Modified oligonucleotide, oligomeric compound, pharmaceutical composition including the same and the use of the same

Description

Modified oligonucleotide, oligomeric compound, pharmaceutical composition comprising the same and use thereof. Separated from BR112020023436-2, filed on 05 / 21 / 2019. Sequence listing

[0001] This application is being filed together with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 200779-WO-PCT-SeqListingUpdated.txt created on May 20, 2019, which is 465 kb in size. The information in electronic format from the sequence listing is incorporated herein by reference in its entirety. Field

[0002] The present embodiments provide methods, compounds and compositions useful for inhibiting the expression of APOL1 (apolipoprotein L, 1) and, in certain cases, reducing the amount of APOL1 protein in a cell or animal, which may be useful for the treatment, prevention or improvement of a disease associated with APOL1. Background

[0003] End-stage renal disease (ESRD) affects more than half a million people in the United States. In the United States, the likelihood of individuals of African descent developing ESRD is approximately twice that observed among patients of other ethnic backgrounds (McClellan W. et al. Am. J. Kidney Dis. 1988. 12: 285-290; Cowie CC. et al. N. Engl. J. Med. 1989. 321: 1074-1079). There are no specific therapies for the vast majority of kidney diseases. Antihypertensive and anti-inflammatory treatments have been found to slow progression and reduce symptoms in some patients for some types of chronic kidney disease (CKD), but do not result in disease resolution or completely halt disease progression. Petition 870260057655, dated 12 / 06 / 2026, page 9 / 1268 2 / 343

[0004] Recent data have suggested an association between two common variants (G1 and G2) in the last exon of APOL1 among patients of African descent and an increased risk of developing CKD (Kao WH et al. Nat. Genet. 2008. 40: 1185-1192; Lipkowitz MS et al. Kidney Int. 2013. 83: 114-120; Genovese G. et al. Science. 2010. 329: 841-845; Hum Genet. In a 2013 study, the G1 and G2 risk variants in APOL1 were associated with higher rates of CKD and CKD progression that were observed in patients of African descent compared to other ethnic ancestry groups, regardless of diabetes status (Parsa A et al. N. Engl. J. Med. 2013. 369: 2183-2196).Approximately 50% of subjects of African descent carry one risk allele in APOL1, while approximately 13% of subjects of African descent (~five million individuals) carry two risk alleles in APOL1, a substantial fraction of whom will develop APOL1-associated CKD. Studies in subjects of African descent with two APOL1 risk alleles have demonstrated increased odds ratios for the development of many forms of kidney disease, including, but not limited to, focal segmental glomerulosclerosis (FSGS) (OR = 10.5), hypertension attributed to ESRD (OR = 7.3), HIV-associated nephropathy (HIV-NA) (OR = 29), sickle cell nephropathy (OR = 3.4), and lupus membranous nephropathy (OR = 5.4) (Genovese et al. Science, 2010; Tzur et al. Hum Genet. 2010; Kopp et al. J Am Soc Nephrol. 2011). Summary

[0005] Certain modalities provided in this document are compounds and methods for reducing the amount or activity of APOL1 mRNA and, in certain modalities, reducing the amount of APOL1 protein in a cell or animal. In certain modalities, the animal has a nephropathy associated with Petition 870260057655, dated 12 / 06 / 2026, page 10 / 1268 3 / 343 AP0L1, including, for example, HIV-associated nephropathy, focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, hypertension-associated nephropathy, and other forms of proteinuric disease associated with AP0L1. In certain modalities, the disease is focal segmental glomerulosclerosis (FSGS). In certain modalities, the disease is CKD. In certain modalities, the disease is arterionephrosclerosis. In certain modalities, the disease is lupus nephritis. In certain modalities, the disease is hypertension-associated CKD. In certain modalities, the disease is end-stage renal disease (ESRD). In certain modalities, the disease is HIV-associated nephropathy. In certain modalities, the disease is sickle cell nephropathy. In certain modalities, the disease is membranous lupus nephropathy.

[0006] Certain modalities provided in this document are directed to potent and tolerable compounds and compositions useful for inhibiting APOL1 expression, which may be useful for the treatment, prevention, improvement, or slowing of the progression of APOL1-associated nephropathy. Certain modalities provided in this document are directed to compounds and compositions that are more potent or have greater therapeutic value than publicly disclosed compounds. Detailed description

[0007] It is to be understood that both the preceding general description and the following detailed description are merely illustrative and explanatory and are not restrictive of the modalities, as claimed. In this document, the use of the singular includes the plural unless specifically stated otherwise. As used in this document, the use of “or” means “and / or” unless stated otherwise. Petition 870260057655, dated 12 / 06 / 2026, page 11 / 1268 4 / 343 mode. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting.

[0008] The section headings used in this document are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records, are hereby expressly incorporated by reference into the parts of the document discussed herein, as well as into the whole.

[0009] It is understood that the sequence shown in each SEQ ID NO in the examples contained in this document is independent of any modification to a sugar moiety, an internucleoside bond, or a nucleobase. As such, compounds defined by a SEQ ID NO may independently comprise one or more modifications to a sugar moiety, an internucleoside bond, or a nucleobase. Compounds described by ION / ISIS number indicate a combination of nucleobase sequence, chemical modification, and motif. Definitions

[0010] Unless otherwise indicated, the following terms have the following meanings:

[0011] “2'-deoxynucleoside” means a nucleoside comprising a 2'-H(H)furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2'-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

[0012] “2'-O-methoxyethyl” (also 2-MOE) refers to a 2' Petition 870260057655, dated 12 / 06 / 2026, page 12 / 1268 5 / 343 O(CH2)2-OCH3) in place of the 2'-OH group of a ribosyl ring. A sugar modified with 2'-O-methoxyethyl is a modified sugar.

[0013] “Nucleoside with 2'-MOE” (also nucleoside with 2'-Omethoxyethyl) means a nucleoside comprising a sugar moiety modified with 2'-MOE.

[0014] “2'-substituted nucleoside” or “2'-modified nucleoside” means a nucleoside comprising a 2'-substituted or 2'-modified sugar fraction. As used herein, “2'-substituted” or “2'-modified” in reference to a sugar fraction means a sugar fraction comprising at least one 2'-substituted substituent group other than H or OH.

[0015] “3' target site” refers to the nucleotide of a target nucleic acid that is complementary to the 3' plus nucleotide of a particular compound.

[0016] “5' target site” refers to the nucleotide of a target nucleic acid that is complementary to the 5' plus nucleotide of a particular compound.

[0017] “5-methylcytosine” means a cytosine with a methyl group attached at position 5.

[0018] “Approximately” means within ± 10% of a value. For example, if it is stated “the compounds affected approximately 70% inhibition of APOL1”, it is implied that APOL1 levels are inhibited within a range of 60% to 80%.

[0019] “Administration” or “administering” refers to routes of delivery of a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that may be used includes, but is not limited to, parenteral administration, such as subcutaneous, intravenous or intramuscular injection or infusion. Petition 870260057655, dated 12 / 06 / 2026, p. 13 / 1268 6 / 343

[0020] “Simultaneous administration” or “co-administration” means the administration of two or more compounds in any manner in which the pharmacological effects of both are manifested in the patient. Simultaneous administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest at the same time. The effects only need to overlap over a period of time and do not need to be coextensive. Simultaneous administration or co-administration includes parallel or sequential administration.

[0021] “Improvement” refers to an improvement or attenuation of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain modalities, improvement includes a delay or slowing of the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures known to experts in the art.

[0022] “Animal” refers to a human being or a non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0023] “Antisense activity” means any detectable and / or measurable activity attributable to the hybridization of an antisense compound with its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or target nucleic acid-encoded protein compared to target nucleic acid levels or target protein levels in the absence of the antisense compound for the target.

[0024] “Antisense compound” means a compound comprising Petition 870260057655, dated 12 / 06 / 2026, page 14 / 1268 7 / 343 an oligonucleotide and optionally one or more additional features, such as a conjugated group or terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as oligonucleotides, ribozymes, siRNA, shRNA, ssRNA, and occupation-based compounds.

[0025] “Antisense inhibition” means the reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared with target nucleic acid levels in the absence of the antisense compound.

[0026] “Antisense mechanisms” are all those mechanisms involving the hybridization of a compound with a target nucleic acid, where the result or effect of hybridization is degradation of the target or occupation of the target with simultaneous disruption of cellular machinery involving, for example, transcription or splicing.

[0027] “Antisense oligonucleotide” means an oligonucleotide having a nucleobase sequence that is complementary to a target nucleic acid or region or segment thereof. In certain embodiments, an antisense oligonucleotide is specifically hybridizable with a target nucleic acid or region or segment thereof.

[0028] “APOL1” means any nucleic acid or protein of APOL1. “APOL1 nucleic acid” means any nucleic acid that encodes APOL1. For example, in certain embodiments, an APOL1 nucleic acid includes a DNA sequence that encodes APOL1, an RNA sequence transcribed from DNA that encodes APOL1 (including genomic DNA comprising introns and exons), and an mRNA sequence that encodes APOL1. “APOL1 mRNA” means an mRNA that encodes an APOL1 protein. The target may be cited in either uppercase or lowercase.

[0029] “Specific APOL1 inhibitor” refers to any agent capable of specifically inhibiting APOL1 RNA and / or expression or Petition 870260057655, dated 12 / 06 / 2026, p. 15 / 1268 8 / 343 APOL1 protein activity at the molecular level. For example, specific inhibitors of APOL1 include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of APOL1 RNA and / or APOL1 protein.

[0030] “Bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. “Bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed by bridging two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0031] “Branching group” means a group of atoms with at least 3 positions that are capable of forming covalent bonds with at least 3 groups. In certain embodiments, a branching group provides a plurality of reactive sites for the attachment of ligands bound to an oligonucleotide via a conjugate ligand and / or a cleavable moiety.

[0032] “Cell-directed fraction” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.

[0033] “cEt” or “hindered ethyl” means a bicyclic ribosyl sugar moiety in which the second ring of the bicyclic sugar is formed by means of a bridge connecting carbon 4' and carbon 2', in which the bridge has the formula: 4'-CH(CH3)-O-2', and in which the methyl group of the bridge is in the S configuration.

[0034] “Nucleoside with cEt” means a nucleoside comprising a sugar moiety modified with cEt. Petition 870260057655, dated 12 / 06 / 2026, page 16 / 1268 9 / 343

[0035] “Chemical modification” in a compound describes the substitutions or changes through chemical reaction of any of the units in the compound relative to the original state of that unit. “Modified nucleoside” means a nucleoside that independently has a modified sugar moiety and / or a modified nucleobase. “Modified oligonucleotide” means an oligonucleotide comprising at least one modified internucleosidic bond, one modified sugar, and / or one modified nucleobase.

[0036] “Chemically distinct region” refers to a region of a compound that is somehow chemically different from another region of the same compound. For example, a region that has nucleotides with 2'-O-methoxyethyl is chemically distinct from a region that has unmodified nucleotides with 2'-O-methoxyethyl.

[0037] “Chimeric antisense compounds” means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.

[0038] “Cleavable linkage” means any chemical bond capable of being broken. In certain embodiments, a cleavable linkage is selected from: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a disulfide, or a peptide.

[0039] “Cleavable fraction” means a bond or group of atoms that is cleaved under physiological conditions, for example, within a cell, an animal or a human being.

[0040] “Complementary” in reference to an oligonucleotide means that the nucleobase sequence of such oligonucleotide or one or more regions thereof correspond to the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposite directions. Nucleobase correspondences Petition 870260057655, dated 12 / 06 / 2026, p. 17 / 1268 10 / 343 or complementary nucleobases, as described in this document, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G), unless otherwise specified. Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity in each nucleoside and may include one or more nucleobase mismatches. In contrast, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches in each nucleoside without any nucleobase mismatches.

[0041] “Conjugated group” means a group of atoms that is attached to an oligonucleotide. Conjugated groups include a conjugated moiety and a conjugate linker that links the conjugated moiety to the oligonucleotide.

[0042] “Conjugate ligand” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

[0043] “Conjugated fraction” means a group of atoms that is linked to an oligonucleotide by means of a conjugated ligand.

[0044] “Contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleosidic bonds that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

[0045] “Design” or “Designed for” refers to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.

[0046] “Diluent” means an ingredient in a composition that Petition 870260057655, dated 12 / 06 / 2026, p. 18 / 1268 11 / 343 lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition may be a liquid, for example, saline solution.

[0047] “Differently modified” means chemical modifications or chemical substituents that are different from each other, including the absence of modifications. Thus, for example, a nucleoside with MOE and an unmodified DNA nucleoside are “differently modified,” although the DNA nucleoside is not modified. Similarly, DNA and RNA are “differently modified,” although both are naturally occurring unmodified nucleosides. Nucleosides that are the same except for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a sugar modified with 2'-OMe and an unmodified adenine nucleobase and a nucleoside comprising a sugar modified with 2'-OMe and an unmodified thymine nucleobase are not differently modified.

[0048] “Dose” means a specified amount of a pharmaceutical compound or agent delivered in a single administration or over a specified period of time. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose may require a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual. In other embodiments, the pharmaceutical compound or agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month. Petition 870260057655, dated 12 / 06 / 2026, page 19 / 1268 12 / 343

[0049] “Dosage regimen” is a combination of doses designed to achieve one or more desired effects.

[0050] “Double-stranded antisense compound” means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, wherein one of said two oligomeric compounds comprises an oligonucleotide.

[0051] “Effective amount” means the amount of compound sufficient to effect a desired physiological result in an individual in need of the compound. The effective amount may vary between individuals depending on the health and physical condition of the individual being treated, the taxonomic group of the individuals being treated, the formulation of the composition, assessment of the individual’s medical condition, and other relevant factors.

[0052] “Effectiveness” means the ability to produce a desired effect.

[0053] “Expression” includes all the functions by which the encoded information of a gene is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.

[0054] “Gapme” means an oligonucleotide comprising an internal region having a plurality of nucleosides supporting cleavage by RNase H positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be called a “gap” and the external regions may be called wings.

[0055] “Hybridization” means the annealing of oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, Petition 870260057655, dated 12 / 06 / 2026, page 20 / 1268 13 / 343 The most common hybridization mechanism involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, the complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, the complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.

[0056] “Immediately adjacent” means that there are no intervening elements between immediately adjacent elements of the same type (for example, there are no intervening nucleobases between immediately adjacent nucleobases).

[0057] “Individual” means a human being or non-human animal selected for treatment or therapy.

[0058] “Inhibition of expression or activity” refers to a reduction or blocking of expression or activity relative to the expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.

[0059] “Internucleoside linkage” means a group or linkage that forms a covalent bond between adjacent nucleosides in an oligonucleotide. “Modified internucleoside linkage” means any internucleoside linkage other than a naturally occurring phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.

[0060] “Elongated oligonucleotides” are those that have one or more additional nucleosides in relation to an oligonucleotide disclosed in this document, for example, a parent oligonucleotide.

[0061] “Linked nucleosides” means adjacent nucleosides joined by an internucleoside bond.

[0062] “Linking nucleoside” means a nucleoside that links a Petition 870260057655, dated 12 / 06 / 2026, page 21 / 1268 14 / 343 oligonucleotide to a conjugated moiety. The nucleoside linkers are located within the conjugate linker of a compound. The nucleoside linkers are not considered part of the oligonucleotide moiety of a compound even if they are contiguous to the oligonucleotide.

[0063] “Non-match” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, nucleobases including, but not limited to, a universal nucleobase, inosine, and hypoxanthine are capable of hybridizing with at least one nucleobase, but are still non-matching or non-complementary with respect to the nucleobase with which they hybridized. As another example, a nucleobase of a first oligonucleotide that is not capable of hybridizing with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a non-matching or non-complementary nucleobase.

[0064] “Modulation” refers to the change or adjustment of a characteristic in a cell, tissue, organ, or organism. For example, modulation of APOL1 RNA may mean increasing or decreasing the level of APOL1 RNA and / or APOL1 protein in a cell, tissue, organ, or organism. A “modulator” effects the change in the cell, tissue, organ, or organism. For example, a compound for APOL1 may be a modulator that decreases the amount of APOL1 RNA and / or APOL1 protein in a cell, tissue, organ, or organism.

[0065] “MOE” means methoxyethyl.

[0066] “Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides. Petition 870260057655, dated 12 / 06 / 2026, page 22 / 1268 15 / 343

[0067] “Motif” means the pattern of unmodified and / or modified sugar fractions, nucleobases and / or internucleoside bonds in an oligonucleotide.

[0068] “Natural” or “of natural occurrence” means found in nature.

[0069] “Non-bicyclic modified sugar” or “non-bicyclic modified sugar fraction” means a modified sugar fraction comprising a modification, such as a substituent, that does not form a bridge between two sugar atoms to form a second ring.

[0070] “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

[0071] “Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used in this document, a “naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A “modified nucleobase” is a naturally occurring nucleobase that is chemically modified. A “universal base” or “universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and a modified nucleobase and is capable of pairing with any nucleobase.

[0072] “Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independently of any sugar or internucleoside bond.

[0073] “Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and the sugar moiety are each independently unmodified or modified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which do not have Petition 870260057655, dated 12 / 06 / 2026, page 23 / 1268 16 / 343 a nucleobase.

[0074] “Oligomeric compound” means a compound comprising a single oligonucleotide and, optionally, one or more additional features, such as a conjugated group or a terminal group.

[0075] “Oligonucleotide” means a polymer of linked nucleosides, each of which may be modified or unmodified independently of the others. Unless otherwise indicated, oligonucleotides consist of 8 to 80 linked nucleosides. “Modified oligonucleotide” means an oligonucleotide in which at least one sugar, nucleobase, or internucleoside linkage is modified. “Unmodified oligonucleotide” means an oligonucleotide that does not comprise any sugar, nucleobase, or internucleoside modification.

[0076] “Progenitor oligonucleotide” means an oligonucleotide whose sequence is used as the basis for designing more oligonucleotides of similar sequence but with different lengths, motifs and / or chemistries. The newly designed oligonucleotides may have the same or overlapping sequence as the progenitor oligonucleotide.

[0077] “Parenteral administration” means administration by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra-arterial administration, intraperitoneal administration or intracranial administration, for example, intrathecal or intracerebroventricular administration.

[0078] “Pharmaceutically acceptable vehicle or diluent” means any substance suitable for use in administration to an individual. For example, a pharmaceutically acceptable vehicle may be a sterile aqueous solution, such as PBS or water for injection.

[0079] “Pharmaceutically acceptable salts” means physiological salts Petition 870260057655, dated 12 / 06 / 2026, page 24 / 1268 17 / 343 clinically and pharmaceutically acceptable compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesirable toxicological effects to it.

[0080] “Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual.

[0081] “Pharmaceutical composition” means a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition may comprise one or more compounds or salts thereof and a sterile aqueous solution.

[0082] “Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage.

[0083] “Phosphorus fraction” means a group of atoms comprising one phosphorus atom. In certain embodiments, a phosphorus fraction comprises a mono-, di- or triphosphate or phosphorothioate.

[0084] “Portion” means a definite number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a definite number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a definite number of contiguous nucleobases of an oligomeric compound.

[0085] “Prevent” refers to delaying or stopping the onset, development or progression of a disease, disorder or condition for a period of time ranging from minutes to indefinitely.

[0086] “Prodrug” means a compound in one form outside the body that, when administered to an individual, is metabolized into another form within the body or its cells. In certain embodiments, the metabolized form is the active, or most active, form of the compound (e.g., drug). Typically, the conversion of a prodrug Petition 870260057655, dated 12 / 06 / 2026, page 25 / 1268 18 / 343 within the body is facilitated by the action of an enzyme(s) (e.g., endogenous or viral enzyme) or chemical component(s) present in cells or tissues and / or by physiological conditions.

[0087] “Reduce” means to lower to a smaller extent, size, quantity or number.

[0088] “RefSeq No.” is a unique combination of letters and numbers assigned to a sequence to indicate that the sequence is for a particular target transcript (e.g., target gene). Such a sequence and information about the target gene (collectively, the gene registry) can be found in a genetic sequence database. Genetic sequence databases include the NCBI Reference Sequence Database, GenBank, the European Nucleotide Archive, and the Japan DNA Database (the latter three forming the International Collaboration of Nucleotide Sequence Databases or INSDC).

[0089] “Region” is defined as a portion of the target nucleic acid that has at least one identifiable structure, function, or characteristic.

[0090] “RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.

[0091] “Segments” are defined as smaller portions or subportions of regions within a nucleic acid.

[0092] “Side effects” means illness and / or physiological conditions attributable to a treatment other than the desired effects. In certain modalities, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, abnormalities Petition 870260057655, dated 12 / 06 / 2026, p. 26 / 1268 19 / 343 of the central nervous system, myopathies, and malaise. For example, increased serum aminotransferase levels may indicate liver toxicity or abnormal liver function. For example, increased bilirubin may indicate liver toxicity or abnormal liver function.

[0093] “Single-stranded” in reference to a compound means that the compound has only one oligonucleotide. “Self-complementary” means an oligonucleotide that hybridizes at least partially with itself. A compound consisting of an oligonucleotide, in which the oligonucleotide of the compound is self-complementary, is a single-stranded compound. A single-stranded compound may be able to bind to a complementary compound to form a duplex.

[0094] “Sites” are defined as the positions of unique nucleobases within a target nucleic acid.

[0095] “Specifically hybridizable” refers to an oligonucleotide that has a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

[0096] “Specifically inhibiting” with reference to a target nucleic acid means reducing or blocking the expression of the target nucleic acid while exhibiting less, minimal, or no effect on non-target nucleic acids. Reduction does not necessarily indicate a complete elimination of the expression of the target nucleic acid.

[0097] “Standard cell assay” means assay(s) described in the Examples and reasonable variations thereof.

[0098] “Standard in vivo experiment” means the procedure(s) described in the Example(s) and reasonable variations thereof. Petition 870260057655, dated 12 / 06 / 2026, page 27 / 1268 20 / 343

[0099] “Stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center with a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules with the (S) configuration of the stereorandom chiral center may be, but is not necessarily, the same as the number of molecules with the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside bond.

[0100] “Sugar fraction” means an unmodified sugar fraction or a modified sugar fraction. “Unmodified sugar fraction” or “unmodified sugar” means a 2'OH(H) ribosyl fraction, as found in RNA (an “unmodified RNA sugar fraction”), or a 2'-H(H) fraction, as found in DNA (an “unmodified DNA sugar fraction”). “Modified sugar fraction” or “modified sugar” means a modified furanosyl sugar fraction or a sugar substitute. “Modified furanosyl sugar fraction” means a furanosyl sugar comprising a non-hydrogen substituent in place of at least one hydrogen or hydroxyl group of an unmodified sugar fraction. In certain embodiments, a modified furanosyl sugar fraction is a 2'-substituted sugar fraction. Such modified furanosyl sugar fractions include bicyclic sugars and non-bicyclic sugars.

[0101] “Sugar substitute” means a modified sugar moiety that has a moiety other than a furanosyl moiety capable of linking a nucleobase to another group, such as an internucleosidic linkage, conjugate group, or terminal group on an oligonucleotide. The Petition 870260057655, dated 12 / 06 / 2026, p. 28 / 1268 21 / 343 Modified nucleosides comprising sugar substitutes can be incorporated at one or more positions in an oligonucleotide, and such oligonucleotides are capable of hybridizing with complementary nucleic acids or compounds.

[0102] “Synergy” or “synergistic” refers to an effect of a combination that is greater than the additive effect of each component alone at the same doses.

[0103] “Target gene” refers to a gene that codes for a target.

[0104] “Targeted at / targeting” means the specific hybridization of a compound with a target nucleic acid to induce a desired effect.

[0105] “Target nucleic acid”, “target RNA”, “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described in this document.

[0106] “Target region” means a portion of a target nucleic acid to which one or more compounds are directed.

[0107] “Target segment” means the nucleotide sequence of a target nucleic acid to which a compound is directed. “5’ target site” refers to the 5’ plus nucleotide of a target segment. “3’ target site” refers to the 3’ plus nucleotide of a target segment.

[0108] “Terminal group” means a chemical group or group of atoms that is covalently attached to a terminal of an oligonucleotide.

[0109] “Therapeutically effective amount” means an amount of a compound, pharmaceutical agent or composition that provides a therapeutic benefit to an individual.

[0110] “Treat” refers to the administration of a pharmaceutical compound or composition to an animal in order to effect a change or improvement of a disease, disorder or condition in the animal. Certain modalities Petition 870260057655, dated 12 / 06 / 2026, p. 29 / 1268 22 / 343

[0111] Certain modalities provide methods, compounds and compositions for inhibiting the expression of APOL1 (APOL1).

[0112] Certain modalities provide compounds targeted to an APOL1 nucleic acid. In certain embodiments, the nucleic acid of APOL1 has the sequence shown in RefSeq or GENBANK Accession No. NM_003661.3 (incorporated by reference, disclosed in this document as SEQ ID NO: 1), NT_011520.9 truncated from nucleotides 15986452 to 16001905 (SEQ ID NO: 2), NM_001136541.1 (SEQ ID NO: 3), NM_001136540.1 (SEQ ID NO: 4), NM_145343.2 (SEQ ID NO: 5), DC339680.1 (SEQ ID NO: 6), AK309143.1 (SEQ ID NO: 7), NT_011520.13 truncated from nucleotides 17543446 to 17543655 (SEQ ID NO: 8) or NC_000022.11 truncated from nucleotides 36250001 to 36271000 (SEQ ID NO: 9). In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0113] Certain embodiments provide a compound comprising a modified oligonucleotide with 8 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the nucleobase sequences of SEQ ID NOs: 13 to 1941. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide has 10 to 30 linked nucleosides in length.

[0114] Certain embodiments provide a compound comprising a modified oligonucleotide with 12 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the Petition 870260057655, dated 12 / 06 / 2026, page 30 / 1268 23 / 343 nucleobase sequences of SEQ IDs: 13 to 1941. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide has 12 to 30 linked nucleosides in length.

[0115] In certain embodiments, the compound comprises a modified oligonucleotide with 16 linked nucleosides in length. In certain embodiments, the compound is an antisense compound or an oligomeric compound.

[0116] Certain embodiments provide a compound comprising a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0117] Certain embodiments provide a compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0118] In certain embodiments, the compounds target nucleotides 5849 to 5907, 5853 to 5869, 5855 to 5873, 8145 to 8180, 8168 to 8216, 8306 to 8321, 8320 to 8338, 8723 to 8847, 8743 to 8760, 8829 to 8847, 8755 to 8840, 14342 to 14390, and 14342 to 14370 of an APOL1 nucleic acid. In certain embodiments, the compounds target nucleotides 5849 to 5907, 5853 to 5869, Petition 870260057655, dated 12 / 06 / 2026, p. 31 / 1268 24 / 343 5855 to 5873, 8145 to 8180, 8168 to 8216, 8306 to 8321, 8320 to 8338, 8723 to 8847, 8743 to 8760, 8829 to 8847, 8755 to 8840, 14342 to 14390 and 14342 to 14370 of an APOL1 nucleic acid having the nucleobase sequence SEQ ID NO: 2. In certain embodiments, the compounds have at least one portion of 8, 9, 10, 11, 12, 13, 14, 15 or 16 contiguous nucleobases complementary to a portion of equal length in nucleotides 5849 to 5907, 5853 to 5869, 5855 to 5873, 8145 to 8180, 8168 to 8216, 8306 to 8321, 8320 to 8338, 8723 to 8847, 8743 to 8760, 8829 to 8847, 8755 to 8840, 14342 to 14390 and 14342 to 14370 of an APOL1 nucleic acid with the nucleobase sequence of SEQ ID NO: 2. In certain embodiments, these compounds are antisense compounds, oligomeric compounds or oligonucleotides.

[0119] In certain embodiments, the compounds target a region of an APOL1 nucleic acid with the nucleobase sequence SEQ ID NO: 2 in nucleobases 5849 to 5907, 5853 to 5869, 5855 to 5873, 8145 to 8180, 8168 to 8216, 8306 to 8321, 8320 to 8338, 8723 to 8847, 8743 to 8760, 8829 to 8847, 8755 to 8840, 14342 to 14390, and 14342 to 14370. In certain embodiments, the compounds target at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobases are found in the nucleobase regions mentioned above. In certain embodiments, these compounds are antisense compounds, oligomeric compounds, or oligonucleotides. In certain embodiments, the modified oligonucleotide has 10 to 30 linked nucleosides in length.

[0120] In certain embodiments, a compound comprises a modified oligonucleotide with 12 to 30 linked nucleosides of complementary length at nucleotides 5854 to 5869, 5855 to 5870, 8164 to 8179, 8306 to 8321, 8321 to 8336, 8744 to 8759, 8829 to Petition 870260057655, dated 12 / 06 / 2026, page 32 / 1268 25 / 343 8844 or 14342 to 14357 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide has 16 to 30 linked nucleosides in length.

[0121] In certain embodiments, a compound comprises a modified oligonucleotide with 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least one portion of 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobases of any of the following SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the modified oligonucleotide has 16 to 30 linked nucleosides in length.

[0122] In certain embodiments, a compound comprises a modified oligonucleotide with 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925. In certain embodiments, the modified oligonucleotide has 16 to 30 linked nucleosides in length.

[0123] In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925.

[0124] In certain embodiments, any of the above modified oligonucleotides comprises at least one modified internucleosidic bond, at least one modified sugar and / or at least one modified nucleobase.

[0125] In certain embodiments, any of the above modified oligonucleotides comprises at least one modified sugar. In certain embodiments, at least one modified sugar comprises a 2'-O-methoxyethyl group. In certain embodiments, at least one modified sugar is a bicyclic sugar, such as a 4'-CH(CH3)-O-2' group, a 4'-CH2-O-2' group, or a 4'-(CH2)2-O-2' group. Petition 870260057655, dated 12 / 06 / 2026, page 33 / 1268 26 / 343

[0126] In certain embodiments, the modified oligonucleotide comprises at least one modified internucleosidic linkage, such as a phosphorothioate internucleosidic linkage.

[0127] In certain embodiments, any of the above modified oligonucleotides comprises at least one modified nucleobase, such as 5-methylcytosine.

[0128] In certain embodiments, any of the above modified oligonucleotides comprises:

[0129] a gap segment consisting of linked deoxynucleosides;

[0130] a 5' wing segment consisting of linked nucleosides; and

[0131] a 3' wing segment consisting of linked nucleosides;

[0132] wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide has 16 to 80 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the modified oligonucleotide has 16 to 30 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925.In certain embodiments, the modified oligonucleotide has 16 linked nucleosides in length having a nucleobase sequence consisting of the sequence recited in any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925.

[0133] In certain embodiments, a compound comprises or consists of an oligonucleotide modified with 16 to 30 nucleoblocks. Petition 870260057655, dated 12 / 06 / 2026, page 34 / 1268 27 / 343 linked ses of length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 13, 1095, 1730, 76, 1326 and 81, wherein the modified oligonucleotide comprises

[0134] a gap segment consisting of ten linked deoxynucleosides;

[0135] a 5' wing segment consisting of three linked nucleosides; and

[0136] a 3' wing segment consisting of three linked nucleosides;

[0137] wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein the 5' and 3' wing segments comprise a nucleoside with cEt; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has 16 to 80 linked nucleosides in length. In certain embodiments, the modified oligonucleotide has 16 to 30 linked nucleosides in length.

[0138] In certain embodiments, a compound comprises or consists of a modified oligonucleotide with 16 to 30 linked nucleobases in length having a nucleobase sequence comprising or consisting of the sequence recited in any one of SEQ ID NOs: 1164 and 1925, wherein the modified oligonucleotide comprises:

[0139] a gap segment consisting of nine linked deoxynucleosides;

[0140] a 5' wing segment consisting of three linked nucleosides; and

[0141] a 3' wing segment consisting of four linked nucleosides; Petition 870260057655, dated 12 / 06 / 2026, page 35 / 1268 28 / 343

[0142] wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment; wherein the 5' wing segment comprises cEt nucleosides; wherein the 3' wing segment comprises a cEt nucleoside, a cEt nucleoside, a cEt nucleoside, and a 2'-O-methoxyethyl nucleoside in the 5' to 3' direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has 16 to 30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide has 16 linked nucleosides in length.

[0143] In certain embodiments, a compound comprises or consists of a modified oligonucleotide with 16 to 30 linked nucleobases of length having a nucleobase sequence comprising or consisting of the sequence recited in SEQ ID NO: 1164, wherein the modified oligonucleotide comprises:

[0144] a gap segment consisting of nine linked deoxynucleosides;

[0145] a 5' wing segment consisting of three linked nucleosides; and

[0146] a 3' wing segment consisting of four linked nucleosides;

[0147] wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment; wherein the 5' wing segment comprises cEt nucleosides; wherein the 3' wing segment comprises a cEt nucleoside, a cEt nucleoside, a cEt nucleoside, and a 2'-O-methoxyethyl nucleoside in the 5' to 3' direction; wherein each internucleosidic linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has 16 to 30 linked nucleosides in length. In certain embodiments, the oligonucleotide Petition 870260057655, dated 12 / 06 / 2026, page 36 / 1268 The modified 29 / 343 has 16 linked nucleosides in length.

[0148] In certain embodiments, a compound comprises or consists of the following formula Tks Tks Tks Tds Gds Tds Ads Ads Gds Tds Gds mCds Aks Aks mCks mCe, wherein, A = adenine, mC = 5-methylcytosine G = guanine, T = a thymine, e = a nucleoside modified with 2'-O-methoxyethyl, k = a nucleoside modified with cEt, d = a 2'-deoxynucleoside, es = a phosphorothioate internucleoside linkage.

[0149] In certain embodiments, a compound comprises or consists of ION 972190 or a salt thereof, having the following chemical structure:

[0150] In certain embodiments, a compound comprises the Petition 870260057655, dated 12 / 06 / 2026, p. 37 / 1268 30 / 343 or consists of the sodium salt of ION 972190, having the following structure

[0151] In any of the above embodiments, the compound or oligonucleotide may be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding APOL1. Petition 870260057655, dated 12 / 06 / 2026, p. 38 / 1268 31 / 343

[0152] In any of the above embodiments, the compound may be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

[0153] In any of the above embodiments, the compound may have 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 nucleosides linked lengthwise. In certain embodiments, the compound comprises or consists of an oligonucleotide.

[0154] In certain embodiments, the compounds or compositions provided herein comprise a pharmaceutically acceptable salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

[0155] In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least a 1% increase in alanine transaminase (ALT) or aspartate transaminase (AST) value of no more than 4-fold, 3-fold, or 2-fold relative to saline-treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2% compared to control-treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in ALT or AST relative to control-treated animals. In certain embodiments, the compounds or compositions Petition 870260057655, dated 12 / 06 / 2026, page 39 / 1268 32 / 343 as described in this document are highly tolerable as demonstrated by the absence of any increase in liver, spleen or kidney weight compared to control animals.

[0156] Certain embodiments provide a composition comprising the compound of any of the aforementioned embodiments or any pharmaceutically acceptable salt thereof and at least one of a pharmaceutically acceptable vehicle or diluent. In certain embodiments, the composition has a viscosity of less than about 40 centipoise (cP), less than about 30 centipoise (cP), less than about 20 centipoise (cP), less than about 15 centipoise (cP), or less than about 10 centipoise (cP). In certain embodiments, the composition having any of the viscosities mentioned above comprises a compound supplied in this document at a concentration of about 100 mg / mL, about 125 mg / mL, about 150 mg / mL, about 175 mg / mL, about 200 mg / mL, about 225 mg / mL, about 250 mg / mL, about 275 mg / mL or about 300 mg / mL.In certain embodiments, the composition having any of the viscosities and / or compound concentrations mentioned above has a temperature of room temperature or about 20 °C, about 21 °C, about 22 °C, about 23 °C, about 24 °C, about 25 °C, about 26 °C, about 27 °C, about 28 °C, about 29 °C or about 30 °C. Certain indications

[0157] Certain embodiments provided in this document refer to methods of inhibiting APOL1 expression, which may be useful for the treatment, prevention, or improvement of an APOL1-associated disease in an individual, by administering a compound that targets APOL1. In certain embodiments, the compound may be a specific APOL1 inhibitor. In certain embodiments, the compound may be a specific inhibitor of APOL1. Petition 870260057655, dated 12 / 06 / 2026, p. 40 / 1268 33 / 343 dalities, the compound may be an antisense compound, oligomeric compound, or oligonucleotide targeting APOL1.

[0158] Examples of diseases associated with APOL1 that can be treated, prevented and / or improved with the methods provided in this document include APOL-1 associated nephropathy, focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy attributed to hypertension, HIV-associated nephropathy, sickle cell nephropathy, ESRD, glomerular damage, end-stage renal disease, arterionephrosclerosis, lupus nephritis and other forms of proteinuric disease associated with APOL1.

