Single injection on day 1 15 3.0 mg / kg of AD04872 + 1.0 mg / kg of AD05071 Single injection on day 1 16 3.0 mg / kg of AD04872 + 1.0 mg / kg of AD05073 Single injection on day 1 17 3.0 mg / kg of AD04872 + 1.0 mg / kg of AD05074 Single injection on day 1 18 3,0 mg / kg of AD04872 + 1.0 mg / kg of AD05075 Single injection on day 1 19 3.0 mg / kg of AD04872 + 1.0 mg / kg of AD05076 Single injection on day 1 20 3.0 mg / kg of AD04872 + 1.0 mg / kg of AD05077 Single injection on day 1 21 3.0 mg / kg of AD04872 + 1.0 mg / kg of AD05078 Single injection on day 1, Petition 870250071938, dated 08 / 14 / 2025, page 230 / 535 219 / 233

[0284] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 38. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugates to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under loose skin in the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0285] Serum was collected on day -1 before administration and then on days 8, 15, 22, 29, 36, 43, and 50. Serum hepatitis B surface antigen (HBsAg) levels were determined according to the procedure described in Example 2 above. The experimental data are shown in Table 39 below, with the mean HBsAg reflecting the mean of the normalized HBsAg values: Table 39. Mean normalized HBeAg for pre-treatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 15. Group Day 8 Day 15 Day 22 Day 29 1 1.000 ± 0.119 1.000 ± 0.047 1.000 ± 0.080 1.000 ± 0.027 2 0.339 ± 0.076 0.414 ± 0.126 0.385 ± 0.067 0.450 ± 0.075 3 0.240 ± 0.096 0.361 ± 0.078 0.446 ± 0.073 0.508 ± 0.114 4 0.081 ± 0.026 0.127 ± 0.031 0.223 ± 0.057 0.330 ± 0.112 5 0.452 ± 0.020 0.431 ± 0.126 0.373 ± 0.079 0.383 ± 0.080 6 0.375 ± 0.181 0.632 ± 0.192 0.463 ± 0.117 0.567 ± 0.159 7 0.325 ± 0.032 0.438 ± 0.125 0.393 ± 0.056 0.443 ± 0.096 8 0.155 ± 0.031 0.322 ± 0.019 0.333 ± 0.077 0.463 ± 0.043 Petition 870250071938, dated 08 / 14 / 2025, page 231 / 535 220 / 233 9 0.245 ± 0.063 0.467 ± 0.090 0.477 ± 0.045 0.562 ± 0.049 10 0.120 ± 0.062 0.173 ± 0.029 0.289 ± 0.019 0.331 ± 0.042 11 0.128 ± 0.042 0.172 ± 0.046 0.179 ± 0.015 0.215 ± 0.049 12 0.040 ± 0.015 0.014 ± 0.004 0.014 ± 0.006 0.015 ± 0.004 13 0.050 ± 0.020 0.015 ± 0.011 0.017 ± 0.008 0.022 ± 0.009 14 0.020 ± 0.011 0.011 ± 0.006 0.015 ± 0.006 0.023 ± 0.004 15 0.043 ± 0.005 0.013 ± 0.005 0.010 ± 0.002 0.011 ± 0.004 16 0.021 ± 0.017 0.008 ± 0.004 0.012 ± 0.003 0.011 ± 0.001 17 0.032 ± 0.011 0.009 ± 0.003 0.007 ± 0.002 0.008 ± 0.0003 18 0.023 ± 0.014 0.010 ± 0.006 0.009 ± 0.006 0.009 ± 0.004 19 0.025 ± 0.006 0.010 ± 0.004 0.009 ± 0.002 0.010 ± 0.003 20 0.061 ± 0.013 0.027 ± 0.006 0.020 ± 0.003 0.029 ± 0.006 21 0.061 ± 0.050 0.013 ± 0.010 0.012 ± 0.005 0.018 ± 0.006 Group Day 36 Day 43 Day 50 1 1.000 ± 0.031 1.000 ± 0.114 1.000 ± 0.112 2 0.617 ± 0.116 0.643 ± 0.154 0.665 ± 0.199 3 0.638 ± 0.067 0.743 ± 0.015 0.792 ± 0.115 4 0.472 ± 0.121 0.515 ± 0.126 0.689 ± 0.167 5 0.591 ± 0.159 0.604 ± 0.086 0.709 ± 0.115 6 0.717 ± 0.136 0.686 ± 0.194 0.781 ± 0.301 7 0.586 ± 0.069 0.775 ± 0.143 0.747 ± 0.095 8 0.666 ± 0.066 0.803 ± 0.096 0.856 ± 0.180 9 0.801 ± 0.047 0.667 ± 0.055 0.765 ± 0.208 10 0.640 ± 0.059 0.667 ± 0.034 0.742 ± 0.133 11 0.429 ± 0.063 0.383 ± 0.005 0.497 ± 0.060 12 0.037 ± 0.013 0.044 ± 0.012 0.056 ± 0.014 13 0.046 ± 0.011 0.055 ± 0.010 0.070 ± 0.010 14 0.054 ± 0.016 0.070 ± 0.018 0.096 ± 0.012 15 0.029 ± 0.011 0.032 ± 0.015 0.051 ± 0.020 16 0.033 ± 0.005 0.038 ± 0.007 0.062 ± 0.004 17 0.021 ± 0.002 0.031 ± 0.004 0.061 ± 0.005 18 0.034 ± 0.014 0.047 ± 0.016 0.079 ± 0.017 Petition 870250071938, dated 08 / 14 / 2025, p. 232 / 535 221 / 233 19 0.028 ± 0.005 0.037 ± 0.006 0.060 ± 0.011 20 0.070 ± 0.009 0.063 ± 0.018 0.097 ± 0.018 21 0.040 ± 0.012 0.066 ± 0.007 0.120 ± 0.036

