PROCESS FOR PREPARING A DERIVATIVE OF 1-(PIPERIDINOCARBONYLMETHYL)-2-OXOPIPERAZINE, INTERMEDIATE, ITS USES, PHARMACEUTICAL FORMS, AND KIT

Description

[0001] This application claims priority and the benefit of applications no. US 62 / 599,336, filed December 15, 2017, and no. CH 1522018, filed February 8, 2018, the full content of each of which is incorporated herein by reference. INCORPORATION OF SEQUENCE LISTING

[0002] The contents of the text file named NTHR-001001WO_SeqList, created on December 12, 2018 and 32 KB in size, are incorporated by reference in their entirety. FIELD OF THE INVENTION

[0003] The present invention relates to new compounds of Formula (I) or Formula (Ia): (I); or (Ia)

[0004] pharmaceutically acceptable salts, hydrates, solvates or stereoisomers thereof, and pharmaceutical compositions of these compounds that are useful for preventive and therapeutic use in human and veterinary medicine. BACKGROUND

[0005] Despite the increasing number of cancer therapies in general and combination cancer therapies in particular, cancer is still the third most common cause of death in the world, after diseases Petition 870260058863, dated 06 / 17 / 2026, pp. 430 / 843 2 / 404 cardiovascular and infectious / parasitic diseases; in absolute numbers, this corresponds to 7.6 million deaths (about 13% of all deaths) in a given year. The World Health Organization (WHO) estimates that cancer deaths will increase to 13.1 million by 2030, while the American Cancer Society expects more than 1,685,210 new cancer cases diagnosed and 595,690 cancer deaths in the US in 2016. Research conducted in 2012 by McMillan Cancer Support in the UK revealed that the average survival time for cancer patients in general has increased from 1 year to 6 years since the 1970s. However, for many types of cancer, including esophageal, stomach, lung, brain, and pancreatic cancer, average survival has barely improved, remaining less than one year. These statistics illustrate the fact that cancer remains a critical health condition and that there is an urgent need for new anticancer drugs. SUMMARY

[0006] The present invention relates to new compounds of Formula (Ia). The present invention provides new compounds according to Formula (Ia): (Ia),

[0007] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein

[0008] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl or C1-3 alkyl substituted by cycloalkyl, aryl or heteroaryl, wherein the cycloalkyl, aryl or heteroaryl is optionally substituted by halogen, C1-4 alkyl or C3-5 cycloalkyl; Petition 870260058863, dated 06 / 17 / 2026, pp. 431 / 843 3 / 404

[0009] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanediyl, C1-5 alkyl-NHCOR13or C1-3 alkyl substituted by cycloalkyl, aryl or heteroaryl, wherein the cycloalkyl, aryl or heteroaryl is optionally substituted by halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, both R15s can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8;

[00010] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl or C4-7 cycloalkenyl, all optionally halogen substituted, OR8, NR8R11 or C1-3 aryl or heteroaryl substituted alkyl, wherein the aryl or heteroaryl is optionally halogen substituted, C1-4 alkyl or C3-5 cycloalkyl;

[00011] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl or C1-3 alkyl substituted by cycloalkyl, aryl or heteroaryl, wherein the cycloalkyl, aryl or heteroaryl is optionally substituted by halogen, C1-4 alkyl or C3-5 cycloalkyl;

[00012] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8 or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group;

[00013] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein Petition 870260058863, dated 06 / 17 / 2026, pp. 432-843 4 / 404 the aryl or heteroaryl group is optionally replaced by a halogen, C1-4 alkyl or C3-5 cycloalkyl; and where R6 can form a ring with any part of X; or is an imidazolidinone;

[00014] R8 and R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl or C47 cycloalkenyl;

[00015] X is selected from a linkage, C1-7 alkanediyl, C2-7 alkenediyl, C2-7 alkynediyl, C3-9 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, -O-C3-9 cycloalkanediyl, C1-3 alkanediyl-O-Cw alkanediyl, C1-7 heteroalkanediyl or -S-C1-7 alkanediyl; and wherein X may form a ring or a polycyclic system with any part of R5, R6, or Y, wherein the ring optionally contains a carbonyl group;

[00016] Y is selected from H, C(O)NR10R12, C(O)OR10, R10NC(O)NR10R12, OC(O)R10, OC(O)NR10R12, S(O)nR8, where n is 0, 1 or 2, SO2NR10R12, NR10SO2R10, NR10R12, HNCOR8, CN, C3-7cycloalkyl optionally containing a heteroatom in the ring selected from O and N, wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, O-aryl, S-heteroaryl, O-heteroaryl, wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or aryl, heteroaryl, wherein the aryl or heteroaryl is optionally replaced by one or more R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group;with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8;

[00017] R9 is selected from H, halogen, C1-5 alkyl, C2-5 Petition 870260058863, dated 06 / 17 / 2026, pp. 433-843 5 / 404 alkenyl, C2-5 alkynyl, C3-5 cycloalkyl, C1-5 alkyl-OR8, C1-5 alkyl-SR8, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkyl-C(O)NR8R11, C1-5 alkyl-C(O)R10, CN, C(O)R8, C(O)NR8R11, C(O)OR8, NR8C(O)NR8R11, OC(O)NR8R11, SO2NR8R11, NR8SO2R8, OR8, NR8R11or S(O)nR8, where n is 0, 1 or 2;

[00018] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11;

[00019] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group;

[00020] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and

[00021] each R15 is independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8or C1-3 alkyl-OR8.

[00022] In another aspect, the present invention relates to new compounds of Formula (I). The present invention provides new compounds according to Formula (I): (I)

[00023] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Petition 870260058863, dated 06 / 17 / 2026, pp. 434 / 843 6 / 404

[00024] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl;

[00025] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13 or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; provided that, when R2 is C(O)NR15R15, both R15s may form a ring wherein the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally substituted with R8;

[00026] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 aryl or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl;

[00027] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl;

[00028] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8 or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group;

[00029] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally Petition 870260058863, dated 06 / 17 / 2026, pp. 435-843 7 / 404 substituted with halogen, OR8, NR8R11; or C1-3 alkyl substituted with C(O)NR8R11; C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone;

[00030] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl or C4-7 cycloalkenyl;

[00031] X is selected from a linkage, C1-7 alkanedi-yl, C2-7 alkenedi-yl, C2-7 alkynedi-yl, C3-6 cycloalkanedi-yl, C4-6 cycloalkenedi-yl, -O-, C1-3 alkanedi-yl-O-, -O-C1-7 alkanedi-yl, C1-3 alkanedi-yl-O-C1-7 alkanedi-yl, C1-7 heteroalkanedi-yl or -S-C1-7 alkanedi-yl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a carbonyl group;

[00032] Y is selected from H, C(O)NR10R12, C(O)OR10, R10NC(O)NR10R12, OC(O)R10, OC(O)NR10R12, S(O)nR8, where n is 0, 1 or 2, SO2NR10R12, NR10SO2R10, NR10R12, HNCOR8, CN, C3-7cycloalkyl optionally containing a heteroatom in the ring selected from O and N, wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, O-aryl, S-heteroaryl, O-heteroaryl, wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; aryl or heteroaryl, wherein the aryl or heteroaryl group is optionally replaced by one or more R8 groups; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group;with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8;

[00033] R9 is selected from H, halogen, C1-5 alkyl, C2-5 Petition 870260058863, dated 06 / 17 / 2026, pp. 436-843 8 / 404 alkenyl, C2-5 alkynyl, C3-5 cycloalkyl, C1-5 alkyl-OR8, C1-5 alkyl-SR8, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkyl-C(O)NR8R11, C1-5 alkyl-C(O)R10, CN, C(O)R8, C(O)NR8R11, C(O)OR8, NR8C(O)NR8R11, OC(O)NR8R11, SO2NR8R11, NR8SO2R8, OR8, NR8R11or S(O)nR8, where n is 0, 1 or 2;

[00034] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11;

[00035] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group;

[00036] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and

[00037] each R15 is independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8or C1-3 alkyl-OR8.

[00038] The present invention also relates to pharmaceutical compositions useful for preventive and therapeutic use in human and veterinary medicine comprising compounds of Formula (I) and / or Formula (Ia) and pharmaceutically acceptable salts, hydrates, solvates or stereoisomers thereof. The present invention is useful in methods for preventing and treating cancer.

[00039] Unless otherwise defined, all technical and scientific terms used in this document have the same meaning as is generally understood by a person skilled in the art to which this disclosure pertains. In the descriptive report, the forms Petition 870260058863, dated 06 / 17 / 2026, pp. 437 / 843 9 / 404 Singulars also include the plural, unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein may be used in the practice or testing of this disclosure, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference. References cited herein are not admitted as prior art to the claimed invention. In case of conflict, this descriptive report, including definitions, shall prevail. Furthermore, the materials, methods and examples are for illustrative purposes only and are not intended to be limiting. In case of conflict between the chemical structures and the names of the compounds disclosed herein, the chemical structures shall prevail.

[00040] Other features and advantages of disclosure will become evident from the detailed description and methods that follow. BRIEF DESCRIPTION OF THE FIGURES

[00041] Figure 1 is a graph showing the inhibition of tumor growth in a patient-derived xenograft model of head and neck cancer. Nude NMRI mice bearing HN11873 subcutaneous tumors were treated by oral administration BID with either vehicle (control) or 30 mg / kg of the test Compound 57.

[00042] Figures 2A to 2F are graphs representing characteristic 5-day cell proliferation inhibition curves. The figure shows the inhibition curves for the reported values ​​for the lymphoma cell lines and Compound 258 (light gray line) in Table 5. Concentrations are given in micromol / L (μM), To = day 0 reading (proliferation reference). The cisplatin inhibition curve (quality control) is shown in dark gray. Petition 870260058863, dated 06 / 17 / 2026, pp. 438 / 843 10 / 404

[00043] Figure 3 is a graph showing tumor size development in a patient-derived xenograft mouse model of castration-resistant prostate cancer at various concentrations of Compound 258 and Compound 284, compared to standard of care treatment (Enzalutamide). The arrow indicates a concentration change from 10 mg / kg of Compound 258 to 3 mg / kg on day 51.

[00044] Figure 4 is a graph showing the development of body weight in mice in a patient-derived xenograft mouse model of castration-resistant prostate cancer at various concentrations of Compound 258 and Compound 284, compared to standard treatment (Enzalutamide). The arrow indicates a change in concentration from 10 mg / kg of Compound 258 to 3 mg / kg on day 51.

[00045] Figure 5 is a graph showing the development of tumor size in a mouse model of hormone-resistant prostate cancer xenograft cells (DU-145 cells) at various concentrations of Compound 258, Compound 279, Compound 253, and Compound 284.

[00046] Figure 6 is a graph showing the development of body weight in a mouse model of hormone-resistant prostate cancer xenograft cells (DU145 cells) at various concentrations of Compound 258, Compound 279, Compound 253, and Compound 284.

[00047] Figure 7 is a graph showing the development of tumor size in a mouse model of xenograft derived from colorectal cancer cells (HCT116 cells) at various concentrations of Compound 258, Compound 279, and Compound 284, compared to standard of care treatment (Avastin, also called bevacizumab). Petition 870260058863, dated 06 / 17 / 2026, pp. 439 / 843 11 / 404

[00048] Figure 8 is a graph showing the development of body weight in mice in a xenograft mouse model derived from colorectal cancer cells (HCT116 cells) at various concentrations of Compound 258, Compound 279, and Compound 284, compared to standard-care treatment (Avastin).

[00049] Figure 9 is a graph showing the development of tumor size in a mouse model of xenograft derived from gastric cancer cells (MKN45 cells) at various concentrations of Compound 258, Compound 253, and Compound 284, compared to the standard of care treatment (Paclitaxel).

[00050] Figure 10 is a graph showing the development of body weight in mice in a xenograft mouse model derived from gastric cancer cells (MKN45 cells) at various concentrations of Compound 258, Compound 253, and Compound 284, compared to the standard of care treatment (Paclitaxel).

[00051] Figure 11 is a graph showing the development of tumor size in a mouse model of xenograft derived from HPV-positive cervical cancer cells (SiHa cells) at various concentrations of Compound 248, Compound 273, Compound 318, and Compound 258.

[00052] Figure 12 is a graph showing the development of body weight in mice in a xenograft mouse model derived from HPV-positive cervical cancer cells (SiHa cells) at various concentrations of Compound 248, Compound 273, Compound 318, and Compound 258.

[00053] Figures 13A and 13B are graphs showing luciferase activity in a MOLM13-Luc mouse model for acute myeloid leukemia tumor dissemination. (A) Average profile of Petition 870260058863, dated 06 / 17 / 2026, pp. 440 / 843 12 / 404 Luciferase activity (photons / s) in vivo (whole body image): the test compound is Compound 258, administered at 1, 3, and 6 mg / kg, displayed versus the corresponding vehicle control group. Data are displayed as mean + / - SEM values. (B) Luciferase activity (photons / s), measured in vivo on Day 19 (whole body image at necropsy): the test compound is Compound 258, administered at 1, 3, and 6 mg / kg, displayed versus the corresponding vehicle control group. Data are displayed as individual data points, along with their corresponding median values ​​and interquartile ranges. P-values ​​were calculated in comparison to the corresponding vehicle control group and between the 3 mg / kg and 6 mg / kg groups, using the Mann-Whitney test and the unpaired t-test (in parentheses), as well as one-way ANOVA with Dunnett's post-hoc test. *=p<0.05; **= p<0.01; ***= p<0.001.

[00054] Figure 14 is a graph showing the mean animal weight profile (g) in a MOLM13-Luc mouse model for acute myeloid leukemia tumor dissemination. The test compound is Compound 258, administered at 1, 3, and 6 mg / kg, displayed versus the corresponding vehicle control group. Data are shown as mean + / - SEM values.

[00055] Figure 15 is a graph showing ex vivo, post-organ / tissue luciferase activity (photons / s / mg body weight or photons / s for lymph nodes) in a MOLM13-Luc mouse model for acute myeloid leukemia tumor dissemination. The test compound is Compound 258, administered at 1, 3, and 6 mg / kg, displayed versus the corresponding vehicle control group, for femur, lumbar spine, peritoneal carcinomatosis (adipose tissue), and lymph nodes (both axillary and inguinal). Data are displayed as mean ± SD. P-values ​​were calculated compared to the corresponding vehicle control group using the Mann-Whitney test. Petition 870260058863, dated 06 / 17 / 2026, pp. 441 / 843 13 / 404

[00056] Figure 16 is a graph showing the development of tumor volume in a patient-derived xenograft mouse model of HPV-positive human head and neck squamous cell carcinoma for Compound 248 and Compound 282 (both 30 mg / kg, twice daily, administered orally).

[00057] Figure 17 is a graph showing the development of body weight in mice in a patient-derived xenograft mouse model of human HPV-positive head and neck squamous cell carcinoma for Compound 248 and Compound 282 (both 30 mg / kg, twice daily, administered orally).

[00058] Figure 18 is a graph showing the development of tumor volume in a patient-derived xenograft mouse model of HPV-positive human head and neck squamous cell carcinoma for Compound 57, Compound 248, Compound 282, and Compound 273 at varying doses (Table 23). All sixteen mice treated with Compound 248 and Compound 273 were tumor-free at the end of the observation period.

[00059] Figure 19 is a graph showing the development of body weight in mice in a patient-derived xenograft mouse model of human HPV-positive head and neck squamous cell carcinoma for Compound 57, Compound 248, Compound 282, and Compound 273 at varying doses (Table 23).

[00060] Figure 20 is a graph showing the development of tumor volume in a syngeneic mouse model derived from colorectal carcinoma cells (CT-26 cells) combined with immuno-oncological treatment (anti-PD1 antibodies). Compound 258 was administered as a single agent and as a combination. The data Petition 870260058863, dated 06 / 17 / 2026, pages 442 / 843 14 / 404 after day 21 are a mean + / - SEM of mice still in the experiment. Only the combined therapies and anti-PD1 have data after day 28 (Table 26). Two mice showed complete regression in the combined groups, hence the huge SEM values.

[00061] Figure 21 is a graph showing the development of body weight in mice in a syngeneic mouse model derived from colorectal carcinoma cells (CT26 cells) combined with an immuno-oncological treatment (anti-PD1 antibodies). Compound 258 was administered as a single agent and as a combination. Data after day 21 are a mean + / - SEM of mice still in the experiment. Only the combined therapies and anti-PD1 have data after day 28 (Table 26).

[00062] Figure 22 is a graph showing the inhibition of gene expression of three well-characterized androgen receptor (AR) targets through Compound 258-mediated disruption of p300-CH1 / TAZ1-AR signaling in the LNCaP castration-resistant prostate cancer cell line. Prostate-specific antigen (PSA / KLK3), transmembrane serine protease 2 (TMPRSS2), and prosteine ​​gene expression (SLC45A3) were measured in cells stimulated with dihydrotestosterone for 4 hours (DHT, 100 nM) and compared to untreated cells. 300 nM of Compound 258 was added concomitantly with DHT. Treatment with Compound 258 resulted in complete repression of PSA stimulation and 85%, respectively, 80% repression of TMPRSS2 and SLC45A3 stimulation.

[00063] Figure 23 is a graph showing serum levels of prostate-specific antigen (PSA) in a patient-derived xenograft mouse model of castration-resistant prostate cancer (CRPC). Serum levels were determined in five mice that still had detectable tumors in Petition 870260058863, dated 06 / 17 / 2026, pages 443 / 843 15 / 404 End of experiment (after a 19-day treatment period, blood samples collected 3 h after the last dose, Figure 3, numbered on the x-axis of Figure 23). Two mice were treated daily with 10 and 3 mg / kg and three mice were treated daily with 6 mg / kg of Compound 258 (Figure 3). The minimum expected PSA levels were calculated based on the minimum PSA / tumor size ratio of vehicle-treated mice. All five mice showed a clear reduction in the expected serum PSA levels.

[00064] Figure 24 is a graph showing the levels of Tumor Vascular Endothelial Growth Factor (VEGF) protein in the mouse model of xenograft derived from HCT-116 and MKN45 colorectal / gastric cancer cells after approximately 4 and 3 weeks, respectively, of treatment with 3 mg / kg or 6 mg / kg of Compound 258 (Figures 7 and 9). According to the proposed mode of action of Compound 258, the p300 / CBP-HIF1alpha transcriptional complex was disrupted, resulting in significantly reduced VEGF protein levels with Compound 258 treatment. The effect is more evident in HCT-116 cells than in MKN45 xenografts, reflecting the greater VEGF dependence of the HCT-116 xenograft's vascularization (described in Dang et al., Cancer Res 2008;68(6):1872-80).

[00065] Figure 25 is a pair of Western blots of HPV16-positive cervical cancer CaSki cells treated with Compound 258. The figure shows a characteristic rescue of p53 protein expression and p53 acetylation at lysine 382 (K382Ac-p53) after Compound 258-mediated inhibition of p300 / CBP-HPVE6-p53 protein-protein interactions. Cells were treated with the indicated concentrations (nM) for 72 h. Induction of p53 protein above baseline is already evident at 7 nM, and p53 acetylation at lysine Petition 870260058863, dated 06 / 17 / 2026, pp. 444 / 843 16 / 404 382 is detectable at 20nM. Equivalent amounts of protein were loaded onto the blot, and the amount of loading was assessed by detecting the total protein from the same blot using a Bio-Rad ChemiDoc Touch imaging sensor. DETAILED DESCRIPTION

[00066] The present invention is directed to a series of compounds having strong activities against a wide variety of tumor types, including, but not limited to, prostate, colon, head and neck and cervical cancer, as well as hematological neoplasms.

[00067] The present invention is directed to a series of compounds having strong activity as p300 / CBP inhibitors, including stereoisomers, tautomers, pharmaceutically acceptable salts and prodrugs thereof, and the use of such compounds to treat p300 / CBP-related conditions or diseases, such as cancer.

[00068] Exemplary conditions that can be treated with the disclosed compounds include cancer. The types of cancer that can be treated include, but are not limited to, prostate cancer, kidney cancer, pancreatic cancer, liver cancer, breast cancer, gastric cancer, colorectal cancer, cervical cancer, ovarian cancer, head and neck cancer, esophageal cancer, leukemia, lymphoma, lung cancer, brain cancer, central nervous system cancer and skin cancer.

[00069] The invention provides pharmaceutical compositions of the compounds described, comprising the compounds described and pharmaceutically acceptable vehicles, diluents or excipients.

[00070] The invention provides pharmaceutical compositions of the described compounds, wherein the compounds are administered in combination with one or more anticancer treatments or anticancer therapeutic agents. In one aspect, the pharmaceutical composition consists of combining one of the compounds with a point inhibitor. Petition 870260058863, dated 06 / 17 / 2026, pages 445 / 843 17 / 404 of the programmed cell death protein 1 (PD-1) immune checkpoint. DEFINITIONS

[00071] The following are definitions of terms used in this application. The initial definition provided for a group or term in this document applies to that group or term throughout the description and modalities, individually or as part of another group, unless otherwise indicated.

[00072] The term alkyl, as used in this document, refers to a saturated linear or branched chain group of carbon atoms derived from an alkane by the removal of a hydrogen atom. C1-3 alkyl includes, but is not limited to, for example, methyl, ethyl, n-propyl, i-propyl. C1-4 alkyl comprises, for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, l-butyl, tert-butyl. C1-5 alkyl comprises, for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, tert-butyl, n-pentyl. C1-7 alkyl comprises, for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, tert-butyl, n-pentyl, n-hexyl or n-heptyl. The alkyl groups of this invention can be optionally substituted.

[00073] The terms C2-5 alkenyl and C2-7 alkenyl, as used in this document, refer to linear or branched chain hydrocarbon groups having 2 to 5 carbon atoms and 2 to 7 carbon atoms, respectively, and at least one double bond.

[00074] The terms C2-5 alkynyl and C2-7 alkynyl, as used in this document, refer to linear or branched chain hydrocarbon groups having 2 to 5 carbon atoms and 2 to 7 carbon atoms, respectively, and at least one triple bond.

[00075] The terms C3-7 cycloalkyl and C3-5 cycloalkyl, as used herein, refer to a saturated monovalent cyclic or bicyclic hydrocarbon group of 3 to 7 or 3 to 5 carbons, respectively, derived from a cycloalkane by the removal of a single carbon atom. Petition 870260058863, dated 06 / 17 / 2026, pp. 446 / 843 18 / 404 hydrogen atom. C3-5 cycloalkyl includes, but is not limited to, cyclopropyl, cyclobutyl, and cyclopentyl. C3-7 cycloalkyl includes, but is not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl. The terms C3-7 cycloalkyl and C3-5 cycloalkyl, as used herein, also include cycloalkyl groups comprising a C1-3-alkyl radical. Examples of such C3-7 cycloalkyl groups include cyclopropylmethyl, 2-cyclopropylethyl, cyclobutylmethyl, 2-cyclobutylethyl, cyclopentylmethyl, 2-cyclopentylethyl. Examples of such C3-5 cycloalkyl groups include cyclopropylmethyl, 2-cyclopropylethyl, cyclobutylmethyl. Cycloalkyl groups of this invention may be optionally substituted. Substituents can be, for example, halogens, C1-4 alkyl, or C3-5 cycloalkyl.

[00076] The term C4-7 cycloalkenyl, as used herein, refers to a monovalent cyclic or bicyclic hydrocarbon group of 4 to 7 carbons having at least one double bond, derived from a cycloalkene by the removal of a single hydrogen atom. The term C4-7 cycloalkenyl, as used herein, also includes cycloalkenyl groups comprising a C1-3 alkyl radical.

[00077] The terms C1-3 alkanedi-yl, C1-6 alkanedi-yl and C1-7 alkanedi-yl, as used in this document, refer to a diradical of a saturated hydrocarbon group with a linear or branched chain, having 1 to 3, 1 to 6 and 1 to 7 carbon atoms, respectively. Examples of alkanedi-yl groups include methanediyl, ethane-1,2-diyl and the like.

[00078] The terms C2-6 alkenediyl and C2-7 alkenediyl, as used herein, refer to a diradical of a linear or branched hydrocarbon group having 2 to 6 carbon atoms and 2 to 7 carbon atoms, respectively, and at least one double bond. Examples of alkenediyl groups include 1,2-ethene Petition 870260058863, dated 06 / 17 / 2026, pp. 447 / 843 19 / 404 di-ila and related compounds.

[00079] The terms C2-6 alkynedi-yl and C2-7 alkynedi-yl, as used herein, refer to a diradical of a linear or branched chain hydrocarbon group having 2 to 6 carbon atoms and 2 to 7 carbon atoms, respectively, and at least one triple bond. Examples of alkynedi-yl groups include ethyne-1,2-diyl and similar groups.

[00080] The term C3-6 cycloalkanedi-yl, as used in this document, refers to a 3 to 6 carbon saturated cyclic or bicyclic hydrocarbon group.

[00081] The term C3-6 cycloalkenedi-yl, as used in this document, refers to a cyclic or bicyclic diradical hydrocarbon group of 3 to 6 carbons having at least one double bond.

[00082] The term heteroalkyl or heteroalkanedi-yl, as used herein, refers to an alkyl radical or an alkanedi-yl radical, as defined herein, in which one, two, three, or four hydrogen atoms have been replaced by a substituent independently selected from the group consisting of OH, NH2, and halogen. Representative examples include, but are not limited to, 2-hydroxyethyl, 2-hydroxypropyl, 3-hydroxypropyl, 2-hydroxy-1-hydroxymethylethyl, 2-hydroxy-1-methylethyl, 2,3-dihydroxypropyl, 1-hydroxymethylethyl, 3-hydroxybutyl, 2,3-dihydroxybutyl, 1-hydroxy-2-methylpropyl, 3-hydroxy-1-(2-hydroxyethyl)propyl, 2-hydroxy-1-methylpropyl, 1,1,1-trifluoroethyl, 2,2,3,3-tetrafluoropropyl.

[00083] The term aryl, as used in this document, refers to a mono- or bicyclic carbocyclic ring system having one or two aromatic rings. The aryl group may also be fused to a cyclohexane, cyclohexene, cyclopentane or cyclopentene ring or to a cyclohexane, cyclohexene, cyclopentane or cyclopentene ring comprising a carbonyl group. Thus, the aryl group includes, for example, Petition 870260058863, dated 06 / 17 / 2026, pp. 448 / 843 20 / 404 example, substituted indane or mono-oxo indane rings. The aryl groups of this invention may be optionally substituted as described below. A preferred aryl group and an optionally substituted aryl group, respectively, of this invention, is a phenyl group or a substituted phenyl group. The substituents may be, for example, halogen, C1-4 alkyl or C3-5 cycloalkyl.