[0159] In certain embodiments, a method of treating, preventing, or improving an APOL1-associated disease in an individual comprises administering to the individual a compound comprising a specific APOL1 inhibitor, thereby treating, preventing, or improving the disease. In certain embodiments, the individual is identified as having or at risk of having an APOL1-associated disease. In certain embodiments, the disease is an APOL1-associated nephropathy. In certain embodiments, the APOL1-associated nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy attributed to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an antisense compound targeting APOL1. In certain embodiments, the compound comprises an oligonucleotide targeting APOL1.In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the sequences. Petition 870260057655, dated 12 / 06 / 2026, page 41 / 1268 34 / 343 nucleobases of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising any of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925. In certain embodiments, a compound comprises a A modified oligonucleotide that has a nucleobase sequence consisting of any one of the following SEQ ID NOS: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compound is ION n.° 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administration of the compound improves, preserves, or prevents edema, proteinuria, albuminuria, decline in GFR, elevated lipid levels, elevated cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, and renal failure.

[0160] In certain modalities, a method of treatment, prevention or improvement of edema, proteinuria, albuminuria, decline in GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage and renal failure comprises the administration to the individual of a compound Petition 870260057655, dated 12 / 06 / 2026, page 42 / 1268 35 / 343 comprising a specific APOL1 inhibitor, thereby treating, preventing or improving edema, proteinuria, albuminuria, GFR decline, elevated lipid levels, elevated cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage and renal failure. In certain embodiments, the compound comprises an antisense compound targeting APOL1. In certain embodiments, the compound comprises an oligonucleotide targeting APOL1. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the nucleobase sequences of SEQ ID NOs: 13 to 1941.In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925. In certain embodiments, a compound comprises a modified oligonucleotide that has a nucleobase sequence consisting of any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925. In certain embodiments, the compound is ION no. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163.In any of the above embodiments, the compound can be single-stranded or double-stranded. In any of the above embodiments, the compound can be an antisense compound. Petition 870260057655, dated 12 / 06 / 2026, p. 43 / 1268 36 / 343 or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administration of the compound improves, preserves, or prevents edema, proteinuria, albuminuria, decline in GFR, elevated lipid levels, elevated cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, and renal failure. In certain embodiments, the individual is identified as having or at risk of having a disease associated with APOL1.

[0161] In certain embodiments, a method of inhibiting APOL1 expression in an individual who has, or is at risk of having, an APOL1-associated disease comprises administering to the individual a compound comprising a specific APOL1 inhibitor, thereby inhibiting APOL1 expression in the individual. In certain embodiments, administration of the compound inhibits APOL1 expression in the kidney. In certain embodiments, the disease is an APOL1-associated nephropathy. In certain embodiments, the APOL1-associated nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy attributed to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, ESRD, and other forms of APOL1-associated proteinuric disease.In certain embodiments, the individual has, or is at risk of having, edema, proteinuria, albuminuria, decreased GFR, elevated lipid levels, elevated cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage or kidney failure, or a combination of these symptoms. In certain embodiments, the compound comprises an antisense compound targeting APOL1. In certain embodiments, the compound comprises an oligonucleotide targeting APOL1. In certain embodiments, the compound comprises an oligonucleotide targeting APOL1. In certain embodiments, a compound. Petition 870260057655, dated 12 / 06 / 2026, page 44 / 1268 37 / 343 comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the nucleobase sequences of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any of SEQ ID NOs: 13 to 1941. Nos: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925.In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of the following SEQ ID Nos: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compound is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain modalities, administration of the compound improves, preserves, or prevents edema, proteinuria, albuminuria, decline in GFR, elevated lipid levels, elevated cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, and kidney failure.

[0162] In certain modalities, a method of inhibiting APOL1 expression in a cell involves contact of the cell with Petition 870260057655, dated 12 / 06 / 2026, page 45 / 1268 38 / 343 a compound comprising a specific APOL1 inhibitor, thereby inhibiting APOL1 expression in the cell. In certain embodiments, the cell is a glomerulus. In certain embodiments, the cell is in the kidney. In certain embodiments, the cell is in the kidney of an individual who has, or is at risk of having, an APOL1-associated nephropathy. In certain embodiments, the APOL1-associated nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy attributed to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, ESRD, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an APOL1-targeted antisense compound. In certain embodiments, the compound comprises an APOL1-targeted oligonucleotide.In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the nucleobase sequences of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any of SEQ ID NOs: 13 to 1941. Nos: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925.In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of... Petition 870260057655, dated 12 / 06 / 2026, p. 46 / 1268 39 / 343 any of the SEQ ID Nos: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925. In certain embodiments, the compound is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

[0163] In certain embodiments, a method of reducing or inhibiting edema, proteinuria, albuminuria, GFR decline, elevated lipid levels, elevated cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, or renal failure in the kidney of an individual who has, or is at risk of having, an APOL1-associated disease comprises administering to the individual a compound comprising a specific APOL1 inhibitor, thereby reducing or inhibiting edema, proteinuria, GFR decline, elevated lipid levels, elevated cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, or renal failure in the individual. In certain embodiments, the individual has, or is at risk of having, an APOL1-associated nephropathy.In certain embodiments, APOL1-associated nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy attributed to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, ESRD, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an APOL1-targeted antisense compound. In certain embodiments, the compound comprises an APOL1-targeted oligonucleotide. In certain embodiments, the compound comprises an APOL1-targeted antisense compound. In certain embodiments, the compound comprises an APOL1-targeted oligonucleotide. In certain embodiments, a compound comprises a modified oligonucleotide. Petition 870260057655, dated 12 / 06 / 2026, page 47 / 1268 40 / 343 with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the nucleobase sequences of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925.In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of the following SEQ ID Nos: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compound is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the individual is identified as having or at risk of having a disease associated with APOL1.

[0164] Certain embodiments are directed to a compound comprising a specific APOL1 inhibitor for use in the treatment of an APOL1-associated disease. In certain embodiments, the disease is focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy attributed to hypertension, nephropathy Petition 870260057655, dated 12 / 06 / 2026, page 48 / 1268 41 / 343 associated with HIV, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, DRET, or other forms of proteinuric disease associated with APOL1. In certain embodiments, the compound comprises an antisense compound targeting APOL1. In certain embodiments, the compound comprises an oligonucleotide targeting APOL1. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the nucleobase sequences of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any of the SEQ ID NOs: 13 to 1941.In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925. In certain embodiments, a compound comprises a modified oligonucleotide that has a nucleobase sequence consisting of any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925. In certain embodiments, the compound is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.In certain modalities, the compound is administered to the individual parenterally. Petition 870260057655, dated 12 / 06 / 2026, page 49 / 1268 42 / 343

[0165] Certain embodiments are directed to a compound comprising a specific APOL1 inhibitor for use in reducing or inhibiting edema, proteinuria, albuminuria, decline in GFR, elevated lipid levels, elevated cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, or renal failure in an individual who has or is at risk of having an APOL1-associated nephropathy. In certain embodiments, the APOL1-associated nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy attributed to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, ESRD, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an APOL1-directed antisense compound. In certain embodiments, the compound comprises an APOL1-directed oligonucleotide.In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the nucleobase sequences of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any of the nucleobase sequences. Petition 870260057655, dated 12 / 06 / 2026, page 50 / 1268 43 / 343 of SEQ ID Nos: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of the following SEQ ID Nos: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compound is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above modalities, the compound can be an antisense compound or an oligomeric compound.

[0166] Certain embodiments are directed to the use of a compound comprising a specific APOL1 inhibitor for the manufacture or preparation of a medicament for the treatment of an APOL1-associated disease. In certain embodiments, the disease is an APOL1-associated nephropathy. In certain embodiments, the disease is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy attributed to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, ESRD, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an APOL1-targeted antisense compound. In certain embodiments, the compound comprises an APOL1-targeted oligonucleotide.In certain embodiments, the compound comprises an antisense compound targeting APOL1. In certain embodiments, the compound comprises an oligonucleotide targeting APOL1. In certain embodiments, a compound. Petition 870260057655, dated 12 / 06 / 2026, page 51 / 1268 44 / 343 comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the nucleobase sequences of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any of SEQ ID NOs: 13 to 1941. Nos: 1164, 13, 76, 81, 1095, 1326, 1730 and 1925.In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of the following SEQ ID Nos: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compound is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

[0167] Certain embodiments are directed to the use of a compound comprising a specific APOL1 inhibitor for the manufacture or preparation of a medicament for the reduction or inhibition of edema, proteinuria, albuminuria, decline in GFR, elevated lipid levels, elevated cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage or renal failure in an individual who has or is at risk of having nephropathy. Petition 870260057655, dated 12 / 06 / 2026, page 52 / 1268 45 / 343 associated with APOL1. In certain embodiments, APOL1-associated nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy attributed to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, ESRD, and other forms of APOL1-associated proteinuric disease. Certain embodiments are directed toward the use of a compound comprising a specific APOL1 inhibitor for the preparation of a medicament for the treatment of APOL1-associated disease. In certain embodiments, the disease is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy attributed to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, ESRD, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an antisense compound directed at APOL1.In certain embodiments, the compound comprises an oligonucleotide targeting APOL1. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the nucleobase sequences of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 13 to 1941. In certain embodiments, a compound comprises a modified oligonucleotide with 16 to 30. Petition 870260057655, dated 12 / 06 / 2026, page 53 / 1268 46 / 343 linked nucleosides of length having a nucleobase sequence comprising any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compound is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the foregoing embodiments, the compound may be single-stranded or Double-stranded compound. In either of the above embodiments, the compound can be an antisense compound or an oligomeric compound.

[0168] In any of the foregoing methods or uses, the compound may be targeted to APOL1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example a modified oligonucleotide with 8 to 80 linked nucleosides in length, 10 to 30 linked nucleosides in length, 12 to 30 linked nucleosides in length, or 16 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1 to 9. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleosidic linkage, at least one modified sugar, and / or at least one modified nucleobase.In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2'-O-methoxyethyl group, and the modified nucleobase is a 5-methylcytosine group. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and... Petition 870260057655, dated 12 / 06 / 2026, page 54 / 1268 47 / 343 a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

[0169] In any of the foregoing embodiments, the modified oligonucleotide has 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 17 to 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1 to 9. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleosidic linkage, at least one modified sugar, and / or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2'-O-methoxyethyl group, and the modified nucleobase is a 5-methylcytosine group.In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked 2'-deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment, and wherein each nucleoside of each wing segment comprises a modified sugar.

[0170] In any of the foregoing methods or uses, the compound comprises or consists of a modified oligonucleotide with 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising any of the following SEQ ID NOS: Petition 870260057655, dated 12 / 06 / 2026, page 55 / 1268 48 / 343 to 1941, wherein the modified oligonucleotide comprises:

[0171] a gap segment consisting of linked 2'-deoxynucleosides;

[0172] a 5' wing segment consisting of linked nucleosides; and

[0173] a 3' wing segment consisting of linked nucleosides;

[0174] wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

[0175] In any of the foregoing methods or uses, the compound comprises or consists of a modified oligonucleotide with 16 to 30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 13, 1095, 1730, 76, 1326 and 81, wherein the modified oligonucleotide comprises

[0176] a gap segment consisting of ten linked deoxynucleosides;

[0177] a 5' wing segment consisting of three linked nucleosides; and

[0178] a 3' wing segment consisting of three linked nucleosides;

[0179] wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein the 5' and 3' wing segments comprise a nucleoside with cEt; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has 16 to 30 linked nucleosides in length. Petition 870260057655, dated 12 / 06 / 2026, page 56 / 1268 49 / 343

[0180] In any of the foregoing methods or uses, the compound comprises or consists of a modified oligonucleotide with 16 to 30 linked nucleobases in length having a nucleobase sequence comprising or consisting of the sequence recited in any one of SEQ ID Nos: 1164 and 1925, wherein the modified oligonucleotide comprises:

[0181] a gap segment consisting of nine linked deoxynucleosides;

[0182] a 5' wing segment consisting of three linked nucleosides; and

[0183] a 3' wing segment consisting of four linked nucleosides;

[0184] wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment; wherein the 5' wing segment comprises cEt nucleosides; wherein the 3' wing segment comprises a cEt nucleoside, a cEt nucleoside, a cEt nucleoside, and a 2'-O-methoxyethyl nucleoside in the 5' to 3' direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has 16 to 30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide has 16 linked nucleosides in length.

[0185] In any of the foregoing methods or uses, the compound comprises or consists of ION 972190 or a salt thereof, having the following chemical structure: Petition 870260057655, dated 12 / 06 / 2026, p. 57 / 1268 50 / 343

[0186] In any of the foregoing methods or uses, the compound comprises or consists of the sodium salt of ION 972190, having the following chemical structure: Petition 870260057655, dated 12 / 06 / 2026, p. 58 / 1268 51 / 343

[0187] In any of the foregoing methods or uses, the compound may be administered parenterally. For example, in certain embodiments, the compound may be administered by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra-arterial administration, intraperitoneal administration, or administration Petition 870260057655, dated 12 / 06 / 2026, p. 59 / 1268 52 / 343 intracranial, for example, intrathecal or intracerebroventricular administration. Certain compounds

[0188] In certain embodiments, the compounds described herein may be antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

[0189] In certain embodiments, a compound described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

[0190] In certain embodiments, a compound or antisense compound is single-stranded. Such a single-stranded antisense compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugated group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.

[0191] In certain embodiments, the compounds are double-stranded. Such double-stranded compounds comprise a first oligonucleotide modified with a region complementary to a target nucleic acid and a second oligonucleotide modified with a region complementary to the first modified oligonucleotide. In certain Petition 870260057655, dated 12 / 06 / 2026, p. 60 / 1268 In 53 / 343 embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, the compound comprises a conjugated group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide has 12 to 30 linked nucleosides in length and the second modified oligonucleotide has 12 to 30 linked nucleosides in length.In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the SEQ ID NOs: 13 to 1941.

[0192] In certain embodiments, antisense compounds are double-stranded. Such double-stranded antisense compounds comprise a first oligomeric compound with a region complementary to a target nucleic acid and a second oligomeric compound with a region complementary to the first oligomeric compound. The first oligomeric compound of such double-stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugated group. The oligonucleotide of the second oligomeric compound of such double-stranded antisense compound may be modified or unmodified. One or both of the oligomeric compounds of a double-stranded antisense compound may comprise a conjugated group. The oligomeric compounds of double-stranded antisense compounds may include non-complementary protruding nucleosides.

[0193] Examples of single-stranded and double-stranded compounds include, Petition 870260057655, dated 12 / 06 / 2026, page 61 / 1268 54 / 343 but are not limited to, oligonucleotides, siRNA, microRNA-targeted oligonucleotides and single-stranded RNAi compounds such as small hairpin RNA (shRNA), single-stranded siRNA (ssRNA) and microRNA mimics.

[0194] In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is directed.

[0195] In certain embodiments, a compound described herein comprises an oligonucleotide with 10 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 12 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 12 to 22 linked subunits in length. In certain embodiments, the compound described herein comprises an oligonucleotide with 14 to 30 linked subunits in length. In certain embodiments, the compound described herein comprises an oligonucleotide with 14 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 15 to 30 linked subunits in length.In certain embodiments, a compound described herein comprises an oligonucleotide with 15 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 16 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 16 to 20 linked subunits in length. In certain embodiments, a compound described herein... Petition 870260057655, dated 12 / 06 / 2026, page 62 / 1268 55 / 343 This document comprises an oligonucleotide with 17 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 17 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 18 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 18 to 21 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 18 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 20 to 30 linked subunits in length.In other words, such oligonucleotides have 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits in length, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide with 14 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 16 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide with 17 linked subunits in length. In certain embodiments, the compound described herein comprises an oligonucleotide with 18 linked subunits in length.In certain modalities, a compound is described. Petition 870260057655, dated 12 / 06 / 2026, page 63 / 1268 56 / 343 in the present document comprises an oligonucleotide with 19 linked subunits in length. In certain embodiments, a compound described in the present document comprises an oligonucleotide with 20 linked subunits in length. In other embodiments, a compound described in the present document comprises an oligonucleotide with 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50 or 20 to 30 linked subunits. In certain embodiments, the compound described herein comprises an oligonucleotide with 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits of length or a range defined by any two of the above values. In some embodiments, the linked subunits are nucleotides, nucleosides, or nucleobases.

[0196] In certain embodiments, the compound may additionally comprise additional features or elements, such as a conjugated group, which are attached to the oligonucleotide. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where a conjugated group comprises a nucleoside (i.e., a nucleoside linking the conjugated group to the oligonucleotide), the nucleoside of the conjugated group is not counted in the length of the oligonucleotide.

[0197] In certain embodiments, compounds can be shortened or truncated. For example, a single subunit can be eliminated from the 5' end (5' truncation) or, alternatively, from the 3' end (3' truncation). A shortened or truncated compound Petition 870260057655, dated 12 / 06 / 2026, page 64 / 1268 57 / 343 targeting an APOL1 nucleic acid may have two subunits deleted from the 5' end or, alternatively, it may have two subunits deleted from the 3' end of the compound. Alternatively, the deleted nucleosides may be dispersed throughout the compound.

[0198] When a single additional subunit is present in an elongated compound, the additional subunit may be located at the 5' or 3' end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound with two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the compound. Alternatively, the added subunits may be dispersed throughout the compound.

[0199] It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and / or introduce mismatched bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89: 7305-7309; Gautschi et al. J. Natl. Cancer Inst. March 2001, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in the sequence, chemistry, and motif of oligonucleotides can make large differences in one or more of the properties required for clinical development (Seth et al. J. Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 2011, 133, 16642).

[0200] In certain embodiments, the compounds described in this document are RNA interference compounds (RNAi), which include double-stranded RNA compounds (also called short RNA interference or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds function at least in part through the RISC pathway to degrade and / or sequester a target nucleic acid. Petition 870260057655, dated 12 / 06 / 2026, p. 65 / 1268 58 / 343 (thus, include microRNA / microRNA mimetic compounds). As used in this document, the term siRNA is intended to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating a sequence-specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. Additionally, as used in this document, the term “RNAi” is intended to be equivalent to other terms used to describe sequence-specific RNA interference, such as post-transcriptional gene silencing, translational inhibition, or epigenetics.

[0201] In certain embodiments, a compound described herein may comprise any of the APOL1-targeted oligonucleotide sequences described herein. In certain embodiments, the compound may be double-stranded. In certain embodiments, the compound comprises a first strand comprising at least one portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from any of SEQ ID NOS: 13 to 1941 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence from any of SEQ ID NOS: 13 to 1941 and a second strand. In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) instead of thymine (T) in any of SEQ ID Nos: 13 to 1941. In certain embodiments, the compound comprises (i) a first strand comprising a sequence of complementary nucleobases Petition 870260057655, dated 12 / 06 / 2026, p. 66 / 1268 59 / 343 in AP0L1 to which any of SEQ ID NOS: 13 to 1941 is directed and (ii) a second strand. In certain embodiments, a compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as a fluorine group; 2'-F) or contains an alkoxy group (such as a methoxy group; 2'-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are arranged in an alternating pattern over at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally occurring phosphodiester bond.Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains one or more shielded strands, as disclosed, for example, by WO 00 / 63364, filed April 19, 2000.

[0202] In certain embodiments, the first strand of the compound is a guide siRNA strand and the second strand of the compound is a passenger siRNA strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound has 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides in length. In certain embodiments, the first or second strand of the compound may comprise a conjugated group.

[0203] In certain embodiments, a compound described in this document may comprise any of the following sequences Petition 870260057655, dated 12 / 06 / 2026, p. 67 / 1268 60 / 343 oligonucleotides targeting APOL1 described in this document. In certain embodiments, the compound is single-stranded. In certain embodiments, such a compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises at least one portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases from any of SEQ ID NOs: 13 to 1941. In certain embodiments, the compound comprises the nucleobase sequence from any of SEQ ID NOs: 13 to 1941. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any of SEQ ID NOs: 13 to 1941. In certain embodiments, the compound comprises a nucleobase sequence complementary to the site on APOL1 to which any of SEQ ID NOs: 13 to 1941 is directed.In certain embodiments, a compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as a fluorine group; 2'-F) or contains an alkoxy group (such as a methoxy group; 2'-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, the at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are arranged in an alternating pattern over at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally occurring phosphodiester bond. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages.The compounds can also be chemically modified nucleic acid molecules as taught in U.S. Patent No. Petition 870260057655, dated 12 / 06 / 2026, page 68 / 1268 61 / 343 6,673,661. In other embodiments, the compound contains a protected ribbon, as disclosed, for example, by WO 00 / 63364, filed on April 19, 2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22 or 23 linked nucleosides. In certain embodiments, the compound may comprise a conjugated group. Certain mechanisms

[0204] In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. In certain embodiments, the compounds described herein are capable of hybridizing with a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, the compounds described herein selectively affect one or more target nucleic acids. Such compounds comprise a nucleobase sequence that hybridizes with one or more target nucleic acids, resulting in one or more desired antisense activities, and does not hybridize with one or more non-target nucleic acids or does not hybridize with one or more non-target nucleic acids in such a way as to result in significant undesired antisense activity.

[0205] In certain antisense activities, hybridization of a compound described in this document with a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described in this document result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, the... Petition 870260057655, dated 12 / 06 / 2026, p. 69 / 1268 62 / 343 compounds described in this document are sufficiently “DNA-like” to elicit RNase H activity. Additionally, in certain embodiments, one or more non-DNA-like nucleosides are tolerated in the gap of a gapmer.

[0206] In certain antisense activities, the compounds described herein or a portion of the compound are loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. The compounds that are loaded into RISC are RNAi compounds. RNAi compounds can be double-stranded (siRNA) or single-stranded (ssRNA).

[0207] In certain embodiments, hybridization of compounds described in this document with a target nucleic acid does not result in the recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound with the target nucleic acid results in altered splicing of the target nucleic acid. In certain embodiments, hybridization of the compound with a target nucleic acid results in the inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound with a target nucleic acid results in altered translation of the target nucleic acid.

[0208] Antisense activities can be observed directly or indirectly. In certain embodiments, the observation or detection of an antisense activity involves observing or detecting a change in the quantity of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splicing variants of a nucleic acid or protein, and / or a phenotypic change in a cell or animal. Petition 870260057655, dated 12 / 06 / 2026, page 70 / 1268 63 / 343 Target nucleic acids, target regions, and nucleotide sequences

[0209] In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic, and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0210] The nucleotide sequences encoding APOL1 include, without limitation, the following: Ref. No. NM_003661.3 (incorporated by reference, disclosed in this document as SEQ ID NO: 1), NT_011520.9 truncated from nucleotides 15986452 to 16001905 (SEQ ID NO: 2), NM_001136541.1 (SEQ ID NO: 3), NM_001136540.1 (SEQ ID NO: 4), NM_145343.2 (SEQ ID NO: 5), DC339680.1 (SEQ ID NO: 6), AK309143.1 (SEQ ID NO: 7), NT_011520.13 truncated from nucleotides 17543446 to 17543655 (SEQ ID NO: 8) or NC_000022.11 truncated from nucleotides 36250001 to 36271000 (SEQ ID NO: 9). Hybridization

[0211] In some embodiments, hybridization occurs between a compound disclosed in this document and an APOL1 nucleic acid. The most common hybridization mechanism involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding) between complementary nucleobases of the molecules. Petition 870260057655, dated 12 / 06 / 2026, p. 71 / 1268 64 / 343 of nucleic acid.

[0212] Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

[0213] Methods for determining whether a sequence is specifically hybridizable with a target nucleic acid are well known in the art. In certain embodiments, the compounds provided in this document are specifically hybridizable with a nucleic acid from APOL1. Complementarity

[0214] An oligonucleotide is said to be complementary to another nucleic acid when the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposite directions. Nucleobase matches or complementary nucleobases, as described in this document, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity in every nucleoside and may include one or more non-matches of nucleobases.An oligonucleotide is considered fully complementary or 100% complementary when such oligonucleotides have matching nucleobases in each nucleoside without any mismatches.

[0215] In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the compounds described in Petition 870260057655, dated 12 / 06 / 2026, page 72 / 1268 65 / 343 present document are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. Non-complementary nucleobases between a compound and an APOL1 nucleic acid may be tolerated provided that the compound remains capable of specifically hybridizing with a target nucleic acid. Furthermore, a compound may hybridize along one or more segments of an APOL1 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, non-matching, or hairpin structure).

[0216] In certain embodiments, the compounds provided herein, or a specified portion thereof, are, are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to an APOL1 nucleic acid, a target region, target segment or specified portion thereof. In certain embodiments, the compounds provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to an APOL1 nucleic acid, a target region, target segment, or specified portion thereof. The percentage of complementarity of a compound to a target nucleic acid can be determined using routine methods.

[0217] For example, a compound in which 18 of the compound's 20 nucleobases are complementary to a target region, and therefore would hybridize specifically, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases can be grouped or interspersed with complementary nucleobases and do not need to be contiguous with respect to each other or with respect to complementary nucleobases. As such, a compound Petition 870260057655, dated 12 / 06 / 2026, page 73 / 1268 A compound 66 / 343, which has 18 nucleobases in length and four non-complementary nucleobases flanked by two regions of complete complementarity with the target nucleic acid, would have 77.8% overall complementarity with the target nucleic acid. The percentage of complementarity of a compound with a region of a target nucleic acid can be routinely determined using BLAST (Basic Local Alignment Search Tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res, 1997, 7, 649-656). The percentage of homology, sequence identity, or complementarity can be determined, for example, by the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison, Wis.), using standard definitions, which uses the Smith and Waterman algorithm (Adv. Appl. Math., 1981, 2, 482-489).

[0218] In certain embodiments, the compounds described in this document, or specified portions thereof, are fully complementary (i.e., 100% complementarity) to a target nucleic acid or specified portion thereof. For example, a compound may be fully complementary to a nucleic acid of APOL1, or a target region, or a target segment or target sequence thereof. As used in this document, “fully complementary” means that each nucleobase of a compound is complementary to the corresponding nucleobase of a target nucleic acid. For example, a compound with 20 nucleobases is fully complementary to a target sequence that is 400 nucleobases long, provided there is a corresponding 20-nucleobase portion of the target nucleic acid that is fully complementary to the compound. Fully complementary may also be used in reference to a portion Petition 870260057655, dated 12 / 06 / 2026, p. 74 / 1268 67 / 343 specified tion of the first and / or second nucleic acid. For example, a 20-nucleobase portion of a 30-nucleobase compound may be “fully complementary” to a target sequence that is 400 nucleobases long. The 20-nucleobase portion of the 30-nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20-nucleobase portion where each nucleobase is complementary to the 20-nucleobase portion of the compound. At the same time, the entire 30-nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

[0219] In certain embodiments, the compounds described herein comprise one or more non-matching nucleobases with respect to the target nucleic acid. In certain such embodiments, the antisense activity against the target is reduced by the non-match, but the activity against a non-target is reduced to a greater extent. Thus, in certain such embodiments, the selectivity of the compound is improved. In certain embodiments, the non-match is specifically positioned within an oligonucleotide that has a gapper motif. In certain such embodiments, the non-match is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In certain such embodiments, the non-match is at position 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3' end of the gap region. In certain of these configurations, the mismatch is at position 1, 2, 3, or 4 from the 5' end of the wing region.In certain of these embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3' end of the wing region. In certain embodiments, the mismatch is specifically positioned den. Petition 870260057655, dated 12 / 06 / 2026, page 75 / 1268 68 / 343 part of an oligonucleotide that does not have a gapper motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain embodiments, the mismatch is at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

[0220] The location of a non-complementary nucleobase may be at the 5' end or 3' end of the compound. Alternatively, the non-complementary nucleobase(s) may be in an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.

[0221] In certain embodiments, the compounds described in this document that have, or have up to, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleobases in length comprise not more than 4, not more than 3, not more than 2 or not more than 1 non-complementary nucleobase(s) with respect to a target nucleic acid, such as an APOL1 nucleic acid, or a specified portion thereof.

[0222] In certain embodiments, the compounds described in this document that have, or have up to, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases in length comprise not more than 6, not more than 5, not more than 4, not more than 3, not more than 2 or not more than 1 non-complementary nucleobase(s) with respect to a target nucleic acid, such as an APOL1 nucleic acid, or a specified portion thereof.

[0223] In certain embodiments, the compounds described in this document also include those that are complementary Petition 870260057655, dated 12 / 06 / 2026, page 76 / 1268 69 / 343 to a portion of a target nucleic acid. As used in this document, “portion” refers to a defined number of contiguous (i.e., linked) nucleobases within a region or segment of a target nucleic acid. A “portion” may also refer to a defined number of contiguous nucleobases of a compound. In certain embodiments, compounds are complementary to at least one 8-nucleobase portion of a target segment. In certain embodiments, compounds are complementary to at least one 9-nucleobase portion of a target segment. In certain embodiments, compounds are complementary to at least one 10-nucleobase portion of a target segment. In certain embodiments, compounds are complementary to at least one 11-nucleobase portion of a target segment. In certain embodiments, compounds are complementary to at least one 12-nucleobase portion of a target segment.In certain embodiments, the compounds are complementary to at least one 13-nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least one 14-nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least one 15-nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least one 16-nucleobase portion of a target segment. Compounds that are complementary to at least one portion with 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobases of a target segment, or a range defined by any two of these values, are also contemplated. Identity.

[0224] The compounds provided in this document may also have a defined percentage of identity with respect to a particular nucleotide sequence, SEQ ID NO or compound represented. Petition 870260057655, dated 12 / 06 / 2026, p. 77 / 1268 70 / 343 by a specific ION number or portion thereof. In certain embodiments, the compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, the compounds described herein are modified oligonucleotides. As used herein, a compound is identical to the sequence disclosed herein if it has the same nucleobase pairing capability. For example, an RNA containing uracil instead of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and elongated versions of the compounds described herein, as well as compounds having non-identical bases with respect to the compounds provided herein, are also contemplated. Non-identical bases may be adjacent to each other or dispersed throughout the compound.The percentage of identity of a compound is calculated according to the number of bases that have identical base pairing with respect to the sequence with which it is being compared.

[0225] In certain embodiments, the compounds described in this document, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOS, or a portion thereof, disclosed in this document. In certain embodiments, the compounds described herein are approximately 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical, or any percentage between these values, to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof, wherein the compounds comprise an oligonucleotide. Petition 870260057655, dated 12 / 06 / 2026, p. 78 / 1268 71 / 343 nucleotide with one or more non-matching nucleobases. In certain embodiments, the non-match is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain embodiments, the non-match is at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

[0226] In certain embodiments, the compounds described herein comprise or consist of antisense compounds. In certain embodiments, a portion of the antisense compound is compared with a portion of equal length of the target nucleic acid. In certain embodiments, a portion with 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobases is compared with a portion of equal length of the target nucleic acid.

[0227] In certain embodiments, the compounds described herein comprise or consist of oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared with a portion of equal length of the target nucleic acid. In certain embodiments, a portion with 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobases is compared with a portion of equal length of the target nucleic acid. Certain modified compounds

[0228] In certain embodiments, the compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA), or they may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification with respect to unmodified RNA or DNA (i.e., they comprise at least one modified nucleoside). Petition 870260057655, dated 12 / 06 / 2026, page 79 / 1268 72 / 343 (comprising a modified sugar fraction and / or a modified nucleobase) and / or at least one modified internucleosidic bond). A. Modified nucleosides

[0229] Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase. 1. Modified sugar fractions

[0230] In certain embodiments, the sugar fractions are non-bicyclic modified sugar fractions. In certain embodiments, the modified sugar fractions are bicyclic or tricyclic sugar fractions. In certain embodiments, the modified sugar fractions are sugar substitutes. Such sugar substitutes may comprise one or more substitutions corresponding to those of other types of modified sugar fractions.

[0231] In certain embodiments, the modified sugar fractions are non-bicyclic modified furanosyl sugar fractions comprising one or more acyclic substituents, including, but not limited to, substituents in the 2', 4' and / or 5' positions. In certain embodiments, the furanosyl sugar fraction is a ribosyl sugar fraction. In certain embodiments, one or more acyclic substituents of non-bicyclic modified sugar fractions is / are branched. Examples of suitable 2' substituent groups for non-bicyclic modified sugar fractions include, but are not limited to: 2'F, 2'-OCH3 (“OMe” or “O-methyl”) and 2'-O(CH2)2OCH3 (“MOE”).In certain embodiments, the 2' substituent groups are selected from: halogen, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10 alkoxy, substituted O-C1-C10 alkoxy, O-C1-C10 alkyl, substituted O-C1-C10 alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl,. Petition 870260057655, dated 12 / 06 / 2026, p. 80 / 1268 73 / 343 alkynyl, alcaryl, aralkyl, O-alcaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), wherein each Rm and Rn independently, H, a substituted or unsubstituted C1-C10 amino or alkyl protecting group and the substituent groups in 2' described in Cook et al., US 6,531,584; Cook et al., US 5,859,221; and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituted groups may be further substituted with one or more substituent groups independently selected from: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of 4'-substituent groups suitable for modified non-bicyclic linear sugar fractions include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., NO 2015 / 106128.Examples of suitable 5' substituent groups for non-bicyclic modified sugar fractions include, but are not limited to: 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridged sugar substituent, for example, 2'-F-5'-methyl sugar fractions, and the modified sugar and modified nucleoside fractions described in Migawa et al., US2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0232] In certain embodiments, a 2'-substituted nucleoside or 2'-modified non-bicyclic nucleoside comprises a sugar moiety comprising a linear 2'-substituted substituent group, selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamide (OCH2C(=O)N(Rm)(Rn)), wherein each Rm and Rn independently H, an amino or C1-C10 substituted or unsubstituted alkyl protecting group.

[0233] In certain embodiments, a substituted nucleoside Petition 870260057655, dated 12 / 06 / 2026, page 81 / 1268 74 / 343 in 2' or non-bicyclic nucleoside modified in 2' comprises a sugar moiety comprising a linear substituent group in 2', selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2 and OCH2C(=O)-N(H)CH3(“NMA”).

[0234] In certain embodiments, a 2'-substituted nucleoside or 2'-modified non-bicyclic nucleoside comprises a sugar moiety comprising a linear 2'-substituent group, selected from: F, OCH3 and OCH2CH2OCH3.

[0235] Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, are referred to by the position(s) of the substitution(s) in the nucleoside sugar moiety. For example, nucleosides comprising 2'-substituted or 2'-modified sugar moieties are called 2'-substituted nucleosides or 2'-modified nucleosides.

[0236] Certain modified sugar fractions comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar fraction. In certain such embodiments, the bicyclic sugar fraction comprises a bridge between the furanose ring atoms at 4' and 2'. In certain embodiments, the furanose ring is a ribose ring. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4'CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (called “hindered ethyl” or “cEt” when in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'CH(CH2OCH3)-O-2' (“hindered MOE” or “cMOE”) and their analogues (see, for example, Seth et al., US 7,399,845, Bhat et al., US 7,569,686, Swayze et al., US 7,741,457 and Swayze et al., US 8,022,193), 4'C(CH3)(CH3)-O-2' and its analogues (see, for example, Seth et al., US 8,278.283), 4'-CH2-N(OCH3)-2' and its analogues (see, for example, Pra. Petition 870260057655, dated 12 / 06 / 2026, p. 82 / 1268 75 / 343 kash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, for example, Allerson et al., US 7,696,345 and Allerson et al., US 8,124,745), 4'-CH2C(H)(CH3)-2' (see, for example, Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and its analogues (see, for example, Seth et al., US 8,278,426), 4'-C(RaRb)-N(R)-O-2', 4'-C(RaRb)-ON(R)-2', 4'-CH2O-N(R)-2' and 4'-CH2-N(R)-O-2', where each R, Rae Rbé, independently, H, a protecting group or C1-C12 alkyl (see, for example, Imanishi et al., US 7,427,672).

[0237] In certain embodiments, such 4' to 2' bridges independently comprise 1 to 4 independently connected groups selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO-, -C(Ra)=C(Rb)-, -C (Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)X- and -N(Ra)-;

[0238] where:

[0239] x is 0, 1 or 2;

[0240] right 1, 2, 3 or 4;

[0241] each Rae Rbé, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C2 aryl, substituted C5-C2 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-Ji) or sulfoxyl (S(=O)-Ji); and each J1 and J2 is, independently, H, C1Ci2 alkyl, substituted C1-Ci2alkyl, C2-Ci2 alkenyl, substituted C2-Ci2alkenyl, C2-Ci2 alkynyl, substituted C2-Ci2alkynyl, Cs-C2o aryl, substituted Cs-C2o aryl, acyl (C(=O)-H), substituted acyl, a heterocyclic radical, a substituted heterocyclic radical, C1-C12 aminoalkyl, C1-C12 substituted aminoalkyl or a protecting group.