[0286] Each of the RNAi agents AD04776, AD05069, AD05070, AD05071, AD05073, and AD05074 was designed to have an antisense strand sequence that is at least partially complementary to the open X reading frame at positions 1781 and 1799 of the HBV genome, as shown in Tables 1 and 2. Each of the RNAi agents, AD05075, AD05076, AD05077, and AD05078 was designed to have antisense strand sequences that are at least partially complementary to the open X reading frame at positions 1780 to 1798 of the HBV genome, as shown in Tables 1 and 2.

[0287] Table 39 shows that the HBV RNAi agents AD04776, AD05069, AD05070, AD05071, AD05073, and AD05074 administered alone or in combination with AD04872 (which includes an antisense strand that is at least partially complementary to the open S reading frame at positions 261 to 279 of the HBV genome) provided a significant reduction in HBsAg compared to the PBS control at each of the measured time points. Example 16. HBV RNAi agents in pHBV mice: dose-response and combination studies.

[0288] The pHBV mouse model described in Example 2 above was used. The mice were divided into several groups, as shown in Table 40 below, and each mouse received a single subcutaneous injection of 200 μL according to the dosage regimen shown in Table 40. Table 40. pHBV mouse dosage groups for Example 16. Group Dose and RNAi Agent Dosing Regimen 1 PBS (without RNAi agent) Single injection on day 1 Petition 870250071938, dated 08 / 14 / 2025, page 233 / 535 222 / 233 2 3.2 mg / kg of AD04872 Single injection on day 1 3 3.2 mg / kg of AD04872 Single injection on day 1 and day 22 4 3.0 mg / kg of AD04872 + 0.8 mg / kg of AD05070 Single injection on day 1 5 3.0 mg / kg of AD04872 + 0.8 mg / kg of AD05070 Single injection on day 1 and day 22 6 3.0 mg / kg of AD04872 + 1.0 mg / kg of AD05070 Single injection on day 1 7 3.0 mg / kg of AD04872 + 1.0 mg / kg of AD05070 Single injection on day 1 and day 22 8 2.7 mg / kg of AD04872 + 1.3 mg / kg AD05070 Single injection on day 1 9 2.7 mg / kg of AD04872 + 1.3 mg / kg of AD05070 Single injection on day 1 and day 22 10 2.0 mg / kg of AD04872 + 2.0 mg / kg of AD04776 Single injection on day 1 and day 22 11 0.8 mg / kg of AD05070 Single injection on day 1 and day 22 12 1.3 mg / kg of AD05070 Single injection on day 1 and day 22

[0289] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 40. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugated to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under loose skin in the neck and shoulder area. Six (6) mice in each group were tested (n=6).

