Nucleic acid vector, transgenic plant, methods for producing a transgenic plant cell and for expressing a polynucleotide sequence of interest in a plant cell, and use of a plant, plant part, plant cell or seed

Description

1 / 130 Nucleic acid vector, transgenic plant, methods for producing a transgenic plant cell and for To express a sequence of polynucleotides of interest in a plant cell, and use a plant, plant part, plant cell, or seed. Divided from patent application BR 11 2020 008180 9, filed on October 29, 2018. INCORPORATION BY REFERENCE

[0001] This application claims the benefit of the Patent Application. Provisional Patent Application Serial No. US 62 / 578,658 filed on October 30, 2017, and Provisional Patent Application Serial No. US 62 / 727,007 filed on September 21, 2018, both of which are expressly incorporated by reference in their entirety herein.

[0002] Incorporated by way of reference in its entirety is a computer-readable listing of nucleotide / amino acid sequences submitted simultaneously with this document and identified as follows: a 32.4 KB ASCII (Text) file named 79351 [2] SEQ LISTING_ST25 created on September 4, 2018. BACKGROUND

[0003] Many plant species have the ability to be transformed with transgenes to introduce agronomically desirable traits or characteristics. The resulting plant species are developed and / or modified to have particular desirable traits. In general, desirable traits include, for example, improving nutritional value, increasing yield, conferring resistance to pests or diseases, increasing tolerance to stress and drought, improving horticultural qualities (e.g., pigmentation and growth), conferring herbicide tolerance, enabling the production of Petition 870260040239, dated 04 / 29 / 2026, page 18 / 159 2 / 130 industrially useful compounds and / or plant materials, and / or enable the production of pharmaceutical products.

[0004] Transgenic plant species comprising multiple transgenes stacked at a single genomic locus are produced through plant transformation technologies. Plant transformation technologies result in the introduction of a transgene into a plant cell, recovery of a fertile transgenic plant containing the stably integrated copy of the transgene in the plant genome, and subsequent transgene expression through transcription and translation results in transgenic plants possessing desirable traits and phenotypes. However, innovative gene regulatory elements that allow the production of transgenic plant species highly expressing multiple manipulated transgenes as a set of traits are desirable.

[0005] Similarly, innovative gene regulatory elements that allow the expression of a transgene in particular tissues or organs of a plant are desirable. For example, increased plant resistance to infection by soil-borne pathogens can be achieved by transforming the plant genome with a pathogen resistance gene, so that the pathogen resistance protein is robustly expressed in the plant roots. Alternatively, it may be desirable to express a transgene in plant tissues that are at a particular stage of development or growth, such as, for example, cell division or elongation. Furthermore, it may be desirable to express a transgene in leaf and stem tissues of a plant to provide herbicide tolerance, or resistance to aboveground insects and pests.

[0006] Therefore, there is a need for innovative gene regulatory elements that can lead to the desired levels. Petition 870260040239, dated 04 / 29 / 2026, page 19 / 159 3 / 130 of transgene expression in specific plant tissues. BRIEF SUMMARY

[0007] In embodiments of the present description, the description refers to a nucleic acid vector comprising a promoter operationally linked to: a polylinking sequence; a heterologous coding sequence other than GmCAB2; wherein said promoter comprises a polynucleotide sequence having at least 95% sequence identity with SEQ ID NO: 2. In further embodiments, said promoter is 1,376 base pairs in length. In other embodiments, said promoter consists of a polynucleotide sequence having at least 95% sequence identity with SEQ ID NO: 2. In further embodiments, said promoter is operationally linked to a heterologous coding sequence.Consequently, the heterologous coding sequence encodes a selectable marker protein, an insecticide resistance protein, a herbicide tolerance protein, a nitrogen use efficiency protein, a water use efficiency protein, a small RNA molecule, a nutritional quality protein, or a DNA-binding protein. In other embodiments, the nucleic acid vector comprises a terminator polynucleotide sequence. In further embodiments, the nucleic acid vector comprises a 3' untranslated polynucleotide sequence. In further embodiments, the nucleic acid vector comprises a 5' untranslated polynucleotide sequence. In further embodiments, the nucleic acid vector comprises an intron sequence. In further embodiments, said promoter has preferential tissue expression.In additional embodiments, the nucleic acid vector comprises a polynucleotide sequence having at least 95% sequence identity with SEQ ID NO: 2 operationally linked to a heterologous coding sequence. Petition 870260040239, dated 04 / 29 / 2026, p. 20 / 159 4 / 130 In further embodiments, said plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, Glycine max, cotton, Arabidopsis, tobacco, sunflower, and canola. In yet another embodiment, said plant is Glycine max. In some embodiments, the heterologous coding sequence is inserted into the genome of said plant. In other embodiments, the promoter comprises a polynucleotide sequence that has at least 95% sequence identity with SEQ ID NO:2, and said promoter is operationally linked to a heterologous coding sequence. In further embodiments, the transgenic plant comprises an untranslated 3' sequence. In further embodiments, said heterologous coding sequence has preferential tissue expression. In further embodiments, the transgenic plant comprises said promoter of 1,376 base pairs in length.

[0008] In embodiments of the present description, the description refers to a method for producing a transgenic plant cell, wherein the method comprises the steps of transforming a plant cell with a gene expression cassette comprising a GmCAB2 promoter operationally linked to at least one polynucleotide sequence of interest; isolating the transformed plant cell comprising the gene expression cassette; and producing a transgenic plant cell comprising the GmCAB2 promoter operationally linked to at least one polynucleotide sequence of interest. In other embodiments, the transformation of a plant cell is performed using a plant transformation method.In some respects, the plant transformation method is selected from among the group consisting of an Agrobacterium-mediated transformation method, a biolistic transformation method, a silicon carbide transformation method, a protoplast transformation method, and a transformation method of... Petition 870260040239, dated 04 / 29 / 2026, page 21 / 159 5 / 130 liposome. In further embodiments, the polynucleotide sequence of interest is expressed in a plant cell. In other embodiments, the polynucleotide sequence of interest is stably integrated into the genome of the transgenic plant cell. In further embodiments, the method comprises regenerating the transgenic plant cell into a transgenic plant; and obtaining the transgenic plant, wherein the transgenic plant comprises the gene expression cassette comprising the GmCAB2 promoter operationally linked to at least one polynucleotide sequence of interest. In other embodiments, the transgenic plant cell is a monocotyledonous transgenic plant cell or a dicotyledonous transgenic plant cell. Examples of a dicotyledonous transgenic plant cell include an Arabidopsis plant cell, a tobacco plant cell, a Glycine max plant cell, a canola plant cell, and a cotton plant cell.Examples of a transgenic monocotyledonous plant cell include a Zea mays plant cell, a rice plant cell, and a wheat plant cell. In some embodiments, the GmCAB2 promoter comprises the polynucleotide of SEQ ID NO: 2. In other embodiments, the GmCAB2 promoter comprises a first polynucleotide sequence of interest operationally linked to the 3' end of SEQ ID NO: 2. In further embodiments, the method comprises introducing into the plant cell a polynucleotide sequence of interest operationally linked to a GmCAB2 promoter. In further embodiments, the polynucleotide sequence of interest operationally linked to the GmCAB2 promoter is introduced into the plant cell through a plant transformation method. Examples of plant transformation methods include an Agrobacterium-mediated transformation method, a biolistic transformation method, and a carbide transformation method. Petition 870260040239, dated 04 / 29 / 2026, page 22 / 159 6 / 130 silicon, a protoplast transformation method, and a liposome transformation method. In additional embodiments, the polynucleotide sequence of interest is expressed in embryonic cell tissue. In further embodiments, the polynucleotide sequence of interest is stably integrated into the plant cell genome. In some embodiments, the transgenic plant cell is either a monocotyledonous plant cell or a dicotyledonous plant cell. Examples of dicotyledonous plant cells include an Arabidopsis plant cell, a tobacco plant cell, a Glycine max plant cell, a canola plant cell, and a cotton plant cell. Examples of monocotyledonous plant cells include a Zea mays plant cell, a rice plant cell, and a wheat plant cell.

[0009] In embodiments of the present description, the description refers to a transgenic plant cell comprising a GmCAB2 promoter. In other embodiments, the transgenic plant cell comprises a transgenic event. In further embodiments, the transgenic event comprises an agronomic trait. Examples of agronomic traits include an insecticide resistance trait, herbicide tolerance trait, nitrogen use efficiency trait, water use efficiency trait, nutritional quality trait, DNA binding trait, selectable marker trait, small RNA trait, or any combination thereof. In further embodiments, the agronomic trait comprises a herbicide-tolerant trait. In one aspect of this embodiment, the herbicide-tolerant trait comprises an aad-1 coding sequence. In yet another embodiment, the transgenic plant cell produces a primary product.Examples of a primary product include protein concentrate, protein isolate, grain, bran, flour, oil, or fiber. In further embodiments, the transgenic plant cell is selected from the group consisting of one. Petition 870260040239, dated 04 / 29 / 2026, page 23 / 159 7 / 130 dicotyledonous plant cell or a monocotyledonous plant cell. For example, the dicotyledonous plant cell is a Glycine max plant cell. In further embodiments, the GmCAB2 promoter comprises a polynucleotide with at least 95% sequence identity with the polynucleotide of SEQ ID NO: 2, SEQ ID NO: 28, or SEQ ID NO: 29. In other embodiments, the GmCAB2 promoter is 1,376 base pairs in length. In some embodiments, the GmCAB2 promoter consists of SEQ ID NO: 2, SEQ ID NO: 28, or SEQ ID NO: 29. In subsequent embodiments, the GmCAB2 promoter comprises a first polynucleotide sequence of interest operationally linked to the 3' end of SEQ ID NO: 2. In other embodiments, the agronomic trait is expressed in plant tissues. In further embodiments, the isolated polynucleotide comprises a nucleic acid sequence with at least 95% sequence identity to the polynucleotide of SEQ ID NO: 2, SEQ ID NO: 28, or SEQ ID NO: 29.In additional embodiments, the isolated polynucleotide drives preferential tissue expression. In other embodiments, the isolated polynucleotide comprises expression activity within a plant cell. In some embodiments, the isolated polynucleotide comprises an open reading frame polynucleotide encoding a polypeptide; and a termination sequence. In subsequent embodiments, the polynucleotide of SEQ ID NO: 2 is 1,376 base pairs in length. In subsequent embodiments, the polynucleotide of SEQ ID NO: 28 is 1,453 base pairs in length. In subsequent embodiments, the polynucleotide of SEQ ID NO: 29 is 1,454 base pairs in length.

[00010] In embodiments of the present description, the description refers to a gene expression cassette comprising a promoter operationally linked to a coding sequence. Petition 870260040239, dated 04 / 29 / 2026, page 24 / 159 8 / 130 heterologous, with the promoter comprising a polynucleotide comprising at least 95% sequence identity with SEQ ID NO: 2, SEQ ID NO: 28, or SEQ ID NO: 29. In some embodiments, the polynucleotide has at least 95% sequence identity with SEQ ID NO: 2, SEQ ID NO: 28, or SEQ ID NO: 29. In further embodiments, the gene expression cassette comprises an intron. In further embodiments, the gene expression cassette comprises a 5' UTR. In subsequent embodiments, the promoter has tissue-preferential expression. In other embodiments, the promoter is operationally linked to a heterologous coding sequence encoding a polypeptide or small RNA gene.Examples of encoded polypeptide or small RNA genes include a heterologous coding sequence conferring insecticide resistance, herbicide tolerance, a nucleic acid conferring nitrogen use efficiency, a nucleic acid conferring water use efficiency, a nucleic acid conferring nutritional quality, a nucleic acid conferring DNA-binding protein, and a nucleic acid encoding a selectable marker. In additional embodiments, the gene expression cassette comprises a 3' untranslated region. For example, the 3' untranslated region has at least 95% sequence identity with SEQ ID NO: 4. In additional embodiments, the gene expression cassette comprises a 5' untranslated region. For example, the 5' untranslated region has at least 95% sequence identity with SEQ ID NO: 3. In additional embodiments, the gene expression cassette comprises a terminator region.For example, the terminator region has at least 95% sequence identity with SEQ ID NO: 5. In other embodiments, the present description refers to a recombinant vector comprising the gene expression cassette, wherein the vector is selected from the group consisting of a plasmid, one. Petition 870260040239, dated 04 / 29 / 2026, page 25 / 159 9 / 130 cosmid, a bacterial artificial chromosome, a virus, and a bacteriophage. In other embodiments, the present description refers to a transgenic cell comprising the gene expression cassette. In one aspect of this embodiment, the transgenic cell is a transgenic plant cell. In other aspects of this embodiment, the transgenic plant comprises the transgenic plant cell. In further aspects, the transgenic plant is a monocotyledonous plant or a dicotyledonous plant. Examples of a monocotyledonous plant include a maize plant, a rice plant, and a wheat plant. In further aspects of the embodiment, the transgenic plant produces a seed comprising the gene expression cassette. In other embodiments, the promoter is a tissue-preferred promoter. In some embodiments, the tissue-preferred promoter is a tissue-preferred promoter.

[00011] In embodiments of the present description, the description refers to a nucleic acid vector comprising a promoter operationally linked to: a polylinking sequence; a heterologous coding sequence other than GmCAB2; wherein said promoter comprises a polynucleotide sequence having at least 95% sequence identity with SEQ ID NO: 28. In further embodiments, said promoter is 1,453 base pairs in length. In other embodiments, said promoter consists of a polynucleotide sequence having at least 95% sequence identity with SEQ ID NO: 28. In further embodiments, said promoter is operationally linked to a heterologous coding sequence.Consequently, the heterologous coding sequence encodes a selectable marker protein, an insecticide resistance protein, a herbicide tolerance protein, a nitrogen use efficiency protein, a water use efficiency protein, a small RNA molecule, and a protein of... Petition 870260040239, dated 04 / 29 / 2026, page 26 / 159 10 / 130 nutritional quality or a DNA-binding protein. In other embodiments, the nucleic acid vector comprises a terminator polynucleotide sequence. In further embodiments, the nucleic acid vector comprises a 3' untranslated polynucleotide sequence. In further embodiments, the nucleic acid vector comprises a 5' untranslated polynucleotide sequence. In further embodiments, the nucleic acid vector comprises an intron sequence. In further embodiments, said promoter has preferential tissue expression. In further embodiments, the nucleic acid vector comprises a polynucleotide sequence that has at least 95% sequence identity with SEQ ID NO: 28 operationally linked to a heterologous coding sequence.In further embodiments, said plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, Glycine max, cotton, Arabidopsis, tobacco, sunflower, and canola. In yet another embodiment, said plant is Glycine max. In some embodiments, the heterologous coding sequence is inserted into the genome of said plant. In other embodiments, the promoter comprises a polynucleotide sequence that has at least 95% sequence identity with SEQ ID NO:28, and said promoter is operationally linked to a heterologous coding sequence. In further embodiments, the transgenic plant comprises a 3' untranslated sequence. In further embodiments, said heterologous coding sequence has preferential tissue expression. In further embodiments, the transgenic plant comprises said promoter of 1,453 base pairs in length.

[00012] In embodiments of the present description, the description refers to a nucleic acid vector comprising a promoter operationally linked to: a polylinking sequence; a heterologous coding sequence other than GmCAB2; wherein said promoter. Petition 870260040239, dated 04 / 29 / 2026, p. 27 / 159 11 / 130 comprises a polynucleotide sequence that has at least 95% sequence identity with SEQ ID NO: 29. In further embodiments, said promoter is 1,454 base pairs in length. In other embodiments, said promoter consists of a polynucleotide sequence that has at least 95% sequence identity with SEQ ID NO: 29. In further embodiments, said promoter is operationally linked to a heterologous coding sequence. Consequently, the heterologous coding sequence encodes a selectable marker protein, an insecticide resistance protein, a herbicide tolerance protein, a nitrogen use efficiency protein, a water use efficiency protein, a small RNA molecule, a nutritional quality protein, or a DNA-binding protein. In other embodiments, the nucleic acid vector comprises a terminator polynucleotide sequence.In further embodiments, the nucleic acid vector comprises a 3' untranslated polynucleotide sequence. In further embodiments, the nucleic acid vector comprises a 5' untranslated polynucleotide sequence. In further embodiments, the nucleic acid vector comprises an intron sequence. In further embodiments, said promoter has preferential tissue expression. In further embodiments, the nucleic acid vector comprises a polynucleotide sequence that has at least 95% sequence identity with SEQ ID NO: 29 operationally linked to a heterologous coding sequence. In further embodiments, said plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, Glycine max, cotton, Arabidopsis, tobacco, sunflower, and canola. In yet another embodiment, said plant is Glycine max.In some forms, the heterologous coding sequence is inserted into the genome of the plant in question. In other forms, the promoter... Petition 870260040239, dated 04 / 29 / 2026, page 28 / 159 12 / 130 comprises a polynucleotide sequence that has at least 95% sequence identity with SEQ ID NO:29, and said promoter is operationally linked to a heterologous coding sequence. In further embodiments, the transgenic plant comprises an untranslated 3' sequence. In further embodiments, said heterologous coding sequence has preferential tissue expression. In further embodiments, the transgenic plant comprises said promoter of 1,454 base pairs in length.

[00013] The aforementioned and other features will become more apparent from the following detailed description of various embodiments, which proceed with reference to the accompanying Figures. BRIEF DESCRIPTION OF THE FIGURES

[00014] Figure 1 Provides a picture of a linear synthetic DNA fragment containing the GmCAB2 promoter, 5' UTR and terminator linked by multiple cloning sites and aatL1 and aatL2 recombination sites franchised by Gateway.

[00015] Figure 2 Provides a plasmid map figure for pDAB122135.

[00016] Figure 3A, Figure 3B, and Figure 3C provide an alignment of SEQ ID NO: 2, SEQ ID NO: 28, and SEQ ID NO: 29 using the AlignX global alignment program from the Vector NTI Advance 11.0 bioinformatics computer program, which is available from Invitrogen Corporation. SEQ ID NO: 28 and SEQ ID NO: 29 share 99.9% sequence identity. SEQ ID NO: 2 and SEQ ID NO: 28 share 94.5% sequence identity. SEQ ID NO: 2 and SEQ ID NO: 29 share 94.4% sequence identity. DETAILED DESCRIPTION I. Overview of various modalities

[00017] The development of transgenic plant products has Petition 870260040239, dated 04 / 29 / 2026, page 29 / 159 13 / 130 becoming increasingly complex. Commercially viable transgenic plants now require the stacking of multiple transgenes at a single locus. Plant promoters and 3' terminators / UTRs used for basic research or biotechnological applications are generally unidirectional, directing only one gene that has been fused at its 3' end (downstream) to the promoter, or at its 5' end (upstream) to the 3' terminator / UTR. Consequently, each heterologous transgene / coding sequence typically requires a promoter and 3' terminator / UTR for expression, where multiple regulatory elements are needed to express multiple transgenes within a gene pool. With an increasing number of transgenes in gene pools, the same promoter and / or 3' terminator / UTR is routinely used to achieve optimal levels of expression templates for different transgenes.Achieving optimal levels of heterologous transgene / coding sequence expression is necessary for the production of a unique polygenic trait. Unfortunately, it is known that constructs of multiple genes driven by the same promoter and / or 3' terminator / UTR cause gene silencing, resulting in less effective transgenic products in the field. Repeated promoter and / or 3' terminator / UTR elements can result in homology-based gene silencing. Furthermore, repetitive sequences within a heterologous transgene / coding sequence can result in intra-gene homologous recombination, leading to polynucleotide reassignments. Transgene silencing and reassignment will likely have an undesirable effect on the performance of a transgenic plant produced to express transgenes.Furthermore, an excess of transcription factor (TF) binding sites due to promoter repetition can lead to the depletion of endogenous TFs, resulting in their deactivation. Petition 870260040239, dated 04 / 29 / 2026, page 30 / 159 14 / 130 transcription. Given the need to introduce multiple genes into plants for metabolic modification and trait stacking, a variety of promoters and / or 3' terminators / UTRs are required to develop transgenic crops that drive the expression of multiple genes.

[00018] A particular problem in identifying promoters and / or terminators / 3' UTRs is the need to identify tissue-specific / preferred promoters, with respect to specific cell types, developmental stages, and / or functions in the plant that are not expressed in other plant tissues. Tissue-specific (i.e., tissue-preferred) or organ-specific promoters drive gene expression in a particular tissue, such as the grain, root, leaf, or tapetum of the plant. Tissue- and developmental-stage specific promoters and / or terminators / 3' UTRs can initially be identified from observing gene expression, which are expressed in particular tissues or at particular time periods during plant development.These tissue-specific / preferred 3' promoters and / or terminators / UTRs are necessary for certain applications in the transgenic plant industry and are desirable insofar as they allow specific expression of heterologous genes in a tissue- and / or developmental-stage selective manner, indicating the heterologous gene is expressed differently in various organs, tissues, and / or time points, but not in other undesirable tissues. For example, increased plant resistance to infection by soil-borne pathogens can be achieved by transforming the plant genome with a pathogen resistance gene, so that the pathogen resistance protein is robustly expressed in the plant roots. Alternatively, it may be desirable to express a heterologous transgene / coding sequence in plant tissues. Petition 870260040239, dated 04 / 29 / 2026, page 31 / 159 15 / 130 that are in a particular stage of development or growth, such as, for example, cell division or elongation. Another application is the desire to use tissue-specific / preferred 3' promoters and / or terminators / UTRs to confine the expression of transgenes encoding an agronomic trait to specific tissue types such as developing parenchyma cells. Thus, a particular problem in identifying promoters and / or terminators / UTRs is how to identify the promoters, and relate the identified promoter to developing cell properties for tissue-specific / preferred expression.

[00019] Another problem related to promoter identification is the need to clone all relevant cis-acting and trans-activating transcriptional control elements so that the cloned DNA fragment drives transcription in the desired specific expression pattern. Given that such control elements are located distal to the translation initiation or start site, the size of the polynucleotide selected to comprise the promoter is important for providing the expression level and expression patterns of the promoter polynucleotide sequence. Promoter lengths are known to contain functional information, and different genes have been shown to have longer or shorter promoters than the promoters of other genes in the genome. Elucidating the transcription start site of a promoter and predicting the functional gene elements in the promoter region is challenging.In addition to the challenge, there is the complexity, diversity, and inherent degenerate nature of regulatory motifs and cis- and trans regulatory elements (Blanchette, Mathieu, et al. Genome-wide computational prediction of transcriptional regulatory modules reveals new insights into human gene expression. Genome research 16.5 (2006): 656-668). Cis- and trans regulatory elements are located in the distal parts of the promoter that they regulate. Petition 870260040239, dated 04 / 29 / 2026, page 32 / 159 16 / 130 the spatial and temporal expression of a gene to occur only at necessary sites and at specific times (Porto, Milena Silva, et al. Plant promoters: a structure and function approach. Molecular biotechnology 56.1 (2014): 38-49). Consequently, the identification of promoter regulatory elements requires that an appropriate sequence of a specific size containing the necessary cis and trans regulatory elements be obtained, which will result in the desirably driven expression of a heterologous transgene / coding sequence.