[0242] Additional bicyclic sugar fractions are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, Petition 870260057655, dated 12 / 06 / 2026, p. 83 / 1268 76 / 343 (22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Academic. Sci. U. S. A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh etal., J. Org. Chem., 1998, 63,10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001,2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther, 2001, 3, 239243; Wengel et al., US 7.053.207, Imanishi et al., US 6.268.490, Imanishi et al. US 6.770.748, Imanishi et al., US RE44,779; Wengel et al., US 6.794.499, Wengel et al., US 6.670.461; Wengel et al., US 7.034.133, Wengel et al., US 8.080.644; Wengel et al., US 8.034.909; Wengel etal., US 8.153.365; Wengel etal., US 7.572.582; e Ramasamy et al., US 6.525.191, Torsten et al., WO 2004 / 106356, Wengel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., US 7.547.684; Seth et al., US 7.666.854; Seth et al., US 8.088.746; Seth et al., US 7.750.131; Seth et al., US 8.030.467; Seth et al., US 8.268.980; Seth et al., US 8.546.556; Seth et al., US 8,530,640; Migawa et al., US 9,012,421; Seth et al., US 8,501,805; Allerson et al., US2008 / 0039618; and Migawa et al., US2015 / 0191727.

[0243] In certain embodiments, the bicyclic sugar fractions and nucleosides incorporating such bicyclic sugar fractions are further defined by the isomeric configuration. For example, an LNA nucleoside (described in this document) may be in the α-L configuration or in the β-D configuration. LNA (β-D configuration) bridge = 4'-CH2-O-2' α-Z,-LNA (αL configuration) bridge = 4'-CH2-O-2' Petition 870260057655, dated 12 / 06 / 2026, page 84 / 1268 77 / 343

[0244] Bicyclic nucleosides of α-L-methyleneoxy(4-CH2-O-2') or αL-LNA have been incorporated into oligonucleotides that have shown antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In the present document, general descriptions of bicyclic nucleosides include both isomeric configurations. When specific bicyclic nucleoside positions (e.g., LNA or cEt) are identified in exemplary embodiments in the present document, they are in the β-D configuration unless otherwise specified.

[0245] In certain embodiments, the modified sugar fractions comprise one or more non-bridged sugar substituents and one or more bridged sugar substituents (e.g., sugars substituted at 5' and bridged from 4' to 2').

[0246] In certain embodiments, the modified sugar fractions are sugar substitutes. In certain such embodiments, the oxygen atom of the sugar fraction is substituted, for example, with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar fractions also comprise bridging and / or non-bridging substituents as described in this document. For example, certain sugar substitutes comprise a sulfur atom at 4' and a substitution at the 2' position (see, for example, Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or at the 5' position.

[0247] In certain embodiments, the sugar substitutes comprise rings having a number other than 5 atoms. For example, in certain embodiments, a sugar substitute comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), Petition 870260057655, dated 12 / 06 / 2026, p. 85 / 1268 78 / 343 anitol nucleic acid (“ANA”), mannitol nucleic acid (“MNA”) (see, for example, Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA: F-HNA

[0248] (“F-HNA”, see, for example, Swayze et al., US 8,088,904; Swayze et al., US 8,440,803; and Swayze et al., US 9,005,906, F-HNA (which can also be called F-THP or 3'-fluoro-tetrahydropyran) and nucleosides comprising additional modified THP compounds having the formula:

[0249] wherein, independently, for each of the aforementioned modified THP nucleosides:

[0250] Bx is a nucleobase fraction;

[0251] T3 and T4 are each independently an internucleoside linking group linking the modified THP nucleoside to the rest of an oligonucleotide or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the rest of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a conjugated group linked or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6 and q7 are each independently H, C1-C1 alkyl, substituted C1-C1 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C1 alkynyl or substituted C2-C6 alkynyl; and each of R1 and R2 is independently selected from: hydrogen, halogen, substituted alkoxy Petition 870260057655, dated 12 / 06 / 2026, p. 86 / 1268 79 / 343 or not substituted, NJ1J2, SJ1, N3, OC(=X)Ji, OC(=X)NJiJ2, NJ3C(=X) NJ1J2e CN, where X is O, S or NJ1 and each Ji, J2 and J3 is independently H or C1-C1 alkyl.

[0252] In certain embodiments, modified THP nucleosides are provided in which q1, q2, q3, q4, qs, qe and q? are each H. In certain embodiments, at least one of q1, q2, q3, q4, qs, qe and q? is different from H. In certain embodiments, at least one of q1, q2, q3, q4, qs, qe and q? is methyl. In certain embodiments, modified THP nucleosides are provided in which one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0253] In certain embodiments, the sugar substitutes comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used in the present document, the term “morpholino” means a sugar substitute having the following structure: I « / vw

[0254] In certain embodiments, morpholinos can be modified, for example by the addition or alteration of various substituent groups of the morpholinos structure above. Such sugar substitutes are referred to in this document as “modified morpholinos”.

[0255] In certain forms, sugar substitutes Petition 870260057655, dated 12 / 06 / 2026, page 87 / 1268 80 / 343 comprise acyclic fractions. Examples of nucleosides and oligonucleotides comprising such acyclic sugar substitutes include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865) and nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378.

[0256] Many other sugar ring systems and bicyclic and tricyclic sugar substitutes are known in the art that can be used in modified nucleosides. 2. Modified nucleobases

[0257] Modifications or substitutions of nucleobases (or bases) are structurally distinguishable from, but functionally indistinguishable from, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may provide stability to nucleases, binding affinity, or some other beneficial biological property to antisense compounds.

[0258] In certain embodiments, the compounds described herein comprise modified oligonucleotides. In certain embodiments, the modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, the modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, the modified oligonucleotides comprise one or more nucleosides that do not comprise a nucleobase, referred to as an abasic nucleoside.

[0259] In certain embodiments, the modified nucleobases are selected from: pyrimidines substituted at 5,6-azapyrimidines, pyrimidines substituted with alkyl or alkynyl, purines substituted with alkyl, and purines substituted at N-2, N-6 and O-6. In certain embodiments Petition 870260057655, dated 12 / 06 / 2026, page 88 / 1268 In 81 / 343 embodiments, the modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C^C-CHs) uracil, 5-propynylcytosine, 6-azouracyl, 6-azocytosine, 6-azotimine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other purines substituted in 8,5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-desazaguanine, 7-desaza-adenine, 3-desazaguanine, 3-desaza-adenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl-4-N-benzoylcytosine, 5-methyl-4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, bases with expanded size and fluorinated bases.Additional modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-desazaadenine, 7-desazaguanosine, 2-aminopyridine, and 2-pyridone. Additional nucleobases include those disclosed in Merigan et al., US 3,687,808, and those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0260] Publications that teach the preparation of certain types of Petition 870260057655, dated 12 / 06 / 2026, page 89 / 1268 82 / 343 modified nucleobases above mentioned as other modified nucleobases include, without limitation, Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906; Dinh et al., US 4,845,205; Spielvogel et al., US 5,130,302; Rogers et al., US 5,134,066; Bischofberger et al., US 5,175,273; Urdea et al., US 5,367,066; Benner et al., US 5,432,272; Matteucci et al., US 5,434,257; Gmeiner et al., US 5,457,187; Cook et al., US 5,459,255; Froehler et al., US 5,484,908; Matteucci et al., US 5,502,177; Hawkins et al., US 5,525,711; Haralambidis et al., US 5,552,540; Cook et al., US 5,587,469; Froehler et al., US 5,594,121; Switzer et al., US 5,596,091; Cook et al., US 5,614,617; Froehler et al., US 5,645,985; Cook et al., US 5,681,941; Cook et al., US 5,811,534; Cook et al., US 5,750,692; Cook et al., US 5,948,903; Cook et al., US 5,587,470; Cook et al., US 5,457,191; Matteucci et al., US 5,763,588; Froehler et al., US 5,830,653; Cook et al., US 5,808,027; Cook et al., US 6,166.199; and Matteucci et al., US 6,005,096.

[0261] In certain embodiments, compounds targeting an APOL1 nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine. Modified internucleoside bonds

[0262] The naturally occurring RNA-DNA internucleoside linkage is a 3' to 5' phosphodiester bond. In certain embodiments, compounds described herein that have one or more modified, i.e., non-naturally occurring, internucleoside linkages are often selected with greater preference than compounds that have naturally occurring internucleoside linkages due to desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases. Petition 870260057655, dated 12 / 06 / 2026, p. 90 / 1268 83 / 343

[0263] Representative internucleoside linkages with a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages with a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, the modified oligonucleotide populations comprise phosphorothioate internucleoside linkages in which all phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in the random selection of the stereochemical configuration of each phosphorothioate linkage.However, as is well understood by experts in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched in modified oligonucleotides comprising one or more particular phosphorothioate internucleosidic linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population.In certain embodiments, the particular configuration of the phosphorothioate bond is present in at least 90% of the... Petition 870260057655, dated 12 / 06 / 2026, p. 91 / 1268 84 / 343 molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, for example, methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014) and WO 2017 / 015555. In certain embodiments, a population of modified oligonucleotides is enriched in modified oligonucleotides with at least one phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched in modified oligonucleotides with at least one phosphorothioate in the (Rp) configuration.In certain embodiments, the modified oligonucleotides comprising phosphorothioates ( / βp) and / or (Sp) comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

[0264] Unless otherwise indicated, the chiral internucleoside linkages of modified oligonucleotides described herein may be stereorandom or in a particular stereochemical configuration.

[0265] In certain embodiments, compounds targeting an APOL1 nucleic acid comprise one or more linkages Petition 870260057655, dated 12 / 06 / 2026, page 92 / 1268 85 / 343 modified internucleoside bonds. In certain embodiments, the modified internucleoside bonds are phosphorothioate bonds. In certain embodiments, each internucleoside bond of an antisense compound is a phosphorothioate internucleoside bond.

[0266] In certain embodiments, the compounds described herein comprise oligonucleotides. Oligonucleotides having modified internucleosidic linkages include internucleosidic linkages retaining a phosphorus atom as well as internucleosidic linkages lacking a phosphorus atom. Representative phosphorus-containing internucleosidic linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods for preparing both phosphorus-containing and non-phosphorus-containing linkages are well known.

[0267] In certain embodiments, modified oligonucleotide nucleosides can be linked using any internucleosidic linkage. The two main classes of internucleosidic linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleosidic linkages include, but are not limited to, phosphates containing a phosphodiester (“P=O”) linkage (also called unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates and phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus-containing internucleosidic linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-OCH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-); siloxane (-O-S1H2O-) and Ν,Ν'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-).Modified internucleosidic bonds, compared to naturally occurring phosphate bonds, can be used to alter, typically increase, the nuclease resistance of the oligonucleotide. In certain embodiments, the internucleosidic bonds have a chiral atom. Petition 870260057655, dated 12 / 06 / 2026, page 93 / 1268 86 / 343 can be prepared as a racemic mixture or as separate enantiomers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0268] Neutral internucleoside links include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-OCH2-O-5'), methoxypropyl and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleosidic linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester, and amides (See, for example: Carbohydrate Modifications in Antisense Research, YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleosidic linkages include nonionic linkages comprising mixed component parts of N, O, S, and CH2.

[0269] In certain embodiments, the oligonucleotides comprise modified internucleosidic linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleosidic linkage motif. In certain embodiments, the internucleosidic linkages are arranged in a motif with gaps. In such embodiments, the internucleosidic linkages in each of the two wing regions are different from the internucleosidic linkages in the gap region. In certain embodiments, the internucleosidic linkages in the wings are phosphodiester and the internucleosidic linkages in the gap are phosphorothioate. The nucleoside motif is independently selected, so such oligonucleotides having a gap-internucleosidic linkage motif may or may not have a Petition 870260057655, dated 12 / 06 / 2026, page 94 / 1268 87 / 343 nucleoside motif with gap, and if they have a nucleoside motif with a gap, the wing and gap lengths may or may not be the same.

[0270] In certain embodiments, the oligonucleotides comprise a region that has an alternating internucleosidic linkage motif. In certain embodiments, the oligonucleotides comprise a region of uniformly modified internucleosidic linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleosidic linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleosidic linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleosidic linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleosidic linkage is phosphorothioate.

[0271] In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleosidic bonds. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleosidic bonds. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleosidic bonds. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleosidic bonds. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleosidic bonds. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleosidic bonds. In certain embodiments, the oligonucleotide with Petition 870260057655, dated 12 / 06 / 2026, page 95 / 1268 88 / 343 comprises at least one block of at least 12 consecutive phosphorothioate internucleoside linkages. In certain embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain embodiments, at least one such block is located within 3 nucleosides of the 3' end of the oligonucleotide.

[0272] In certain embodiments, oligonucleotides comprise one or more methylphosphonate linkages. In certain embodiments, oligonucleotides having a gapper nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosphonate linkages. In certain embodiments, a methylphosphonate linkage is in the central gap of an oligonucleotide having a gapper nucleoside motif.

[0273] In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside bonds and phosphodiester internucleoside bonds to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside bonds and the number and position of phosphodiester internucleoside bonds to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside bonds can be decreased and the number of phosphodiester internucleoside bonds can be increased. In certain embodiments, the number of phosphorothioate internucleoside bonds can be decreased and the number of phosphodiester internucleoside bonds can be increased while maintaining nuclease resistance. In certain embodiments, it is desirable to decrease the number of phosphorothioate internucleoside bonds while retaining resistance to nucleases.In certain situations, it is desirable. Petition 870260057655, dated 12 / 06 / 2026, page 96 / 1268 89 / 343 increase the number of phosphodiester internucleoside bonds while retaining resistance to nucleases. 3. Certain reasons

[0274] In certain embodiments, the compounds described herein comprise oligonucleotides. Oligonucleotides may have a motif, for example, a pattern of unmodified and / or modified sugar moieties, nucleobases and / or internucleosidic bonds. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleosidic bonds. In such embodiments, the modified, unmodified and differently modified sugar moieties, nucleobases and / or internucleosidic bonds of a modified oligonucleotide define a pattern or motif.In certain embodiments, the patterns of sugar fractions, nucleobases, and internucleosidic bonds are each independent of the others. Thus, a modified oligonucleotide can be described by its sugar motif, nucleobase motif, and / or internucleosidic bond motif (as used in this document, a nucleobase motif describes modifications to the nucleobases independently of the nucleobase sequence). a. Certain sugar motifs

[0275] In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise one or more types of modified and / or unmodified sugar moieties arranged Petition 870260057655, dated 12 / 06 / 2026, page 97 / 1268 90 / 343 along the oligonucleotide or a region thereof, in a defined sugar pattern or motif. In certain cases, such sugar motifs include, but are not limited to, any of the sugar modifications discussed in this document.

[0276] In certain embodiments, the modified oligonucleotides comprise or consist of a region having a gapmer motif, comprising two outer regions or “wings” and a central or inner region or “gap.” The three regions of a gapmer motif (the 5' wing, the gap, and the 3' wing) form a contiguous sequence of nucleosides in which at least some of the sugar fractions of the nucleosides in each of the wings differ from at least some of the sugar fractions of the nucleosides in the gap. Specifically, at least the sugar fractions of the nucleosides in each wing that are closest to the gap (the 3'most nucleoside of the 5' wing and the 5'most nucleoside of the 3' wing) differ from the sugar fraction of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing / gap junction). In certain forms, the sugar fractions within the gap are equal to one another.In certain embodiments, the gap includes one or more nucleosides with a sugar moiety that differs from the sugar moiety of one or more of the other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5' wing differs from the sugar motif of the 3' wing (asymmetric gapmer).

[0277] In certain embodiments, the wings of a gapmer comprise from 1 to 5 nucleosides. In certain embodiments, the wings of a gapmer comprise from 2 to 5 nucleosides. In certain embodiments, the wings of a gapmer comprise from 3 to 5 nucleosides. In certain embodiments, the nucleosides of a gapmer are all modified nucleosides. Petition 870260057655, dated 12 / 06 / 2026, p. 98 / 1268 91 / 343

[0278] In certain embodiments, the gap of a gapmer comprises 7 to 12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7 to 10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8 to 10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In a certain embodiment, each nucleoside in the gap of a gapmer is an unmodified 2'-deoxynucleoside.

[0279] In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the gap-side nucleosides of each wing / gap junction are unmodified 2'-deoxynucleosides and the wing-side nucleosides of each wing / gap junction are modified nucleosides. In certain of these embodiments, each gap nucleoside is an unmodified 2'-deoxynucleoside. In certain of these embodiments, each wing nucleoside is a modified nucleoside.

[0280] In certain embodiments, a modified oligonucleotide has a completely modified sugar motif in which each nucleoside of the modified oligonucleotide comprises a modified sugar fraction. In certain embodiments, modified oligonucleotides comprise or consist of a region that has a completely modified sugar motif in which each nucleoside of the region comprises a modified sugar fraction. In certain embodiments, modified oligonucleotides comprise or consist of a region that has a completely modified sugar motif, in which each nucleoside within the completely modified region comprises the same modified sugar fraction, referred to herein as a uniformly modified sugar motif. In certain embodiments, a completely modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments Petition 870260057655, dated 12 / 06 / 2026, page 99 / 1268 92 / 343 mined modalities, each nucleoside of a uniformly modified nucleoside comprises the same modification in 2'. b. Certain nucleobase motifs

[0281] In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

[0282] In certain embodiments, the modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5' end of the oligonucleotide. In certain embodiments, oligonucleotides having a gapper motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, a nucleoside comprising a modified nucleobase is in the gap. Petition 870260057655, dated 12 / 06 / 2026, pp. 100 / 1268 93 / 343 central oligonucleotide that has a gapmer motif. In certain embodiments, the sugar moiety of said nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propinopyrimidine. c. Certain internucleoside linkage motifs

[0283] In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise modified and / or unmodified internucleosidic linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, essentially each group of internucleosidic linkages is a phosphate (P=O) internucleosidic linkage. In certain embodiments, each group of internucleosidic linkages of a modified oligonucleotide is a phosphorothioate (P=S) linkage. In certain embodiments, each group of internucleosidic linkages of a modified oligonucleotide is independently selected from a phosphorothioate and a phosphate internucleosidic linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleosidic linkages within the gap are all modified.In certain embodiments, some or all of the internucleosidic linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleosidic linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleosidic linkage motif comprises at least one phosphodiester internucleosidic linkage in at least one wing, wherein at least one phosphodiester linkage is not a terminal internucleosidic linkage and the remainder of the internucleosidic linkages. Petition 870260057655, dated 12 / 06 / 2026, page 101 / 1268 94 / 343 are phosphorothioate internucleosidic linkages. In certain embodiments, all phosphorothioate linkages are stereorandom. In certain embodiments, all phosphorothioate linkages in the wings are phosphorothioates (Sp) and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the modified oligonucleotide populations are enriched in modified oligonucleotides comprising such internucleosidic linkage motifs. 4. Certain modified oligonucleotides

[0284] In certain embodiments, the compounds described herein comprise modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, internucleosidic linkage) are incorporated into a modified oligonucleotide. In certain embodiments, the modified oligonucleotides are characterized by their modification, motifs, and overall lengths. In certain embodiments, such parameters are each independent of each other. Thus, unless otherwise indicated, each internucleosidic linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleosidic linkages within the wing regions of a sugar gapmer may be the same or different from each other and may be the same or different from the internucleosidic linkages of the gap region of the sugar motif.Similarly, such gapper oligonucleotides may comprise one or more modified nucleobases independently of the gapper pattern of the sugar modifications. Furthermore, in certain cases, an oligonucleotide is described by an overall length or range and by lengths or ranges of lengths of two or more regions. Petition 870260057655, dated 12 / 06 / 2026, page 102 / 1268 95 / 343 (for example, a nucleoside region having specified sugar modifications), under such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length outside the specified range. Under such circumstances, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists of 15 to 20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2 to 6 linked nucleosides having a specified sugar motif, region B consists of 6 to 10 linked nucleosides having a specified sugar motif, and region C consists of 2 to 6 linked nucleosides having a specified sugar motif.These embodiments do not include modified oligonucleotides where each of A and C consists of 6 linked nucleosides and B consists of 10 linked nucleosides (although these numbers of nucleosides are permitted in the requirements for A, B, and C) because the overall length of such an oligonucleotide is 22, which exceeds the upper limit of the overall length of the modified oligonucleotide (20). In the present document, if a description of an oligonucleotide is silent with respect to one or more parameters, that parameter is not limited. Thus, a modified oligonucleotide described only as having a gapmer sugar motif without further description may have any length, internucleoside linking motif, and nucleobase motif. Unless otherwise indicated, all modifications are independent of the nucleobase sequence. Certain conjugated compounds

[0285] In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugated groups and / or end groups. The conjugated groups consist of Petition 870260057655, dated 12 / 06 / 2026, page 103 / 1268 96 / 343 one or more conjugated moieties and a conjugate linker that links the conjugated moiety to the oligonucleotide. Conjugated groups may be attached to one or both ends of an oligonucleotide and / or at any internal position. In certain embodiments, conjugated groups are attached to the 2' position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugated groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain embodiments, conjugated groups or terminal groups are attached to the 3' and / or 5' ends of oligonucleotides. In certain embodiments, conjugated groups (or terminal groups) are attached to the 3' end of oligonucleotides. In certain embodiments, conjugated groups are attached near the 3' end of oligonucleotides.In certain embodiments, the conjugated groups (or terminal groups) are attached at the 5' end of oligonucleotides. In certain embodiments, the conjugated groups are attached near the 5' end of oligonucleotides.

[0286] In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a compound has a nucleobase sequence that is complementary to a target nucleic acid. In certain embodiments, the oligonucleotides are complementary to a messenger RNA (mRNA). In certain embodiments, the oligonucleotides are complementary to a sense transcript.

[0287] Examples of terminal groups include, but are not limited to, conjugated groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified. Petition 870260057655, dated 12 / 06 / 2026, page 104 / 1268 97 / 343 A. Certain conjugated groups

[0288] In certain embodiments, oligonucleotides are covalently linked to one or more conjugated groups. In certain embodiments, the conjugated groups modify one or more properties of the linked oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, loading, and elimination. In certain embodiments, the conjugated groups impart a new property to the linked oligonucleotide, for example, fluorophores or reporter groups that allow detection of the oligonucleotide.

[0289] Certain conjugated groups and conjugated fractions have been previously described, for example: cholesterol fraction (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), um tiocolesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), uma cadeia alifática, p.ex., resíduos de do-decan-diol ou undecila (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov etal., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), um fosfolipideo, p.ex., di-hexadecilrac-glicerol ou 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate de triethyl-amônio (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine ou a mixture of polyethylene glycol (Manoharan etal., Nucleosides & Nucleotides, 1995, 14, 969-973) or adamantane acid, a fraction of palmetto (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), a substance fraction of octadecylamine or hexilamino-carbonyl-oxycholesterol (Crooke et al., J. Pharmacol. Exp. Ther, 1996, / , 923-937), a tocopherol group (Nishina etal., Molecular Therapy Nucleic Acids, 2015,4, e220;. Petition 870260057655, dated 12 / 06 / 2026, page 105 / 1268 98 / 343 doi:10.1038 / mtna.2014.72 and Nishina et al., Molecular Therapy, 2008,16, 734-740) or a grouping of GalNAc (e.g., WO2014 / 179620). 1. Conjugate fractions

[0290] Conjugated fractions include, without limitation, intercalating agents, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GaINac), vitamin fractions, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid fractions, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0291] In certain embodiments, a conjugated fraction comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansilsarcosine, 2,3,5-tri-iodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicone, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. 2. Conjugate ligands

[0292] Conjugated moieties are linked to oligonucleotides by means of conjugated ligands. In certain compounds, a conjugated group is a single chemical bond (i.e., the conjugated moiety is linked to an oligonucleotide via a conjugated ligand through a single bond). In certain embodiments, the conjugated ligand comprises a chain structure, such as a hydrocarbyl chain or an oligomer of repeating units such as ethylene glycol units, nucleosides or amino acids.

[0293] In certain embodiments, a conjugate ligand comprises one or more groups selected from alkyl, amino, oxo, Petition 870260057655, dated 12 / 06 / 2026, p. 106 / 1268 99 / 343 amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain embodiments, the conjugate linker comprises selected groups of alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises selected groups of alkyl and amide groups. In certain embodiments, the conjugate linker comprises selected groups of alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0294] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linker fractions, for example, those known in the art to be useful for linking conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, the bifunctional linker fraction comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linker fraction include, but are not limited to, electrophiles for reaction with nucleophilic groups and nucleophiles for reaction with electrophilic groups. In certain embodiments, the bifunctional linker fractions comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0295] Examples of conjugated ligands include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) and Petition 870260057655, dated 12 / 06 / 2026, p. 107 / 1268 100 / 343 6-aminohexanoic acid (AHEX or AHA). Other conjugate ligands include, but are not limited to, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, or substituted or unsubstituted C2-C10 alkynyl, wherein a non-limiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0296] In certain embodiments, the conjugate linkers comprise 1 to 10 linking nucleosides. In certain embodiments, such linking nucleosides are modified nucleosides. In certain embodiments, such linking nucleosides comprise a modified sugar moiety. In certain embodiments, the linking nucleosides are not modified. In certain embodiments, the linking nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine, or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is typically desirable for the nucleoside linkers to be cleaved from the compound after it reaches a target tissue.Accordingly, the nucleoside linkers are typically linked to each other and to the rest of the compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0297] In this document, the linking nucleosides are not considered to be part of the oligonucleotide. Thus, in embodiments where a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percentage of complementarity with a reference nucleic acid, and the compound also comprises a Petition 870260057655, dated 12 / 06 / 2026, page 108 / 1268 101 / 343 conjugate group comprising a conjugate linker comprising nucleoside linkers, these nucleoside linkers are not counted toward the length of the oligonucleotide and are not used in determining the percentage complementarity of the oligonucleotide to the reference nucleic acid. For example, a compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group comprising 1 to 10 nucleoside linkers that are contiguous to the nucleosides of the modified oligonucleotide. The total number of contiguous nucleosides linked in such a compound is greater than 30. Alternatively, a compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and no conjugate group. The total number of contiguous nucleosides linked in such a compound is not more than 30. Unless otherwise indicated, the ligands of conjugates comprise not more than 10 linking nucleosides.In certain embodiments, the conjugate ligands comprise no more than 5 nucleoside ligands. In certain embodiments, the conjugate ligands comprise no more than 3 nucleoside ligands. In certain embodiments, the conjugate ligands comprise no more than 2 nucleoside ligands. In certain embodiments, the conjugate ligands comprise no more than 1 nucleoside ligand.

[0298] In certain embodiments it is desirable that a conjugated group be cleaved from the oligonucleotide. For example, under certain circumstances compounds comprising a particular conjugated moiety are better absorbed by a particular cell type, but, as soon as the compound has been absorbed, it is desirable that the conjugated group be cleaved to release the unconjugated oligonucleotide or parent. Thus, certain conjugates may comprise one or more cleavable moieties, typically within the ligand of Petition 870260057655, dated 12 / 06 / 2026, page 109 / 1268 102 / 343 conjugated. In certain embodiments, a cleavable fraction is a cleavable bond. In certain embodiments, a cleavable fraction is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable fraction comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable fraction is selectively cleaved within a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable fraction is selectively cleaved by endogenous enzymes, such as nucleases.

[0299] In certain embodiments, a cleavable linkage is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable linkage is one or both esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugated moiety or conjugated group.

[0300] In certain embodiments, a cleavable moiety comprises or consists of one or more nucleoside linkers. In certain such embodiments, one or more nucleoside linkers are linked to each other and / or to the rest of the compound via cleavable linkages. In certain embodiments, such cleavable linkages are unmodified phosphodiester linkages.In certain embodiments, a cleavable moiety is a 2'-deoxynucleoside that is linked to the 3' or 5'-terminal nucleoside of an oligonucleotide by an internucleoside phosphate bond and covalently linked to the rest of the conjugate ligand or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable unit is 2'-deoxyadenosine. Petition 870260057655, dated 12 / 06 / 2026, page 110 / 1268 103 / 343 Compositions and methods for formulating pharmaceutical compositions

[0301] The compounds described in this document may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for formulating pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of the disease or dose to be administered.

[0302] Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or vehicle. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compounds. In certain embodiments, such a pharmaceutical composition consists of a sterile saline solution and one or more compounds. In certain embodiments, the sterile saline solution is pharmaceutical grade saline solution. In certain embodiments, a pharmaceutical composition comprises one or more compounds and sterile water. In certain embodiments, a pharmaceutical composition consists of a compound and sterile water.In certain embodiments, sterile water is pharmaceutical-grade water. In certain embodiments, a pharmaceutical composition comprises one or more compounds and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compounds and PBS. Petition 870260057655, dated 12 / 06 / 2026, page 111 / 1268 104 / 343 sterile. In certain embodiments, sterile PBS is pharmaceutical grade PBS. The compositions and methods for formulating pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0303] A compound described herein targeting APOL1 nucleic acid may be used in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or vehicle. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, a pharmaceutical composition comprising a compound targeting APOL1 nucleic acid and a pharmaceutically acceptable diluent is employed in the methods described herein. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

[0304] The pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also directed to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, salts Petition 870260057655, dated 12 / 06 / 2026, page 112 / 1268 105 / 343 of sodium and potassium.

[0305] A prodrug may include the incorporation of additional nucleosides at one or both ends of a compound that are cleaved by endogenous nucleases within the body to form the active compound.

[0306] In certain embodiments, the compounds or compositions additionally comprise a pharmaceutically acceptable vehicle or diluent. Certain selected compounds

[0307] Approximately 1930 newly designed compounds and some previously disclosed compounds of various lengths, chemistries, and motifs were tested for their effect on human APOL1 mRNA in vitro in various cell types (Example 1). Of the 1930 compounds tested for potency at a single dose in vitro, 373 selected compounds were tested for dose-dependent inhibition in A431 cells (Example 2). Of the 373 compounds tested by dose-response assays, 86 oligonucleotides were selected for efficacy and tolerability in vivo in rodents.

[0308] In in vivo rodent tolerability models, body weights and organ weights, liver function markers (such as alanine transaminase, aspartate transaminase, and bilirubin), hematology markers (such as HCT, leukocyte counts, platelet counts, red blood cell counts, MCH, and MCHC), and renal function markers (such as NUS and creatinine) were measured. In the hAPOLI transgenic mouse model, the in vivo reduction of hAPOLI mRNA was measured.

[0309] ION nos. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163 were tested for activity, pharmacokinetic profile and tolerability in cynomolgus monkeys (Example 9). Treatment with some of the compounds caused a reduction in mRNA expression of Petition 870260057655, dated 12 / 06 / 2026, page 113 / 1268 106 / 343 APOL1 in liver tissue. Specifically, treatment with ION 904763 and ION 972190, which cross-reacted with the cynomolgus monkey gene sequence for APOL1, caused a significant reduction in APOL1 mRNA expression in liver tissue compared to the PBS control. ION 972190 was observed to cause the greatest reduction in APOL1 mRNA expression compared to the PBS control. Treatment with the compounds was well tolerated in monkeys, particularly treatment with ION 972190.

[0310] Accordingly, compounds with any one or more of the improved properties are provided herein. In certain embodiments, the compounds as described herein are potent and tolerable. EXAMPLES

[0311] The examples below describe the screening process to identify the lead compounds targeting APOL1. ION 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163 resulted in high potency and tolerability, for example. ION 972190 exhibited high potency and tolerability. Non-limiting disclosure and incorporation by reference

[0312] Although the sequence listing accompanying this filing identifies each sequence as “RNA” or “DNA” as required, in reality, these sequences may be modified with any combination of chemical modifications. A person skilled in the art will readily appreciate that designations such as “RNA” or “DNA” to describe modified oligonucleotides are, in certain cases, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2'-OH sugar moiety and a thymine base could be described as DNA having a modified sugar (2'-OH for the natural 2'-H of DNA) or as RNA having a modified base (thymine (methylated uracil) for the natural uracil of RNA). Petition 870260057655, dated 12 / 06 / 2026, page 114 / 1268 107 / 343

[0313] Accordingly, the nucleic acid sequences provided herein, including, but not limited to, those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having the sequence “AUCGAUCG”, and those having some DNA bases and some RNA bases such as “AUCGATCG”, and compounds having other modified nucleobases, such as “ATmCGAUCG”, where C indicates a cytosine base comprising a methyl group at position 5.

[0314] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined, in terms of absolute stereochemistry, as (R) or (S), as α or β, such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. The compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the compounds indicated. The compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. Similarly, all tautomeric forms of the compounds provided herein are included, unless otherwise indicated. Petition 870260057655, dated 12 / 06 / 2026, pp. 115 / 1268 108 / 343 mode. Unless otherwise indicated, the oligomeric compounds and modified oligonucleotides described herein are intended to include the corresponding salt forms.

[0315] The compounds described in this document include variations in which one or more atoms are replaced with a non-radioactive isotope or a radioactive isotope of the indicated element. For example, the compounds in this document comprising hydrogen atoms encompass all possible deuterium substitutions for each of the hydrogen atoms1H. The isotopic substitutions encompassed by the compounds in this document include, but are not limited to:2H or3H in place of1H,13C or14C in place of12C,15N in place of14N,17O or18O in place of16O and33S,34S,35S or36S in place of32S.

[0316] Although certain compounds, compositions and methods described herein have been described specifically according to certain embodiments, the examples that follow serve only to illustrate the compounds described herein and are not intended to limit them. Each of the references cited in this application is incorporated herein by reference in its entirety. Example 1: Antisense inhibition of human APOL1 in A431 cells

[0317] Antisense oligonucleotides with various chemical motifs were designed targeting a nucleic acid of APOL1 and were tested for their effects on APOL1 mRNA in vitro. Gapmers with cEt 3-10-3

[0318] The newly designed chimeric antisense oligonucleotides in the Tables below have been designated as cEt 3-10-3 gapmers. The gapmers are 16 nucleosides long, wherein the central gap segment comprises ten 2'-deoxynucleosides and is Petition 870260057655, dated 12 / 06 / 2026, pp. 116 / 1268 109 / 343 flanked by wing segments in the 5' and 3' directions comprising three nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a cEt modification. The internucleoside linkages along each gapmer are phosphorothioate (P=S) linkages. All cytosine residues along each gapmer are 5-methylcytosines.

[0319] “Start site” indicates the 5’ plus nucleoside to which the gapmer is directed in the human gene sequence. “Stop site” indicates the 3’ plus nucleoside to which the gapmer is directed in the human gene sequence. Each gapmer mentioned in the Tables below is directed to the human APOL1 mRNA, designated herein as SEQ ID NO: 1 (GENBANK accession no. NM_003661.3) or to the human APOL1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK accession no. NT_011520.9 truncated from nucleotides 15986452 to 16001905). “n / a” indicates that the antisense oligonucleotide is not directed to that particular gene sequence with 100% complementarity.