[0290] Serum was collected before administration and then on days 8, 15, 22, and 29, and serum levels of hepatitis B virus surface antigen were measured. Petition 870250071938, dated 08 / 14 / 2025, page 234 / 535 223 / 233 (HBsAg) were determined according to the procedure described in Example 2 above. The experimental data are shown in Table 41 below. Table 41. Mean normalized HBsAg levels for pre-treatment and control (PBS) in pHBV mice after administration of the HBV RNAi agents from Example 16 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 Day 29 1 1.000 ± 0.117 1.000 ± 0.213 1.000 ± 0.169 1.000 ± 0.130 2 0.050 ± 0.018 0.015 ± 0.007 0.011 ± 0.005 0.009 ± 0.006 3 0.051 ± 0.037 0.014 ± 0.011 0.010 ± 0.006 0.002 ± 0.001 4 0.029 ± 0.018 0.010 ± 0.006 0.011 ± 0.006 0.010 ± 0.005 5 0.022 ± 0.003 0.007 ± 0.001 0.009 ± 0.003 0.001 ± 0.001 6 0.027 ± 0.012 0.007 ± 0.004 0.008 ± 0.005 0.011 ± 0.005 7 0.028 ± 0.012 0.010 ± 0.005 0.009 ± 0.005 0.001 ± 0.000 8 0.033 ± 0.016 0.016 ± 0.008 0.020 ± 0.009 0.021 ± 0.011 9 0.034 ± 0.025 0.015 ± 0.011 0.018 ± 0.013 0.003 ± 0.002 10 0.038 ± 0.021 0.015 ± 0.005 0.019 ± 0.004 0.003 ± 0.001 11 0.446 ± 0.143 0.376 ± 0.120 0.474 ± ​​0.149 0.338 ± 0.123 12 0.307 ± 0.111 0.257 ± 0.122 0.236 ± 0.057 0.138 ± 0.031

[0291] The HBV RNAi agents tested, both individually and in combination, showed a reduction in HBsAg compared to the PBS control at all measured time points. HBsAg expression was further reduced in all groups that were redosed on day 22.

[0292] Additionally, serum levels of hepatitis B e antigen (HBeAg) were also evaluated. For the day 8 measurement, serum samples from all six mice in each group were pooled, and the resulting samples were tested in a single assay. For the day -1, day 15, day 22, and day 29 measurements, the six mice in each group were paired within each Petition 870250071938, dated 08 / 14 / 2025, page 235 / 535 Groups 224 / 233 and their respective serum samples were pooled, forming three subgroups for each group. The serum samples for each of the three subgroups for each group were then tested. The experimental data are shown in Table 42 below. Table 42. Mean normalized HBeAg levels for pre-treatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 16 (standard deviation for days 15, 22, and 29 reflected as (+ / -)). Group Day 8 Day 15 Day 22 Day 29 1 1.000 1.000 ±0.011 1.000 ±0.170 1.000 ±0.173 2 0.510 0.308 ± 0.031 0.217 ± 0.021 0.226 ± 0.035 3 0.488 0.301 ± 0.065 0.283 ± 0.081 0.147 ± 0.030 4 0.213 0.216 ± 0.067 0.192 ± 0.029 0.141 ± 0.048 5 0.192 0.211 ± 0.053 0.216 ± 0.088 0.047 ± 0.016 6 0.176 0.163 ± 0.022 0.238 ± 0.069 0.117 ± 0.011 7 0.165 0.175 ± 0.046 0.215 ± 0.061 0.028 ± 0.012 8 0.128 0.166 ± 0.065 0.386 ± 0.284 0.167 ± 0.118 9 0.172 0.171 ± 0.037 0.244 ± 0.052 0.032 ± 0.010 10 0.180 0.211 ± 0.012 0.283 ± 0.034 0.034 ± 0.001 11 0.634 0.594 ± 0.082 0.840 ± 0.152 0.271 ± 0.029 12 0.486 0.441 ± 0.066 0.804 ± 0.096 0.214 ± 0.039

[0293] The HBV RNAi agents tested, both individually and in combination, showed a reduction in HBeAg compared to the saline control at all measured time points. HBeAg expression was further reduced in all groups that were redosed on day 22.