[00084] The term heteroaryl, as used in this document, refers to 5- or 6-membered monocyclic aromatic groups, substituted and unsubstituted, and 9- or 10-membered bicyclic groups, having at least one heteroatom (O, S, or N) in at least one of the rings. Each heteroaryl group ring containing a heteroatom may contain one or two oxygen or sulfur atoms and / or one to four nitrogen atoms, provided that the total number of heteroatoms in each ring is four or less and each ring has at least one carbon atom. The heteroaryl groups must include at least one fully aromatic ring, but the other fused ring or rings may be aromatic or non-aromatic. The heteroaryl group may be attached to any available nitrogen or carbon atom of any ring. The heteroaryl groups of this invention may be optionally substituted as described below.Generally, a heteroaryl group and an optionally substituted heteroaryl group, respectively, of this invention, are selected from the group consisting of 5- or 6-membered aromatic monocyclic groups, substituted and / or unsubstituted, having at least one heteroatom (O, S, or N), preferably a heteroatom (O, S, or N), more preferably an O or N in the ring, even more preferably two N in the ring. A preferred heteroaryl group and an optionally substituted heteroaryl group, respectively, of this invention, are selected from the group consisting of a pyridinyl group, a substituted pyridinyl group, an imidazole group, a group. Petition 870260058863, dated 06 / 17 / 2026, pp. 449 / 843 21 / 404 substituted imidazole, a pyrazole group, a substituted pyrazole group, a triazole group, a substituted triazole group, a benzimidazole group and a substituted benzimidazole group. More preferably, a substituted pyridinyl group, a pyridinyl group, a triazole group, a substituted triazole group, an imidazole group and / or a substituted imidazole group are used as the heteroaryl group in the present invention.

[00085] More preferably, a substituted pyridinyl group, a pyridinyl group, an imidazole group and / or a substituted imidazole group are used as the heteroaryl group in the present invention. The substituents may be, for example, halogen, C1-4 alkyl or C3-5 cycloalkyl.

[00086] The term S-aryl, as used in this document, refers to an -SR root where R is an aryl, as defined in this document.

[00087] The term O-aryl, as used in this document, refers to a -OR root where R is an aryl, as defined in this document.

[00088] The term S-heteroaryl, as used in this document, refers to an -SR radical where R is a heteroaryl, as defined in this document.

[00089] The term O-heteroaryl, as used in this document, refers to an -OR radical where R is a heteroaryl, as defined in this document.

[00090] The term C1-3 alkyl-aryl, as used herein, refers to a C1-3 alkyl radical, as defined herein, to which an aryl group, as defined herein, is attached to any carbon of the alkyl.

[00091] The term C1-3 alkyl-heteroaryl, as used herein, refers to a C1-3 alkyl radical, as defined herein, to which a heteroaryl group, as defined herein, is attached. Petition 870260058863, dated 06 / 17 / 2026, pp. 450 / 843 22 / 404 attached to any carbon of the alkyl group.

[00092] The terms halo or halogen, as used in this document, refer to F, Cl, Br, or I and are preferably, F, Cl, or Br. COMPOUNDS OF THIS DISCLOSURE

[00093] In some respects, the present disclosure refers to a compound of Formula (Ia): (Ia),

[00094] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein

[00095] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl;

[00096] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; provided that, when R2 is C(O)NR15R15, R15 may form a ring wherein the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally substituted with R8;

[00097] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, Petition 870260058863, dated 06 / 17 / 2026, pp. 451 / 843 23 / 404 NR8R11, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl;

[00098] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl;