[0320] Antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. A431 cells cultured at a density of 10,000 cells per well were transfected by free uptake with 4,000 mM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and APOL1 mRNA levels were measured by quantitative real-time PCR. The human RTS35962 probe and primer set (forward sequence GCTACTCCTGCTGACTGATAATG, designated herein as SEQ ID NO: 10; reverse sequence AAGGTTGTCCAGAGCTT) Petition 870260057655, dated 12 / 06 / 2026, pp. 117 / 1268 110 / 343 TACG, designated in this document as SEQ ID NO: 11; probe sequence TGCCCAGGAATGAGGCAGATGAG, designated in this document as SEQ ID NO: 12) was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are shown as percentage of APOL1 inhibition relative to untreated control cells. The oligonucleotides mentioned in Table 28 were screened in subsequent experiments. Petition 870260057655, dated 12 / 06 / 2026, p. 118 / 1268 Inhibition of APOL1 mRNA by cEt 3-10-3 gappers targeting SEQ ID NOs: 1 and 2 SEQ ID NO CO T- LO CO CO σ> 20 T- CXJ 22 23 24 25 26 27 28 29 Jo % of in tion co co 24 54 55 48 76 co o 30 46 82 57 59 co 76 84 Sequence GTTCAAAAGCAGCATT AAGATATACCGAGGAA TCCCCTGGCAGAGACT TCGCTCCAGCTTCCTC TTACTTTGAGGATCTC ACTGCTGGCCTTTATC GGACCTTCTTATGTT GGTGCCTTTGTGGACC AGACCCATGCCGACGA AGCGGCTGTGATTCCC CTTTCCGTAGTCCATG OOOOOI oo GCACGGATGTCCTTCC GATTGGCTCAGTGACC TGGGTTCATTAACCCT ACGAGGTAGACTACAT TTCTTGGTCCGCCTGC Stopping location in SEQ ID: 2 8321 531 632 4558 4792 12665 ​​​​12734 12775 12846 12916 12955 13036 13113 13189 13232 13317 13450 Starting location in SEQ ID: 2 co o co co 516 617 4543 4777 12650 12719 12760 12831 12901 12940 13021 13098 13174 13217 13302 13435 Stopping location in SEQ ID: 1 V / N co co 139 265 317 574 643 684 755 825 864 945 1022 1098 1141 1226 1359 Starting location in SEQ ID: 1 V / N 23 124 250 302 559 628 σ> co co 740 810 σ> co 930 1007 1083 1126 1211 1344 Compound number 793406 903425 903457 903489 903521 903617 903649 903681 903713 903745 903777 903809903841 903873 903905 903937 903969 Petition 870260057655, dated 12 / 06 / 2026, p. 119 / 1268 112 / 343 SEQ ID NO o co T- CO CM co co co co CO co co co co co co σ> co o CM co Uj) co co σ> % de in ção co σ> o σ> co CM CO CM co co CO CM CO co co CO co σ> co co CO co CM 00 00 oo σ> o CM co co Sequência AATGTTTGCATTTGGG GTGCTCAGCTATGGAA TAGTCTAAAGTAAACT GCTGGTTCCTTCAAGC CATTCTTCGGAGGACA TCAGGAAGCCGCTGCC ACCTGCCCTTCAGTGT CTGTTTACTTACCGGG TCAATCCTGGGCGGCG CATGATTGCAAAGCTG GCTTTGTGAACCCATC CAAGCCCAGTCCAATT GATGTTTGTCTTCTGG GCCAGTGTGTATTGCA ACAAATTGTGGGATCA CTAGGTGCCAGGGTAG CCCCCCCCCCGCTGAT GGGCCACTCAGAGCAA GTGGCAAAGGACAGAC CCCTATTGTGTGGCAG Local de paragem em SEQ ID: 2 13825 13904 14031 14389 14518 14616 14705 14829 14910 1388 T— CO 00 2494 co oo co 4354 4726 5072 5129 5307 5372 5504 Local de início em SEQ ID: 2 13810 13889 14016 14374 14503 14601 14690 14814 14895 1373 WHAT WHAT 2479 2988 σ> co co 4711 5057 5114 5292 5357 σ> co S Λ σ Local de p gem em S ID: 1 1734 1813 1940 2298 2427 2525 2614 2738 2819 zzz al de início SEQ ID: 1 1719 1798 1925 2283 2412 2510 2599 2723 2804 zzzzzzzzz Loc; em 5ro to posto τO o co co o 990t Z60t σ> CM t— Tco T- co σ> T— CO CM CM CO CM T— CM CO co CO co CO co co 1417 1449 T- CO co t— CO CO S CO σ> o co T- ω 1 § o σ> o σ> o σ> o σ> O σ> o σ> O σ> O σ> O σ> O σ> o σ> o σ> o σ> o σ> o σ> o σ> o σ> o σ> o σ> o σ> Petição 870260057655, de 12 / 06 / 2026, pág. 120 / 1268 113 / 343 SEQ ID NO o LO Tm CM CO CO CO s COCO CO LO 00 CO σ> CO o CO T- CO CM CO CO CO CO CO CO CO 00 CO σ CO % of ink □ □ □ □ 2 5 CGAAGCCTCCTCCAGT CACCCGATAAACCTTG 5 5 5 □ □ □ ATTCGGAGACCCTCCCT CCTGGGCAAGGCTAAG TTACTCCACACCTTAA TTTGGTAGAAAOCTCAOGC OCAOCOGC ACCACCTGTAGGGACA GGGTACTTCTGTTAGA CAGCTGTAACCCCCTG CAGCCCTGAAACATTC 5 5 j= □ □ □ GCCGTGGCAACTCTGT GGGTCGGCTGAGTGCT emCTCCATGTTGCCTC GCTGGTCTTGCT geGGCTGCT emCTCCATGTTGCCTC CO σ> CO UO o 00 CO 5821 o » UO 5947 5979 6152 6220 6275 6343 6416 6556 6614 6662 oo o oo CO 6893 7009 7171 o7 75258 ID ID 5765 5806 5 oo UO 5932 5964 6137 6205 6260 6328 6401 6541 6599 6647 CO o 00 00 CO 6994 7156 7243 00 SEQ Location CO ID para: V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N oo .. c Q Local of em SEQ z V / NV / N z V / NV / NV / NV / NV / NV / NV / NV / NV / NV / N z V / NV / NV / NV / NV / N Compound number 904673 904705 904737 904769 904801 904833 904865 904897 904929 90496969 905025 905057 905089 905121 905153 905185 905217 905249 905281 Petition 870260057655, of 12 / 06 / 2026, p. 121 / 1268 114 / 343 SEQID NO o OJ CO CO CO 00 CD o 00 T- CO C\l 00 CO 00 % de in ção σ> LO G) CO 00 CO 00 00 CO 00 CO σ> CO σ> σ> CO σ> GAACC SEQUENCE CDGACC) TTGCCGTGCACACACCA GTTTGCAGGGATCTGG CAAAGAACTCAAGTCA ACTGCTCCCTGTAATC TGTGTTTAGGCATTCA GTTATGAAATTATTGG ATGCCTGTTGGGTCAA GCACCAACATGAAGTG 5 □ □ □ 5 □ TAGTC□ GCTTTAAACTCAGGTG l= DD □ 5 GTGCATAACAGCCATT re σ Place of p gem em S ID: 2 7489 7857 7952 8015 8102 8189 CO CO CO 00 oo CO 8470 o 3 oo 8758 000 Oil Oil CD 8470 o 3 oo start SEQ ID: 2 7474 7842 7937 ooo 00 00 o 00 8174 8321 8385 8455 io C\l CO oo 00 00 8829 O CD OO OO 8959 Loc< em Stopping place SEQ ID: 1 em V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N oo .. c Q Location of em SEQ V / NV / NV / NV / NV / NV / NV / NV / NV / N z V / NV / N z V / N Compound number 905313 905345 905377 905409 905441 905473 905505 9055367 9055631 905697 905729 Petition 870260057655, dated 6 / 12 / 2026, p. 122 / 1268 CM RJ Φ Χ2 RJ SEQ ID NO co 84 85 co co 87 co co σ> co 06 τ- Ο) co co Ζ,Ζ, SEQ ID NOs: 1 e2 Sequence GTTCAAAAGCAGCATT AGATATACCGAGGAAT GGATCCCACCTCCAGT ACTCCCACACCAAGGA TACTTTGAGGATCTCC CTGCTGGCCTTTATCG GAGCCTTCTTATGTGACGCT GGCCCATTTGTCCGATT TTTCCGTAGTCCATGG 0 I oooo CACGGATGTCCTTCCC ATTGGCTCAGTGACCC GGGTTCATTAACCCTC I ro onados Ie para- SEQ ID: > τ- CXJ ο 35 Tσ> 564 co co PL· 545 LO TσJ d-3 co direci( C-C 00 45 47 CXJ T- cxj T- cxj cxj CXJ cxj CO T- co LN CO T- t 3-10- 'c ϕ σ a LU ( / ) CM 06 m CM 20 76 549 CO T- σ> LO Q6390 Q1 ooc 00 LO in Uj) 47 CXJ T- cxj cxj cxj cxj cxj T- co CO CO LN CO T- E qooo S2 ϕ EQ RJ d of para- )mSEQ ID: 1 V / N 37 94 242 co T- CO 573 642 co CO co 754 824 co co co 929 1021 1097 1140 I per ( oq gem ( ,m de APOL1 Local de ini- cio em SEQ ID: 1 V / N 22 79 227 301 558 627 CO co co 739 σ> o co co co 914 1006 1082 1125 I z or E o de oo .2 Ή 'ίί (Ο ο eÜ 99t co co 520 CO 548 o CO CXJ T- 9L 508 o 572 o O ( / ) Ο ο co co co co co co co co co co co co co co co Inibics φ °· Ε ζ ζ σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> Petição 870260057655, de 12 / 06 / 2026, pág. 123 / 1268 116 / 343 SEQ ID NO 86 σ> σ> 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 Jo % of in COτ CO τ co- or σ> CO T- T- T- CXJ o co Sequence CGAGGTAGACTACATC TCTTGGTCCGCCTGCA TGTTTGCATTTGGGTC TGCTCAGCTATGGAAA AGTCTAAAGTAAACTG CTGGTTCCTTCAAGCC ATTCTTCGGAGGACAT TGTACCCGTTG AGGAAGCCCGCT CAATCCTGGGCGGCGA ATGATTGCAAAGCTGG AACCCATCTGAGCTGT GCCCAGTCCAATTGTG ACTCCATGCAGCAAGG GTCTGCGATGTGCAGA TGTGGGATCAAATGTG TAGGTGCCAGGGTAGG d de paraim SEQ ID: 2 1330416 139416 139416 (O co EO) ​​Start Location in SEQ ID: 2 14373 14502 14599 14687 14813 14894 1372 828 2476 2970 4322 4705 5056 1D: ro σ Q. LU Φ ( / ) CO-X> T co σ- IV co CM T CM T- σ> CM CM eü l£> CM co CM 28' zzzzzzz O co EO) ​​-f σ — LU Φ Cf) T- o co CM CO CO CO CM CO Local (ie ID: CM T- co T- σ> CM CM 24' 25( zzz 282 CO CO co co oo CM CO )64 CO σ> 128 091 CM σ> eÜ co l£> o CM CM CO co co T- 148 o co cxj ( / ) OO CO co IN IN Φ °· E oz σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> cd cd σ> σ> σ> σ> σ> σ> σ>. Petição 870260057655, de 12 / 06 / 2026, pág. 124 / 1268 117 / 343 Ο z Q CO 00 σ> O T- CM CO m CO |>»» 00 σ> O T- CM CO T- T- T- T- CM CM CM CM CM CM CM CM CM CM CM C) CO C) C) O T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- LU ω 5 o CO T- CO 00 co T- co 00 co T- CD CD / 1« Φ o T- CM co 00 co T- co Is- ·. co CO CO m CO s© 0s στ 0 o 0 OO iTT 0 0 TA 0 Q δ O iGA 0 O ¢3 0 δ o O 0 0 0 1= 0 0 O < 0 o Q δ 0 0 O 111 .so 0 0 TA δ OOOO TC δ CT O Õ oo TT OQ CA oo 0 o 0 0 0 0 o O 0 Q «D o 0 O 0 0 0 0 Q zoo 0 — O — 0 |— ω O σ ol— 0 O — I— I— — (') oo 0 0 0 Φ 0 o Q — 0 -— oo 0 |__ CO O <£ 0 0 0 0 0 0 oo 0 CD o 0 o OO o á 0 0 0 oo δ 0 () 0 0 o 0 0 o δ δ oo O 0 0 Q 0 0 0 o 0 o 0 0 o 0 0 o 0 0 0 I— o 0 0 0 Q CÜ — ro σ Q. LU oo CO o T- τ- cd om co co T- σ> CM CM in CO T- Φ c / j Λ1 CM C 5 Is*». 00 co Is*». CM Is*». Is*». m T- Is-», CD in T- co Ό r- 04 T- σ> CO co Is*». a> co CD cd T- CM CM σ> σ> in co co _ c CO U) U) U) CO CO CO in in in co CO CO co co co co O co E _1 Φ O) -f σ — LU Φ Cf) CM CO T- m CO co in o T- co co σ> o co co Ό c ..T- σ> U) CO co co C 5 co co co C) C 5 in CM Is-», CD — EQ T- CM CO co co co cd cd T- CM CM CO co in in co ra φ — CO U) U) U) CO CO CO in in in co CO co CO co co co co 8 .2 —I o Q CÜ — ra σ Q. LU φ Cf) <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ ° E ra φ oco E _1 Φ O) -f σ — LU φ Cf) T- -O e ra φ — zzzzzzzzzzzzzzz 8 .2 —I o E o CO CO o CM co co o CM co co o CM co co OQC 5 c_> C) co C 5 σ> co <» CM co CD CM in a> Ό ( / ) U) CO CO CO CO Is*». Is*». 00 co 00 00 05 05 05 C 5 C 5 C 5 O o in in in C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 Φ 05 05 05 05 05 05 05 05 05 05 05 05 05 05 CD E o z. Petição 870260057655, de 12 / 06 / 2026, pág. 125 / 1268 118 / 343 SEQ ID NO 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 Jo Ο (Ο CM in CM in σ> T- σ> in T- in CM CM co in CM Λ» Φ ο 05 CM C) CO CM U) m CM co σ> in 00 05 m CO S© 0s — :tgta δ δ TGTC 0 0 3TGG 0 0 0 0 'TATG TCAG TCAC TCAG 3TTC CAAA GTGA CTTC CTAG 3TGA ra ο C <φ 0 uo iAGTG CCTC 3GGC δ 0 WOO' GACA iGAAT CAAG GTAA GCAT ATTG( GGGT TGAA GCAC 0 0 0 0 0 Ζ σ ο o 0 0 t= 0 0 0 0 0 δ δ 0 TT δ 0 0 0 δ ω 0 0 O |— 0 0 0 0 0 0 — < / ) I— 0 0 0 0 0 0 0 |— — I— 0 0 0 I— 0 I— I— 0 0 — ΓΠ 0 Q 0 δ 0 <£ 0 0 0 0 0 0 |— o o 0 0 0 I— 0 0 0 Ο o 0 0 0 0 0 0 0 0 0 0 ιϋ: ro σ Q. LU CM T- m o co co σ> σ> σ> co Φ C / J 75 — CM ο 05 o co mm co in τ- c_> co C) co σ) m Ζ Ε co CO co co co co co 00 co co co Ο C ο Ε σ) -ρ σ .Ε LU Φ Ο CM CM CM CM CM co CM o σ> σ> mp> co CM co 2 £ çj co σ> T- pi p> ''sf co σ> σ> o T- co co co co 8 .2 —I ο ιϋ: ro σ Q. LU Φ ( / ) ° ε V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N φ φ Ο C ο Ε σ) -ρ σ .2 LU φ (local ID: —I ο Ε ο ο CM co 00 o CM co co o CM co co o CM ο 7Ί 'ίί CM LO 00 T- co T- ο c_> C) in co ( mm mmmmmm ϕ °· Ε σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> ο ζ. Petition 870260057655, dated 12 / 06 / 2026, p. 126 / 1268 119 / 343 SEQ ID NO 152 153 42 = Ο ... >ro cd o Φ ο X© 0s 0 0 11 CO l= δ uco 0 <φ z 0 δ σ ϕ ω 0 0 <c δ 11 0 Q CO — ra a Q. LU Φ w CM o co T3 c ™ CD CD _ c 00 00 ra φ o c Ο E _1 Φ CD -f a — LU Φ ( / ) CM OO Ό c .. OO U) — E Q OO σ> LU Φ ( / ) Ξ Ezzra ϕ O c ο E _1 Φ CD -fa — LU Φ ( / ) T- -O was φ — zz 8 o 02 E oz SEQ ID NO CO T- 154 155 156 157 158 159 160 161 162 42 % of in cão T- CO 24 55 44 co co T- CO o CD CO T- CM SEQ ID NOs: 1 e2 Sequence GTTCAAAACCAGCCAGCCAGGAGTA GAATCTTCCCCTGGCA CACCCTCGCTCCAGCT CAGCCCAGTCACCGAG TGTACTGCTGGCCTTT CACGGAGCCTTCTTAT GGTGGTGCCTTTGTGG GCCAGACCCATGCCGA CAAAGCGGCTGTGATT 05 recionados :al de para- em SEQ ID: 2 8321 co 538 V / 46 V42 12737 12778 12849 12919 -3 di q gem om cEt 3-10 Local de ini- cio em SEQ ID: 2 co o co 00 519 623 V / N ID: 1 V / N 145 270 co co 577 646 co co 758 828 1 por o gem d ÍL Έ φ σ a LU ( / ) ,- co o o U2 CM CM T- CM co co <m de. o o φ Q o o z CM T- CM CO LL / m Ç* J co CO h* co z or E o de o o 5 Π ’ti co o 00 CM o co S6t 524 520 552 584 co T- 8½ O ( / ) O O co CO co co co co co co co co ibiçê Φ “ E CD CD CD CD CD CD CD CD CD c z Petition 870260057655, of 12 / 06 / 2026, p. 127 / 1268 120 / 343 SEQ ID NO 163 164 165 166 167 168 169 170 170 176 177 178 179 180 % of in 32 35 2074 σ> 93 co 34 73 o 24 58 σ> co 62 Sequence CTTCTTTCCGTAGTCC GTTCTCACCCAAAAAC GAGGGCCACGGATGTCC TGAGATTGGCTCAGTG TGCTGGGTTCATTAAC GTAAGTGCTTTGATTC GTAAGTGCTTTGATTC GTACCATGGTCCTCGTTGC TCACTTAGGGTCCTCGTTGC TCTTTAGTCTAAAGTA TAACTCTTGGGCTTTC CTTCATTCTTCGGAGG TCATCAGGAAGCCGCT GGCCATGGCCCACCAC AGCTTCCTCCCAATGC AGGTCAATCCCTGGGCG TCTCATGATTGCAAAG GTCTCAGCAGTCAAAA Ie paraSEQ4 CO€9 ID: co2 89 T- CM σ> T- σ> T- 372 CO T- τ- Ο co CM T- CO T- co T- CO T- (.N CO T- co T- co T- CO T- CO T- T- T- T- T- T- MJ T- C) CM co co CN σ> CM cxi ooo Lo σ> 76 T- ro Φ Q 8 .2 —I o CM T- co T- co T- co T- (.LU φ ( / ) T- co T- co CM co co T- o co co T- CM Ξ E co co 95 o T- TT- TT- CM T- CO T- T- co T- Q) T- 23i eü CN CO CM co CM vj CM co CM O c ο E CD -fa .E LU φ ( / ) T- CM co T- co σ> T- co T- σ> co CO CO CO CO φ Q 85 co σ> Ó o (.N T- CM co co CN σ> co ΙΌ co z 8 .2 —IOCNCNCNE oo 5 7Ί 'tí o co CM T- 344 376 co o O CM o co co co co oo 132 164 961 co CM o co 324 co CO ( / ) oo co co co co co CO CO (.N (.N Φ “ E oz σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ>. Petição 870260057655, de 12 / 06 / 2026, pág. 128 / 1268 121 / 343 SEQ ID NO 181 182 183 184 185 186 187 188 188 189 190 191 192 193 193 194 195 196 197 198 .E ο (OR CO CM CO LO CO or CM> CO f-lí / fs-. φ or C) 00 00 00 05 CM CM LO CO CO CM Is»-. U) Is». σ s© 0s < AA 0 0 I— O 0 TC 0 0 ;cg 0 0 TT OO o C) 0 TC δ o 0 < o 0 0 o P o CD CD l— o 0 o ra oc AT 0 o 0 0 δ δ 0 0 < oo 0 ooδ TA 0 ζ 0 AC O δ AT 0 0 O o Q 0 CD o «D δ Q o Q l— I- o 0 o 0 0 o 3 σ φ TCC 0 0 0 V1V 0 0 AAC o 0 0 δ GCC AAG DCC AAA' 0 O FGG o GTT TCT < / ) |— 0 0 O «ς-ζ o CD 0 O Q |— 0 0 CD l— l— Cl 0 o CD O o O ( 1 o 0 0 — o 0 cn 0 <T C3 |— 0 o TI AC δ I— δ 0 AT AG( AG AT 00 AT IVV 0 AT o o o o ιϋ: ra σ Q. LU CO σ>CO CO or 00 or 00 [s-. σ> CO mo CM CO CO 00 CM C) CM U) 00 00 CM ooo 00 CM / γ\ 00 U) 00 U) CM ZE CM CO LOLO LO LO LO U ) LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LOLO LOLO LOLO LOLO LOLO LOLO LOLO LOLO LOLO LOLO LOLO LOLO LOLO LOLO) -C0 T-LU0 . 00 σ> σ> T- CM 8 .2 U ) U ) —I o ϋ: ra σ Q.LU ϕ Cf) ° EV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N ra φ oco EO) ​​-f σ .E LU φ Cf) T-ocal dioem ID: zzzzzzzzzzzzzzzzzz —I or E oooo 00 o CM CO 00 o CM CO 00 o CM CO 00 o CM ° « C LO LO LO CO CO CO 00 00 00 σ> σ> O oooo O oooo O oooo O ooooo Φ 05 05 05 E o z. Petition 870260057655, 06 / 12 / 2026, p. 129 / 1 122 / 3 SEQ ID NO 199 200 201 202 203 204 205 206 O CM 208 209 210 211 212 213 214 215 216 ÍQ . Φ OR LO 00 LO CM C) WITH X- Is»-. X- 05 CO XJ s© 0s | 0 I— QOQ |_______ O oo 0 O 0 0 0 I— 0 0 1— δ 0 0 O ooo 0 0 0 CA 0 l— 1— <3^ 1— o |—— o 0 CD ra oc 0 0 0 o CTG 0 O AGo δ δ GCA δ CCG oo δ “DO o 0 |— 0 Q 0 I— o |— |— (D o O 1 |— O 0 o QI— <1** o 0 σ QQ 0 0 — ol— Q 0 |— 0 0 ω 0 OQ o 0 0 0 ooo — o 0 0 0 0 o < 0 < 0 0 δ 0 0 oo 0 Q 0 0 0 GA iAT o δ 0 0 GG 0 o δ δ GA δ 0 o 0 O 0 0 δ δ δ δ 0 o 0 O 0 0 δ δ σ. X- CD LO LO CD CO LO CM o 05 ZE CO CO CO CO UJ CO CO CO 00 00 00 00 O co EO) ​​-f σ .E LU Φ Cf) ιϋ: ra σ Q. IN φ Cf) ° EV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N ra φ oco EO) ​​-f σ .E LU φ Cf) T- ocal d io em ID: zzzzzzzzzzzzzzzzz —I o E oo CO CO o CM CO CO o CM CO 00 o CM CO 00 O _9 7Ί 'tí CO CD CM CO CD CM LO 00 CM LO 00 X- 00 X- o OO LO LO LO IO IO LO LO Lm LO LO LO LO LO LO LO LO Φ “ E cd cd cd CD CD CD CD CD CD CD CD CD CD CD CD o z. Petition 870260057655, de 12 / 06 / 2026, pág. 130 / 1268 123 / 343 SEQ ID NO 217 218 219 220 221 222 223 ο co σ> co co 00 fs^. Λ» Φ ο ιο 00 τ- 00 S© 0s ro FTGGGT Ο Ο C5 CCI III GAGGG XACTCA 0 0 0 Ο 0 C5 ο C 0 C5 Ο ζ σ ω ω OO 0 Ο 0 Ο Ο Ο Ι- Ο Ε Ο 0 ό 0 C5 ο ο Ο 0 |__ 0 0 0 o 0 0 ιί: ro σ Q. LU co τ- 00 τ- 00 ο fs^. CM o 00 co τ- Ξ E co co 00 0Õ 00 00 00 UC ο E σ) -ρ σ .Ε LU φ ( / ) οι co co co co co ιο CM 2 £ ο co co 00 00 σ> 8 .2 —I ο ιϋ: ro σ Q. LU Φ ( / ) <ζ <ζ <ζ <ζ <ζ <ζ Ξ E Ο C ο E σ) -ρ σ .Ε LU φ (Λ τ- ocal d io em ID: —I o E oo CM co 00 π CM ο P 7Ί 'tí ο co co ο CO ( / ) oo LO ΙΟ ΙΟ ιο ιο ιο ΙΟ Φ “ E σ> σ> σ> σ> σ> σ> σ> σ> oz Petition 870260057655, dated 12 / 06 / 2026, pp. 131 / 1268 CM RJ RJ Φ Q Ο θ CO LO CO 00 σ> or CM with CO co ( / ) CM CM CM CM CM CM CM VJ CM CM VJ CM CM CM L' J CM 5 % of in 85 or T- LO 24 or 87 co 1 Q co o 48 ID: ID Sequence GTTCAAAAGCAGCATT CCCCAAGATATACCGA GGAATCTTCCCCTGGC GCACCCTCGCTCCAGC GCAGCCCAGTCACCGA CTGTACTGCTGGCCTT GCACGGAGCCTTCTTA TGGTGGTGCCTTTGTG TGCCAGACCACATGCCTCG CGCCOTGTCAGOTAG0 TGAGGGCACGGATGTC CAGCTGAGATTGGCTC ATGCTGGGTTCATTAA 05 CO Ο TJ 05 co le para- SEQ ID: T- CXJ LO σ> CO σ> CO co co 6Z2 550 323 σ> CO co CO dire ε em9 Local 196 d-3 LO CO 48 CM CXJ cxj cxj cxj cxj co T- co CO T- VN CO T- t 3-10 'c φ σ α LU ( / ) CM 06 O 98 554 932 1792 535 ra 80€ 544 T- CO LU Tc 103 (.m CO 47 CM CM CM CM CM CM co co co co E o O o ο ο O 1 oor c / aomers Local de para- gem em SEQ ID: 1 V / N 42 146 271 00 CO CO 578 647 00 00 co 759 832 00 CO 00 955 1027 1105 1145 \m de APOL Local de iní- cio em SEQ ID: 1 V / N 27 131 256 323 563 632 co co 744 817 853 940 1012 1090 1130 z or E o de O o .2 Π 'íí CO o σ> CM T- CO CO σ> 525 T- CXJ 553 585 σ> T- CO CO T- 545 577 60€ O c / ) OO CO CO CO CO CO LL / CO co co co co co co co co co co ibiçé Φ °· E σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> c. Petição 870260057655, de 12 / 06 / 2026, pág. 132 / 1268 125 / 343 SEQ ID NO 238 239 240 241 242 243 244 245 245 246 247 248 249 250 250 % of inch 74 CM σ2 or σ> CM or ot σ> co 25 or co co co co 90 Sequence ATGTAAGTGCTTTGAT ACAGTTCTTGGTCCGC CTCACCCTCTTTATCC CTGCCATCTGCATTAA CCCCCCAATATTCT GTTCTAACTCTTGGGC ACTTCATTCTTCGGAG ATCATCACCTAGCCATGCAGCCGC ATGAGTAGGTGAGTTT AATCTCATGATTGCAA TGTCTCAGCAGTCAAA TTTGGTTCCTAGAAGA ACAACTGAGGGTAT AGCATGTGTGATAACT TACCTGGGTCCATGGT GAGTCATTTGCTAGGT d de paraim SEQ ID: 2 13339 1394354 14446 14522 14620 14720 14873 14945 1393 co co 2534 3432 4381 co co co 5082 O c ο E CD Start location in SEQ ID: 14431 14507 14605 14705 14858 14930 1378 872 2519 3417 co co co 4818 5067 ιϋ: ro a Q. LU Φ ( / ) coΞ co σ T> CM CM t— T“ CO T“ σ> T“ 23Í eü CO CM co CM CM 28i zzzzzzz O c ο E CD -faE LU Φ ( / ) T- co co CM o co σ> Local ( cio em ID: CM T“ co T“ T- Ln CO T“ Q) T“ co CM 24' 25' 26' 3Z3 co CM zzzzzzz E oo .2 T“ co LO o co 69( τ- Ο co co 165 197 σ> CM Τ- Ο 525 CO σ> co t— CM co CO CO co T— ( / ) oo co co IN IN Φ °· E oz σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ>. Petição 870260057655, de 12 / 06 / 2026, pág. 133 / 1268 126 / 343 SEQ ID NO 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 .E ο o ο ΙΌ co ο co co co |s^_ o co σ> CM / lí φ o co τ- τ- Τ- co ΙΌ ΙΌ ΙΌ U) co C) co CO 05 σ ​​s© 0s o 0 ο 0 Ο 0 Q Ο CD 0 l— 0 0 Ι— |— Ι— Ο Ο 0 0 0 |— 0 o (D ο 0 ω Q |— |—— 0 CO o 0 0 0 ο 0 0 ο CD o 0 ω ra oc «D σ |— 0 0 I- ο 0 0 δ 0 0 I- o 0 'CAACC ο Ο Ο 1= GGTAA δ GCCTC ÍAAGCC ο ο ο I— Ο Ο TCGGA 3CTGG TACTO l= 0 GTCTC 0 δ o CACCT 5GTAC7 0 o 0 0 Φ ω 0 0 C5 0 CD Ο Ο 0 0 0 0 ο Ρ Ο Ο < <!j δ CD C5 o δ 0 O CJ 0 0 0 (Π CD ο <£ 0 (J O <£ |— n O <Γ 0 ο 0 o 0 0 0 0 < 0 I— ο ο o 0 o I— ιϋ: ro σ Q. LU o τ- σ>00 o 00 t- ΙΟ |s^_ co o co oo CM co CM 05 CM ο o t- 00 CM 00 IΙ 00 IΙ CM co CM co CM T- ZE IΙ IΙ LO IΙ IΙ IΙ IΙ IΙ IΙ IΙ IΙ CO co co co co co co CO co O co EO) ​​-f σ .E LU Φ (Λ CM LO CO CO IΙ σ> CO CM CO Ι CM co CO co CO CO 00 T- CO co CO 00 00 σ> σ> τ- CM CM co CO CO co 8 .2 —I o ιD: ra σ Q. LU φ ( / ) ° E ra φ oco EO) ​​-f σ .E LU Φ Cf) T- ocal d io em ID: z Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ —I o E o σ> τ- co ΙΌ σ> τ- CO ΙΌ |s^_ σ> T- co ΙΌ σ> T- co O o 7Ί 'íí 00 τ- ο b-. ο co co o C) co σ> CM co 05 ( / ) O o CO CO CO Φ °· E σ> o z. Petition 870260057655, de 12 / 06 / 2026, pág. 134 / 1268 127 / 343 Q “ O m co Is*» co CD o T- CM co m co |s»» co σ> o T- OX Is*» Is*» Is*» Is*» Is*» co co co co co co co σ> σ> LU 2 CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM ω £ θ CD T- T- Is*» m CD C~> Is*» CM co CD m Φ 't* LO T- co Is-- T- CM CM CD co co co σ *O 0s 0 0 TO 0 0 0 0 c5 CG AA 0 CA 0 0 0 0 ΤΓ 0 co CT 0 C5 TCC CAT 0 0 I— P 0 CD 0 0 0 V0E AAG CCT 0 0 .Vil 0 0 0 0 0 0 0 — 0 H 0 |__ 0 0 0 Q 0 <3^ 1- C <φ t= 0 0 0 CA 0 Q 0 0 0 0 P 0 0 0 <c r- z σ 0 0 0 0 0 0 1= 0 0 0 CT 0 0 0 CD — 0 0 n o 0 φ O 0 0 0 0 0 J— 0 0 «»·£ 0 ( / ) 0 0 0 0 0 0 l·— 0 0 0 0 0 1— 0 0 n 0 0 0 0 0 Γ- 0 J— 0 0 0 0 0 0 0 0 0 0 0 Q 0 0 0 <£ 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Q CÜ — ra σ Q. LU CM Is*» co Is*» co co CO T- CM co co co Is*» CD CM o CM T- σ> in Is*» in 05 co CM c_> 05 c_> co CO in T5 r- CO α> C 5 T- CM C) co CD C 5 T- T- σ> co a> _ c CO co Is·— Is·— Is— Is— Is— CO co co co co co 00 co O<o E _1 Φ O) -f σ E LU Φ Cf) CM Is*» CM co CM T- co co co Is*» cd T- co T- σ> CM Is*» m Ό c ..CD α> CO co Is*» m C 5 cd Is*» co a> σ> σ> — EQ Is*» co o T- CM co co CD oo T- co co co Is*» co ra φ — CO co Is*» Is*» Is*» Is*» Is*» Is*» co co co co co co co co co 8 .2 —I o Q CÜ — ra σ Q. LU φ Cf) <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ ° E zzzzzzzzzzzzzzzzz ra φ oco E _1 Φ O) -f σ .E LU φ Cf) T- -O e ra φ — zzzzzzzzzzzzzzzzz 8 .2 —I o E om Is*» cd T- co in Is*» σ> T- co in Is*» σ> OQ CM m co CM in a> T- co T- Is*» C 5 Is*» C 5 co co Ό ( / ) T- T- T- CM CM CM co σ> σ> in in in co co co O 0 m in in in in in in in in in in in in in in in in oooooooooooooooo Φ 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 E o z. Petition 870260057655, de 12 / 06 / 2026, pág. 135 / 1268 128 / 343 Q σ θ 292 293 LU (Λ £ é ιηι ção CM 30 Ο sO 0s Ο 0 — Ο ra 1— ο c 0 <φ z σ ο ό 0 ω 0 0 0 0 0 0 0 D: ra σ Q. LU Φ ω CM co σ <ζ 04 CD CD C 00 00 ο ο E σ) Ε σ LU ω (Λ CM σ> CO E Q 00 CD ο ο ο ο D: ra σ Q. LU Φ ω σ E ζ ζ ο ο ο E σ) Ε σ LU φ ω τ- σ ra φ Q ζ ζ ο ο ο E ο θ 5 τ- Ο 733 ο ο m φ °· E σ> CD '3 ζ Q a θ co LO CO 00 CD O t— CM S 2 ω t— CM CM CM CM CM CM CO co CO Z % of ink 85 OO CO o 46 CO t— O CM CO O iOS a SEQ ID NOs: 1 e2 Sequence GTCCTAAOCAC ooGAGCAGCATT 0 TGCACCCTCGCTCCAG AGCAGCCCAGTCACCG TCTGTACTGCTGGCCT GGCACGGAGCCTTCTT ATGGTGGTGCCTTTGT GTGCCAGACCATGCC CCGGTCAAAAGCGGCTG 1- D: 05 C o ra σ Q. LU t— o CD de CO 8 ot— S Õ CD T3 64C 481· 1267 127c 127E LO CO CM t— 129z :t 3-1C -f σ .E LU Φ ( / ) CM Ό c 06 t— to CD CD 555 i£> CO co CD O LU O E LO 7 CM Q CM co z co .2 —IO o S2 φ EQ Ie paraSEQ ID: 1 CO CM CD CD 00 CD O CO (Ü O Σε z T— CM CO CO Φ CO 00 1 oor Location gem ε \m from APOL Start location in SEQ ID: 1 CO 25 7342 745 818 z or E o de oo .2 7Ί 'íí co oo co CM CO σ> 526 522 554 co co co CO t— 092 O ( / ) oo co co CO co co co co co co co Inhibit Φ °· E oz CD CD CD CD CD CD CD CD CD Petition 870260057655, dated 12 / 06 / 2026, p. 136 / 1268 129 / 343 SEQ ID NO CO or CO 304 305 CO or CO 307 00 or CO σ> ο co 310 311 312 with TCO 314 315 with TCO 317 with T-CO 35 82 co co co Sequence CACTTCTTTCCGTAGT GATATGTTCTCACCCA CTGAGGGCACGGATGT TCAGCTGAGATTGGCT GATGCTGGGTTCATTA TCATGTAAGTGCTTTG CACAGTTCTCTTGGTCCG TACCTCACCCTCTTGTGATTAGTOGCATCT0 GACTTCATTCTTCGGA CATCATCAGGAAGCCG ATGGCCATGGCCCACC TGAGCTTCCTCCCAAT GATGAGTAGGTGAGTT GAATCTCATGATTGCA AGATGGCACCCCCAA Ie paraSEQ ID: 09( ZM σ> T- 197 Z£37 T- 99 T- CM T- CM 374 co 94 CM T- T- T- T- T-<JJ T- CO T- σ> O c ο E CD −f σ — IN Φ < / ) CM Ό e (.N CO o (.N 00 (.N CM (AJ CM co T- co IN co o 1 ΓΊ o o <JJ IO rc\ co 79 σ>75 Φ — 8 .2 —I o CM T- CO T- CO T- CO T- (.N CO T- VJ CO T- MJ CO T- CO T- T- T- T- T- T- T- MJ T- T- CO T- σ> 1D: ra σ Q.LU Φ ( / ) σ> CO 00 CO CO o CM co 00 co CM oo co CO Ξ E CO 00 95 o T- TT- TT- UJ CM T- VAJ CO T- T- CO T- σ> T- 23i VJ eü i£> CM co CM MJ CM 28i 5 O co EO) ​​-f σ .E LU φ Cf) T- T- CO T- T- IO σ> co co T- l£> l£> 00 o 2 £ çj 85 94 ó o VJ T- VJ CM co IN co σ> co LO CO UJ co ζ 8 .2 —I o IN IN IN IN E oo .2 7Ί 'íí CM 00 T- 346 00 O T- 342 90( 00 co o 102 134 co co 861 o co CM CO 326 00 ιο OO CO CO CO CO CO CO CO co IN Φ °· E oz σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> UJ σ> σ> UJ σ> σ>. Petição 870260057655, de 12 / 06 / 2026, pág. 137 / 1268 130 / 343 Q “ O T- CM CO ιη co [Χ^. 00 σ> Ο τ- CM CO in co [X-^ CO OX CM CM CM CM CM CM CM CM CM CM CO co CO CO co co co CO LU 2 C) C) C) σ) σ) σ) σ) σ) σ) σ) σ) σ) σ) σ) σ) C) C) C) ω 5 o |X^_ Ο 00 co σ> σ> ο σ> CM co τ- co m T- Φ o CM CO σ) σ) CM 00 τ- co Is-·. co Is-·. Is-- s© 0s 0 0 0 0 0 1 0 0 0 |— 0 Ι— ο 0 0 0 0 0 0 0 0 δ o ο ο 0 0 |— 0 |— 0 0 0 0 0 ο Ι— 0 0 0 0 0 0 0 0 CÜ 0 0 0 0 0 |— 0 0 |— 0 0 0 0 0 0 0 1“ 0 0 0 0 0 Ι— 0 0 0 c 0 l— 0 0 0 0 0 0 <£ 0 0 0 0 «DZ ci ο 1— δ 1= 0 0 f \ 0 0 0 0 δ 0 I— 0 δ 0 0 σ φ ω 0 0 0 oo ο CD TAC 0 TGA 0 δ iGC( FGG 0 δ TAT 0 0 P 1— 0 0 δ 0 0 0 <£ Ο 0 0 0 0 μ 0 0 0 0 oo 0 0 0 0 0 0 0 0 <χ 0 0 <c 0 0 I— ο 0 0 < 0 0 <c 0 0 0 Q CÜ — ra σ Q. LU 00 σ>|χ-> co σ> CM τ- σ> τ- co σ> 00 CM [X^. co σ> T- 2 CM in <» co α> C 5 CM CM C 5 τ- 00 CM α> in co U) CM co T3 c 04 U) in σ) 00 C 5 CM σ> ιη Jx-» Jx-» α> α> <» <» T- CM CM _ c CM C) ιη ιη U) ιη ιη mm U) ιη U) U) co co CO O co E _1 Φ O) -f σ — LU Φ Cf) CM CO σ> CM 00 [χ^_ co co τ- co [X^_ CM co CO Ό c ..