[0294] Additionally, serum HBV DNA levels were determined for each of the groups in Table 40 from serum samples collected on days -1, 8, 15, and 22, according to the procedure presented in Example 2 above. Petition 870250071938, dated 08 / 14 / 2025, page 236 / 535 225 / 233 The serum from each pair of mice was pooled, and then DNA was isolated from each serum group into a single isolate. The data are presented in the following table. Table 43. Mean serum HBV DNA levels normalized to pretreatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 16 (standard deviation reflected as (+ / -)). Group Day 8 Day 15 Day 22 1 1.000 ± 0.122 1.000 ± 0.299 1.000 ± 0.241 2 0.312 ± 0.016 0.126 ± 0.008 0.087 ± 0.018 3 0.264 ± 0.065 0.081 ± 0.023 0.073 ± 0.028 4 0.321 ± 0.254 0.120 ± 0.066 0.134 ± 0.101 5 0.319 ± 0.081 0.108 ± 0.038 0.098 ± 0.051 6 0.260 ± 0.095 0.068 ± 0.010 0.076 ± 0.031 7 0.170 ± 0.028 0.082 ± 0.013 0.062 ± 0.018 8 0.188 ± 0.020 0.192 ± 0.160 0.307 ± 0.309 9 0.242 ± 0.003 0.100 ± 0.042 0.075 ± 0.028 10 0.322 ± 0.028 0.159 ± 0.025 0.086 ± 0.016 11 1.124 ± 0.142 0.742 ± 0.127 0.807 ± 0.192 12 1.004 ± 0.144 0.541 ± 0.340 0.569 ± 0.060

[0295] The HBV RNAi agents tested, both individually and in combination, showed a reduction in serum HBV DNA compared to the saline control at all time points measured except in groups 11 and 12 which did not show a reduction in serum HBV DNA on day 8. Example 17. HBV RNAi agents in pHBV mice.

[0296] The pHBV mouse model described in Example 2 above was used. The mice were divided into several groups, as shown in Petition 870250071938, dated 08 / 14 / 2025, page 237 / 535 226 / 233 Table 44 below shows that each mouse received a single subcutaneous injection of 200 μL according to the dosage regimen presented in Table 44: Table 44. pHBV mouse dosage groups for Example 17. Group Dose and RNAi Agent Dosing Regimen 1 PBS (without RNAi agent) Single injection on day 1 2 5 mg / kg AD04585 + 1 mg / kg AD04963 Single injection on day 1 3 5 mg / kg AD04872 + 1 mg / kg AD04963 Single injection on day 1 4 5 mg / kg AD04585 + 1 mg / kg AD04963 On day 1 and single injection on day 8 5 5 mg / kg AD04872 + 1 mg / kg AD04963 On day 1 and single injection on day 8 6 2.5 mg / kg AD04585 + 0.5 mg / kg AD04963 Single injection on day 1 7 2.0 mg / kg AD04585 + 1.0 mg / kg AD04963 Single injection on day 1: 8 2.5 mg / kg of AD04872 + 0.5 mg / kg of AD04963 Single injection on day 1: 9 2.0 mg / kg of AD04872 + 1.0 mg / kg of AD04963 Single injection on day 1: 10 5 mg / kg of AD04872 + 1 mg / kg of AD04981 Single injection on day 1: 11 2.5 mg / kg of AD04872 + 0.5 mg / kg of AD04981 On day 1 and single injection on day 8: 12 2.5 mg / kg of AD04872 + 0.5 mg / kg of AD04981 Single injection on day 1: 13 2 mg / kg of AD04872 + 1 mg / kg of AD04981 Single injection on day 1: 14 2.5 mg / kg of AD04585 + 0,5 mg / kg of AD04981 Single injection on day 1 15 2 mg / kg of AD04585 + 1 mg / kg of AD04981 Single injection on day 1, Petition 870250071938, dated 08 / 14 / 2025, page 238 / 535 227 / 233 16 0.5 mg / kg of AD04981 Single injection on day 1