[00020] Methods and compositions are provided to overcome such problems through the use of GmCAB2 gene regulatory elements to express plant transgenes. II. Terms and Abbreviations

[00021] Throughout the application, several terms are used. In order to provide a clear and consistent understanding of the descriptive report and claims, which includes the scope to be given to these terms, the following definitions are provided.

[00022] As used in this document, the articles, a, an and the include plural references unless the context clearly and unambiguously states otherwise.

[00023] The term isolate, as used in this document, means having been removed from its natural environment, or removed from other compounds present when the compound is first formed. The term isolate encompasses materials isolated from natural sources, as well as materials (e.g., nucleic acids and proteins) recovered after preparation by recombinant expression in a host cell, or chemically synthesized compounds such as nucleic acid molecules, proteins, and peptides.

[00024] The term purified, as used in this document, refers to the isolation of a molecule or compound in Petition 870260040239, dated 04 / 29 / 2026, page 33 / 159 17 / 130 a form that is substantially free of contaminants normally associated with the molecule or compound in a native or natural environment, or substantially enriched in concentration relative to other compounds present when the compound is first formed, and means that have increased in purity as a result of being separated from other components of the original composition. The term purified nucleic acid is used in this document to describe a nucleic acid sequence that has been separated, produced separately from, or purified away from, other biological compounds including, but not limited to, polypeptides, lipids, and carbohydrates, while effecting a chemical or functional change in the component (e.g., a nucleic acid may be purified from a chromosome by removing protein contaminants and breaking the chemical bonds that link the nucleic acid to the remaining DNA in the chromosome).

[00025] The term synthetic, as used in this document, refers to a polynucleotide molecule (i.e., DNA or RNA) that has been created through chemical synthesis as an in vitro process. For example, synthetic DNA can be created during a reaction in an Eppendorf™ tube, such that the synthetic DNA is enzymatically produced from a native strand of DNA or RNA. Other laboratory methods can be used to synthesize a polynucleotide sequence. Oligonucleotides can be chemically synthesized in an oligo synthesizer by solid-phase synthesis using phosphoramidites. The synthesized oligonucleotides can be annealed together as a complex, thus producing a synthetic polynucleotide. Other methods for chemically synthesizing a polynucleotide are known in the art and can be readily implemented for use in this description.

[00026] The term "approximately," as used in this document, Petition 870260040239, dated 04 / 29 / 2026, page 34 / 159 18 / 130 means greater or less than the stated value or range of values ​​within 10 percent, but is not intended to designate any value or range of values ​​only within that broader definition. Each value or range of values ​​preceded by the term about is also intended to encompass the modality of the stated absolute value or range of values.

[00027] For the purposes of this description, a gene includes a region of DNA that encodes a gene product (see below), as well as all regions of DNA that regulate the production of the gene product, whether or not such regulatory sequences are adjacent to the coding and / or transcribed sequences.Consequently, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translation regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, threshold elements, origins of replication, matrix binding sites, introns, and locus control regions.

[00028] As used in this document, the terms native or natural define a condition found in nature. A native DNA sequence is a DNA sequence found in nature that was produced by natural means or traditional breeding techniques, but not generated by genetic modification (e.g., using molecular biology / transformation techniques).

[00029] As used in this document, a transgene is defined as a nucleic acid sequence that encodes a gene product which includes, for example, but not limited to, mRNA. In one embodiment, the transgene / heterologous coding sequence is an exogenous nucleic acid, wherein the transgene / heterologous coding sequence has been introduced into a host cell by genetic manipulation (or the progeny thereof) wherein the transgene / heterologous coding sequence is not normally Petition 870260040239, dated 04 / 29 / 2026, page 35 / 159 19 / 130 found. In one example, a heterologous transgene / coding sequence encodes an industrially or pharmaceutically useful compound, or a gene that encodes a desirable agricultural trait (e.g., a herbicide resistance gene). In yet another example, a heterologous transgene / coding sequence is an antisense nucleic acid sequence, wherein expression of the antisense nucleic acid sequence inhibits the expression of a target nucleic acid sequence. In one embodiment, the heterologous transgene / coding sequence is an endogenous nucleic acid, wherein additional genomic copies of the endogenous nucleic acid are desirable, or a nucleic acid that is in the antisense orientation relative to the sequence of a target nucleic acid in a host organism.

[00030] As used in this document, the term GmCAB2-different transgene or GmCAB2-different gene means any heterologous transgene / coding sequence that has less than 80% sequence identity with the GmCAB2 gene coding sequence of Glyma14g01130, as provided in the UniProt nucleotide database as UniProtKB C6TD73_SOYBN.

[00031] As used in this document, heterologous DNA coding sequence means any coding sequence other than that which naturally codes for the GmCAB2 gene, or any homolog of the expressed GmCAB2 protein. The term heterologous is used in the context of this invention for any combination of nucleic acid sequences that are not normally found to be closely associated in nature.

[00032] A gene product, as defined herein, is any product produced by a gene. For example, a gene product may be the direct transcription product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, RNA of Petition 870260040239, dated 04 / 29 / 2026, page 36 / 159 20 / 130 interference, ribozyme, structural RNA, or any other type of RNA) or a protein produced by translation of an mRNA. Gene products also include RNAs that are modified by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation. Gene expression can be influenced by external signals, for example, exposure of a cell, tissue, or organism to an agent that increases or decreases gene expression. Gene expression can also be regulated anywhere along the DNA-to-RNA-to-protein pathway.The regulation of gene expression occurs, for example, through controls acting on transcription, translation, transport and processing of RNA, degradation of intermediate molecules such as mRNA, or through the activation, deactivation, compartmentalization or degradation of specific protein molecules after they have been produced, or by combinations thereof. Gene expression can be measured at the RNA level or at the protein level by any method known in the art, which includes, without limitation, Northern blot, RT-PCR, Western blot or in vitro, in situ or in vivo protein activity assay(s).

[00033] As used in this document, the term gene expression refers to the process by which the encoded information of a nucleic acid transcription unit (which includes, for example, genomic DNA) is converted into an operational, non-operational, or structural part of a cell, which often includes the synthesis of a protein. Gene expression can be influenced by external signals, for example, exposure of a cell, tissue, or organism to an agent that increases or decreases gene expression. Gene expression can also be regulated anywhere along the DNA-to-RNA-to-protein pathway. Petition 870260040239, dated 04 / 29 / 2026, page 37 / 159 21 / 130 Gene expression regulation occurs, for example, through controls acting on transcription, translation, transport and RNA processing, degradation of intermediate molecules such as mRNA, or through the activation, deactivation, compartmentalization or degradation of specific protein molecules after they have been produced, or by combinations thereof. Gene expression can be measured at the RNA level or at the protein level by any method known in the art, which includes, without limitation, Northern blot, RT-PCR, Western blot or in vitro, in situ or in vivo protein activity assay(s).

[00034] As used in this document, homology-based gene silencing (HBGS) is a generic term that includes both transcriptional gene silencing and post-transcriptional gene silencing. Silencing of a target locus by an unbound silencing locus can result from the inhibition of transcription (transcriptional gene silencing; TGS) or mRNA degradation (post-transcriptional gene silencing; PTGS), due to the production of double-stranded RNA (dsRNA) corresponding to the promoter or transcript sequences, respectively. The involvement of distinct cellular components in each process suggests that dsRNA-induced TGS and PTGS likely result from the diversification of a common ancient mechanism. However, a strict comparison of TGS and PTGS has been difficult to achieve due to the fact that it generally depends on the analysis of distinct silencing loci.In some cases, a single transgene locus can trigger both TGS and PTGS, due to the production of dsRNA corresponding to the promoter and transcribed sequences of different target genes. Mourrain et al. (2007) Planta 225:365 to 379. It is likely that siRNAs are the actual molecules that trigger TGS and PTGS in homologous sequences: in this model, siRNAs would trigger sequence silencing and methylation. Petition 870260040239, dated 04 / 29 / 2026, p. 38 / 159 22 / 130 homologous in cis and trans through methylation spreading of transgene sequences in the endogenous promoter.

[00035] As used in this document, the term nucleic acid molecule (or nucleic acid or polynucleotide) may refer to a polymeric form of nucleotides, which may include both sense and antisense strands of RNA, cDNA, genomic DNA, and synthetic and mixed polymer forms thereof. A nucleotide may refer to a ribonucleotide, deoxyribonucleotide, or a modified form of any type of nucleotide. A nucleic acid molecule, as used in this document, is synonymous with nucleic acid and polynucleotide. The nucleic acid molecule is normally at least 10 bases long, unless otherwise specified. The term may refer to an RNA or DNA molecule of indeterminate length. The term includes single-stranded and double-stranded forms of DNA.A nucleic acid molecule may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and / or non-naturally occurring nucleotide bonds.

[00036] Nucleic acid molecules can be chemically or biochemically modified, or can contain unnatural or derived nucleotide bases, as will be readily observed by those skilled in the art. Such modifications include, for example, identifications, methylation, substitution of one or more of the naturally occurring nucleotides by an analogue, internucleotide modifications (e.g., uncharged linkages: e.g., methyl phosphonates, phosphotriesters, phosphoramidites, carbamates, etc.; charged linkages: e.g., phosphorothioates, phosphorodithioates, etc.; pendant chemical moieties: e.g., peptides; intercalators: e.g., acridine, psoralen, etc.; chelating agents; alkylating agents; and modified linkages: e.g., acids Petition 870260040239, dated 04 / 29 / 2026, page 39 / 159 23 / 130 anomeric alpha nucleic acids, etc.). The term nucleic acid molecule also includes any topological conformation, which includes single-stranded, double-stranded, partially duplexed, triplexed, hairpin, circular, and padlock conformations.

[00037] Transcription proceeds in a 5' to 3' direction along a DNA strand. This means that RNA is made by the sequential addition of ribonucleotide-5'-triphosphates to the 3' end of the growing chain (with a necessary elimination of the pyrophosphate). In a linear or circular nucleic acid molecule, distinct elements (e.g., particular nucleotide sequences) may be termed upstream or 5' relative to an additional element if they are or would be linked to the same nucleic acid in the 5' direction of that element. Similarly, distinct elements may be downstream or 3' relative to an additional element if they are or would be linked to the same nucleic acid in the 3' direction of that element.

[00038] A “base position, as used in this document, refers to the location of a given nucleotide or base residue in a designated nucleic acid. The designated nucleic acid may be defined by alignment (see below) with a reference nucleic acid.

[00039] Hybridization refers to the linking of two polynucleotide strands through hydrogen bonds. Oligonucleotides and their analogues hybridize through hydrogen bonds, which include Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds, between complementary bases. In general, nucleic acid molecules consist of nitrogenous bases that are pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the linking of the pyrimidine to the purine is called base pairing. More Petition 870260040239, dated 04 / 29 / 2026, page 40 / 159 24 / 130 specifically, A will form a hydrogen bond with T or U, and G will bond with C. Complementary refers to base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.

[00040] Specifically hybridizable and specifically complementary are terms that indicate a sufficient degree of complementarity so that stable and specific binding occurs between the oligonucleotide and the target DNA or RNA. The oligonucleotide does not need to be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when the binding of the oligonucleotide to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to prevent non-specific binding of the oligonucleotide to non-target sequences under conditions where specific binding is desirable, for example, under physiological conditions in the case of in vivo assays or systems. Such binding is termed specific hybridization.

[00041] The hybridization conditions that result in particular degrees of stringency will vary depending on the nature of the hybridization method chosen and the composition and length of the hybridization nucleic acid sequences. In general, the hybridization temperature and the ionic strength (especially the concentration of Na+ and / or Mg2+) of the hybridization buffer will contribute to the hybridization stringency, although washing times also influence the stringency. The calculations regarding the hybridization conditions necessary to achieve particular degrees of stringency are discussed in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd edition, volumes 1 to 3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, chapters 9 and 11.

[00042] As used in this document, conditions Petition 870260040239, dated 04 / 29 / 2026, p. 41 / 159 25 / 130 stringent conditions encompass those under which hybridization will occur only if there is less than 50% divergence between the hybridization molecule and the target DNA. Stringent conditions further include particular levels of stringency. Thus, as used in this document, moderate stringency conditions are those under which molecules with more than 50% sequence divergence will not hybridize; high stringency conditions are those under which sequences with more than 20% divergence will not hybridize; and very high stringency conditions are those under which sequences with more than 10% divergence will not hybridize.

[00043] In particular embodiments, the astringent conditions may include hybridisation at 65 °C, followed by washes at 65 °C with 0.1x SSC / 0.1% SDS for 40 minutes.

[00044] The following are representative non-limiting hybridization conditions: Very High Stringency: Hybridization in SSC 5x buffer at 65°C for 16 hours; washing twice in SSC 2x buffer at room temperature for 15 minutes each; and washing twice in SSC 0.5x buffer at 65°C for 20 minutes each. High Stringency: Hybridization in SSC buffer 5x to 6x at 65 to 70°C for 16 to 20 hours; washing twice in SSC buffer 2x at room temperature for 5 to 20 minutes each; and washing twice in SSC buffer 1x at 55 to 70°C for 30 minutes each. Moderate Stringency: Hybridize in SSC buffer 6x at room temperature (55°C) for 16 to 20 hours; wash at least twice in SSC buffer 2x to 3x at room temperature (55°C) for 20 to 30 minutes each.

[00045] In particular embodiments, specifically hybridizable nucleic acid molecules can remain bound under Petition 870260040239, dated 04 / 29 / 2026, p. 42 / 159 26 / 130 very high stringency hybridization conditions. In these and additional embodiments, specifically hybridizable nucleic acid molecules can remain bound under high stringency hybridization conditions. In these and additional embodiments, specifically hybridizable nucleic acid molecules can remain bound under moderate stringency hybridization conditions.

[00046] As used in this document, the term oligonucleotide refers to a short nucleic acid polymer. Oligonucleotides can be formed by cleavage of longer nucleic acid segments, or by polymerization of individual nucleotide precursors. Automated synthesizers allow the synthesis of oligonucleotides up to several hundred base pairs in length. Because oligonucleotides can bind to a complementary nucleotide sequence, they can be used as probes to detect DNA or RNA. DNA-composed oligonucleotides (oligodeoxyribonucleotides) can be used in PCR, a technique for amplifying small DNA sequences. In PCR, the oligonucleotide is typically referred to as a primer, which allows a DNA polymerase to extend the oligonucleotide and replicate the complementary strand.

[00047] The terms percentage of sequence identity or percentage of identity or identity are used interchangeably to refer to a sequence comparison based on identical matches between consequently identical positions in the compared sequences between two or more amino acid or nucleotide sequences. Percentage of identity refers to the extent to which two optimally aligned polynucleotide or peptide sequences are invariant over a component alignment window, for example, nucleotides or amino acids. Hybridization experiments and algorithms Petition 870260040239, dated 04 / 29 / 2026, page 43 / 159 27 / 130 known mathematical algorithms in the art can be used to determine the percentage of identity. Many mathematical algorithms exist as sequence alignment computer programs known in the art that calculate the percentage of identity. These programs can be categorized as global sequence alignment programs or local sequence alignment programs.

[00048] Global sequence alignment programs calculate the percentage of identity of two sequences by comparing end-to-end alignments in order to find exact matches, dividing the number of exact matches by the length of the shorter sequences, and then multiplying by 100. Basically, it is the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (“query”) polynucleotide molecule compared to a test (subject) polynucleotide molecule when the two sequences are optimally aligned (with appropriate nucleotide insertions, deletions, or gaps).

[00049] Local sequence alignment programs are similar in their calculation, but they only compare aligned fragments of sequences instead of using end-to-end analysis. Local sequence alignment programs, such as BLAST, can be used to compare specific regions of two sequences. A BLAST comparison of two sequences results in an E-value, or expectation value, which represents the number of different alignments with scores equal to or better than the raw alignment score, S, that are expected to occur in a random database search. The lower the E-value, the more significant the match. Due to the fact that Petition 870260040239, dated 04 / 29 / 2026, page 44 / 159 28 / 130 that database size is an element in E-value calculations, E-values ​​obtained by BLASTing against public databases, such as GENBANK, generally increased over time for any given query / match input. In defining criteria for polypeptide function prediction security, it is considered in this document that a high BLAST match has an E-value for superior BLAST hit of less than 1E-30; a medium BLAST E-value is 1E-30 to 1E-8; and a low BLAST E-value is greater than 1E-8. Protein function assignment in the present invention is determined using combinations of E-values, identity percentage, query coverage, and hit coverage. Query coverage refers to the percentage of the query sequence that is represented in the BLAST alignment. Hit coverage refers to the percentage of the database entry that is represented in the BLAST alignment.In one embodiment of the invention, the function of a query polypeptide is inferred from the function of a protein homolog wherein either (1) hit_p<1e-30 or % identity >35% AND query_coverage >50% AND hit_coverage >50%, or (2) hit_p<1e-8 AND query_coverage >70% AND hit_coverage >70%. The following abbreviations are produced during a BLAST analysis of a sequence. Provides SEQ ID NO for the listed recombinant polynucleotide SEQ_NUM sequences. provides an arbitrary sequence name CONTIG_ID taken from the name of the clone from which the cDNA sequence was obtained. provides the SEQ ID NO for the recombinant polypeptide sequence PROTEIN_NUM; provides the GenBank ID number for the NCBI_GI top BLAST match for the sequence. The match of Petition 870260040239, dated 04 / 29 / 2026, p. 45 / 159 29 / 130 The top BLAST match is indicated by the GenBank National Center for Biotechnology Information Identifier Number. refers to the GenBank top BLAST match description NCBI_GI_DESCRIPTION for the sequence. E_VALUE provides the assumed value for the top BLAST match. MATCH_LENGTH provides the length of the sequence that is aligned in the top BLAST match. TOP_HIT_PCT_IDENT refers to the percentage of identically correlated nucleotides (or residues) that exist along the length of that portion of the sequences that are aligned in the top BLAST match. CAT_TYPE indicates the classification scheme used to classify the sequence.GO_BP = Gene Ontology Consortium — biological process; GO_CC = Gene Ontology Consortium — cellular component; GO_MF = Gene Ontology Consortium — molecular function; KEGG = KEGG functional hierarchy (KEGG = Kyoto Encyclopedia of Genes and Genomes); EC = Enzyme Classification from ENZYME 25.0 database release; POI = Pathways of Interest. CAT_DESC provides the schema subcategory. Petition 870260040239, dated 04 / 29 / 2026, page 46 / 159 30 / 130 The classification to which the query sequence was assigned. Provides the annotation category of PRODUCT_CAT_DESC FunCAT to which the query sequence was assigned. Provides the description of the BLAST hit PRODUCT_HIT_DESC that resulted in the sequence being assigned to the function category provided in the cat_desc column. Provides the E value for the BLAST hit HIT_E in the hit_desc column. Refers to the percentage of identically correlated PCTJDENT nucleotides (or residues) that exist along the length of that portion of the sequences that is aligned in the BLAST match provided in hit_desc. QRY_RANGE lists the range of the query sequence aligned with the match. HIT_RANGE lists the range of the match sequence aligned with the query. Provides the percentage of the length of the QRY_CVRG query sequence that matches the hit sequence (NCBI) in the BLAST match (% of qry cvrg = (match length / total query length) χ 100).HIT_CVRG provides the percentage of hit sequence length that corresponds to. Petition 870260040239, dated 04 / 29 / 2026, p. 47 / 159 31 / 130 query sequence in the match generated using BLAST (% of match accuracy = (match length / total match length) χ 100).

[00050] Methods for aligning sequences for comparison are well known in the art. Several alignment programs and algorithms are described. In one embodiment, the present description refers to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the AlignX alignment program from the Vector NTI package (Invitrogen, Carlsbad, CA). The AlignX alignment program is a global sequence alignment program for polynucleotides or proteins. In another embodiment, the present description refers to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the MegAlign program from the LASERGENE bioinformatics computing package (MegAlign™ (©1993-2016). DNASTAR. Madison, Wl). The MegAlign program is a global sequence alignment program for polynucleotides or proteins.In one embodiment, the present description refers to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Clustal package of alignment programs, which includes, but is not limited to, ClustalW and ClustalV (Higgins and Sharp (1988) Gene. Dec. 15;73(1):237-244; Higgins and Sharp (1989) CABIOS 5:151-153; Higgins et al. (1992) Comput. Appl. Biosci. 8:189-191). In another embodiment, the present description refers to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the BLAST package of alignment programs, for example, but not limited to, BLASTP, BLASTN, BLASTX, etc. (Altschul et al. (1990) J. Mol. Petition 870260040239, dated 04 / 29 / 2026, page 48 / 159 32 / 130 Biol. 215:403 to 410). In one embodiment, the present description refers to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the FASTA package of alignment programs which include, but are not limited to, FASTA, TFASTX, TFASTY, SSEARCH, LALIGN, etc. (Pearson (1994) Comput. Methods Genome Res. [Proc. Int. Symp.], Date of Meeting, 1992 (Suhai and Sandor, Eds.), Plenum: New York, NY, pages 111 to 120). In another embodiment, the present description refers to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the EMBOSS package of alignment programs which include, but are not limited to: Matcher, Needle, Stretcher, Water, Wordmatch, etc. (Rice, P., Longden, I. & Bleasby, A. EMBOSS: The European Molecular Biology Open Software Suite. Trends in Genetics 16(6) 276 and 277 (2000)).In one embodiment, the present description refers to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Geneious alignment program (Kearse, M., et al. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28(12), 1647-1649). In another embodiment, the present description refers to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Gap alignment program by Needleman and Wunsch (Needleman and Wunsch, Journal of Molecular Biology 48:443-453, 1970). In one embodiment, the present description refers to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the BestFit alignment program by Smith and Waterman (Smith and Waterman, Advances in Applied Mathematics, 2:482 to 489, 1981, Smith et al., Nucleic Acids Research 11:2.205 to 2.220, 1983). These programs produce alignments of multiple sequences. Petition 870260040239, dated 04 / 29 / 2026, page 49 / 159 33 / 130 biologically significant divergent sequences. The best-match alignments calculated for the selected sequences are aligned so that identities, similarities, and differences can be observed.

[00051] The term similarity refers to a comparison between amino acid sequences, and takes into account not only identical amino acids in corresponding positions, but also amino acids with similar functionality in corresponding positions. Thus, similarity between polypeptide sequences indicates functional similarity, in addition to sequence similarity.

[00052] The term homology is sometimes used to refer to the level of similarity between two or more amino acid or nucleic acid sequences in terms of percentage of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of evolutionary relationship, generally evidenced by similar functional properties among different nucleic acids or proteins that share similar sequences.

[00053] As used in this document, the term variants means substantially similar sequences. For nucleotide sequences, naturally occurring variants can be identified using well-known molecular biology techniques, such as, for example, polymerase chain reaction (PCR) and hybridization techniques as outlined in this document.