σ> σ> α> CM co 05 ο ο 05 <» Jx-» τ- Jx^, co T- CO — EQ m in co 00 ο τ- co co Jx-» co co σ> σ> T- CM U CM ra ϕ) CMι σ) U ι ι U) U) U) with CO CO 8 .2 —I or Q CÜ — ra σ Q. LU ϕ Cf) <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ ° E ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ϕ oco E _1 Φ O) -f σ .E LU φ Cf) T- -O e ra ϕ — ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ co ζ ζ zzz0 co 8 .2 —I oο0 ECM0 oo CM CM OQ <» CM ιη 00 τ- ιη α> τ- Jx-» τ- Jx^, C 5 σ> JX-» C 5 σ> ° (Λ C) m ιη ιη co co 00 co 00 ο 05 ο 05 O CO co co co CO co Φ 05 05 05 05 05 05 05 05 05 05 05 05 Petition 870260057655, dated 12 / 06 / 2026, p. 138 / 1268 131 / 343 SEQ ID NO σ> co co 340 341 342 343 344 345 346 347 347 348 349 350 351 351 352 353 354 355 356 % inhibition τ- CM 47 23 83 84 o co 28 28 o 76 78 o 87 92 Sequence AGCTAAGACCAGTGAG CTGAAACCACCTGTAG CAGATGGGTACTTCTG GCCTTTAGAACAGCTG ATTTCTTGATGTGGTG GGCGAGCGATTGTCTT TGGTTGCCGTGGCAAC ATCATCTTG Illi GGCACGGACCTTGCCATGGATTGGATTG TTCTCCCTTATAGCTT AGCGAGAGTCACCGCC GTTTCTTGCCGTGCAC GTCAGCTGCCACCAAA GGTAGGTCTACAAAGA GAGGCTGGACTGCTCC CCAGATGTGTTTAGGC CACATCATTGGGTTAT Location of para- gem em SEQ ID: 2 σ> 3 co 642116 co 64617 e 8689 7074 7178 7278 7359 7494 7862 7975 8025 8110 8194 8347 Starting premises in SEQ ID: o 7163 7263 7344 7479 7847 7960 8010 8095 8179 8332 Para- gem premises in SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Starting Location in SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Compound Number 904966 904998 905030 905062 905094 905126905158 905190 905222 905254 905286 905318 905350 905382 905414 905446 905478 905510 Petição 870260057655, de 12 / 06 / 2026, pág. 139 / 1268 132 / 343 SEQ ID NO LO co 358 359 ο co co 361 362 co co co η Ie ini ção o 37 o ο co T- 64 o 73 s© 0s GG δ δ 0 o <c GA () —— |— 0 — .s 0 <c δ <c GT <ζ o () 0 ο δ I— |— o <φ o I— ο o 0 z 0 ο |— 0 O |— σ 0 φ «ς-ζ 0 ο 0 ( / ) o 0 ο I— 0 0 0 ο 0 0 o 0 0 o 0 () ο 0 0 0 0 0 0 0 Q CÜ — ra a Q. LU m co CD in T- m Π Φ 0 o σ> m co in T- 00 73 r- co oo σ> σ> _ c 00 00 00 00 00 00 00 U <ο E _1 Φ CD -fa — LU Φ ( / ) CM o T- ο co om 73 c .. <» 00 U) σ> C 5 co — EQ co co oo σ> σ> ra φ — 00 00 00 00 00 00 00 8 .2 —I o Q CÜ — ra a Q. LU Φ ( / ) <£ <£ <£ <£ <£ <£ <£ Ξ E zz ζ ζ zzz ra φ O c ο E _1 Φ CD -fa .E LU φ ( / ) T- -O e ra φ — zz ζ ζ zzz 8 .2 —I o E o CM co 00 o CM OQ ο CO O co Ό ( / ) in in co co oo in in in U) CO mm C 5 C 5 C 5 C 5 C 5 C 5 C 5 Φ 05 05 05 05 05 05 05 E oz SEQ ID NO CO T- 364 365 co co co co co Í2 % of in ção 08 CM 53 25 o )-3 directed to SEQ ID Nos: 1 and 2 Sequence GTTCAAAAGCAGCATT GTCCCCAAGATATACC CCAAGGAATCTTCCCC TTGCACCCTCGCTCCA GTGCCAGCAGCCCAGT Stop location in SEQ ID: 2 8321 537 643 V / N 4819 :om cEt 3-1C Start location in SEQ ID: 2 co o co 00 522 628 V / N 4804 oapmers c Stop location SEQ ID: 1 V / N 44 150 273 344 .1 by Location in \m of AP0L Start location in SEQ ID: 1 V / N 29 135 258 329 Inhibition of RN / Compound number 793406 903431 903463 903495 903527 Petition 870260057655, dated 12 / 06 / 2026, pp. 140 / 1268 133 / 343 QO 00 σ> o T- CM coco coco σ> o T- CM co CO SEC N C1J CO CO coco coco coco coco coco co MJ coco coco coco MJ coco coco coco Si % of ink T- ο ooo Tm T- CO 24 49 T- CO TTCTGTACTGCTGGCC GGGCACGGAGCCTTCT GATGGTGGTGCCTTTG GGTGCCAGACCATGC CCCGGTCAAAAGCGGCT CCACTTCTTTCCGTAG AGTTGGATATGTTCTC TCTGAGGGCACGGATG TTCAGCTGATTGCTGGTGTAACTGTCGAT GTCACAGTTCTTGGTC TTACCTCACCCTCTTT CACTGCCATCTGCATT GGCCCCCATATATT CTGTTCTAACTCTTGG AGACTTCATTCTTCGG CCATCATCAGGAAGCC le paraSEQ ID: T- ο T- CO 552 525 Tco ι 19( 8140 8W 524 522 (AJ CM CM CM CM V / / CM CM co co co LN co co co co CO co CÜ Φ OR co SO) -f σ — LU Φ < / ) CM Ό e VAJ LO 04 CO CO UJ T- VAJ rr*» co o co CM CM co rr\ UJ CM U J co V J co o b 75 Φ — 8 .2 —I o VAJ CM T- CM T- CM T- CM T- CM T- CM T- co T- co T- co T- LN CO T- CO T- co T- MJ CO CO T- T- T- de paragem SEQ ID: 1 580 649 069 761 834 870 961 1029 1107 1147 1251 1366 1763 1844 1959 2357 co co eü 2531 75 E q Local de início em SEQ ID: 1 565 634 675 746 819 855 946 1014 1092 1132 1236 1351 1748 1829 1944 2342 2418 2516 E oo 5 7Ί 'tí 523 555 587 σ> T- Tm co co m T- 547 579 TT- co 9Z( o 69( T- 103 135 167 OO CO co co co co co co co co co co co co Φ “ E oz σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> UJ σ> σ> σ> UJ σ> σ> UJ σ> UJ σ> UJ σ> uj σ> uj σ>. Petição 870260057655, de 12 / 06 / 2026, pág. 141 / 1268 134 / 343 Q “ O (O CO σ> O τ- CM CO Ο co CO σ> O τ- CM CO OX 00 co CO co σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> Ο ο Ο Ο Ο Ο LU 2 σ) σ) C) C) σ) σ) σ) σ) σ) σ) σ) σ) σ) σ) σ) ω £ é in ção ο 44 T- CO 75 ο ο 06 09 ο 47 co co 09 32 τ- m τ- 70 87 54 73 s© 0s Ο Ο |_______ o 0 0 0 0 0 0 0 0 0 0 0 Ο 0 CO Ο 0 0 0 0 0 .s CATG TOOT 0 0 3ATT( δ Ο 0 0 CAAC TGAC 0 0 0 0 0 0 TOGO GAGA 'ATTG CTCA' AGCC 0 0 0 AACA1 c «D O 0 1— o 0 0 δ IV. <χ 0 1 1 0 AT 0 0 0 0 0 δ δ z σ 0 0 0 o Ο Ο 0 0 0 δ 0 0 δ Ο ο 0 0 0 φ 0 o 0 0 0 0 0 0 |— 0 Η 0 CO ο 0 |— 0 |— 0 0 0 0 0 0 0 <Γ 0 ο I- ο 0 (0 0 0 0 0 0 0 0 0 0 |— 0 0 0 0 <£ Ι— 0 Ι— 0 0 0 0 <£ 0 0 0 0 0 0 0 0 0 0 0 0 Q CÜ — ra σ Q. LU co 00 IO σ> co CO ΙΟ τ- CM ο CM ο σ> Φ w fM o> Τ- LO LO C 1 «) τ- CM CM τ- τ- 00 co «> 73 r- co ο ΙΟ 00 ο CM CO ΙΟ co 00 _ c CÜ Φ τ- τ- T- T- τ- CM co LO LO ΙΟ LO LO ΙΟ ιο ιο LO ü co E _1 Φ O) -f σ — LU Φ Cf) CM τ- CO CM o CM τ- τ- ο σ> co σ> ΙΟ CM Ιο 73 c .. a> C 5 σ> σ> co 05 C 5 o 05 σ> τ- — EQ co Ο ΙΟ co 00 ο τ- co co 00 00 ra φ — 8 .2 t- t- T- T- t- CM co LO ÍO ío LO LO LO ÍO LO LO —I o E cd T. SQ ra —. LO co o. O co 00 LO Φ LU 73 ω co CM CM 00 CM râ E Ο φ ο -ρ σ — LU φ Cf) τ- Ο CM T- Ο e CM ra φ 5 CO CM C4 00 CM z ζ ζ ζ ζ ζ ζ ζ ζ ζ 8 .2 _ι ο Ε ο σ> τ- CO σ> τ- co ΙΟ |s^_ σ> τ- co LO σ> τ- co ΙΟ ο 05 co CO CM LO σ> CM LO 00 τ- ΙΟ a> T- τ- ° (Λ τ- CM CM C) σ) σ) ΙΟ LO LO co co CO Ο ο ο ο CO CO CO ο ο Ο ο ο ο Ο ο co co ο ο ο φ 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 Ε ο ζ. Petition 870260057655, de 12 / 06 / 2026, pág. 142 / 1268 135 / 343 SEQ ID NO 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 ,Ε ο ο oo CM in T- 0 with U m 420 421) co 05 T- m C) T- C) σ s© 0s AGAC TGGG DCAC FGGT TCAC GTGA 0 0 AGCT 3TGG GTCT GCAA FTGG COAT iATTC 0 0 0 0 0 0 FGCA ra oc «D 0 0— 0 0 0 0 0 — 0 | TTGT GACC CCAC 0 0 AGAA FTGA 0 0 DCGT TTGT GACC AGGA CTTA· 0 0 0 0 σ o O 0 0 |— 0 0 co 0 CD 0 0 Φ |— 0 0 0 I— 0 0 QVI CO 1— I — 0 o Ti IV. 0 0 0 CD 0 0 0 0 0 P 0 0 I— <r 0 0 0 0 I- 0 0 0 0 0 0 0 0 0 I— 0 0 0 0 1D: ro σ Q. LU 00 cd CD o co o CM CM in CD m CD CD o in co CM U) 00 CO C) 00 in CM CO CM T- T- 05 Γχ- co CD co Z E LO LO CO co co co CO CO co co co CO O c o E O) -f σ .E LU Φ Cf) CM 00 m 00 m o CM CD o m o 00 σ> cd T- CM CM with in with 00 or T- CM with 00 8 .2 —I o E ω cd „ g Q ο. α <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c φ LU σ ω z z z z z z z z z z z z z z z z z z râ E o -f σ .E LU φ Cf) T- ocal d io em ID: zzzzzzzzzzzzzzzzzzz —I o E oo cd T- co in CD T- co in CD T- co in CD T- O _9 7Ί 'tí o σ) c_> C) co o> co co 05 CM in CD CM in 00 T- m OO mmm in in in mmmmm Φ “ E σ> cd cd cd cd cd CD CD CD CD CD CD CD CD CD CD CD CD o z. Petição 870260057655, de 12 / 06 / 2026, pág. 143 / 1268 136 / 343 Q “ O CM co ΙΌ CO Is-., 00 σ> Ο τ- CM CO σ y LU 2 CM CM CM CM CM CM CM CM 00 co CO CO ω £ e in ção 87 76 65 CO 00 85 O ΙΌ 57 ο 43 CM 00 O T3 s© 0s Ο 0 0 Q 0 0 0 0 Ο 0 0 0 ί 0 r J— 0 0 Ρ 0 1— ο 0 0 0 0 0 0 φ 0 ο 0 |— 0 0 0 t õ c ο VJJ CA' 0 0 CA 0 0 0 0 0 0 o 0 «DZ ο 0 ο Ο ( 1 0 0 1= 0 <ζ 0 0 0 σ 0 o |— Ο 0 0 Φ ω C5 0 0 AT 0 0 0 0 0 0 0 ο O 0 0 0 Q 0 0 0 0 oo d <£ 0 0 0 <£ 0 0 0 0 <c 0 0 0 0 Q φ — ra σ Q. LU 00 (Ο ΙΌ co cd co T- Is*». CM CM 05 τ- ο co co Is-», T- co T3 c 04 σ> C 5 τ- T- σ> ΙΟ co co CD CD _ c Is-·. 00 00 00 co 00 00 00 00 00 00 00 U co E _1 Φ O) -f σ — LU Φ Cf) CM co τ- cd o co CM σ> τ- CM CM CO Ό c .. (Ο τ- ο 00 σ> ο 05 ΙΌ CO C 5 CO — EQ σ> ο τ- T- co co Is-», CO CD CD ra φ — 00 00 00 co 00 00 00 00 00 00 00 8 .2 —I o E cd T. SQ ra “ o. α <£ <£ <£ <£ <£ <£ <£ Φ LU ζ ζ ζ zz ζ ζ ζ zzz σ ω râ E Ο φ ο -f σ .Ε LU φ Cf) τ- -Ο e ra φ Q ζ ζ zz ζ ζ ζ ζ zzz 8 .2 _ι ο E ο 00 ΙΌ [-*».cd T- co ΙΌ Js^_ CD T- CO ΙΌ Ο Q co τ- T- ο CO Is-», o CO tfí σ> ΙΌ ΙΌ ΙΌ co CO co Is-», Is-», ο ΙΌ LO ΙΌ ΙΌ ΙΌ CO ΙΌ ΙΌ ΙΌ CO CO C ο C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 φ 05 05 05 05 05 05 05 05 05 05 05 05 05 05 E ο z. Petition 870260057655, de 12 / 06 / 2026, pág. 144 / 1268 Inhibition of APOL1 mRNA by gappers with cEt 3-10-3 directed to SEQ IP NOs: 1 and 2 SEQ ID NO CO 434 435 436 437 00 CO 439 440 441 442 443 444 % inhibition CO 00 o CD CO o 64 oo LO o CO CM 74 Sequence H I- O 0 O 0 OHI— 0 AGTCCCCAAGATATAC I— 0 0 $ oo I— oo I— oo 0 oo I— o 0 o I— oooo 0 HI— 0 TGGTGCCAGCAGCCCA O 0 0 I— o 0 I— o I— 0 I— o AGGGCACGGAGCCTTC CGATGGTGGTGCCI II GGGTGCCAGACCCATG TCCCGGTCAAAGCGGC I— 0 O oo HI— ooo AAGTTGGATATGTTCT Stop location in SEQ ID: 2 8321 538 V / NV / N 4821 12672 12741 12782 12853 12926 12962 13053 Start location in SEQ ID: 2 8306 523 V / NV / N CD O 00 12657 12726 12767 12838 CD CM 12947 13038 Stop location in SEQ ID: 1 V / N 45 157 274 346 581 650 691 762 835 871 962 Start location in SEQ ID: 1 V / N 30 142 259 331 566 635 676 747 CM 00 856 947 Compound number 793406 903432 903464 903496 903528 903624 903656 903688 CM CO O CD 903752 903784 903816 Petition 870260057655, dated 12 / 06 / 2026, pp. 145 / 1268 138 / 343SEQ ID NO 445 446 447 448 449 450 451 452 453 454 455 456 457 458 % inhibition 37 56 457 458 70 CD 00 o 00 CO CXI CO CX0 CDI o 06 Sequence GTCTGAGGGCACGGAT II ICAGCTGAGATTGG AGGATGCTGGGTTCAT HI— O 0 I— 0 £ 0 HOI— oo TGGTCACAGTTCTTGG OI— oooo I— ooo HO 0 I— OHOO 0 I— oo I— AT 0 AT— ATHICCCA o AAGACTTCATTCTTCG ACCATCATCAGGAAGC GGGACCATGGCCATGG OI— oo HI— o 0 0 I— o H 0 TTGATGAGTAGGTGAG Local de paragem em SEQ ID: 2 13121 13199 1393569 13935643 14051 14449 14525 14623 14727 14879 14948 Start location in SEQ ID: 2 13106 13184 13224 13328 13444 0 or CD 14712 14864 14933 Local of paragem em SEQ ID: 1 o CO o 1015 1093 1133 1237 1353 1751 o CO 00 1945 2343 2419 2517 2621 2773 CXI 00 CXI Compound number 00 00 CO 90391 CO 902 o CD4 903976 00 yes CD yes CD CXI yes CD yes CD904136 00 CD o CD oo CXI o CD 904232 904264 Petition 870260057655, of 12 / 06 / 2026, p. 146 / 1268 139 / 343 ro Ό c «υ σ φ ω 461 CM co co co 464 465 466 467 co co CD CO 470 471 472 18 95 37 35 63 41 16 56 14 06 72 95 Ο I— 0 0 Η I— 0 0 Ο ο ο ο ο Η I— GAATGAGCAGGTCAGA GGTTCTGACAATGACC GAGGAGGTGAGCCTAC I— o 0 δ I— 0 0 HI— o CGGGAGGTGACAGGTC GCCCGATACATTCCCA CTCATGGTACAGGAGA AGGGAGGCCCTATTGT TTCTATTGGGCCTCAG CCATAGAGCCCCTATTGTGGGGCCTCAG CCATAGGAGCCCCTATTCAGA 256 3768 4407 4846 5085 5212 5325 5424 5511 5713 co co LO 5831 2549 3753 4392 4831 5070 5197 5310 5409 5496 63857576 Petition 870260057655, of 12 / 06 / 2026, p. 147 / 1268 140 / 343 SEQ ID NO 473 474 475 476 477 478 479 480 481 482 483 484 485 486 % inhibition 59 16 00 00 CXI CD 34 54 CD 00 74 94 26 00 87 cxi 67 Sequence 0 OOOOI— 0 0 CACCTGTATTCGGAGA 0 0 I— OOO Ι- Ο 0 CCTTATGCTTACTCCA GTATGCCCATGI I IGG OI— o I— 0 I— I— oo I— ooo δ 0 I— 0 oo 0 £ o 0 o I— 0 I— oooo 0 I— o 0 I— I— ATCAGATGGGTACTTC AGGCCI I IAGAACAGC I— I— 0 I— 0 I— o I— I— oo TGGGCGAGCGATTGTC CTTGGTTGCCGTGGCA OOOI— HI— 0 I— o Stop location in SEQ ID: 2 O CD 00 LO 5954 5990 6160 6231 6284 6351 6424 6563 6626 6729 6815 0069 7091 Start location in SEQ ID: 2 5875 5939 5975 6145 6216 6269 6336 6409 6548 6611 6714 oo 00 CO 6885 7076 Stop location in SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Start location in SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Compound Number 904776 00 o 00 o CD o 00 o CD CXI 00 o CD o CD O CD 904936 904968 905000 905032 905064 905096 905128 905160 905192 Petition 870260057655, dated 12 / 06 / 2026, pp. 148 / 1268 141 / 343 SEQ ID NO 487 488 489 490 491 492 493 494 495 496 497 498 499 500% inhibition LD CO 00 co CM 00 LD CD s LD CD 00 CM oooo Sequence OOI— ooo 0 0 0 HI— oo CCATGCAAAGGAGATT O 0 δ i= ooo I— o πι- ο 0 OOOI— 0 0 0 o 0 o TTGI I ICTTGCCGTGC OOO 0 I— o 0 o I— 0 0 H- o I— o I— 0 0 I— 0 0 H- ooo πι- ο o 0 I— oo HH- ATCCAGATGTGI I IAG AACACATCATTGGGTT TGATCACTTCCATCTG CATGGTGCI I IGGAGA CATAAGCCAGCAAGAG GGGCTCTAATTCTATT Stop location in SEQ ID: 2 o 00 T— o 00 CM CD CO CD CD CD 00 CD σ> CM O 00 O CO 00 CD CD 00 CD CO 00 o CM 00 00 o LD 00 CD 00 CD 00 Start location in SEQ ID: 2 7165 7265 7346 00 7849 7964 CM T— o 00 8115 00 00 CO CO 00 LD O 00 CO CD 00 8659 8752 Stop location in SEQ ID: 1 zzzzzzzzzzzzzz Start location in SEQ ID: 1 zzzzzzzzzzzzzz Compound number 905224 905256 905288 905320 905352 905384 905416 905448 O 00 LD O CD 905512 905544 905576 905608 905640 Petition 870260057655, dated 12 / 06 / 2026, pp. 149 / 1268 142 / 343 SEQ ID ON 501 502 503 ό of inhibition CM CM CD o Sequence O o OO 0 I— 0 I— 0 HI— 0 0 0 TGATGTGGGACTTGTT GTGTGGGAGTGCATAA pa- E CM Location of origin and SEQ ID: co co co co T— CD CO CM CO CD CO Starting location in SEQ ID: 2 co CO co co CO O CD CO CD CD CO 1 of para- in SEQ ozzz CTJ oo E φ D) Starting location in SEQ ID: 1 zzz Compound number 905672 905704 905736 o CO 0 0 HI— o 0 o I— oooo 0 HI— 0 H ATGGTGCCAGCAGCCC 0 0 — o 0 — o — 0 — D 5 AAGGGCACGGAGCCTT )-3 directed! Location of stoppage in SEQ ID: 2 8321 539 V / NV / N CM CM CO 12673 12742 :om cEt 3-1C Location of start in SEQ ID: 2 8306 524 V / NV / N 4807 12658 12727 .1 vor gaomers Location of stoppage in SEQ ID: 1 V / N CD 159 275 347 CM oo LO 651 \m de APOL Location of start in SEQ ID: 1 V / N Xco 144 260 332 567 636 / Nd ΘP oeO|q|U| Compound number 793406 903433 903465 903497 903529 903625 903657 Petition 870260057655, dated 12 / 06 / 2026, pp. 150 / 1268 143 / 343 SEQ ID NO 510 511 512 513 514 515 516 517 518 519 520 521 522 523 % of inhibition CXI CO or CXI CXI CO 00 lo GCGATGGTGGTGCCTT AGGGTGCCAGACCACAT ATCCCGGGTCAAAAGCGG I— 0 OOOI— I— O ooo GAAAGTTGGATGTT CGTCTGAGGGCACGGA CI I ICAGCTGAGATTG CAGGATGCTGGGTTCA I— o—0 O I— 0 I— 0 o I— 0 0 I— 0 I— oooo I— ooo OO 0 I— oo 0 I— o 0 I— oo I— CCGGCCCCCAATATA I— o I— oo I— I— 0 I— oo SEQ ID: 2 12783 12854 C 129527 oo CO 13240 13344 13460 13858 13944 14052 14451 Start location in SEQ ID: 2 12768 CD CO 00 CXI 12912 12948 oo CO 13843 13929 14037 14436 Local of paragem em SEQ ID: 1 692 763 836 CXI 00 964 1031 1109 1149 1253 1369 1767 1819 Local SEQ de2 136 677 748 T— CXI 00 LO 00 949 1016 1094 1134 1238 1354 1752 00 CO 00 T— 1946 2345 Compound number 90963785 903721 00 CO O CD T— 00 00 CO o CD903977 CD OOO CD oo CD CO oo CD 904105 Petition 870260057655, dated 12 / 06 / 2026, pp. 151 / 1268 144 / 343 SEQ ID NO 524 525 526 527 528 529 530 531 532 533 534 535 536 537 % inhibition LD 79 47 00 00 78 00 CD o 97 75 84 85 33 o 75 Sequence GCCCCCAGGAGGACAA GACCATCATCAGGAAG 0 0 0 I— o I— o I— o δ oo I— OOI— I— O 0 0 I— o I— 0 0 CTTGATGAGTAGGTGA ΠΙ- Ο o OOO 0 I— I— 0 I— o I— I— 0 OO 0 I— o I— 0 0 o 0 0 0 I— o OI— 0 0 o 0 0 I— 0 I— 0 AGAGTCTATACACAGA GAGTAGGAACCAGCAG I— o 0 δ I— 0 0 I— I— O GCGGGAGGTGACAGGT GGCCCGATACATTCCC TCTCATGGTACAGGAG Stop location in SEQ ID: 2 14588 14624 14778 14880 14949 1067 2573 3771 4441 4866 5086 5213 5326 5425 Start location in SEQ ID: 2 14573 CD O co 14763 14865 14934 1052 2558 3756 4426 4851 5071 5198 5311 5410 Stop location in SEQ ID: 1 2497 2533 2687 CD 00 CM 2858 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Starting location in SEQ ID: 1 CM 00 CM 2518 2672 2774 CO 00 CM V / NV / NV / NV / NV / NV / NV / NV / NV / N Compound number 904137 904169 o CM O CD 904233 904265 904361 904393 904425 LO o CD CD 00 O CD 904521 904553 904585 904617 Petition 870260057655, dated 12 / 06 / 2026, p. 152 / 1268 145 / 343 SEQ ID NO 538 539 540 541 542 543 544 545 546 547 548 549 550 551 % inhibition T— CD 00 06 95 30 CM CO 52 CO CD CD CD CO CD 00 64 99 o Sequence TAGGGAGGCCCTATTG ATTCTATTGGGCCTCA CACCATAGCACGAAGC AG II ICATATTCACCC OOOOI— 0 0 o TCACCTGTATTCGGAG O 0 0 I— o 0 I— o TCCTTATGCTTACTCC CATGTATGCCCATGTT HI— o 0 l= OOI— ooo í TTCAGCTAAGACCAGT I— oooo 0 I— o 0 HI— 0 TATCAGATGGGTACTT GAGGCCI I IAGAACAG Stopping location in SEQ ID: 2 5512 5714 5790 5832 5892 5955 6032 6161 6234 6285 6352 6425 6564 6627 Start location in SEQ ID: 2 5497 5699 5775 5817 5877 5940 6017 6146 6219 6270 6337 6410 6549 6612 Stop location in SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Start location in SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Composite number 904649 904681 904713 904745 904777 CD O 00 O CD T— 00 o CD CO 00 o CD 904905 904937 904969 905001 905033 905065 Petition 870260057655, dated 12 / 06 / 2026, p. 153 / 1268 146 / 343 SEQ ID NO 552 553 554 555 556 557 558 559 560 561 562 563 564 565 % of inhibition 24 61 cxi 81 CXI CO 30 75 CD 86 CXI 55 I— 0 I— 0 I— o H- I— oo 0 CTGGGCGAGCGATTGT ACTTGGTTGCCGTGGC OOO H- HI— 0 I— oo OOI— ooo 0 0 0 HI— oo H- ACCATGCAAAGGAG0 O í HI— ooo I— o Oο0 oο0 oο0- ATTGI I ICTTGCCGTG O 0 I— o 0 o I— 0 0 I— o H- AATGGTAGGTCTACAA o πι- ο o 0 I— o HH- H AATCCAGATGTGI I IA 0 0 0 ΠΙ- Ο H- OO 0 o H- 16 Parage ID: 6901 CXI CD o 7181 7281 7362 7497 7865 CXI 00 CD 00 CXI o 00 8131 8197 8351 Start location em SEQ ID: 7482 o LO 00 7967 CO T— o 00 CD 00 CXI 00 T— 00 8336 Paragem location in SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Compound number 905097 905129 905161 905193 9052525 9052535 905385 905417 905449 905481 905513 Petition 870260057655, dated 12 / 06 / 2026, p. 154 / 1268 147 / 343 SEQ ID NO 566 567 568 569 570 571 572 % inhibition OT CO LO oo 00 o Sequence I— o I- O o HI— oo H 0 I— 0 CCATGGTGCI I IGGAG CCATAAGCCAGCAAGA AGGGCTCTAATTCTAT ooo 0 I— 0 I— 0 HI— 0 0 0 GTGATGTGGGACTTGT AGTGTGGGAGTGCATA Stop location in SEQ ID: 2 T— CXJ 00 CD O LO 00 8675 00 CD 00 CD 00 00 CD CD 00 CO 00 CD 00 Start location in SEQ ID: 2 CD O 00 8494 0998 8753 s 00 00 O CD 00 00 CD CD 00 Stop location in SEQ ID: 1 Z zzzzzz Starting location in SEQ ID: 1 zzzzzzz Composite number 905545 905577 905609 905641 905673 905705 905737 CXI CD SEQ ID NO co τ- 573 574 575 Si ,E o co co φ 'ü' 00 co CM co Ό -O 0s 0 0 0 δ <ζ 0 0 Q .s 0 0 0 0 0 c 0 0 0 <φ 0 0 0 0 0 σ 0 δ δ Φ ω 0 0 0 0 0 0 l= 0 CCA 0 0 TTG 1D: ra σ Q. LU φ ω 8321 540 2377 V / N Ο C ο E σ) -ρ σ .Ε LU φ ( / ) οι (Ο CM ocal d io em ID: ο co 00 CM LO 236 z —I ο E φ τ- SQ ο. Ο < Is-. CO co φ LU σ ω ζ CM râ Ε Ο φ ο -ρ σ .Ε LU ocal de io em S ID: 1 V / N CM CO 152 261 —I ο E ο co co co ο 9 ° ω ο co co σ> ο σ) σ) C) σ) φ “ E σ> σ> σ> ο ζ Petition 870260057655, de 12 / 06 / 2026, pág. 155 / 1268 148 / 343 SEQ ID NO 576 577 578 579 580 581 582 583 584 585 586 587 588 σ> co LO 590 591 592 593 % of incidence o 58 T“ T- σ> co 48 48 T“ 3 48 T-CM T“ CO T— 92 o σ> co 29 Sequence TCTCTGGGTCCATGGT AGTTTCTGTACTGCTG CAAGGGCACGGAGCCT GGCGATGGTGGTGCCT CTCTGTGAAGGGTGCC AATCCCGGTCAAAGCG CCACCACTTCTTTCCG ATTGCCAGCTAAGGAAGCTGCTGATTGATT GACTCCTCTGCTCATT CCCCTCATGTAAGTGC GCCCTGTGGTCACAGT AAACTTTACCTCACCC TCTCCTTGCTGCACTG CCCGGCCCCCCAATAT OOO 0 O oo ATGCCCCCAGGAGGAC ID: ra o.Φ σ LU ω CM 574 co 782 562 328 1z9€ SZ( co co τO 89Õ 97Í LO co 559 co co LO S9t 590 Ό z XXz CM CM CM CM CM CM CM co LM co VN CO VJ co co CO co CQ OO φ E CD Έ σ LU φ σ ( / ) cm <£ pi CO T“ LO CM LL / co VJ co LO co co co U ) râ oo φ Q ο ο z LL / CM T“ CM T“ CM T“ CM T“ CM T“ CM T“ co T“ CO T“ co t— LM CO t— L' J CO t— CO t— CO t— co t— T— T— t— Ε φ τ- de para( SEQ ID: 358 583 652 693 771 co 00 co co 981 1045 1110 1167 1254 1374 1768 1855 1962 2361 σ> σ> eü Local em Local de iní- cio em SEQ ID: 1 343 568 co co co co 756 822 858 996 1030 1095 1152 1239 1359 1753 1840 1947 2346 2484 E oo 5 530 526 558 590 722 754 co 00 CO T“ 550 582 T— co co ot— )42 )74 901 what what ( / ) oo what XXz CO XXz CO CO what what what what what what what what what Φ “ E oz σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ>. Petição 870260057655, de 12 / 06 / 2026, pág. 156 / 1268 149 / 343 SEQ ID NO 594 595 596 597 598 599 oo CO 601 602 CO or CO 604 605 CO or CO 607 00 or CO σ> or CO 610 611 % of inhibition 45 79 74 54 296 CO 65 CO 64 CO 00 96 Sequence CAATGACCATCATCAG TCACATACTCTCTGGG AGAGATCTGAGCTTCC GCTTGATGAGTAGGTG TCCTCCTTGAGCAGGA TGAACTCCTTGTACCT GTCCTCCCTGGGCGAG CCACATTTGAGATTAT CGGAGCCATCCATCAGCCATCCATCCAT CACTTGAGTCATTTGC AGCGGGAGGTGACAGG AGGCCCGATACATTCC TTCTCATGGTACAGGA TTAGGGAGGCCCTATT AATTCTATTGGGGCCTC TCACCATAGCACGAAG GCAGTTTCATATTCAC Location of para- gem in SEQ ID: 2 14628 1474781 1092 2580 00 o 00 CO 4472 4885 5087 5214 5327 5426 5513 5715 5791 5834 Starting premises in SEQ ID: 2 14613 14764 14866 134951 2565 3793 4457 4870 5072 5199 5312 5411 5498 5700 5776 5819 Stopping place in SEQ ID: 1 2537 2688 2790 2859 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Starting location in SEQ ID: 1 2522 2673 2775 2844 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Compound Number 904170 904202904234 904266 904298 904362 904394 904426 904458 904490 904522 904554 904586 904618 904650 904682 904714 904746 Petition 870260057655, dated 12 / 06 / 2026, p. 157 / 1268 150 / 343 SEQ ID NO 612 613 614 615 616 617 618 619 620 620 621 622 623 624 625 626 627 627 628 629 % of inhibition 84 27 70 σ> CO 7 0 - 7 7 7 74 CO σ> o σ> CO 79 52 64 00 CO σ> Sequence GA III ICCAACAAGGT CTCACCTGTATTCGGA GCACTAAAAGCTGATT GAAATCCTTATGCTTA CCATGTATGCCCATGT CATACCCTCCTTGTCT AATTCAGCTAAGACCA AGTTCACCGACCATGCTGTCTAGCTTA CGAGGCCTTTAGAACA GGCACTAAATCTGTGT GCTGGGCGAGCGATTG GACTTGGTTGCCGTGG GCCTGTTATTAAACCA ATCCTTGAGGCACCTC CTACCATGCAAAGGAG TGCATTCTCCCTTATA AGACAGCGAGAGTCAC Location of para- gem in SEQ ID: 6235 6286 6354 6426 6565 6628 T- CO CO 6817 6902 7093 7182 7283 CO CO CO 7498 Starting premises in SEQ ID: 2 5887 5941 6020 615 CO CO 2726 σ > CO 6411 6550 6613 6716 6802 00 00 CO 7078 7167 7268 7348 7483 Stopping place in SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Starting Location in SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Compound Number 904778 904810 904842 904874904906 904938 904970 905002 905034 905066 905098 905130 905162 905194 905226 905258 905290 905322 Petition 870260057655, dated 12 / 06 / 2026, pp. 158 / 1268 151 / 343 SEQ ID NO ο co co τ- CO CO CM co co co co co m co co co co co co co co co co co co co co co σ> co co 640 T- ω CM co e in ção τ- co m co CM 00 CM co oo co CM co co m CM 00 o σ 0s δ ο Q Ο 0 O δ O t= E 0 0 0 O δ 0 0 δ 0 δ OO 0 0 δ O δ 0 .52 0 0 δ OO δ OO 1— δ O o 0 0 δ c 0 1— 0 0 0 <φ z Ο Ο 0 δ δ O 0 δ I— 0 0 0 σ φ ω δ δ 0 0 oooo O o 0 0 δ δ 0 0 0 0 0 |— |— I— 0 C3 0 0 0 Ι— I— o I— o 0 0 0 |— J— |— 0 () 0 0 0 0 o 0 < φ σ Q. LU co 00 o CM co CM CM o co σ> oo cm co 00 C) C) 05 in CM T- co 00 CM 00 Ζ Ε 00 00 00 co 00 00 co 00 00 00 Ο C ο Ε σ) -ρ σ .Ε LU Φ Ο CM τ- co m CO m co mm σ> 2 £ çj 00 σ> Ó T- T- co co co σ> σ> 8 .2 —I ο Ε Φ τ- g Q Q. Ο <c <ζ <c <c <c <c <c <c <c <c <c <c <c φ LU σ ω φ Ε Ο φ ο -ρ σ .Ε LU φ (Λ τ- ° Ρ Φ Φ — 8 .2 ζ z z z z z z z z ζ _ι ο Ε ο ο co 00 o CM co 00 o CM co co Ο _9 7Ί ’tí U) 00 T- in 00 T- T- c_> σ) Ο Ο mm in in in mmmmmm in in φ “ Ε σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> ο ζ Petição 870260057655, de 12 / 06 / 2026, pág. 159 / 1268 CXI LO SEQ ID NO CO 643 644 645 646 647 647 648 649 650 651 652 652 653 654 655 656 % of inhibition 84 o τ- Ο co oo 24 CO 49 co co 87 o co SEQ ID NO: Sequence NO: GTTCAAAAGCAGCATT AGGTCCTCCAGTCCCC GTCGCTGCAGGGCCTC TTTGTTGCACCCTCGC GCTCTCTGGGTCCATG CAGTTTCTGTACTGCT GCAAGGGCACCGGAGCC TGGCGATGGTGGTGCC CCTCTGTGAAGGGTGC TAATCCCG AGATTGGCTCTGGCTC CGCTTTCAGCTGAGAT GCTTGACTCCCTCTGCT :om cEt 3-10-3 addressed! Para- gem premises SEQ ID: 2 8321 547 2378 V / NV / N 12675 12744 12785 12863 12929 12967 13073 13137 13202 13262 Cooking start premises SEQ ID: 523 o 2363 V / NV / N 12660 12729 12770 12848 12914 12952 13058 13122 13187 13247 .1 oor c / aomers c Stop location SEQ ID: 1 V / N 54 168 277 o co co 584 653 694 772 co co co co co 982 1046 1111 1171 \m de APOL Start location SEQ ID: 1 V / N σ> co 153 262 345 569 co co co σ> co 757 823 861 967 1031 1096 1156 RN inhibition / Compound number 793406 903435 903467 903499 903531 903627 903659 903691 903723 903755 903787 903819 903851 903883 903915. Petition 870260057655, dated 12 / 06 / 2026, pp. 160 / 1268 153 / 343 SEQ ID NO 657 658 659 o co co 661 662 co co co 664 665 999 co co co co co σ> co co 670 671 672 co co 674 .Ε ο ΙΓ> CM in σ> co co co co m co τ- σ> / 1* φ ο CM 00 co 00 T- co CM CM co CM τ- 00 Ό 0s 0 CT o Q bb GA IV b 0 I— 0 0 TC 0 11' 0 0 0 0 0 0 I- 0 0 0 0 |— φ ο C <φ 0 FGGTG' δ oo O 0 b 0 oooob DAGGA 1V00V CATAC TGAGC GAGTAi 0 l= 0 CTGAA 3TGGG TTGAG iCAGCC GATTC GTCAT Ζ 0 1— 0 0 0 0 0 0 0 0 υ σ ω ο 0 IIP 0 o 0 b Õ (} 0 AT 0 b 0 0 0 b 0 0 b 0 I- < / ) ο ο o o o 0 Q 0 0 0 r 0 TC 0 o Q c5 0 0 0 I— 0 ο n 0 õ o 0 I— 0 0 0 0 0 ο Q 0 0 0 0 0 0 0 CO 0 0 ο I— 0 0 I— 0 0 0 0 0 0 ' CM φ Q 11 de ρ SEQI 13346 13486 13860 13947 14054 14453 14591 14631 14784 14882 14951 2367 1101 2581 3810 4476 co co co 5088 2 £ Ο φ -ΐ σι c Q θ σ Ό LU CM φ ω τco co co 3471 3845 3932 σ> what about what 4576 4616 4769 4867 4936 2352 1086 2566 3795 4461 4871 what ο m 8 ° τ- T- T- T- T- T- T- T- T- T- 1 Ο Ε φ σι F3 S.Ο m ΓΓ» σ> co CO CM oo CO zT\ TzT\ o rr\ φ a σ uj CM τ- CO T- T- co T- σ> T- 23( 25( m CM 26( 27( 28( zzzzz ζ ζ φ ω ο IV - Q φ ζ ο o T- co mm co co m — LU CM co 00 σ> co m co 00 5 5 5 5 5 5 5 8 ω τ- T- T- T- T- CM CM CM CM CM ο Ο —1 ο E ο ο σ> T- co m σ> T- co in σ> co in σ> τ- co Ο _9 7Ί 'tí T- o σ) b«- c_> CO co co 05 CM ίθ σ> CM Ο Ο co co φ “ E σ>ο Z. Petition 870260057655, de 12 / 06 / 2026, pág. 161 / 1268 154 / 343 SEQ ID O z © © © © © 00 © cd © ο © © τ— © © © CM © © co co © © © © © © © © © © од © © © © © σ> © © 069 τ— CD © CM CD © % de inibi- o iCQ O CO T- ra CM cd CO σ> eÜ ts> CM co CM Т- (N © CM co © © co © © σ> © © Sequência 0 δ 0 0 0 0 0 0 O 0 0 O δ 0 OOO 0 0 O 0 0 δ 0 0 OOOOO 0 0 0 0 0 δ ο 0 0 0 δ 0 δ 0 ΟΟ Ο Ο Ο Ο 0 Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο � C5 Ο Ο 0 δ 0 δ 0 0 Ο 0 0 0 0 C5 δ Ο 0 δ Ο 0 δ Ο 0 0 Ο δ δ 0 0 δ δ Stop location- CM Q σ LU ω E φ O) © T“ CM © 00 CM CO © CM © T“ © © © τ— © CM σ> © τ— © © ο σ> © © σ> © © co ο © © τ— © © co CM © σ> CM © co © © © © © © © CD CM © © © © © © Local de início SEQ ID: CM OO CM © © TCO © CM © cd cd © τΟ © © © CM © © σ> © © © CM σ> © τ— CM Ο © CM © τ— © τ— CM CM © σ> CM © ο co © CO τ— © τ— © © © τ— © © Ο CM © Local de paragem Q σ LU ω Z zz ζ Ζ Ζ ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Ζ Local de iní- Q σ LU ω o ü Z zzz ζT“ © O cd T“ © © O cd co © © о σ> © т- О с> о с> о с> о с> т— т— © о с> co © о с> © 00 о с> о с> о с> с> co CD о с> т— с> о с> co о о © о CD © © о © о CD © о © о CD CD CD О © О CD Petition 870260057655, de 12 / 06 / 2026, pág. 162 / 1268 155 / 343 SEQ ID NO 693 694 695 969 697 869 σ> σ> co 700 701 702 703 704 705 706 707 708 709 710 .E o [s-. oo τ- CM co co CM co co co CM m co 00 / lí φ o co σ) 00 CM C) 00 co 00 co σ) O) σ) IX) Is»-. σ s© 0s H 0 O 0 δ 0 δ 0 Q 0 < I— I— 0 0 0 0 0 δ 0 0 .52 Q δ ο ο 0 Ο Ο 0 Ο Ο δ 0 Ο δ 0 Ε 0 δ 0 δ 0 δ 0 0 δ 0 δ 0 δ 0 δ c «D 0 0 0 δ 0 0 0 δ 0 0 0 0 δ 0 δ 0 δ ι= Z σ φ ο 0 0 0 0 0 δ 0 0 E 0 δ 0 0 0 0 δ 0 δ 0 δ 0 δ 0 δ CO 0 ο 0 Ο 0 ο ο 0 Ο 0 ο 0 Ο 0 Ο 0 δ 0 δ 0 δ 0 I 0 δ CM ra Q Q. φ o 00 co co σ> σ> τ- co σ> co co τ- σ> τ- S LU 00 σ> τ- CM co co σ> τ- τ- co m co 00 = w Cu r- 2 ε О φ -1 O) ç_Q SQ co 00 σ> 00 σ> σ> CM co 00 00 00 co m co LU CM Ê5< / ) 00 00 ό τ- CM co 00 σ> ο τ- τ- co in co 00 8 ° 1 OE φ O) çü g.Q <ζ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ de EQ ζω o 1 V - Q Φ Z Ό O <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c = ω 8 W ζ ζ ζ ζ ζ ζ ζ z ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ο ο —1 ο Ε ο ο τ- co ΙΟ σ> τ- co in σ> τ- co m σ> τ- co m Ο _9 7Ί 'tí co co 05 CM IX) σ> CM m 00 τ- m 00 τ- τ- Ο Ο in LO IX) mmmmmm in in in mmmmmm φ “ E σ>ο Z. Petition 870260057655, de 12 / 06 / 2026, pág. 163 / 1268 156 / 343 SEQ ID NO 711 712 Si ç o >1« 1,0 Φ o σ> ο s© 0s I— CA ο 0 CÜ 0 0 0 c 0 0 <φ Ι— (') z σ 0 0 φ ω 0 0 0 0 ο CM a ra Q Q. “ Φ m τ- CM mm Ό LU σ> CD — ω 00 co ra <- 2 £ Ο φ -1 O) CQ jí σ (Ο ο LU CM ο CD CD ra CO 00 00 8 ° 1 OE φ CD ra g. Q <ζ <ζ φ σ ζ ζ in râ ω Ο Ο IV - Q φ Ζ σ Ο <ζ <ζ ρ w 8 ω ζ ζ ο__ο —1 ο Ε ο ο ο ο ° « ο σ> co ο ο mm ο ο φ 05 05 Ε ο ζ SEQ ID NO CO τ- 713 714 715 716 717 718 719 720 721 % of inch 93 ο 48 29 57 τ- Ο T- CO 85 Tm co with SEQ ID NOAGTTAAs: AAGCTTTCA2 Sequence AGGAATTCGAAAGGGA ATAATAACCAGACAGG GCACTCATCCAGATGC TCCAGTATCTGTCCCA GTGTGCTCACI III IC GTTATCCTCAAGCTCA δ OOO 0 O l= oo SE GACGAGGGTCAGGATG CATCCCAGGTTCCAAG 05 em ω LoQ para i-10 8321 520 560 V / N 4778 9075 12721 12762 12835 12895 'c σ com cEt 3 φ σ ra oo cio em SE ID: 2 co ο co 00 515 7476 3 V / N 12820 12880 .1 hour c / aomers Location of para- gem em SEQ ID: 1 V / N 27 67 221 co o co 412 o co co 671 744 804 O CL 'c 'c ϕ Q σ LU ω CD de co τ oo CD- 0 CM ο ο ζ- m CM CM co co co z or Ε ο de ο ο .2 η co ο τ- co 00 o T- 542 538 o CM O CD ow ( / ) Ο ° Ο co co co CO co •AJ CO cí CD ϕ CD CO CD CO CD CO ibiç ζ Petition 870260057655, dated 12 / 06 / 2026, p. 164 / 1268 157 / 343 SEQ ID NO £ % of inch CO 76 64 co CO 29 53 32 67 Sequence ATGGTACTGCTGGTAA GGCTTGGGCTTGTGTC GTGTGAGTTGGTAAGT ATGCGGTACTGACTGA CACCTGTCCACCGCTT GCCACATCCGTGAGCT CCTGCAGAATCCTCAGTAA CCTCCTAGTAG TATTGCAGGCTCCAAT Í 0 0 0 0 TGGGTCTGTAGTGGAG TGCCTGACTGAGATAT CCATCACATGACAACC CCGGGTAAGAGCGATG CGGCGACAAGACAGCT AGCAAACACGCTCCCC GCAACGCACCCTTCΓIe paraSEQ5Z: CO1€ co1€ CM 9ZÕ CD CO CD CD 385 SZ€ CM cR CD 00 504 CO s CO T(V) 399 co 48 Σ E CM T- CM T- CO T- CO T- CO T- CO T- VN CO T- CO T- CO T- CO T- CO T- CO T- T- T- T- T- LAJ- E c- LU- T- CO T. ( / ) CM Ό and CM with I,' J with IAJ CD CO CM with !n 00 with VJ 0 with coco with with 75 Φ — 8 .2 —I o 1D: where QLU φ ( / ) T- co |s»» CM CM co co T- T- co co CO Ξ E 85 co co 66 0 T- IN T- T- IAJ T- T- CO T- T- T- CO T- 23Í 25' 25i IN CM 28C zz O c ο E CD fa .E LU φ ( / ) T- co co CM [-*». CD co co σ> co co co 00 CM CM co φ Q co co 87 86 0 T- UJ t- co co co CM co ΓΧΙ mzz 8 .2 —IO IN IN IN IN IN IN E oo .2 7Ί 'íí co co 862 330 362 394 co CM co 06€ )22 )54 co co CO T- 150 182 TΓΧΙ co CO 0 T- ( / ) oo co co co co co co co co IN IN Φ °· E oz cd cd cd cd CD CD CD CD CD CD CD CD CD CD CD CD. Petição 870260057655, de 12 / 06 / 2026, pág. 165 / 1268 158 / 343 SEQ ID NO 740 741 742 743 744 744 745 746 747 748 748 749 750 751 752 753 754 754 756 757 % of inhibition 72 25 00 CO 54 43 94 67 87 CO 57 26 Sequence ACAGGCTTCATCATCT