[00099] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group; [000100] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; and wherein R6 may form a ring with any part of X; or is imidazolidinone; [000101] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C4-7 cycloalkenyl; [000102] X is selected from a linkage, C1-7 alkanediyl, C2-7 alkenediyl, C2-7 alkynediyl, C3-9 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, -O-C3-9 cycloalkanediyl, C1-3 alkanediyl-O-Cw alkanediyl, C1-7 heteroalkanediyl, or -S-C1-7 alkanediyl; and wherein X may form a ring or a polycyclic system with any part of R5, R6, or Y, wherein the ring optionally contains a carbonyl group; [000103] Y is selected from H, C(O)NR10R12, C(O)OR10, R10NC(O)NR10R12, OC(O)R10, OC(O)NR10R12, S(O)nR8 where n is 0, 1 Petition 870260058863, dated 06 / 17 / 2026, pp. 452 / 843 24 / 404 or 2, SO2NR10R12, NR10SO2R10, NR10R12, HNCOR8, CN, C3-7cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 may form a ring optionally substituted by R9 or R14; wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally substituted by R8; [000104] R9 is selected from H, halogen, C1-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, C3-5 cycloalkyl, C1-5 alkyl-OR8, C1-5 alkyl-SR8, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkyl-C(O)NR8R11, C1-5 alkyl-C(O)R10, CN, C(O)R8, C(O)NR8R11, C(O)OR8, NR8C(O)NR8R11, OC(O)NR8R11, SO2NR8R11, NR8SO2R8, OR8, NR8R11, or S(O)nR8 where n is 0, 1 or 2; [000105] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11; [000106] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000107] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 substituted alkyl Petition 870260058863, dated 06 / 17 / 2026, pp. 453 / 843 25 / 404 by aryl or heteroaryl, wherein the aryl or heteroaryl is optionally replaced by halogen, C1-4 alkyl or C3-5 cycloalkyl; and [000108] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000109] In some respects, the present disclosure refers to a compound of Formula (I): (I), [000110] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein [000111] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000112] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000113] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl, all optionally halogen-substituted, OR8, Petition 870260058863, dated 06 / 17 / 2026, pp. 454 / 843 26 / 404 NR8R11, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000114] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000115] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group; [000116] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000117] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl; [000118] X is selected from a linkage, C1-7 alkanediyl, C27 alkenediyl, C2-7 alkynediyl, C3-6 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, C1-3 alkanediyl-OC-1-7 alkanediyl, C1-7 heteroalkanediyl, or -S-C1-7 alkanediyl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a carbonyl group; [000119] Y is selected from H, C(O)NR10R12, C(O)OR10, R10NC(O)NR10R12, OC(O)R10, OC(O)NR10R12, S(O)nR8 where n is 0, 1 or 2, SO2NR10R12, NR10SO2R10, NR10R12, HNCOR8, CN, C3-7 cycloalkyl optionally containing a heteroatom in the ring Petition 870260058863, dated 06 / 17 / 2026, pp. 455 / 843 27 / 404 selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or aryl, heteroaryl, wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000120] R9 is selected from H, halogen, C1-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, C3-5 cycloalkyl, C1-5 alkyl-OR8, C1-5 alkyl-SR8, C15 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkyl-C(O)NR8R11, C1-5 alkylC(O)R10, CN, C(O)R8, C(O)NR8R11, C(O)OR8, NR8C(O)NR8R11, OC(O)NR8R11, SO2NR8R11, NR8SO2R8, OR8, NR8R11, or S(O)nR8 where n is 0, 1 or 2; [000121] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11; [000122] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000123] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and Petition 870260058863, dated 06 / 17 / 2026, pp. 456 / 843 28 / 404 [000124] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000125] It is understood that, for a compound of Formula (I) or Formula (Ia), R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, X, and Y may each be selected, where applicable, from the groups described in this document, and any group described in this document for any one of R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, X, and Y may be combined, where applicable, with any group described in this document for one or more of R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, X, and Y. [000126] In some embodiments, R1 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted by cycloalkyl, aryl or heteroaryl, wherein the cycloalkyl, aryl or heteroaryl is optionally substituted by halogen, C1-4 alkyl or C3-5 cycloalkyl. [000127] In some embodiments, R1 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted by aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted by halogen, C1-4 alkyl or C35 cycloalkyl. [000128] In some embodiments, R1 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C35 cycloalkyl. [000129] In some embodiments, R1 is selected from C2-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted. Petition 870260058863, dated 06 / 17 / 2026, pp. 457 / 843 29 / 404 by halogen, C1-4 alkyl or C3-5 cycloalkyl. [000130] In some embodiments, R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl. [000131] In some modalities, R1 is H. [000132] In some embodiments, R1 is C3-7 cycloalkyl. [000133] In some embodiments, R1 is selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl. [000134] In some embodiments, R1 is selected from cyclopropyl or cyclohexyl. [000135] In some forms, R1 is cyclopropyl. [000136] In some embodiments, R1 is cyclohexyl. [000137] In some embodiments, R1 is C1-7 alkyl. [000138] In some embodiments, R1 is C2-7 alkyl. [000139] In some embodiments, R1 is C3-7 alkyl. [000140] In some embodiments, R1 is selected from methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl or tert-butyl. [000141] In some embodiments, R1 is selected from ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl or tert-butyl. [000142] In some embodiments, R1 is selected from propyl, isopropyl, butyl, sec-butyl, isobutyl, or tert-butyl, [000143] In some embodiments, R1 is isobutyl. [000144] In some embodiments, R1 is C1-3 alkyl substituted by cycloalkyl. [000145] In some embodiments, R1 is methyl, ethyl or propyl substituted by cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl. [000146] In some embodiments, R1 is ethyl or propyl substituted by cyclopropyl or cyclohexyl. [000147] In some embodiments, R1 is C1-3 alkyl substituted by Petition 870260058863, dated 06 / 17 / 2026, pp. 458 / 843 30 / 404 aryl or heteroaryl. [000148] In some embodiments, R1 is methyl, ethyl, or propyl substituted with phenyl, imidazole, pyridine, or triazole. [000149] In some embodiments, R1 is ethyl or propyl replaced by phenyl or pyridine. [000150] In some forms, R1 is ethyl replaced by phenyl. [000151] In some sports, R1 is In some sports, R1 is [000152] [000153] In some sports, R1 is [000154] In some embodiments, R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C^alcinyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C13 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13 or C1-3 alkyl substituted by cycloalkyl, aryl or heteroaryl, wherein the cycloalkyl, aryl or heteroaryl is optionally substituted by halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring, wherein the ring contains the N of NR15r15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000155] In some modalities, R2 is selected from H, Petition 870260058863, dated 06 / 17 / 2026, pp. 459 / 843 31 / 404 C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C13 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted by aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted by halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000156] In some embodiments, R2 is selected from H, C(O)R14, C(O)OR15, C1-7 alkyl, C3-7 cycloalkyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-OR8, C1-5 alkyl-NHCOR13, or C1-3 aryl-substituted alkyl, wherein the aryl is optionally substituted by halogen, C1-4 alkyl or C3-5 cycloalkyl. [000157] In some embodiments, R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8, C1-5 alkylNHCOR13, or C1-3 aryl-substituted alkyl, wherein the aryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl. [000158] In some embodiments, R2 is selected from H, C(O)R14, wherein R14 is C1-7 alkyl; C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13, wherein R13 is pentylamino-5-oxopentyl7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with aryl, wherein the aryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl. [000159] In some embodiments, R2 is selected from H, C(O)R14, where R14 is C1-7 alkyl; C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8, where R8 is C1-7 alkyl; C1-5 alkyl-NHCOR13, where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with aryl, wherein the aryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl. Petition 870260058863, dated 06 / 17 / 2026, pp. 460 / 843 32 / 404 [000160] In some modalities, R2éH. [000161] In some embodiments, R2 is C1-7 alkyl. [000162] In some embodiments, R2 is selected from methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl or tert-butyl. [000163] In some embodiments, R2 is selected from methyl, ethyl or propyl. [000164] In some embodiments, R2 is C(O)R14, and R14 is methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, or tert-butyl, [000165] In some embodiments, R2 is C(O)NR15R15, wherein each R15 is independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8 or C1-3 alkyl-OR8. [000166] In some embodiments, R2 is C(O)NR15R15, where each R15 is independently selected from methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, or tert-butyl, [000167] In some embodiments, R2 is C(O)NR15R15, where each R15 is selected independently of methyl or ethyl. [000168] In some embodiments, R2 is C(O)NR15R15, where each R15 is methyl. [000169] In some embodiments, R2 is C3-7 cycloalkyl. [000170] In some embodiments, R2 is selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl. [000171] In some forms, R2 is cyclopropyl. [000172] In some embodiments, R2 is C1-5 alkyl-OR8, where R8 is C1-7 alkyl. [000173] In some embodiments, R2 is methyl-OR8, ethyl-OR8, propyl-OR8, or butyl-OR8, wherein R8 is methyl, ethyl, propyl, or butyl. [000174] In some embodiments, R2 is ethyl-OR8, where R8 is methyl, ethyl, propyl or butyl. [000175] In some embodiments, R2 is ethyl-OR8, where R8 is methyl. Petition 870260058863, dated 06 / 17 / 2026, pp. 461 / 843 33 / 404 [000176] In some embodiments, R2 is C1-3 alkyl substituted by cycloalkyl. [000177] In some embodiments, R2 is methyl, ethyl or propyl substituted by cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl. [000178] In some embodiments, R2 is ethyl or propyl substituted by cyclopropyl or cyclohexyl. [000179] In some embodiments, R2 is ethyl replaced by cyclopropyl. [000180] In some embodiments, R2 is C1-3 alkyl substituted by aryl or heteroaryl. [000181] In some embodiments, R2 is methyl, ethyl, or propyl substituted with phenyl, imidazole, pyridine, or triazole. [000182] In some embodiments, R2 is ethyl or propyl replaced by phenyl or pyridine. [000183] In some embodiments, R2 is ethyl substituted by phenyl. [000184] In some embodiments, R2 is C1-3 alkyl substituted by aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted by halogen, C1-4 alkyl or C3-5 cycloalkyl. [000185] In some embodiments, R2 is methyl, ethyl or propyl substituted by phenyl, imidazole, pyridine or triazole substituted by fluorine, iodine or bromine. [000186] In some embodiments, R2 is ethyl or propyl substituted by phenyl or pyridine substituted by fluorine, iodine or bromine. [000187] In some embodiments, R2 is ethyl substituted by phenyl substituted fluorine. F [000188] In some modalities, R2 is [000189] In some embodiments, R2 is C1-5 alkyl-NHCOR13, where R13 is pentilamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one. Petition 870260058863, dated 06 / 17 / 2026, pp. 462 / 843 34 / 404 [000190] In some embodiments, R2 is methyl-NHCOR13, ethylNHCOR13, propyl-NHCOR13, butyl-NHCOR13 or pentyl-NHCOR13, where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one. [000191] In some embodiments, R2 is pentyl-NHCOR13, where R13 is pentilamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one. [000192] In some modes, R2 is [000193] In some embodiments, R2 is C1-3 alkyl substituted with aryl, wherein the aryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl. [000194] In some modalities, R2é , ,v, , Λ .1 - AQ' ' .0..... 3* ,0Λ I / W , or . [000195] In some embodiments, R3 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11, or C1-3 aryl-substituted or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl. [000196] In some embodiments, R3 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C4-7 cycloalkenyl. [000197] In some embodiments, R3 is C1-7 alkyl. [000198] In some embodiments, R3 is selected from methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, or tert-butyl. [000199] In some embodiments, R3 is C2-7 alkenyl. [000200] In some modalities, the R3 is vinyl. [000201] In some embodiments, R3 is C3-7 cycloalkyl. [000202] In some modes, R3 is selected from Petition 870260058863, dated 06 / 17 / 2026, pp. 463 / 843 35 / 404 cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl. [000203] In some modalities, R3 is H. [000204] In some embodiments, R3 and R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11, or C1-3 aryl-substituted or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl. [000205] In some embodiments, R3 and R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C4-7 cycloalkenyl. [000206] In some embodiments, R3 and R7 are each independently C1-7 alkyl. [000207] In some embodiments, R3 and R7 are each selected independently from methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, or tert-butyl, [000208] In some embodiments, R3 and R7 are each independently C2-7 alkenyl. [000209] In some modalities, R3e R7são cada um vinyla. [000210] In some embodiments, R3 and R7 are each independently C3-7 cycloalkyl. [000211] In some embodiments, R3 and R7 are selected independently of cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl. [000212] In some modalities, R3 and R7 are each an H. [000213] In some embodiments, R7 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11, or C1-3 aryl-substituted or heteroaryl alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 Petition 870260058863, dated 06 / 17 / 2026, pp. 464 / 843 36 / 404 cycloalkyl. [000214] In some embodiments, R7 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C4-7 cycloalkenyl. [000215] In some embodiments, R7 is C1-7 alkyl. [000216] In some embodiments, R7 is selected from methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, or tert-butyl. [000217] In some embodiments, R7 is C2-7 alkenyl. [000218] In some modalities, R7 is vinyl. [000219] In some embodiments, R7 is C3-7 cycloalkyl. [000220] In some embodiments, R7 is selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl. [000221] In some embodiments, R7 is H. [000222] In some embodiments, the R7 group is at the -5 position of the piperidine ring. [000223] In some embodiments, the R7 group is at the -6 position of the piperidine ring. [000224] In some embodiments, the R6 group is at the -2 position of the piperidine ring. [000225] In some embodiments, the R6 group is at the -2 position of the The piperidine ring and / or the R7 group is at the -5 position of the piperidine ring. [000226] In some embodiments, the R6 group is at the -2 position of the piperidine ring and the R7 group is at the -5 position of the piperidine ring. [000227] In some embodiments, R4 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted by cycloalkyl, aryl or heteroaryl, wherein the cycloalkyl, aryl or heteroaryl is optionally substituted by halogen, C1-4 alkyl or C3-5 cycloalkyl. [000228] In some embodiments, R4 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl Petition 870260058863, dated 06 / 17 / 2026, pp. 465 / 843 37 / 404 heteroaryl is optionally replaced by halogen, C1-4 alkyl or C3-5 cycloalkyl. [000229] In some embodiments, R4 is selected from C1-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl, or C3-5 cycloalkyl. [000230] In some embodiments, R4 is selected from C2-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl, or C3-5 cycloalkyl. [000231] In some embodiments, R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl. [000232] In some modalities, R4éH. [000233] In some embodiments, R4 is C3-7 cycloalkyl. [000234] In some embodiments, R4 is selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl. [000235] In some embodiments, R4 is selected from cyclopropyl or cyclohexyl. [000236] In some forms, R4 is cyclopropyl. [000237] In some embodiments, R4 is cyclohexyl. [000238] In some embodiments, R4 is C1-7 alkyl. [000239] In some embodiments, R4 is C2-7 alkyl. [000240] In some embodiments, R4 is C3-7 alkyl. [000241] In some embodiments, R4 is selected from methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, or tert-butyl. [000242] In some embodiments, R4 is selected from ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, or tert-butyl. [000243] In some embodiments, R4 is selected from propyl, isopropyl, butyl, sec-butyl, isobutyl, or tert-butyl. Petition 870260058863, dated 06 / 17 / 2026, pp. 466 / 843 38 / 404 [000244] In some forms, R4 is isobutyl. [000245] In some embodiments, R4 is C1-3 alkyl substituted by cycloalkyl. [000246] In some embodiments, R4 is methyl, ethyl or propyl replaced by cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl. [000247] In some embodiments, R4 is ethyl or propyl substituted by cyclopropyl or cyclohexyl. [000248] In some embodiments, R4 is C1-3 alkyl substituted by aryl or heteroaryl. [000249] In some embodiments, R4 is methyl, ethyl or propyl substituted with phenyl, imidazole, pyridine or triazole. [000250] In some embodiments, R4 is ethyl or propyl replaced by phenyl or pyridine. [000251] In some forms, R4 is ethyl replaced by phenyl. In some sports, R4 is [000252] [000253] In some modalities, R4é^ or [000254] In some modalities, R4 is [000255] In some embodiments, the compound is of any of the Formulas (IIa), (IIb) or (IIc): Petition 870260058863, dated 06 / 17 / 2026, pp. 467 / 843 39 / 404 (IIb); or (Ila); [000256] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R2, R3, R4, R5, R6, R7, X, and Y are described herein. [000257] In some embodiments, the compound is of Formula (IIa) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R2, R3, R4, R5, R6, R7, X, and Y are as described herein. [000258] In some embodiments, the compound is of Formula (IIb) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R2, R3, R4, R5, R6, R7, X, and Y are as described herein. [000259] In some embodiments, the compound is of Formula (IIc) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R2, R3, R4, R5, R6, R7, X, and Y are as described herein. [000260] In some embodiments, the compound is of any of the Formulas (IIIa), (IIIb), (IIIc) or (IIId): (IIIb); Petition 870260058863, dated 06 / 17 / 2026, pp. 468 / 843 40 / 404 [000261] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R4, R5, R6, X, and Y are as described herein. [000262] In some embodiments, the compound is of Formula (IIIa) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R4, R5, R6, X, and Y are as described herein. [000263] In some embodiments, the compound is of Formula (IIIb) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R4, R5, R6, X, and Y are as described herein. [000264] In some embodiments, the compound is of Formula (IIIc) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R4, R5, R6, X, and Y are as described herein. [000265] In some embodiments, the compound is of Formula (IIId) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R4, R5, R6, X, and Y are as described herein. [000266] In some embodiments, the R6 group is at the -2 position of the piperidine ring. [000267] In some embodiments, the R6 group is at the -3 position of the piperidine ring. [000268] In some embodiments, the R6 group is at the -2 position of the piperidine ring and / or the R7 group is at the -5 position of the piperidine ring. Petition 870260058863, dated 06 / 17 / 2026, pp. 469 / 843 41 / 404 [000269] In some embodiments, the R6 group is at the -2 position of the piperidine ring and the R7 group is at the -5 position of the piperidine ring. [000270] In some embodiments, R6 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted by C(O)NR8R11; or C1-3 alkyl substituted by aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; and wherein R6 may form a ring with any part of X; or is imidazolidinone. [000271] In some embodiments, R6 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted by C(O)NR8R11; or C1-3 alkyl substituted by aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or it is imidazolidinone. [000272] In some embodiments, R6 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C4-7 cycloalkenyl; or it is imidazolidinone. [000273] In some embodiments, R6 is H, C1-7 alkyl, or imidazolidinone. [000274] In some embodiments, R6 is H or C1-7 alkyl. [000275] In some modalities, R6é H. [000276] In some embodiments, R6 is in the -2 position of the piperidine ring and is H. [000277] In some embodiments, R6 is in the -3 position of the piperidine ring and is H. [000278] In some forms, R6 is imidazolidinone. H [000279] In some modalities, R6é . Petition 870260058863, dated 06 / 17 / 2026, pp. 470 / 843 42 / 404 [000280] In some embodiments, R6 is C1-7 alkyl. [000281] In some embodiments, R6 is selected from methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, or tert-butyl. [000282] In some embodiments, R6 is methyl. [000283] In some embodiments, R6 is in the -2 position of the piperidine ring and is C1-7 alkyl. [000284] In some embodiments, R6 is in the -2 position of the piperidine ring and is selected from methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, or tert-butyl. [000285] In some embodiments, R6 is in the -2 position of the piperidine ring and is methyl. [000286] In some modalities, R6 is selected from the group consisting of H,^ ,^ , and . [000287] In some embodiments, R6 is in the -2 position of the piperidine ring and is selected from the group consisting of H / ^ ,^, and ^. [000288] In some modalities, R6é . [000289] In some embodiments, R6 is at the -2 position of the piperidine ring and is . [000290] In some embodiments, R6 is C1-3 alkyl substituted by C(O)NR8R11. [000291] In some embodiments, R6 is C1-3 alkyl substituted by C(O)NR8R11, where R8 is H. [000292] In some embodiments, R6 is C1-3 alkyl substituted by C(O)NR8R11, where R11 is H. [000293] In some embodiments, R6 is C1-3 alkyl substituted by C(O)NR8R11, where R8 and R11 are H. [000294] In some embodiments, R6 is C1-3 alkyl substituted by Petition 870260058863, dated 06 / 17 / 2026, pp. 471 / 843 43 / 404 C(O)NH2. [000295] In some embodiments, R6 is methyl, ethyl or propyl substituted by C(O)NH2. [000296] In some forms, R6 is ethyl substituted by C(O)NH2. [000297] In some embodiments, R6 is propyl replaced by C(O)NH2. [000298] In some modalities, R6 is selected from the group oo which consists of and . [000299] In some forms, R6 is in position -3 of the ring. piperidine and is selected from the group consisting of oe V^nh2. [000300] In some embodiments, R6 forms a ring with any part of X. [000301] In some embodiments, R6 is in the -3 position of the piperidine ring and forms a ring with any part of X. [000302] In some embodiments, R6 is in the -3 position of the piperidine ring and forms a 3-membered, 4-membered, 5-membered, or 6-membered ring with any part of X. [000303] In some embodiments, R6 is in the -3 position of the piperidine ring and forms a 4-membered or 6-membered ring with any part of X. [000304] In some embodiments, R6 is in the -3 position of the piperidine ring and forms a 4-membered ring with any part of X. [000305] In some embodiments, R6 is at the -3 position of the piperidine ring and forms a 6-membered ring with any part of X. [000306] In some forms, the compound is of any Petition 870260058863, dated 06 / 17 / 2026, pp. 472 / 843 44 / 404 of Formulas (IVa), (IVb), (IVc) or (IVd): (IVa); (IVb); (IVc); or (IVd); [000307] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R2, R4, R5, R6, X, and Y are as described herein. [000308] In some embodiments, the compound is of Formula (IVa) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R2, R4, R5, R6, X, and Y are as described herein. [000309] In some embodiments, the compound is of Formula (IVb) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R2, R4, R5, R6, X, and Y are as described herein. [000310] In some embodiments, the compound is of Formula (IVc) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R2, R4, R5, R6, X, and Y are as described herein. [000311] In some embodiments, the compound is of Formula (IVd) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein R1, R2, R4, R5, R6, X, and Y are as described herein. Petition 870260058863, dated 06 / 17 / 2026, pp. 473 / 843 45 / 404 [000312] In some embodiments, R5 is selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group; [000313] In some embodiments, R5 is selected from H, C17 alkyl, OR8, or SR8; and wherein C1-7 alkyl, OR8, or SR8 of R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group. [000314] In some embodiments, R5 is selected from H, C17 alkyl, OR8, or SR8; and wherein C1-7 alkyl, OR8, or SR8 of R5 may form a ring with any part of X or, when Y is C(O)NR10R12 or NR10R12, C1-7 alkyl of R5 may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group. [000315] In some embodiments, R5 is selected from H, C17 alkyl, or OR8; and wherein C1-7 alkyl or OR8 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group. [000316] In some embodiments, R5 is selected from H, C17 alkyl, or OR8; and wherein C1-7 alkyl or OR8 of R5 may form a ring with any part of X or, when Y is C(O)NR10R12 or NR10R12, C1-7 alkyl of R5 may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group. [000317] In some embodiments, R5 is selected from C1-7 alkyl, OR8, or SR8; wherein C1-7 alkyl, OR8, or SR8 may form a ring with any part of X. [000318] In some embodiments, R5 is OR8, where R8 of OR8 is C1-7 alkyl, and where OR8 can form a ring with any part of X. [000319] In some modalities, R5 is selected from H and Petition 870260058863, dated 06 / 17 / 2026, pp. 474 / 843 46 / 404 C1-7 alkyl; and wherein C1-7 alkyl may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group. [000320] In some embodiments, R5 is selected from H and C1-7 alkyl; and wherein the C1-7 alkyl of R5 may form a ring with any part of X or, when Y is C(O)NR10R12 or NR10R12, the C1-7 alkyl of R5 may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group. [000321] In some embodiments, R5 is selected from H and C1-7 alkyl. [000322] In some embodiments, R5 is selected from H, methyl and ethyl. [000323] In some modalities, R5 is H. [000324] In some forms, R5 is methyl. [000325] In some forms, R5 is ethyl. [000326] In some embodiments, R8 and R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C4-7 cycloalkenyl. [000327] In some embodiments, R8 and R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, and C3-7 cycloalkyl. [000328] In some embodiments, R8 is C1-7 alkyl and / or R11 is selected from H, C1-7 alkyl, C2-7 alkenyl, and C3-7 cycloalkyl. [000329] In some embodiments, R8 is C1-7 alkyl and / or R11 is C1-7 alkyl. [000330] In some embodiments, R9 is selected from H, halogen, C1-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, C3-5 cycloalkyl, C1-5 alkyl-OR8, C1-5 alkyl-SR8, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkyl-C(O)NR8R11, C1-5 alkyl-C(O)R10, CN, C(O)R8, C(O)NR8R11, C(O)OR8, NR8C(O)NR8R11, OC(O)NR8R11, SO2NR8R11, NR8SO2R8, Petition 870260058863, dated 06 / 17 / 2026, pp. 475 / 843 47 / 404 OR8, NR8R11, or S(O)nR8 where n is 0, 1, or 2. [000331] In some embodiments, R9 is selected from H, C15 alkyl, halogen, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkylC(O)NR8R11, CN, C(O)R8, C(O)NR8R11, C(O)OR8, and OR8. [000332] In some embodiments, R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-ylO-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11. [000333] In some embodiments, R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen or OR8. [000334] In some embodiments, R10 and R12 are each independently selected from H, C1-7 alkyl, C3-7 cycloalkyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, or C13 alkyl-aryl, all these groups optionally substituted with halogen. [000335] In some embodiments, Y is C(O)NR10R12 or NR10R12, and R10 and R12 may form a ring optionally substituted by R9 or R14; wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein if the additional heteroatom is N, it is optionally substituted by R8. [000336] In some embodiments, R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group. [000337] In some embodiments, R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, Petition 870260058863, dated 06 / 17 / 2026, pp. 476 / 843 48 / 404 or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C35 cycloalkyl. [000338] In some embodiments, R14 is selected from C1-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl, or C3-5 cycloalkyl. [000339] In some embodiments, R14 is selected from C1-7 alkyl and C3-7 cycloalkyl. [000340] In some embodiments, R14 is C1-7 alkyl. [000341] In some embodiments, each R15 is selected independently from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000342] In some embodiments, each R15 is independently selected from H, C1-7 alkyl, and C3-7 cycloalkyl. [000343] In some embodiments, each R15 is selected independently of H and C1-7 alkyl. [000344] In some embodiments, X is selected from a linkage, C1-7 alkanedi-yl, C2-7 alkenedi-yl, C2-7 alkynedi-yl, C3-9 cycloalkanedi-yl, C4-6 cycloalkenedi-yl, -O-, C1-3 alkanedi-yl-O-, -O-C1-7 alkanedi-yl, -O-C3-9 cycloalkanedi-yl, C1-3 alkanedi-yl-O-Cw alkanedi-yl, C1-7 heteroalkanedi-yl, or -S-C1-7 alkanedi-yl; and wherein X may form a ring or a polycyclic system with any part of R5, R6, or Y, wherein the ring optionally contains a carbonyl group. [000345] In some embodiments, X is selected from a linkage, C1-7 alkanediyl, C2-7 alkenediyl, C2-7 alkynediyl, C3-6 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, C1-3 alkanediyl-O-Cw alkanediyl, C1-7 heteroalkanediyl, or -S-C1-7 alkanediyl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a group Petition 870260058863, dated 06 / 17 / 2026, pp. 477 / 843 49 / 404 carbonyl. [000346] In some embodiments, X is selected from a linkage, C1-7 alkanedi-yl, -O-, C1-3 alkanedi-yl-O-, -O-C1-7 alkanedi-yl, C1-3 alkanedi-yl-O-C1-7 alkanedi-yl, C1-7 heteroalkanedi-yl, or -S-C1-7 alkanedi-yl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a carbonyl group. [000347] In some embodiments, X is selected from a linkage, C1-7 alkanedi-yl, -O-, C1-3 alkanedi-yl-O-, -O-C1-7 alkanedi-yl, C13 alkanedi-yl-O-C1-7 alkanedi-yl, C1-7 heteroalkanedi-yl, or -S-C1-7 alkanedi-yl; and where X can form a ring with any part of R5 or, when Y is C(O)NR10R12 or NR10R12, X can form a ring with any part of Y, where the ring optionally contains a carbonyl group. [000348] In some embodiments, X is selected from a linkage, -O-C1-7 alkanedi-yl, -S-C1-7 alkanedi-yl and C1-7 alkanedi-yl; and wherein -O-C1-7 alkanedi-yl, S-C1-7 alkanedi-yl or C1-7 alkanedi-yl of X may form a ring with any part of R5 or Y, wherein the ring optionally contains a carbonyl group. [000349] In some embodiments, X is selected from a linkage, -O-C1-7 alkanedi-yl and C1-7 alkanedi-yl; and wherein -O-C1-7 alkanedi-yl or C1-7 alkanedi-yl of X may form a ring with any part of R5, or, when Y is C(O)NR10R12 or NR10R12, C1-7 alkanedi-yl of X may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group. [000350] In some embodiments, X is selected from a linkage, -O-C1-7 alkanedi-yl, S-C1-7 alkanedi-yl and C1-7 alkanedi-yl, and wherein -O-C1-7 alkanedi-yl, S-C1-7 alkanedi-yl or C1-7 alkanedi-yl may form a ring with any part of R5, wherein the ring optionally contains a carbonyl group. [000351] In some modalities, X is selected from a Petition 870260058863, dated 06 / 17 / 2026, pp. 478 / 843 50 / 404 linkage and C1-7 alkanedi-yl, where C1-7 alkanedi-yl can form a ring with either part of R5 or Y. [000352] In some embodiments, X is selected from a C1-7 alkanedi-yl linkage, where C1-7 alkanedi-yl of X can form a ring with any part of R5, or, when Y is C(O)NR10R12 or NR10R12, C1-7 alkanedi-yl of X can form a ring with any part of Y. [000353] In some embodiments, X is selected from a C1-7 alkanedi-yl linkage, where C1-7 alkanedi-yl can form a ring with any part of Y. [000354] In some embodiments, X is selected from a C1-7 alkanedi-yl linkage, where C1-7 alkanedi-yl of X can form a ring with any part of Y when Y is C(O)NR10R12 or NR10R12. [000355] In some embodiments, the ring that can be formed by R5 and any part of X or Y, the ring that can be formed by X and any part of R5 or Y, and / or the ring that can be formed by Y and any part of X or R5 is a non-aromatic ring, preferably a non-aromatic ring containing between four and six atoms, for example, between four and six carbon and heteroatoms, more preferably a non-aromatic ring containing between three and five carbon and a nitrogen atom or a non-aromatic ring containing between two and four carbon and one or two, preferably two, oxygen or sulfur atoms, preferably oxygen. [000356] In some embodiments, Y is C(O)NR10R12 or NR10R12 and R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein if the additional heteroatom is N, it is optionally replaced by R8, wherein the ring, R10 and R12 can form a non-aromatic ring, preferably a non-aromatic ring containing between four and seven atoms, for example, between three and six carbon atoms and N. Petition 870260058863, dated 06 / 17 / 2026, p. 479 / 843 51 / 404 of NR10R12, or between three and five carbon atoms and the N of NR10R12, and optionally an additional heteroatom selected from O and N, wherein if the additional heteroatom is N, it is optionally replaced by R8. [000357] In some embodiments, R2 is C(O)NR15R15 and R15 can form a ring wherein the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein if the additional heteroatom is N, it is optionally replaced by R8, wherein the ring and R15 can form a non-aromatic ring, preferably a non-aromatic ring containing between four and seven atoms, for example, between three and six carbon atoms and the N of NR15R15, or between three and five carbon atoms and the N of NR15R15 and optionally another heteroatom selected from O and N, wherein if the other heteroatom is N, it will optionally be replaced by R8. [000358] In some forms, the integer n of S(O)nR8 is 1 or 2. [000359] In some embodiments, Y is selected from H, C(O)NR10R12, C(O)OR10, R10NC(O)NR10R12, OC(O)R10, OC(O)NR10R12, S(O)nR8 where n is 0, 1 or 2, SO2NR10R12, NR10SO2R10, NR10R12, HNCOR8, CN, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, Oaryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 may form a ring in which the ring contains the N of NR10R12 and optionally a heteroatom Petition 870260058863, dated 06 / 17 / 2026, pp. 480 / 843 52 / 404 additional selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000360] In some embodiments, Y is selected from NR10R12 and C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; and where Y can form a ring with any part of X or R5; with the condition that, when Y is NR10R12, r10θ r12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000361] In some embodiments, R5 is selected from H and C1-7 alkyl; wherein the C1-7 alkyl of R5 may form a ring with any part of Y; [000362] X is selected from a C1-7 alkanedi-yl linkage, wherein the C1-7 alkanedi-yl of X can form a ring with any part of Y; [000363] Y is selected from NR10R12 and C3-7-cycloalkyl optionally containing a heteroatom in the ring, wherein the heteroatom is N and is optionally replaced by R8 where R8 is C17 alkyl; wherein Y can form a ring with any C1-7 alkanedi-yl moiety of X or with any C1-7 alkyl moiety of R5; on the condition that, when Y is NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; and [000364] R10 and R12 are each independently selected from H, C1-7 alkyl, C3-7 cycloalkyl, or C1-3 alkylaryl, all of these groups optionally substituted with halogen. [000365] In some modes, R5 is selected from C1-7 Petition 870260058863, dated 06 / 17 / 2026, pp. 481 / 843 53 / 404 alkyl, OR8, or SR8; wherein C1-7 alkyl, OR8, or SR8 of R5 may form a ring with any part of X; [000366] X is selected from -O-C1-7 alkanedi-yl, -S-C1-7 alkanedi-yl, or C1-7 alkanedi-yl, and wherein -O-C1-7 alkanedi-yl, -S-C1-7 alkanedi-yl, or C1-7 alkanedi-yl of X can form a ring with any part of R5; and [000367] Y is NR10R12, wherein R10 and R12 can form a ring in which the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein if the additional heteroatom is N, it is optionally replaced by R8. [000368] In some embodiments, R5 is OR8, wherein R8 of OR8 is C1-7 alkyl, wherein OR8 of R5 can form a ring with any part of X; [000369] X is -O-C1-7 alkanedi-yl and where -O-C1-7 alkanedi-yl of X can form a ring with any part of R5; and [000370] Y is NR10R12, wherein R10 and R12 can form a ring in which the ring contains the N of NR10R12 and four or five carbon atoms. [000371] In some embodiments, Y is aryl or heteroaryl, wherein the aryl or heteroaryl is optionally replaced by one or more R8; or S-heteroaryl, wherein the S-heteroaryl is optionally replaced by one or more R14. [000372] In some embodiments, Y is heteroaryl, where heteroaryl is optionally replaced by one or more R8; or Sheteroaryl, where S-heteroaryl is optionally replaced by one or more R14. [000373] In some embodiments, R5 is selected from H and C1-7 alkyl; [000374] X is selected from a linkage and a C1-7 alkanediyl group; and [000375] Y is aryl or heteroaryl, where aryl or heteroaryl is Petition 870260058863, dated 06 / 17 / 2026, pp. 482 / 843 54 / 404 optionally replaced by one or more R8R8; or S-heteroaryl, where S-heteroaryl is optionally replaced by one or more R14. [000376] In some embodiments, R5 is selected from H and C1-7 alkyl; [000377] X is selected from a linkage and a C1-7 alkanediyl group; and [000378] Y is heteroaryl, where heteroaryl is optionally replaced by one or more R8R8; or S-heteroaryl, where Sheteroaryl is optionally replaced by one or more R14. [000379] In some embodiments, R5 is selected from H and C1-7 alkyl; [000380] X is selected from a linkage and a C1-7 alkanediyl group; and [000381] Y is aryl or heteroaryl, wherein aryl or heteroaryl is optionally replaced by one of R8, wherein R8 is selected from C1-7 alkyl, C2-7 alkenyl, or C3-7 cycloalkyl; or S-heteroaryl wherein the S-heteroaryl is optionally replaced by one of R14 wherein R14 is selected from C1-7 alkyl, C2-7 alkenyl, or C3-7 cycloalkyl. [000382] In some embodiments, R5 is selected from H and C1-7 alkyl; [000383] X is selected from a linkage and a C1-7 alkanediyl group; and [000384] Y is heteroaryl, wherein the heteroaryl is optionally replaced by one of R8, wherein R8 is selected from C1-7 alkyl, C2-7 alkenyl, C3-7 cycloalkyl; or S-heteroaryl, wherein the S-heteroaryl is optionally replaced by one of R14, wherein R14 is selected from C1-7 alkyl, C2-7 alkenyl, C3-7 cycloalkyl. [000385] In some forms, the compound is of any Petition 870260058863, dated 06 / 17 / 2026, pp. 483 / 843 55 / 404 of the Formulas (Va), (Vb), (Vc) or (Vd): Ri2 (Va)Ri2 (Vb)Rl2(Vc); orxRi Q N10R12 (Vd) [000386] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n5 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R10 and R12 are as described in this document. [000387] In some embodiments, the compound is of Formula (Va) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n5 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R10 