[00054] For nucleotide sequences, a variant comprises a deletion and / or addition of one or more nucleotides at one or more internal sites within the native polynucleotide and / or a substitution of one or more nucleotides at one or more sites in the native polynucleotide. As used herein, a native nucleotide sequence comprises a naturally occurring nucleotide sequence. For nucleotide sequences, Petition 870260040239, dated 04 / 29 / 2026, page 50 / 159 34 / 130 Naturally occurring variants can be identified using well-known molecular biology techniques, such as polymerase chain reaction (PCR) and hybridization techniques, as highlighted below. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, using site-directed mutagenesis. Generally, variants of a particular nucleotide sequence of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with that particular nucleotide sequence as determined by sequence alignment programs and parameters described elsewhere in this document.A biologically active variant of a nucleotide sequence of the invention may differ from that sequence by 1 to 15 nucleic acid residues, by 1 to 10, by 6 to 10, by 5, by 4, by 3, by 2, or even by 1 nucleic acid residue.

[00055] As used in this document, the term operationally linked refers to a first nucleic acid sequence that is operationally linked to a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For example, a promoter is operationally linked to a coding sequence when the promoter affects the transcription or expression of the coding sequence. When produced recombinantly, operationally linked nucleic acid sequences are usually contiguous and, when necessary, to join two protein coding regions in the same reading frame. However, the elements do not need to be contiguous to be operationally linked. Petition 870260040239, dated 04 / 29 / 2026, page 51 / 159 35 / 130

[00056] As used in this document, the term promoter refers to a region of DNA that is generally located upstream (toward the 5' region of a gene) and is required to initiate and trigger transcription of the gene. A promoter may allow appropriate activation or repression of a gene that it controls. A promoter may contain specific sequences that are recognized by transcription factors. These factors may bind to a promoter DNA sequence, resulting in the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the gene's coding region. The promoter generally refers to all gene regulatory elements located upstream of the gene, including upstream promoters, 5' UTRs, introns, and leader sequences.

[00057] As used in this document, the term upstream promoter refers to a contiguous polynucleotide sequence that is sufficient to direct transcription initiation. As used in this document, an upstream promoter encompasses the transcription initiation site with various sequence motifs, which include the TATA Box, primer sequence, TFIIB recognition elements, and other promoter motifs (Jennifer, EF et al., (2002) Genes & Dev., 16: 2583-2592). The upstream promoter provides the site of action for RNA polymerase II, which is a multi-subunit enzyme with basal or general transcription factors such as TFIIB, B, D, E, F, and H. These factors combine into a transcription pre-initiation complex that catalyzes RNA synthesis from the DNA template.

[00058] Upstream promoter activation is achieved by the additional sequence of DNA sequence regulatory elements to which various proteins bind and subsequently interact with the transcription initiation complex to activate gene expression. These sequences of regulatory elements of Petition 870260040239, dated 04 / 29 / 2026, page 52 / 159 36 / 130 genes interact with specific DNA-binding factors. These sequence motifs can sometimes be referred to as cis elements. Such cis elements, to which developmentally specific or tissue-specific transcription factors bind, individually or in combination, can determine the spatiotemporal expression pattern of a promoter at the transcriptional level. These cis elements vary widely in the type of control they exert on operationally linked genes. Some elements act to increase the transcription of operationally linked genes in response to environmental responses (e.g., temperature, humidity, and injury). Other cis elements may respond to developmental cues (e.g., germination, seed maturation, and flowering) or spatial information (e.g., tissue specificity). See, for example, Langridge et al., (1989) Proc. Natl. Acad. Sci. USA 86:3219–3223.These cis elements are located at varying distances from the transcription starting point; some cis elements (called proximal elements) are adjacent to a minimal core promoter region, while other elements may be positioned several kilobases upstream or downstream of the promoter (enhancers).

[00059] As used in this document, the terms 5' untranslated region or 5' UTR are defined as the untranslated segment at the 5' end of pre-mRNAs or mature mRNAs. For example, in mature mRNAs, a 5' UTR typically harbors a 7-methylguanosine cap at its 5' end and is involved in many processes such as splicing, polyadenylation, mRNA export towards the cytoplasm, identification of the 5' end of the mRNA by the translation machinery, and protection of mRNAs against degradation.

[00060] As used in this document, the term intron refers to any nucleic acid sequence comprised within a Petition 870260040239, dated 04 / 29 / 2026, p. 53 / 159 37 / 130 gene (or expressed polynucleotide sequence of interest) that is transcribed but not translated. Introns include an untranslated nucleic acid sequence in an expressed DNA sequence, as well as the corresponding sequence in RNA molecules transcribed from it. A construct described herein may also contain sequences that enhance translation and / or mRNA stability, such as introns. An example of such an intron is the first intron of gene II of the histone H3 variant of Arabidopsis thaliana or any other commonly known intron sequence. Introns can be used in combination with a promoter sequence to enhance translation and / or mRNA stability.

[00061] As used in this document, the terms transcription terminator or terminator are defined as the segment transcribed at the 3' end of pre-mRNAs or mature mRNAs. For example, longer stretches of DNA beyond the polyadenylation signal site are transcribed as a pre-mRNA. This DNA sequence typically contains a transcription termination signal for the appropriate processing of the pre-mRNA into mature mRNA.

[00062] As used in this document, the term 3' untranslated region or 3' UTR is defined as the untranslated segment at the 3' end of pre-mRNAs or mature mRNAs. For example, in mature mRNAs, this region harbors the poly-(A) tail and is known to have many roles in mRNA stability, translation initiation, and mRNA export. Furthermore, the 3' UTR is considered to include the polyadenylation signal and transcription terminator.

[00063] As used in this document, the term polyadenylation signal designates a nucleic acid sequence present in mRNA transcripts that allows transcripts, when in the presence of a poly-(A) polymerase, to be polyadenylated at the site of Petition 870260040239, dated 04 / 29 / 2026, p. 54 / 159 38 / 130 polyadenylation, for example, located between 10 and 30 bases downstream of the poly-(A) signal. Many polyadenylation signals are known in the art and are useful for the present invention. An exemplary sequence includes AAUAAA and variants thereof, as described in Loke J., et al., (2005) Plant Physiology 138(3); 1457 to 1468.

[00064] A DNA-binding transgene is a polynucleotide coding sequence that encodes a DNA-binding protein. The DNA-binding protein has the ability to subsequently bind to another molecule. A binding protein can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein), and / or a protein molecule (a protein-binding protein). In the case of a protein-binding protein, it can bind to itself (to form homodimers, homotrimers, etc.) and / or it can bind to one or more molecules of a different protein or different proteins. A binding protein can have more than one type of binding activity. For example, zinc finger proteins have DNA-binding, RNA-binding, and protein-binding activity.

[00065] Examples of DNA-binding proteins include meganucleases, zinc fingers, CRISPRs, and TALEN binding domains, which can be genetically modified to bind to a predetermined nucleotide sequence. Typically, genetically modified DNA-binding proteins (e.g., zinc fingers, CRISPRs, or TALEN) are proteins that are non-naturally occurring. Non-limiting examples of methods for genetically modified DNA-binding proteins are design and selection. A designed DNA-binding protein is a non-naturally occurring protein whose design / composition results primarily from rational criteria. Rational criteria for design include the application of substitution rules and computerized algorithms to Petition 870260040239, dated 04 / 29 / 2026, page 55 / 159 39 / 130 Process information in a database that stores information from existing ZFP, CRISPR, and / or TALEN projects and linking data. See, for example, U.S. Patent documents Nos. 6,140,081; 6,453,242; and 6,534,261; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496 and U.S. Patent Publications Nos. 20110301073, 20110239315 and 20119145940.

[00066] A zinc finger DNA-binding protein (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are amino acid sequence regions within the binding domain whose structure is stabilized through coordination with a zinc ion. The term zinc finger DNA-binding protein is generally abbreviated as zinc finger protein or ZFP. Zinc finger binding domains can be genetically modified to bind to a predetermined nucleotide sequence. Non-limiting examples of methods for genetically modifying zinc finger proteins are design and selection. An engineered zinc finger protein is a non-naturally occurring protein whose design / composition results primarily from rational criteria.Rational design criteria include applying substitution rules and computerized algorithms to process information in a database that stores existing ZFP design information and linkage data. See, for example, U.S. Patent documents 6,140,081; 6,453,242; 6,534,261 and 6,794,136; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496.

[00067] In other examples, the DNA-binding domain of one or more of the nucleases comprises a DNA-binding domain of Petition 870260040239, dated 04 / 29 / 2026, page 56 / 159 40 / 130 naturally occurring or genetically modified (non-naturally occurring) TAL effector. See, for example, Patent Application No. 20110301073, incorporated by reference in its entirety herein. Plant pathogenic bacteria of the genus Xanthomonas are known to cause many diseases in important crop plants. The pathogenicity of Xanthomonas depends on a conserved type III secretion system (T3S) that injects more than one different effector protein into the plant cell. Among these injected proteins are transcription activator-like effectors (TALENs) that mimic plant transcriptional activators and manipulate the plant transcriptome (see Kay et al., (2007) Science 318:648-651). These proteins contain a DNA-binding domain and a transcriptional activation domain. One of the best characterized TAL effectors is AvrBs3 from Xanthomonas campestgris pv. vesicatoria (see Bonas et al.)., (1989) Mol Gen Genet 218: 127 to 136 and WO2010079430). TAL effectors contain a centralized tandem repeat domain, where each repeat contains approximately 34 amino acids, which are key to the DNA binding specificity of these proteins. In addition, they contain a nuclear localization sequence and a transcriptional activation acid domain (for an evaluation, see Schornack S, et al., (2006) J Plant Physiol 163(3): 256 to 272). Furthermore, in the phytopathogenic bacteria Ralstonia solanacearum, two genes, designated brg11 and hpx17, were found to be homologous to the AvrBs3 family of Xanthomonas in the biovar strain R. solanacearum GMI1000 and in the biovar strain 4 RS1000 (See Heuer et al., (2007) Appl and Enviro Micro 73(13): 4379 to 4384). These genes are 98.9% identical in nucleotide sequence to each other, but differ by a 1,575 bp deletion in the repeat domain of hpx17.However, both gene products have less than 40% sequence identity with the proteins. Petition 870260040239, dated 04 / 29 / 2026, p. 57 / 159 41 / 130 Xanthomonas AvrBs3 family. See, for example, U.S. Patent Publication No. 20110301073, incorporated by reference in its entirety.

[00068] The specificity of these TAL effectors depends on the sequences found in the tandem repeats. The repeated sequence comprises approximately 102 bp and the repeats are typically 91 to 100% homologous to each other (Bonas et al., ibid). The polymorphism of the repeats is normally located at positions 12 and 13 and appears to be a one-to-one correspondence between the identity of the hypervariable diresidues at positions 12 and 13 with the identity of the contiguous nucleotides in the target sequence of the TAL effector (see Moscow and Bogdanove, (2009) Science 326:1.501 and Boch et al., (2009) Science 326:1.509 to 1.512). Experimentally, the natural code for DNA recognition of these TAL effectors was determined such that an HD sequence at positions 12 and 13 leads to cytosine (C) binding, NG binds to T, NI to A, C, G or T, NN binds to A or G, and ING binds to T.These DNA linkage repeats were assembled into proteins with novel combinations and repeat numbers to produce artificial transcription factors capable of interacting with new sequences and activating the expression of a non-endogenous reporter gene in plant cells (Boch et al., ibid). Genetically modified TAL proteins were linked to a FokI half-cleavage domain to produce a TAL effector domain nuclease fusion (TALEN) that exhibits activity in a yeast reporter assay (plasmid-based target).

[00069] The CRISPR nuclease system (CRISPR repeats Clustered Regularly Interspaced Short Palindromics (CRISPR) / Cas is a recently genetically modified nuclease system based on a bacterial system that can be used for genome-wide genetic manipulation. It has... Petition 870260040239, dated 04 / 29 / 2026, page 58 / 159 42 / 130 is based, in part, on the adaptive immune response of many bacteria and Archaea. When a virus or plasmid invades a bacterium, segments of the invader's DNA are converted into CRISPR RNA (crRNA) by the immune response. This crRNA then associates, through a region of partial complementarity, with another type of RNA called tracrRNA to guide the Cas9 nuclease to a region homologous to the crRNA in the target DNA called a protospacer. Cas9 performs DNA cleavage to generate blunt ends at double-strand breaks (DSBs) at sites specified by a 20-nucleotide guide sequence contained within the crRNA transcript. Cas9 requires both crRNA and tracrRNA for site-specific DNA recognition and cleavage.This system has now been genetically modified so that crRNA and tracrRNA can be combined into one molecule (the single guide RNA), and the equivalent crRNA portion of the single guide RNA can be genetically modified to guide Cas9 nuclease to target any desired sequence (see Jinek et al., (2012) Science 337, pages 816 to 821, Jinek et al., (2013), eLife 2:e00471, and David Segal, (2013) eLife 2:e00563). In other examples, crRNA associates with tracrRNA to guide Cpf1 nuclease to a region homologous to crRNA to cleave DNA with staggered ends (see Zetsche, Bernd, et al. Cell 163.3 (2015): 759 to 771). Thus, the CRISPR / Cas system can be genetically modified to create a DSB at a desired target in a genome, and DSB repair can be influenced by the use of repair inhibitors to cause an increase in error-prone repair.

[00070] In other examples, the heterologous DNA-linking transgene / coding sequence is a site-specific nuclease comprising a modified (non-naturally occurring) meganuclease (also described as a migrating endonuclease). The Petition 870260040239, dated 04 / 29 / 2026, page 59 / 159 43 / 130 recognition sequences of migrating endonucleases or meganucleases such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, IPanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII and I-TevIII are known. See also US Patent No. 5,420,032; US Patent No. 6,833,252; Belfort et al., (1997) Nucleic Acids Res. 25:3,379 to 3,388; Dujon et al., (1989) Gene 82:115 to 118; Perler et al., (1994) Nucleic Acids Res. 22, 11,127; Jasin (1996) Genet. Trends 12:224-228; Gimble et al., (1996) J. Mol. Biol. 263:163-180; Argast et al., (1998) J. Mol. Biol. 280:345-353 and the New England Biolabs catalog. Furthermore, the DNA binding specificity of migrating endonucleases and meganucleases can be genetically modified to bind to unnatural target sites. See, for example, Chevalier et al., (2002) Molec. Cell 10:895-905; Epinat et al., (2003) Nucleic Acids Res. 5 31:2952-2962; Ashworth et al., (2006) Nature 441:656 to 659; Paques et al., (2007) Current Gene Therapy 7:49 to 66; US Patent Publication No. 20070117128. The DNA-binding domains of migrating endonucleases and meganucleases can be altered within the context of the nuclease as a whole (i.e., so that the nuclease includes the cognate cleavage domain) or can be fused to a heterologous cleavage domain.

[00071] As used in this document, the term transformation encompasses all techniques by which a nucleic acid molecule can be introduced into such a cell. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation; lipofection; microinjection (Mueller et al., (1978) Cell 15:579 to 585); Agrobacterium-mediated transfer; direct DNA uptake; WHISKERS™-mediated transformation; and microprojectile bombardment. These techniques can be used for both stable and Petition 870260040239, dated 04 / 29 / 2026, page 60 / 159 44 / 130 Transient transformation of a plant cell. “Stable transformation” refers to the introduction of a nucleic acid fragment into the genome of a host organism that results in genetically stable inheritance. After stable transformation, the nucleic acid fragment is stably integrated into the genome of the host organism and any subsequent generation. Host organisms containing the transformed nucleic acid fragments are called “transgenic” organisms. “Transient transformation” refers to the introduction of a nucleic acid fragment into the nucleus, or organelle containing DNA, of a host organism, resulting in gene expression without genetically stable inheritance.

[00072] An exogenous nucleic acid sequence. In one example, a transgene / heterologous coding sequence is a sequence of genes (e.g., a herbicide resistance gene), a gene encoding an industrial or pharmaceutical compound, or a gene encoding a desirable agricultural trait. In yet another example, the transgene / heterologous coding sequence is an antisense nucleic acid sequence, in which the expression of the antisense nucleic acid sequence inhibits the expression of a target nucleic acid sequence. A transgene / heterologous coding sequence may contain regulatory sequences operationally linked to the transgene / heterologous coding sequence (e.g., a promoter). In some embodiments, a polynucleotide sequence of interest is a transgene.However, in other embodiments, a polynucleotide sequence of interest is either an endogenous nucleic acid sequence, where additional genomic copies of the endogenous nucleic acid sequence are desired, or a nucleic acid sequence that is in the antisense orientation with respect to the sequence of a target nucleic acid molecule. Petition 870260040239, dated 04 / 29 / 2026, page 61 / 159 45 / 130 nucleic acids in the host organism.

[00073] As used in this document, the term a transgenic event is produced through the transformation of plant cells with heterologous DNA, that is, a nucleic acid construct that includes a transgene / heterologous coding sequence of interest, regeneration of a plant population resulting from the insertion of the transgene / heterologous coding sequence into the plant genome, and selection of a particular plant characterized by the insertion at a particular genomic location. The term event refers to the original transformant and the progeny of the transformation that include the heterologous DNA. The term event also refers to progeny produced by a sexual cross between the transformant and another variety that includes the genomic DNA / transgene.Even after repeated backcrossing in a recurrent relative, the transgene / heterologous coding sequence DNA and flanking genomic DNA (genomic / transgene DNA) inserted from the transformed relative are present in the progeny of the cross at the same chromosomal location. The term event also refers to the DNA of the original transformant and its progeny comprising the inserted DNA and the flanking genomic sequence immediately adjacent to the inserted DNA that is expected to be transferred to progeny receiving inserted DNA that includes the transgene / heterologous coding sequence of interest as a result of a sexual cross of a parental lineage that includes the inserted DNA (e.g., the original transformant and progeny resulting from self-pollination) and a parental lineage that does not contain the inserted DNA.

[00074] As used in this document, the terms “polymerase chain reaction” or “PCR” define a procedure or technique in which minute quantities of nucleic acid, RNA and / or DNA are used. Petition 870260040239, dated 04 / 29 / 2026, page 62 / 159 46 / 130 are amplified, as described in US Patent No. 4,683,195 issued July 28, 1987. In general, sequence information from the ends of the region of interest, or beyond, needs to be available so that oligonucleotide primers can be designed; these primers will have sequences identical or similar to the opposite strands of the template to be amplified. The 5' terminal nucleotides of the two primers can coincide with the ends of the amplified material. PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, bacteriophage or plasmid sequences, etc. See generally Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51:263 (1987); Erlich, ed., PCR Technology, (Stockton Press, NY, 1989).

[00075] As used in this document, the term primer refers to an oligonucleotide capable of acting as a synthesis initiation point along a complementary strand when conditions are suitable for the synthesis of a primer extension product. Synthesis conditions include the presence of four different deoxyribonucleotide triphosphates and at least one polymerization-inducing agent such as reverse transcriptase or DNA polymerase. These are present in a suitable buffer, which may include constituents that are cofactors or that affect conditions such as pH and the like at various suitable temperatures. A primer is preferably a single-stranded sequence so that amplification efficiency is optimal, but double-stranded sequences may be used.

[00076] As used in this document, the term probe refers to an oligonucleotide that hybridizes to a target sequence. In the TaqMan® or TaqMan®-style assay procedure, the probe hybridizes to a portion of the target located between the annealing site of the Petition 870260040239, dated 04 / 29 / 2026, p. 63 / 159 47 / 130 two primers. A probe includes approximately eight nucleotides, approximately ten nucleotides, approximately fifteen nucleotides, approximately twenty nucleotides, approximately thirty nucleotides, approximately forty nucleotides, or approximately fifty nucleotides. In some embodiments, a probe includes from approximately eight nucleotides to approximately fifteen nucleotides. A probe may also include a detectable identifier, for example, a fluorophore (Texas-Red®, fluorescein isothiocyanate, etc.). The detectable identifier may be covalently attached directly to the probe oligonucleotide, for example, located at the 5' end of the probe or at the 3' end of the probe. A probe that includes a fluorophore may also include a quencher, for example, Black Hole Quencher™, Iowa Black™, etc.

[00077] As used in this document, the terms “restriction endonucleases” and “restriction enzymes” refer to bacterial enzymes, each of which cuts double-stranded DNA at or near a specific nucleotide sequence. Type 2 restriction enzymes recognize and cleave DNA at the same site and include, but are not limited to, XbaI, BamHI, HindIII, EcoRI, XhoI, SalI, KpnI, AvaI, PstI, and SmaI.

[00078] As used in this document, the term vector is used interchangeably with the terms construct, cloning vector, and expression vector and means the vehicle by which a DNA or RNA sequence (e.g., an exogenous gene) can be introduced into a host cell so as to transform the host and promote expression (e.g., transcription and translation) of the introduced sequence. A nonviral vector is intended to mean any vector that does not comprise a virus or retrovirus. In some embodiments, a vector is a DNA sequence comprising at least one origin of DNA replication and at least one gene. Petition 870260040239, dated 04 / 29 / 2026, page 64 / 159 48 / 130 of selectable marker. Examples include, but are not limited to, a plasmid, cosmid, bacteriophage, bacterial artificial chromosome (BAC), or virus that carries exogenous DNA into a cell. A vector may also include one or more genes, antisense molecules, and / or selectable marker genes and other genetic elements known in the art. A vector may transduce, transform, or infect a cell, thereby causing the cell to express the nucleic acid molecules and / or proteins encoded by the vector.

[00079] The term plasmid defines a circular strand of nucleic acid capable of autosomal replication in a host cell, whether prokaryotic or eukaryotic. The term includes nucleic acid that can be DNA or RNA and can be single-stranded or double-stranded. The plasmid of the definition may also include sequences that correspond to a bacterial origin of replication.

[00080] As used in this document, the term selectable marker gene as used herein defines a gene or other expression cassette that encodes a protein that facilitates the identification of cells into which the selectable marker gene is inserted. For example, a selectable marker gene encompasses reporter genes, as well as genes used in plant transformation to, for example, protect plant cells from a selective agent or provide resistance / tolerance to a selective agent. In one embodiment, only those cells or plants that receive a functional selectable marker have the capacity to divide or develop under conditions that have a selective agent. The phrase marker-positive refers to plants that have been transformed so as to include a selectable marker gene.

[00081] As used in this document, the term detectable marker refers to an identifier with detectability, such as, for example, a radioisotope, fluorescent compound, compound Petition 870260040239, dated 04 / 29 / 2026, p. 65 / 159 49 / 130 bioluminescent, a chemiluminescent compound, metal chelator, or enzyme. Examples of detectable markers include, but are not limited to, the following: fluorescent identifications (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic identifications (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescents, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal-binding domains, epitope labels). In one embodiment, a detectable marker may be fixed by spacer arms of varying lengths to reduce potential steric hindrance.