[0297] Each mouse received a subcutaneous administration of 200 μL containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or 200 μL of phosphate-buffered saline without an HBV RNAi agent, as presented in Table 44. Each of the HBV RNAi agents included targeting ligands consisting of N-acetylgalactosamine conjugates to the 5' terminal end of the sense strand, as shown in Tables 4 and 5. Injections were performed between the skin and muscle (i.e., subcutaneous injections) under loose skin in the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0298] Serum was collected before administration and then on days 8, 14, 21, 29 and 36, and serum hepatitis B surface antigen (HBsAg) levels were determined according to the procedure presented in Example 2 above. The experimental data are shown in Table 45 below. Table 45. Mean normalized HBsAg levels for pre-treatment and control (PBS) in pHBV mice after administration of the HBV RNAi agents from Example 17 (standard deviation reflected as (+ / -)). Group Day 8 Day 14 Day 21 Day 29 1 1.000 ± 0.068 1.000 ± 0.125 1.000 ± 0.152 1.000 ± 0.110 2 0.058 ± 0.033 0.059 ± 0.022 0.085 ± 0.023 0.158 ± 0.021 3 0.025 ± 0.009 0.014 ± 0.006 0.015 ± 0.008 0.026 ± 0.015 4 0.032 ± 0.007 0.005 ± 0.001 0.006 ± 0.002 0.014 ± 0.002 5 0.024 ± 0.009 0.003 ± 0.001 0.001 ± 0.0004 0.001 ± 0.0005 6 0.063 ± 0.020 0.077 ± 0.013 0.131 ± 0.011 0.214 ± 0.026 7 0.041 ± 0.018 0.059 ± 0.017 0.091 ± 0.016 0.140 ± 0.045 8 0.070 ± 0.008 0.046 ± 0.016 0.043 ± 0.009 0.055 ± 0.012 9 0.043 ± 0.006 0.027 ± 0.003 0.064 ± 0.017 0.064 ± 0.014 Petition 870250071938, dated 08 / 14 / 2025, page 239 / 535 228 / 233 10 0.015 ± 0.008 0.005 ± 0.003 0.005 ± 0.003 0.005 ± 0.003 11 0.047 ± 0.014 0.005 ± 0.003 0.003 ± 0.002 0.003 ± 0.003 12 0.062 ± 0.006 0.025 ± 0.007 0.027 ± 0.005 0.033 ± 0.005 13 0.092 ± 0.029 0.050 ± 0.021 0.050 ± 0.022 0.054 ± 0.0019 14 0.310 ± 0.180 0.056 ± 0.010 0.081 ± 0.010 0.112 ± 0.0018 15 0.304 ± 0.044 0.083 ± 0.021 0.115 ± 0.013 0.165 ± 0.025 16 1.667 ± 0.217 0.416 ± 0.163 0.341 ± 0.179 0.511 ± 0.0011 Group Day 36 1 1.000 ± 0.225 2 3 0.049 ± 0.019 4 5 0.004 ± 0.0004 6 7 8 0.081 ± 0.010 9 0.108 ± 0.026 10 0.009 ± 0.004 11 0.005 ± 0.003 12 0.060 ± 0.014 13 0.094 ± 0.027 14 15 16 0.634 ± 0.005

[0299] The combinations of HBV RNAi agents tested showed a reduction in HBsAg compared to the saline control at all measured time points. Combinations containing AD04872 showed greater reductions than equivalent combinations with AD04585 instead of AD04872. Petition 870250071938, dated 08 / 14 / 2025, page 240 / 535 229 / 233