and R12 are as described herein. [000388] In some embodiments, the compound is of Formula (Vb) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n5 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R10 and R12 are as described herein. [000389] In some embodiments, the compound is of Formula (Vc) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n5 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R10 and R12 are as described herein. Petition 870260058863, dated 06 / 17 / 2026, pp. 484 / 843 56 / 404 [000390] In some embodiments, the compound is of Formula (Vd) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n5 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R10 and R12 are as described herein. [000391] In some modalities, R5 is H and XY is [000392] In some embodiments, the compound is of any of the Formulas (VIa), (VIb), (VIc) or (VId): R1 R1 (VIb); (VId); [000393] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n5 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R10 and R12 are as described in this document. [000394] In some embodiments, the compound is of Formula (VIa) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n5 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R10 and R12 are as described herein. [000395] In some embodiments, the compound is of Formula (VIb) or a pharmaceutically acceptable salt, hydrate, solvate or Petition 870260058863, dated 06 / 17 / 2026, pp. 485 / 843 57 / 404 stereoisomer thereof, wherein n5 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R10 and R12 are as described herein. [000396] In some embodiments, the compound is of Formula (VIc) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n5 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R10 and R12 are as described herein. [000397] In some embodiments, the compound is of Formula (VId) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n5 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R10 and R12 are as described herein. [000398] In some embodiments, Y is C(O)NR10R12, wherein R10 and R12 can form a ring in which the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein if the additional heteroatom is N, it is optionally replaced by R8. [000399] In some modalities, R5 is H and XY is . [000400] In some embodiments, R5 is selected from H and C1-7 alkyl; [000401] X is selected from a linkage and a C1-7 alkanediyl group; [000402] Y is C(O)NR10R12, wherein R10 and R12 can form a ring in which the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein if the additional heteroatom is N, it is optionally replaced by R8; and [000403] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C3-7 cycloalkyl, or C1-3 alkylaryl. Petition 870260058863, dated 06 / 17 / 2026, pp. 486 / 843 58 / 404 [000404] In some embodiments, Y is selected from Sarila, O-arila, S-heteroarila or O-heteroarila, wherein S-arila, O-arila, S-heteroarila or O-heteroarila are optionally replaced by one or more of R9 or R14. [000405] In some embodiments, Y is selected from O-aryl and O-heteroaryl, where O-aryl and O-heteroaryl are optionally replaced by one or more of R9 or R14. [000406] In some embodiments, Y is selected from Sarila, O-aryl, S-heteroaryl, or O-heteroaryl, wherein the S-aryl, O-aryl, S-heteroaryl, or O-heteroaryl are optionally replaced by one or more of R9; wherein R9 is selected from H, C1-5 alkyl, halogen, C1-5 alkyl-NR^11, C1-5 alkyl-C(O)OR8, C1-5 alkylC(O)NR8R11, CN, C(O)R8, C(O)NR8R11, C(O)OR8, and OR8. [000407] In some embodiments, R5 is selected from H and C1-7 alkyl; [000408] X is selected from a linkage and a C1-7 alkanediyl group; and [000409] Y is selected from O-aryl and O-heteroaryl, wherein O-aryl and O-heteroaryl are optionally replaced by one or more of R9; wherein R9 is selected from H, C1-5 alkyl, halogen, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)NR8R11, C1-5 alkyl-C(O)OR8, CN, C(O)R8, C(O)NR8R11, C(O)OR8, and OR8. [000410] In some modalities, Y is C(O)OR10. [000411] In some embodiments, R5 is selected from H and C1-7 alkyl; [000412] X is selected from a linkage and a C1-7 alkanediyl group; [000413] Y is C(O)OR10; and [000414] R10 is selected from H, C1-7 alkyl, C2-7 alkenyl, C37 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 Petition 870260058863, dated 06 / 17 / 2026, pp. 487 / 843 59 / 404 alkanedi-yl, C1-3 alkyl-aryl, or C1-3 alkyl-heteroaryl, all these groups optionally replaced by OR8. [000415] In some modalities, Y is H. [000416] In some embodiments, R5 is C1-7 alkyl; X is a connection; and Y is H. [000417] In some modalities, Y is CN. [000418] In some embodiments, R5 is H; X is C1-7 alkanedi-yl; and Y is CN. [000419] In some embodiments, Y is selected from H, C(O)NR10R12, C(O)OR10, NR10R12, CN, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; Saryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; aryl, or heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000420] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000421] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000422] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 Petition 870260058863, dated 06 / 17 / 2026, pp. 488 / 843 60 / 404 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; provided that, when R2 is C(O)NR15R15, R15 may form a ring wherein the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally substituted with R8; [000423] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 aryl or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; [000424] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000425] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group; [000426] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000427] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C4 Petition 870260058863, dated 06 / 17 / 2026, pp. 489 / 843 61 / 404 cycloalkenyl; [000428] X is selected from a linkage, C1-7 alkanediyl, C27 alkenediyl, C2-7 alkynediyl, C3-6 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, C1-3 alkanediyl-O-Cw alkanediyl, C1-7 heteroalkanediyl, or -S-C1-7 alkanediyl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a carbonyl group; [000429] Y is selected from H, C(O)NR10R12, C(O)OR10, NR10R12, cn, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000430] R9 is selected from H, halogen, C1-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, C3-5 cycloalkyl, halogen, C1-5 alkyl-OR8, C1-5 alkyl-SR8, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkylC(O)NR8R11, C1-5 alkyl-C(O)R10, CN, C(O)R8, C(O)NR8R11, C(O)OR8, NR8C(O)NR8R11, OC(O)NR8R11, SO2NR8R11, NR8SO2R8, OR8, NR8R11, or S(O)nR8 where n is 0, 1 or 2; [000431] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 Petition 870260058863, dated 06 / 17 / 2026, pp. 490 / 843 62 / 404 alkyl-aryl, or C1-3 alkyl-heteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11; [000432] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000433] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000434] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000435] In some embodiments, Y is selected from H, C(O)NR10R12, C(O)OR10, NR10R12, CN, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; Saryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein, when Y is C(O)NR10R12 or NR10R12, Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000436] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000437] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 Petition 870260058863, dated 06 / 17 / 2026, pp. 491 / 843 63 / 404 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000438] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000439] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 aryl-substituted or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; [000440] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000441] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and where R5 can form a ring with any part of X or, when Y is C(O)NR10R12 or NR10R12, R5 can form a ring with any part of Y, where the ring optionally contains a carbonyl group; [000442] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally Petition 870260058863, dated 06 / 17 / 2026, pp. 492 / 843 64 / 404 substituted with halogen, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000443] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl; [000444] X is selected from a linkage, C1-7 alkanediyl, C27 alkenediyl, C2-7 alkynediyl, C3-6 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, C1-3 alkanediyl-O-Cw alkanediyl, C1-7 heteroalkanediyl, or -S-C1-7 alkanediyl; and where X may form a ring with any part of R5 or, where Y is C(O)NR10R12 or NR10R12, X may form a ring with any part of Y, where the ring optionally contains a carbonyl group; [000445] Y is selected from H, C(O)NR10R12, C(O)OR10, NR10R12, CN, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein, when Y is C(O)NR10R12 or NR10R12, Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000446] R9 is selected from H, halogen, C1-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, C3-5 cycloalkyl, C1-5 alkyl-OR8, C1-5 alkyl-SR8, C1 Petition 870260058863, dated 06 / 17 / 2026, pp. 493 / 843 65 / 404 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkyl-C(O)NR8R11, C1-5 alkylC(O)R10, CN, C(O)R8, C(O)NR8R11, C(O)OR8, NR8C(O)NR8R11, OC(O)NR8R11, SO2NR8R11, NR8SO2R8, OR8, NR8R11, or S(O)nR8 where n is 0, 1 or 2; [000447] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11; [000448] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000449] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000450] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000451] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000452] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000453] R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13 where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with aryl, wherein the aryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000454] R3e R7são H; [000455] R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or Petition 870260058863, dated 06 / 17 / 2026, pp. 494 / 843 66 / 404 C1-3 alkyl substituted with aryl or heteroaryl; [000456] R5 is selected from H, C1-7 alkyl, or OR8; and wherein C1-7 alkyl or OR8 of R5 may form a ring with any part of X or, where Y is C(O)NR10R12 or NR10R12, C1-7 alkyl of R5 may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group; [000457] R6 is H, C1-7 alkyl, or imidazolidinone; [000458] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, and C3-7 cycloalkyl; [000459] X is selected from a linkage, -O-C1-7 alkanedi-yl and C1-7 alkanedi-yl; and wherein -O-C1-7 alkanedi-yl or C1-7 alkanedi-yl of X may form a ring with any part of R5 or, when Y is C(O)NR10R12 or NR10R12, C1-7 alkanedi-yl of X may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group; [000460] Y is selected from H, C(O)NR10R12, C(O)OR10, NR10R12, CN, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; O-aryl, S-heteroaryl, O-heteroaryl wherein O-aryl or O-heteroaryl are optionally replaced by one or more R9 and wherein S-heteroaryl is optionally replaced by one or more R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more R8; and wherein, when Y is C(O)NR10R12 or NR10R12, Y may form a ring with any C1-7 alkanediyl moiety of X or any C1-7 alkyl moiety of R5, wherein the ring optionally contains a carbonyl group; provided that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 may form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is... Petition 870260058863, dated 06 / 17 / 2026, pp. 495 / 843 67 / 404 optionally replaced by R8; [000461] R9 is selected from H, C1-5 alkyl, halogen, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkyl-C(O)NR8R11, CN, C(O)R8, C(O)NR8R11, C(O)OR8, and OR8; [000462] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanediyl-O-C1-3 alkanediyl-O-C1-3 alkanediyl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen or OR8; and [000463] R14 is C1-7 alkyl. [000464] In some embodiments, Y is selected from H, C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; Saryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000465] In some embodiments, Y is selected from H, C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; Saryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, Sheteroaryl, O-heteroaryl are optionally replaced by one or Petition 870260058863, dated 06 / 17 / 2026, pp. 496 / 843 68 / 404 more than R9 or R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein, when Y is C(O)NR10R12 or NR10R12, y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; on the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 may form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000466] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000467] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000468] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000469] R3e R7e are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 aryl-substituted or heteroaryl-substituted alkyl, wherein aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl Petition 870260058863, dated 06 / 17 / 2026, pp. 497 / 843 69 / 404 or C3-5 cycloalkyl; [000470] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000471] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group; [000472] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000473] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl; [000474] X is selected from a linkage, C1-7 alkanediyl, C27 alkenediyl, C2-7 alkynediyl, C3-6 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, C1-3 alkanediyl-OC-1-7 alkanediyl, C1-7 heteroalkanediyl, or -S-C1-7 alkanediyl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a carbonyl group; [000475] Y is selected from H, C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or aryl, Petition 870260058863, dated 06 / 17 / 2026, pp. 498 / 843 70 / 404 heteroaryl wherein the aryl or heteroaryl group is optionally replaced by one or more R8 groups; and wherein Y can form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; provided that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000476] R9 is selected from H, halogen, C1-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, C3-5 cycloalkyl, halogen, C1-5 alkyl-OR8, C1-5 alkyl-SR8, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)NR8R11, C1-5 alkylC(O)OR8, C1-5 alkyl-C(O)R10, CN, C(O)R8, C(O)NR8R11, C(O)OR8, NR8C(O)NR8R11, OC(O)NR8R11, SO2NR8R11, NR8SO2R8, OR8, NR8R11, or S(O)nR8 where n is 0, 1 or 2; [000477] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11; [000478] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000479] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and [000480] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000481] In some embodiments, the compound is a compound of Petition 870260058863, dated 06 / 17 / 2026, pp. 499 / 843 71 / 404 Formula (I) or Formula (Ia), where: [000482] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted with aryl or heteroaryl; [000483] R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13 where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with an aryl group, wherein the aryl group is optionally substituted with a halogen, C1-4 alkyl or C3-5 cycloalkyl; [000484] R3e R7são H; [000485] R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted with aryl or heteroaryl; [000486] R5 is selected from H, C1-7 alkyl, or OR8; and wherein C1-7 alkyl or OR8 of R5 may form a ring with any part of X or, where Y is C(O)NR10R12 or NR10R12, C1-7 alkyl of R5 may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group; [000487] R6 is H, C1-7 alkyl, or imidazolidinone; [000488] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, and C3-7 cycloalkyl; [000489] X is selected from a linkage, -O-C1-7 alkanedi-yl and C1-7 alkanedi-yl; and wherein -O-C1-7 alkanedi-yl or C1-7 alkanedi-yl of X may form a ring with any part of R5 or, when Y is C(O)NR10R12 or NR10R12, C1-7 alkanedi-yl of X may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group; [000490] Y is selected from H, C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; O-aryl, S-heteroaryl, O-heteroaryl wherein O-aryl or O-heteroaryl are optionally replaced by Petition 870260058863, dated 06 / 17 / 2026, pp. 500 / 843 72 / 404 one or more of R9e where the S-heteroaryl is optionally replaced by one or more of R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein, when Y is C(O)NR10R12 or NR10R12, Y may form a ring with any C1-7 alkanedi-yl part of X or any C1-7 alkyl part of R5, wherein the ring optionally contains a carbonyl group; provided that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 may form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000491] R9 is selected from H, C1-5 alkyl, halogen, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)NR8R11, C1-5 alkyl-C(O)OR8, CN, C(O)R8, C(O)NR8R11, C(O)OR8, and OR8; [000492] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanediyl-O-C1-3 alkanediyl-O-C1-3 alkanediyl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen or OR8; and [000493] R14 is C1-7 alkyl. [000494] In some embodiments, Y is selected from C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally substituted by R8; Saryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally substituted by one or more of R9 or R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally substituted by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; provided that, Petition 870260058863, dated 06 / 17 / 2026, pp. 501 / 843 73 / 404 when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000495] In some embodiments, Y is selected from C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; Saryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein, when Y is C(O)NR10R12 or NR10R12, Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000496] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000497] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000498] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanediyl-O-C1-3 alkanediyl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted by aryl or heteroaryl, wherein aryl or heteroaryl is optionally substituted Petition 870260058863, dated 06 / 17 / 2026, pp. 502 / 843 74 / 404 by halogen, C1-4 alkyl or C3-5 cycloalkyl; provided that, when R2 is C(O)NR15R15, R15 may form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, in which, if the additional heteroatom is N, it is optionally replaced by R8; [000499] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 aryl or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; [000500] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000501] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group; [000502] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000503] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl; [000504] X is selected from a linkage, C1-7 alkanedi-yl, C27 alkenedi-yl, C2-7 alkynedi-yl, C3-6 cycloalkanedi-yl, C4-6 cycloalkendi Petition 870260058863, dated 06 / 17 / 2026, pp. 503 / 843 75 / 404 ila, -O-, C1-3 alkanedi-yl-O-, -O-C1-7 alkanedi-yl, C1-3 alkanedi-yl-O-C1-7 alkanedi-yl, C1-7 heteroalkanedi-yl, or -S-C1-7 alkanedi-yl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a carbonyl group; [000505] Y is selected from C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000506] R9 is selected from H, halogen, C1-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, C3-5 cycloalkyl, C1-5 alkyl-OR8, C1-5 alkyl-SR8, C15 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkyl-C(O)NR8R11, C1-5 alkylC(O)R10, CN, C(O)R8, C(O)NR8R11, C(O)OR8, NR8C(O)NR8R11, OC(O)NR8R11, SO2NR8R11, NR8SO2R8, OR8, NR8R11, or S(O)nR8 where n is 0, 1 or 2; [000507] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11; [000508] R13 is a C1-5 alkyl substituted by a bicyclic ring Petition 870260058863, dated 06 / 17 / 2026, pp. 504 / 843 76 / 404 optionally containing at least one heteroatom and one carbonyl group; [000509] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and [000510] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000511] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000512] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted with aryl or heteroaryl; [000513] R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13 where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with aryl, wherein the aryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000514] R3e R7são H; [000515] R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000516] R5 is selected from H, C1-7 alkyl, or OR8; and wherein C1-7 alkyl or OR8 of R5 may form a ring with any part of X or, where Y is C(O)NR10R12 or NR10R12, C1-7 alkyl of R5 may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group; [000517] R6 is H or C1-7 alkyl; [000518] R8e R11 são cada um independente escolhidos de H, C1-7 alkyl, C2-7 alkenyl, e C3-7 cycloalkyl; [000519] X is selected from a linkage, -O-C1-7 alkanedi-yl Petition 870260058863, dated 06 / 17 / 2026, pp. 505 / 843 77 / 404 and C1-7 alkanedi-yl; and wherein -O-C1-7 alkanedi-yl or C1-7 alkanedi-yl of X may form a ring with any part of R5 or, when Y is C(O)NR10R12 or NR10R12, C1-7 alkanedi-yl of X may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group; [000520] Y is selected from C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; O-aryl, S-heteroaryl, O-heteroaryl wherein O-aryl or O-heteroaryl are optionally replaced by one or more R9 and wherein S-heteroaryl is optionally replaced by one or more R14; or aryl, heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more R8; and wherein, when Y is C(O)NR10R12 or NR10R12, Y can form a ring with any C1-7 alkanedi-yl moiety of X or any C1-7 alkyl moiety of R5, wherein the ring optionally contains a carbonyl group;with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000521] R9 is selected from H, C1-5 alkyl, halogen, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkyl-C(O)NR8R11, CN, C(O)R8, C(O)NR8R11, C(O)OR8, and OR8; [000522] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-OC-1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen or OR8; and [000523] R14 is C1-7 alkyl. Petition 870260058863, dated 06 / 17 / 2026, pp. 506 / 843 78 / 404 [000524] In some embodiments, Y is selected from C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; Saryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or heteroaryl wherein the heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000525] In some embodiments, Y is selected from C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; Saryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, Sheteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or heteroaryl wherein the heteroaryl is optionally replaced by one or more of R8; and wherein, when Y is C(O)NR10R12 or NR10R12, Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000526] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: Petition 870260058863, dated 06 / 17 / 2026, pp. 507 / 843 79 / 404 [000527] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000528] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000529] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 aryl or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; [000530] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000531] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group; [000532] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally Petition 870260058863, dated 06 / 17 / 2026, pp. 508 / 843 80 / 404 substituted with halogen, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000533] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl; [000534] X is selected from a linkage, C1-7 alkanediyl, C27 alkenediyl, C2-7 alkynediyl, C3-6 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, C1-3 alkanediyl-O-Cw alkanediyl, C1-7 heteroalkanediyl, or -S-C1-7 alkanediyl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a carbonyl group; [000535] Y is selected from C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or heteroaryl wherein the heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000536] R9 is selected from H, halogen, C1-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, C3-5 cycloalkyl, C1-5 alkyl-OR8, C1-5 alkyl-SR8, C15 alkyl-NR8R11, C1-5 alkyl-C(O)NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkylC(O)R10, CN, C(O)R8, C(O)NR8R11, C(O)OR8, NR8C(O)NR8R11, Petition 870260058863, dated 06 / 17 / 2026, pp. 509 / 843 81 / 404 OC(O)NR8R11, SO2NR8R11, NR8SÜ2R8, OR8, NR8R11, or S(O)nR8 where n is 0, 1, or 2; [000537] wherein R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C47 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11; [000538] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000539] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and [000540] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000541] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000542] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted with aryl or heteroaryl; [000543] R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13 where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with an aryl group, wherein the aryl group is optionally substituted with a halogen, C1-4 alkyl or C3-5 cycloalkyl; [000544] R3e R7são H; [000545] R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted with aryl or heteroaryl; [000546] R5 is selected from H, C1-7 alkyl, or OR8; and wherein Petition 870260058863, dated 06 / 17 / 2026, pp. 510 / 843 82 / 404 C1-7 alkyl or OR8 of R5 can form a ring with any part of X or, when Y is C(O)NR10R12 or NR10R12, C1-7 alkyl of R5 can form a ring with any part of Y, wherein the ring optionally contains a carbonyl group; [000547] R6 is H or C1-7 alkyl; [000548] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, and C3-7 cycloalkyl; [000549] X is selected from a linkage, -O-C1-7 alkanedi-yl and C1-7 alkanedi-yl; and wherein -O-C1-7 alkanedi-yl or C1-7 alkanedi-yl of X may form a ring with any part of R5 or, when Y is C(O)NR10R12 or NR10R12, C1-7 alkanedi-yl of X may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group; [000550] Y is selected from C(O)NR10R12, C(O)OR10, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; O-aryl, S-heteroaryl, O-heteroaryl wherein O-aryl or O-heteroaryl are optionally replaced by one or more R9 and wherein S-heteroaryl is optionally replaced by one or more R14; or heteroaryl wherein the heteroaryl is optionally replaced by one or more R8; and wherein, when Y is C(O)NR10R12 or NR10R12, Y can form a ring with any C1-7 alkanedi-yl moiety of X or any C1-7 alkyl moiety of R5, wherein the ring optionally contains a carbonyl group;with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000551] R9 is selected from H, C1-5 alkyl, halogen, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)NR8R11, C1-5 alkyl-C(O)OR8, CN, C(O)R8, Petition 870260058863, dated 06 / 17 / 2026, p. 511 / 843 83 / 404 C(O)NR8R11, C(O)OR8, and OR8; [000552] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen or OR8; and [000553] R14 is C1-7 alkyl. [000554] In some embodiments, Y is selected from C(O)NR10R12, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, Oaryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or heteroaryl wherein the heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000555] In some embodiments, Y is selected from C(O)NR10R12, NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally substituted by R8; S-aryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally substituted by one or more of R9 or R14; or heteroaryl wherein the heteroaryl is optionally substituted by one or more of R8; and wherein, when Y is C(O)NR10R12 or NR10R12, Y may form a ring with any part of X or R5, in Petition 870260058863, dated 06 / 17 / 2026, p. 512 / 843 84 / 404 that the ring optionally contains a carbonyl group; provided that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 may form a ring in which the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000556] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000557] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000558] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000559] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 aryl or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; [000560] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein aryl or heteroaryl is optionally Petition 870260058863, dated 06 / 17 / 2026, pp. 513 / 843 85 / 404 substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000561] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group; [000562] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000563] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl; [000564] X is selected from a linkage, C1-7 alkanediyl, C27 alkenediyl, C2-7 alkynediyl, C3-6 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, C1-3 alkanediyl-OC-1-7 alkanediyl, C1-7 heteroalkanediyl, or -S-C1-7 alkanediyl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a carbonyl group; [000565] Y is selected from C(O)NR10R12, NR10R12, C3-7cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-aryl, O-aryl, S-heteroaryl, O-heteroaryl wherein S-aryl, O-aryl, S-heteroaryl, O-heteroaryl are optionally replaced by one or more of R9 or R14; or heteroaryl wherein the heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 may form Petition 870260058863, dated 06 / 17 / 2026, pp. 514 / 843 86 / 404 a ring in which the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000566] R9 is selected from H, halogen, C1-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, C3-5 cycloalkyl, C1-5 alkyl-OR8, C1-5 alkyl-SR8, C15 alkyl-NR8R11, C1-5 alkyl-C(O)OR8, C1-5 alkyl-C(O)NR8R11, C1-5 alkylC(O)R10, CN, C(O)R8, C(O)NR8R11, C(O)OR8, NR8C(O)NR8R11, OC(O)NR8R11, SO2NR8R11, NR8SO2R8, OR8, NR8R11, or S(O)nR8 where n is 0, 1 or 2; [000567] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11; [000568] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000569] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and [000570] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8. [000571] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000572] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, C13 alkyl substituted by aryl or heteroaryl; [000573] R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13where R13is Petition 870260058863, dated 06 / 17 / 2026, pp. 515 / 843 87 / 404 pentilamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with aryl, wherein the aryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000574] R3e R7são H; [000575] R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000576] R5 is selected from H, C1-7 alkyl, or OR8; and wherein C1-7 alkyl or OR8 of R5 may form a ring with any part of X or, where Y is C(O)NR10R12 or NR10R12, C1-7 alkyl of R5 may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group; [000577] R6 is H or C1-7 alkyl; [000578] R8e R11 são cada um independente escolhidos de H, C1-7 alkyl, C2-7 alkenyl, e C3-7 cycloalkyl; [000579] X is selected from a linkage, -O-C1-7 alkanedi-yl and C1-7 alkanedi-yl; and wherein -O-C1-7 alkanedi-yl or C1-7 alkanedi-yl of X may form a ring with any part of R5 or, when Y is C(O)NR10R12 or NR10R12, C1-7 alkanedi-yl of X may form a ring with any part of Y, wherein the ring optionally contains a carbonyl group; [000580] Y is selected from C(O)NR10R12, NR10R12, C3-7 cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally substituted by R8; O-aryl, S-heteroaryl, O-heteroaryl wherein O-aryl or O-heteroaryl are optionally substituted by one or more of R9 and wherein S-heteroaryl is optionally substituted by one or more of R14; or heteroaryl wherein the heteroaryl is optionally substituted by one or more of R8; and wherein, when Y is C(O)NR10R12 or NR10R12, Y may form a ring with any C1-7 alkanedi-yl moiety of X or any C1-7 alkyl moiety of R5, wherein Petition 870260058863, dated 06 / 17 / 2026, pp. 516 / 843 88 / 404 the ring optionally contains a carbonyl group; provided that, when Y is C(O)NR10R12 or NR10R12, R10 and R12 may form a ring in which the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000581] R9 is selected from H, C1-5 alkyl, halogen, C1-5 alkyl-NR8R11, C1-5 alkyl-C(O)NR8R11, C1-5 alkyl-C(O)OR8, CN, C(O)R8, C(O)NR8R11, C(O)OR8, and OR8; [000582] R10 and R12 are each independently selected from H, C1-7 alkyl, C3-7 cycloalkyl, C1-3 alkylaryl, all these groups optionally substituted with halogen; and [000583] R14 is C1-7 alkyl. [000584] In some embodiments, Y is selected from NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-heteroaryl, wherein S-heteroaryl is optionally replaced by one or more of R14; aryl, or heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; on the condition that, when Y is NR10R12, R10 and R12 may form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000585] In some embodiments, Y is selected from NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-heteroaryl, wherein S-heteroaryl is optionally replaced by one or more of R14; aryl, or heteroaryl wherein the aryl or heteroaryl is optionally replaced by Petition 870260058863, dated 06 / 17 / 2026, p. 517 / 843 89 / 404 one or more of R8; and wherein, when Y is NR10R12, Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; on the condition that, when Y is NR10R12, r10 and r12 may form a ring wherein the ring contains the N of Nr10r12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000586] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000587] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000588] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000589] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 aryl or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; [000590] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 Petition 870260058863, dated 06 / 17 / 2026, pp. 518 / 843 90 / 404 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000591] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group; [000592] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000593] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl; [000594] X is selected from a linkage, C1-7 alkanediyl, C27 alkenediyl, C2-7 alkynediyl, C3-6 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, C1-3 alkanediyl-O-Cw alkanediyl, C1-7 heteroalkanediyl, or -S-C1-7 alkanediyl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a carbonyl group; [000595] Y is selected from NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-heteroaryl, wherein the S-heteroaryl is optionally replaced by one or more of R14; aryl, or heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the Petition 870260058863, dated 06 / 17 / 2026, p. 519 / 843 91 / 404 condition that, when Y is NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000596] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11; [000597] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000598] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and [000599] R15 is selected independently from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000600] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000601] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000602] R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13 where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with aryl, wherein the aryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000603] R3e R7são H; [000604] R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or Petition 870260058863, dated 06 / 17 / 2026, pp. 520 / 843 92 / 404 C1-3 alkyl substituted with aryl or heteroaryl; [000605] R5 is selected from H, C1-7 alkyl, or OR8; and wherein C1-7 alkyl or OR8 of R5 may form a ring with any part of X or, when Y is NR10R12, C1-7 alkyl of R5 may form a ring with any part of Y; [000606] R6é H; [000607] R8 is selected from H, C1-7 alkyl, C2-7 alkenyl, and C3-7 cycloalkyl; [000608] X is selected from a linkage, -O-C1-7 alkanedi-yl and C1-7 alkanedi-yl; and wherein -O-C1-7 alkanedi-yl or C1-7 alkanedi-yl of X can form a ring with any part of R5 or, when Y is NR10R12, C1-7 alkanedi-yl of X can form a ring with any part of Y; [000609] Y is selected from NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8, wherein R8 is C1-7 alkyl; S-heteroaryl wherein S-heteroaryl is optionally replaced by one or more of R14; aryl, or heteroaryl wherein the aryl or heteroaryl is optionally replaced by one or more of R8; and wherein, when Y is NR10R12, Y may form a ring with any C1-7 alkanedi-yl part of X or any C1-7 alkyl part of R5; with the condition that, when Y is NR10R12, R10 and R12 can form a ring in which the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000610] R10 and R12 are each independently selected from H, C1-7 alkyl, C3-7 cycloalkyl, or C1-3 alkylaryl, all of these groups optionally substituted with halogen; and [000611] R14 is C1-7 alkyl. Petition 870260058863, dated 06 / 17 / 2026, pp. 521 / 843 93 / 404 [000612] In some embodiments, the aryl, heteroaryl or sheteroaryl groups of any of the compounds in this disclosure are preferably selected from the group consisting of phenyl, imidazole, pyridine and triazole, more preferably selected from the group consisting of phenyl, imidazole and pyridine. [000613] In some embodiments, Y is selected from NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-heteroaryl, wherein S-heteroaryl is optionally replaced by one or more of R14; or heteroaryl wherein the heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; on the condition that, when Y is NR10R12, R10 and R12 may form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000614] In some embodiments, Y is selected from NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-heteroaryl, wherein S-heteroaryl is optionally replaced by one or more of R14; or heteroaryl wherein the heteroaryl is optionally replaced by one or more of R8; and wherein, when Y is NR10R12, Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; on the condition that, when Y is NR10R12, R10 and R12 may form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. Petition 870260058863, dated 06 / 17 / 2026, pp. 522 / 843 94 / 404 [000615] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000616] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000617] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000618] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 aryl or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; [000619] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000620] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group; Petition 870260058863, dated 06 / 17 / 2026, pp. 523 / 843 95 / 404 [000621] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000622] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl; [000623] X is selected from a linkage, C1-7 alkanediyl, C27 alkenediyl, C2-7 alkynediyl, C3-6 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, C1-3 alkanediyl-OC-1-7 alkanediyl, C1-7 heteroalkanediyl, or -S-C1-7 alkanediyl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a carbonyl group; [000624] Y is selected from NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; S-heteroaryl, wherein the S-heteroaryl is optionally replaced by one or more of R14; or heteroaryl wherein the heteroaryl is optionally replaced by one or more of R8; and wherein Y may form a ring with any part of X or R5, wherein the ring optionally contains a carbonyl group; with the condition that, when Y is NR10R12, R10 and R12 may form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000625] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 Petition 870260058863, dated 06 / 17 / 2026, pp. 524 / 843 96 / 404 alkyl-aryl, or C1-3 alkyl-heteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11; [000626] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000627] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and [000628] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000629] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000630] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000631] R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13 where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with aryl, wherein the aryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000632] R3e R7são H; [000633] R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000634] R5 is selected from H, C1-7 alkyl, or OR8; and wherein C1-7 alkyl or OR8 of R5 may form a ring with any part of X or, when Y is NR10R12, C1-7 alkyl of R5 may form a ring with any part of Y; [000635] R6é H; [000636] R8 is selected from H, C1-7 alkyl, C2-7 alkenyl, and Petition 870260058863, dated 06 / 17 / 2026, pp. 525 / 843 97 / 404 C3-7 cycloalkyl; [000637] X is selected from a linkage, -O-C1-7 alkanedi-yl and C1-7 alkanedi-yl; and wherein -O-C1-7 alkanedi-yl or C1-7 alkanedi-yl of X can form a ring with any part of R5 or, when Y is Nr10r12, C1-7 alkanedi-yl of X can form a ring with any part of Y; [000638] Y is selected from NR10R12, C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8, wherein R8 is C1-7 alkyl; S-heteroaryl wherein S-heteroaryl is optionally replaced by one or more of R14; or heteroaryl wherein the heteroaryl is optionally replaced by one or more of R8; and wherein, when Y is NR10R12, Y may form a ring with any C1-7 alkanedi-yl part of X or any C1-7 alkyl part of R5; with the condition that, when Y is NR10R12, R10 and R12 can form a ring in which the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; and [000639] R14 is C1-7 alkyl. [000640] In some embodiments, the aryl, heteroaryl or sheteroaryl groups of the compounds in this disclosure are preferably selected from the group consisting of phenyl, imidazole, pyridine and triazole, more preferably selected from the group consisting of phenyl, imidazole and pyridine. [000641] In some embodiments, Y is selected from NR10R12e C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; and where Y can form a ring with any part of X or R5; on the condition that, when Y is Petition 870260058863, dated 06 / 17 / 2026, pp. 526 / 843 98 / 404 NR10r12, R10θ r12 can form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000642] In some embodiments, Y is selected from Nr10r12e C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8; and wherein, when Y is NR10R12, Y can form a ring with any part of X or R5; on the condition that, when Y is NR10R12, R10 and R12 can form a ring wherein the ring contains the N of NR10R12e optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8. [000643] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000644] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000645] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-Ci-3 alkanediyl-O-C1-3 alkanediyl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted by aryl or heteroaryl, wherein aryl or heteroaryl is optionally substituted by halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000646] R3e R7são cada um independente escolhido a Petition 870260058863, dated 06 / 17 / 2026, pp. 527 / 843 99 / 404 of H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally substituted with halogen, OR8, NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000647] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000648] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; and wherein R5 may form a ring with any part of X or Y, wherein the ring optionally contains a carbonyl group; [000649] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000650] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl; [000651] X is selected from a linkage, C1-7 alkanediyl, C27 alkenediyl, C2-7 alkynediyl, C3-6 cycloalkanediyl, C4-6 cycloalkenediyl, -O-, C1-3 alkanediyl-O-, -O-C1-7 alkanediyl, C1-3 alkanediyl-OC-1-7 alkanediyl, C1-7 heteroalkanediyl, or -S-C1-7 alkanediyl; and where X may form a ring with any part of R5 or Y, where the ring optionally contains a carbonyl group; [000652] Y is selected from NR10R12e C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from Petition 870260058863, dated 06 / 17 / 2026, pp. 528 / 843 100 / 404 of O and N where, if the heteroatom is N, it is optionally replaced by R8; and where Y can form a ring with any part of X or R5; with the condition that, when Y is NR10R12, R10 and R12 can form a ring in which the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, in which, if the additional heteroatom is N, it is optionally replaced by R8; [000653] R10 and R12 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-3 alkylaryl, or C1-3 alkylheteroaryl, all these groups optionally substituted with halogen, OR8, or NR8R11; [000654] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000655] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and [000656] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000657] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000658] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, C13 alkyl substituted by aryl or heteroaryl; [000659] R2 is selected from H, C(O)R14, where R14 is C1-7 alkyl; C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkylNHCOR13 where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 aryl-substituted alkyl, in Petition 870260058863, dated 06 / 17 / 2026, pp. 529 / 843 101 / 404 where the aryl group is optionally replaced by halogen, C1-4 alkyl or C35 cycloalkyl; [000660] R3e R7são H; [000661] R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000662] R5 is selected from H and C1-7 alkyl; and wherein the C1-7 alkyl of R5 may form a ring with any part of Y; [000663] R6é H; [000664] R8 is selected from H, C1-7 alkyl, C2-7 alkenyl, and C3-7 cycloalkyl; [000665] X is selected from a C1-7 alkanedi-yl linkage, wherein the C1-7 alkanedi-yl of X can form a ring with any part of Y; [000666] Y is selected from NR10R12 or C3-7-cycloalkyl optionally containing a heteroatom in the ring selected from O and N wherein, if the heteroatom is N, it is optionally replaced by R8, wherein R8 is C1-7 alkyl; and wherein, when Y is NR10R12, Y may form a ring with any C1-7 alkanedi-yl part of X or any C1-7 alkyl part of R5; on the condition that, when Y is NR10R12, R10 and R12 may form a ring wherein the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; and [000667] R10 and R12 are each independently selected from H, C1-7 alkyl, C3-7 cycloalkyl, C1-3 alkylaryl, all these groups optionally substituted with halogen. [000668] In some embodiments, the aryl or heteroaryl groups of the compounds in this disclosure are preferably selected from the group consisting of phenyl, imidazole, pyridine and triazole, more preferably selected from the group consisting of Petition 870260058863, dated 06 / 17 / 2026, pp. 530 / 843 102 / 404 phenyl, imidazole and pyridine. [000669] In some forms, the compound is of any of the Formulas (VIIa), (VIIb), (VIIc), (VIId), (VIIe), or (VIIf): R2 R? R1 R? ny A ^N. R3 Rs R4(VIIa); R8r8r8r8R(VIIc); (VIIe); or R1 R2 r8 R4r8 Rs r8(VIIb); 2(VIId); R(VIIf); [000670] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, where n8 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, and R8 are as described in this document. [000671] In some embodiments, the compound is of Formula (VIIa) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n8 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, and R8 are as described herein. [000672] In some embodiments, the compound is of Formula (VIIb) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n8 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, and R8 are as described herein. Petition 870260058863, dated 06 / 17 / 2026, pp. 531 / 843 103 / 404 [000673] In some embodiments, the compound is of Formula (VIIc) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n8 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, and R8 are as described herein. [000674] In some embodiments, the compound is of Formula (VIId) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n8 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, and R8 are as described herein. [000675] In some embodiments, the compound is of Formula (VIIe) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n8 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, and R8 are as described herein. [000676] In some embodiments, the compound is of Formula (VIIf) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n8 is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, and R8 are as described herein. [000677] In some forms, R5 is H and XY is \ , Petition 870260058863, dated 06 / 17 / 2026, pp. 532-843 104 / 404 or [000678] In some embodiments, Y is aryl or heteroaryl, where aryl or heteroaryl is optionally replaced by one or more R8; or S-heteroaryl, where S-heteroaryl is optionally replaced by one or more R14. [000679] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000680] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000681] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000682] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 Petition 870260058863, dated 06 / 17 / 2026, pp. 533 / 843 105 / 404 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; [000683] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000684] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; [000685] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000686] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl; [000687] X is selected from a linkage, C1-7 alkanedi-yl, C27 alkenedi-yl, C2-7 alkynedi-yl, C3-6 cycloalkanedi-yl, C4-6 cycloalkenediyl, -O-, C1-3 alkanedi-yl-O-, -O-C1-7 alkanedi-yl, C1-3 alkanedi-yl-O-Cw alkanedi-yl, C1-7 heteroalkanedi-yl, or -S-C1-7 alkanedi-yl; [000688] Y is aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted by one or more R8; or S-heteroaryl, wherein the S-heteroaryl is optionally substituted by one or more R14; [000689] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000690] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2 Petition 870260058863, dated 06 / 17 / 2026, pp. 534 / 843 106 / 404 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and [000691] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000692] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000693] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000694] R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13 where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with an aryl group, wherein the aryl group is optionally substituted with a halogen, C1-4 alkyl or C3-5 cycloalkyl; [000695] R3e R7são H; [000696] R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000697] R5 is selected from H and C1-7 alkyl; [000698] R6é H; [000699] R8 is selected from H, C1-7 alkyl, C2-7 alkenyl, and C3-7 cycloalkyl; [000700] X is selected from a linkage and a C1-7 alkanediyl group; [000701] Y is aryl or heteroaryl, where aryl or heteroaryl is optionally replaced by one or more R8; or S-heteroaryl, where S-heteroaryl is optionally replaced by one or more R14; and [000702] R14 is C1-7 alkyl. [000703] In some forms, aryl, heteroaryl or S Petition 870260058863, dated 06 / 17 / 2026, pp. 535 / 843 107 / 404 heteroaryl groups of any of the compounds in this disclosure are preferably selected from the group consisting of phenyl, imidazole, pyridine and triazole, more preferably selected from the group consisting of phenyl, imidazole and pyridine. [000704] In some embodiments, Y is heteroaryl, where the heteroaryl is optionally replaced by one or more R8; or Sheteroaryl, where the S-heteroaryl is optionally replaced by one or more R14. [000705] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000706] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000707] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; [000708] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 aryl or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; Petition 870260058863, dated 06 / 17 / 2026, pp. 536 / 843 108 / 404 [000709] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000710] R5 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, C1-3 alkyl-OR8, or SR8; [000711] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000712] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl; [000713] X is selected from a linkage, C1-7 alkanedi-yl, C27 alkenedi-yl, C2-7 alkynedi-yl, C3-6 cycloalkanedi-yl, C4-6 cycloalkenediyl, -O-, C1-3 alkanedi-yl-O-, -O-C1-7 alkanedi-yl, C1-3 alkanedi-yl-O-Cw alkanedi-yl, C1-7 heteroalkanedi-yl, or -S-C1-7 alkanedi-yl; [000714] Y is heteroaryl, where heteroaryl is optionally replaced by one or more R8; or S-heteroaryl, where Sheteroaryl is optionally replaced by one or more R14; [000715] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000716] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and [000717] each R15 is selected independently of H, Petition 870260058863, dated 06 / 17 / 2026, pp. 537 / 843 109 / 404 C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000718] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000719] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000720] R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13 where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with aryl, wherein the aryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000721] R3e R7são H; [000722] R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000723] R5 is selected from H and C1-7 alkyl; [000724] R6é H; [000725] R8 is selected from H, C1-7 alkyl, C2-7 alkenyl, and C3-7 cycloalkyl; [000726] X is selected from a linkage and a C1-7 alkanediyl group; [000727] Y is heteroaryl, wherein the heteroaryl is optionally replaced by one or more R8; or S-heteroaryl, wherein the S-heteroaryl is optionally replaced by one or more R14; and [000728] R14 is C1-7 alkyl. [000729] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000730] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000731] R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13where R13is Petition 870260058863, dated 06 / 17 / 2026, pp. 538 / 843 110 / 404 pentilamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with aryl, wherein the aryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000732] R3e R7são H; [000733] ​​R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000734] R5 is selected from H, C1-7 alkyl, OR8, and O-C1-7 alkyl; [000735] R6é H; [000736] R8 is selected from H, C1-7 alkyl, C2-7 alkenyl, and C3-7 cycloalkyl; [000737] X is selected from a linkage, C1-7 alkanedi-yl, O-, and -O-C1-7 alkanedi-yl; [000738] Y is heteroaryl, wherein the heteroaryl is optionally replaced by one or more R8; or S-heteroaryl, wherein the S-heteroaryl is optionally replaced by one or more R14; and [000739] R14 is C1-7 alkyl. [000740] In some embodiments, the aryl, heteroaryl or sheteroaryl groups of any of the compounds in this disclosure are preferably selected from the group consisting of phenyl, imidazole, pyridine and triazole, more preferably selected from the group consisting of phenyl, imidazole and pyridine. [000741] In some embodiments, R5, X and Y form a spirane or spiro compound at the -4 position of the piperidine ring. [000742] In some embodiments, R5, X and Y form a spirane or spiro compound at the -4 position of the piperidine ring and R5, X and Y form / N Petition 870260058863, dated 06 / 17 / 2026, pp. 539 / 843 111 / 404 or \, where — indicates the -4 position of the piperidine ring, the common atom of spirane. [000743] In some embodiments, the compound is any of Formulas (VIIIa), (VIIIb), (VIIIc), (VIIId), (VIIIe), (VIIIf), (VIIIg), (VIIIh), (VIIIi), (VIIIj), (VIIIk), (VIIIl): (VIIIa); (VIIIb); (VIIIc); (VIIId); Petition 870260058863, dated 06 / 17 / 2026, pp. 540 / 843 112 / 404 Y (VlIIe); (Vlllf); (Vlllg); (Vlllh); (Vllli); (Vlllj); (Vlllk); or (Vllll); [000744] or a pharmaceutically acceptable salt, hydrate, solvate, or stereoisomer thereof, wherein Qi and Q2 are each independently O, S, NR8 or CR8, and R1, R2, R3, R4, R6, R7, R8 and Y are as described herein. [000745] In some embodiments, the compound is of Formula (Vllla) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000746] In some embodiments, the compound is of Formula (Vlllb) or a pharmaceutically acceptable salt, hydrate, solvate or Petition 870260058863, dated 06 / 17 / 2026, pp. 541 / 843 113 / 404 stereoisomer thereof, wherein Qi and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000747] In some embodiments, the compound is of Formula (VIIIc) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000748] In some embodiments, the compound is of Formula (VIIId) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000749] In some embodiments, the compound is of Formula (VIIIe) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000750] In some embodiments, the compound is of Formula (VIIIf) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000751] In some embodiments, the compound is of Formula (VIIIg) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000752] In some embodiments, the compound is of Formula (VIIIh) or a pharmaceutically acceptable salt, hydrate, solvate or Petition 870260058863, dated 06 / 17 / 2026, pp. 542 / 843 114 / 404 stereoisomer thereof, wherein Qi and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000753] In some embodiments, the compound is of Formula (VIIIi) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000754] In some embodiments, the compound is of Formula (VIIIj) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000755] In some embodiments, the compound is of Formula (VIIIk) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000756] In some embodiments, the compound is of Formula (VIIIl) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000757] In some embodiments, the compound is of any of the Formulas (VIIIa1), (VIIIb1), (VIIIc1), (VIIId1), (VIIIe1), (VIIIf1), (VIIIg1), (VIIIh1), (VIIIi1), (VIIIj1), (VIIIk1), (VIIIl1): Petition 870260058863, dated 06 / 17 / 2026, pp. 543 / 843 115 / 404 (Vlllal); (Vlllbl); R1 Y (Vlllcl); (Vllldl); R1 Y (Vlllel); (Vlllfl); (Vlllgl); (Vllllil); (Vlllhl); (Vllljl); Petition 870260058863, dated 06 / 17 / 2026, pp. 544 / 843 116 / 404 (Vlllkl); or [000758] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Qi and Q2 are each independently O, S, NR8 or CR8, n8a is 0, 1, 2, 3, 4, 5, 6 or 7, preferably 1, 2 or 3, and R1, R2, R3, R4, R6, R7, R8 and Y are as described in this document. [000759] In some embodiments, the compound is of Formula (VIIIa1) or a pharmaceutically acceptable salt, hydrate, solvate, or stereoisomer thereof, wherein Qi and Q2 are each independently O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000760] In some embodiments, the compound is of Formula (VIIIb1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000761] In some embodiments, the compound is of Formula (VIIIc1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000762] In some embodiments, the compound is of Formula (VIIId1) or a pharmaceutically acceptable salt, hydrate, solvate or Petition 870260058863, dated 06 / 17 / 2026, pp. 545 / 843 117 / 404 stereoisomer thereof, wherein Qi and Q2 are each independently O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000763] In some embodiments, the compound is of Formula (VIIIe1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000764] In some embodiments, the compound is of Formula (VIIIf1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Qi and Q2 are each independently, O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000765] In some embodiments, the compound is of Formula (VIIIg1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000766] In some embodiments, the compound is of Formula (VIIIh1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000767] In some embodiments, the compound is of Formula (VIIIi1) or a pharmaceutically acceptable salt, hydrate, solvate or Petition 870260058863, dated 06 / 17 / 2026, pp. 546 / 843 118 / 404 stereoisomer thereof, wherein Qi and Q2 are each independently O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000768] In some embodiments, the compound is of Formula (VIIIj1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000769] In some embodiments, the compound is of Formula (VIIIk1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000770] In some embodiments, the compound is of Formula (VIIIl1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein Q1 and Q2 are each independently O, S, NR8, or CR8, n8a is 0, 1, 2, 3, 4, 5, 6, or 7, preferably 1, 2, or 3, and R1, R2, R3, R4, R6, R7, R8, and Y are as described herein. [000771] In some embodiments, Y is NR10R12, wherein R10 and R12 can form a ring in which the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein if the additional heteroatom is N, it is optionally replaced by R8. [000772] In some embodiments, the compound is of any of the Formulas (IXa), (IXb), (IXc) or (IXd): Petition 870260058863, dated 06 / 17 / 2026, pp. 547 / 843 119 / 404 R1 (IXa); (IXc);or R1 [000773] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, where n10 is 0, 1, 2, 3, 4, 5, 6 or 7, preferably 1, 2 or 3, and R1, R2, R3, R4, R6, R7, R10, R12 and Y are as described in this document. [000774] In some embodiments, the compound is of Formula (IXa) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n10 is 0, 1, 2, 3, 4, 5, 6 or 7, preferably 1, 2 or 3, and R1, R2, R3, R4, R6, R7, R10, R12 and Y are as described herein. [000775] In some embodiments, the compound is of Formula (IXb) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n10 is 0, 1, 2, 3, 4, 5, 6 or 7, preferably 1, 2 or 3, and R1, R2, R3, R4, R6, R7, R10, R12 and Y are as described herein. [000776] In some embodiments, the compound is of Formula (IXc) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n10 is 0, 1, 2, 3, 4, 5, 6 or 7, preferably 1, 2 or 3, and R1, R2, R3, R4, R6, R7, R10, R12 and Y are as described herein. [000777] In some forms, the compound is of the formula (IXd) Petition 870260058863, dated 06 / 17 / 2026, pp. 548 / 843 120 / 404 or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, where n10 is 0, 1, 2, 3, 4, 5, 6 or 7, preferably 1, 2 or 3, and R1, R2, R3, R4, R6, R7, R10, R12 and Y are as described in this document. [000778] In some embodiments, the compound is of any of the Formulas (IXa1), (IXb1), (IXc1) or (IXd1): R1 (IXa1); (IXb1); (IXc1); or (IXd1); [000779] or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, where n10 is 0, 1, 2, 3, 4, 5, 6 or 7, preferably 1, 2 or 3, R1, R2, R3, R4, R6, R7, R10, R12 and Y are as described in this document, and * indicates the Z isomer of the spiro compound. [000780] In some embodiments, the compound is of Formula (IXa1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n10 is 0, 1, 2, 3, 4, 5, 6 or 7, preferably 1, 2 or 3, R1, R2, R3, R4, R6, R7, R10, R12 and Y are as described herein, and * indicates the Z isomer of the spiro compound. [000781] In some embodiments, the compound is of Formula (IXb1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n10 is 0, 1, 2, 3, 4, 5, 6 or 7, preferably 1, 2 or 3, R1, R2, R3, R4, R6, R7, R10, R12 and Y are as Petition 870260058863, dated 06 / 17 / 2026, pp. 549 / 843 121 / 404 described in this document, and * indicates the Z isomer of the spiro compound. [000782] In some embodiments, the compound is of Formula (IXc1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n10 is 0, 1, 2, 3, 4, 5, 6 or 7, preferably 1, 2 or 3, R1, R2, R3, R4, R6, R7, R10, R12 and Y are as described herein, and * indicates the Z isomer of the spiro compound. [000783] In some embodiments, the compound is of Formula (IXd1) or a pharmaceutically acceptable salt, hydrate, solvate or stereoisomer thereof, wherein n10 is 0, 1, 2, 3, 4, 5, 6 or 7, preferably 1, 2 or 3, R1, R2, R3, R4, R6, R7, R10, R12 and Y are as described herein, and * indicates the Z isomer of the spiro compound. [000784] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000785] R1 is selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000786] R2 is selected from H, C(O)R14, C(O)NR15R15, C(O)OR15, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, C1-5 alkyl-OR8, C1-3 alkanedi-yl-O-C1-3 alkanedi-yl-O-C1-3 alkanedi-yl, C1-5 alkyl-NHCOR13, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; with the condition that, when R2 is C(O)NR15R15, R15 can form a ring in which the ring contains the N of NR15R15 and optionally an additional heteroatom selected from O and N, wherein, if the additional heteroatom is N, it is optionally replaced by R8; Petition 870260058863, dated 06 / 17 / 2026, pp. 550 / 843 122 / 404 [000787] R3e R7 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; or C1-3 aryl or heteroaryl-substituted alkyl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; [000788] R4 is selected from C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000789] R5 is selected from C1-7 alkyl, OR8, or SR8; wherein the C1-7 alkyl, OR8, or SR8 of R5 may form a ring with any part of X; [000790] R6 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, all optionally halogen-substituted, OR8, NR8R11; C1-3 alkyl substituted with C(O)NR8R11; or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally halogen-substituted, C1-4 alkyl or C3-5 cycloalkyl; or is imidazolidinone; [000791] R8e R11 are each independently selected from H, C1-7 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, or C47 cycloalkenyl; [000792] X is selected from -O-C1-7 alkanedi-yl, -S-C1-7 alkanedi-yl, or C1-7 alkanedi-yl, and wherein -O-C1-7 alkanedi-yl, -S-C1-7 alkanedi-yl or C1-7 alkanedi-yl of X can form a ring with any part of R5; [000793] Y is NR10R12, wherein R10 and R12 can form a ring in which the ring contains the N of NR10R12 and optionally an additional heteroatom selected from O and N, wherein if the additional heteroatom is N, it is optionally replaced by R8; Petition 870260058863, dated 06 / 17 / 2026, pp. 551 / 843 123 / 404 [000794] R13 is C1-5 alkyl substituted by a bicyclic ring optionally containing at least one heteroatom and a carbonyl group; [000795] R14 is selected from H, C1-7 alkyl, C2-7 alkenyl, C27 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, or C1-3 alkyl substituted with aryl or heteroaryl, wherein the aryl or heteroaryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; and [000796] each R15 is independently selected from H, C17 alkyl, C2-7 alkenyl, C2-7 alkynyl, C3-7 cycloalkyl, C4-7 cycloalkenyl, OR8, or C1-3 alkyl-OR8. [000797] In some embodiments, the compound is a compound of Formula (I) or Formula (Ia), where: [000798] R1 is selected from C3-7 alkyl, C3-7 cycloalkyl, or C1-3 alkyl substituted by aryl or heteroaryl; [000799] R2 is selected from H, C(O)R14, C1-7 alkyl, C3-7 cycloalkyl, C1-5 alkyl-OR8; C1-5 alkyl-NHCOR13 where R13 is pentylamino-5-oxopentyl-7-thia-2,4-diazabicyclo[3.3.0]octan-3-one; or C1-3 alkyl substituted with aryl, wherein the aryl is optionally substituted with halogen, C1-4 alkyl or C3-5 cycloalkyl; [000800] R3e R7são H; [000801] R4 is selected from C3-7 alkyl, C3-7 cycloalkyl, C1-alkyl substituted by aryl or heteroaryl; [000802] R5 is OR8, and OR8 of R5 can form a ring with any part of X; [000803] R6é H; [000804] R8 and R11 are C1. 7 alkyl; [000805] X is -O-C1-7 alkanedi-yl and where -O-C1-7 alkanedi-yl of X can form a ring with any part of R5; and [000806] Y is NR10R12, where R10 and R12 can form a ring in which the ring contains the N of NR10R12 and optionally a heteroatom Petition 870260058863, dated 06 / 17 / 2026, pp. 552 / 843 124 / 404 additional selected from O and N, where if the additional heteroatom is N, it is optionally replaced by R8. [000807] Some preferred embodiments of the present application relate to compounds having one of the following structures or being one of the following compounds, pharmaceutically acceptable salts, hydrates, solvates or stereoisomers thereof: Petition 870260058863, dated 06 / 17 / 2026, pp. 553 / 843 125 / 404 Petition 870260058863, dated 06 / 17 / 2026, pp. 554 / 843 126 / 404 HN^γ0 0 k ,ν. AJ ; O j? v AA AAAA^n7 ' ' K HN-k^00 1 ,Ν. A \ YNY iAg γ / a-yyyy \ \ HN'^γ0 0 ( ^Ag xA AA AY^ν 1 \ HN^γ0 0 AAg \ > L .o. Y Ax HN^Y 0 k / N. A x-a J ; η rv ^A aAaA-ν7 HN^γ00 k ^N, AJ YnlY ι a γ / AAA^ν 1 \ I 7—z ---\ 2 Vv / --\.....1 O / >° Ao HN γ Ο YNYk-A ο j γ AA0 / Υ / 0 HN γ 0 ^ΝΑθγχ Λ / -0 HN Y 0 AY YA -° / ν4° 0 k A A Ζα ΥY A AA ΥAan 1 \ Â jÓ aa*° ο k A Y ΑνA a AA AYaY^ν 1 \ Y / O HN Y 0 Y Ά ^'A 1 i HN^γ° O An^ν^ YY^^^^^^ A ^o HN γ 0 YA^ γ Αγγ^χ ΑΑ'-ρ HN^γ° 0 k / N. AAAYA^ aYa^n7 Λ / 0 HN γ 0 ΑνАνυ ΑΑ αΥαν7τ κ X ,ο —Α Α γ· ο V k Α-. Jk YnlY a ΑΑ YaAA^n 1 \ Λ .O HN y 0 L^N'k HN^γ0ο L ^,ν A ; αΙ υ \γ Α / ΑΑΑ^ν 1 \ Α\ / 0 HN γ 0 ΑλΥ 1 H HN^γY 0 ΑΑγ , \|Y YaYaaYY HN^Υ° 0 Α Α Υ Α / ΚΑ^ν 1 \ Ν·^γ° 0 k^NA^N^A ο Α|Α AyAA^-'-'A / A. A / 0 HN γ Ο ΑΑ \Υ k / k^AAA 1 1 H AN HN'^γ® 0 0 \|A AaAaYqA^ / wk^0 0 AA ] í 1 °\Aa Petition 870260058863, de 17 / 06 / 2026, pág. 555 / 843 127 / 404 [000808] Some preferred embodiments of the present application relate to compounds having one of the following structures or being one of the following compounds, pharmaceutically acceptable salts, hydrates, solvates or stereoisomers thereof: Λ ,0 HN o 1 i HN'^^° O YsYa JL / 0 HN Y 0 y My f I ,—z .F \_z \ ΗΝ^φ3 O i KL ,n. A / O FT 1 \ HN^M° o HN^Y° OL ,NA = mL ΤΛ 1 \ ΗΝ^γ° OLA 1 H Λ / 0 HN YO Yzd °T / %, F\ y ΗΝ'^γθ O o 'Ύ' \^Y,YXn--MM\ HN^^° O 1 Th ΗΝ^γ° 0 ^''^V^'nY 0 I TTxMqA, / ΗΝ'^γ0 0 \γ ] 1 1 °χ^\χΝ\ HN^0 O ny Yr ί y 1 mmT e «,1^° 0 Mb o 1 °\zVN^ [000809] Some embodiments of the present application relate to compounds having one of the following structures or being one of the Petition 870260058863, dated 06 / 17 / 2026, pp. 556 / 843 128 / 404 The following compounds, pharmaceutically acceptable salts, hydrates, solvates or stereoisomers thereof: Petition 870260058863, dated 06 / 17 / 2026, pp. 557 / 843 129 / 404 pharmaceutically acceptable refers to salts of the compounds formed by the process of the present application that are, within the scope of a proper medical judgment, suitable for use in contact with human and lower animal tissues without undue toxicity, irritation, allergic response and the like, and are proportionate to a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, SM Berge, et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). The salts may be prepared in situ, during the final isolation and purification of the compounds of the applications, or separately by reaction of the free base or acid function with a suitable acid or base. [000811] Examples of acceptable salts Pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts: salts formed with inorganic acids, such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or with organic acids, such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid.Other pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, Propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts and similar substances. Alkali metal salts. Petition 870260058863, dated 06 / 17 / 2026, pp. 558 / 843 Representative alkaline earth metals (130 / 404) include sodium, lithium, potassium, calcium, magnesium, and similar elements. Other pharmaceutically acceptable salts include, when appropriate, non-toxic ammonium compounds, quaternary ammonium compounds, and amine cations formed using counter-ions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl compounds having 1 to 6 carbon atoms, sulfonate, and aryl sulfonate. [000812] As used in this document, the term pharmaceutically acceptable ester refers to esters of compounds formed by the process of the present application that hydrolyze in vivo and include those that readily decompose in the human body to leave the parent compound or a salt thereof. Suitable ester groups include, for example, those derived from pharmaceutically acceptable aliphatic carboxylic acids, particularly alkanoic, alkenoic, cycloalkananoic and alkanedioic acids, in which each alkyl or alkenyl moiety advantageously has no more than 6 carbon atoms. Examples of particular esters include, but are not limited to, formates, acetates, propionates, butyrates, acrylates and ethylsuccinates. [000813] The term pharmaceutically acceptable prodrugs, as used herein, refers to prodrugs of the compounds formed by the process of the present application that are, within the scope of a reasonable medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, proportionate to a reasonable benefit / risk ratio and effective for the intended use, as well as the zwitterionic forms, where possible, of the compounds of the present application. Prodrug, as used herein, means a compound that is convertible in vivo by metabolic means (e.g., by hydrolysis) to provide any compound outlined by the Formulas of the present application. Petition 870260058863, dated 06 / 17 / 2026, pp. 559 / 843 131 / 404 request. Several forms of prodrugs are known in the art, for example, as discussed in Bundgaard, (ed.), Design of Prodrugs, Elsevier (1985); Widder et al., (ed.), Methods in Enzymology, vol. 4, Academic Press (1985); Krogsgaard-Larsen, et al., (Ed). Design and Application of Prodrugs, Textbook of Drug Design and Development, Chapter 5, 113-191 (1991); Bundgaard, et al., Journal of Drug Delivery Reviews, 8: 1-38 (1992); Bundgaard, J. of Pharmaceutical Sciences, 77: 285 et seq. (1988); Higuchi and Stella (eds.) Prodrugs as Novel Drug Delivery Systems, American Chemical Society (1975); and Bernard Testa & Joachim Mayer, Hydrolysis In Drug And Prodrug Metabolism: Chemistry, Biochemistry And Enzymology, John Wiley and Sons, Ltd. (2002). [000814] This application also covers pharmaceutical compositions and methods of treating disorders by administering pharmaceutically acceptable prodrugs of the compounds of the application. For example, compounds of the application having free amino, amide, hydroxy or carboxylic groups can be converted into prodrugs. Prodrugs include compounds in which an amino acid residue or a polypeptide chain of two or more (e.g., two, three or four) amino acid residues is covalently linked by means of an amide or ester bond to a free amino, hydroxy or carboxylic acid group of compounds of the application. Amino acid residues include, but are not limited to, the 20 naturally occurring amino acids, commonly designated by three-letter symbols, and also include 4-hydroxyproline, hydroxylysine, demosine, isodemosine, 3-methylhistidine, norvaline, beta-alanine, gamma-aminobutyric acid, citrulline, homocysteine, homoserine, ornithine, and methionine sulfone.Additional types of prodrugs are also included. For example, free carboxyl groups can be derivatized as amides or alkyl esters. Free hydroxyl groups can also be derivatized. Petition 870260058863, dated 06 / 17 / 2026, pp. 560 / 843 132 / 404 using groups including, but not limited to, hemisuccinates, phosphate esters, dimethylaminoacetates, and phosphoryloxymethyloxy carbonyls, as described in Advanced Drug Delivery Reviews, 1996, 19, 115. Carbamate prodrugs of amino and hydroxy groups are also included, as are carbonate prodrugs, sulfonate esters, and sulfate esters of hydroxy groups. Derivatization of hydroxy groups as (acyloxy)methyl and (acyloxy)ethyl ethers, wherein the acyl group may be an alkyl ester optionally substituted by groups including, but not limited to, ether, amine, and carboxylic acid functionalities, or wherein the acyl group is an amino acid ester as described above, is also covered. Prodrugs of this type are described in J. Med. Chem. 1996, 39, 10. Free amines can also be derivatized as amides, sulfonamides, or phosphonamides.All of these prodrug fractions may incorporate groups including, but not limited to, ether, amine, and carboxylic acid functionalities. [000815] The application also provides a pharmaceutical composition comprising a therapeutically effective amount of a compound of the application, or a pharmaceutically acceptable enantiomer, diastereomer, stereoisomer or salt thereof and a pharmaceutically acceptable carrier. [000816] In another aspect, the application provides a method for synthesizing a compound disclosed in this document. [000817] The synthesis of the compounds in the application can be found in this document and in the Examples below. [000818] Other embodiments are a method of producing a compound of any of the Formulas used in this document, using any one or combination of reactions outlined herein. The method may include the use of one or more chemical intermediates or reagents outlined herein. Petition 870260058863, dated 06 / 17 / 2026, pp. 561 / 843 133 / 404 [000819] Another aspect is an isotopically labeled compound of any of the Formulas outlined here. Such compounds have one or more isotope atoms that may or may not be radioactive (e.g., 3H, 2H, 14C, 13C, 18F, 35S, 32P, 125I, and 131I) introduced into the compound. Such compounds are useful for studies and diagnoses of drug metabolism, as well as for therapeutic applications. [000820] A compound of the application may be prepared as a pharmaceutically acceptable acid addition salt by reacting the free base form of the compound with a pharmaceutically acceptable inorganic or organic acid. Alternatively, a pharmaceutically acceptable base addition salt of a compound of the application may be prepared by reacting the free acid form of the compound with a pharmaceutically acceptable inorganic or organic base. [000821] Alternatively, salt forms of the compounds in question may be prepared using salts of the starting or intermediate materials. [000822] The free acid or free base forms of the compounds of the application can be prepared from the corresponding base addition salt or acid addition salt forms, respectively. For example, a compound of the application in the form of an acid addition salt can be converted to the corresponding free base by treatment with a suitable base (e.g., ammonium hydroxide solution, sodium hydroxide, and the like). A compound of the application in the form of a base addition salt can be converted to the corresponding free acid by treatment with a suitable acid (e.g., hydrochloric acid, etc.). [000823] The compounds of the present invention can be used in the form of pharmaceutically acceptable salts derived from inorganic or organic acids. By pharmaceutically acceptable salt is meant those salts which are, within the scope of a judgment Petition 870260058863, dated 06 / 17 / 2026, pp. 562 / 843 134 / 404 suitable medical compounds, suitable for use in contact with human and lower animal tissues, without toxicity, irritation, allergic reaction and the like, and which are proportionate to a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. The salts can be prepared in situ during the final isolation and purification of the compounds of the invention or separately by reaction of a free base function with a suitable acid. [000824] Representative acid addition salts include, but are not limited to, trifluoroacetic acid (TFA), formate, acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorated, camphorsulfonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, fumarate, hydrochloride, hydrobromide, iodide, 2-hydroxyethanesulfonate (isethionate), lactate, maleate, methanesulfonate, nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, phosphate, glutamate, bicarbonate, ptoluenesulfonate and undecanoate.Furthermore, basic nitrogen-containing groups can be quaternized with agents such as lower alkyl halides, such as methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dialkyl sulfates such as dimethyl, diethyl, dibutyl, and diamyl sulfates; long-chain halides such as decyl, lauryl, myristyl, and stearyl chlorides, bromides, and iodides; arylalkyl halides such as benzyl and phenethyl bromides, and others. Water-soluble or oil-dispersible products are thus obtained. Examples of acids that can be used to form pharmaceutically acceptable acid addition salts include inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid, and organic acids such as oxalic acid, maleic acid, succinic acid, and citric acid. Petition 870260058863, dated 06 / 17 / 2026, pp. 563 / 843 135 / 404 [000825] Basic addition salts can be prepared in situ during the final isolation and purification of the compounds of this invention by reacting a fraction containing carboxylic acid with a suitable base, such as hydroxide, carbonate or bicarbonate of a pharmaceutically acceptable metal cation, or with ammonia or primary, secondary or tertiary organic amine. Pharmaceutically acceptable basic addition salts