[00082] As used in this document, the terms cassette, expression cassette, and gene expression cassette refer to a segment of DNA that can be inserted into a nucleic acid or polynucleotide at specific restriction sites or by homologous recombination. As used in this document, the DNA segment comprises a polynucleotide encoding a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette into the appropriate reading frame for transcription and translation. In one embodiment, an expression cassette may include a polynucleotide encoding a polypeptide of interest and have elements beyond the polynucleotide that facilitate transformation in a specific host cell. In one embodiment, a gene expression cassette may also include elements that allow for enhanced expression of a polynucleotide encoding a polypeptide of interest in a host cell.These elements may include, but are not limited to: a promoter, a minimal promoter, an intensifier, a response element, a terminator sequence, a sequence of. Petition 870260040239, dated 04 / 29 / 2026, page 66 / 159 50 / 130 polyadenylation and similar compounds.

[00083] As used in this document, a linker or spacer is a link, molecule, or group of molecules that links two separate entities together. Linkers and spacers may provide optimal spacing of the two entities or may provide a labile link that allows the two entities to be separated from each other. Labile linkers include photocleavable groups, labile acidic chemical moieties, labile base chemical moieties, and enzyme-cleavable groups. The terms polylinker or multiple cloning sites, as used in this document, define a cluster of three or more Type 2 restriction enzyme sites located within 10 nucleotides of each other in a nucleic acid sequence.In other examples, the term polylinker, as used in this document, refers to a stretch of nucleotides that are targeted to join two sequences by means of any known continuous cloning method (i.e., Gibson Assembly®, NEBuilder HiFiDNA Assembly®, Golden Gate Assembly, BioBrick® Assembly, etc.). Constructs comprising a polylinker are used for insertion and / or excision of nucleic acid sequences, such as the coding region of a gene.

[00084] As used in this document, the term control refers to a sample used in an analytical procedure for comparison purposes. A control can be positive or negative. For example, when the purpose of an analytical procedure is to detect a differently expressed transcript or polypeptide in cells or tissue, it is generally preferable to include a positive control, such as a sample from a known plant that exhibits the desired expression, and a negative control, such as a sample from a known plant that does not have the desired expression. Petition 870260040239, dated 04 / 29 / 2026, page 67 / 159 51 / 130

[00085] As used in this document, the term plant includes a complete plant and any offspring, cell, tissue, or part of a plant. A class of plant that can be used in the present invention is generally as comprehensive as the class of mutagenic lower and higher plants, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. Thus, plant includes monocotyledonous and dicotyledonous plants. The term plant parts includes any part (or any parts) of a plant, including, for example and without limitation: seed (including mature seed and immature seed); a plant cutting; a plant cell; a plant cell culture; a plant organ (e.g., pollen, embryos, flowers, fruits, buds, leaves, roots, stems, and explants).A plant tissue or plant organ can be a seed, protoplast, callus, or any other group of plant cells that is organized into a structural or functional unit. A plant cell or tissue culture may have the capacity to regenerate a plant that has the physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and to regenerate a plant that has substantially the same genotype as the plant. Conversely, some plant cells do not have the capacity to be regenerated to produce plants. Regenerable cells in a plant cell or tissue culture can be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silk, flowers, grains, ears, cobs, husks, or stems.

[00086] Plant parts include harvestable parts and parts useful for propagating progeny plants. Plant parts useful for propagation include, for example, and without limitation: seed; fruit; a cutting; a seedling; a tuber; and a rootstock. Petition 870260040239, dated 04 / 29 / 2026, page 68 / 159 52 / 130 A harvestable part of a plant can be any useful part of a plant, including, for example, but not limited to: flower; pollen; seedling; tuber; leaf; stem; fruit; seed; and root.

[00087] A plant cell is the structural and physiological unit of a plant, comprising a protoplast and a cell wall. A plant cell may be in the form of a single isolated cell or an aggregate of cells (e.g., a friable callus and a cultured cell), and may be part of a higher organized unit (e.g., a plant tissue, plant organ, and plant). Thus, a plant cell may be a protoplast, a gamete-producing cell, or a cell or collection of cells that can regenerate into a complete plant. In this way, a seed comprising multiple plant cells and having the capacity to regenerate into a complete plant is considered a plant cell in embodiments in this document.

[00088] As used in this document, the term small RNA refers to several classes of non-coding ribonucleic acid (ncRNA). The term small RNA describes the short chains of ncRNA produced in bacterial, animal, plant, and fungal cells. These short chains of ncRNA can be produced naturally within the cell or can be produced by the introduction of an exogenous sequence that expresses the short chain or ncRNA. Small RNA sequences do not directly encode a protein and differ in function from other RNA, since small RNA sequences are only transcribed and not translated. Small RNA sequences are involved in other cellular functions, including gene expression and modification. Small RNA molecules are typically composed of about 20 to 30 nucleotides. Small RNA sequences can be derived from longer precursors. Precursors form structures that fold back, Petition 870260040239, dated 04 / 29 / 2026, page 69 / 159 53 / 130 molecules are linked to each other in autocomplementary regions; these are then processed by the nuclease Dicer in animals or DCL1 in plants.

[00089] Many types of small RNA exist naturally or are produced artificially, including microRNAs (miRNAs), short interfering RNAs (siRNAs), antisense RNAs, short hairpin RNAs (shRNAs), and small nucleolar RNAs (snoRNAs). Certain types of small RNA, such as microRNAs and siRNAs, are important in gene silencing and RNA interference (RNAi). Gene silencing is a gene regulation process in which a gene that would normally be expressed is "switched off" by an intracellular element, in this case, small RNA. The protein that would normally be formed from this genetic information is not formed due to the interference, and the information encoded in the gene is blocked from expression.

[00090] As used in this document, the term small RNA encompasses RNA molecules described in the literature as “tiny RNA (Storz, (2002) Science 296:1.260 to 1.263; Illangasekare et al., (1999) RNA 5:1.482 to 1.489); prokaryotic small RNA (sRNA) (Wassarman et al., (1999) Trends Microbiol. 7:37 to 45); eukaryotic non-coding RNA (ncRNA); micro-RNA (miRNA); non-small mRNA (snmRNA); functional RNA (fRNA); transfer RNA (tRNA); catalytic RNA [e.g., ribozymes, including autoacylated ribozymes (Illangasekare et al., (1999) RNA 5:1.482 to 1.489); Small nucleolar RNAs (snoRNAs), tmRNA (also known as 10S RNA, Muto et al., (1998) Trends Biochem Sci. 23:25-29; and Gillet et al., (2001) Mol Microbiol. 42:879-885); RNAi molecules, including small interfering RNA without restriction (siRNA), endoribonuclease-prepared siRNA (e-siRNA), short hairpin RNA (shRNA), and regulated RNA. Petition 870260040239, dated 04 / 29 / 2026, p. 70 / 159 54 / 130 temporarily small (stRNA), cleaved siRNA (d-siRNA), and aptamers, oligonucleotides and other synthetic nucleic acids comprising at least one uracil base.

[00091] Unless specifically explained otherwise, all technical and scientific terms used in this document have the same meaning as that commonly understood by those of ordinary skill in the technique to which this description pertains. Definitions of terms common in molecular biology can be seen in, for example: Lewin, Genes V, Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Meyers (ed.), Molecular Biology and Biotechnology: A Comprehensive Table Reference, VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). III. Regulatory elements of the GmCAB2 gene and the nucleic acids that comprise them.

[00092] Methods and compositions are provided for the use of a Glycine max Glyma10g39460 gene promoter (PsaD subunit of photosystem I) to express non-GmCAB2 transgenes in plants. In one embodiment, a promoter can be the GmCAB2 gene promoter of SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29.

[00093] In one embodiment, a polynucleotide comprising a promoter is provided, wherein the promoter is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29. In one embodiment, a promoter is a GmCAB2 gene promoter comprising a polynucleotide with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity to the polynucleotide with SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29. In another embodiment, an isolated polynucleotide is provided that comprises at least 80%, 85%, 90%, Petition 870260040239, dated 04 / 29 / 2026, page 71 / 159 55 / 130 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity with the polynucleotide of SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29. In one embodiment, a nucleic acid vector comprising a GmCAB2 promoter of SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29 is provided. In one embodiment, a polynucleotide comprising a GmCAB2 promoter that is operationally linked to a polylinker is provided. In one embodiment, a gene expression cassette comprising a GmCAB2 promoter that is operationally linked to a non-GmCAB2 transgene is provided. In one embodiment, a nucleic acid vector is provided comprising a GmCAB2 promoter that is operationally linked to a non-GmCAB2 transgene. In one embodiment, the promoter consists of SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29.In an illustrative embodiment, a nucleic acid vector comprises a GmCAB2 promoter that is operationally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linker transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof.

[00094] In one embodiment, a nucleic acid vector comprises a gene expression cassette, as disclosed herein. In one embodiment, a vector may be a plasmid, a cosmid, a bacterial artificial chromosome (BAC), a bacteriophage, a virus, or a polynucleotide fragment excised for use in direct transformation or gene targeting as a donor DNA.

[00095] Transgene expression can also be regulated by Petition 870260040239, dated 04 / 29 / 2026, page 72 / 159 56 / 130 a 5' UTR region located downstream of the promoter sequence. Both a promoter and a 5' UTR can regulate the expression of a heterologous transgene / coding sequence. Although a promoter is required to trigger transcription, the presence of a 5' UTR can increase expression levels that result in mRNA transcription for translation and protein synthesis. A 5' UTR gene region assists the stable expression of a transgene. In an additional embodiment, a 5' UTR is operationally linked to a GmCAB2 promoter. In one embodiment, a 5' UTR can be the 5' UTR of GmCAB2 with SEQ ID NO:3.

[00096] In one embodiment, a polynucleotide comprising a 5' UTR is provided, wherein the 5' UTR is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO:3. In one embodiment, a 5' UTR is a 5' UTR of GmCAB2 comprising a polynucleotide with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity to the polynucleotide of SEQ ID NO:3. In another embodiment, an isolated polynucleotide is provided that comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity to the polynucleotide of SEQ ID NO:3. In one embodiment, a nucleic acid vector comprising a 5' UTR of GmCAB2 with SEQ ID NO:3 is provided. In another embodiment, a polynucleotide comprising a 5' UTR of GmCAB2 that is operationally linked to a polylinker is provided.In one embodiment, a gene expression cassette is provided comprising a 5' GmCAB2 UTR that is operationally linked to a non-GmCAB2 transgene. In another embodiment, a nucleic acid vector is provided comprising a 5' GmCAB2 UTR that is operationally linked to a non-GmCAB2 transgene. In one embodiment, the 5' UTR consists of... Petition 870260040239, dated 04 / 29 / 2026, page 73 / 159 57 / 130 in SEQ ID NO:3. In an illustrative embodiment, a nucleic acid vector comprises a 5' UTR of GmCAB2 that is operationally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linker transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof.

[00097] Transgene expression can also be regulated by an intron region located downstream of the promoter sequence. Both a promoter and an intron can regulate the expression of a transgene / heterologous coding sequence. Although a promoter is required to trigger transcription, the presence of an intron can increase expression levels that result in mRNA transcription for translation and protein synthesis. An intron gene region assists the stable expression of a transgene. In an additional embodiment, an intron is operationally linked to a GmCAB2 promoter.

[00098] According to one embodiment, a nucleic acid vector is provided comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a GmCAB2 promoter operationally linked to a polylinker sequence, a non-GmCAB2 gene or non-GmCAB2 transgene, or combinations thereof. In one embodiment, the recombinant gene cassette comprises a GmCAB2 promoter operationally linked to a non-GmCAB2 gene or transgene. In another embodiment, the recombinant gene cassette comprises a GmCAB2 promoter, as disclosed herein, operationally linked to a polylinker sequence. The Petition 870260040239, dated 04 / 29 / 2026, page 74 / 159 The 58 / 130 polyligand is operationally linked to the GmCAB2 promoter such that inserting an encoding sequence into one of the polyligand's restriction sites operationally links the encoding sequence, allowing the encoding sequence to be expressed when the vector is transformed or transfected into a host cell.