AGCCTCTGCTGAATAT GATCTTGCCAGATGCC ATCACTGAGCCCCCAT TCACCCTAAGGAGAGG ACTTCCCCAAGGATGT AGGGTCAGCTTGGAGC GTTAAGCTGCTGAGTTGTTGTTGTT TGCCCTAACACAGCTG TTCCCAATTCAGCAAT TTGTCTCCGACACTTT AAGTGCAACCAATCAA CTAAACTCACACTGGC CTAAGTTCCGGTCTCA ACTCCACTGGGCCCGA GCATTGCCCTCCCAAT CACCACAGCCGTTCCA Local de para- gem em SEQ ID: 2 1673393949 5031 5110 5232 5347 5470 5595 5757 5808 5864 5933 5968 6105 6206 00 CO Starting location in SEQ ID: 5217 5332 5455 5580 5742 5793 5849 5918 5953 0609 6191 6233 Storage premises in SEQ ID: V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Starting Location in SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Compound Number 904374 904406 904438 904470 904502 904559 694569904630 904662 904694 904726 904758 904790 904822 904854 904886 904918 Petition 870260057655, dated 12 / 06 / 2026, p. 166 / 1268 159 / 343 SEQ ID NO 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 .E ο T- T- |s-. T- co o co o co CM co co / lí φ o Is»-. σ> σ> σ> CM CM 05 Is-— T- U) 05 Is»— 05 05 σ ​​s© 0s 0 0 0 0 0 0 0 0 0 0 I_______ 0 0 u 0 I- 0 0 I— 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 I— 0 0 0 ci 0 .s OO 0 0 <c 0 0 0 0 0 0 C5 C5 C5 0 c «D 3 TGA 0 0 0 0 0 0 0 0 0 0 0 0 C5 TGA 0 0 0 0 GTA 3AG 0 0 3AG σ Q 0 0 0 0 0 I— I— 0 I— φ ω 0 0 GAT GTT 0 0 0 0 TGG 0 0 CTO 0 0 0 0 GCA 0 GCC 0 0 0 0 0 0 0 0 0 0 <£ |— 0 0 0 <£ 0 0 0 0 0 0 0 0 0 0 0 0 0 <c 0 0 0 0 0 <c 0 0 0 0 I— 1- D: ra σ Q. LU o τ- CM co 00 co co co [S-. σ>T- CM T- σ> o co CM CM co U) σ> C) CM c_> o co 00 ZE CO co CO co co co co CO Is-- 00 co 00 00 O co EO) ​​-f σ .E LU Φ Cf) CM CO co CM 00 co T- T- T- CM co σ> co CO 00 2 £ çj CO co CO co 00 σ> T- pi pi CO f° σ> o T- CM 8 .2 —I o ιϋ: ra σ Q. LU φ Cf) ° EV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N ra φ oco EO) ​​-f σ .E LU ϕ Cf) T- ocal and ID: —I o E oo CM coco o CM coco o CM coco o CM O o 7Ί 'íí U) 00 T- T- Is-. c_> C) C_> C) co C) CO 05 ( / ) O o CO CO CO CO LO LO CO CO to CO CO CO CO CO CO Φ °· E σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> or z. Petition 870260057655, dated 12 / 06 / 2026, p. 167 / 1268 160 / 343 SEQ ID NO 776 LLL 778 779 780 781 782 ÍQ % of in ção co co 50 48 25 90 87 84 ra ο OO AACATCC kCCCAGC XGCACAC O 0 0 O \TAGAGG ω E φ O zGATC GGAAGTGGA GTTGAAGTC / GACTGTGTG / CATTTGGAG / ATTAGTGCT / TTGCATAAG / de paraι SEQ ID: 2 co co σ> co 576 o 524 CM σ> 091 — E co co co oc5 co co U c ο σ E CD co .f CM σ> LO φ Q co (. M LO co co co σ> 8 .2 —IO the paraim SEQ ID: 1 V / NV / NV / NV / NV / NV / NO c ο E CD Start location in SEQ ID: 1 V / NV / NV / NV oo.5 / NV / NV / NV / NV 522 554 co co CO X- ( / ) oo LO CO LO LO LO Φ °· E oz σ> σ> σ> σ> σ> σ> σ> SEQ ID ON 13 co co 784 785 786 k) c φ Ό o'- o ra o σ> co 47 30 15 70 SEQ ID NOs: 1 e2 Sequence GTTCAAAAGCAGCATT GAGGAATTCGAAAGGG δ 0 OO 0 TGCACTCATCCAGATG CTCCAGTATCTGTCCC co )-3 directed Stop location in SEQ ID: 2 8321 521 562 V / N 4779 om cEt 3-1C Start location in SEQ ID: 2 co o co co 909 547 V / N 4764 .1 by gapmers c Stop location in SEQ ID: V / N 28 σ> co 222 304 <m de APOL Local de Início em SEQ ID: 1 V / N 13 54 207 289 Inibição de RNZ Numero do o o Q E o o 793406 903415 903447 903479 903511 Petition 870260057655, dated 12 / 06 / 2026, pages 168 / 1268 161 / 343 SEQ ID NO 787 00 00 σ> 00 790 791 792 793 794 794 795 796 797 798 799 ο ο co 801 802 co ο 00 804 % inhibition 20 00 00 CO 92 o 87 τ- Ο 00 00 co co 85 76 24 54 42 Sequence GGACCTTCTGAACCCC CGACGAGGGTCAGGAT CCATCCCAGGTTCCAA CATGGTACTGCTGGTA TTTGATGACCAGGTCG CGTGTGAGTTGAGTTGACCTTGACCTTGACCTT GGGCCACATCCGTGAG GCCAAAGTCCCTAACA δ 0 ο ο ο GCTGGGTCTGTAGTGG CTGCCTGACTGAGATA Ο δ Η δ Ο δ ο ο ACCGGGTAAGAGCGAT GCGGCGACAGACAGCACCAGCCAGCCATTGATTTC Stop in SEQ ID: 2 12764 12836 12896 12943 12997 13089 13154 13214 13277 13886 14363 14491 14605 14649 148 149 Local 135 Cook em SEQ ID: 2 12749 12821 12881 12928 12982 13074 13139 13199 13262 13871 14348 14476 14590 14634 14804 Local 1365 Paracoco 1365 in SEQ ID: 1 CO CO 745 805 852 906 866 1063 1123 1186 1795 2272 2400 2514 2558 2728 2809 V / NV / N Starting Location in SEQ ID: 1 CO CO 745 805 852 906 866 1063 983 1048 1108 1171 1780 2257 2385 2499 2543 2713 2794 V / NV / N Number ofcompound 903671 903703 903735 903767 903799 903831 903863 903895 903927 904023 904087 904119 904151 904183 904215 904247 904311 904343 Petition 870260057655, dated 12 / 06 / 2026, pp. 169 / 1268 162 / 343 SEQ ID O z 805 CO o 00 807 00 o 00 σ> ο co 810 811 812 813 814 815 816 817 818 819 820 821 822 in c Φ σ o' çao 00 CO 00 CO CO ο co co co CO co co co co T- CO CM σ> 00 oo co co Sequência δ OO δ ooo 0 o GACCCTGACCTGGAGC GCACTGGACAGCCTGT TTGTCTATCACTGAGC GTCACCCTAAGGAGAG GCTGATTCCACTTCCC CCCCAGGGTCAGCTTG AGTTAAGCTGGAAGCT TAGCCGTGTTATATTT TGAACTCAGCCCCTGC δ 0 O δ o CTTGTCTCCGACACTT TAAGTGCAACCAATCA CCTAAACTCACACTGG GCTAAGTTCCGGTCTC AACTCCACTGGGCCCG ACTGCATTGCCCTCCC GCACCACAGCCGTTCC Local de Paragem em SEQ ID: 2 1900 2652 o CO o 4605 5032 5119 5236 5348 5471 5665 5758 5809 5865 5934 5969 6106 6209 6249 Local de Início em SEQ ID: 2 1885 2637 4015 4590 5017 5104 5221 5333 5456 5650 co !n 5794 5850 5919 5954 6091 6194 6234 Local de Paragem em SEQ ID: zzzz ζ ζ zzzzzzzzzzzz Local de Início em SEQ ID: 1 zzzz ζ ζ zzzzzzzzzzzz 3ro do oo CL LO CO o σ> 00 co ο mm co m co m σ> σ> m T- CO CO co co co m σ> co CM σ> m τ- Ο) co CM 00 mm co co co σ> Tσ> E oz E oo O σ>o σ> o σ> o σ> o ο σ> o σ> o σ> o σ> o σ> o σ> o σ> O σ> o σ> o σ> O σ> o σ> o σ> o σ> Petition 870260057655, dated 12 / 06 / 2026, p. 170 / 1268 163 / 343 Q “ O CO CO CO co σ> o T- CM co CO CO co σ> o σ ~ CM CM CM CM CM CM CM CM co co co co co co co co LU Z 00 00 00 00 00 co co co 00 co co 00 00 co 00 co co 00 ω co ” ira φ O 00 T- T- 96 65 58 13 co co 06 o 75 96 70 93 75 52 o 09 σ s© 0s 0 I_______ O 0 0 O 0 0 QQOO 0 o 0 <£ |— 0 O |— 0 0 QOO o |— l— 0 0 |— 0 q |— 0 O ooo I— I— 0 |— o 0 0 ra |— |— 0 |— o <£ 0 0 o |— o |— OO 0 o <£ 0 <£ 0 ω 0 0 |— O c <φ o 0 o O 0 ooo 0 o 0 q 0 0 Hl 0 0 o O 0 zo 0 o 0 I— I— I— |— σ |— o 0 0 oooo <£ Q 0 doo 0 Φ ω 0 0 CA ooooo 0 oo 0 0 AT 0 o 0 11 0 0 <£ |— 0 <£ <£ «ς-ζ 0 0 O <£ 0 0 0 o 0 oo Q ooo 0 o 0 0 o 0 <£ Q oqqo |— <£ <c <c <c <c 0 o o I— 0 0 0 « α re LU CM CM 00 CO |s^_ |s^_ |s^_ co o co LO CM o T- σ>σ> φ E 00 σ> CO σ> CM ooo co co 00 co CO [<««. ° Φ Q CO CO CO 00 σ> T- CM co CO σ> oo T- CM co CO CO CO CO CO CO co [<««. [<««. [<««. [<««.00 co 00 00 co 00 00 Loca gem φ E ™ Ό φ Q CO o CM CM CM co CO σ> 00 o CO co σ> CM CO 00 CO CM co T- co 00 CO CM σ> 00 co co co CO CO CO 00 σ> T- CM CM CO co σ> o T- CM co CO oq lu -1 — ω CO CO CO CO co 00 00 00 00 00 00 rà !2 L. ra σ 0. LU Φ ( / ) <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c . <c ξ e ra ω o c _l φ o) φ ° êi — 'o cf z q ‘="lu" -1 ê co σ>CO CO σ> T- co CO σ> T- co CO σ> T- oo 00 [<««. o co [<««. o co CO σ> co co σ> CM CO σ> σ> oo T- T- CM CM CM co co co co CO CO CO CO Φ Q. CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO EE oooooooooooooooooooo σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> zo Petição 870260057655, de 12 / 06 / 2026, pág. 171 / 1268 164 / 343 SEQ ID ON 841 842 co co 844 k) c φ Ό çao ΙΌ CO σ> co co co s© 0s Sequência cGACTGTGTGAGCAC 8826 8893 8961 Local de Início em SEQ ID: 2 8694 8811 co co co co σ> co e Para- SEQ ID: Local d gem em zzzz Local de Início em SEQ ID: 1 V / NV / NV / NV / N Número do composto 905623 905655 905687 905719 RJ what nj Φ SEQ ID NO co 845 846 847 co co σ> co 850 851 Si = o >1« 1.0 Φ s© 0s σ> CM CM CM oo CM o σ> co e2 c5 0 0 O 3 0 o 0 O C5 δ SEquê 0 ID NO Ο GTTCAAAAGCAGi CGAGGAATTCGA? TGTATAATAACC / s GTGCACTCATCC / o 0 ooo GATTCTGTGTGC' ο δ ο δ TGGACCTTCTGA / 05 (Λ 3 addressed: Parajem locale in SEQ ID: 2 TCM CO 00 CM CO co co CO z25 T-1 CO TCO2 O 05 3-10- Starting location in SEQ ID: 2 CO o co co o CO co sz 4766 9906 12708 12750 E φ EQ CO O of parage SEQ ID: 1 z σ> LU φ ( / ) T- -O was ϕ — Ο nz T- CO CO CO 00 O CM Tσ> CM co o σ> ΙΌ co E o .2 —I oz or E o de oo 5 η co o coco O J ο CM O coni cobi " E co ( / ) σ > σ > σ > σ > σ > σ > σ> Petition 870260057655, dated 12 / 06 / 2026, p. 172 / 1268 165 / 343 QO CM CO LO CO 00 σ> o T" CM co LO co co σ> SEC N 00 00 00 00 00 u 77 co co co co 80 84 58 Sequence CCGACGAGGGTCAGGA ACTCCATCCCAGGTTC CCATGGTACTGCTGGT III IGATGACCAGGTC CCTTCCCAATGCCTCG GCATGCGGTACTGACT TCCACCTGTTCACCAAGA CCACTGCTAGGCCACCAAGA TGCCAAAAGTCCCTAAC TTCCCTTATTGCAGGC Í 0 ooo GGCTGGGTCTGTAGTG GCTGCCTGACTGAGAT ACCCATCACATGACAA TACCGGGTAAGAGCGA GGCGGCGACAAGACAG le paraSEQ ID: CO 399 Í7Í7€ T395" T395" 8Z( Í79Í S6t 306 350 320 τΟ / Τ'» CM CM CM V / / CM CO CO IN CO co co CAJ co co V / CÜ Φ O co SO) -f σ — LU 1 ΓΊ Φ< / ) CM Ό e (.N CM CO CM J 00 00 o σ> CL) CM CL) 00 LN J with σ> U ) CO fr\ U ) or CL) with ϕ Q2 —I o CM T" CM T" CM T" CM T" CO T" CO T" IN CO T" CO T" CO T" co t— CAJ CO t— CO t— t— T— t— \AJ T— \AJ T— jaragem 2 ID: 1 CO 00 CO CM θ!ι LO oo co ΓΓ» co t— LO σ> r\ σ> ΓΧΙ o Φ LU σ ω 74 08 85 06 OT" OT" T" T" CM T" co T" T— t— CO t— 24( 25' 25( CM 28' râ E o -f σ .E LU φ Cf) T- -O e râ φ Q 731 793 00 CO 00 892 997 1049 1109 1200 1335 1395 1781 1872 co LO CM co co co oo LO 3544 '714 LO σ> 8 .2 —I o CN E oo _2 7Ί 'tí o CO CO 00 CO 300 332 364 396 co CM o co CM σ> )24 99( 00 00 120 152 184 CO t— co OO CO CO CO CO CO CO CO CO CO CO co IN CN Φ " E oz σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ>. Petição 870260057655, de 12 / 06 / 2026, pág. 173 / 1268 166 / 343 Q " O ο τ- CM with LO with [Xs-, OX [χ*". 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ω 5 .E o 00 τ- LO co σ> CM CO fXs_ LO 00 CO O 00 00 00 U CO- CO- T- CM 00 O) CM Ό s© 0s ο Ο Ο ο Ο O |_______ o 1- 0 0 | <c O 0 0 δ 0 0 CÜ ω Ο |— ο ο ή 0 0 o 0 <c o δ <£ 0 0 0 ω 0 ο I- ο o 0 0 0 0 0 c «D δ Ο 1— ο <ζ 0 1" o o 0 o 0 o R 0 0 <c 0 0 z ο 0 0 0 o l— 0 0 0 0 σ (.5 0 |— 0 |— O 0 o o 0 0 0 Φ ω δ 0 0 ο ο ο ο ο <c O 0 δ <c O O o 0 0 0 w. 0 η Ι— 0 ο Ι— 0 δ l— o |— 0 0 0 ο ο ο o 0 0 0 0 δ 0 Ι— o 0 0 Q o 0 |— 0 0 ο ο ο o o o 0 0 0 0 0 0 Q φ — ra σ Q. LU co CM ΙΟ σ> CO or [s-. σ> CM [Xs-, σ> or CO LO or 2 CM There) C ) <» U) T- C) CM CO CO U) T- CO C) [x·»-. T3 c 04 σ) Ο) co ο CO C ) T- CM C) CO [x·»-. 00 a> <» σ> _ c τ- τ- CM U) LO U) U) U) LO U) U) U) U) U) U) <o E _1 Φ O) -f σ .E LU Φ Cf) CM 00 [Μ-, ο σ> 00 uo CM |Xs-_ CM LO T- o LO Ό c .. σ> 00 α> <» T- o CM C) LO U) O) LO CM U) — EQ co 00 co ο LO o T- CM CO CO [x·»-. [x·»-. 00 O) σ> ra ϕ — τ- τ- CM U) LO U) U) U) U) LO LO U) U) U) 8 .2 —I o E φ o T. SQ ra " o. α <£ Φ LU ζ ζ zzzzzzzzzzzz σ ω râ E Ο ϕ ο -f σ .Ε LU φ Cf) τ- -Ο e Φ Φ — ζ ζ ζ ζ ζ zzzzzzzzz 8 .2 _ι ο Ε ο ο CM co co CM CO 00 o CM CO 00 o CM ο α> τ- ο C ) C) CO C ) C) CO <» CM CO O) CM ° (Λ CM co σ) co U) U) U) CO CO CO CO 00 Ο ο ο ο ο ο ο ooooo O oo O o OO φ 05 Ο) Ο) Ο) Ο) O) O) O) O) O) O) O) O) O) O) Ε ο ζ. Petition 870260057655, 06 / 12 / 2026, p. 174 / 1 167 / 3 Q " O oo CD O T- CM 00 UO CO Is*». CO CD O T- CM co uo OX CO 00 CD CD CD CD CD CD CD CD CD CD O o O ooo LU 2 00 00 00 00 00 00 00 00 00 00 00 00 05 05 05 05 05 ω £ .Ε o CM CO CM 00 T- CO 00 CD O CO O Is*». co Φ O CM CM Is*» CM Is*» 00 U) C) U) Is*» co C) 05 Ό *O 0s o Q Η 0 0 0 0 0 0 0 0 O 0 1— 0 0 0 0 |— 0 0 1— 0 O 0 0 0 0 0 0 0 0 0 1- 0 0 0 0 0 |— 0 0 0 0 <£ 0 ra oc 0 0 0 0 0 AGC 0 CTG ACA 6 0 0 0 0 GCT CCA CAG TGA V0£ δ 0 0 3AG <φ Q 0 0 0 0 0 O 0 I— I— I— 0 z σ φ O (} R o COA GGT GAT 0 AAC CAG FGG. 0 0 CTC iCTC 0 0 GCA 0 CCG L0VÍ 0 < / ) 0 0 0 0 «ς-ζ I— 0 0 kJ 0 0 0 <£ 0 0 0 0 0 0 0 0 0 0 o 0 0 0 0 0 l— 0 0 0 0 0 0 0 0 0 0 0 I— 0 0 0 QJ <c 0 0 0 0 0 I— 0 0 0 0 0 0 Q Φ — ra σ Q. LU Is*». o T- CM 00 CM CO o 00 co co CD T- CO Is*». Is*». co Φ V) o T- UO CM a> U) C 5 U) σ> CD CM o Is*» o C 5 T3 c 04 T- CM CM σ> σ> CO CO Is*» α> CD T- CM C) U) 05 C 5 _ c CO CO CO CO CO CO CO CO CO CO Is-* Is-* Is-* Is-* Is-* 00 U co E _1 Φ O) -f σ .E LU Φ Cf) CM CM U0 CO Is*». 00 CD Is*».T- uo CO co co co o CM CM CO Ό c .. CD 05 σ> o CO C) 00 00 C) CM a> T- σ> a> co σ> CD a> — EQO T- CM co 00 uo CO Is*» co CD T- CM CM CO 00 CD ra φ — CO CO CO CO CO CO CO CO CO co co Is*» Is*» Is*» Is*» Is*» 8 .2 —I o E φ cd T. SQ ra " o. α <£ <£ <£ <£ <£ Φ LU zzzzzzzzzzzzzzzzzzz σ ω râ E Ο φ o -f σ .E LU φ Cf) T- -O e ra φ — zzzzzzzzzzzzzzzzzzz 8 .2 -I o E o CO 00 o CM CO 00 o CM co co o CM co co o OOU) a> CM U) a> T- a> T- C 5 C 5 σ> co c_> tfí 00 00 05 05 05 o C 5 C 5 T- T- T- CM CM CM σ> σ> σ> ο OU) U) U) CO CO CO U) U) U) U) U) U) U) C o C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 Φ 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 E o z. Petição 870260057655, de 12 / 06 / 2026, pág. 175 / 1268 168 / 343 SEQ ID NO 906 907 806 σ> ο σ> 910 911 912 913 914 915 ,E ο 00 σ> 00 τ- co CM τ- σ> / 1» φ ο U) 05 U) τ- co CM CO σ> τ- σ sO 0s δ 0 0 ο 0 Ο 0 δ δ 0 0 — 0 0 δ 0 <ζ <c 0 ra ο c ο — I- ο 0 1— AT 0 ο TC 0 0 GA δ 0 <φ 0 δ 0 δ ω 0 0 I— 0 <c σ Ι— «ΤΤ ο ο Ρ η <-τ Φ ω δ TCC ΑΛΤ ο 0 0 0 ACA CAT ΤΤΑ< 001 ο Ι— Ι"" <-τ 0 |— ο < 0 0 0 AG' ον 0 0 δ ο δ ιϋ: φ σ Q. LU τ- τ- co ο 00 ο σ>CM CM 00 Γ'-- 00 05 ιη 00 τ- CM 05 CO __ Ε 00 00 00 00 00 00 00 00 00 00 Ο C ο E σ) -ρ σ .Ε LU Φ 0 CM co co τ- m co m CM σ> [χ^ 2 £ çj ο τ- CM co m 00 00 σ> 8 .2 tU —I ο E φ σι λ 2 Q ο. α <c <c <c <c <c <c <c <c <c <c φ LU σ ω ζ Ζ ζ ζ ζ ζ ζ ζ ζ ζ râ Ε ο -ρ σ .Ε LU φ (Λ τ- ocal d io em ID: ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ —I ο Ε ο ο CM co 00 ο CM co 00 ο Ο _9 7Ί ’tí σ) co 05 CM co 05 CM in 00 CM Ο Ο LO CO CO m m m m m m ιη φ " Ε σ> s> s> s> s> s> s> s> s> s> s> o z SEQ ID NO co τ- 916 o CM CM Φ o 00 τ- s© 0s 1_______ 0 CM CD ο CÜ 0 0 ο (Λ c 0 Ε Ο <φ □ 0 Ζ σ φ 0 Q ω 0 0 (J 0 LLI |— 0 ω 0 0 05 ο Ό rà 05 ra σ C Q. LU ο Ό CD φ ω 8321 523 S— CQ Φ Ό UC ο Ε CO 1 _1 Φ σ) ο ~ σ cEt 3- al de ir em SE ID: 2 co ο co 00 809 Ε ο 8 .2 —I ο Ο ( / ) Ε μ Φ τ- φ ο Ε g QQ ο. ο<c ο Ο φ LU σ ω ζ co S— ο Q Ο φ ο _| ο > ε σ η .Ε LU φ (Λ τ- ° Ε m de φ φ Q ο η ζ E ο .2 —I ο ζ 1 or C ο ιο de j do c DStO 3406 3417 »05 C η σ> ο CD φ |χ». 05 -Q Ε !Ξ ο Ζ Petition 870260057655, de 12 / 06 / 2026, pág. 176 / 1268 169 / 343 SEQ ID NO 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 % of in ção 47 o 279 27 5" 8 52 o T τ- Ο co co 96 77 50 Sequence 0 OO 0 o AGTGCACTCATCCAGA GATCTCCAGTATCTGT O 0 OOO 0 GTGGACCTTCTGAACC GCCGACGAGGGGTCAGG AACTCCATCCCAGGTT TCCATGGACCTTAGCTAGCTGCTGTT GGCATGCGGTACTGAC CTCCACCTGTTCACCG CTACATCCAGCACAAG CCGCCTGCAGAATCTT Illi GTCCTGGCCCCT ATGCCAAAGTCCCTAA TTTCCCTTATTGCAGG TATTCTTCCGTCAATA Ie paraSEQ ID: 82 CO CO 538 σ5 00( CO1>54 bt— t— 588 σ> 565 Ό g CO z 47 CM cxi CM CM V / / CM CM co co Ln co VJ co co UJ co CO co CÜ Φ O co EO) ​​-f σ - LU Φ< / ) CM Ό e σ> <£ 67 o CO VJ CM 00 UJ CO co σ> b IN σ> CM VAJ σ> L' J with UJ CO 75 Φ —2 —I o LO z cxi T" cxi T" MJ CM T" CM T" CM T" CM T" CO t— co t— IN CO t— IN CO t— CO t— CO t— MJ CO t— CO t— VJ t— E Φ T- de paraç SEQ ID: T- 224 307 CO CO CO 675 747 σ> o 00 854 806 1014 1065 1125 1216 1351 1420 1797 1888 2274 Local em Local de início em SEQ ID: 1 56 209 292 618 o CO CO 732 794 σ> CO 00 893 σ> σ> σ> 1050 1110 1201 1336 1405 1782 1873 2259 E oo 5 7Ί 'tí 149 T" CO CO T" T" P / L 573 CO o CO 692 τΟ 533 565 597 σ> CM Τ- Ο 86( 525 Z9C 68( OO CO CO CO VAJ CO CO CO CO CO CO co co co co co co co co Φ " E oz σ> σ> tJ σ> tJ σ> tJ σ> tJ σ> σ> σ> tJ σ> tJ σ> tJ σ> tJ σ> σ> tJ σ> σ>. Petição 870260057655, de 12 / 06 / 2026, pág. 177 / 1268 170 / 343 Q " O uo CO 00 σ> O T- CM CO uo CO 00 σ> o T- CM OX CO 00 00 00 00 uo uo uo LU 2 CO 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 ω 5 o (O 00 σ> CO CM O |S^_ CM CO σ> UO Φ o 00 U) U) 00 C) U) T- CO Is-·. CM C) Is-·. uo s© 0s 0 0 0 0 0 0 0 CD 0 0 0 0 0 0 0 0 O 0 OJ— 0 0 0 0 0 0 0 0 |— 0 0 |— 0 0 0 0 0 0 0 |— 0 0 CO CD 0 0 CD 0 (QO l— J— 0 0 0 0 J— I— 0 0 0 O c O oo 0 CA 0 0 0 0 l= 0 CA 0 0 0 0 0 δ «D 0 |— 0 0 0 0 0 Z 0 J— o 0 0 0 l— 0 «ς·ζ 0 u 0 σ φ oo IV 0 (Π 0 0 δ 0 0 0 0 0 Q 0 0 0 0 0 oo < / ) 0 o f X 0 0 0 0 0 0 |— |— δ |— |— 0 CD o o ( X o 0 0 ( 1 0 0 0 0 0 o 0 0 |— 0 0 0 0 0 0 0 0 0 0 |— 0 0 0 0 0 o 0 I— 0 0 0 0 0 0 0 0 0 0 Q CÜ — ra σ Q. LU Φ ω T3 zost o CO Ti£> CO T- CM 00 CM O σ> CO CO 354 CO CO 903 721 o CO o 622 034 121 248 350 473 00 CO CO _ c CÜ Φ T- T- T- T- T- T- T- CM uo uo uo uo uo U) ü co E _1 Φ O) -f σ .E LU Φ Cf) CM ° z — c Q 1492 CM σ> LO CO CO CO CO o 00 00 00 T- LO 339 T- LO 00 00 00 706 045 607 019 106 233 335 458 653 ra φ — 8 .2 T- T- T- T- T- T- T- CM —I or E Φ T- or SQ ro —. CO CO Π Π T- o. O T- T- CO CO T- φ LU σ Cf) CM LO CM LO CM CM 00 CM zzzz Z zzzzzzzz râ E Ο φ o -f σ .E LU φ Cf) T- T- T- LO LO CO O eoo T- 05 ra φ — eü LO CM LO CM CM CM zzzzzzzzzzzzz 8 .2 —I o E o T- 00 UO |S^_ σ> T- CO uo |s^_ σ> T- CO uo σ> T- CO uo OO CM U) 00 T- 00 T- Is-», o Is-», C 5 CO CO o σ> CO ° (Λ T- T- T- CM CM CM CO C) CO U) U) U) CO CO CO O ooooo OOO oooooo O ooooo Φ 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 E o z. Petition 870260057655, 06 / 12 / 2026, p. 178 / 1 171 / 3 Q " O CO IO CO Is—» 00 σ> O T- CM CO IO CO Is»», CO σ> OOX 10 IO IO IO IO IO IO CO co CO CO CO CO CO CO CO co Is-». LU 2 05 CO 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 σ> ω £ o [-»». T- IO 00 IO CO |S»» CM T- IO σ> IO IO Φ o CO Is-. 00 T- C) T- co T- C) Is-·. CO σ) LO CM s© 0s Q o 0 0 0 I— 0 0 0 0 0 0 CD CO 0 J— 0 0 0 0 0 O 0 0 0 0 0 0 0 0 I— CD 0 0 0 0 0 0 0 <£ 0 0 |— <£ 0 CÜ 0 0 0 0 0 0 0 J— 0 0 0 0 0 0 0 0 I— 0 0 V ) 0 0 0 Q 0 0 0 0 0 0 0 CD «D 0 0 |— <£ |— |— 0 0 0 0 CD 0 0 0 Z o 0 0 0 δ 0 0 CD 0 σ o 0 0 0 0 0 0 0 0 0 Φ o 0 0 0 0 0 0 0 C / í 1— 1— l— l— 0 0 0 0 0 0 CD 0 0 0 1- 1— 0 0 0 0 0 0 0 co 0 0 0 l— o J— 0 0 0 0 0 0 0 ω 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Q CÜ — ra σ Q. LU o T- [s»» CO T- co T- CM co Is-» CO Is-» T- σ> σ> σ> o 2 CM CO T- CO σ> Is—» ο T- LO CM a> CM C 5 LO σ> <» CM LO 73 c04 CO a> <» σ> τ- CM CM σ> σ> LO CO co Is-», a> <» T- CM _ c LO LO LO LO LO co CO CO co co CO CO co co co co Is-- U co E _1 Φ O) -f σ .E LU Φ Cf) CM LO CO CM T- CO co CO |S»» co σ> CM CO CM co IO 73 c .. 05 LO CM LO <» 05 co C 5 co T- a> σ> C) CM a> T- σ> — EQ Is-». Is—» CO σ> σ> ο T- CM co co IO IO co Is-», CO σ> T- CM ra φ — LO LO LO LO LO co co CO co co co co co co CO co Is-». 8 .2 —I o E Φ T- o SQ ra ~. o. O Φ LU zzzzzzzzzzzzz 73 Cf) râ E Ο φ o -f σ .E LU φ Cf) T- -O e ra φ — zzzzzzzzzzzzzzzzz 8 .2 —I o E o [-»». σ> T- C0 IO Is-» σ> T- co IO Is-» σ> T- CO LO |s»» σ> T- OO σ> CM CO . <y>CM I α> CM LO a> T- co T- Is-». C 5 tfí CO Is—» 00 00 co 05 05 05 o C 5 C 5 T- T- T- CM CM ο O LO LO LO LO LO LO LO C o C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 Φ CO 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 E oz Petition 870260057655, 12 / 06 / 2026, pág. 179 / 1268 172 / 343 SEQ ID NO 971 972 973 974 975 976 977 978 979 086 981 982 983 984 985 © Ο co 00 τ- CM co ra CD co © CD © Λ» Φ ο co CM CD CO Is·— 05 Is— Φ © © © © S© 0s 0 ο I_______ Ο 1_______ 0 O 0 H 0 0 Η I- ο _ <1^ 0 I- 0 0 I- 0 — ο I— o δ 0 ra ο C <φ ζ AGCATT ο 0 ACCTCA 0 0 TACAGA 011101' CACTAT AAGCAG δ oo δ o TGAAGT TAAGAAi δ δ 0 0 ATAAGA σ φ ω OV0 CAT( GAG ο ο 0 δ Ο 1= CAA i GAG I— 0 0 0 δ TGC 0TC The CAA 0 0 0 CAC 3AAI 1= 0 0 0 0 0 CTA 0 δ δ CAT <c <c 0 <c Ο Ο 0 0 < o O 0 Ο ιϋ: φ σ Q. LU φ 00 © CM φ CM τ- CD T- © © © φ £ CM ο ο ο © Is— CM σ>© ra φ φ φ __ E 00 © 00 © co CO ra co © © © Ο C ο E σ) -ρ σ .Ε LU Φ (Λ CM σ> τ- CD co ο © φ φ co ο Ο © 2 £ çj CM (. M 00 © CD Ο τ- CO co © © © σ> 8 .2 —I ο E Φ τ- g Q Q. Ο <c <c <c <c <c <c <c <c <c <c <c <c <c <c <c φ LU σ ω ζ ζ ζ ζ ζ ζ ζ ζ ζ z z z ζ ζ ζ râ Ε Ο φ ο -ρ σ .E LU φ Cf) τ- ocal d io em ID: ζ ζ ζ ζ ζ ζ ζ ζ zzz ζ ζ ζ —I ο E ο ο co © (D τ- co © CD T- co © CD τ- Ο _9 7Ί 'tí ο φ CO ο φ co CD CM Φ CM © © CM Ο Ο © © © © © © © © © © © © © © © © © © © © © φ " E CD CD CD CD CD σ> σ> σ> CD CD CD σ> σ> σ> σ> ο Z. Petition 870260057655, de 12 / 06 / 2026, pág. 180 / 1268 co — co m QPO with co with σ> or T" CM with m with σ> SEC NT" σ> laj σ> σ> σ> σ> σ> σ> σ> σ> σ> LO 7 % with CO in 02 ção T" 42 37 τ- CM 87 co co 53 co co τ— CO SEQ ID NOs: 1 e2 Sequence GTTCAAAAGCAGCATT ACCGAGGAATTCGAAA OO 0 O 0 o AAGTGCACTCATCCAG GGATCTCCAGTATCTG TTATCGAGGTTAGCCCCTCAAG CAACTCCATCCCAGGT AGTCCATGGTACTGCT GO III IGATGACCAGG TGTCCTTCCCAATGCC GAGGCATGCGGTACTG TCTCCACCTGTTCACC AGACTACATCCAGCAC ro o Ό ro co Ie para- Q σ lu ω CM T" 6 CM Í co oo Z1932 158 T— Ο τ— o (DEC) with mz 47 CM CM CM CM CM co co co LN co co )-3 dir CO OO gem ε it 3-1C Έ φ σ σ LU ( / ) CM 06 σ> CM255 co co o82 392 Ο 143 30c m σ> LU O § Q co co mmz CM CM CM CM CM CM co co co co E oooo O aapmers c de paragem SEQ ID: 1 V / NT" 1126 1219 .1 per Local < em I \m de APOL Local de ini- cio em SEQ ID: 1 V / N CO T" 59 210 293 619 661 733 795 841 894 1000 1052 1111 1204 z or E o de oo 5 7Ί 'tí co o CO T" ost CM CO T- 542 574 co o co co o 502 534 566 598 08( O ( / ) oo co co co CO U ) co co co co co co co co co co co co Inibiçí Φ " E oz σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ>. Petição 870260057655, de 12 / 06 / 2026, pág. 181 / 1268 174 / 343 SEQ ID NO 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 Jo % in 764 963 65 T- CO 55 49 74 o co co mo σ> 76 29 T- Sequence TCCGCCTGCAGAATCT AI II IGTCCTGGCCCC TGGAAATGCCAAAGTC CAGTTCCCAI IIII CO O 0 O oot= δ AGGACATTGAACCTGG CCGCTGACCGACCGATCGATCGATC CTTACCGGGTAAGAGC TGGGCGGCGACAAGAC ACCAAGCACAGCAAAC ACCATTCTGCAACGCA GGAGGCAGGTCAACTG TGACCACCTGTCTTGG GGTGCCTCGGATTCCC GTGCTCAACTCTTCAT CCAAGACCAACCTAAA CGTGTCACCCTAAGGA d de paraim ID: 1313 SEQ: 134 13893 13990 14366 14508 14608 14652 14822 14903 472 1356 670 2066 2731 4067 o co co 5035 O c ο E CD Starting location in SEQ 13428: ID 13428 13878 13975 14351 14493 14593 14637 14807 14888 457 1341 655 2051 2716 4052 4615 5020 E Φ T- of parac SEQ ID: 1899 2275 2417 2517 2561 2731 2812 V / NV / NV / NV / NV / NV / NV / N Local em -f σ — LU φ ( / ) T- co o CM CM co co Local ( cio em ID: CO T- co 2 2 2 2 2 2 CM ( 25 ) m ( 27 27( 5 5 5 5 5 5 5 E oo 5 CM co σ> )26 89(06( 122 154 co co CO T- om CM 00 co co o 142 506 ( / ) or CO co IN IN Φ σ> σ> Petition 870260057655, dated 12 / 06 / 2026, p. 182 / 1268 175 / 343 Q 00 σ> O T- CM CO in CO Is»» OO σ> O T- CM CO m CH ο T- T- CM CM CM CM CM CM CM CM CM CM C) co C) C) C) C) ιϊι Z oo O C_> C_> C_> C_> c_> C_> C_> C_> c_> C_> c_> C_> C_> c_> c_> LU T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- ω £ .E ο CO T- T- co |s»_ co co co |s»_ CM CM mm CM φ t* T- m Is»». T- Is»» T- CM CM C<) 0) σ 0s o 0 C) 0 0 0 0 |— 0 0 0 0 0 CD 0 0 CD o 0 0 |— () H 0 0 0 0 0 0 0 0 CÜ o CA 0 0 0 1- 0 0 0 0 0 C) δ 0 CD 0 0 0 0 0 0 δ õ co <3^ 0 0 0 0 δ 0 i 111 0 0 )11 0 0 0 0 0 0 0 <φ I- 0 0 0 0 0 I— CD 0 o 0 0 z 0 0 0 0 C) 0 0 0 C) σ 0 0 |— 0 0 CD 0 <£ 0 0 0 0 Φ ω o 0 0 0 0 0 0 0 0 iwi 0 0 0 CD 0 0 0 0 0 0 0 ACA CCT TGG o 0 0 0 CD 0 0 0 O 0 0 o 0 0 0 Q_J 0 0 0 |— 0 0 o 0 0 0 0 0 0 Q φ — ra σ Q. LU CM σ> T- m σ> CM CM co o CM σ> CM co in m σ> m co 2 CM CM in Is»» co CO T- co T- T- in σ> a> CM C 5 T3 c 04 T- CM σ> co OO a> C» σ> T- CM CM σ> σ> in co co _ c LO U) U) in in m in in in in in co CO co co co co co U <ο E _1 Φ CD -f σ .E LU Φ ( / ) CM |s»_ co o |s»_ |s»_ co m |S»_ |s»_ co ooo co T3 c .. o σ> σ> co in σ> in CM in c_> σ> σ> CM Is»» T- C» σ> — EQ T- CM co co Is»» Is»» co σ> σ> T- T- CM co co in m co ra φ — LO U) U) in in mm in in in co co co co co co co 8 .2 —I o E φ T- σ) SQ ra ~. about Is»» C 5 σ> co C» C) CO 05 CM in C» CM in a> T- in a> tfí U) LO CO co co co Is»» Is»» 00 co 00 05 05 05 o C 5 C 5 ο O in in in C o C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 Φ 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 E o z. Petição 870260057655, de 12 / 06 / 2026, pág. 183 / 1268 176 / 343 Q (Ο Is*». co σ> ο τ- CM co m co Is-» co 05 ο τ- CM co CH ο σ) co σ) σ) ιη m in in ιιι Z o o o o o o o o o o o o o o o o o oo LU τ- τ- τ- τ- τ- τ- τ- τ- τ- τ- τ- τ- τ- τ- τ- τ- τ- T- T- ω Z .Ε ο ο Is*». Is*». co co m ιη co 00 CM ο co ο co P»». / 1* φ ο 05 00 Is—. η τ- 00 05 η 00 05 co co in 00 σ S© 0s 0 Ο 0 0 0 0 0 0 Ε 0 0 |— 0 0 <£ 0 0 |— η— 0 η— <1^ 0 η_ 0 0 0 0 1- 0 0 0 0 0 0 0 0 0 0 0 0 0 Ι— J— |— 0 0 Ε 0 Ο c 0 0 0 0 Ο CT CT 0 0 CA 0 0 0 0 δ 0 0 0 0 1— 0 0 0 <φ 0 J— Ι— 0 J— 0 0 I— <1^ ζ σ 0 (Π ΤΟ 0 0 0 0 0 δ 0 0 1— 0 0 0 ω I— 0 0 0 0 δ 0 0 Ι— 0 0 0 0 < / ) 0 0 0 0 0 0 Ι"" <(* 0 0 0 0 0 |— 0 0 0 0 0 δ 0 0 0 0 0 0 0 0 0 0 0 <Γ 0 ο 0 0 0 0 0 0 0 0 0 0 0 0 0 Q φ — φ σ Q. LU ο ο ο τ- ιη τ- m CM co co co CM ο CM 05 co Ji CM U) C 5 σ) ιη C 5 00 σ> C 5 α> Is-» CM 05 co α> 05 05 Ο = CM Is*». α> ο τ- CM σ) 00 05 C 5 C 5 τ- σ> σ> in Is-». a> _ C co co Is-. Is-. Is-. Is-. Is-. 00 00 00 00 00 00 co 00 co UC ο E _1 Φ σ) -ρ σ .Ε LU Φ (Λ CM σ> IT) ιη m co ο co ο [-» τ- 00 05 co [S-» m [S-» T- Ο r- .. s) CM a> t- s> 05 co s> t- s> co ir C 5 Is-». co CM CM — E Q Is*'. co σ> τ- CM CM 00 σ> σ> o τ- co co in CO φ φ — co co co Is—» Is-» Is-» Is-» Is-» 00 00 00 00 00 co 00 00 8 .2 _ι o Ε φ τ- σ> SQ φ ~. o. O Φ LLJ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ zzz σ ω φ E Ο φ ο -ρ σ .Ε LU φ ( / ) τ- -Ο e Φ Φ — ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ ζ zzz 8 .2 _ι ο E ο co 00 ο CM co 00 ο CM co co ο CM co co ο ο τ- Is—» τ- Is—» C 5 σ> Is-» Ο σ) co 05 σ> CO 05 CM in tfí τ- τ- τ- CM CM CM σ> σ> co ιη in in CO co ο ο ΙΓ> in m ιη in ιη ιη ιη ιη ιη ιη in in ιη in in in in C ο ο ο ο ο ο ο ο ο ο ο ο ο ο ο ο ο ο 05 05 φ 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 E the Z. Petition 870260057655, de 12 / 06 / 2026, pág. 184 / 1268 177 / 343 SEQ ID NO 1054 1055 η = ο o CD / 1* Φ ο 05 CM χθ 0s \TA 0 I— 0 ra ο o 0 <ζ C <φ 0 <ζ ζ ο σ φ I— 0 ω .V01 CAT' 0 Ο 0 1D: φ σ Q. LU CM co σ> co _ Ε co CO Ο C ο Ε σ) -ρ σ .Ε LU Φ ( / ) CM X- CD J Ε Q co CD 8 .2 —I ο Ε Φ τ- g Q Q. Ο <c <c φ LU σ ( / ) z z râ Ε Ο φ ο -ρ σ .