include, but are not limited to, alkali metal or alkaline earth metal-based cations, such as lithium, sodium, potassium, calcium, magnesium and aluminum salts and the like, and non-toxic quaternary ammonium and amine cations, including ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine and the like. Other representative organic amines useful for the formation of basic addition salts include ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine and the like. [000826] Prodrugs of the compounds in the application can be prepared by methods known to those skilled in the art (e.g., for more details, see Saulnier et al., (1994), Bioorganic and Medicinal Chemistry Letters, Vol. 4, p. 1985). For example, suitable prodrugs can be prepared by reacting a non-derived compound of the application with a suitable carbamylation agent (e.g., 1,1-acyloxyalkylcarbanochloride, paranitrophenyl carbonate or the like). [000827] Protected derivatives of the compounds in the application may be made by means known to those skilled in the art. A detailed description of the techniques applicable to the creation of protecting groups and their removal includes, but is not limited to, those illustrated in T.W. Greene, Protecting Groups in Organic Chemistry, 3rd edition, John Wiley and Sons, Inc., 1999. [000828] The compounds of this application may be Petition 870260058863, dated 06 / 17 / 2026, pp. 564 / 843 136 / 404 conveniently prepared or formed during the application process, such as solvates (e.g., hydrates). The hydrates of the compounds of the present application can be conveniently prepared by recrystallization from a mixture of aqueous / organic solvents, using organic solvents such as dioxin, tetrahydrofuran or methanol. [000829] The acids and bases useful in the methods described in this document are known in the art. Acid catalysts are any acidic chemical, which may be inorganic (e.g., hydrochloric, sulfuric, nitric acids, aluminum trichloride) or organic (e.g., camphorsulfonic acid, p-toluenesulfonic acid, acetic acid, ytterbium triflate) in nature. Acids are useful in catalytic or stoichiometric amounts to facilitate chemical reactions. Bases are any basic chemical, which may be inorganic (e.g., sodium bicarbonate, potassium hydroxide) or organic (e.g., triethylamine, pyridine) in nature. Bases are useful in catalytic or stoichiometric amounts to facilitate chemical reactions. [000830] The combinations of substituents and variables provided for in this application are only those that result in the formation of stable compounds. The term stable, as used herein, refers to compounds that possess sufficient stability to permit manufacture and that maintain the integrity of the compound for a period of time sufficient to be useful for the purposes detailed herein (e.g., therapeutic or prophylactic administration to a patient). [000831] When any variable (for example, R14) occurs more than once in any constituent or formula of a compound, its definition in each occurrence is independent of its definition in any other occurrence. Thus, for example, if a group is Petition 870260058863, dated 06 / 17 / 2026, pp. 565 / 843 137 / 404 shown to be replaced by one or more fractions of R14, so R14 in each occurrence is selected independently of the definition of R14. Furthermore, combinations of substituents and / or variables are allowed, but only if these combinations result in stable compounds within the normal valence of a designated atom. [000832] In addition, some of the compounds in this application have one or more double bonds or one or more asymmetric centers. Such compounds may occur as racemates, racemic mixtures, single enantiomers, individual diastereomers, diastereomeric mixtures, and cis or trans or E- or Z- double isomeric forms, and other stereoisomeric forms that may be defined in terms of absolute stereochemistry, such as (R)- or (S)- or as (D)- or (L)- for amino acids.When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry or even E or Z isomerism through multiple bonds and / or rings, and unless otherwise specified, the compounds are intended to include geometric E and Z isomers. The configuration of any carbon-carbon double bond appearing herein is selected for convenience only and is not intended to designate a specific configuration unless the text states otherwise; therefore, a carbon-carbon double bond arbitrarily described herein as trans may be cis, trans, or a mixture of the two in any proportion. All such isomeric forms of such compounds are expressly included in this application. [000833] Optical isomers can be prepared from their respective optically active precursors by the procedures described in this document or by resolving racemic mixtures. Resolution can be carried out in the presence of a resolving agent, by chromatography or by repeated crystallization or by some combination of these techniques known to those skilled in the art. Petition 870260058863, dated 06 / 17 / 2026, pp. 566 / 843 138 / 404 subject. Additional details on resolutions can be found in Jacques, et al., Enantiomers, Racemates and Resolutions (John Wiley & Sons, 1981). [000834] Isomerism means compounds that have identical molecular formulas but differ in the bonding sequence of their atoms or in the spatial arrangement of their atoms. Isomers that differ in the spatial arrangement of their atoms are called stereoisomers. Stereoisomers that are not mirror images of each other are called diastereomers, and stereoisomers that are non-superimposable mirror images of each other are called enantiomers or sometimes optical isomers. A mixture containing equal amounts of individual enantiomeric forms of opposite chirality is called a racemic mixture. [000835] A carbon atom bonded to four non-identical substituents is called a chiral center. [000836] A chiral isomer means a compound with at least one chiral center. Compounds with more than one chiral center can exist as an individual diastereomer or as a mixture of diastereomers, called a diastereomeric mixture. When a chiral center is present, a stereoisomer can be distinguished by the absolute configuration (R or S) of that chiral center. Absolute configuration refers to the spatial arrangement of the substituents attached to the chiral center. The substituents attached to the chiral center under consideration are classified according to the Cahn, Ingold, and Prelog Sequence Rule. (Cahn et al, Angew. 81; Cahn, J. Chem. 1964, 41, 116). [000837] Geometric isomer means diastereomers that Petition 870260058863, dated 06 / 17 / 2026, pp. 567 / 843 139 / 404 owe their existence to hindered rotation around double bonds and / or other rigid structures, such as a ring or polycyclic system. These configurations are differentiated in their names by the prefixes cis and trans, or Z and E, which indicate whether the groups are on the same side or opposite side of the double bond and / or other rigid structures, such as a ring or a polycyclic system in the molecule according to the Cahn, Ingold and Prelog rules. [000838] Furthermore, the structures and other compounds discussed in this application include all atropic isomers thereof. Atrophic isomers are a type of stereoisomer in which the atoms of two isomers are arranged differently in space. Atropic isomers owe their existence to restricted rotation caused by the hindrance of rotation of large groups around a central bond. Such atropic isomers normally exist as a mixture; however, as a result of recent advances in chromatography techniques, it has been possible to separate mixtures of two atropic isomers in selected cases. [000839] A tautomer is one of two or more structural isomers that exist in equilibrium and is readily converted from one isomeric form to another. This conversion results in the formal migration of a hydrogen atom accompanied by an exchange of adjacent conjugated double bonds. Tautomers exist as a mixture of a tautomeric set in solution. In solid form, usually one tautomer predominates. In solutions where tautomerization is possible, a chemical equilibrium of the tautomers will be achieved. The exact proportion of tautomers depends on several factors, including temperature, solvent, and pH. The concept of tautomers that are interconvertible by tautomerizations is called tautomerism. [000840] Of the various types of tautomerism that are possible, two are commonly observed. In keto-enol tautomerism, a Petition 870260058863, dated 06 / 17 / 2026, pp. 568 / 843 140 / 404 simultaneous exchange of electrons and a hydrogen atom. Ring chain tautomerism arises as a result of the aldehyde group (-CHO) in a sugar chain molecule reacting with one of the hydroxyl groups (-OH) in the same molecule to obtain a cyclic (ring-shaped) form, as exhibited by glucose. Common tautomeric pairs are: ketone-enol, amide-nitrile, lactam-lactam, amide-imidic acid tautomerism in heterocyclic rings (e.g., in nucleobases such as guanine, thymine, and cytosine), amine-enamine, and enamine-enamine. The compounds in this application may also be represented in various tautomeric forms; in such cases, the application expressly includes all tautomeric forms of the compounds described herein (e.g., alkylation of a ring system may result in alkylation at multiple sites; the application expressly includes all such reaction products). [000841] In the present application, the structural formula of the compound represents a certain isomer for convenience in some cases, but the present application includes all isomers, such as geometric isomers, optical isomers based on asymmetric carbon, stereoisomers, tautomers and the like. In the present descriptive report, the structural formula of the compound represents a certain isomer for convenience in some cases, but the present application includes all isomers, such as geometric isomers, optical isomers based on asymmetric carbon, stereoisomers, tautomers and the like. [000842] The compounds of the present invention can exist as stereoisomers in which asymmetric or chiral centers are present. These compounds are designated by the symbols R or S, depending on the configuration of the substituents around the chiral carbon atom. The present invention contemplates several stereoisomers and mixtures thereof. Stereoisomers include enantiomers and Petition 870260058863, dated 06 / 17 / 2026, pp. 569 / 843 141 / 404 Diastereomers and mixtures of enantiomers or diastereomers. The individual stereoisomers of the compounds of the present invention can be prepared synthetically from commercially available starting materials containing asymmetric or chiral centers or by preparing racemic mixtures followed by a resolution well known to those skilled in the art. These resolution methods are exemplified by (1) linking a mixture of enantiomers to a chiral auxiliary, separating the resulting mixture of diastereomers by recrystallization or chromatography and releasing the optically pure product from the auxiliary, (2) salt formation using an optically active resolving agent, or (3) direct separation of the mixture of optical enantiomers on chiral chromatography columns. [000843] Geometric isomers may also exist in the compounds of the present invention. The present invention contemplates the various geometric isomers and mixtures thereof resulting from the arrangement of substituents around a carbon-carbon double bond or the arrangement of substituents around a carbocyclic or heterocyclic ring. [000844] The compounds of the present invention can also exist as racemates, which are given the descriptor rac. The term racemate, as used herein, means an equimolar mixture of a pair of enantiomers. A racemate is generally formed when the synthesis results in the generation of a stereocenter. As used herein, the term racemic mixture means racemate. The compounds of the present invention can also exist as meso diastereomeric forms, which are given the descriptor rel. The term meso diastereomeric form, as used herein, means achiral forms with a pseudostereogenic C atom, which are given the descriptor Ύ' or s, respectively. Petition 870260058863, dated 06 / 17 / 2026, pp. 570 / 843 142 / 404 [000845] Additionally, the compounds of the present application, for example, the salts of the compounds, may exist in hydrated or non-hydrated (anhydrous) form or as solvates with other solvent molecules. Non-limiting examples of hydrates include monohydrates, dihydrates, etc. Non-limiting examples of solvates include ethanol solvates, acetone solvates, etc. [000846] Solvate means solvent addition forms that contain stoichiometric or non-stoichiometric amounts of solvent. Some compounds have a tendency to retain a fixed molar ratio of solvent molecules in the crystalline solid state, thus forming a solvate. If the solvent is water, the solvate formed is a hydrate; and if the solvent is alcohol, the solvate formed is an alcoholate. Hydrates are formed by the combination of one or more water molecules with a molecule of the substance in which water retains its molecular state as H2O. [000847] It should be appreciated that the solvates and hydrates of the compound according to Formula (I) or Formula (Ia) are also within the scope of this application. The solvation methods are generally known in the art. [000848] A further embodiment of the present invention may also include compounds that are identical to the compounds of Formula (I) or Formula (Ia), except that one or more atoms are replaced by an atom having an atomic mass number or mass different from the atomic mass number or mass generally found in nature, for example, compounds enriched in 2H(D), 3H, 13C, 127I, etc. These isotopic analogues and their salts and pharmaceutical formulations are considered useful agents in therapy and / or diagnosis, for example, but not limited to, where a fine adjustment of the in vivo half-life time may lead to an optimized dosage regimen. [000849] The synthesized compounds can be separated from Petition 870260058863, dated 06 / 17 / 2026, pp. 571 / 843 143 / 404 a reaction mixture and subsequently purified by a method such as column chromatography, high-performance liquid chromatography or recrystallization. As can be appreciated by those skilled in the art, additional methods of synthesizing the compounds of the Formulas contained in this document will be apparent to those skilled in the art. Furthermore, the various synthetic steps can be carried out in an alternative sequence or order to obtain the desired compounds. In addition, the solvents, temperatures, reaction durations, etc., outlined in this document are for illustrative purposes only, and those skilled in the art will recognize that varying the reaction conditions can produce the desired bridge macrocyclic products of this application.The synthetic chemical transformations and protecting group methodologies (protection and deprotection) useful in the synthesis of the compounds described in this document are known in the art and include, for example, those such as those described in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); TW Greene and PGM Wuts, Protective Groups in Organic Synthesis, 2nd ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995) and subsequent editions thereof. [000850] The compounds in this application may be modified by adding various functionalities through any synthetic means outlined herein to enhance selective biological properties. Such modifications are known in the art and include those that increase biological penetration into a given biological system (e.g., blood, lymphatic system, central nervous system), increase oral bioavailability, increase solubility to allow administration by injection, alter the Petition 870260058863, dated 06 / 17 / 2026, pp. 572 / 843 144 / 404 metabolism and alter the rate of excretion. [000851] The compounds in this application are defined herein by their chemical structures and / or chemical names. When a compound is referred to by a chemical structure and a chemical name, and the chemical structure and the chemical name conflict, the chemical structure determines the identity of the compound. [000852] The recitation of a list of chemical groups in any definition of a variable in this document includes definitions of that variable as any single group or combination of groups listed. The recitation of an embodiment for a variable included in this document includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof. METHODS OF SYNTHESIZING THE COMPOUNDS [000853] The compounds of the invention can be prepared by the exemplary processes described in the following reaction schemes or by the processes described in the examples below. Exemplary reagents and procedures for these reactions appear below. Starting materials can be purchased or readily prepared by a person skilled in the art. [000854] The compounds of the present application can be prepared in various ways using commercially available starting materials, compounds known from the literature, or from readily prepared intermediates, employing standard synthetic methods and procedures known to those skilled in the art or which will be evident to those skilled in the art in the art from the teachings contained in this document. Standard synthetic methods and procedures for the preparation of organic molecules and transformations and manipulations of functional groups can be obtained from the relevant scientific literature or textbooks. Petition 870260058863, dated 06 / 17 / 2026, pp. 573 / 843 145 / 404 standard in the field. While not limited to any one or several sources, classic texts such as Smith, MB, March, J., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5th edition, John Wiley & Sons: New York, 2001; and Greene, TW, Wuts, PGM, Protective Groups in Organic Synthesis, 3rd edition, John Wiley & Sons: New York, 1999, incorporated herein by reference, are useful and recognized reference books on organic synthesis known to those skilled in the art. The following descriptions of synthetic methods are designed to illustrate, but not to limit, general procedures for the preparation of compounds of the present application. The processes generally provide the desired final compound at or near the end of the overall process, although it may be desirable in certain cases to further convert the compound into a pharmaceutically acceptable salt, ester, or prodrug thereof.The appropriate synthetic pathways are represented in the diagrams below. [000855] Those skilled in the art will recognize whether a stereocenter exists in the compounds disclosed in this document. Therefore, the present application includes both possible stereoisomers (unless specified in the synthesis) and includes not only racemic compounds but also individual enantiomers and / or diastereomers. When a compound is desired as a single enantiomer or diastereomer, it can be obtained by stereospecific synthesis or by resolution of the final product or any convenient intermediate. The resolution of the final product, an intermediate, or a starting material can be affected by any suitable method known in the art. See, for example, Stereochemistry of Organic Compounds, by EL Eliel, SH Wilen, and LN Mander (Wiley-Interscience, 1994). [000856] The compounds of the present application can be prepared in a number of ways well known to those skilled in the art. Petition 870260058863, dated 06 / 17 / 2026, pp. 574 / 843 146 / 404 organic synthesis. By way of example, the compounds of the present application can be synthesized using the methods described below, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereof as deemed appropriate by those skilled in the art. Preferred methods include, but are not limited to, the methods described below. [000857] The compounds of the present application can be synthesized following the steps described in General Scheme 1 (Method A), General Scheme 2 (Method B1 and Method B2) and General Scheme 3 (Method C) which comprise different sequences of assembly intermediates. The starting materials are commercially available or are produced by procedures known in the literature reported or as illustrated. GENERAL REGIME 1 (METHOD A) Method A [000858] Method A: Using I where P is a suitable protecting group, such as tBoc or nosyl, I and II are coupled using a dehydrating agent, such as DCC or HATU, in a suitable solvent, such as DMF or NMP. Compounds in which R2 is H are obtained by deprotection under standard conditions. Compounds in which R2 is C(O)R14, C(O)NR15R15 or C(O)OR15 are obtained by acylation of the secondary amine. Compounds in which R2 is not the one mentioned are obtained by reductive amination of the secondary amine with the appropriate aldehyde or ketone. Petition 870260058863, dated 06 / 17 / 2026, pp. 575 / 843 147 / 404 GENERAL SCHEME 2 (METHODS B1 AND B2) R1 R7IIIb [000859] Method B1: using the appropriate precursor Illa and lllb, III is prepared by amide coupling using a dehydrating agent, such as DCC or HATU, in a suitable solvent, such as DMF or NMP. [000860] Method B2: Z can be elaborated in the desired functional group using the reaction sequences described in Table X. In cases where the compound of the invention has R2 = H, the starting material of method B will have P as a protecting group, such as t-Boc or Nosil. The compounds of the invention are then obtained by deprotection under standard conditions. The compounds, in which R2 is C(O)R14, C(O)NR15R15 or C(O)OR15, are obtained by acylation of the secondary amine at this point. The compounds, in which R2 is not the one mentioned, are obtained by reductive amination of the secondary amine with the appropriate aldehyde or ketone. GENERAL REGIME 3 (METHOD C) Ib Method C [000861] Method C: I can be prepared by following the sequence Petition 870260058863, dated 06 / 17 / 2026, pp. 576 / 843 148 / 404 described in Method C. Using the appropriate Ia which has a protecting group P and Ib which has a short alkyl group R, the coupling is carried out using a dehydrating agent, such as DCC or HATU, in a suitable solvent, such as DMF or NMP. The resulting dipeptide ester is reacted with Ic. When P2 is Br, Ic is reacted in a suitable solvent, such as DMF or DMSO, in the presence of a base, such as potassium carbonate or cesium carbonate, to obtain a short-chain ester derivative of I. When P2 is a protected alcohol, such as OTHP or OTBDMS, the short-chain ester of I is obtained by first reacting Ic with the dipeptide ester in a suitable solvent, such as DMF or DMSO, in the presence of a base, such as potassium carbonate or cesium carbonate, followed by alcohol deprotection, followed by activation and coupling of the alcohol using methods such as the Mitsunobu reaction or mesylate formation and base-catalyzed cyclization.It is finally obtained by hydrolysis using a base, such as sodium hydroxide or potassium carbonate, in a suitable solvent, such as water or a mixture of water and THF. PHARMACEUTICAL COMPOSITIONS [000862] In a further aspect, the present invention provides a pharmaceutical composition comprising a compound of Formula (I) or Formula (Ia) according to the invention and a pharmaceutically acceptable diluent, excipient or vehicle. [000863] In one embodiment, the pharmaceutical composition also includes another active pharmaceutical agent. [000864] In one embodiment, the invention provides a pharmaceutical composition comprising a compound of Formula (I) or Formula (Ia) according to the invention and a pharmaceutically acceptable diluent, excipient or vehicle, wherein said compound of Formula (I) or Formula (Ia) is present in a therapeutically acceptable amount. Petition 870260058863, dated 06 / 17 / 2026, p. 577 / 843 149 / 404 effective. [000865] The term effective amount or therapeutically effective amount, as used in this document, refers to an amount capable of eliciting one or more of the following effects in a patient receiving the combination of the present invention: (i) inhibition or interruption of tumor growth, including reducing the rate of tumor growth or causing complete cessation of growth; (ii) reduction in the number of tumor cells; (iii) reduction in tumor size; (iv) reduction in the number of tumors; (v) inhibition of metastasis (i.e., reduction, slowing, or complete cessation) of tumor cell infiltration into peripheral organs; (vi) enhancement of the antitumor immune response, which may, but does not necessarily, result in tumor regression or elimination; (vii) relief, to some extent, of one or more symptoms associated with cancer; (viii) increased progression-free survival (PFS) and / or overall survival (OS) of the patient receiving the combination. [000866] The compounds of the present invention can, according to the invention, be administered in single or divided doses by oral, parenteral, inhalation, rectal or topical administration, including cutaneous, ophthalmic, mucosal, sublingual, buccal and intranasal routes of administration; furthermore, the compounds provided by the invention can be formulated for use in the treatment of leukocyte populations in vivo, ex vivo and in vitro. [000867] When the compounds of the present invention are to be administered, for example, orally, they can be administered as medicaments in the form of pharmaceutical compositions containing them in association with a pharmaceutically acceptable diluent, excipient, or carrier material. Thus, the present invention also provides a pharmaceutical composition comprising the compounds according to the invention as described above and one or more Petition 870260058863, dated 06 / 17 / 2026, pp. 578 / 843 150 / 404 Pharmaceutically acceptable diluent, excipient or vehicle. Pharmaceutical compositions may be prepared conventionally and the finished dosage forms may be solid dosage forms, for example, tablets, dragees, capsules and the like, or liquid dosage forms, for example, solutions, suspensions, emulsions and the like. Pharmaceutically acceptable diluent, excipient or vehicle includes sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such means and agents for pharmaceutically active substances is known in the art. [000868] In one embodiment, the invention provides a pharmaceutical composition comprising a compound of Formula (I) or Formula (Ia) according to the invention and at least one pharmaceutically acceptable diluent, excipient or vehicle, wherein the composition is a tablet or a capsule, preferably a tablet. [000869] The amount of compounds of the invention to be administered will vary depending on factors such as the specific compound, the disease condition and its severity, according to the particular circumstances surrounding the case, including, for example, the specific compound being administered, the route of administration, the condition to be treated, the target region to be treated and the patient or host to be treated. [000870] In another aspect, the application provides a pharmaceutical composition comprising a therapeutically effective amount of a compound of the present application or an enantiomer, diastereomer or stereoisomer thereof, or a pharmaceutically acceptable salt, hydrate, solvate or prodrug thereof, and a pharmaceutically acceptable carrier. [000871] The compounds in the application can be administered as pharmaceutical compositions by any conventional route, in Petition 870260058863, dated 06 / 17 / 2026, pp. 579 / 843 151 / 404 in particular, by enteric route, for example, orally, for example, in the form of tablets or capsules, or parenterally, for example, in the form of injectable solutions or suspensions, or topically, for example, in the form of lotions, gels, ointments or creams, or in nasal or suppository form. Pharmaceutical compositions comprising a compound of the present application in free form or in a pharmaceutically acceptable salt form in association with at least one pharmaceutically acceptable vehicle or diluent may be manufactured conventionally by methods of mixing, granulation or coating.For example, oral compositions may be tablets or gelatin capsules comprising the active ingredient together with a) diluents, for example, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine; b) lubricants, for example, silica, talc, stearic acid, its magnesium or calcium salt and / or polyethylene glycol; for tablets also c) binders, for example, aluminum and magnesium silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidone; if desired d) disintegrants, for example, starches, agar, alginic acid or its sodium salt or effervescent mixtures; and / or e) absorbents, colorants, flavorings and sweeteners. Injectable compositions may be aqueous isotonic solutions or suspensions, and suppositories may be prepared from fatty emulsions or suspensions.The compositions may be sterilized and / or contain adjuvants such as preservatives, stabilizers, humectants or emulsifiers, solution promoters, salts to regulate osmotic pressure and / or buffers. In addition, they may also contain other therapeutically valuable substances. Formulations suitable for transdermal applications include an effective amount of a compound of the present application with a vehicle. A vehicle may include pharmacologically absorbable solvents. Petition 870260058863, dated 06 / 17 / 2026, pp. 580 / 843 152 / 404 acceptable for assisting passage through the host skin. For example, transdermal devices are in the form of a dressing comprising a support element, a reservoir containing the compound optionally with vehicles, optionally a rate control barrier to release the compound to the host skin at a controlled and predetermined rate over a prolonged period of time, and means for securing the device to the skin. Transdermal matrix formulations may also be used. Formulations suitable for topical application, for example, to the skin and eyes, are preferably aqueous solutions, ointments, creams, or gels well known in the art. These may contain solubilizers, stabilizers, tonicity-enhancing agents, buffers, and preservatives. [000872] The pharmaceutical compositions of the present application comprise a therapeutically effective amount of a compound of the present application formulated together with one or more pharmaceutically acceptable carriers. As used herein, the term pharmaceutically acceptable carrier means a non-toxic encapsulating material, diluent or formulation aid, inert solid, semi-solid or liquid filler, of any kind.Some examples of materials that can serve as pharmaceutically acceptable carriers include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid or potassium sorbate, partial mixtures of glycerides of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, polyacrylates, waxes, polyethylene-polyoxypropylene block polymers, wool grease. Petition 870260058863, dated 06 / 17 / 2026, pp. 581 / 843 153 / 404 Sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil; safflower oil; sesame oil; olive oil; corn oil and soybean oil; glycols, such as propylene glycol or polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline solution; Ringer's solution;Ethyl alcohol and phosphate buffer solutions, as well as other compatible non-toxic lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweeteners, flavorings and fragrance agents, preservatives and antioxidants may also be present in the composition, according to the formulator's judgment. [000873] The pharmaceutical compositions of this application can be administered to humans and other animals orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (as powders, ointments or drops), buccally or as an oral or nasal spray. [000874] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing and emulsifying agents, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed oil, Petition 870260058863, dated 06 / 17 / 2026, pp. 582 / 843 154 / 404 peanut, germ, olive, castor bean and sesame), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and sorbitan fatty acid esters and mixtures thereof. In addition to inert diluents, oral compositions may also include adjuvants such as humectants, emulsifying and suspending agents, sweeteners, flavorings and fragrance agents. [000875] Injectable preparations, for example, sterile aqueous or oily injectable suspensions, may be formulated according to known techniques using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension, or emulsion in a parenterally acceptable non-toxic diluent or solvent, for example, a solution in 1,3-butanediol. Acceptable vehicles and solvents that may be employed include water, Ringer's solution, USP, and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally employed as a solvent or suspension medium. For this purpose, any mild fixed oil may be employed, including synthetic mono- or diglycerides. Furthermore, fatty acids, such as oleic acid, are used in the preparation of injectables. [000876] To prolong the effect of a drug, it is often desirable to delay the absorption of the drug by subcutaneous or intramuscular injection. This can be achieved by using a liquid suspension of crystalline or amorphous material with low solubility in water. The rate of drug absorption then depends on its rate of dissolution, which in turn may depend on the crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form is achieved by dissolving or suspending the drug in an oil-based vehicle. [000877] Compositions for rectal or vaginal administration are Petition 870260058863, dated 06 / 17 / 2026, pp. 583 / 843 155 / 404 preferably suppositories which can be prepared by mixing the compounds of this application with suitable non-irritating excipients or vehicles, such as cocoa butter, polyethylene glycol or a suppository wax, which are solid at room temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound. [000878] Solid compositions of a similar type can also be used as filling agents in soft and hard gelatin capsules, using excipients such as lactose or milk sugar, as well as high molecular weight polyethylene glycols and the like. [000879] The active compounds may also be in microencapsulated form with one or more excipients, as noted above. Solid dosage forms of tablets, dragees, capsules, pills, and granules may be prepared with coatings and shells, such as enteric coatings, release-control coatings, and other coatings well known in the pharmaceutical formulation art. In such solid dosage forms, the active compound may be mixed with at least one inert diluent, such as sucrose, lactose, or starch. Such dosage forms may also comprise, as is common practice, additional substances that are not inert diluents, for example, tablet lubricants and other tablet aids, such as magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents. [000880] Dosage forms for topical or transdermal administration of a compound of this application include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches. The active component is mixed under sterile conditions with a pharmaceutically acceptable vehicle and with any preservative or buffer. Petition 870260058863, dated 06 / 17 / 2026, pp. 584 / 843 156 / 404 required, as requested. Ophthalmic formulations, eye drops, eye ointments, powders and solutions are also contemplated as being within the scope of this request. [000881] Ointments, pastes, creams and gels may contain, in addition to an active compound of this application, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide or mixtures thereof. [000882] Powders and sprays may contain, in addition to the compounds of this application, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder or mixtures of these substances. Sprays may additionally contain common propellants such as chlorofluorohydrocarbons. [000883] Transdermal patches have the added advantage of providing controlled release of a compound to the body. Such dosage forms can be made by dissolving or dispensing the compound in the appropriate medium. Absorption enhancers can also be used to increase the flow of the compound through the skin. The rate can be controlled by providing a rate-control membrane or by dispersing the compound in a polymeric matrix or gel. [000884] The compounds and compositions of the application may be administered in therapeutically effective amounts in combination therapy with one or more therapeutic agents (pharmaceutical combinations) or modalities, for example, an antiproliferative, anticancer, immunomodulatory or anti-inflammatory agent. Where the compounds of the application are administered in conjunction with other therapies, the dosages of the co-administered compounds will, of course, vary depending on the type of co-drug employed, the specific drug employed, the condition being treated, and so forth. The compounds and compositions of the application may be administered in Petition 870260058863, dated 06 / 17 / 2026, pp. 585 / 843 157 / 404 therapeutically effective amounts in a combination therapy with one or more therapeutic agents (pharmaceutical combinations) or modalities, for example, antiproliferative, anticancer, immunomodulatory or anti-inflammatory agent and / or non-drug therapies, etc. For example, synergistic effects may occur with antiproliferative, anticancer, immunomodulatory or anti-inflammatory substances. Where the compounds in question are administered in conjunction with other therapies, the dosages of the co-administered compounds will, of course, vary depending on the type of co-drug employed, the specific drug employed, the condition being treated and so forth. [000885] Combination therapy includes the administration of the compounds in question in additional combination with one or more other biologically active ingredients.For example, the compounds in the application may be used in combination with other pharmaceutically active compounds, preferably compounds that are able to enhance the effect of the compounds in the application. The compounds in the application may be administered simultaneously (as a single preparation or separate preparation), in close temporal proximity, or sequentially to another drug therapy or treatment modality. In general, a combination therapy involves the administration of two or more drugs during a single cycle or course of therapy. [000886] In another aspect of the application, the compounds may be administered in combination with one or more separate pharmaceutical agents, for example, a chemotherapeutic agent, an immunotherapeutic agent or an adjuvant therapeutic agent. TREATMENT METHODS [000887] The compounds according to the invention, as described above, have preventive and therapeutic utility in human and veterinary diseases. Petition 870260058863, dated 06 / 17 / 2026, pp. 586 / 843 158 / 404 [000888] Thus, in a further aspect, the present invention provides the use of the compounds, as described herein, and the use of the pharmaceutical composition, as described herein, for preventive and / or therapeutic purposes. [000889] In one embodiment of the present invention, the compounds according to the invention, as described herein, or the pharmaceutical composition, as described herein, can be used as a medicament, preferably for use in human medicine and / or veterinary medicine. Therefore, the present invention provides the compounds according to the invention, as described herein, or a pharmaceutical composition, as described herein, for use as a medicament. [000890] In another embodiment, the compounds according to the invention, as described herein, or the pharmaceutical composition, as described herein, may be used in a method for preventing or treating cancer in a patient. [000891] The use of the compounds according to the invention, as described herein, or the pharmaceutical composition, as described herein, for the manufacture of a medicament for the prevention or treatment of cancer in a patient is also provided. [000892] The use of the compounds according to the invention, as described herein, or the pharmaceutical composition, as described herein, for the prevention or treatment of cancer in a patient is also provided. [000893] A method is also provided for the prevention or treatment of cancer in a patient, comprising administering to said patient a therapeutically