[00099] According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a GmCAB2 promoter and a non-GmCAB2 gene. In one embodiment, the GmCAB2 promoter of SEQ ID NO: 2, SEQ ID NO: 28, or SEQ ID NO: 29 is operationally ligated to the 5' end of the non-GmCAB2 gene or transgene. In a further embodiment, the GmCAB2 promoter sequence comprises SEQ ID NO: 2, SEQ ID NO: 28, or SEQ ID NO: 29, or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO: 2, SEQ ID NO: 28, or SEQ ID NO: 29.According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a GmCAB2 promoter, a non-GmCAB2 gene, wherein the GmCAB2 promoter is operationally ligated to the 5' end of the non-GmCAB2 gene, and the GmCAB2 promoter sequence comprises SEQ ID NO:2, SEQ ID NO:28 or SEQ ID NO:29 or a sequence that has 80, 85, 90, 95, 99 or 100% sequence identity with SEQ ID NO:2, SEQ ID NO:28 or SEQ ID NO:29. In an additional embodiment, the GmCAB2 promoter sequence consists of SEQ ID NO: 2 or a 1,376 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 2. In an additional embodiment, the GmCAB2 promoter sequence consists of SEQ ID NO: 28 or a 1,453 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 28. In an additional embodiment, the GmCAB2 promoter sequence consists of SEQ ID NO:. Petition 870260040239, dated 04 / 29 / 2026, p. 75 / 159 59 / 130 or a 1,454 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 29. [000100] According to one embodiment, a nucleic acid vector is provided comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a 5' GmCAB2 UTR operationally linked to a polylinker sequence, a non-GmCAB2 gene or transgene, or a combination thereof. In one embodiment, the recombinant gene cassette comprises a 5' GmCAB2 UTR operationally linked to a non-GmCAB2 gene or transgene. In another embodiment, the recombinant gene cassette comprises a 5' GmCAB2 UTR, as disclosed herein, operationally linked to a polylinker sequence. The polylinker is operationally linked to the 5' GmCAB2 UTR such that insertion of a coding sequence into one of the polylinker restriction sites operationally links the coding sequence, allowing expression of the coding sequence when the vector is transformed or transfected into a host cell. [000101] According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a 5' UTR of GmCAB2 and a non-GmCAB2 gene. In one embodiment, the 5' UTR of GmCAB2 from SEQ ID NO:3 is operationally ligated to the 5' end of the non-GmCAB2 gene or transgene. In a further embodiment, the sequence of the 5' UTR of GmCAB2 comprises SEQ ID NO:3 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO:3. According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a 5' UTR of GmCAB2, a non-GmCAB2 gene, wherein the 5' UTR of GmCAB2 is Petition 870260040239, dated 04 / 29 / 2026, page 76 / 159 60 / 130 operationally linked to the 5' end of the non-GmCAB2 gene, and the 5' UTR sequence of the GmCAB2 gene comprises SEQ ID NO:3 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO:3. In a further embodiment, the 5' UTR sequence of GmCAB2 consists of SEQ ID NO:3 or a 124 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:3. [000102] A GmCAB2 promoter may also comprise one or more additional sequence elements. In some embodiments, a GmCAB2 promoter may comprise an exon (e.g., a leader or signal peptide, such as a chloroplast transit peptide or ER retention signal). For example, and without limitation, a GmCAB2 promoter may encode an exon embedded in the GmCAB2 promoter as an additional embodiment. [000103] Methods and compositions are further provided for using a 3' UTR of a Glycine max Glyma10g39460 gene (PsaD subunit of photosystem I) to terminate the expression of non-GmCAB2 transgenes in a plant. In one embodiment, a 3' UTR terminator can be the 3' UTR of GmCAB2 from SEQ ID NO:4. [000104] In one embodiment, a polynucleotide comprising a 3' UTR is provided, wherein the 3' UTR is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO:4. In one embodiment, a 3' UTR is a 3' UTR of GmCAB2 comprising a polynucleotide with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity to the polynucleotide of SEQ ID NO:4. In another embodiment, an isolated polynucleotide is provided that comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity to the polynucleotide of SEQ ID NO:4. In one modality, it is provided Petition 870260040239, dated 04 / 29 / 2026, page 77 / 159 61 / 130 a nucleic acid vector comprising a 3' UTR of GmCAB2 from SEQ ID NO:4. In one embodiment, a polynucleotide comprising a 3' UTR of GmCAB2 that is operationally linked to a polylinker is provided. In one embodiment, a gene expression cassette comprising a 3' UTR of GmCAB2 that is operationally linked to a non-GmCAB2 transgene is provided. In one embodiment, a nucleic acid vector comprising a 3' UTR of GmCAB2 that is operationally linked to a non-GmCAB2 transgene is provided. In one embodiment, the 3' UTR consists of SEQ ID NO:4.In an illustrative embodiment, a nucleic acid vector comprises a 3' UTR of the GmCAB2 gene that is operationally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linker transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof. [000105] According to one embodiment, a nucleic acid vector is provided comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a 3' GmCAB2 UTR operationally linked to a polylinker sequence, a non-GmCAB2 gene or heterologous transgene / coding sequence, or a combination thereof. In one embodiment, the recombinant gene cassette comprises a 3' GmCAB2 UTR operationally linked to a non-GmCAB2 gene or transgene. In another embodiment, the recombinant gene cassette comprises a 3' GmCAB2 UTR, as disclosed herein, operationally linked to a polylinker sequence. The polylinker is linked Petition 870260040239, dated 04 / 29 / 2026, page 78 / 159 62 / 130 operationally to the UTR 3' of GmCAB2 so that the insertion of an encoding sequence into one of the polylinkant's restriction sites operationally links the encoding sequence, allowing the expression of the encoding sequence when the vector is transformed or transfected into a host cell. [000106] According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a 3' UTR of GmCAB2 and a non-GmCAB2 gene. In one embodiment, the 3' UTR of GmCAB2 of SEQ ID NO:4 is operationally ligated to the 3' end of the non-GmCAB2 gene or transgene. In a further embodiment, the 3' UTR sequence of GmCAB2 comprises SEQ ID NO:4 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO:4. According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a 3' UTR of GmCAB2, a non-GmCAB2 gene, wherein the 3' UTR of GmCAB2 is operationally ligated to the 3' end of the non-GmCAB2 gene, and the 3' UTR sequence of GmCAB2 comprises SEQ ID NO:4 or a sequence that has 80, 85, 90, 95, 99 or 100% sequence identity with SEQ ID NO:4.In an additional embodiment, the GmCAB2 UTR 3' sequence consists of SEQ ID NO:4 or a 278 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4. [000107] Methods and compositions are further provided for using a terminator of a Glycine max Glyma10g39460 gene (PsaD subunit of photosystem I) to terminate the expression of non-GmCAB2 transgenes in a plant. In one embodiment, a terminator may be the GmCAB2 terminator of SEQ ID NO:5. [000108] In one embodiment, a polynucleotide comprising a terminator is provided, wherein the terminator is at least 80%, Petition 870260040239, dated 04 / 29 / 2026, p. 79 / 159 63 / 130 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO:5. In one embodiment, a terminator is a GmCAB2 terminator comprising a polynucleotide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to the polynucleotide of SEQ ID NO:5. In one embodiment, an isolated polynucleotide is provided that comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity to the polynucleotide of SEQ ID NO:5. In one embodiment, a nucleic acid vector is provided that comprises a GmCAB2 terminator of SEQ ID NO:5. In one embodiment, a polynucleotide is provided that comprises a GmCAB2 terminator that is operationally linked to a polylinker. In one embodiment, a gene expression cassette is provided that comprises a GmCAB2 terminator that is operationally linked to a non-GmCAB2 transgene.In one embodiment, a nucleic acid vector is provided comprising a GmCAB2 terminator that is operationally linked to a non-GmCAB2 transgene. In one embodiment, the terminator consists of SEQ ID NO: 5. In an illustrative embodiment, a nucleic acid vector comprises a GmCAB2 terminator that is operationally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linker transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof. [000109] According to one embodiment, a nucleic acid vector comprising a gene expression cassette is provided. Petition 870260040239, dated 04 / 29 / 2026, page 80 / 159 64 / 130 recombinant, wherein the recombinant gene expression cassette comprises a GmCAB2 terminator operationally linked to a polylinker sequence, a non-GmCAB2 gene or transgene, or a combination thereof. In one embodiment, the recombinant gene cassette comprises a GmCAB2 terminator operationally linked to a non-GmCAB2 gene or transgene. In another embodiment, the recombinant gene cassette comprises a GmCAB2 terminator, as disclosed herein, operationally linked to a polylinker sequence. The polylinker is operationally linked to the GmCAB2 terminator such that insertion of a coding sequence into one of the polylinker restriction sites operationally links the coding sequence, allowing expression of the coding sequence when the vector is transformed or transfected into a host cell. [000110] According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a GmCAB2 terminator and a non-GmCAB2 gene. In one embodiment, the GmCAB2 terminator of SEQ ID NO:5 is operationally ligated to the 3' end of the non-GmCAB2 gene or transgene. In a further embodiment, a GmCAB2 terminator sequence comprises SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO:5. According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a GmCAB2 terminator, a non-GmCAB2 gene, wherein the GmCAB2 terminator is operationally ligated to the 3' end of the non-GmCAB2 gene, and the GmCAB2 terminator sequence comprises SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO:5. In one embodiment Petition 870260040239, dated 04 / 29 / 2026, p. 81 / 159 65 / 130 additionally, the GmCAB2 terminator sequence consists of SEQ ID NO:5 or a 425 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5. [000111] In one embodiment, a nucleic acid construct is provided comprising the GmCAB2 promoter and a non-GmCAB2 gene and, optionally, one or more of the following elements: a) a 5' untranslated region; b) an intron; and c) an untranslated 3' region, wherein the GmCAB2 promoter consists of SEQ ID NO:2, SEQ ID NO:28, SEQ ID NO:29 or a sequence that has 95% sequence identity with SEQ ID NO:2, SEQ ID NO:28 or SEQ ID NO:29; The 5' UTR of GmCAB2 consists of a known 5' UTR, a SEQ ID NO:3, or a sequence that has 95% sequence identity with SEQ ID NO:3; and the 3' UTR consists of a known 3' UTR, a SEQ ID NO:4, or a sequence that has 95% sequence identity with SEQ ID NO:4; wherein, said GmCAB2 promoter is operationally linked to said heterologous transgene / coding sequence, and each optional element, when present, is also operationally linked to both the promoter and the transgene. In a further embodiment, a transgenic cell comprising the nucleic acid construct disclosed immediately above is provided. In one embodiment, the transgenic cell is a plant cell, and in a further embodiment, a plant is provided, wherein the plant comprises said transgenic cells. [000112] In one embodiment, a nucleic acid construct is provided comprising the GmCAB2 promoter and a non-GmCAB2 gene and, optionally, one or more of the following elements: Petition 870260040239, dated 04 / 29 / 2026, p. 82 / 159 66 / 130 a) an untranslated region 5'; b) an intron; and c) the 3' terminator region, wherein the GmCAB2 promoter consists of SEQ ID NO:2, SEQ ID NO:28, SEQ ID NO:29, or a sequence that has 95% sequence identity with SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29; The 5' UTR of GmCAB2 consists of a known 5' UTR, a SEQ ID NO:3, or a sequence that has 95% sequence identity with SEQ ID NO:3; and the 3' terminator consists of a known 3' terminator, a SEQ ID NO:5, or a sequence that has 95% sequence identity with SEQ ID NO:5; wherein, said GmCAB2 promoter is operationally linked to said heterologous transgene / coding sequence, and each optional element, when present, is also operationally linked to both the promoter and the transgene. In a further embodiment, a transgenic cell comprising the nucleic acid construct disclosed immediately above is provided. In one embodiment, the transgenic cell is a plant cell, and in a further embodiment, a plant is provided, wherein the plant comprises said transgenic cells. [000113] Another aspect of the present description comprises a functional variant that differs in one or more nucleotides from those of the nucleotide sequences comprising the regulatory element, provided herein. Such a variant is produced as a result of one or more modifications (e.g., deletion, rearrangement, or insertion) of the nucleotide sequences comprising the sequence described herein. For example, fragments and variants of the GmCAB2 promoter sequence of SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29 may be used. Petition 870260040239, dated 04 / 29 / 2026, page 83 / 159 67 / 130 in a DNA construct or in a gene expression cassette to trigger the expression of a heterologous coding sequence. As used in this document, the term fragment refers to a portion of the nucleic acid sequence. Fragments of the GmCAB2 promoter sequence of SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29 may retain the biological activity to initiate transcription, more particularly, to trigger transcription in a tissue-preferential manner. Alternatively, fragments of a nucleotide sequence that are useful as hybridization probes may not necessarily retain biological activity.Fragments of a nucleotide sequence for the promoter region of the GmCAB2 promoter sequence of SEQ ID NO:2, SEQ ID NO:28 or SEQ ID NO:29 can vary from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides up to the full-length nucleotide sequence of the invention for the gene promoter region. [000114] A biologically active portion of a GmCAB2 promoter sequence from SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29 can be prepared by isolating a portion of the GmCAB2 promoter sequence from SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29 and evaluating the promoter activity of the portion. The nucleic acid molecules that are fragments of a GmCAB2 promoter nucleotide sequence comprise at least about 16, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1550, 1600, 1650, or 1700 nucleotides, or up to the number of nucleotides present in a full-length GmCAB2 promoter sequence disclosed herein. [000115] Variant nucleotide sequences also include Petition 870260040239, dated 04 / 29 / 2026, page 84 / 159 68 / 130 sequences derived from a mutagenic and recombinogenic procedure, such as DNA scrambling. With such a procedure, GmCAB2 promoter nucleotide sequences of SEQ ID NO:2, SEQ ID NO:28 or SEQ ID NO:29 can be manipulated to create a new GmCAB2 promoter. In this way, recombinant polynucleotide libraries are generated from a population of sequence-related polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. The strategies for such DNA scrambling are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci. USA i: 10,747 to 10,751; Stemmer (1994) Nature 570:389 to 391; Crameri et al. (1997) Nature Biotech. 75:436 to 438; Moore et al. (1997) J. Mol. Biol. 272:336 to 347; Zhang et al. (1997) Proc. Natl. Academic. Sci. USA £4:4,504 to 4,509; Crameri et al. (1998) Nature 527:288 to 291; and US 5 patents.605,793 and 5,837,458. [000116] The nucleotide sequences described herein can be used to isolate corresponding sequences from other organisms, particularly other plants, more specifically other monocotyledons. In this way, methods such as PCR, hybridization and the like can be used to identify such sequences based on their sequence homology with the sequences presented herein. The sequences isolated based on their sequence identity with the entire GmCAB2 promoter sequence presented herein or with fragments thereof are covered by the present invention. [000117] In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from genomic DNA extracted from any plant of interest. The methods for designing primers of Petition 870260040239, dated 04 / 29 / 2026, page 85 / 159 69 / 130 PCR and PCR cloning are generally known in the art and are described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York), further on in this document, Sambrook. See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known PCR methods include, but are not limited to, methods using paired primers, nested primers, single-specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially erroneous pairing primers, and the like. [000118] In hybridization techniques, all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments from a chosen organism. Hybridization probes can be identified with a detectable group, such as P32 or any other detectable marker. Thus, for example, hybridization probes can be produced by labeling synthetic oligonucleotides based on the GmCAB2 promoter sequence of the invention. The methods for preparing hybridization probes and for constructing genomic libraries are generally known in the art and are described in Sambrook. For example, the complete GmCAB2 promoter sequence disclosed herein, or one or more portions thereof, can be used as a probe capable of specifically hybridizing with corresponding GmCAB2 promoter sequences and messenger RNAs.To achieve specific hybridization under a variety of conditions, such probes include... Petition 870260040239, dated 04 / 29 / 2026, page 86 / 159 70 / 130 sequences that are unique among GmCAB2 promoter sequences and are at least about 10 nucleotides long or at least about 20 nucleotides long. Such probes can be used to amplify the corresponding GmCAB2 promoter sequence from a chosen plant via PCR. This technique can be used to isolate additional coding sequences from a desired organism, or as a diagnostic assay to determine the presence of coding sequences in an organism. Hybridization techniques include screening hybridization of DNA libraries transferred to plates (plates or colonies; see, for example, Sambrook). [000119] According to one embodiment, the nucleic acid vector further comprises a sequence encoding a selectable marker. According to one embodiment, the recombinant gene cassette is operationally linked to an Agrobacterium T-DNA edge. According to one embodiment, the recombinant gene cassette further comprises a first and a second T-DNA edge, wherein the first T-DNA edge is operationally linked to one end of a gene construct, and the second T-DNA edge is operationally linked to the other end of a gene construct.The first and second Agrobacterium T-DNA borders can be independently selected from T-DNA border sequences originating from bacterial strains selected from the group consisting of an Agrobacterium nopalin-synthesizing T-DNA border, an Agrobacterium ocotopin-synthesizing T-DNA border, an Agrobacterium mannopin-synthesizing T-DNA border, an Agrobacterium succinamopine-synthesizing T-DNA border, or any combination thereof. In one embodiment, an Agrobacterium strain selected from the group consisting of a... Petition 870260040239, dated 04 / 29 / 2026, p. 87 / 159 71 / 130 a nopaline synthesizing strain, a mannopine synthesizing strain, a succinamopine synthesizing strain, or an octopine synthesizing strain is provided, wherein said strain comprises a plasmid, wherein the plasmid comprises a heterologous transgene / coding sequence operationally linked to a sequence selected from SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29.In another embodiment, the first and second Agrobacterium T-DNA borders can be independently selected from T-DNA border sequences originating from bacterial strains selected from the group consisting of an Agrobacterium nopalin-synthesizing T-DNA border, an Agrobacterium ocotopin-synthesizing T-DNA border, an Agrobacterium mannopin-synthesizing T-DNA border, an Agrobacterium succinamopine-synthesizing T-DNA border, or any combination thereof.In one embodiment, an Agrobacterium strain selected from the group consisting of a nopaline-synthesizing strain, a manopin-synthesizing strain, a succinamopin-synthesizing strain, or an octopin-synthesizing strain is provided, wherein said strain comprises a plasmid, wherein the plasmid comprises a heterologous transgene / coding sequence operationally linked to a sequence selected from SEQ ID NO:3 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:3. In another embodiment, an Agrobacterium strain selected from the group consisting of a nopaline-synthesizing strain, a manopin-synthesizing strain, a succinamopin-synthesizing strain, or an octopin-synthesizing strain is provided, wherein said strain comprises... Petition 870260040239, dated 04 / 29 / 2026, p. 88 / 159 72 / 130 a plasmid, wherein the plasmid comprises a heterologous transgene / coding sequence operationally linked to a sequence selected from SEQ ID NO:4 or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO:4. In one embodiment, an Agrobacterium strain selected from the group consisting of a nopalin-synthesizing strain, a mannopin-synthesizing strain, a succinamopin-synthesizing strain, or an octopin-synthesizing strain is provided, wherein said strain comprises a plasmid, wherein the plasmid comprises a heterologous transgene / coding sequence operationally linked to a sequence selected from SEQ ID NO:5 or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO:5. [000120] Transgenes of interest that are suitable for use in the constructs described herein include, but are not limited to, coding sequences that confer (1) pest or disease resistance, (2) herbicide tolerance, (3) value-added agronomic traits such as yield enhancement, nitrogen use efficiency, water use efficiency, and nutritional quality, (4) site-specific binding of a protein to DNA, (5) small RNA expression, and (6) selectable markers. According to one embodiment, the heterologous transgene / coding sequence encodes a selectable marker or gene product that confers insecticide resistance, herbicide tolerance, small RNA expression, nitrogen use efficiency, water use efficiency, or nutritional quality. 1. Insect resistance [000121] Several insect resistance genes can be operationally linked to the GmCAB2 promoter comprising the SEQ ID Petition 870260040239, dated 04 / 29 / 2026, page 89 / 159 73 / 130 NO: 2, SEQ ID NO:28 or SEQ ID NO:29 or a sequence that has 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 2, SEQ ID NO:28 or SEQ ID NO:29. In addition, insect resistance genes can be operationally linked to the 5' UTR of GmCAB2 comprising SEQ ID NO:3 or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO:3. Similarly, insect resistance genes can be operationally linked to the 3' UTR of GmCAB2 comprising SEQ ID NO:4 or the sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4. Furthermore, insect resistance genes can be operationally linked to the GmCAB2 terminator comprising SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5.Operationally linked sequences can then be incorporated into a chosen vector to enable identification and selection of transformed plants (transformants). Exemplary insect resistance coding sequences are known in the art. As examples of insect resistance coding sequences that can be operationally linked to the regulatory elements of the present description, the following traits are provided. Exemplary Lepidoptera insect resistance coding sequences include: crylA; cry1A.105; crylAb; crylAb (truncated); cry1Ab-Ac (fusion protein); crylAc (marketed as Widestrike®); cry1C; crylF (marketed as Widestrike®); cry1Fa2; cry2Ab2; cry2Ae; cry9C; mocrylF; pinlI (protease inhibitor protein); vip3A(a); and vip3Aa20.The coding sequences that provide resistance to Coleoptera insects include: cry34Ab1 (marketed as Herculex®); cry35Ab1 (marketed as Herculex®); cry3A; cry3Bb1; dvsnf7; and mcry3A. The coding sequences that provide resistance to... Petition 870260040239, dated 04 / 29 / 2026, page 90 / 159 74 / 130 multiple insect examples include ecry31.Ab. The above list of insect resistance genes is not intended to be limiting. Any insect resistance genes are covered by this description. 2. Herbicide Tolerance [000122] Several herbicide tolerance genes can be operationally linked to the GmCAB2 promoter comprising SEQ ID NO: 2, SEQ ID NO: 28 or SEQ ID NO: 29 or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 2, SEQ ID NO: 28 or SEQ ID NO: 29. In addition, insect resistance genes can be operationally linked to the 5' UTR of GmCAB2 comprising SEQ ID NO: 3 or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 3. Similarly, insect resistance genes can be operationally linked to the 3' UTR of GmCAB2 comprising SEQ ID NO:4 or the sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4. Furthermore, insect resistance genes can be operationally linked to the GmCAB2 terminator comprising SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5.Operationally linked sequences can then be incorporated into a chosen vector to allow identification and selection of transformed plants (transformants). Exemplary herbicide tolerance coding sequences are known in the art. As embodiments of herbicide tolerance coding sequences that can be operationally linked to the regulatory elements of the present description, the following traits are provided. The herbicide glyphosate contains a mode of action that inhibits the EPSPS enzyme (5-enolpyruvylshikimate-3-phosphate synthase). This enzyme is involved in the biosynthesis of aromatic amino acids that are essential for plant growth and development. Various. Petition 870260040239, dated 04 / 29 / 2026, page 91 / 159 75 / 130 enzymatic mechanisms are known in the art that can be used to inhibit this enzyme. The genes encoding such enzymes can be operationally linked to the gene regulatory elements of the present description. In one embodiment, selectable marker genes include, but are not limited to, genes encoding glyphosate resistance genes, including: EPSPS mutant genes, such as 2mEPSPS genes, cp4 EPSPS genes, mEPSPS genes, dgt28 genes; aroA genes; and glyphosate degradation genes, such as glyphosate acetyltransferase (gat) genes and glyphosate oxidase (gox) genes. These traits are currently marketed as Gly-Tol™, Optimum® GAT®, Agrisure® GT, and Roundup Ready®. Resistance genes for glufosinate and / or bialaphos compounds include dsm-2, bar, and pat genes. The bar and pat traces are currently marketed as LibertyLink®.Also included are tolerance genes that provide resistance to 2,4-D genes, such as aad-1 genes (it should be noted that aad-1 genes also have activity against arloxyphenoxypropionate herbicides) and aad-12 genes (it should be noted that aad-12 genes also have activity against pyidyloxyacetate synthetic auxins). These traits are marketed as Enlist® crop protection technology. Resistance genes for ALS inhibitors (sulfonylureas, imidazolinones, triazolpyrimidines, pyrimidinylthiobenzoates, and sulfonylaminocarbonyltriazolinones) are known in the art. These resistance genes most commonly result from point mutations to the ALS-encoding gene sequence. Other ALS inhibitor resistance genes include hra genes, csr1-2 genes, Sr-HrA genes, and surB genes. Some of the traits are marketed under the trade name Clearfield®.Herbicides that inhibit HPPD include pyrazolones, such as pyrazoxifene, benzophenone, and topramezone; triketones, such as mesotrione, sulcotrione, tembotrione, and benzobicyclone; and diketonitriles such as isoxaflutol. These are HPPD herbicides. Petition 870260040239, dated 04 / 29 / 2026, page 92 / 159 76 / 130 exemplary traits can be tolerated by known traits. Examples of HPPD inhibitors include the hppdPF_W336 gene (for isoxaflutol resistance) and the avhppd-03 gene (for meostrione resistance). An example of oxynil herbicide-tolerant traits includes the bxn gene, which has been shown to confer resistance to the herbicide / antibiotic bromoxynil. Resistance genes for dicamba include the dicamba monooxygenase (dmo) gene, as disclosed in International PCT Application No. WO 2008 / 105890. Resistance genes for PPO- or PROTOX-inhibiting herbicides (e.g., acifluorfen, butafenacil, flupropazil, pentoxazone, carfentrazone, fluazolate, piraflufen, aclonifen, azaphenidine, flumioxazin, flumiclorac, bifenox, oxyfluorfen, lactofen, fomesafen, fluoroglycophene, and sulfentrazone) are known in the art.Exemplary genes conferring PPO resistance include overexpression of a wild-type Arabidopsis thaliana PPO enzyme (Lermontova I and Grimm B, (2000) Overexpression of plastidic protoporphyrinogen IX oxidase leads to resistance to the herbal diphenyl ether acifluorfen. Plant Physiol 122:75-83), the B. subtilis PPO gene (Li, X. and Nicholl D. 2005. Development of PPO inhibitor-resistant crops and cultures. oxyfluorfen, via expression of the Bacillus subtilis protoporphyrinogen oxidase gene in transgenic tobacco plants. Biosci Biotechnol Biochem 62:558-560). Resistance genes for pyridinium- or phenoxypropionic acids and cyclohexones include ACCase inhibitor-encoding genes (e.g., Acc1-S1, Acc1-S2). and Acc1-S3).Examples of genes that confer resistance to cyclohexanediones and / or aryloxyphenoxypropanoic acid include haloxyfop, diclofop, phenoxyprop, fluazifop, and quizalofop. Finally, herbicides can inhibit photosynthesis, including triazines or... Petition 870260040239, dated 04 / 29 / 2026, page 93 / 159 77 / 130 benzonitrile plants are endowed with tolerance to psbA genes (triazine tolerance), 1s+ genes (triazine tolerance), and nitrilase genes (benzonitrile tolerance). The above list of herbicide tolerance genes is not intended to be limiting. Any herbicide tolerance genes are covered by this description. 3. Agronomic Traits [000123] Several agronomic trait genes can be operationally linked to the GmCAB2 promoter comprising SEQ ID NO: 2, SEQ ID NO: 28 or SEQ ID NO: 29 or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 2, SEQ ID NO: 28 or SEQ ID NO: 29. In addition, insect resistance genes can be operationally linked to the 5' UTR of GmCAB2 comprising SEQ ID NO: 3 or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 3. Similarly, insect resistance genes can be operationally linked to the 3' UTR of GmCAB2 comprising SEQ ID NO:4 or the sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4. Furthermore, insect resistance genes can be operationally linked to the GmCAB2 terminator comprising SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5.Operationally linked sequences can then be incorporated into a chosen vector to allow identification and selection of transformed plants (transformants). Exemplary agronomic trait coding sequences are known in the art. As modalities of agronomic trait coding sequences that can be operationally linked to the regulatory elements of the present description, the following traits are provided. Delayed fruit softening, as provided by pg genes, inhibits the production of polygalacturonase enzyme responsible for the rupture of... Petition 870260040239, dated 04 / 29 / 2026, page 94 / 159 78 / 130 pectin molecules in the cell wall, thus delaying fruit softening. Furthermore, the acc genes for delayed ripening / senescence of fruit act to suppress the normal expression of the native acc synthase gene, resulting in reduced ethylene production and delayed fruit ripening. While the accd genes metabolize the ethylene precursor of the fruit ripening hormone, resulting in delayed fruit ripening. Alternatively, the sam-k genes cause delayed ripening by reducing S-adenosylmethionine (SAM), a substrate for ethylene production. Water stress tolerance phenotypes, as provided by cspB genes, maintain normal cellular functions under water stress conditions, preserving stability and RNA translation. Another example includes the EcBetA genes, which catalyze the production of the osmoprotective compound glycine betaine, conferring tolerance to water stress.Furthermore, the RmBetA genes catalyze the production of the osmoprotective compound glycine betaine, which confers tolerance to water stress. Photosynthesis and yield enhancement are provided by the bbx32 gene, which expresses a protein that interacts with one or more endogenous transcription factors to regulate the plant's diurnal / nocturnal physiological processes. Ethanol production can be increased by expression of the amy797E genes, which encode a thermostable alpha-amylase enzyme that enhances bioethanol production by increasing the thermostability of amylase used in starch degradation. Finally, modified amino acid compositions can result in the expression of the cordapA genes, which encode a dihydrodipicolinate synthase enzyme that increases the production of the amino acid lysine. The above list of agronomic trait coding sequences is not intended to be limiting. Any agronomic trait coding sequence is encompassed. Petition 870260040239, dated 04 / 29 / 2026, p. 95 / 159 79 / 130 as described here. 4. DNA-Binding Proteins [000124] Several DNA-linking transgenes / heterologous coding sequence genes / heterologous coding sequences may be operationally linked to the GmCAB2 promoter comprising SEQ ID NO: 2, SEQ ID NO: 28 or SEQ ID NO: 29 or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 2, SEQ ID NO: 28 or SEQ ID NO: 29. In addition, insect resistance genes may be operationally linked to the 5' UTR of GmCAB2 comprising SEQ ID NO: 3 or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 3. Similarly, insect resistance genes can be operationally linked to the 3' UTR of GmCAB2 comprising SEQ ID NO:4 or the sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4.Furthermore, insect resistance genes can be operationally linked to the GmCAB2 terminator comprising SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5. Operationally linked sequences can then be incorporated into a chosen vector to enable identification and selection of transformed plants (transformants). Exemplary DNA-binding protein coding sequences are known in the art. As embodiments of DNA-binding protein coding sequences that can be operationally linked to the regulatory elements of the present description, the following types of DNA-binding proteins may include: Zinc Fingers, TALENS, CRISPRs, and meganucleases. The above list of DNA-binding protein coding sequences is not intended to be limiting. Any DNA-binding protein coding sequences are covered by the present description. Petition 870260040239, dated 04 / 29 / 2026, p. 96 / 159 80 / 130 5. Small RNA [000125] Several small RNA sequences can be operationally linked to the GmCAB2 promoter comprising SEQ ID NO: 2, SEQ ID NO: 28 or SEQ ID NO: 29 or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 2, SEQ ID NO: 28 or SEQ ID NO: 29. In addition, insect resistance genes can be operationally linked to the 5' UTR of GmCAB2 comprising SEQ ID NO: 3 or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 3. Similarly, insect resistance genes can be operationally linked to the 3' UTR of GmCAB2 comprising SEQ ID NO:4 or the sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4. Furthermore, insect resistance genes can be operationally linked to the GmCAB2 terminator comprising SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5.Operationally linked sequences can then be incorporated into a chosen vector to allow identification and selection of transformed plants (transformants). Exemplary small RNA traits are known in the art. As modalities of small RNA coding sequences that can be operationally linked to the regulatory elements of the present description, the following traits are provided. For example, the fruit ripening / senescence delay anti-efe small RNA delays fruit ripening by suppressing ethylene production through silencing the ACO gene encoding an ethylene-forming enzyme. The ccomt small RNA altered lignin production reduces guanacyl (G) lignin content by inhibiting endogenous S-adenosyl-L-methionine: trans-caffeoyl CoA 3-O-methyltransferase (CCOMT gene). Furthermore, Black Spot Injury Tolerance. Petition 870260040239, dated 04 / 29 / 2026, page 97 / 159 The 81 / 130 deficiency in Solanum verrucosum can be reduced by the small RNA Ppo5, which triggers the degradation of Ppo5 transcripts to block the development of black spot wound. Also included is the small RNA dvsnf7, which inhibits the Western Corn Rootworm with dsRNA containing a 240 bp fragment of the Western Corn Rootworm Snf7 gene. Modified starch / carbohydrates can result from small RNAs such as small RNA pPhL (degrades PhL transcripts to limit the formation of reducing sugars through starch degradation) and small RNA pR1 (degrades R1 transcripts to limit the formation of reducing sugars through starch degradation). Additional benefits are observed, such as reduced acrylamide resulting from small RNA asn1, which triggers Asn1 degradation to impair asparagine formation and reduce polyacrylamide.Finally, the non-browning phenotype of small RNA pgas suppression results in PPO suppression to produce apples with a non-browning phenotype. The above list of small RNAs is not intended to be limiting. Any small RNA coding sequences are covered by the present description. 