[0300] Additionally, serum HBV DNA levels were determined for serum samples collected on days 8, 14, 21, and 29, according to the procedure presented in Example 2 above. Serum HBV DNA was isolated from each animal at each time point. The data are presented in Table 46 below. Table 46. Mean serum HBV DNA levels normalized to pretreatment and PBS control in pHBV mice after administration of the HBV RNAi agents from Example 17 (standard deviation reflected as (+ / -)). Group Day 8 Day 14 Day 21 Day 29 1 1.000 ± 0.280 1.000 ± 0.269 1.000 ± 0.418 1.000 ± 0.383 2 0.136 ± 0.068 0.192 ± 0.071 0.173 ± 0.032 0.292 ± 0.039 3 0.097 ± 0.034 0.068 ± 0.016 0.076 ± 0.034 0.131 ± 0.061 4 0.061 ± 0.039 0.002 ± 0.001 0.003 ± 0.001 0.019 ± 0.013 5 0.068 ± 0.025 0.003 ± 0.002 0.0009 ± 0.0003 0.0009 ± 0.0003 6 0.354 ± 0.299 0.345 ± 0.187 0.522 ± 0.234 0.509 ± 0.106 7 0.103 ± 0.064 0.291 ± 0.025 0.203 ± 0.043 0.203 ± 0.015 8 0.336 ± 0.142 0.185 ± 0.071 0.183 ± 0.065 0.162 ± 0.064 9 0.198 ± 0.055 0.093 ± 0.023 0.118 ± 0.054 0.143 ± 0.032 10 0.122 ± 0.071 0.024 ± 0.026 0.023 ± 0.020 0.014 ± 0.017 11 0.160 ± 0.069 0.016 ± 0.023 0.003 ± 0.001 0.005 ± 0.004 12 0.158 ± 0.039 0.120 ± 0.044 0.100 ± 0.049 0.091 ± 0.034 13 0.190 ± 0.038 0.169 ± 0.025 0.066 ± 0.015 0.081 ± 0.015 14 0.434 ± 0.136 0.318 ± 0.104 0.144 ± 0.094 0.240 ± 0.029 15 0.358 ± 0.185 0.287 ± 0.108 0.279 ± 0.080 0.303 ± 0.038 16 0.713 ± 0.085 0.674 ± 0.140 0.496 ± 0.128 0.590 ± 0.093

[0301] The combinations of HBV RNAi agents tested showed a reduction in serum HBV DNA compared to the saline control at all measured time points. Combinations containing AD04872 showed greater Petition 870250071938, dated 08 / 14 / 2025, page 241 / 535 230 / 233 reductions compared to equivalent combinations with AD04585 instead of AD04872. These larger reductions were observed on day 22 and day 29. Example 18. HBV RNAi agents in a humanized mouse model infected with HBV.

[0302] For this study, FRG® mice (genotype Fah - / - / Rag2 - / - / Il2rg - / - triple knockout) on a C57BL / 6 background (Yecuris) were transplanted with human hepatocytes when they were 1 to 2 months old. The human hepatocytes were left to repopulate the liver for approximately 6 months with periodic treatment with NTBC to discourage mouse hepatocyte growth. At 9 months of age, the mice received an intravenous inoculation of 4 x 10⁸ genomes / kg of HBV genotype, which infected human hepatocytes. After 2 to 3 months, serum HBV DNA levels reached a plateau indicating that human hepatocytes were maximally infected (mouse hepatocytes cannot be infected by HBV). The mice were one year old at the start of treatment with HBV RNAi agents, thus approaching the end of their lifespan.

[0303] Pre-treatment serum samples were collected on day -10 and day -3. Beginning on day 1, each mouse received a daily oral gavage with 0.01 mg / kg of Entecavir dissolved in water to inhibit HBV replication. Daily administration of Entecavir continued until the day the mice were euthanized. The expected outcome of Entecavir administration was to reduce serum HBV DNA in chronically infected human patients, but not to reduce HBsAg.

[0304] The mice were divided into several groups including those presented in Table 47 below: Petition 870250071938, dated 08 / 14 / 2025, page 242 / 535 231 / 233 Table 47. Dosage groups of humanized FRG model mice infected with HBV for Example 18. Group Dose and RNAi Agent Dosage Regimen Termination Day A- Mouse 1 PBS (without RNAi agent) Single injection on day 1 euthanized on day 21 (unhealthy animal) A- Mouse 2 PBS (without RNAi agent) Single injection on day 1 and day 29 euthanized on day 36 B- Mouse 1 4.0 mg / kg AD04872 + 2.0 mg / kg AD05070 Single injection on day 1 and day 29 euthanized on day 36 B- Mouse 2 4.0 mg / kg AD04872 + 2.0 mg / kg AD05070 Single injection on day 1 and day 29 euthanized on day 40 C- Mouse 1 4.5 mg / kg AD04872 + 1.5 mg / kg AD05070 Single injection on day 1 C- Mouse 2: 4.5 mg / kg AD04872 + 1.5 mg / kg AD05070. Single injection on day 1 and day 29. Euthanized on day 36. C- Mouse 3: 4.5 mg / kg AD04872 + 1.5 mg / kg AD05070. Single injection on day 1 and day 29. Euthanized on day 40.