effective amount of the compounds according to the invention as described herein. Petition 870260058863, dated 06 / 17 / 2026, pp. 587 / 843 159 / 404 document, or the pharmaceutical composition, as described in this document. [000894] The terms treatment / treat, as used in this document, include: (1) delaying the appearance of clinical symptoms of the state, disorder or condition that develops in an animal, particularly a mammal and especially a human, who may be affected or predisposed to the state, disorder or condition, but who do not yet exhibit or show clinical or subclinical symptoms of the state, disorder or condition; (2) inhibiting the state, disorder or condition (e.g., halting, reducing or delaying the development of the disease, or a relapse thereof in the case of maintenance treatment, of at least one clinical or subclinical symptom); and / or (3) alleviating the condition (i.e., causing regression of the state, disorder or condition or at least one of its clinical or subclinical symptoms). The benefit to a patient being treated is statistically significant or at least perceptible to the patient or to the physician.However, it should be noted that when a medication is administered to a patient to treat an illness, the result may not always be an effective treatment. [000895] Preventive treatments comprise prophylactic treatments. In preventive applications, the pharmaceutical combination of the invention is administered to a patient suspected of having or being at risk of developing cancer. In therapeutic applications, the pharmaceutical combination is administered to a patient, such as a patient already suffering from cancer, in an amount sufficient to cure or at least partially interrupt the symptoms of the disease. The effective amounts for this use will depend on the severity and course of the disease, prior therapy, the patient's health status, the response to medications, and the judgment of the attending physician. [000896] In the event that the patient's condition does not improve, the Petition 870260058863, dated 06 / 17 / 2026, pp. 588 / 843 The pharmaceutical combination of the invention, 160 / 404, can be administered chronically, that is, for a prolonged period of time, including for the duration of the patient's life, in order to improve, control, or limit the symptoms of the patient's disease or condition. [000897] In the event that the patient's condition improves, the pharmaceutical combination may be administered continuously; alternatively, the dose of drug being administered may be temporarily reduced or temporarily suspended for a certain period of time (i.e., a drug holiday). After the patient's condition improves, a maintenance dose of the pharmaceutical combination of the invention is administered, if necessary. Subsequently, the dosage or frequency of administration, or both, is optionally reduced, depending on the symptoms, to a level at which the improved disease is maintained. [000898] When administered preventively, the compounds are given before the disease is established. Preventive administration of a compound of the present invention serves to prevent or attenuate the progression of the disease. Therapeutic administration of a compound of the present invention serves to attenuate the established disease. Thus, according to the invention, a compound of the present invention can be administered before the onset of the disease or during the course of the disease. [000899] In one embodiment of the invention, the compounds according to the invention, as described above, or the pharmaceutical composition, as described above, are provided for use in a method for the prevention or treatment of cancer in a patient. Preferably, the cancer is selected from the group consisting of head and neck cancers. P300 [000900] Dysregulation of the cellular transcription mechanism is a key feature of cancer. E1A-binding protein Petition 870260058863, dated 06 / 17 / 2026, pp. 589 / 843 161 / 404 (p300) and CREB-binding protein (CBP) are two closely related paralogous transcription coactivators involved in the expression of oncogenic drivers in cancer cells (Attar and Kurdistani in Cold Spring Harbor Perspectives in Medicine 7: a026534 (2017)). [000901] P300 / CBP interact through their conserved domains with hundreds of proteins; they can act synergistically or antagonistically; and modulate downstream biological processes in a highly context-dependent manner to promote apoptosis or cell proliferation (Bedford et al. in Epigenetics 5(1): 9 (2010); Goodman and Smolik in Genes & Development 14(13): 1553 (2000); Dancy and Cole in Chemical Reviews 115(6):2419 (2015)). These domains include the nuclear receptor interaction domain (RID), the cysteine / histidine CH1 (TAZ1) and CH3 (TAZ2) regions, the CREB and MYB interaction domain (KIX), Bromodomain, the plant homeodomain (PHD), the histone acetyltransferase and / or lysine acetyltransferase domain (KAT / HAT), the ZZ-type zinc finger domain (ZZ), and the interferon response binding domain (IBiD (NCBD)). [000902] The following examples (from Dancy and Cole in Chemical Reviews 115(6):2419 (2015)) demonstrate the context-dependent nature of p300 / CBP gene expression regulation. For example, Hottiger et al. (in EMBO Journal 17, 3124 (1998)) showed that HIV gene expression could be increased by tumor necrosis factor alpha through the binding of the NFkB RelA subunit to p300 / CBP-CH1, but was repressed through interferon alpha-mediated STAT2 binding to the same motif. In other studies, p300 / CBP mediated both the induction and repression of antioxidant response genes, through the binding of AP-1 to the C-terminal region, respectively by the binding of p53 to CH1 / CH3 and the binding of the glucocorticoid receptor to the NRID domain (Avantaggiati et al. in Petition 870260058863, dated 06 / 17 / 2026, pp. 590 / 843 162 / 404 Cell 89:1175 (1997); Kamei et al. in Cell 85:403 (1996)). The binding of p53 to p300 / CBP / CH3 and the consequent induction of p53-dependent genes result in cell cycle arrest (e.g., as a consequence of genotoxic insults), but apoptosis is induced when overexpressed E2F-1 (a central protein in cell cycle regulation that can also act through p53) is bound to p300 / CBP / CH3 (Goodman and Smolik in Genes & Development 14:1553 (2000); Lee et al. in Oncogene). 16:2695 (1998)). The cyclic AMP response is induced and repressed by p300 / CBP through the binding of CREB to the KIX domain, respectively, and the binding of S6 kinase pp90RSK to the CH3 domain (Nakajima et al. in Cell 86:465 (1996)). [000903] The modulation of relevant cancer pathways by p300 / CBP includes hormone-dependent androgen receptor signaling in prostate cancer (Culig in Journal of Cell Physiology 231 (2):270 (2016)); the HIF-1 alpha / VEGF pathway in hypoxia-dependent tumor growth (Masoud and Li in Acta Pharmacologica Sinica B 5(5):378 (2015)); and the interaction with the tumor suppressor p53 and HPV-E6 oncoprotein in HPV-positive carcinomas (Tornesello et al. in Cancers (Basel) 10(7)pii: E213 (2018)). [000904] P300 and CBP also play an important role in hematopoiesis and control processes, the disruption of which can lead to the development of leukemias and lymphomas (Blobel in Blood 95(3):745 (2000); Dutta et al. in Molecular Genetics and Metabolism 119(1-2):37 (2016)). [000905] Taken together, these studies highlight how p300 / CBP is indispensable for many cell signaling pathways and how p300 and CBP use their protein-protein interactions to determine how the cell responds to environmental stimuli. This makes CBP / p300 an ideal target for the development of new therapies. Petition 870260058863, dated 06 / 17 / 2026, pp. 591 / 843 163 / 404 against cancer (Di Martile et al. in Oncotarget 7(34):55789 (2016); Ali et al. in Chemical Reviews 118(3):1216 (2018)). [000906] However, the exploration of CBP / p300 protein-protein interactions for drug detection has proven difficult due to the highly disordered nature inherent in the protein structure (Wright and Dyson in Nature Reviews in Molecular and Cell Biology 16(1):18-29 (2015)). However, specific inhibitors have been developed against highly conserved and more ordered domains, such as the HAT / KAT catalytic site, KIX and bromodomain (Breen and Mapp in Current Opinion in Chemical Biology 45:195-203 (2018);Dancy and Cole in Chemical Reviews 115(6):2419-2452 (2015)). [000907] Without being tied to any particular theory, an extremely well-conserved p300 / CBP domain that may be a suitable drug target is the transcriptional adapter and CH1 / TAZ1 domain of zinc finger 1, as highlighted by several publications showing, for example, that the interaction between p300 / CBPCH1 / TAZ1 and HIF1-alpha, as well as the interaction between HPV-E6 / E7 and p300 / CBP-CH1 / TAZ1 in HPV-positive cervical and head and neck cancer can potentially be exploited for the development of anticancer therapies (Wuchano Yuan and Giordano in Oncogene 21:2253-2260(2002); Breen and Mapp in Current Opinion in Chemical Biology 45:195-203 (2018); Laos and colleagues in PNAS 111(21):7531 (2014); Kushal and colleagues in PNAS 110(39):15602 (2013); Masoud and Li in Acta Pharmacologica Sinica B 5(5):378 (2015); Burslem and colleagues in Chemical Science 8(6):4188 (2017);Fera et al. in Biochemistry 51(47):9524 (2012); Xie et al. in Oncogene 33(8):1037 (2014); Patel et al. in The EMBO Journal 18(18):5061 (1999); Bernat et al. in Oncogene 22(39):7871 (2003). [000908] In short, reprogramming the transcriptional profile of cells Petition 870260058863, dated 06 / 17 / 2026, pp. 592 / 843 164 / 404 carcinogens by modulating p300 / CBP activity - for example, targeting the CH1 / TAZ1 domain - represents a novel and widely applicable approach to cancer treatment. [000909] Without being tied to any particular theory, disclosure compounds can inhibit or modify p300 activity by inhibiting or modifying the activity of any p300 domain. For example, disclosure compounds can inhibit or modify the activity of the CH1 / TAZ1, CH2 / TAZ2, RID, KIX, KAT / HAT, PHD, Bromodomain, ZZ, or IBiD domains. Disclosure compounds can inhibit or modify the interaction of p300 with any of its protein interaction partners or combination of protein interaction partners, through CH1 / TAZ1, CH2 / TAZ2, RID, KIX, IBiD, or any other p300 protein-protein interaction domain. A non-exhaustive list of p300 interaction partners whose interaction with p300 may be affected by disclosure compounds includes the transcription coactivator BCL3 (BCL3), beta-catenin, breast cancer 1, early onset (BRCA1), caudal-type homeobox 2 (CDX2), enhancer-binding protein beta (CEBPB), and epsilon protein (CEBPE).CCAAT enhancer-binding protein (CEBPE), cbp / p300 interacting with Glu / Asp-rich c-terminal carboxy-terminal domain 1 transactivator (CITED1), cbp / p300 interacting with Glu / Asp-rich c-terminal carboxy-terminal domain 2 transactivator (CITED2), DEADbox helicase 5 (DDX5), deltex E3 ubiquitin ligase 1 (DTX1), EP300 differentiation interaction inhibitor 1 (EID1), ELK1, ETS transcription factor (ELK1), estrogen receptor 1 (ESR1), flap structure-specific endonuclease 1 (FEN1), G protein pathway suppressor 2 (GPS2), hypoxia-inducible factor 1 subunit (HIF1A), HNF1 homeobox A (HNF1A), heterogeneous nuclear ribonucleoprotein U (HNRPU), growth family member inhibitor 4 (ING4), growth family member inhibitor 5 (ING5), factor, Petition 870260058863, dated 06 / 17 / 2026, pp. 593 / 843 165 / 404 Interferon Regulator 2 (IRF2), Lymphoid Enhancer Binding Factor 1 (LEF1), MAF bZIP Transcription Factor (MAF), Enhancer-as-Transcriptional Coactivator 1 (MAML1), Myocyte Stimulating Factor 2C (MEF2C), Myocyte Stimulating Factor 2D (MEF2D), Myocyte Stimulating Factor 2D (MEF2D), MyoD-type 2 proto-oncogene (MYBL2), MDM2 proto-oncogene (Mdm2), Myogenic Differentiation Factor 1 (MyoD), Myocyte Enhancer Factor 2A (MEF2A), Nuclear Receptor Coactivator 6 (NCOA6), Nuclear Activated T-cell Factor 2 (NFATC2), Neuronal Protein PAS Domain 2 (NPAS2), Tumor Protein p53 (P53), Paired Box 6 (PAX6), Proliferating Cell Nuclear Antigen (PCNA), Homeobox Provoking 1 (PROX1), protosimosin alpha (PTMA), peroxisome proliferator-activated receptor (PPARA), peroxisome proliferator-activated receptor gamma (PPARG), RAR-related orphan receptor A (RORA), RELA proto-oncogene, NF-κB subunit (RELA), SMAD family member 1 (SMAD1),SMAD family member 2 (SMAD2), SMAD family member 7 (SMAD7), Smad nuclear interaction protein 1 (SNIP1), SS18, nBAF chromatin remodeling complex subunit (SS18), signal transducer and activator of transcription 3 (STAT3), signal transducer and activator of transcription 6 (STAT6), TAL bHLH transcription factor 1, erythroid differentiation factor (TAL1), transcription factor 3 (TCF3), AP-2 alpha transcription factor (TFAP2A), trimethylguanosine synthase 1 (TGS1), transcriptional regulatory factor 1 (TRERF1), tumor susceptibility 101 (TSG101), bHLH torsion family transcription factor 1 (TWIST1), YY1 transcription factor (YY1), and early growth response 1 (Zif-268). [000910] Without wishing to be bound to any particular theory, the inhibition or modification of the ability of p300 to interact with protein-protein interaction partners may inhibit or modify the ability of p300 or protein complexes comprising the Petition 870260058863, dated 06 / 17 / 2026, pp. 594 / 843 166 / 404 p300 from binding to DNA. For example, a disclosure compound may prevent p300 or a protein complex comprising p300 from binding to a target promoter, thereby preventing the transcription of a target gene. A disclosure compound may prevent p300 or a protein complex comprising p300 from binding to a subset of all target p300 promoters, thereby altering the transcriptional profile of a cell, for example, a cancer cell. Alternatively, or in addition, a disclosure compound may inhibit or modify the ability of p300 or the p300 protein complex to recruit one or more additional transcription factors, for example, transcription coactivators, to a promoter.Without limiting the possible pathways affected, a disclosure compound may alter the expression of genes involved in cell cycle progression, Wnt, Notch, and Hedgehog signaling, DNA damage response, apoptosis, antioxidant response, cyclic AMP response, hormone-dependent androgen receptor signaling, hypoxia-dependent tumor growth, hematopoiesis, or a combination thereof, thereby reducing proliferation or viability of cancer cells. For example, disclosure compounds may inhibit the interaction of p300 with CBP-HPVE6-p53, thereby rescuing p53 protein expression and acetylation and restoring the DNA damage response pathway in cervical cancer cells.Alternatively, or in addition, the disclosure compounds may inhibit the formation of the p300 / CBP-HIF1alpha protein complex and reduce the transcription of growth factors and pro-proliferation genes, such as Tumor Vascular Endothelial Growth Factor A (VEGF) in cancer cells. Alternatively, or in addition, the disclosure compounds may disrupt the p300-CH1 / TAZ1 (AR) androgen receptor in castration-resistant prostate cancers, inhibiting its expression. Petition 870260058863, dated 06 / 17 / 2026, pp. 595 / 843 167 / 404 target genes for RA. [000911] Without wishing to be bound to any particular theory, disclosure compounds may inhibit p300 activity in its regulation of oncogenic transcription factors that contribute to cancer progression. [000912] Without wishing to be bound to any particular theory, the disclosure compounds may act by inhibiting or modifying the acetyltransferase activity of the KAT / HAT domain. [000913] An exemplary human p300 protein sequence can be found in NCBI NP_001420.2, the contents of which are incorporated herein by reference in their entirety. An exemplary human p300 protein comprises a sequence of: [000914] 1 maenvvepgp psakrpklss palsasasdg tdfgslfdle hdlpdelins telgltnggd [000915] 61 inqlqtslgm vqdaaskhkq lsellrsgss pnlnmgvggp gqvmasqaqq sspglglins [000916] 121 mvkspmtqag ltspnmgmgt sgpnqgptqs tgmmnspvnq pamgmntgmn agmnpgmLaa [000917] 181 gngqgimpnq vmngsigagr grqnmqypnp gmgsagnllt eplqqgspqm ggqtglrgpq [000918] 241 plkmgmmnnp npygspytqn pgqqigasgl glqiqtktvl snnlspfamd kkavpgggmp [000919] 301 nmgqqpapqv qqpglvtpva qgmgsgahta dpekrkliqq qlvlllhahk cqrreqange [000920] 361 vrqcnlphcr tmknvlnhmt hcqsgkscqv ahcassrqii shwknctrhd cpvclplkna [000921] 421 gdkrnqqpil tgapvglgnp sslgvgqqsa pnlstvsqid pssierayaa lglpyqvnqm [000922] 481 ptqpqvqakn qqnqqpgqsp qgmrpmsnms aspmgvnggv gvqtpsllsd smLhsainsq Petition 870260058863, dated 06 / 17 / 2026, pp. 596 / 843 168 / 404 [000923] 541 npmmsenasv pslgpmptaa qpsttgirkq wheditqdlr nhlvhklvqa ifptpdpaal [000924] 601 kdrrmenlva yarkvegdmy esannraeyy hllaekiyki qkeleekrrt rlqkqnmLpn [000925] 661 aagmvpvsmn pgpnmgqpqp gmtsngplpd psmirgsvpn qmmpritpqs glnqfgqmsm [000926] 721 aqppivprqt pplqhhgqla qpgalnppmg ygprmqqpsn qgqflpqtqf psqgmnvtni [000927] 781 plapssgqap vsqaqmssss cpvnspimpp gsqgshihcp qlpqpalhqn spspvpsrtp [000928] 841 tphhtppsig aqqppattip apvptppamp pgpqsqalhp pprqtptppt tqlpqqvqps [000929] 901 lpaapsadqp qqqprsqqst : aasvptptap llppqpatpl sqpavsiegq vsnppstsst [000930] 961 evnsqaiaek qpsqevkmea kmevdqpepa dtqpedises kvedckmest eteerstelk [000931] 1021 teikeeedqp stsatqsspa pgqskkkifk peelrqalmp tlealyrqdp eslpfrqpvd [000932] 1081 pqllgipdyf divkspmdls tikrkldtgq yqepwqyvdd iwlmfnnawl ynrktsrvyk [000933] 1141 ycsklsevfe qeidpvmqsl gyccgrklef spqtlccygk qlctiprdat yysyqnryhf [000934] 1201 cekcfneiqg esvslgddps qpqttinkeq fskrkndtld pelfvectec grkmhqicvl [000935] 1261 hheiiwpagf vcdgclkksa rtrkenkfsa krlpstrlgt flenrvndfl rrqnhpesge [000936] 1321 vtvrvvhasd ktvevkpgmk arfvdsgema esfpyrtkal fafeeidgvd lcffgmhvqe [000937] 1381 ygsdcpppnq rrvyisylds vhffrpkclr tavyheilig yleyvkklgy ttghiwacpp Petition 870260058863, dated 06 / 17 / 2026, pp. 597 / 843 169 / 404 [000938] 1441 segddyifhc hppdqkipkp krlqewykkm Idkavseriv hdykdifkqa tedrltsake [000939] 1501 lpyfegdfwp nvleesikel eqeeeerkre entsnestdv tkgdsknakk knnkktsknk [000940] 1561 sslsrgnkkk pgmpnvsndl sqklyatmek hkevffvirl iagpaanslp pivdpdplip [000941] 1621 cdlmdgrdaf ltlardkhle fsslrraqws tmcmLvelht qsqdrfvytc neckhhvetr [000942] 1681 whctvcedyd lcitcyntkn hdhkmeklgl glddesnnqq aaatqspgds rrlsiqrciq [000943] 1741 slvhacqcrn ancslpscqk mkrvvqhtkg ckrktnggcp ickqlialcc yhakhcqenk [000944] 1801 cpvpfclnik qklrqqqlqh rlqqaqmLrr rmasmqrtgv vgqqqglpsp tpatpttptg [000945] 1861 qqpttpqtpq ptsqpqptpp nsmppylprt qaagpvsqgk aagqvtpptp pqtaqpplpg [000946] 1921 pppaavemam qiqraaetqr qmahvqifqr piqhqmppmt pmapmgmnpp pmtrgpsghl [000947] 1981 epgmgptgmq qqppwsqggl pqpqqlqsgm prpammsvaq hgqplnmapq pglgqvgisp [000948] 2041 lkpgtvsqqa lqnllrtlrs pssplqqqqv lsilhanpql laafikqraa kyansnpqpi [000949] 2101 pgqpgmpqgq pglqpptmpg qqgvhsnpam qnmnpmqagv qraglpqqqp qqqlqppmgg [000950] 2161 mspqaqqmnm nhntmpsqfr dilrrqqmmq qqqqqgagpg igpgmanhnq fqqpqgvgyp [000951] 2221 pqqqqrmqhh mqqmqqgnmg qigqlpqalg aeagaslqay qqrllqqqmg spvqpnpmsp [000952] 2281 qqhmLpnqaq sphlqgqqip nslsnqvrsp qpvpsprpqs qpphsspspr mqpqpsphhv Petition 870260058863, on 17 / 06 / 2026, page. 598 / 843 170 / 404 [000953] 2341 spqtssphpg lvaaqanpme qghfaspdqn smLsqlasnp gmanlhgasa tdlglstdns [000954] 2401 dlnsnlsqst ldih (SEQ ID NO: 1). [000955] In some embodiments, a p300 protein comprises a protein having at least 85% identity with SEQ ID NO: 1, at least 90% identity with SEQ ID NO: 1, at least 95% identity with SEQ ID NO: 1, at least 96% identity with SEQ ID NO: 1, at least 97% identity with SEQ ID NO: 1, at least 98% identity with SEQ ID NO: 1, at least 99% identity with SEQ ID NO: 1, or at least 99.8% identity with SEQ ID NO: 1. In some embodiments, a p300 protein is identical to a protein with SEQ ID NO: 1. [000956] The CH1 / TAZ domain corresponds approximately to amino acids 347-414 of SEQ ID NO: 1. The KIX domain corresponds approximately to amino acids 566-646 of SEQ ID NO: 1. The bromodomain corresponds approximately to amino acids 10511158 of SEQ ID NO: 1. The PHD domain corresponds approximately to amino acids 1243-1277 of SEQ ID NO: 1. The HAT / KAT domain corresponds approximately to amino acids 1306-1612 of SEQ ID NO: 1. The ZZ domain corresponds approximately to amino acids 1668-1708 of SEQ ID NO: 1. The TAZ2 domain corresponds approximately to amino acids 1729-1807 of SEQ ID NO: 1. [000957] As used in this document in the context of polypeptides, nucleic acids and chemical compounds, the term corresponding to designates the position / identity of a structural element, for example, of an amino acid residue, a nucleotide residue or a chemical fraction, in a compound or composition by comparison with an appropriate reference compound or composition. For example, in some embodiments, a monomeric residue in a polymer (e.g., an amino acid residue) Petition 870260058863, dated 06 / 17 / 2026, pp. 599 / 843 A residue (171 / 404 in a polypeptide or a nucleic acid residue in a polynucleotide) can be identified as corresponding to a residue in an appropriate reference polymer. For example, those skilled in the art will understand that, for simplicity, residues in a polypeptide are often designated using a canonical numbering system based on a related reference polypeptide, so that an amino acid corresponding to a residue at position 190, for example, need not actually be the 190th amino acid in a specific amino acid chain, but corresponds to the residue found at position 190 in the reference polypeptide; those skilled in the art will readily understand how to identify corresponding amino acids (see, for example, Benson et al., Nucl. Acids (January 1, 2013) 41 (D1): D36-D42; Pearson et al., PNAS Vol. 85, pp. 2444-2448, April 1988).Those skilled in the art will be aware of various sequence alignment strategies, including software programs such as, for example, BLAST, CS-BLAST, CUSASW++, DIAMOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, HHpred / HHsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSIBLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM or SWIPE, which can be used, for example, to identify matching residues in polypeptides and / or nucleic acids according to this disclosure. [000958] As used in this document, the term domain refers to a section or portion of a polypeptide. In some embodiments, a domain is associated with a specific structural and / or functional feature of the polypeptide such that, when the domain is physically separated from the rest of its parent polypeptide, it retains substantially or entirely the specific structural and / or functional feature. In some embodiments, a Petition 870260058863, dated 06 / 17 / 2026, pp. 600 / 843 172 / 404 A domain may include a portion of a polypeptide that, when separated from that (parent) polypeptide and linked to a different (receptor) polypeptide, retains and / or substantially confers upon the receptor polypeptide one or more structural and / or functional features that distinguish it from the parent polypeptide. In some embodiments, a domain is a section of a polypeptide. In some of these embodiments, a domain is characterized by a specific structural element (e.g., a specific amino acid sequence or sequence motif, O-helix character, B-sheet character, coiled-coil character, random coil character) and / or by a specific functional feature (e.g., binding activity, enzymatic activity, folding activity, signaling activity). A person skilled in the art will understand that domain boundaries are normally determined experimentally, or by sequence alignment, and can be approximated.In some embodiments, the domain boundaries may vary by at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 10, at least 15, or at least 20 amino acids without affecting the living function of the domain. [000959] An exemplary nucleic acid sequence encoding a p300 protein comprises a sequence of: [000960] 1 gagaaggagg aggacagcgc cgaggaggaa gaggttgatg gcggcggcgg agctccgaga [000961] 61 gacctcggct gggcaggggc cggccgtggc gggccgggga ctgcgcctct agagccgcga [000962] 121 gttctcggga attcgccgca gcggacgcgc tcggcgaatt tgtgctcttg tgccctcctc [000963] 181 cgggcttggg cccaggcccg gcccctcgca cttgccctta ccttttctat cgagtccgca [000964] 241 tccctctcca gccactgcga cccggcgaag agaaaaagga Petition 870260058863, dated 06 / 17 / 2026, pp. 601 / 843 173 / 404 acttccccca ccccctcggg [000965] 301 tgccgtcgga gccccccagc ccacccctgg gtgcggcgcg gggaccccgg gccgaagaag [000966] 361 agatttcctg aggattctgg ttttcctcgc ttgtatctcc gaaagaatta aaaatggccg [000967] 421 agaatgtggt ggaaccgggg ccgccttcag ccaagcggcc taaactctca tctccggccc [000968] 481 tctcggcgtc cgccagcgat ggcacagatt ttggctctct atttgacttg gagcacgact [000969] 541 taccagatga attaatcaac tctacagaat tgggactaac caatggtggt gatattaatc [000970] 601 agcttcagac aagtcttggc atggtacaag atgcagcttc taaacataaa cagctgtcag [000971] 661 aattgctgcg atctggtagt tcccctaacc tcaatatggg agttggtggc ccaggtcaag [000972] 721 tcatggccag ccaggcccaa cagagcagtc ctggattagg tttgataaat agcatggtca [000973] 781 aaagcccaat gacacaggca ggcttgactt ctcccaacat ggggatgggc actagtggac [00097 caaatcgcagc tcaacaggta tgatgaacag tccagtaaat cagcctgcca [000975] 901 tgggaatgaa cacagggatg aatgcgggca tgaatcctgg aatgttggct gcaggcaatg [000976] 961 gacaagggat aatgcctaat caagtcatga acggttaat tggagcaggc cggagcc [000977] 1021 agaatatgca gtacccaaac ccaggcatgg gaagtgctgg caacttactg actgagcctc [000978] 1081 ttcagcaggg ctctccccag atgggaggac aaacaggatt gagaggcccc cagcctctta [0001979] cccaatcctt atggttcacc Petition 870260058863, of 17 / 06 / 2026, p. 602 / 843 174 / 404 atatactcag aatcctggac [000980] 1201 agcagattgg agccagtggc cttggtctcc agattcagac aaaaactgta ctatcaaata [000981] 1261 acttatctcc atttgctatg gacaaaaagg cagttcctgg tggaggaatg cccaacatgg [000982] 1321 gtcaacagcc agccccgcag gtccagcagc caggcctggt gactccagtt gcccaaggga [000983] 1381 tgggttctgg agcacataca gctgatccag agaagcgcaa gctcatccag cagcagcttg [000984] 1441 ttctcctttt gcatgctcac aagtgccagc gccgggacaca ggccaatggg gaagtgaggc [000985] 1501 agtgcaacct tcccactgt cgcacaatga agatgctct aaaccacatg accacactgcc [000986] 1561 agtcaggcaa gtcttgcca gtgcacact gtgcatctc tcgacaaatc atttcacact [000987] 1621 ggaagaattg tacagacat gattgtcctg tgtgtctccc cctcaaaaat gctggtgata [000988] 1681 agagaaatca acagccaattt ttgactggag cacccgttgg acttggaat cctagctctc [000989] 1741 taggtgggg tagtcagatt gccccagt [000990] 1801 ccatagaaag agcctatgca gctcttggac tacctatca agtaaatcag atgccgacac [000991] 1861 aacccaggt gcaagcaag aaccaggcaga atcagcagcc tggcagtct cccaggcag [000992] 1921 tgcggcccat gagcacatg agtgctagtc ctatgggagt aaatggaggt gtaggagttc [000993] 1981 aaacgccgag tcttctttct gactcaatgt tgcattcagc cataaattct caaacccaa [000994] 2041 tgatgagtga aaatgccagt gtgccctccc tgggtcctat Petition 870260058863, dated 06 / 17 / 2026, p. 603 / 843 175 / 404 gcHp gcthp. [000995] 2101 ccactactgg aattcggaaa cagtggcacg agatattac tcaggatctt cgaatcatc [000996] 2161 ttgttcacaa actcgtccaa gccatatttc ctacgccgga tcctgctgct ttaaaagaca [000997] 2221 gacggatgga aaacctagtt gcatatgctc ggaagttga agggacatg tatgaatctg [000998] 2281 caacaatcg agcggaatac taccaccttc tagctgagaa atctataag atccagaag [000999] 2341 aactagaga aaacgaagg accagactac agaagcagaa catgctacca atgctgcag [0001000] 2401 gcatggttcc agtttccatg aatccaggc ctacatggg acagccgcaa ccaggaatga [0001001] 2461 cttctaatgg ccctacct gacccaagta tgatccgtgg cagtgtgcca aaccagatga [0001002] 2521 tgcctcgaat aactccacaa tctggtttga atcaatttgg ccagatgagc atggcccagc [0001003] 2581 cccctattgt accccggcaa acccctcctc ttcagcacca tggacagttg gctcaacctg [0001004] 2641 gagctctcaa cccgcctatg ggctatgggc ctcgtatgca acagccttcc aaccagggcc [0001005] 2701 agttccttcc tcagactcag ttcccatcac agggaatgaa tgtaacaaat atccctttgg [0001006] 2761 ctccgtccag cggtcaagct ccagtgtctc aagcacaaat gtctagttct tcctgcccgg [0001007] 2821 tgaactctcc tataatgcct ccagggtctc aggggagcca cattcactgt ccccagcttc [0001008] 2881 ctcaaccagc tcttcatcag aattcaccct cgcctgtacc tagtcgtacc cccacccctc [0001009] 2941 accatactcc cccaagcata ggggctcagc agccaccagc Petition 870260058863, of 17 / 06 / 2026, p. 604 / 843 176 / 404 aacaacaatt ccagcccctg [0001010] 3001 ttcctacacc tcctgccatg ccacctgggc cacagtccca ggctctacat ccccctccaa [0001011] 3061 ggcagacacc tacaccacca acaacacaac ttccccaaca agtgcagcct tcacttcctg [0001012] 3121 ctgcaccttc tgctgaccag ccccagcagc agcctcgctc acagcagagc acagcagcgt [0001013] 3181 ctgttcctac cccaacagca ccgctgcttc ctccgcagcc tgcaactcca ctttcccagc [0001014] 3241 [0001015] 3301 attctcaggc cattgctgag aagcagcctt cccaggaagt gaagatggag gccaaaatgg [0001016] 3361 aagtggatca accagaacca gcagatactc agccggagga tatttcagag tctaaagtgg [0001017] 3421 aagactgtaa aatggaatct accgaaacag aagagagaag cactgagtta aaaactgaaa [0001018] 3481 taaaagga ggaagaccag ccaagtactt cagctaccca gtcatctccg gctccaggac [0001019] 3541 agtcaagaa aaagattttc aaaccagaag aactacgaca ggcactgatg ccaactttgg [0001020] 3601 aggcacttta ccgtcaggat ccagaatccc ttccctttcg tcaacctgtg gaccctcagc [0001021] 3661 ttttaggaat ccctgattac tttgatattg tgaagagccc catggatctt tctaccatta [0001022] 3721 agaggaagtt agacactgga cagtatcagg agccctggca gtatgtcgat gatatttggc [0001023] 3781 ttatgttcaa taatgctgg ttatatacc ggaaaacatc acgggtatac aaatactgct [0001024] 3841 ccaagctctc tgaggtcttt gacaagaaa ttgaccagt Petition 870260058863, dated 06 / 17 / 2026, p. 605 / 843 177 / 404 gatcaagc cttggatact. [0001025] 3901 gttgtggcag aaagttggag ttctccac agacactgtg ttgctacggc aacagttgt [0001026] 3961 gcacaatacc tcgtgatgcc acttattaca gttaccagaa caggtatcat ttctgtgaga [0001027] 4021 agtgttcaa tgagatccaa ggggagagcg ttctttggg ggatgaccct tcccagccctc [0001028] 4081 aaactacaat aaaataagaa caatttcca agagaaaaa tgacacactg gatcctgaac [0001029] 4141 tgtttgttga atgtacagag tgcggaagaa agatgcatca gatctgtgtc cttcaccatg [0001030] 4201 agatcatctg gctgctgga ttcgtctg atggctgtt aaagaaaagt gcacgaacta [0001031] 4261 ggaaagaaaa taagttttct gctaaaaggt tgccatctac cagacttggc acctttctag [0001032] 4321 agaatcgtgt gaatgacttt ctgaggcgac agaatcaccc tgagtcagga gaggtcactg [001304383] tcatgcttct gacaaaaccg tggaagtaaa accaggcatg aaagcaaggt [0001034] 4441 ttgtggacag tggagagatg gcagaatcct ttccataccg aaccaaagcc ctctttgcct [0001035] 4501 ttgaagaaat tgatggtgtt gacctgtgct tctttggcat gcatgttcaa gagtatggct [0001036] 4561 ctgactgccc tccacccaac cagaggagag tatacatatc ttacctcgat agtgttcatt [0001037] 4621 tcttccgtcc taaatgcttg aggactgcag tctatcatga aatcctaatt ggatatttag [0001038] 4681 aatatgtcaa gaaattaggt tacacaacag ggcatatttg ggcatgtcca ccaagtgagg [0001039] 4741 gagatgatta tatcttccat tgccatcctc ctgaccagaa gatacccaag Petition 870260058863, of 17 / 06 / 2026, p. 606 / 843 178 / 404 cccaagcgac [0001040] 4801 tgcaggaatg gtacaaaaaa atgcttgaca aggctgtatc agagcgtatt gtccatgact [0001041] 4861 acaaggatat ttttaaacaa gctactgaag atagattaac aagtgcaaag gaattgcctt [0001042] 4921 atttcgaggg tgatttctgg cccaatgttc tggaagaaag cattaaggaa ctggaacagg [0001043] 4981 aggaagaaga gagaaaacga gaggaaaaca ccagcaatga aagcacagat gtgaccaagg [0001044] 5041 gagacagcaa aaatgctaaa aagaagaata ataagaaac cagcaaaaat aagagcagcc [0001045] 5101 tgagtagggg caacaagaag aaacccggga tgcccaatgt atctaacgac ctctcacaga [0001046] 5161 aactatgc caccatggag aagcataaag aggtctttct tgtgatccgc ctcattgctg [0001047] 5221 gccctgctgc caactccctg cctcccattg ttgatcctga tcctctcatc ccctgcgatc [0001048] 5281 tgatggatgg tcgggatgcg tttctcacgc tggcaaggga caagcacctg gagttctctt [0001049] 5341 cactccgaag agcccagtgg tccaccatgt gcatgctggt ggagctgcac acgcagagcc [0001050] 5401 aggaccgctt tgtctacacc tgcaatgaat gcaagcacca tgtggagaca cgctggcact [0001051] 5461 gtactgtctg tgaggattat gacttgtgta tcacctgcta taacactaaa aaccatgacc [0001052] 5521 acaaaatgga gaaactaggc cttggcttag atgatgagag caacaaccag caggctgcag [0001053] 5581 cccacccagag cccaggcgat tctcgccgcc tgagtatcca gcgctgcatc cagtctctgg [0001054] 5641 tccatgcttg ccagtgtcgg aatgccaatt gctcactgcc atcctgccag Petition 870260058863, dated 06 / 17 / 2026, pp. 607 / 843 179 / 404 aagatgaagc [0001055] 5701 gggttgtgca gcataccaag ggttgcaaac ggaaaaccaa tggcgggtgc cccatctgca [0001056] 5761 agcagctcat tgccctctgc tgctaccatg ccaagcactg ccaggagac aaatgcccgg [0001057] 5821 tgccgttctg cctaaacatc aagcagaagc tccggcagca acagctgcag caccgactc [0001058] 5881 agcaggccca aatgcttcgc aggaggatgg ccagcatgca gcggactggt gtggttgggc [0001059] 5941 agcaacaggg cctcccttcc cccactcctg ccactccaac gacaccaact ggccaacagc [0001060] 6001 caccacccc gcagacgccc cgcccactt ctcagcctca gcctacccct cccaatagca [0001061] 6061 tgccacccta cttgcccagg actcaagctg ctggccctgt gtcccagggt aaggcagcag [0001062] 6121 gccaggtgac ccctccaacc cctcctcaga ctgctcagcc accccttcca gggcccccac [0001063] 6181 ctgcagcagt ggaaatggca atgcagattc agagagcagc ggagacgcag cgccagatgg [0 6241 cccacgtgca aatttttcaa aggccatcc aacaccagat gcccccgatg actcccatgg [0001065] 6301 cccccatggg tatgaaccca cctcccatga ccagaggtcc cagtgggcat ttggagccag [0001066] 6361 ggatggggacc gacagggatg ttgcctcagc [0001067] 6421 cccagcaactacagtctggg atgccaaggc cagccatgat gtcagtggcc cagcatggtc [0001068] 6481 aacctttgaa catggctcca caaccaggat tgggccaggt aggtatcagc ccactcaaac [0001069] 6541 caggcactgt gtctcaacaa gccttacaaa accttttgcg Petition 870260058863, dated 06 / 17 / 2026, pp. 608 / 843 180 / 404 gactctcagg tctcccagct [0001070] 6601 ctcccctgca gcagcaacac j gtgcttagta tccttcacgc caacccccag ctgttggctg [0001071] 6661 cattcatcaa gcagcgggct gccaagtatg ccaactctaa tccacaaccc atccctgggc [0001072] 6721 agcctggcat gccccagggg cagccagggc tacagccacc taccatgcca ggtcagcagg [0001073] 6781 gggtccactc caatccagcc atgcagaaca tgaatccaat gcaggcgggc gttcagaggg [0001074] 6841 ctggcctgcc ccagcagcaa ccacagcagc aactccagcc acccatggga gggatgagcc [0001075] 6901 cccaggctca gcagatgaac atgaaccaca acaccatgcc ttcacaattc cgagacatct [0001076] 6961 tgagacgaca gcaaatgatg caacagcagc agcaacaggg agcagggcca ggaataggcc [0001077] 7021 ctggaatggc caaccataac cagttccagc aaccccaagg agttggctac ccaccacagc [0001078] 7081 agcagcagcg gatgcagcat cacatgcaac agatgcaaca aggaaatatg ggacagatag [0001079] 7141 gccagcttcc ccaggccttg ggagcagagg caggtgccag tctacaggcc tatcagcagc [0001080] 7201 gactccttca gcaacagatg gggtcccctg ttcagcccaa ccccatgagc ccccagcagc [0001081] 7261 atatgctccc aaatcaggcc cagtccccac acctacaagg ccagcagatc cctaattctc [0001082] 7321 tctccaatcaagtgcgctct ccccagcctg tccctctcc acggccacag tcccagcccc [0001083] 7381 cccactccag tccttcccca aggatgcagc ctcagccttc tccaccac gtttccccac [0001084] 74tt41 cggacagcccc [0001084] ctgcccaggc Petition 870260058863, dated 06 / 17 / 2026, p. 609 / 843 181 / 404 stormg rattlegggc [0001085] 7501 atttgccag cccggaccag attcaatgc tttctcagct tgctagcaat ccaggcatgg [0001086] 7561 caaacctcca tggtgcaagc gccacggacc tgggactcag caccgataac tcagacttga [0001087] 7621 attcaaacct ctcacagagt acactagaca tacactagag acaccttgta gtattttggg [0001088] 7681 agcaaaaaa ttttctc ttaacagac ttttgtact gaaaacatt ttttgaatc [0001089] 7741 ttcgtagcc taaaagacaa ttttccttgg aacacataag aactgtgcag tagccgttg [0001090] 7801 tggttttaag caacatgca agatgaacct gagggatgat agaatacaa gatatatttt [0001091] 7861 ttgttatggc tggttaccac cagccttttct tccccttgt gtgtgtggtt caagtgtgca [0001092] 7921 ctgggaggag gctgaggcct gtgaagccaa acaatatgct cctgccttgc acctccaata [0001093] 7981 ggttttatta tttttttta attaatgaac attagtaata ttatagtta tttattactg [0001094] 8041 gtgcagatgg ttgacatttt tcctatttt cctcacttta tggaagtt aaaacatttc [0001095] 8101 taaaccagag gawaaaggg gttaatgtta ctttaaaatt acattctata tatatataaa [0001096] 8161 tatatataa tatatatta ataccagtt ttttctct gggtgcaaag atgttcattc [0001097] 8221 ttttaaaaaa tgtttaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaactctct tccctcaag tcaactttg [0001098] 8281 tgctccagaa aattttctat tctgtaagtc tgagcgtaaa acttcaagta ttaaaataat [0001099] 8341 ttgtacatgt agagagaaaa atgactttt caaaaata Petition 870260058863, dated 06 / 17 / 2026, p. 610 / 843 182 / 404 caggggcagc tgccaaattg [0001100] 8401 atgtattata tattgtggtt tctgttttctt gaagaattt tttcgttt ttcatct [0001101] 8461 aaaagtaa aaaattaaaaaggtaa gaaacgattc cggtgggatg atttacat [0001102] 8521 gcaaaatgtc cctgggggtt tcttctttgc ttgctttctt cctccttacc ctacccccca [0001103] 8581 ctcacacaca cacacacaca cacacacaca cacacacaca cacactttct ataaaacttg [0001104] 8641 aaaatagcaa aaaccctcaa ctgttgtaaa tcatgcaatt aaagttgatt acttataaat [0001105] 8701 atgaactttg gatcactgta tagactgtta aatttgattt cttattacct attgttaaat [0001106] 8761 aaactgtgtg agacagaca (SEQ ID NO: 2). [0001107] In some embodiments, a nucleic acid sequence encoding a p300 protein comprises a nucleic acid sequence encoding a protein having at least 85% identity with SEQ ID NO: 1, at least 90% identity with SEQ ID NO: 1, at least 95% identity with SEQ ID NO: 1, at least 96% identity with SEQ ID NO: 1, at least 97% identity with SEQ ID NO: 1, at least 98% identity with SEQ ID NO: 1, at least 99% identity with SEQ ID NO: 1, or at least 99.8% identity with SEQ ID NO: 1. In some embodiments, the nucleic acid sequence encoding a p300 protein comprises a nucleic acid sequence encoding a protein identical to SEQ ID NO: 1.In some embodiments, a nucleic acid sequence encoding a p300 protein comprises a nucleic acid sequence having at least 85% identity with SEQ ID NO: 2, at least 90% identity with SEQ ID NO: 2, or at least 95% identity with SEQ ID NO: 2. Petition 870260058863, dated 06 / 17 / 2026, pp. 611 / 843 183 / 404 at least 96% identity with SEQ ID NO: 2, at least 97% identity with SEQ ID NO: 2, at least 98% identity with SEQ ID NO: 2, at least 99% identity with SEQ ID NO: 2, or at least 99.8% identity with SEQ ID NO: 2. In some embodiments, a nucleic acid sequence encoding a p300 protein comprises a nucleic acid sequence identical to SEQ ID NO: 2 or a portion or subsequence thereof. [0001108] As used in this document, the term expression of a nucleic acid sequence refers to the generation of any gene product from the nucleic acid sequence. In some embodiments, a gene product may be a transcript. In some embodiments, a gene product may be a polypeptide. In some embodiments, the expression of a nucleic acid sequence involves one or more of the following: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation and / or 3' end formation); (3) translation of an RNA into a polypeptide or protein; and / or (4) post-translational modification of a polypeptide or protein. [0001109] As used in this document, the term nucleic acid refers to a polymer of at least three nucleotides. In some embodiments, a nucleic acid comprises DNA. In some embodiments, it comprises RNA. In some embodiments, a nucleic acid is single-stranded. In some embodiments, a nucleic acid is double-stranded. In some embodiments, a nucleic acid comprises both single-stranded and double-stranded portions. In some embodiments, a nucleic acid comprises a backbone comprising one or more phosphodiester bonds. In some embodiments, a nucleic acid comprises a backbone that Petition 870260058863, dated 06 / 17 / 2026, pp. 612 / 843 184 / 404 comprises phosphodiester and non-phosphodiester linkages. In some embodiments, a nucleic acid comprises one or more, or all, of the following natural residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytididine, deoxyganosine, deoxythymidine, guanine, thymine, uracil). In some embodiments, a nucleic acid comprises one or more, or all, of the following non-natural residues. In some embodiments, a non-natural residue comprises a nucleoside analog. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product, such as an RNA or polypeptide. In some embodiments, a nucleic acid has a nucleotide sequence that comprises one or more introns.In some embodiments, a nucleic acid can be prepared by isolation from a natural source and enzymatic synthesis (e.g., by polymerization based on a complementary template, e.g., in vivo or in vitro, reproduction in a cell or recombinant system, or chemical synthesis). METHODS OF TREATING CANCER [0001110] Cancer is a disease caused by the uncontrolled division of cells in the body. Abnormally dividing cancerous cells can form a primary tumor, which can then invade nearby tissues and spread throughout the body via the blood and lymphatic systems (metastatic cancer). Cancer can arise from many organs and cell types in the body, including, but not limited to, cells of the lymphatic system, bone marrow, blood, brain tissue, nervous system, breast, cervix, ovary, colorectal cells, stomach, gastric cells, head and neck, kidney, liver, lung, esophagus, pancreas, prostate, and skin. [0001111] As used in this document, the term tumor refers to an abnormal growth of cells or tissue....