6. Selectable Markers [000126] Several selectable markers, also described as reporter genes, can be operationally linked to the GmCAB2 promoter comprising SEQ ID NO: 2, SEQ ID NO: 28, or SEQ ID NO: 29, or a sequence having 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 2, SEQ ID NO: 28, or SEQ ID NO: 29. Additionally, insect resistance genes can be operationally linked to the 5' UTR of GmCAB2 comprising SEQ ID NO: 3, or a sequence having 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 3. Similarly, insect resistance genes can be operationally linked to the 3' UTR of Petition 870260040239, dated 04 / 29 / 2026, p. 98 / 159 82 / 130 GmCAB2 comprising SEQ ID NO:4 or the sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4. Additionally, insect resistance genes can be operationally linked to the GmCAB2 terminator comprising SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5. Operationally linked sequences can then be incorporated into a chosen vector to allow identification and selection of transformed plants (transformants). Many methods are available to confirm expression of selectable markers in transformed plants, including, for example, DNA sequencing and PCR (polymerase chain reaction), Southern blotting, RNA blotting, and immunological methods for detecting an expressed vector protein. However, reporter genes are typically observed through visual observation of proteins that, when expressed, produce a colored product.Exemplary reporter genes are known in the art and encode β-glucuronidase (GUS), luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP, Phi-YFP), red fluorescent protein (DsRFP, RFP, etc.), β-galactosidase, and the like (See Sambrook, et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, NY, 2001, the content of which is incorporated into this document in its entirety by way of reference). [000127] Selectable marker genes are used for the selection of transformed cells or tissues. Selectable marker genes include genes that encode antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO), spectinomycin / streptionomycin (AAD) resistance, and hygromycin phosphotransferase (HPT or HGR), as well as genes that confer resistance to herbicide compounds. Herbicide resistance genes Petition 870260040239, dated 04 / 29 / 2026, page 99 / 159 83 / 130 generally encode for a modified target protein insensitive to the herbicide or for an enzyme that degrades or detoxifies the herbicide in the plant before it can act. For example, glyphosate resistance has been achieved using genes encoding mutant target enzymes, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Genes and mutants for EPSPS are well known and further described below. Resistance to glufosinate ammonium, bromoxynil, and 2,4-dichlorophenoxyacetate (2,4-D) has been achieved using bacterial genes encoding PAT or DSM-2, a nitrilase, an AAD-1, or an AAD-12, each of which are examples of proteins that detoxify their respective herbicides. [000128] In one embodiment, herbicides can inhibit the growth point or meristem, including imidazolinone or sulfonylurea, and genes for resistance / tolerance of acetohydroxyacid synthase (AHAS) and acetolactate synthase (ALS) to these herbicides are well known. Glyphosate resistance genes include mutant 5-enolpyruvylshikimate-3-phosphate synthase (EPSP) and dgt-28 genes (through the introduction of recombinant nucleic acids and / or various forms of in vivo mutagenesis of native EPSP genes), aroA genes, and glyphosate acetyltransferase (GAT) genes, respectively. Resistance genes for other phosphono compounds include bar and pat genes from Streptomyces species, including Streptomyces hygroscopicus and Streptomyces viridichromogenes, and pyridinoxy or phenoxypropionic acids and cyclohexones (ACCase inhibitor encoding genes).Exemplary genes conferring resistance to cyclohexanediones and / or aryloxyphenoxypropanoic acid (including haloxyfop, diclofop, phenoxyprop, fluazifop, quizalofop) include acetyl coenzyme A carboxylase (ACCase) genes; Acc1-S1, Acc1-S2, and Acc1-S3. In one embodiment, herbicides can inhibit photosynthesis, including triazine (psbA and 1s+ genes) or benzonitrile (nitrilase gene). Furthermore, such... Petition 870260040239, dated 04 / 29 / 2026, pp. 100 / 159 84 / 130 selectable markers may include positively selected markers such as the enzyme phosphomannose isomerase (PMI). [000129] In one embodiment, selectable marker genes include, but are not limited to, genes encoding: 2,4-D; neomycin phosphotransferase II; cyanamide hydratase; aspartate kinase; dihydrodipicolinate synthase; tryptophan decarboxylase; desensitized dihydrodipicolinate synthase and aspartate kinase; bar gene; tryptophan decarboxylase; neomycin phosphotransferase (NEO); hygromycin phosphotransferase (HPT or HYG); dihydrofolate reductase (DHFR); phosphinothricin acetyltransferase; 2,2-dichloropropionic acid dehalogenase; acetohydroxyacid synthase; 5-enolpyruvylshikimate-phosphate synthase (aroA); haloarylnitrilase; acetylcoenzyme A carboxylase; Dihydropteroate synthase (sul I); and photosystem II 32 kD polypeptide (psbA). One embodiment also includes selectable marker genes encoding resistance to: chloramphenicol; methotrexate; hygromycin; spectinomycin; bromoxynil; glyphosate; and phosphinothricin.The above list of selectable marker genes is not intended to be exhaustive. Any selectable marker or reporter gene is covered by this description. [000130] In some embodiments, coding sequences are synthesized for optimal expression in a plant. For example, in one embodiment, a gene's coding sequence has been modified by codon optimization to enhance expression in plants. An insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, or a selectable marker transgene / heterologous coding sequence may be optimal for expression in a specific plant species or, alternatively, may be modified for optimal expression in plants. Petition 870260040239, dated 04 / 29 / 2026, pp. 101 / 159 85 / 130 dicotyledons or monocotyledons. Preferred plant codons can be determined from the highest frequency codons in the proteins expressed in the greatest quantity in the particular plant species of interest. In one embodiment, a coding sequence, gene, heterologous coding sequence, or transgene / heterologous coding sequence is designed to be expressed in plants at a higher level, resulting in greater transformation efficiency. Methods for optimizing plant genes are well known. Guidance related to the optimization and production of synthetic DNA sequences can be found, for example, in documents WO2013016546, WO2011146524, WO1997013402, U.S. Patent No. 6166302, and U.S. Patent No. 5380831, are incorporated herein by reference. Transformation [000131] Suitable methods for plant transformation include any method by which DNA can be introduced into a cell, for example and without limitation: electroporation (see, for example, U.S. Patent 5,384,253); microprojectile bombardment (see, for example, U.S. Patents 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861 and 6,403,865); transformation mediated by Agrobacterium (see, for example, U.S. Patents 5,635,055, 5,824,877, 5,591,616; 5,981,840, and 6,384,301); and protoplast transformation (see, for example, U.S. Patent 5,508,184). [000132] A DNA construct can be introduced directly into the genomic DNA of the plant cell using techniques such as agitation with silicon carbide fibers (see, for example, U.S. Patents 5,302,523 and 5,464,765), or DNA constructs can be introduced directly into plant tissue using biolistic methods such as DNA particle bombardment (see, for example, U.S. Patents 5,302,523 and 5,464,765). Petition 870260040239, dated 04 / 29 / 2026, pp. 102 / 159 86 / 130 example, Klein et al. (1987) Nature 327:70 to 73). Alternatively, the DNA construct can be introduced into the plant cell by means of nanoparticle transformation (see, for example, U.S. Patent Application No. 20090104700, which is incorporated herein by reference in its entirety). [000133] Furthermore, gene transfer can be achieved using non-Agrobacterium bacteria or viruses, such as Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, potato virus X, cauliflower mosaic virus and cassava vein mosaic virus and / or tobacco mosaic virus, see, for example, Chung et al. (2006) Trends Plant Sci. 11(1):1 to 4. [000134] Through the application of transformation techniques, cells of virtually any plant species can be stably transformed, and these cells can be developed into transgenic plants by well-known techniques. For example, techniques that may be particularly useful in the context of cotton transformation are described in U.S. Patent Nos. 5,846,797, 5,159,135, 5,004,863 and 6,624,344; techniques for transforming Brassica plants, in particular, are described, for example, in U.S. Patent 5,750,871; techniques for transforming soybean grains are described, for example, in U.S. Patent 6,384,301; and techniques for transforming Zea mays are described, for example, in U.S. Patents 7,060,876 and 5,591,616, and International Application PCT WO 95 / 06722. [000135] After effective delivery of an exogenous nucleic acid to a recipient cell, a transformed cell is usually identified for further culture and plant regeneration. In order to enhance the ability to identify transformants, it may be desirable to employ a selectable marker gene with the transformation vector used to generate the transformation. In an illustrative embodiment, a population of transformed cells can be examined by exposing the Petition 870260040239, dated 04 / 29 / 2026, pp. 103 / 159 87 / 130 cells to a selective agent or agents, or the cells can be analyzed for the desired marker gene trait. [000136] Cells that survive exposure to a selective agent, or cells that have been classified as positive in an analytical assay, can be cultured in media that support plant regeneration. In one embodiment, any suitable plant tissue culture medium can be modified by including additional substances such as growth regulators. The tissue can be maintained in a basic medium with growth regulators until sufficient tissue is available to initiate plant regeneration efforts, or after repeated cycles of manual selection until the tissue morphology is suitable for regeneration (e.g., at least 2 weeks), then it is transferred to conducting media for shoot formation. Cultures are transferred periodically until sufficient shoot formation has occurred. Once shoots are formed, they are transferred to a conducting medium for root formation.Once sufficient roots have formed, plants can be transferred to soil for further growth and maturation. Transgenic Plants [000137] In one embodiment, a plant, plant tissue, or plant cell comprises a GmCAB2 promoter. In one embodiment, a plant, plant tissue, or plant cell comprises the GmCAB2 promoter of a sequence selected from SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% Petition 870260040239, dated 04 / 29 / 2026, pp. 104 / 159 88 / 130 sequence identity with a selected sequence of SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29 that is operationally linked to a non-GmCAB2 gene. In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a GmCAB2 promoter that is operationally linked to a transgene or heterologous coding sequence, wherein the transgene or heterologous coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, a selectable marker transgene, or combinations thereof. [000138] According to one embodiment, a plant, plant tissue or plant cell is provided, with the plant, plant tissue or plant cell comprising a GmCAB2 promoter-derived sequence operationally linked to a transgene, with the GmCAB2 promoter-derived sequence comprising a sequence SEQ ID NO:2, SEQ ID NO:28 or SEQ ID NO:29 or a sequence having 80%, 85%, 90%, 95% or 99.5% sequence identity with SEQ ID NO:2. In one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29 operationally linked to a non-GmCAB2 gene.In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant. In one embodiment, the plant is selected from the group consisting of Zea. Petition 870260040239, dated 04 / 29 / 2026, pp. 105 / 159 89 / 130 mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybean, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybean (e.g., Glycine max). According to one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29, or a sequence having 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29 operationally linked to a non-GmCAB2 gene. In one embodiment, the plant, plant tissue, or plant cell comprises a promoter operationally linked to a heterologous transgene / coding sequence, wherein the promoter consists of SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29.According to one embodiment, the gene construct comprising the GmCAB2 promoter sequence operationally linked to a heterologous transgene / coding sequence is incorporated into the plant genome, plant tissue, or plant cell. [000139] In one embodiment, a plant, plant tissue, or plant cell comprises a 5' UTR of GmCAB2. In one embodiment, a plant, plant tissue, or plant cell comprises the 5' UTR of GmCAB2 of a sequence selected from SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:3. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:3 that is operationally linked to a non-GmCAB2 gene. In one embodiment Petition 870260040239, dated 04 / 29 / 2026, pp. 106 / 159 90 / 130 illustrative, a plant, plant tissue or plant cell comprises a gene expression cassette comprising a 5' UTR of GmCAB2 that is operationally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, a selectable marker transgene or combinations thereof. [000140] According to one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises a sequence derived from the 5' UTR of GmCAB2 operationally linked to a transgene, wherein the sequence derived from the 5' UTR of GmCAB2 comprises a SEQ ID NO:3 sequence or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:3. In another embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:3 operationally linked to a non-GmCAB2 gene. In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant.In one embodiment, the plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybeans, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybeans (e.g., Glycine max). According to one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID NO:3 or a sequence that has 80%, 85%, Petition 870260040239, dated 04 / 29 / 2026, pp. 107 / 159 91 / 130 90%, 95%, or 99.5% sequence identity with SEQ ID NO:3 operationally linked to a non-GmCAB2 gene. In one embodiment, the plant, plant tissue, or plant cell comprises a 5' UTR operationally linked to a heterologous transgene / coding sequence, wherein the 5' UTR consists of SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:3. According to one embodiment, the gene construct comprising the 5' UTR sequence of GmCAB2 operationally linked to a heterologous transgene / coding sequence is incorporated into the genome of the plant, plant tissue, or plant cell. [000141] In one embodiment, a plant, plant tissue, or plant cell comprises a 3' UTR of GmCAB2. In one embodiment, a plant, plant tissue, or plant cell comprises the 3' UTR of GmCAB2 of a sequence selected from SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:4. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:4 that is operationally linked to a non-GmCAB2 gene.In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a 3' UTR of GmCAB2 that is operationally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, or a transgene. Petition 870260040239, dated 04 / 29 / 2026, pp. 108 / 159 92 / 130 DNA linkage, a selectable marker transgene, or combinations thereof. [000142] According to one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises a sequence derived from the 3' UTR of GmCAB2 operationally linked to a transgene, wherein the sequence derived from the 3' UTR of GmCAB2 comprises a sequence SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:4. In another embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:4 operationally linked to a non-GmCAB2 gene. In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant.In one embodiment, the plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybeans, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybeans (e.g., Glycine max). According to one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:4 operationally linked to a non-GmCAB2 gene. In one embodiment, the plant, plant tissue, or plant cell comprises a 3' UTR operationally linked to a heterologous transgene / coding sequence, wherein the 3' UTR consists of SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:4. According to one. Petition 870260040239, dated 04 / 29 / 2026, pp. 109 / 159 In the 93 / 130 modality, the gene construct comprising the 3' UTR sequence of the GmCAB2 gene operationally linked to a heterologous transgene / coding sequence is incorporated into the plant genome, plant tissue, or plant cell. [000143] In one embodiment, a plant, plant tissue, or plant cell comprises a GmCAB2 terminator. In one embodiment, a plant, plant tissue, or plant cell comprises the GmCAB2 terminator of a sequence selected from SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:5. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:5 that is operationally linked to a non-GmCAB2 gene.In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a GmCAB2 terminator that is operationally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, a selectable marker transgene, or combinations thereof. [000144] According to one embodiment, a plant, plant tissue or plant cell is provided, wherein the plant, plant tissue or plant cell comprises a GmCAB2 terminator-derived sequence operationally linked to a transgene, wherein the GmCAB2 terminator-derived sequence comprises a Petition 870260040239, dated 04 / 29 / 2026, pp. 110 / 159 94 / 130 sequence SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:5. In one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:5 operationally linked to a non-GmCAB2 gene. In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant. In one embodiment, the plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybeans, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybeans (e.g., Glycine max).According to one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:5 operationally linked to a non-GmCAB2 gene. In another embodiment, the plant, plant tissue, or plant cell comprises a terminator operationally linked to a heterologous transgene / coding sequence, wherein the terminator consists of SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:5. According to one embodiment, the gene construct comprising the terminator sequence of the GmCAB2 gene operationally linked to a heterologous transgene / coding sequence is incorporated into the genome of the plant, plant tissue, or plant cell. [000145] In one embodiment, a plant, plant tissue, or plant cell according to the methods described in this document may be a dicotyledonous plant. The dicotyledonous plant, plant tissue Petition 870260040239, dated 04 / 29 / 2026, pp. 111 / 159 95 / 130 plant or plant cell can be, but is not limited to, alfalfa, rapeseed, canola, Indian mustard, Ethiopian mustard, soybean, sunflower, cotton, beans, broccoli, cabbage, cauliflower, celery, cucumber, eggplant, lettuce; melon, pea, pepper, peanut, potato, pumpkin, radish, spinach, beet, sunflower, tobacco, tomato and watermelon. [000146] An individual skilled in the art will recognize that, after the exogenous sequence has been stably incorporated into transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any one of a number of standard breeding techniques can be used, depending on the species to be crossed. [000147] This description also covers the seeds of the transgenic plants described above, wherein the seed has the transgene / heterologous coding sequence or gene construct containing the gene regulatory elements of this description. This description further covers the progeny, clones, cell lines or cells of the transgenic plants described above, wherein said progeny, clone, cell line or cell has the transgene / heterologous coding sequence or gene construct containing the gene regulatory elements of this description. [000148] The present description also covers the cultivation of transgenic plants described above, wherein the transgenic plant has the transgene / heterologous coding sequence or gene construct containing the gene regulatory elements of the present description. Consequently, such transgenic plants may be genetically modified to, inter alia, have one or more desired transgenic traits or events containing the gene regulatory elements of the present description, by being transformed with nucleic acid molecules according to the invention, and may be harvested or cultivated by any method known to those skilled in the art. Petition 870260040239, dated 04 / 29 / 2026, pp. 112 / 159 96 / 130 technique. Method of Expressing a Transgene [000149] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmCAB2 promoter operationally linked to at least one heterologous transgene / coding sequence or a polylinking sequence. In one embodiment, the GmCAB2 promoter consists of a sequence selected from SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:2, SEQ ID NO:28, or SEQ ID NO:29. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmCAB2 promoter operationally linked to at least one transgene.In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a GmCAB2 promoter operationally linked to at least one transgene. [000150] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmCAB2 promoter operationally linked to at least one transgene. In one embodiment, the GmCAB2 promoter consists of a sequence selected from SEQ ID NO:2, SEQ ID NO:28 or SEQ ID NO:29 or a sequence that has 80%, 85%, 90%, 95% or 99.5% sequence identity with a sequence selected from SEQ ID NO:2, SEQ ID Petition 870260040239, dated 04 / 29 / 2026, pp. 113 / 159 97 / 130 NO:28 or SEQ ID NO:29. In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmCAB2 promoter operationally linked to at least one transgene. In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmCAB2 promoter operationally linked to at least one transgene. In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette containing a GmCAB2 promoter operationally linked to at least one transgene.In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette, a GmCAB2 promoter operationally linked to at least one transgene. [000151] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a 5' UTR of GmCAB2 operationally linked to at least one heterologous transgene / coding sequence or a polylinker sequence. In one embodiment, the 5' UTR of GmCAB2 consists of a sequence selected from SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:3. In a Petition 870260040239, dated 04 / 29 / 2026, pp. 114 / 159 In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a 5' UTR of GmCAB2 operationally linked to at least one transgene. [000152] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 5' UTR of GmCAB2 operationally linked to at least one transgene. In one embodiment, the 5' UTR of GmCAB2 consists of a sequence selected from SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:3. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 5' UTR of GmCAB2 operationally linked to at least one transgene.In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 5' UTR of GmCAB2 operationally linked to at least one transgene. In another embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette that... Petition 870260040239, dated 04 / 29 / 2026, pp. 115 / 159 99 / 130 contains a 5' UTR of GmCAB2 operationally linked to at least one transgene. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette, a 5' UTR of GmCAB2 operationally linked to at least one transgene. [000153] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a 3' UTR of GmCAB2 operationally linked to at least one heterologous transgene / coding sequence or a polylinker sequence. In one embodiment, the 3' UTR of GmCAB2 consists of a sequence selected from SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:4. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a 3' UTR of GmCAB2 operationally linked to at least one transgene.In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a 3' UTR of GmCAB2 operationally linked to at least one transgene. [000154] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 3' UTR of GmCAB2 operationally linked to at least one transgene. In one embodiment, the Petition 870260040239, dated 04 / 29 / 2026, pp. 116 / 159 100 / 130 The 3' UTR of GmCAB2 consists of a sequence selected from SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:4. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 3' UTR of GmCAB2 operationally linked to at least one transgene. In another embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 3' UTR of GmCAB2 operationally linked to at least one transgene.In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette containing a 3' UTR of GmCAB2 operationally linked to at least one transgene. In another embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette, a 3' UTR of GmCAB2 operationally linked to at least one transgene. [000155] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmCAB2 terminator operationally linked to at least one heterologous transgene / coding sequence or a polylinker sequence. In one embodiment, the GmCAB2 terminator consists of a sequence selected from SEQ ID NO:5 or a sequence that has 80%, Petition 870260040239, dated 04 / 29 / 2026, pp. 117 / 159 101 / 130 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:5. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmCAB2 terminator operationally linked to at least one transgene. In another embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a GmCAB2 terminator operationally linked to at least one transgene. [000156] In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmCAB2 terminator operationally linked to at least one transgene. In one embodiment, the GmCAB2 terminator consists of a sequence selected from SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:5. In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmCAB2 terminator operationally linked to at least one transgene.In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmCAB2 terminator operationally linked to at least one transgene. In another embodiment, a method for expressing at least one transgene / sequence of... Petition 870260040239, dated 04 / 29 / 2026, pp. 118 / 159 102 / 130 Heterologous coding in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette containing a GmCAB2 terminator operationally linked to at least one transgene. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette, a GmCAB2 terminator operationally linked to at least one transgene. [000157] The following examples are provided to illustrate specific features and / or modalities. The examples should not be interpreted as limiting the description to the specific features or modalities exemplified. EXAMPLES Example 1: Identification of regulatory elements in soybean genomic sequences [000158] Total mRNA expression profiles for 25 soybean tissues (var. Williams 82) were obtained by Next-Generation Sequencing (NGS) and used to identify candidate soybean genes for obtaining regulatory elements. The included tissues were collected from young seedlings (expanded cotyledons, roots, and hypocotyls), V5 (leaves and stems), and R5 soybean plants (leaves, flowers, different stages of seed development, and pods). Endogenous soybean genes exhibiting the desired expression profile were identified as potential candidates for obtaining regulatory sequences. [000159] One of the genes with the desired expression pattern was Glyma14g01130, which was expressed in green tissues. This gene was identified as the GmCAB2 gene, which encodes the binding protein. Petition 870260040239, dated 04 / 29 / 2026, pp. 119 / 159 103 / 130 a / b chlorophyll type II (UniProtKB - C6TD73_SOYBN) (Apweiler, Rolf, et al. UniProt: the universal protein knowledgebase. Nucleic acids research 32.suppl_1 (2004): D115-D119; available at http: / / www.uniprot.org / ), thus, this gene was described in this document as GmCAB2. The regulatory sequences of the GmCAB2 gene were isolated and characterized for their ability to trigger transgene expression. The GmCAB2 promoter is provided in this document as SEQ ID NO:2. [000160] The regulatory sequences of the Glyma14g01130 gene (GmCAB2) were defined as a sequence of ~1.5 kb upstream of the ATG of the Glyma14g01130 gene for the promoter and 5' untranslated leader (UTR) and ~0.4 kb downstream of the stop codon of the Glyma14g01130 gene for the 3' UTR and terminator. To further refine the regulatory sequences, additional analyses of the regulatory elements were completed. Putative upstream and downstream regulatory sequences were evaluated for the presence of transposable sequence marks, repressive DNA (methylation), and chromatin (histone-H3lysine-4-dimethylation, commonly abbreviated as H3K4me2) using methods as previously disclosed in U.S. Patent Publication No. 20150128309A1, which is incorporated herein by reference in its entirety. DNA sequences from the Glyma14g01130 gene containing repressive DNA and chromatin marks were excluded from the obtained upstream and downstream regulatory sequence.Long extensions (100 bp or more) of AT-rich sequences (>75% AT-rich) within the 5' and 3' sequences were also avoided as a means of reducing difficulties with the de novo synthesis of DNA fragments. [000161] The resulting upstream GmCAB2 regulatory sequence contained both a promoter (SEQ ID NO:2) and a 5' UTR (SEQ ID NO:3). The downstream sequences included a 3' UTR (SEQ ID NO:4). Petition 870260040239, dated 04 / 29 / 2026, pp. 120 / 159 104 / 130 and a terminator (SEQ ID NO:5) of the GmCAB2 gene. The terminator sequences extended approximately 100 to 200 bp beyond the last known polyadenylation site. [000162] The sequences obtained from the soybean genome of the terminator and UTR 5' / promoter of the GmCAB2 gene (Glyma14g01130) are provided in the sequence listing. [000163] Additional candidate regulatory sequences originating from soybean were: Glyma06g15520 annotated as an actin-like coding protein (Dai, Xinbin, Ji He, and Xuechun Zhao. A novel systematic computational approach to predict transcription factor target genes. Nucleic Acid Research 35.13 (2007): 4433-4440; available at http: / / plantgrn.noble.org / ) which was named GmAct7-2 (SEQ ID NO:6) and Glyma06g18110 annotated as Glyceraldehyde-3-phosphate dehydrogenase C1 encoding (Dai, Xinbin, Ji He, and Xuechun Zhao. A novel systematic computational approach to predict transcription factor target genes). The additional regulatory sequences of Glyma06g15520 and Glyma06g18110 were obtained using the same approach described. for GmCAB2.In addition, spot modifications were made by removing some base pairs from the regulatory sequences of the Glyma06g15520 and Glyma06g18110 promoters to facilitate the cloning of the promoters into gene expression cassettes. Example 2: Cloning of soybean regulatory sequences [000164] The promoter, 5' UTR, and 3' UTR / terminator sequences of the GmCAB2 gene were synthesized using DNA2.0. A diagram of the synthetic fragment is shown in Figure 1. A linker containing multiple cloning sites was included between the promoter / 5' UTR and the 3' UTR / terminator sequence. Petition 870260040239, dated 04 / 29 / 2026, pp. 121 / 159 105 / 130 [000165] The synthetic GmCAB2 fragment (promoter / 5' UTR and terminator) was cloned into an Accession Gate entry vector, and the RFP / AAD12 reporter gene (SEQ ID NO:10) was inserted between the 5' UTR and the terminator. The reporter gene was the dual reporter encoding a translation fusion protein containing the RFP and AAD12 polypeptides linked with the rigid helical peptide linker, LAE(EAAAK)5AAA described by Arai et al. (2001), Protein Eng, 14, 529-532 and Marqusee et al. (1987), Proc Natl Acad Sci USA, 84, 8898-8902. The resulting expression cassette (SEQ ID NO:11) was moved to a binary vector and identified as pDAB122138 (Figure 2). This binary vector also contained the Green Fluorescent Protein (GFP) gene driven by the Arabidopsis Ubiquitin3 (AtUbi3) promoter and 5' UTR, and terminated by the Arabidopsis Ubiquitin 3 (AtUbi3) terminator.Likewise, the binary vector contained the synthetic phosphophinothricin N-acetyltransferase gene from Streptomyces viridochromogenes (PAT) which was triggered by the promoter of cassava vein mosaic virus (CsVMV) and terminated by the terminator of Agrobacterium tumefaciens Orf1 (AtuOrf1). The GFP and PAT gene expression cassettes are provided as SEQ ID NO:12. [000166] The cloning steps for the regulatory sequences of GmAct7-2 and GmGAPC1 were similar to those described above for GmCAB2. GmAct7-2 was tested on the pDAB122133 construct and GmGAPC1 was tested on the pDAB122134 construct. Example 3: N. benthamiana leaf infiltrations and temporary assays of expression triggered by GmCAB2, GmAct7-2 and GmGAPC1 of the RFP / AAD12 reporter [000167] Next, N. benthamiana plants were grown in a greenhouse under a 16-hour photoperiod, 27 °C / 24 °C. Plants aged 20 to 24 days were used for temporary expression assays. For this, the top 3 to 4 leaves were infiltrated using a Petition 870260040239, dated 04 / 29 / 2026, pp. 122 / 159 106 / 130 mixture of two modified Agrobacterium tumefaciens strains. The first strain was used in all infiltrations and carried the pDAB112236 construct containing the transgene that expressed the P19 silencing suppressor (Voinnet et al, (1999), Proc Natl Acad Sci USA, 96, 14.147 to 14.152). The second Agrobacterium strain was the experimental strain carrying either a test construct (with the regulatory elements GmCAB2, GmAct7-2 or GmGAPC1) or a reference control construct (Table 1). The reference constructs used contained the reporter gene RFP / AAD12 under the control of the Arabidopsis thaliana Ubiquitin 14::Arabidopsis thaliana Ubiquitin 14 terminator (AtUbi14 / AtUbi14) and the Arabidopsis thaliana Ubiquitin 10::Agrobacterium tumefaciens Orf23 promoter (AtUbi10 / AtuOrf23). Mixing ratios were based on Optical Density (OD) readings. The density of all Agrobacterium cultures was adjusted to OD 2.0.After infiltration, the plants were grown in a Conviron™ until the infiltrated leaves were collected on the fifth day after infiltration. Fluorescence data for reporter genes were collected using a Typhoon™ digitizer with multiple individual 1.5 cm leaf discs for each construct. [000168] All N. benthamiana samples were scanned in three channels; chlorophyll (488 nm blue laser, 670 nm BP30, 580 nm split), GFP (488 nm blue laser, 520 nm BP40, 580 nm split), and RFP (532 nm green laser, 580 nm BP30). The photomultiplier voltage (PMT) setting used for N. benthamiana was 340 for chlorophyll, 340 for GFP, and 360 for RFP. [000169] Transient test results of N. Benthamiana are shown in Table 1. Analysis of the fluorescence produced by the reporter transgene RFP / AAD12 revealed that the regulatory sequences of GmCAB2 resulted in fluorescence of Petition 870260040239, dated 04 / 29 / 2026, pp. 123 / 159 107 / 130 The average RFP (473.2 pixels / area) was significantly higher (p<0.0001) than the average background fluorescence (26.1 pixels / area). The RFP / AAD12 fluorescence of the GmCAB2 regulatory sequences was observed to be lower (p<0.0001) than