[0305] Each mouse also received a subcutaneous administration of 100 μL per 20 grams of body weight containing the amount of HBV RNAi agent(s) formulated in phosphate-buffered saline, or an equal volume of phosphate-buffered saline without an HBV RNAi agent, on day 1 and day 29 (if still alive on day 29), as shown in Table 47, directly above. Each of the HBV RNAi agents included ligands of Peti...

Claims

1. RNAi agent for inhibiting the expression of a hepatitis B virus gene in an individual CHARACTERIZED in that the RNAi agent comprises a sense strand comprising a nucleobase sequence according to SEQ ID NO: 328, and an antisense strand comprising a nucleobase sequence according to SEQ ID NO: 188, wherein at least one nucleotide of the sense strand and / or at least one nucleotide of the antisense strand of the RNAi agent is a modified nucleotide and / or has a modified internucleoside bond.

2. RNAi agent, according to claim 1, CHARACTERIZED in that 0, 1, 2, 3 or 4 of the nucleotides in the sense strand and in the antisense strand of the RNAi agent are unmodified nucleotides.

3. RNAi agent, according to claim 2, CHARACTERIZED in that both the sense strand and the antisense strand independently comprise 1, 2, 3, 4, 5 or 6 phosphorothioate linkages.

4. RNAi agent, according to claim 3, CHARACTERIZED in that the RNAi agent is conjugated to a targeting ligand comprising N-acetylgalactosamine.

5. RNAi agent, according to claim 4, CHARACTERIZED in that the targeting ligand is selected from the group consisting of: O (NAG13); Petition 870250071938, dated 08 / 14 / 2025, p. 246 / 535 2 / 21 O NAG χ 0 χχ0 >L h O '•z 0 N' H o [ H NAG-0 x xx. χθχ χχ χχ A Ã Á N. N 0 k H 0 0, xOx / N-. NAG OOHOOH NAG—O—x O. zx 11 „N, _x - NH \ OH H'N^OII xx xx xN- A NAG—O—0 Π 1 o >ííO - Nx CH NAG—0—O^Çf 0 H NAG-0 x O 11 N x. NH \ OH Jx HH^N^O 1 1 NAG-0—0 ^-^ 0 , Nx CH NAG-0—-''O'^ „ 0 ,-χ. NAG 0 ^-^ NH 0 [--^0 ...X „ / -xx Ox z~x XN xx NAG—0 NH HN^OO NAG—O^ 7 <AW 1 - O=P—S 1 O O XxAx / ^x / \ / x / L x OH 9 N H (NAG13)s; H 0 -X X Nx X-\ χ'-'χ x^x 1 1 1 I (NAG18); H 0 •X XNx χΧ-Χχ x-X χ / χ 1 1 J 0 ..... ...... (NAG18)s; O li ϊ XXX O-Pd NH O Ϊ O (NAG24); Petição 870250071938, de 14 / 08 / 2025, pág. 247 / 535 3 / 21 S' (NAG24)s; O (NAG26); Petição 870250071938, de 14 / 08 / 2025, pág.248 / 535 4 / 21 O (NAG26)s; O (NAG27); (NAG27)s; NAG OO OP— O- (NAG28); Petition 870250071938, of 08 / 14 / 2025, p. 249 / 535 5 / 21 NAG NAG O NAG—O (NAG28)s; NAG / OO OP=O avav (NAG29); NAG OOS—P=O yvww (NAG29)s; Petition 870250071938, of 08 / 14 / 2025, p. 250 / 535 6 / 21 NAG O „ O NAG NAG OO HN HNOONHOIO pI O (NAG30); NAG (NAG30)s; OI p IO (NAG31); OP (NAG31)s; OOP O-1 (NAG32); Petition 870250071938, dated 08 / 14 / 2025, p. 251 / 535 7121 H (NAG32)s; (NAG33); O % OP-| S- (NAG33)s; O 11 i PO (NAG36); Petition 870250071938, dated 08 / 14 / 2025, p. 253 / 535 9 / 21 (NAG36)s; O PO (NAG37); O (NAG37)s; 254 / 535 10 / 21 (NAG38)s; OO—P— OI “ . O (NAG39); and o—p—IIn > S (NAG39)s; where NAG is N-acetyl-galactosamine.