Claims

1. Process for preparing a 1-(piperidinocarbonylmethyl)-2-oxopiperazine derivative compound, characterized in that it comprises one or more steps selected from amide coupling, deprotection, acylation, reductive amination, ketalization, oxidation, catalytic hydrogenation, mesylation, tosylation, nucleophilic substitution, hydrolysis, cyclization, Mitsunobu reaction, chromatography, stereoisomeric resolution and diastereomer separation.

2. Intermediate, characterized in that it is for use in the preparation of a compound derived from 1-(piperidinocarbonylmethyl)2-oxopiperazine, wherein the intermediate is selected from precursors, starting materials, protected intermediates, unprotected intermediates, acylated intermediates, intermediates resulting from reductive amination, intermediates resulting from amide coupling, mesylated intermediates, tosylated intermediates, ketalized intermediates, cyclized intermediates or salts thereof.

3. Pharmaceutical form, characterized in that it comprises a compound derived from 1-(piperidinocarbonylmethyl)-2-oxopiperazine, obtainable by the process as defined in claim 1, and wherein the pharmaceutical form is selected from tablet, capsule, powder, granule, solution, suspension, emulsion, injectable, infusion, suppository, spray, topical formulation, ophthalmic formulation, mucosal formulation, sublingual formulation, buccal formulation, intranasal formulation, rectal formulation, transdermal formulation, dressing, transdermal matrix and transdermal patch.

4. Pharmaceutical form, according to claim 3, characterized in that it comprises one or more excipients, vehicles, diluents, adjuvants, buffers, preservatives, antioxidants, suspending agents, solubilizing agents, controlled-release agents, albumin, phosphates, glycine, fatty acids, water, electrolytes, silica, polyvinylpyrrolidone, polyacrylates, waxes, oils, sugars, starches, cellulose, tragacanth, gelatin, talc, cocoa butter, propylene glycol or combinations thereof.

5. Use of a compound derived from 1-(piperidinocarbonylmethyl)-2-oxopiperazine, obtainable by the process as defined in claim 1, characterized in that it is used in the manufacture of a medicament to prevent or treat cancer associated with the modulation or inhibition of p300, CBP and / or p300 / CBP.

6. Use, according to claim 5, characterized in that the modulation or inhibition of p300, CBP and / or p300 / CBP comprises modulation of one or more domains selected from RID, CH1 / TAZ1, CH3 / TAZ2, KIX, bromodomain, PHD, KAT / HAT, ZZ and IBiD, and / or modulation of interaction with one or more partners selected from p53, HIF1A, HPV-E6, HPV-E7, androgen receptor, AP-1, CREB, STATs, SMADs, MYB, MDM2, BRCA1, RELA, TAL1, TCF3 and YY1.

7. Use of a 1-(piperidinocarbonylmethyl)-2-oxopiperazine derivative compound, obtainable by the process as defined in claim 1, characterized in that it is used in the manufacture of a medicament for modulating gene or protein expression associated with cancer, wherein the modulation comprises reduction of PSA / KLK3, reduction of TMPRSS2, reduction of SLC45A3, reduction of VEGF, reactivation of p53, increase in p53 acetylation, modulation of HIF1a, modulation of androgen receptor, modulation of angiogenesis, modulation of apoptosis, modulation of response to DNA damage, modulation of cell cycle, modulation of Wnt pathway, modulation of Notch pathway or modulation of Hedgehog pathway.

8. Use of a compound derived from 1-(piperidinocarbonylmethyl)-2-oxopiperazine, obtainable by the process, Petition 870260058863, dated 06 / 17 / 2026, pp. 835 / 843 3 / 3 as defined in claim 1, characterized in that it is used in the manufacture of a cancer treatment drug in combination with a PD-1 inhibitor, optionally wherein the compound is Compound 258.

9. Use of a compound derived from 1-(piperidinocarbonylmethyl)-2-oxopiperazine, obtainable by the process as defined in claim 1, characterized in that it is used in the manufacture of a cancer treatment drug in combination with a PD-L1 inhibitor, CTLA-4 inhibitor, anti-VEGF antibody, anti-VEGFA antibody, CAR-T therapy, adoptive cell therapy, cancer vaccine, gene therapy, biological agent, chemotherapeutic agent, radiotherapy or surgery.

10. Cancer treatment kit, characterized in that it comprises: (i) a compound derived from 1-(piperidinocarbonylmethyl)-2-oxopiperazine, obtainable by the process as defined in claim 1; (ii) an additional therapeutic agent selected from PD-1 inhibitor, PD-L1 inhibitor, CTLA-4 inhibitor, anti-VEGF antibody, anti-VEGFA antibody, chemotherapeutic agent, biological agent, CAR-T therapy, adoptive cell therapy, cancer vaccine and immunotherapeutic agent; and (iii) instructions for combined, simultaneous, sequential or temporally close administration.

Images