the average RFP / AAD12 fluorescence of the constructs driven by the AtUbi14 / AtUbi14 and AtUbi10 / AtuOrf23 reference regulatory elements; 7,567.4 and 3,084.5 pixels / area, respectively. The significantly higher RFP / AAD12 fluorescence than the background supported by GmCAB2 regulatory elements indicated that the Glyma14g01130 GmCAB2 regulatory sequences are functional and can be used to trigger the expression of a heterologous transgene in N. benthamiana leaf temporary assays. [000170] In contrast, for the GmCAB2 regulatory sequences that triggered significantly higher average RFP / AAD12 fluorescence expression than the background, the GmAct2-2 and GmGAPCI regulatory sequences contained within the pDAB122333 and pDAB122134 constructs, respectively, produced only low expression levels that were similar to the background (Table 1). These results demonstrate that the newly isolated GmAct2-2 and GmGAPC1 candidate regulatory sequences did not have the capacity to trigger RFP / AAD12 transgene expression. The lack of RFP / AAD12 expression in the pDAB122333 and pDAB122134 constructs was not due to unsatisfactory infiltration because the second transgene within these constructs, GFP, exhibited strong fluorescence that was significantly higher than the background (p<0.0001).Thus, these results show that the de novo candidate regulatory sequences of Glyma06g15520 and Glyma06g18110 did not have the ability to trigger the expression of heterologous reporter transgenes. [000171] Based on these results, the pDAB122333 and pDAB122134 constructs, which carry GmAct7-2 and GmGAPC1, respectively, do not Petition 870260040239, dated 04 / 29 / 2026, pp. 124 / 159 108 / 130 were further pursued. In contrast, the pDAB122138 construct containing the GmCAB2 regulatory sequences and exhibiting high levels of RFP / AAD12 fluorescence, compared to the background fluorescence of N. benthamiana leaves, proceeded to further testing in stably transformed Arabidopsis transgenic plants. Petition 870260040239, dated 04 / 29 / 2026, pp. 125 / 159 TABLE 1. Results of RFP / AAD12 fluorescence assay on temporarily transformed N. benthamiana leaves. Construct Regulator Element Name Number of Samples RFP Fluorescence (pixels / area) GFP Fluorescence (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error P19 only None (background) 216 26.1 24.0 14.4 1.0 34.6 33.5 14.0 1.0 pDAB 117559 AtUbi14 / AtUbi14 261 7567.4*** 6698.4 5191.7 321.4 9770.9*** 9230.0 4609.7 285.3 pDAB 117560 AtUbi10 / AtuOrf23 260 3084.5*** 2760.0 1984.2 123.1 8915.9*** 8737.2 5404.7 335.2 pDAB 122133 GmAct7-2 / GmAct7-2 30 25.3 24.6 5.1 0.9 5295.7*** 5184.5 2085.8 380.8 pDAB 122138 GmCAB2 / GmCAB2 90 473.2*** 386.7 313.0 33.0 5904.0*** 5262.2 3414.9 360.0 109 / 130 Note: *** indicates mean RFP or GFP values ​​that are significantly higher (p<0.0001) than the mean background fluorescence. Due to the presence of unequal variances, Welch's t-test was used to compare the mean RFP or GFP fluorescence of each construct to the corresponding mean fluorescence values ​​of the P19 background control only. Statistical analyses were conducted using the JMP® statistical package. Petition 870260040239, dated 04 / 29 / 2026, pp. 126 / 159 110 / 130 Example 4: Agrobacterium-mediated transformation of Arabidopsis and molecular analyses of transgenic events. [000172] The Columbia-0 (Col-0) ecotype of Arabidopsis thaliana was used to test the expression of the RFP / AAD12 reporter under the control of GmCAB2 regulatory elements. A standard Arabidopsis transformation procedure was used to produce transgenic seed by the flowering immersion method (Clough and Bent, 1998). Ti seeds were sown in sorting trays (10.5x21x1, TO Plastics Inc., Clearwater, MN). For this, 200 mg of cold stratified seeds (0.1% agar + 385 mg / L Liberty for 48 hours before sowing) were distributed into sorting trays using a modified air-driven sprayer to distribute 10 mL of seed suspension per sorting tray. The trays were covered with moisture domes, marked with seed identifiers, and placed in a Conviron™ with an individual irrigation tray under each tray. The moisture dome was removed approximately five days after sowing.The first irrigation of selection trays was done using subirrigation with Hoagland fertilizer approximately 10 to 14 days after sowing. In addition to herbicide stratification, the plants were sprayed with a 0.2% solution (20 pl / 10 mL distilled H2O) of Liberty™ herbicide seven and nine days after sowing. Liberty™-resistant T1 plants were transplanted from selection trays to two-inch (five-centimeter) pots and allowed to grow for seven to ten days before sampling for molecular analysis. [000173] Next, DNA was extracted from leaves using a leaf of approximately 0.5 square centimeters of Arabidopsis that was removed from each plant. Samples were collected in a 96-well DNA extraction plate. Then, 200 µl of extraction buffer were added to each well and the tissue was broken up with microspheres. Petition 870260040239, dated 04 / 29 / 2026, pp. 127 / 159 111 / 130 mm stainless steel tissue was macerated using a Kleko™ tissue sprayer (three minutes at maximum setting). After tissue maceration, DNA was isolated using the BioSprint 96 DNA Plant™ Kit. [000174] For qPCR, the transgene copy number was assessed using a hydrolysis probe designed to detect the pat and aad12 genes (Table 2). The endogenous Arabidopsis gene, AtTafII15 (Arabidopsis locus: AT4G31720), was used for standardization of the DNA template concentration (Table 2). qPCR was performed as follows: 10 μl of Probes Master™ mixture with a final concentration of 0.4 μM of each primer and 0.2 μM of each probe. PCR cycles were performed using 95°C for 10 min, followed by 40 amplification cycles (95°C for 1 min, 60°C for 40 min, and 72°C for 1 s) and 40°C for 1 s. All qPCR assays were performed in biplex format, with pat or aad12 assays paired with the assay for the endogenous AtTafII15 gene. cp scores, the point at which the fluorescence signal crosses the background threshold, were determined using the advanced relative quantification algorithm, based on the ΔΔΦ method (LightCycler® software version 1).5) were used to analyze real-time PCR data. All samples were then calibrated to a known hemizygous plant to obtain the transgene copy number. Up to 100 T1 events that were identified as being resistant to Liberty™ were screened to identify single- and double-copy transgene events that were used for further transgene expression analyses in T1 transgenic plants. TABLE 2. Primers and probes used for genotyping and zygosity analysis of transgenic Arabidopsis plants. Oligo Name Oligo Sequence Fluorophore Identification Target Gene AtTafII15 F SEQ ID NO:13 GAGGATTAGGGTTTCCAACGGAG — AtTafII15 AtTafII15R SEQ ID NO:14 GAGAATTGAGCTGAGACGAGG — AtTafII15 Petition 870260040239, dated 04 / 29 / 2026, pp. 128 / 159 112 / 130 Sonda AtTafII15 SEQ ID NO:15 agagaagtttcgacggatttcgggc HEX AtTafII15 Iniciador PAT A SEQ ID NO:16 acaagagtggattgatgatctagagaggt — pat Iniciador PAT S SEQ ID NO:17 ctttgatgcctatgtgacacgtaaacagt — pat Sonda PAT_AS SEQ ID NO:18 agggtgttgtggctggtattgcttacgct Cy5 pat AAD12 F SEQ ID NO:19 cagagtccatgctcaccaat — AAD12 AAD12 R SEQ ID NO:20 acgtggcaacttgaaatcc — AAD12 Sonda AAD12 SEQ ID NO:21 tggagatgtggttgtgtgggacaa Cy5 (T1) ou FAM (T2) AAD12 Example 5: Availability of genes to operate on a sequence of GmCAB2 genes in Arabidopsis plants [000175] To evaluate the expression of the RFP / AAD12 reporter gene driven by the GmCAB2 promoter regulatory elements, the GmCAB2 5' UTR, and the GmCAB2 terminator, single-copy transgenic events were identified and analyzed for RFP / AAD12 fluorescence using the Typhoon instrument. All samples were scanned in three channels: chlorophyll (488 nm blue laser, 670 nm BP30, 580 nm split), GFP (488 nm blue laser, 520 nm BP40, 580 nm split), and RFP (532 nm green laser, 580 nm BP30). The definition of PMT for leaf tissue was chlorophyll 400, GFP 400, and RFP 420. For fluorescence analyses in leaves, fully expanded rosette leaves from low-copy transgenic events (1 to 2 copies) were harvested from each plant and sorted from the adaxial (top) side.The Contour Drawing function was used to highlight leaf shapes, and normalized fluorescence was determined by dividing the signal volume by the leaf surface area. The results are presented in Table 3. [000176] Analysis of Ti events regarding RFP / AAD12 fluorescence revealed that the GmCAB2 regulatory elements supported high mean RFP / AAD12 fluorescence (1,825.1 pixels / area) which was statistically higher (p<0.0001) than the Petition 870260040239, dated 04 / 29 / 2026, pp. 129 / 159 113 / 130 average background fluorescence (350.5 pixels / area) detected in the non-transgenic wild-type control (Wt) (Table 3). These results show that the GmCAB2 regulatory sequences triggered higher expression than the background of the RFP / AAD12 reporter in transgenic Arabidopsis thaliana plants. The average RFP / AAD12 fluorescence produced by the GmCAB2 regulatory elements was not statistically different from the RFP / AAD12 fluorescence levels of the pDAB117559 and pDAB117560 reference constructs (p<0.0912 and 0.1551, respectively, not shown). In the pDAB117559 and pDAB117560 constructs, the RFP / AAD12 reporter was under the control of the following regulatory elements; Arabidopsis thaliana promoter Ubiquitin 14::Arabidopsis thaliana terminator Ubiquitin 14 and the Arabidopsis thaliana Ubiquitin promoter 10::Agrobacterium tumefaciens terminator Orf23, respectively.Thus, pDAB122138 supported RFP / AAD12 fluorescence similar to that of the positive controls pDAB117559 and pDAB117560, indicating that GmCAB2 is highly effective as a regulatory sequence in Arabidopsis transgene applications. Based on the above results, the pDAB122138 transgenic events containing the GmCAB2 regulatory sequences were advanced for further characterization in Arabidopsis T2. Petition 870260040239, dated 04 / 29 / 2026, pp. 130 / 159 TABLE 3. Results of RFP / AAD12 reporter gene expression test / heterologous coding sequence expression in leaves of transgenic Arabidopsis Ti plants. Construct Regulatory Element Number of Events RFP Fluorescence (pixels / area) GFP Fluorescence (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error Wt None (background) 57 350.5 269.3 231.4 30.7 665.2 614.1 218.0 28.9 pDAB 117559 AtUbi14 / AtUbi14 60 1492.3*** 1537.3 495.2 63.9 5164.1*** 5164.7 1605.8 207.3 pDAB 117560 AtUbi10 / AtuOrf23 63 1547.6*** 1556.1 504.5 63.6 5521.2*** 5515.4 1434.3 180.7 pDAB 122138 GmCAB2 / GmCAB2 20 1825.1*** 1425.1 1485.9 796.2 7749.4*** 6707.5 2378.4 531.8 Note: *** indicates means that differ from the mean fluorescence of the Wt control at p<0.0001. Due to the presence of unequal variances, Welch's t-test was used to compare the mean RFP or GFP fluorescence of each construct to the corresponding fluorescence means of the Wt background control. Statistical analyses were conducted using the JMP® statistical package. 114 / 130 Petition 870260040239, dated 04 / 29 / 2026, pp. 131 / 159 115 / 130 Example 6: Expression of genes operationally linked to GmCAB2 regulatory sequences in leaves of Arabidopsis T2 plants. [000177] The GmCAB2 regulatory sequences exhibited lower, but significantly higher, expression levels than the background compared to the expression levels of the reference regulatory sequences Arabidopsis thaliana Ubiquitin 14 promoter::Arabidopsis thaliana Ubiquitin 14 terminator and Arabidopsis thaliana Ubiquitin 10 promoter::Agrobacterium tumefaciens Orf23 terminator in Arabidopsis Ti (EXAMPLE 5). Selected events containing the GmCAB2 regulatory sequences that trigger the RFP / AAD12 reporter gene were advanced for further characterization in Arabidopsis T2 plants. Consequently, five T1 plants expressing medium to high levels of RFP / AAD12 and GFP were selected. These five plants contained pDAB122138 transgenic events and were used for T2 plant testing. From these five events, 56 plants were cultivated for each event.The T2 plants were genotyped at the molecular level, as described in EXAMPLE 4. Based on the molecular analyses, all homozygous plants and a comparable number of hemizygous plants were retained for fluorescence analysis of the four single-copy events. To simplify data interpretation for the two-copy transgenic event, only hemizygous plants were retained for expression analyses. [000178] The results of the analyses in T2 transgenic plants are provided in Table 4. The results for homozygous (1 copy) and hemizygous (1 and 2 copies) pDAB122138 transgenic plants containing the RFP / AAD12 transgene under the control of GmCAB2 regulatory elements exhibited RFP / AAD12 fluorescence that was significantly higher than the background fluorescence of plants. Petition 870260040239, dated 04 / 29 / 2026, pp. 132 / 159 116 / 130 of non-transgenic control. The mean RFP / AAD12 fluorescence produced by hemizygotes (7,243.0 pixels / area) and homozygotes (11,340.2 pixels / area) for transgene plants carrying the GmCAB2 regulatory elements was significantly higher than the background fluorescence (1,137.5 pixels / area, p<0.0001, Table 4). Comparison of pDAB122138 hemizygous plants with hemizygous plants of the reference constructs pDAB117559 and pDAB117560 revealed that pDAB122138 supported RFP / AAD12 fluorescence that was lower than that of pDAB117559 (10,943.2 pixels / area, p<0.0001) and similar to that of pDAB117560 (8,239.2 pixels / area, p=0.0965, not shown). Comparison of homozygous pDAB122138 plants with homozygous plants of the reference constructs pDAB117559 and pDAB117560 revealed that pDAB122138 exhibited lower RFP / AAD12 fluorescence than both the reference constructs pDAB117559 (17,194.3 pixels / area) and pDAB117560 (15,000 pixels / area).334.3 pixels / area) (p<0.0001, not shown). In the pDAB117559 and pDAB117560 constructs, the RFP / AAD12 reporter was under the control of the following regulatory elements: Arabidopsis thaliana Ubiquitin 14 promoter::Arabidopsis thaliana Ubiquitin 14 terminator and Arabidopsis thaliana Ubiquitin 10 promoter::Agrobacterium tumefaciens Orf23 terminator, respectively. These results demonstrate that GmCAB2 regulatory sequences support robust heritable expression of transgenes across two generations of transgenic events. Petition 870260040239, dated 04 / 29 / 2026, pp. 133 / 159 TABLE 4. Results of RFP / AAD12 reporter gene expression test / heterologous coding sequence expression in leaves of transgenic Arabidopsis T2 plants Construct Regulatory Elements Zygocity Number of plants RFP Fluorescence (pixels / area) GFP Fluorescence (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error Wt None (background) none 15 1137.5 1062.9 384.0 99.2 337.0 322.8 60.3 15.6 pDAB 117559 AtUbi14 / AtUbi14 hemi 26 10943.2*** 10394.5 2862.0 561.3 3352.3*** 3355.0 380.2 74.6 homo 40 17194.3*** 16208.0 6090.0 962.9 5649.3*** 6144.2 1509.4 238.7 pDAB 117560 AtUbi10 / AtuOrf23 hemi 25 8239.2*** 8031.3 1928.4 385.7 3436.3*** 3312.6 674.3 134.9 homo 50 15334.3*** 15077.5 4080.2 577.0 6308.3*** 6152.4 1385.5 195.9 pDAB 122138 GmCAB2 / GmCAB2 hemi 25 7243.0*** 7218.9 2215.8 443.2 5055.8*** 4806 1950.84 390.2 homo 37 11340.2*** 10249.8 4703.8 773.3 7665.2*** 6789.2 3708.7 609.7 Note: *** indicates means that differ from the mean fluorescence of the Wt control at p<0.0001. Due to the presence of unequal variances, Welch's t-test was used to compare the mean RFP or GFP fluorescence of each construct to the corresponding fluorescence means of the Wt background control. Statistical analyses were conducted using the JMP® statistical package. 117 / 130 Petition 870260040239, dated 04 / 29 / 2026, pp. 134 / 159 118 / 130 [000179] Interrogation of individual transgenic events (Table 5) revealed that RFP / AAD12 fluorescence was detected in all independent transgenic events examined. In these four single-copy transgenic events, homozygous plants exhibited higher mean RFP / AAD12 fluorescence than hemizygous plants, indicating that transgene expression in these events was copy number dependent. [000180] In summary, testing of transgenic Arabidopsis T2 events showed that GmCAB2 regulatory elements trigger heritable expression of the RFP / AAD12 reporter gene that is higher than the Wt background fluorescence. These results reaffirm that GmCAB2 regulatory elements are effective in triggering heritable transgene expression in stably transformed Arabidopsis plants. Petition 870260040239, dated 04 / 29 / 2026, pp. 135 / 159 TABLE 5. Test results for the expression of the RFP / AAD12 reporter gene / heterologous coding sequence in leaves of homozygous and hemizygous plants for individual Arabidopsis T2 events. Construct Event Regulator Element Name Number of Samples RFP Fluorescence (pixels / area) GFP Fluorescence (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error Col-0 Wt none 15 1137.5 1062.9 384.0 99.2 337.0 322.8 60.3 15.6 pDAB117559;AtUbi14 / AtUbi14 117559[2]-057 hemi 5 10415,0 10400,7 930,2 416,0 3529,5 3519,1 159,8 71,5 117559[2]-057 homo 8 17840,7 19158,8 3743,1 1323,4 6196,5 6607,7 1257,6 444,6 117559[2]-062 hemi 6 9320,9 9586,9 808,9 330,2 3486,9 3472,2 161,6 66,0 117559[2]-062 homo 9 14534,0 16156,6 3679,1 1226,4 5455,1 6345,2 1482,7 494,2 117559[8]-246 hemi 5 14037,8 13650,2 1112,2 497,4 3351,0 3316,9 488,5 218,4 117559[8]-246 homo 9 23442,5 25126,5 5547,1 1849,0 5724,0 5870,9 1573,9 524,6 117559[8]-314 hemi 5 13987,2 13806,8 1671,9 747,7 3411,0 3489,6 465,9 208,3 117559[8]-314 homo 4 21176,8 20884,0 7321,8 3660,9 5296,8 5217,0 2391,4 1195,7 117559[8]-391 hemi 5 7279,7 7364,9 922,8 412,7 2956,2 3020,1 350,4 156,7 117559[8]-391 homo 10 11855,0 12938,5 2711,7 857,5 5459,9 5750,6 1475,0 466,4 pDAB117560;AtUbi10 / AtuOrf23 117560[2]-191 hemi 5 8889.2 9549.1 2092.5 935.8 3831.1 4015.2 859.5 384.4 117560[2]-191 homo 103.1 14866.4 4404.6 1392.9 6352.1 6030.2 1756.8 555.6 117560[3]-254 hemi 5 9158.7 8167.0 2264.3 1012.6 3611.3 336.3364. 297.1 117560[3]-254 homo 10 14704.1 14959.2 4009.6 1267.9 6283.7 6343.9 1273.8 402.8 117560[3]-288 hemi 56.86.838 948.7 424.3 3066.4 3136.1 256.9 114.9 117560[3]-288 homo 10 18550.4 18921.9 3158.6 998.8 7007.3 6673.1177.7 117560[3]-325 hemi 5 7716.5 6838.0 1951.7 872.8 3172.3 3092.6 668.9 299.1 117560[3]-325 homo 10 14238.135.36.46 1466.3 6230.7 5924.0 1444.7 456.9 117560[3]-353 hemi 5 8924.7 8444.1 1354.0 605.5 3500.2 3459.6 733.6 328.1 117560[3]-353 homo 10 13848.3 13274.9 2821.9 892.4 5667.9 5782.0 1125.1 355.8; 119 / 130 Petition 870260040239, of 29 / 04 / 2026, p. 136 / 159 pDAB122138; GmCAB2 / GmCAB2 122138[2]-015 hemi 5 9839.0 9874.0 907.8 406.0 7051.1 7011.6 753.4 336.9 homo 10 14386.6 15350.7 4942.8 1563.1 11145.9 11939.7 3385.3 1070.5 122138[3]-053 hemi 5 6722.5 6275.6 859.1 384.2 3412.6 3357.5 561.1 250.9 homo 10 9989.4 9933.0 3655.9 1156.1 4323.9 4147.5 1290.2 408.0 122138[3]-056 hemi 5 4081.9 3675.5 897.8 401.5 2934.5 2985.6 636.8 284.8 homo 10 7667.6 7686.4 2039.4 644.9 6063.0 6432.8 1811.7 572.9 122138[4]-144 (two copies) hemi 5 7433.0 7218.9 888.3 397.3 6210.3 5962.3 1681.7 752.1 122138[5]-189 hemi 5 8138.5 8171.1 1999.8 894.4 5670.4 5409.2 1613.6 721.6 homo 7 14164.2 12672.9 4418.9 1670.2 9755.1 11151.2 3120.8 1179.6 120 / 130 Petition 870260040239, dated 04 / 29 / 2026, pp. 137 / 159 121 / 130 Example 7: Other transgenic plants produced with the regulatory elements of GmCAB2 [000181] Soybeans can be transformed with genes operationally linked to the GmCAB2 promoter, the GmCAB2 5' UTR, the GmCAB2 3' UTR and / or the GmCAB2 terminator using the same techniques previously described in Example 11 or Example 13 of patent application WO 2007 / 053482. [000182] Cotton can be transformed with genes operationally linked to the GmCAB2 promoter, the GmCAB2 5' UTR, the GmCAB2 3' UTR and / or the GmCAB2 terminator using the same techniques previously described in Example No. 14 of US Patent No. 7,838,733 or in Example No. 12 of patent application WO 2007 / 053482 (Wright et al.). [000183] Canola can be transformed with genes operationally linked to the GmCAB2 promoter, the GmCAB2 5' UTR, the GmCAB2 3' UTR and / or the GmCAB2 terminator using the same techniques previously described in Example No. 26 of U.S. Patent No. 7,838,733 or in Example No. 22 of patent application WO 2007 / 053482 (Wright et al.). [000184] Wheat can be transformed with genes operationally linked to the GmCAB2 promoter, the GmCAB2 5' UTR, the GmCAB2 3' UTR and / or the GmCAB2 terminator using the same techniques previously described in Example 23 of patent application WO 2013 / 116700A1 (Lira et al.). [000185] Rice can be transformed with genes operationally linked to the GmCAB2 promoter, the GmCAB2 5' UTR, the GmCAB2 3' UTR and / or the GmCAB2 terminator using the same techniques previously described in Example 19 of patent application WO 2013 / 116700A1 (Lira et al.). Example 8: Agrobacterium-mediated transformation of genes Petition 870260040239, dated 04 / 29 / 2026, pp. 138 / 159 122 / 130 functionally linked to the regulatory elements of GmCAB2 [000186] In light of the present description, additional crops may be transformed according to the embodiments of the present description using techniques known in the art. For Agrobacterium-mediated transformation of rye, see, for example, Popelka JC, Xu J, Altpeter F., Generation of transgenic low copy number rye after biolistic gene transfer and production of transgenic wilted plants (Secale cereale L.) without instant labeling, Transgenic Res., October 2003;12(5):587-596.). For Agrobacterium-mediated transformation of sorghum, see, for example, Zhao et al., “Agrobacterium-mediated sorghum transformation,” Plant Mol Biol., December 2000;44(6):789–798. For Agrobacterium-mediated transformation of barley, see, for example, Tingay et al., “Agrobacterium tumefaciens-mediated barley transformation,” The Plant Journal, (1997) 11:1369–1376.For Agrobacterium-mediated transformation of wheat, see, for example, Cheng et al., Genetic transformation of wheat mediated by Agrobacterium tumefaciens, Plant Physiol., November 1997;115(3):971-980. For Agrobacterium-mediated transformation of rice, see, for example, Hiei et al., Rice transformation mediated by Agrobacterium tumefaciens, Plant Mol. Biol., September 1997;35(1-2):205-218. [000187] The Latin names for these and other plants are given below. It should be clear that other transformation techniques (not Agrobacterium) can be used to transform genes operationally linked to the GmCAB2 promoter, the 5' UTR to GmCAB2, the 3' UTR to GmCAB2 and / or the GmCAB2 terminator, for example, in these or other plants. Examples include, but are not limited to; Maize (Zea mays), Wheat (Triticum spp.), Rice (Oryza spp. and Zizania spp.), Barley (Hordeum spp.), Cotton (Abroma Petition 870260040239, dated 04 / 29 / 2026, pp. 139 / 159 123 / 130 augusta and Gossypium spp.), Soybean (Glycine max), Sugar beet and table beet (Beta spp.), Sugarcane (Arenga pinnata), Tomato (Lycopersicon esculentum and other spp., Physalis ixocarpa, Solanum incanum and other spp., and Cyphomandra betacea), Potato (Solanum tuberosum), Sweet potato (Ipomoea batatas), Rye (Secale spp.), Peppers (Capsicum annuum, chinense and frutescens), Lettuce (Lactuca sativa, perennis and pulchella), Cabbage (Brassica spp.), Celery (Apium graveolens), Eggplant (Solanum melongena), Peanut (Arachis hypogea), Sorghum (Sorghum spp.), Alfalfa (Medicago sativa), Carrot (Daucus carota), Beans (Phaseolus spp. and other genera), Oats (Avena sativa and strigosa), Peas (Pisum, Vigna and Tetragonolobus spp.), Sunflower (Helianthus annuus), Pumpkin (Cucurbita spp.), Cucumber (Cucumis sativa), Tobacco (Nicotiana spp.), Arabidopsis (Arabidopsis thaliana), Grass (Lolium, Agrostis, Poa, Cynodon, and other genera), Clover (Trifolium), Vetch (Vicia).The transformation of such plants, with genes operationally linked to the GmCAB2 promoter, the GmCAB2 5' UTR, the GmCAB2 3' UTR, and / or the GmCAB2 terminator, for example, is contemplated in the embodiments of the present description. [000188] The use of the GmCAB2 promoter, the GmCAB2 5' UTR, the GmCAB2 3' UTR, and / or the GmCAB2 terminator to activate operationally linked genes can be employed in many evergreen and deciduous wood species. Such applications are also within the scope of the embodiments of this description. These species include, but are not limited to: alder (Alnus spp.), ash (Fraxinus spp.), aspen and poplar species (Populus spp.), beech (Fagus spp.), birch (Betula spp.), cherry (Prunus spp.), eucalyptus (Eucalyptus spp.), walnut (Carya spp.), maple (Acer spp.), oak (Quercus spp.), and pine (Pinus spp.). [000189] The use of the GmCAB2 promoter, the 5' UTR of GmCAB2, the 3' UTR of GmCAB2 and / or the GmCAB2 terminator to activate genes Petition 870260040239, dated 04 / 29 / 2026, pp. 140 / 159 124 / 130 coupled operationally can be employed in ornamental and fruit-bearing species. Such applications are also within the scope of the embodiments of this description. Examples include, but are not limited to: rose (Rosa spp.), burning bush (Euonymus spp.), petunia (Petunia spp.), begonia (Begonia spp.), rhododendron (Rhododendron spp.), wild apple or apple (Malus spp.), pear (Pyrus spp.), peach (Prunus spp.) and marigolds (Tagetes spp.). Example 8: Agrobacterium-mediated transformation of soybean (Glycine max) with genes operationally linked to GmCAB2 regulatory elements. [000190] To test the ability of upstream GmCAB2 regulatory sequences (promoter and 5' UTR) to trigger transgene expression in transgenic soybean plants, a construct containing a variant of the GmCAB2 gene promoter sequence (SEQ ID: NO:28; GmCAB2.1) and the GmCAB2 5' UTR sequence (SEQ ID NO:3) was paired with the Phaseolus vulgaris Phaseolin (PvPhas) gene terminator. These GmCAB2 promoter (SEQ ID NO:28) and GmCAB2 5' UTR terminator (SEQ ID NO:3) / PvPhas regulatory sequences were fused with the coding sequence of an insecticidal protein denoted herein as insecticidal protein A (IP-A). The resulting construct was stably integrated into the soybean genome using biolistic bombardment and FLP / FRT recombinase-mediated cassette exchange (RMCE).RMCE relies on replacing the specific sequence previously integrated into the soybean genome with the donor sequence to generate independent transgenic events integrated at the same genomic location (see, Tao et al., (2007) Modified FRT recombination sites and methods of use, document no. WO2007011733; and Li et al., (2009) Site-Specific Integration of Transgenes in Soybean via Recombinase-Mediated DNA Cassette Exchange Plant Physiology,). Petition 870260040239, dated 04 / 29 / 2026, pp. 141 / 159 125 / 130 (Volume 151, pages 1087-1095). A control construct containing IP-A under the control of the regulatory sequences of the Ubiquitin10 promoter and 5' UTR and the Arabidopsis Ubiquitin14 terminator (AtUbi10 / AtUbi14) was integrated into the same soybean genomic locus as the test construct with the GmCAB2 promoter and 5' UTR (Tao et al., 2007; Li et al., 2009). All transformants also contained a selectable cassette specifying chlorsulfuron resistance (Tao et al., 2007; Li et al., 2009). Chlorsulfuron-resistant soybean plants were molecularly screened, and events containing completed single-copy insertions were regenerated. Transgenic soybean plants were grown to maturity under typical greenhouse growing conditions. To assess the levels of transgenic protein accumulation, leaves from T0 transgenic plants were sampled, the protein was extracted, and IP-A protein accumulation was determined using standard Western blotting techniques.The results of these analyses are shown in Table 6. Statistical analyses of IP-A protein levels did not reveal statistically significant differences between the mean protein levels of the test construct and those in the control construct (p=0.7221). Therefore, these results in transgenic soybean plants demonstrate that the GmCab2 promoter of SEQ ID NO:28 and UTR 5' of SEQ ID NO:3 support protein levels comparable to those of the strong ubiquitous promoter AtUbi10 (Norris et al., (1993) The intron of Arabidopsis thaliana polyubiquitin genes is conserved in location and is a quantitative determinant of chimeric gene expression. Plant Mol Biol. Mar;21(5):895 to 906). Furthermore, in this experiment, the PvPhas terminator was paired with the upstream regulatory sequence of the GmCAB2 promoter with SEQ ID NO:28; these results, therefore, show that the GmCAB2 promoter with SEQ ID NO:28 works to trigger the robust expression of an encoding sequence. Petition 870260040239, dated 04 / 29 / 2026, pages 142 / 159 126 / 130 heterologous sequence in combination with downstream heterologous regulatory sequences in transgenic soybean plants. TABLE 6. Accumulation of insecticidal protein A (IP-A) in leaves of transgenic soybean plants T0 Regulatory Sequence ID of the Event Protein Level (ppm) Individual Events Mean Median Standard Deviation Standard Error GmCab2.1 / PvPhas 1 174 225 237.5 55 19 2 146 3 186 4 251 5 246 6 231 7 244 8 322 AtUbi10 / AtUbi14 1 1200 383.9 180.5 370 117 2 139 3 55 4 140 5 513 6 215 7 102 8 146 9 638 10 691 Notes: 1 Protein accumulation levels were normalized to total soluble protein and expressed in parts per million (ppm). ppm values ​​were rounded to the nearest whole number. 2 No significant difference was detected between the control AtUbi10 / AtUbi14 and GmCAB2.1 / PvPhas constructs (p=0.7221). Due to the presence of unequal variances, non-parametric comparisons using Dunn's method for joint rankings were used for analysis. Statistical analyses were conducted using the JMP® statistical package. Example 9: The promoter and 5' UTR of GmCAB2 support the accumulation of insecticidal protein B (IP-B) in T1 transgenic soybean plants. [000191] To test the ability of regulatory sequences to Petition 870260040239, dated 04 / 29 / 2026, pp. 143 / 159 127 / 130 amount of GmCAB2 (promoter and 5' UTR) to trigger heritable transgene expression in T1 transgenic soybean plants, a construct containing a variant version of the GmCAB2 gene promoter sequence (SEQ ID: NO:28) and GmCAB 5' UTR (SEQ ID NO:3) was paired with the OsT28 terminator (Bhyri, P., Krishnamurthy, N., Narayamam, E., Nott, A., Sarangi, RR (2013) Novel Plant Terminator Sequences, WO2013122729_A2) from convergent rice genes (LOC_Os03g60090.1 and LOC_Os03g60080.1). These regulatory sequences of the GmCAB2 promoter (SEQ ID NO:28), the 5' UTR (SEQ ID NO:3), and the OsT28 terminator (GmCAB2 / OsT28) were used to trigger the expression of the IPB insecticidal protein coding sequence. Other genes present in the construct were expression cassettes containing another insecticidal protein and an expression cassette containing the acetolactate synthase gene (Gm-HRA) that confers resistance to the sulfonylurea herbicide (Mazur, BJ and Falco SC).(1989) The development of herb residue crops. Annu. Rev. Plant Phylsiol. Plant Mol. Biol. 40:441; and Green JM (2007) Review of Glyphosate and Alsinhibiting Herbicide Crop Resistance and Resistant Weed Management Weed Technology 21(2):547 to 558)) which was used as an acceptable marker during plant transformation. Transgenic T0 plants were produced from immature seed cultures following the Agrobacterium-mediated transformation protocol (Finer JJ, McMullen MD (1991) Transformation of soybean via pumping of embryogenic suspension culture tissue particles. Vitro Cell Dev Biol-Plant 27: 175 to 182; Stewart CN Jr, Adang MJ, All JN, Boerma HR, Cardineau G, Tucker D, Parrott WA (1996) Genetic transformation, recovery and characterization of transgenic fertile soybean for a synthetic Bacillus thuringiensis cryIAc gene).Cultivation medium for Agrobacterium mediated transformation of dicot plants. US8962328)). Soon,. Petition 870260040239, dated April 29, 2026, pp. 144-159 128 / 130 immature seeds were harvested from soybean pods of plants grown in a greenhouse under standard conditions. The seeds were surface sterilized, immature cotyledons were aseptically excised, and the cultures were maintained in 250 mL flasks containing 50 mL of liquid medium in rotary shakers at 26 °C under cool white fluorescent lights with a 16 / 8 h day / night photoperiod (Samoylov VM, Tucker DM, Thibaud-Nissen F, Parrott WA (1998) A liquid-medium-based protocol for rapid regeneration from embryogenic soybean cultures. Plant Cell Rep 18:49 to 54; and Cho et al., (2015)). A strain of Agrobacterium tumefaciens modified to carry plasmids with genes of interest was used to transform the immature soybean cotyledons. Transgenic soybean events were selected and grown to maturity under typical greenhouse growing conditions. [000192] To produce T1 transgenic plants, seeds from an intact single-copy transgenic event were planted in a greenhouse, and young seedlings were genotyped using standard molecular biology techniques to identify null, hemizygous, and homozygous transgenic plants. For evaluation of protein accumulation levels, leaves from V3 and R3 growth stages and immature pods ~2.5 to 3 cm long were collected from hemizygous and homozygous transgenic plants. Samples were frozen in dry ice and stored in a freezer at -80°C until freeze-dried, then ground and used for protein extraction. Protein extraction and protein level analyses were similar to those described by Xu XT, Owens MA.(2011) Multiplexed protein quantification in maize leaves by liquid chromatography coupled with tandem mass spectrometry: an alternative tool to immunoassays for target protein analysis in genetically engineered crops. J Agric Food Chem. April 27, 2011 ;59(8):3,551 to 3,558. doi: 10.1021 / jf104516r. Epub, March 9, 2011). [000193] The results of protein analyses are shown in the Table. Petition 870260040239, dated 04 / 29 / 2026, pages 145 / 159 129 / 130 7. Protein level analyses revealed that both hemizygous and homozygous plants accumulated IP-B protein in all tissues tested: V3 and R3 leaves and immature pods. Comparison of mean protein accumulation levels between homozygous and hemizygous transgenic plants revealed statistically higher protein levels in homozygous plants compared to hemizygous plants, and this was true for all tissues tested (Table 7). These results indicate that the increased transgene copy number in homozygous plants resulted in greater protein accumulation. The copy number-dependent accumulation of IP-B protein in V3 and R3 leaves and immature pods of homozygous transgenic plants demonstrates that the GmCAB2 promoter of SEQ ID NO:28 and the 5' UTR of SEQ ID NO:3 support heritably and transgenerationally stable IP-B transgene expression.Furthermore, in this experiment, the GmCAB2 promoter / UTR 5' of SEQ ID NO:28 and SEQ ID NO:3 were paired with the OsT28 terminator of rice from a heterologous monocotyledonous species. This suggests that the GmCAB2 promoter functions to trigger robust expression of a heterologous coding sequence in combination with heterologous downstream transcription termination sequences from a dicotyledonous (Example 8) or monocotyledonous (this example) plant species. Table 7. Accumulation of IP-B protein in V3 and R3 leaves and immature pods of T1 soybean plants. Developmental Stage 2 Zygosity Number of Plants Protein Level, ppm Protein Level (ppm) 1 Mean Median Standard Deviation Standard Error Leaf V3*** Homozygous 1 402 396 399 15 6 2 406 3 377 4 396 5 380 6 417 Hemizygous 1 189 202 196 23 11 2 181 3 203 4 233 Petition 870260040239, dated 04 / 29 / 2026, pp. 146 / 159 130 / 130 leaf R3** Homozygous 1 347 328 332 72 29 2 330 3 259 4 248 5 448 6 333 Hemizygous 1 175 185 166 50 25 2 156 3 150 4 258 immature pods*** Homozygous 1 831 847 841 52 21 2 784 3 856 4 850 5 823 6 940 Hemizygous 1 403 409 408 8 4 2 401 3 412 4 418 Notes: 1. Protein accumulation levels were normalized to total soluble protein and expressed in parts per million (ppm). ppm values ​​were rounded to the nearest whole number. 2Significant differences between mean protein levels of hemizygous and homozygous transgenic plants are indicated by ***<0.0001 and **p=0.0061. Statistical analyses were conducted using Welch's ANOVA test in the JMP® statistical package. [000194] Although various exemplary aspects and modalities have been discussed above, those skilled in the art will recognize certain modifications, permutations, additions, and subcombinations thereof. It is intended, therefore, that the appended claims and claims introduced hereafter be interpreted as including all such modifications, permutations, additions, and subcombinations to the extent that they are within their true spirit and scope. Petition 870260040239, dated 04 / 29 / 2026, pp. 147 / 159