Ε LU φ ( / ) τ- ocal d io em ID: z z —I o E o o 5 o CD CM CM w ( / ) O o LO m Φ " E CD CD o z CXI (D SEQ ID NO 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 ri % of in ção CO X- X- in X- 24 X- CO 58 49 o X- 24 CAGGATTCGATC Sequence TACCTA AAAGTGCACTCATCCA AGGATCTCCAGTATCT CTTATGTTATCCTCAA TTGTGGACCTTCTGAA ATGCCGACGAGGGTCA GATTCCCAACTCCATC TAGTCCATGGTACTGC AGGCI III GA IGACCA D: ra Q. o Z σ lu 2 X9 €8 CM4 LO Ό E LO LO z 47 oi X- oi X- CM X- CM X- CM X- CO X- oo E CD Έ φ Ό σ LU ( / ) CM o CO CD CO XX- co LO 525 592 533 Z8( ra oo § Q oo X-LO CM X- CM X- o mz X- D: ra Q. Φ SEQ II CM co co CD LO CD co X- Local gem 1 C) 00 CM CO CO co co co co CD 'c σ ϕ Ό CO X- co X- o CM X- CM X- 543 575 O CD CO X- 503 ( / ) OO co co CO co Xi- / co Xi- / co CO CO co co Φ " E 'Z z CD CD CD CD CD CD CD CD CD Petition 870260057655, dated 12 / 06 / 2026, p. 185 / 1268 178 / 343 SEQ ID NO 1066 1067 1068 1069 1070 1071 1071 1072 1073 1074 1079 1079 1080 1081 1082 CM 1080 CMão % of CO 00 57 90 90 CM cd 62 48 co 00 49 σ> co o σ> τ- CO T- Sequence ATGTCCTTCCCAATGC TGAGGCATGCGGTACT ACCCTCTCCACCTGTT TAGACTACATCCAGCTATGAGCACTGCAGAATC TCCAGTTCCCAI IIII CTCTCTATTCTTCCGT GGAGGACATTGAACCT GCCGCTGCCTGACTGA CAGTGTTCAAGCAGGG ACTTACCGGGTAAGAG CTGGGCGGCGACAAGA GACCAAGCACAGCAAA CACCATTCTGCAACGC CAATCAGACTCAAGCC5e CGTGACCAC5 para ICMQTTGACCACGG TT- o CD CM cd oo T- σ> om σ> 323 o co !n CM co co co T- CO T- (. σ> or σ> CM (. N σ> (. N 00 UJ m UJ σ> σ> LJ 00 IAJ o co ίΥΊ 00 CM co m 75 Φ — 8 .2 —I o CO T- co T- (. N CO T- (. N CO T- 1- D: ra a Q. LU φ ( / ) with 00 or with T- cd σ> 00 CM with Ξ E Ó T- or T- VJ TT- (.N CM T- co T- T- LJ CO T- σ> T- CM CM 24' 25' 26C VJ CM 28' zzzz O c ο E CD -fa .E LU φ ( / ) T- T- co mm co T- Trv» co P / L co σ> 00 φ Q oo T- LJ CM co 00 UJ CM LJ m IAJ mzzzz 8 .2 —IO (N (N (N (N (N (NE oo 5 7Ί 'tí 335 367 399 T- CO co 96( )27 69( Tσ> 123 155 187 σ> T- T- LO co 00 m T- 347 σ> ( / ) oo co co co co co co (N (N \· J Φ " E oz σ> σ> σ> LJ σ> σ> σ> LJ cd LJ cd LJ σ> σ> σ> σ> LJ σ> LJ σ> σ> σ> LJ σ> σ>. Petição 870260057655, de 12 / 06 / 2026, pág. 186 / 1268 179 / 343 Q m (O Is—, 00 σ> Ο T- CM CO in CO Is—. CO σ> o T- γϊ O a> a> a> 00 a> α> <» σ> <» <» <» <» <» σ> <» <» c_> o iíi Z ooooo ο Ο oo O oo O o O o T- T- LU T- T- T- T- T- τ- τ- T- T- T- T- T- T- T- T- T- T- T- ω £ .E oo (O LO CO CM 00 co co what o what T- Φ OC) CO T- U) T- σ) Is—. C) co 05 co co in T- T- Ό -O 0s 0 0 0 0 0 0 CD 0 0 0 0 0 0 0 0 |— 0 |— 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 (D o 0 0 0 I— 0 0 0 CD 0 0 CÜ l— 0 l— 0 0 0 0 Q 1— 0 0 0 ol— 0 l— 0 0 0 0 1— 0 0 0 l— 0 0 Q 0 CD 0 0 <φ 0 0 0 0 0 H 0 0 CD z 0 0 0 |— 0 1— 0 0 0 0 0 0 σ 0 0 0 I- Ι— 0 0 0 0 0 Φ 0 l— 0 0 0 0 I— 0 o 0 ( 1 < / ) l— 0 0 0 0 0 0 0 |__ 0 0 0 0 0 0 0 0 0 0 0 CD 0 0 0 0 0 0 0 0 0 0 0 TC 0 0 0 hi 0 0 W 0 Q 0 0 0 0 0 0 0 0 0 0 0 0 0 Q CÜ — ra σ Q. LU (O (O CO CO CO ο CM co o CM co σ> T- co T- co [S-. co 2 CM C) <» CO σ> CM U) in Is—. T- co Is—. CM T- in σ> T3 c 04 o CO C 5 T- CM σ> co Is—. co a> <» σ> T- CM CM σ> _ c CM U) CO U) U) CO CO m in in in in in co CO co co U <o E _1 Φ O) -f σ .E LU Φ Cf) CM T- T- 00 T- 00 ΙΟ |s—, T- m |s—. co co co co CO CM T- Ό c .. CM CO CM o σ> co co in m 05 in CM in c_> 05 CM — EQ o CO O T- CM co co Is—. Is—. what zzzzzzzzzzz ra φ oco E _1 Φ O) -f σ .E LU φ Cf) T- -O e ra φ — zzzzz ζ ζ zzzzzzzzzzz 8 .2 —I o E o T- CO CO [s-. σ> τ- co in [S-. σ> T- co in [S-. σ> T- co in OO T- Is—. o σ> Is—, C 5 σ> co <» co co 05 CM in σ> CM in ° (Λ U) U) LO CO co co co 00 co co 05 05 O ooooooo Ο CO co co co co co co CO co co Φ CO CO 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 E o z. Petição 870260057655, de 12 / 06 / 2026, pág. 187 / 1268 180 / 343 Q CM CO in co |x«-. co cd O T- CM co IO CO |x«-. 00 CD Cf θ O C_> c_> c_> c_> o c_> c_> T- T- T- T" T- T- T- T- T- T- HI Z T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- LU T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- T- ω 5 .E o in T- T- CM o co CM CD in CM CD co Φ O co co Is»-. cd CO C) CD CD co CD CO U) Ό s© 0s 0 |. |—— () 0 0 0 |—— 1— o 0 0 0 0 0 0 o |— |— ci 0 0 o 0 0 0 0 0 c5 0 0 0 co 0 oc «D ;gat GAA GAG GAT< ACG 0 0 iCTC 0 0 GAG 0 0 GAG TTGi 0 1V0' GCA AAA( 0 GAG z 0 |— 0 I— 0 ^|** H σ 0 0 0 0 0 0 0 0 0 k 0 0 0 Φ ω o 0 0 0 1= AT 0 0 0 0 0 δ 0 0 0 0 δ ill 0 o 0 0 0 0 0 0 0 0 0 0 0 0 0 C) 0 0 0 0 0 0 0 0 0 |— |— 0 0 0 0 <ci 0 0 0 0 0 0 o 0 Q φ — ra σ Q. LU (O [X-^ cd in T- T- T- CM co CM co co [X-. in LO co co 2 CM a> o U) o co U) C 5 00 σ> CD a> |x«-. CM CD co T3 c 04 σ> co co |x«-. a> c_> T- CM C) 00 CD C 5 C 5 T- σ> σ> _ c co co co co co Is-·. Is-·. Is-. Is»-. Is»-. Is»-. 00 co co co co co U <o E _1 Φ O) -f σ .E LU Φ Cf) CM τ- CM o co co co [X-. T- |X-^ co co CM o CD CD co co Ό c .. [X»», CD σ> CM a> T- co cd co σ> T- CD |x«-. co C 5 |x«-. — EQ CO in co |x«-. co cd T- CM CM co CD CD CD T- co co ra φ — CO co co co co co |x«-. |x«-. |x«-. |x«-. |x«-. co co co co co 8 .2 -I o Q Φ - ra σ Q. LU φ Cf) <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ ° E zzzzzzzzzzzzzzzzzzz ra φ oco E _1 Φ O) -f σ .E LU φ Cf) T- -O e ra φ — zzzzzzzzzzzzzzzzzzz 8 .2 —I o E o [x-. T- what LO [X-. cd T- co iO [X-. CD T- co in [X-. CD T- co o o co in a> T- |x«-. T- |x«-. o σ> |x«-. G> C) co CD co co tfí co C 5 C 5 T- T- T- CM CM CM σ> σ> co U) U) oo U) U) IO IO IO U) U) U) U) U) U) U) U) U) U) U) U) C ooooooo OOO oo CD CD CD CD CD CD CD Φ co co co co co co CO CO CD CD CD CD CD CD CD CD E o z. Petição 870260057655, de 12 / 06 / 2026, pág. 188 / 1268 181 / 343 coSEQ ID NO 1120 1121 1122 1123 1124 Si % of ini ção 34 24 T- 92 46 Sequence GCCAGATGTTGAAGTC GTCCTATTGTAAGAAC ACTCAGGTGACTACAT GAGTCATTAGTiTTGGCATAT CAGCCA Z6Í 99( _ E with KAJ CO with UC ο E CD .E LU Φ ( / ) CM with CM CM T- EQ LU IN with CO U ) σ> 8 .2 —I or ten ten ten N start in SEQ ID: 1 V / NV / NV / NV / NV / NE oo 5 m σ> 527 559 Tσ> co CM ( / ) oom KU m KU m LU m in Φ " E oz σ> σ> σ> σ> σ> SEQ ID NO with T- 1125 1126 1127 1128 1129 1130 Jo % of inch 84 m 70 65 09 90 76 1 e2 ra \GCATT 0 O FTATGC OOOO 0 'ATCQJ ID NOcados a VOO1O1 Í 0 ATACCGAGGA / CCACCTCCAG' AAAAGTGCACI GAGGATCTCC / CTTCTTATGT1 TTTGTGGACC1 il de paraim SEQ ID: 2 8321 526 582 4520 4785 12729 13 de-cíccE gemε l-3 em SEQ ID: 2 co o co co 511 567 4505 4770 12714 12754 .1 oor aapmers. SEQ ID paradigm location: 1 V / N coco coco σ> co 227 310 coco coco coco \m of APOL Start location: 1 V / N coco T- co co co KU co KU co Inhibit Φ " E oz σ> σ> σ> LU σ> LU σ> LU σ> Petition 870260057655, dated 12 / 06 / 2026, p. 189 / 1268 182 / 343 SEQ ID NO 1131 1132 1136 1137 1138 1139 1140 1140 1140 1141 1142 1143 1143 1144 1144 1145 1145 £ 1146 1147 Tão 125 % in 4 co 78 48 co co 70 94 62 73 49 σ> 00 54 92 47 53 Sequence CATGCCGACGAGGGTC CTGTGATTCCCAACTC GTAGTCCATGGTACTG AAGGCI III GA I'GACCCT GATCCCTGACGACCAATG GTAGACTACATCCAGC GGTCCGCCTGCAGAAT GGGTCAAAAGCGATGG AGCTATGGAAATGCCA TCTCCAGTTCCCATTT O δ δ δ Ο δ Ο 0 CGGAGGACATTGAACC AGCCGCTGCCTGACTG IAGGTAAGTACTTCAACCAGCAGG paraSEQ ID: > T- TT- 349 co o 108 160 CM CM CM 9W CM 398 1z6€ co ττι ΓΊ Ο τ- 396 324 mo Ξ E IAJ CM O CM CMΞ co cÜ co CO^ co Φ co U -fa .E LU (Ts 1 ΓΊ Φ ( / ) CM Ό and LLJ CM LLJ σ> CO with σ> bb co b I,' i with ΓΤι with LLJ σ> U ) σ> ι rS co o σ> CM o 85-CM Φ CM T- CM T- CO T- co U) co uy τ- T- IAJ T- IAJ T- 1- ID: ra σocal de p jm em SE 1 750 820 858 912 1017 1069 1131 1221 1354 1721 1807 1903 2285 2420 2519 2605 co 273 T-φ fa 2814 CD σ> with CM with ο with σ> ϕ Q 73 08 84 68 OU ) or CM with with CM ΓΧΙ m ΓΧΙ m MJ CM 09( 36( 124 156) co co o CM CM m ( / ) oo co co co co co co co co IN IN Φ " E oz σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ>J σ> σ> L σ> σ> L_J σ>. Petition 870260057655, dated 12 / 06 / 2026, p. 190 / 1268 183 / 343 Q cd o T- CM CO m CO Is*». 00 CD O T- CM CO ιη CO Cf θ U) m U) U) U) U) U) m U) U) CO CO CO CO co co CO HI Z T- T- T- T- T- T- T- T- T- T- T- T- T- τ- τ- τ- T- LU T- T- T- T- T- T- T- T- T- T- T- T- T- τ- τ- τ- T- ω 5 .Ε oo cd CM CD Is*». CO m CO CM T- CO o Is*». co Is*». Φ O T- CM CM U) CD T- CO T- CO CO U) 00 05 CM CD Ό *O 0s 0 QOOQ o 0 oo 0 t OQ 0 δ O 0 O 0 0 o 0 W. δ δ 0 1— 0 0 O 0 0 Q Ο Ο cc CÜ o V0 0 0 0 0 0 δ δ ω ro 0 δ O δ Õ δ iTT ü o 0 0 δ 0 OO 1— δ ? o o O δ Ο 0 δ 0 «D o O δ δ 0 0 0 0 δ 0 Ο Z 0 o Q 1— O I- J— 1— 0 ο Ο σ |— 0 o PJ— o 0 0 0 o φ oo 0 0 0 0 O ο ο 0 < / ) o o 0 o — (D |— 0 o 0 ο ο 0 ο 0 o o Q ω — 0 o o ω 0 ο J— o — |— 0 0 o __ 0 0 ω o Q o o o o o 0 o <£ ο — <£ o 0 o 0 0 o o 0 0 0 ο 0 0 Q CÜ — ra σ Q. LU CO CM CO m CM Is*». T- CO Is*». T- m ο CM φ cn U) U) c > T- «) co CM m U) Is*». Is*». Is*». τ- Is*». Is*». T3 C 04 CO CO CM CO o T- CM CO CO Is*». 00 00 CD CD _ c T- CM CM U) m U) U) U) U) m ιη ιη in in U <o E _1 Φ O) -f σ .E LU Φ Cf) CM CO Is*».CO O Is*». CM CD CO 00 CM CO ο CD m Is*». CD Ό c .. CO 00 C 5 CO CM o σ> σ> CO U) co 05 ιη CM in — EQ CO Is*». CM CO O T- CM CO CO Is*». 00 CD CD φ Φ — T- CM CM U) m U) U) U) U) mm ιη in in 8 .2 —I o AQ CÜ — ra σ Q. LU φ Cf) <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ ° E ra φ oco E _1 Φ O) -f σ .E LU φ Cf) T- ° P ra φ Q zzzzzzzzzz ζ ζ zz 8 .2 —I o E o CO 00 o CM CO 00 o CM CO 00 ο CM co co ooa> T- a> T- C 5 C 5 σ> CO ο σ) every 05 CM ° (Λ CM CO C) C) U) U) m CO CO CO 00 O oo δ δ δ δ CD CD CD CD CD CD CD CD CD δ ο δ δ δ Φ 05 CD 05 05 05 05 05 05 05 05 05 CD CD CD 05 05 05 05 E o z. Petição 870260057655, de 12 / 06 / 2026, pág. 191 / 1268 184 / 343 Q Is»» CO σ> O T- CM CO m co Is*». co 05 05 T- CM CO Cf θ CO CO CO Is*». Is»» Is*». Is*». Is*». Is*» Is*» Is*» 00 co 00 00 co Hl Z T- T- T- T- T- T- T" T- T- T- T- T- T- T- T- T- T- T- LU T- T- T- T- T- T- T" T- T- T- T- T- T- T- T- T- T- T- ω £ .Ε o CO ohm CO Τ" CM CO 05 |S»_ 05 05 05 co CO 05 |S»_ Φ O CO U) CO 05 co CO Is*» 00 Is*» CM 00 05 U) T- 05 co σ *O 0s O 0 o O 0 0 | | 0 0 0 0 0 0 0 0 l— 0 0 0 0 0 O 0 O 0 o 0 0 0 0 0 0 0 ci 0 ci 0 0 o 0 0 0 I- 0 0 1— CÜ o 0 0 0 0 0 0 P õ co CA o O 0 0 0 ci 0 0 0 0 0 0 0 0 >AA 0 «D 0 0 0 I— 0 I— 0 0 0 Z 0 O 0 0 0 0 0 0 0 0 σ φ o OO 0 o 0 0 0 0 1= 0 0 0 0 0 δ C5 0 < / ) 0 0 0 0 0 0 0 CO 0 0 <T* 0 0 0 0 ~) 0 0 0 0 |— 0 l— 0 0 I— 0 0 o o 0 0 I- 0 0 0 0 0 0 0 o 0 o 0 0 0 0 0 0 0 Q CÜ — ra σ Q. LU CO σ> Is*», Is*». T- co o co CM CM CM co CO co 05 co 05 Φ CM T- CO CO CO m C 5 in U) C 5 CO in T- co in 05 C 5 T5 r- T- CM CM σ> σ> U) CO co Is*». a> C_5 T- CM CO co 05 C 5 _ c CO CO CO CO CO CO CO co co Is*-. Is*-.Is*» Is*» Is*» Is*» 00 U<o E _1 Φ O) -f σ .E LU Φ Cf) CM CO σ> CM CM CO CO m T- Is*», Is*», Is*», co co co in T- Ό c .. o 05 U) CM σ> 05 σ> CM co T- 05 05 co 05 CM 05 — EQ T- T- CM CO CO m in co Is*». CO 05 T- CM CM co 05 05 ra φ — CO CO CO CO CO co co co co CO CO Is»» Is»» Is»» Is»» Is»» 8 .2 —I o Q CÜ — ra σ Q. LU φ Cf) <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ <ζ ° E zzzzz ζ zzzzzzzzzzzz ra φ oco E _1 Φ O) -f σ .E LU Φ Cf) T- -O e ra φ — zzzzz ζ zzzzzzzzzzzz 8 .2 —I o E oo CM CO CO ο CM co co 05 CM co co o CM oo CO 05 CM U) a> CM in a> T- 00 T- C 5 c_> tfí 00 00 05 05 C 5 C 5 C 5 T- T- T- CM CM CM 05 05 CO ο O CO U) U) mmm U) U) U) U) U) U) U) C o C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 Φ 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 E o z. Petição 870260057655, de 12 / 06 / 2026, pág. 192 / 1268 185 / 343 SEQ ID NO 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 % inhibition o LO CM σ> LO 00 T- 00 00 CO LO CM 00 00 CO CM 00 o LO Sequence GTAATCACACCCACAC TTCAGAATTTCCACTA ATTGGTTCAAAAGCAG GTTGGGTCAAACACTT ACATGAAGTGAGCCTT TTTGGCACCTTCACCT TTAGAGGGCTAGTGTC AACTCAGGTGACTACA GGAGTCATTAGTGCTA ACAGCCATTGCATAAG Stopping location in SEQ ID: 2 CM σ> o 00 T- CO LO CM CO 00 σ> CO 00 CO CO LO CO CO 00 CO LO 00 00 CO 00 00 00 σ> 00 00 CO σ> 00 Starting location in SEQ ID: 2 o 00 CM CO T00 O TCO 00 σ> CO 00 8449 o CM CO 00 00 CO 00 CO CM 00 00 CO 00 00 00 CM LO σ> 00 Stopping location in SEQ ID: 1 zzzzzzzzzz Starting location in SEQ ID: 1 zzzzzzzzzz Composite number 905436 905468 905500 905532 905564 905596 905628 905660 905692 905724 Petition 870260057655, dated 12 / 06 / 2026, page 193 / 1268 co co — CD CO CO Inhibition of APOL1 mRNA by gappers with cEt 3-10-3 targeting SEQ ID NOs: 1 and 2 SEQ ID NO 13 1195 1196 1197 00 CD T" CD CD T" oo C\| 1201 1202 1203 1204 1205 % inhibition 87 CO C\| 45 33 69 00 00 C\| 00 74 25 59 25 00 00 Sequence ΠΙ- Ο 0 ο 0 ο l·I— 0 TATACCGAGGAATTCG 0 1— HI— 0 O o I— ooooo I— oo 0 I— 0 0 0 o TGAGGATCTCCAGTAT TTCATGATCAI I IG TC CCTTCTTATGTTATCC 0 I— o 1— I— oo 0 0 I— 0 o CCATGCCGACGAGGGT I— oooo 1— 1— 0 I— 0 I— o 0 I— o I— 0 0 ί- ο o I— 0 I— 0 o CAAGGCI III GA IGAC Stopping location in SEQ ID: 2 8321 527 583 4525 4786 12633 o CO C\| 12770 12842 12912 12950 oo CO Local de começar em SEQ ID: 2 8306 512 568 4510 4771 12618 12715 12755 12827 CD 00 C\| T" 12935 CD 00 CD C\| Stop location in SEQ ID: 1 V / N 34 06 232 311 542 639 679 751 T— C\| 00 859 913 Start location in SEQ ID: 1 V / N 19 75 217 296 527 624 664 736 CD O 00 844 00 CD 00 Composite number 793406 903421 903453 903485 903517 903613 903645 903677 CD O CO O CD 903741 903773 903805 Petition 870260057655, dated 12 / 06 / 2026, pp. 194 / 1268 187 / 343 SEQ ID NO 1206 1207 00 Ο CXI τ— CD Ο CXI Τ— 1210 1211 1212 1213 1214 1215 1216 1217 00 τΓΜ—CDxi9 c΄— % co 121ç co 00 CD 00 00 00 T— 00 CD T— 00 CXI CD CXI CD 00 CXI CXI τ— Sequence I— ooo I— I— oo I— 0 I— δ 0 0 0 0 ooo δ I— 0 δ ο ι— ο ο I— ο ο ο £ I— 0 δ Ο δ ι— ο δ ι— 0 0 0 δ 0 I— oo 0 OOI— 0 0 I— CAGCTATGGAAATGCC I— δ OO 0 δ o I— o I o— o I— o I— o I o— o I— TTCGGAGGACATTGAA I— O δ I— oo 0 I— o 0 oo 0 TTCAGTGTTCAAGCAG TCCTGGGCGGCGACAA o δ 0 I— OI— I— δ o δ 0 0 Ü I— o I— ooo δ Local de paragem CO02 T em CD OT" τ— ΙΌ CXI CXI co τ— co τ— co co τ— CD CO T— CD CD 00 CO T— CD CD CD CO T— 00 co τ— CO T— LO τ— T— T— CD T— O) CD T— CD O σ> T— CD LOcal SEQ T> ID in 02 or CO T" ο Τ- Ο Τ- Ο του with Τ— 00 CD CXI with τ— T— with with τ— OT 00 CO τ— τ— 00 CD CO τ— with CD CO τ— 00 CD T— CDI with T X 0 CD LO T— C 00 Paragem location in SEQ ID: 1 00 Τ- Ο T" σ> ο Τ- co Τ— Τ— CXI CXI CXIτ— LO LO with τ— 00 or 00 τ— LO O CD T— 00 CXI CXI CXI CXI CXI o CXI LO CXI CD O CD CXI LO τ— 00 CXI zz Starting place in SEQ ID: 1 CO oo Τ— CD- CXI T— o with T— with σ> τ— o CD 00 T— CXI CXI CXI o CXI LO o LO CXI T— CD LO CXI oo 00 CXI zz Compound number CO OO CD T— CD OO CD with CD oo CD LO CXI τ— o CD LO τ— o CD CD 00 T— o CD with LO CXI o CD T— with o CD CD with o CD Petition 870260057655, dated 12 / 06 / 2026, p. 195 / 1268 188 / 343 SEQ ID NO o CM CM 1221 1222 1223 1224 1225 1226 1227 1228 1229 O CO CM 1231 1232 1233 % inhibition o CM CM CM o CO CO LD T— CD CO LO CD CO CO CO CD CO LD Sequence 0 OOOI— ooo I— ooo 0 0 0 0 0 I— oooo H 0 I— 0 I— 0 HOI— 0 oo 0 TGAGCCACCAGTGGAC δ o HH 0 I— o 0 oooooo O 0 0 I— 0 0 OI— oo 0 0 I— o 0 £ I— 0 oo I— 0 0 0 δ I— o 0 I— o 0 H 0 δ o 0 1 oo 1— oo 1— oo 0 OOI— OI— 0 HI— O o 0 OO 0 I— 0 l í o I— oo OI— oo 0 0 0 GGCAAGGCTAAGTTCC o 0 o 0 o 0 o Stop location in SEQ ID: 2 CO CO CM CD CO 00 CM T— CM CM CD O LD CM T— LD CO LO CM LD LO CO LO CO CD LD CD LD CD T— 00 LD T— 00 LD CO σ> LO LD CD LD CD CM CD Start location in SEQ ID: 2 00 CN T— CM 00 CM CD O CM CD CD o LD 00 CO CM LD CD CO CO LD 00 LD CD LD CD LD o 00 LD CD LD 00 LD 00 CM CD LD O CD CD LD T" CD Stop location in SEQ ID: 1 zzz ZZ zz ZZZZ z ZZ Starting point in SEQ ID: 1 Z zzz Z zzzzzzzzz Compound number T— 00 CO o CD CO T— o CD LD O CD O CD LO O CD CO LO O CD LD O CDThe CD CD CD CD The CD oo CD CO CO o CD LD CD The CD O) The CD CD CM 00 The CD CD 00 The CD Petition 870260057655, dated 12 / 06 / 2026, pp. 196 / 1268 189 / 343 SEQ ID NO 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 % inhibition CO CD CM LO CD LO co σ> CD 00 LO 00 co CD 00 o CD LO Sequence 0 H Ι- Ο 0 I— O o I— 0 OOO oo OOI— oo 0 0 o I— ooo I— 0 0 I— 0 TGGGCCCACAGGATCC O δ 0 δ I— 0 I— o I— I— o I— o 0 I— ooooo £ 0 0 0 O 0 0 I— oo πι- ο CCCAGGI I IGGATGGA AGGGAAATGAACGCAA o 0 0 OI— o I— o 0 I— 0 0 I— o 0 OOI— o I— o 0 0 oo I— 0 0 0 δ I— o I— oo 0 0 0 I— I— o I— 0 O o I— OOI— o I— 0 I— $ OHOO ooo 0 oo Stop location in SEQ ID: 2 CO T— CM CD o CM CD 00 CO CO CD CD 00 CO CD CM LO LO CD CD O CD CD co LO CD CD LO CD co CO CD co oo co co T— LO CM IO t— CO OT Start location in SEQ ID: 2 o CM CD LO LO CM CD CO CM CO CD CO CD CO LO CD σ> LO CD 00 co CD CD CM CD 00 CM 00 CD 00 co CD CD co CD CO CM oo co CD CD Stop location in SEQ ID: 1 Z zz ZZZ z Z zzzzzz Start location in SEQ ID: 1 zzzzzzzzzzzzzz Compound number CO CD 00 O CD LO CM CD O CD LO CD O CD CD 00 CD O CD T— CMO LO o CD CO LO O LO o CD LO 00 o LO o CD T— LO o CD σ> LO o CD T— 00 T— LO o CD CO T— CM LO o CD LO CM LO O CD CM LO O CD CD o co LO o CD Petition 870260057655, dated 12 / 06 / 2026, pp. 197 / 1268 190 / 343 SEQ ID NO 00 CXI T— CD CXI 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 % inhibition o 00 CD 00 00 00 00 CD CO LO CD o Sequence TGCACACACAAGAGAC GGAATTATGGAATTGC δ I— 0 o I— 0 o I— oooooo H£ 0 I— ooo TATTGGTTCAAAAGCA ooo I— 0 0 0 HI— 0 I— o I— OO 0 0 I— 0 0 H- OOOO HI— O oo 0 0 ATTAGAGGGCTAGTGT OI— o 0 I— 0 0 o I— o TGGAGTCATTAGTGCT | Stop location in SEQ ID: 2 LO 00 CO CD oo 00 CD CD o 00 CD CXI CO 00 CD CD CO 00 LO CD 00 CD CO CD 00 LO 00 CD CO 00 00 CD CD 00 00 00 CD CD 00 Start location in SEQ ID: 2 CD CO 00 CXI CXI CD LO CD CD T— 00 o 00 T" CO 00 T— 00 CO 00 O LO 00 T— CXI CD 00 CD CO 00 cxi 00 00 OT 00 00 8953 Stop location in SEQ ID: 1 zzzzzzzzzzzz Start location in SEQ ID: 1 zzzzzzzzzzzz Composite number 905341 905373 905405 905437 905501 905533 905565 905597 905629 905661 905693 905725 Petition 870260057655, dated 12 / 06 / 2026, page 198 / 1268 σ> Q " O o X- CM CO LO co co σ> o X-pi co LO O 5 III 2 VJ X- CM CM CM CM CM CM CM CM ω £ % of ink 74 o CO Xco CO CO 59 o 39 X87 o 62 jonados with SEQ ID NOs: 1 e 2 Sequence GTTCAAAAGCAGCATT CAAGATATACCGAGGA TTCCCCTGGCAGAGAC CCCTCGCTCCAGCTTC CTTACTTTGAGGATCT TACTGCTGGCCTTTAT CGGAGCCTTCTTATGTGAGGACTGCGACTTCGTCCGTT TCTTTCCGTAGTCCAT CACCCAAAAACTCCCT GGCACGGATGTCCTTC AGATTGGCTCAGTGAC CTGGGTTCATTAACCC CACGAGGTAGACTACA GTTCTTGGTCCGCCTG Ie paraSEQ ID: X- CM CM co 93 co LO CO 9L· 5 / 9» X Xm (DC) with LO co z 47 CM CM CM CM CM (J / CM CM with co with LN with VJ with with I-3 say Loes gem ε 3-1C -f σ .E LU | | | Φ ( / ) X- VJ or now ϕ Q coco co LO coz CM CM CM CM (J / CM CM CO coco co co LN co VJ co co co co 82 -I o S2 φ £ ΌΙΟΞ -BJB( IC / BDJOd f Local de f gem em SE 1 V / N σ> co 140 268 co T- CO 575 644 685 756 826 865 946 1023 1099 1142 1227 1360 Am de APOL Local de início em SEQ ID: 1 V / N 24 125 253 co o co 560 629 670 741 811 850 931 1008 1084 1127 1212 1345 z or E o de oo 5 7Ί 'tí co o co CM co LO o σ> CM CM CO X-550 582 X- what what o X- 542 574 what o what what 0Z€ o ( / ) oo what CO what what CO what Xi- / what Xi- / what what what what what what what what what what Φ " E oz σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ>. Petição 870260057655, de 12 / 06 / 2026, pág. 199 / 1268 192 / 343 Q " O CO 00 σ> o CM CO co co σ> o T- ΓΓ» CM CO O 5 III 2 CM δ CM CM CM CM CM CM CM CM CM ω CO % o CO4 co τ co τ CM-4 20 oo co co o 00 co OSO Sequence ooooo δ δ ο ο TGTGCTCAGCTATGGA TTAGTCTAAAGTAAAC TGCTGGTTCCTTCAAG TCATTCTTCGGAGGAC ATCAGGCGAAGCCGCTGC ATGGCCCACCACAGCTGCCTGC0GJGCTCGAAAGCCGCTGC AGCTTTGTGAACCCAT GCCCAAGCCCAGTCCA AGGGTATGAAAGTT AGCCAGTGTGTATTGC TTGCACCCTTGAGGAG GCTAGGTGCCAGGTA CCCCCCCCCCCGCTGA ACATTCCCACAGGGCC GGATGTGGCAAAGGAC GCCCTATT7mGTcal de1 IDGGCA 13905 14032 14390 14519 14617 14715 14842 14911 1389 852 2497 3425 4355 4748 5073 5130 535 ( SEQ ID9 de99976) Local 13832 13890 14017 14375 14504 14602 14700 14827 14896 1374 co 00 2482 3410 4340 4733 50933 par 51-5:5 5360 SEQI with σ> with with Τι o Ξ E τ- 00 τ- σ> CM CM δ CO CM with CM 27( with CM 5 5 5 5 5 5 5 5 O with EO) -f σE LU φ Cf) T- τ- σ> ΓΓ» with σ> with Local (ie ID: τ- σ> CM 24' 25' 26( CM 28( 5 5 5 5 5 5 5 Ο ο ο O CM CM CO co co Uj) CO LO co CO Number pc Ο σ> ο σ> ο σ> o σ> o σ> o σ> 706 O σ> O σ> 706 o σ> o σ> o O σ> o σ> o σ> o σ> O σ>. Petition 870260057655, dated 12 / 06 / 2026, p. 200 / 1268 193 / 343 SEQ ID NO 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 ο .Ε ο IO CM |x^_ CM CM τ- o cd CM co CD CM CD |x^_ / 1* φ ο CO LO 00 LO LO CM LO co CO T- C) CO T- co Ό 0s 0 0 I_______ 0 0 0 0 0 0 I_______ 0 0 0 0 0 0 0 O δ 0 δ 0 δ 0 0 0 δ δ δ 0 0 0 0 0 0 0 0 0 GTT δ 0 0 0 δ 0 δ Q ra ο c O 0 δ o AAA δ 0 0 0 0 0 CAC 0 0 0 CTG 0 0 δ 0 0 Q 0 0 0 i= <φ I— I— 0 0 0 0 0 H I- 0 0 o ζ to 0 0 0 I— I— I— 0 0 δ 0 0 0 σ 0 0 0 0 ο 0 |— 0 0 0 0 I- 0 |— Φ 0 0 CD 0 0 0 0 I— 0 0 0 CO 0 0 0 δ 0 0 δ 0 0 GTC 0 δ 0 0 δ 0 0 0 0 δ 0 0 0 0 0 0 δ 0 δ <c 0 0 0 0 0 δ 0 0 0 0 0 0 δ 0 0 0 0 0 1D: ra σ Q. LU |X^_ T- CM co co ο co τ- CO LO |X^_ |X^_ LO IO CD CM CD CM cd co CM 00 co LO CM T- LO T- CD C_> CD LO Is-- LO LO _ Ε UJ LO LO LO ιο LO ιο co CO co CO co CO CO CO CO CO Is- Ο C ο Ε σ) -ρ σ .Ε LU Φ ( / ) CM CM co co co ιο co CO T- o CM CM o O CD CD CD ε Q CO co co cd cd τ- CM CM co LO co CO 00 O T- CM CO 8 .2 —I ο ιϋ: ra σ Q.LU 1 de m S 1 zzzzz ζ ζ Ζ Z zzzzzzzzz Z z to φ O c ο E CD -p σ .E LU Φ ( / ) T- ° P ·· ra φ — zzzzz ζ ζ ζ zzzzzzzzzzzz 8 .2 —I o E oo CO co o CM CO co o CM CO co o CM CO co o CM O _9 7Ί 'tí c_> C) Is-. C_> σ) co CD C) CO CD CM LO CD CM LO 00 T- LO 00 ( / ) oo LO LO LO lb lb io LO LO LO Φ cd cd cd cd cd σ> cd cd cd cd CD CD CD CD CD CD CD CD CD CD E o z. Petição 870260057655, de 12 / 06 / 2026, pág. 201 / 1268 194 / 343 SEQ ID NO 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1326 1327 1328 1329 % of inhibition 58 O T- 56 55 o T-CO 48 o 65 O 62 Z- Z- σ> Sequence AGAGTCACCGCCCAAA CTTGCCGTGCACACAC TGGTTTGCAGGGATCT ACAAAGAACTCAAGTC GACTGCTCCCTGTAAT ATGTGTTTAGGCATTC CATTGGGTTATGAAAT CATGCCTGTTGGGTCA GCTCAGCACCAACATG II ACTCCAACCAGCTGAGCTGAGCT AAGCTTTAAACTCAGG CTTGI II IAIGGAGTC AGTGCATAACAGCCAT Stopping place in SEQ ID: 2 7490 7858 7954 8016 8103 8190 8342 8401 8475 8646 σ> CO 00 68 8088856 incio in SEQ ID: 2 7475 7843 7939 8001 00 00 o 00 8175 8327 CO 00 CO 00 8460 T- CO CO 00 8744 T- CO 00 00 8893 0968 Stopping place in SEQ ID: V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Local de início em SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Número do composto 905314 905346 905378 905410 905442 905474 905506 905538 905570 905602 905634 905666 905698 905730 Petition 870260057655, of 12 / 06 / 2026, p. 202 / 1268 co co — LT) CD Ο ~ oo T" CM with coco cd o T" CM with σ y III 2 L' i T" with L' i coco coco L' J cococo L' J coco coco coco coco coco ω iõ % of inch CM T" with T" omo 47 CO o 49 29 NO co co CM e2 Sequence GTTCAAAAGCAGCATT CCAAGATATACCGAGG AATCTTCCCCTGGCAG ACCCTCGCTCCAGCTT GGGCTTACTTTGAGGA GTACTGCTGGCCTTTA ACGGAGCCTTCTTATG GTGGTGCCTTTGTGGA CCAGACCCATGCCGACTT ooGATCOCCGCTooGATCOCGCT AGGGCACGGATGTCCT GAGATTGGCTCAGTGA GCTGGGTTCATTAACC TAAGTGCTTTGATTCG AGTTCTTGGTCCGCCT 05 ions Ie paraSEQ ID: > T" CM co 96 567 co co 777 co CO T" Z9( co em CO CM d Ο m CD- rec co co z 47 CM T" CM T" CM T" CM T" CM T" CM T" CO T" co T" co T— LN CO t— co t— CO t— CO CD :t 3-10 -fa — LU Φ ( / ) CM Ό c co o co CMΟ" CO CM m T" with LU OE or 75 Φ —2 —I o C) co in IN co z 47 CM T" CM T" CM T" CM T" CM T" CM T" CO T" CO T— co T— CO t— CO t— co t— aaomers il de parajm SEQ ID: 1 V / N 40 144 269 321 576 645 co co co 757 827 co co co 947 1025 1100 1143 1245 1361 1 cor Loci gem ( de APOL Local de início em SEQ ID: 1 V / N 25 129 254 co o co 561 o co co 671 742 812 851 932 1010 1085 1128 1230 1346 z or E oo CM de oo 5 7Ί 'tí co o CM cd m τ- Ο 523 CD T" T" LO co co m T" 6Z; T" T" co 575 Z0€ σ> co T— / Τ'» Π5 o >πτ ( / ) oo co CO co co co LU co co co co co co co co co co co co co co Φ X2 Π5 Inibiçi Φ " E oz cd cd cd LU cd LU cd cd cd cd LU cd cd LU cd cd LU cd LU cd LU cd LU σ> σ> LU CD. Petição 870260057655, de 12 / 06 / 2026, pág. 203 / 1268 196 / 343 Ο " O co 00 σ> ο τ- CM co m co co σ> o T- CM co m σ y III 2 co co co co co co co co co co co co co co LL / co co co co co co ω Ζ % de in ção m co co CO τ- τ- Ο) co co co CM oo 00 m σ> co ni m CM σ> m CM co CM 00 co co CM σ> co o Sequência OOOO δ δ Ο Ο Ο CTGTGCTCAGCTATGG CTTTAGTCTAAAGTAA ACTCTTGGGCTTTCTC TTCATTCTTCGGAGGA CATCAGGAAGCCGCTG GCCATGGCCCACCACC GCTTTCATGCTAATTT GGTCAATCCTGGGCGG CTCATGATTGCAAAGC CTCAGCAGTCAAAACC GTTCCTAGAAGAAGCC GAGGGTATATGAAAGT TAGCTGGTGATAGCCA TGTTGCACCCTTGAGG TCATTTGCTAGGTGCC GGTCAACCTCCTCTCC TACATTCCCACAGGGC CGCCAGGTCACACAGA GGCCCTATTGTGTGGC -ocal de para5m em SEQ ID: 2 13848 13906 14034 14440 14520 14618 14718 14850 14912 1390 00 00 2530 3426 co co co 4750 5079 5187 5319 5394 5506 CD Local de início em SEQ ID: 2 13833 13891 14019 14425 14505 14603 14703 14835 14897 1375 σ> co co 2515 3411 4351 4735 5064 5172 5304 5379 5491 1- ID: 3 pairs; SEQI m co σ> σ> σ> T- Ξ E τ- 00 τ- σ> τ- co CM m CM co CM CM 00 CM zzzzzzzzzzz O c ο E CD -f σ .E LU ϕ ( / ) T- CM ο 00 CM CM CO Local (ie ID: τ- co τ- σ> τ- co CM δ in CM S CM 00 CM zzzzzzzzzzz ο ο ο τ- T- T- CM CM co co co in in co Number pc ο σ> ο σ> ο σ> ο σ> ο σ> o σ> o σ> O σ> o σ> o σ> o σ> o σ> o σ> o σ> o σ> o σ> o σ>. Petition 870260057655, dated 12 / 06 / 2026, p. 204 / 1268 197 / 343 SEQ ID NO 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 £ .Ε ο ΙΟ co σ> in T- m T- o T- CM σ> co σ> co T- / 1* φ ο 05 σ) co CM CM co co C) Is-» co U) T- co σ -Ο 0s CD | 0 0 0 0 I— 0 0 Ο Ο Ο 0 0 0 TC 0 0 0 0 IV 0 0 TT 0 I— 0 0 0 l= 0 0 0 0 J— 0 0 0 CD 0 0 J— 0 0 0 ο 0 0 0 0 |— J— I— o 0 CD |—_ 0 0 0 0 c5 0 |— ct Ι— Ι— 0 0 0 CD 0 0 J— I- 0 0 0 <φ 0 0 0 0 0 I— 0 0 0 0 0 0 0 ζ 0 0 0 0 0 CD I— 0 0 0 0 o I— 0 0 0 σ CD 0 0 0 0 I- 0 0 0 J— 0 t Φ ω — 0 0 0 0 δ 0 0 0 δ 0 0 0 0 0 0 — 0 I— <c — 0 0 0 I— 0 CD Õ 0 0 0 0 — 0 0 |— <ζ 0 0 0 0 <c 0 0 0 0 TT 0 0 0 0 0 GT 0 0 0 O O 0 0 0 < 0 0 I— <c I— 0 0 I— 0 0 Q φ — φ σ Q. LU 00 CM co σ>T- in m Is—» co co co σ> Is—» o in co in T- in 2 CM <» α> CM a> co U) CM Is-» T- in T- σ> T- <» in Is-» Is-» in Ό = CM (Ο Is-» α> a> <» <» T- CM CM σ> in co co co a> C 5 T- CM σ> _ CU) LO U) U) U) U) co co CO co co co co co co Is-. Is-. Is-. Ο C ο Ε _1 Φ σ) -ρ σ .Ε LU φ ( / ) CM co Is-» co σ> co oo CM T- co CO CM in o co o CO o Ό C α> co C 5 co σ> co T- CO co c_> C 5 a> 05 a> σ> co in — Ε Q (Ο co co σ> σ> T- CM CM co in CO co Is-» co o T- CM co (5 φ = U) LO U) U) U) U) co CO CO co co co CO co co Is-» Is-» Is-» 8 .2 _ι ο AQ Φ — φ σ Q. LU φ ( / ) <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ <£ ° Ε ζ ζ zzzzzzzzzzzzzzzzzz φ φ Ο C ο Ε —1 Φ σ) -ρ σ .Ε LU φ (Λ τ- ° Ρ ·· Φ Φ — ζ ζ zzzzzzzzzzzzzzzzzz 8 .2 _ι ο Ε ο ΙΟ Is—» σ> T- co in Is—» σ> T- co in Is—» σ> T- co in Is—» σ> T- co ο ο Is—» ο σ> Is-» C 5 σ> co <» co co <» CM in σ> CM U) co T- in a> tfí CO Is-» Is-» Is-» 00 what what what 05 C 5 C 5 C 5 T- T- T- CM CM CM ο Ο U) U) U) mmm U) U) U) C ο C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 C 5 φ 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 05 Ε ο ζ. Petição 870260057655, de 12 / 06 / 2026, pág. 205 / 1268 198 / 343 SEQ ID NO 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 % of inhibition 65 26 82 42 84 84 COLO 2030 G ) σ> Sequence GAGAGTCACCGCCCAA TCTTGCCGTGCACACCA GTGGTTTGCAGGGATC GGTCTACAAAGAACTC GGACTGCTCCCTGTAA GATGTGTTTAGGCATT ATCATTGGGTTATGAA ACATGCCTGTTGGGTC AGCTCAGCACCAACAT GACCAACCTA IICCAGTCAGTC GAAGCTTTAAACTCAG ACTTGI II IAIGGAGT GAGTGCATAACAGCCA Stopping place in SEQ ID: 2 7491 σ> LO 00 7955 8021 8104 8191 8344 8402 8476 8647 o CO 0 0 0 σ> σ> 00 σ> 8976 Starting location in SEQ ID: 2 7476 7844 7940 CO oo 00 σ> 00 o 00 8176 8329 00 CO 00 8461 8632 8745 8832 8894 8961 Stopping location in SEQ ID: V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Local de início em SEQ ID: 1 V / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / NV / N Número do composto 905315 905347 905379 905411 905443 905475 905507 905539 905571 905603 905635 905667 905699 905731 Petition 870260057655, of 12 / 06 / 2026, p. 206 / 1268 co co — CD CD SEQ ID NO with T- 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 £ % of in ção 84 σ-37 T co-35 oo σ> co m SEQ ID NOs: 1 e2 Sequence GTTCAAAAGCAGCATT ACAGGTCCTCCAGTCC TGTCGCTGCAGGGCCT III IGITGCACCCTCG TGCTCTCTGGGTCCAT CCAGTTTCTGTACTGC ATCTGCAAGGGCACGG TTGGAGCAGCTGGTGGTTAGTACG GTGTCCACCACTTCTT GTATTGCCAGCTAAGG AAGATTGGCTCTGGCT CCGCTTTCAGCTGAGA GAGCTTGACTCCTG 05 CO o Ό 05 CQ para- >EQ ID: T- σ> co co co o co co co Õ CD TJ CO 1 T6 23 S 23 em2 CM T- 128( 129- 129( 1305 131- 132C 132( zt 3-10 c φ σ σ LU ( / ) CM CO o 64 Tco co co T- 549 T- co m σ> m 127 co 60 ra < co 0 CM zz CM CM CM CM CM coco coco co E o (1 ooooc / aomers i the para- ;m SEQ ID: 1 V / N co m 169 278 361 585 657 695 773 σ> co co 877 983 1047 1112 1173 1 por oq gem t de APOL Local de ini- cio em SEQ ID: 1 V / N T- 154 263 346 570 642 o co co 758 824 862 996 1032 1097 1158 z or E o de oo 5 Π 'ti co o co co co 500 CM CO 528 560 CM σ> 724 co m co 00 520 CM m 584 CO T- o ( / ) OO co co co co CO 'Xz co VXZ co co co co co co co co co Inibiçí Φ " E '3 z σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ> σ>; Petição 870260057655, de 12 / 06 / 2026, pág. 207 / 1268 200 / 343 SEQ ID NO 1414 1415 1416 1417 1418 1419 1420 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 Jo % in co-TT > σ 628 64 40 co co τ- Ο τ- T- CM CM co 09 43 o 27 67 Sequence GCCCCCTCATGTAAGT ATATCTCTCCTGGTGG ATAAACTTTACCTCAC CTTCTCCTTGCTGCAC CACCCGGCCCCCCAAT ATCCAACT TGGTTCTCACATACTC CTAGAGATCTGAGCTT CAGCTTGATGAGTAGG GGGCCTCCTCCTT...