6. RNAi agent, according to claim 5, CHARACTERIZED in that the targeting ligand is attached to the 3' or 5' end of the sense strand of the RNAi agent.

7. RNAi agent, according to claim 5, CHARACTERIZED in that the targeting ligand is attached to the 3' or 5' end of the antisense strand of the RNAi agent.

8. RNAi agent, according to claim 4, CHARACTERIZED by Petition 870250071938, dated 08 / 14 / 2025, page 255 / 535 11 / 21, in that the sense strand has the structure of: (NAG37)s(invAb)scgcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO: 262); (NAG37)csgcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO: 271); or (NAG25)s(invAb)scgcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO: 274), wherein a, g, ceu are nucleotides modified in 2'-O-methyl; Af, Cf, Gf, and Uf are nucleotides modified in 2'-fluoro; s is a phosphorothioate internucleoside bond; (invAb) is an inverted abasic deoxyribonucleotide (linked in 3'-3'); and (invAb)s is an inverted abasic phosphorothioate deoxyribonucleotide (linked in 3'-3').

9. RNAi agent, according to claim 8, CHARACTERIZED in that the antisense strand has a structure of usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140).

10. RNAi agent, according to claim 9, CHARACTERIZED in that the RNAi agent comprises a sense strand attached to the 5' terminal end of NAG37s having the structure: (NAG37)s(invAb)scgcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO: 262) and an antisense strand having the structure usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140).

11. RNAi agent, according to any one of claims 1 to 10, CHARACTERIZED in that the RNAi agent is in salt form.

12. RNAi agent, according to claim 11, CHARACTERIZED in that it has the structure represented by the following: Petition 870250071938, dated 08 / 14 / 2025, p. 256 / 535 12 / 21 Petition 870250071938, dated 08 / 14 / 2025, p. 257 / 535 13 / 21 1—ρ=ι è Petition 870250071938, dated 08 / 14 / 2025, p. 258 / 535 14 / 21 Petition 870250071938, dated 08 / 14 / 2025, p. 259 / 535 15 / 21 Petition 870250071938, dated 08 / 14 / 2025, p. 260 / 535 16 / 21 and is supplied as a salt, mixed salt or a free acid.

13. RNAi agent, according to claim 12, CHARACTERIZED in that the RNAi agent is in the form of a sodium salt and has the structure: Petition 870250071938, dated 08 / 14 / 2025, p. 261 / 535 17 / 21 Petition 870250071938, dated 08 / 14 / 2025, p. 262 / 535 18 / 21 Petition 870250071938, dated 08 / 14 / 2025, p. 263 / 535 19 / 21 Petition 870250071938, dated 08 / 14 / 2025, p. 264 / 535 20 / 21 14. Composition CHARACTERIZED in that it comprises the RNAi agent, as defined in any one of claims 1 to 13, and a pharmaceutically acceptable excipient.

15. Composition, according to claim 14, CHARACTERIZED in that it is formulated for subcutaneous injection. Petition 870250071938, dated 08 / 14 / 2025, page 265 / 535 21 / 21 16. Composition according to claim 15, CHARACTERIZED in that it is a sterile injectable solution.

17. Composition according to claim 16, CHARACTERIZED in that it is packaged in a pre-filled syringe.

18. Composition according to claim 14, CHARACTERIZED in that it is a sterile powder for the preparation of a sterile injectable solution.

19. Composition according to claim 18, CHARACTERIZED in that it is packaged in a bottle.

20. Use of an RNAi agent, as defined in any one of claims 1 to 13, CHARACTERIZED in that it is for the manufacture of a medicament to treat chronic HBV infection.

21. Use of an RNAi agent, as defined in any one of claims 1 to 13, and an additional therapeutic agent CHARACTERIZED in that it is for the manufacture of a medicament to treat chronic HBV infection, wherein the RNAi agent and the additional therapeutic agent are formulated to be administered separately.

22. Use according to claim 21, CHARACTERIZED in that the additional therapeutic agent is a nucleoside inhibitor or nucleotide inhibitor.

Images