Claims

1 / 2 CLAIMS 1. Nucleic acid vector characterized in that it comprises a terminator operatively linked to: a) a heterologous polylinking sequence; or b) a non-GmCAB2 polynucleotide sequence, wherein said terminator comprises a polynucleotide sequence as set forth by SEQ ID NO:

5.

2. Nucleic acid vector, according to claim 1, characterized in that said terminator is 425 bp long.

3. Nucleic acid vector, according to claim 1, characterized in that it further comprises a sequence encoding a selectable marker.

4. Nucleic acid vector, according to claim 1, characterized in that said non-GmCAB2 polynucleotide sequence is a transgene.

5. Nucleic acid vector, according to claim 4, characterized in that the transgene encodes a selectable marker or gene product that confers insecticide resistance, herbicide tolerance, RNAi expression, nitrogen use efficiency, water use efficiency, or nutritional quality.

6. Nucleic acid vector, according to claim 1, characterized in that it further comprises a promoter polynucleotide sequence as set forth by SEQ ID NO:2, wherein the promoter sequence is operatively linked to said polylinker or to said non-GmCAB2 polynucleotide sequence.

7. Nucleic acid vector, according to claim 6, characterized in that it further comprises an intron sequence.

8. Nucleic acid vector, according to claim 6, Petition 870260040239, dated 04 / 29 / 2026, pp. 148 / 159 2 / 2, characterized in that said promoter has preferential specific expression in tissue. Petition 870260040239, dated 04 / 29 / 2026, pp. 149 / 159

Images