Claims

1. Modified oligonucleotide, characterized by the fact that (SEQ ID NO: 1164), or a salt thereof. Petition 870260057655, dated 12 / 06 / 2026, page 352 / 1268 2 / 7 2. Modified oligonucleotide, according to claim 1, characterized in that it is a sodium salt or a potassium salt.

3. Modified oligonucleotide, characterized by having the following chemical structure: (SEQ ID NO: 1164). Petition 870260057655, dated 12 / 06 / 2026, page 353 / 1268 3 / 7 4. Modified oligonucleotide, characterized in that the anion form of the modified oligonucleotide has the following (SEQ ID NO: 1164). Petition 870260057655, dated 12 / 06 / 2026, page 354 / 1268 4 / 7 5. Oligomeric compound, characterized in that it comprises an oligonucleotide modified according to the following formula: Tks Tks Tks Tds Gds Tds Ads Ads Gds Tds Gds mCds Aks Aks mCks mCe (SEQ ID NO: 1164), wherein, A = an adenine, mC = a 5-methylcytosine, G = a guanine, T = a thymine, e = a nucleoside modified with 2-MOE, k = a nucleoside modified with cEt, d = pD-2'-deoxyribonucleoside, es = a phosphorothioate internucleoside linkage.

6. Pharmaceutical composition, characterized in that it comprises the modified oligonucleotide as defined in any of the preceding claims and a pharmaceutically acceptable vehicle or diluent.

7. Pharmaceutical composition according to claim 6, characterized in that the pharmaceutically acceptable diluent comprises water or phosphate-buffered saline (PBS) solution.

8. Pharmaceutical composition, according to claim 7, characterized in that it consists essentially of the modified oligonucleotide and water or PBS.

9. Modified oligonucleotide, according to any one of claims 1 to 4, oligomeric compound according to claim 5, or pharmaceutical composition according to any one of claims 6 to 8, characterized in that it is for use in a therapy.

10. Modified oligonucleotide, according to any one of claims 1 to 4, oligomeric compound according to claim 5, or pharmaceutical composition according to any one of claims 6 to 8, characterized in that it is for use in a method of treating a disease associated with APOL1, the method comprising administering the modified oligonucleotide, oligomeric compound or pharmaceutical composition to an individual having a disease associated with APOL1, thereby treating the disease associated with APOL1.

11. Modified oligonucleotide, oligomeric compound, or pharmaceutical composition for use according to claim 10, characterized in that the disease associated with APOL1 is a nephropathy.

12. Modified oligonucleotide, oligomeric compound, or pharmaceutical composition for use according to claim 11, characterized in that the nephropathy is focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, hypertension-associated nephropathy, CKD attributed to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, ESRD, end-stage renal disease (ESRD), and membranous lupus nephropathy.

13. Modified oligonucleotide, oligomeric compound, or pharmaceutical composition for use according to any of claims 10 to 12, characterized in that administration of the modified oligonucleotide, oligomeric compound, or pharmaceutical composition reduces at least one of edema, proteinuria, albuminuria, decline in GFR, elevated lipid levels, elevated cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, and renal failure in the individual as compared with the respective levels before administration.

14. Use of the modified oligonucleotide, according to any one of claims 1 to 4, oligomeric compound according to claim 5, or pharmaceutical composition according to Petition 870260057655, dated 12 / 06 / 2026, page 356 / 1268 6 / 7 any one of claims 6 to 8, characterized in that it is used in the manufacture of a medicament for the treatment of a disease associated with APOL1.

15. Use, according to claim 14, characterized in that the disease associated with APOL1 is a nephropathy.

16. Use, according to claim 15, characterized in that the disease is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy attributed to hypertension, CKD attributed to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, ESRD, end-stage renal disease (ESRD), and membranous lupus nephropathy.

17. Use, according to any of claims 14 to 16, characterized in that administration of the modified oligonucleotide, oligomeric compound, or pharmaceutical composition reduces at least one of edema, proteinuria, albuminuria, decline in GFR, elevated lipid levels, elevated cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, and renal failure in the individual as compared with the respective levels before administration.

18. Method, characterized in that it comprises administering to an individual the modified oligonucleotide according to any one of claims 1 to 4, oligomeric compound according to claim 5, or pharmaceutical composition according to any one of claims 6 to 8.

19. Method, according to claim 18, characterized in that the individual has a disease associated with APOL1.

20. Method, according to claim 19, characterized in that the disease associated with APOL1 is a nephropathy.

21. Method, according to claim 20, characterized in that the nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, hypertension-attributed nephropathy, HIV-associated nephropathy, sickle cell nephropathy, arterionephrosclerosis, lupus nephritis, ESRD, end-stage renal disease (ESRD), and membranous lupus nephropathy.