Recombinant Gram-negative bacterial strain of attenuated virulence and its use.

Description

Recombinant Gram-negative bacterial strain of attenuated virulence and its use. Divided from BR 11 2019 012338 5, deposited on 12 / 20 / 2017. Field of Invention

[001] The present invention relates to recombinant Gram-negative bacterial strains of attenuated virulence and their use in a method of treating cancer in a subject. Fundamentals of the Invention

[002] Bacteria have developed different mechanisms to directly inject proteins into target cells 1. The type III secretion system (T3SS) used by bacteria such as Yersinia, Shigella and Salmonella2 functions as a nano-syringe that injects so-called bacterial effector proteins into host cells.

[003] T3S has been exploited to release hybrid proteins and peptides in target cells. Heterologous bacterial T3SS effectors have been released in cases where the bacterium under study is difficult to access genetically (such as Chlamydia trachomatis). Frequently, reporter proteins have been fused with potential T3SS secretion signals in order to study the requirements for T3SS-dependent protein release, such as Bordetella pertussis adenylate cyclase, murine DHFR, or a phosphorylatable marker. Peptide release has been primarily conducted with the aim of vaccination. This includes viral epitopes, bacterial epitopes (listeriolysin O), as well as peptides representing epitopes from human cancer cells. In some cases, functional eukaryotic proteins have been released to modulate the host cell, as done with nanobodies3, nuclear proteins (Crerecombinase, MyoD)4,5 or I110 and IL1ra 6.None of the systems mentioned above allows for the release of a single protein because, in each case, Petition 870260073253, dated 07 / 23 / 2026, page 14 / 287 2 / 190 one or multiple endogenous effector proteins are still encoded. Furthermore, the vectors used were not designed in a way that allows for the simple cloning of other DNA fragments encoding the proteins of choice, preventing the widespread application of the system.

[004] Methods that allow targeted drug delivery are of great interest. For example, antibodies that recognize surface structures of tumor cells and, ideally, selectively bind to tumor cells are used. To improve the mechanism of such antibodies, they can be conjugated to therapeutic agents or to lipid vesicles packaged with drugs. One of the challenges with such vesicles is the appropriate release of the active reagent. Even more complex is the release of therapeutic proteins or peptides, especially when intracellular mechanisms are targeted. Many alternative modes have been attempted to solve the problem of releasing therapeutic proteins in eukaryotic cells, among which are “cell-penetrating peptides” (CPPs) or similar technologies as well as various nanoparticle-based methodologies.All of these technologies have the disadvantage of low efficacy and the fact that the cargo absorbed by the cell through endocytosis will likely end up being degraded in lysosomes. Furthermore, the conflict between the need for cargo carrier stability in the human body and the requirement for destabilization and release within the target cell constitutes an intrinsic problem of such technologies.

[005] Several bacteria have been shown to replicate within solid malignant tumors when administered from a distal site, including Escherichia coli, Vibrio cholerae, Salmonella enterica, Listeria monocytogenes, Pseudomonas aeruginosa, and Bifidobacteria. Currently, only Bacillus Calmette-Guérin (BCG, derived from Mycobacterium bovis) is used in practice. Petition 870260073253, dated 07 / 23 / 2026, page 15 / 287 3 / 190 clinical. BCG is administered to treat superficial bladder cancer, while the underlying molecular mechanism remains largely unknown. The development of bacterial strains that are capable, for example, of releasing the cargo produced within the bacteria to its site of action within cells such as cancer cells, that is, outside the bacteria, remains a major challenge. Summary of the Invention

[006] The present invention relates to recombinant Gram-negative bacterial strains of attenuated virulence and their use in a method of treating cancer in a subject. In some embodiments, the present invention provides recombinant Gram-negative bacterial strains of attenuated virulence and the use thereof to treat cancer in a subject wherein the recombinant Gram-negative bacterial strains of attenuated virulence allow the translocation of various type III effectors, but also type IV effectors, viral proteins and most importantly functional eukaryotic proteins into cancer cells, for example, into cells of a malignant solid tumor.

[007] The present invention provides a recombinant Gram-negative bacterial strain of attenuated virulence with enhanced heterologous protein expression and secretion properties and which is surprisingly capable of stably encoding heterologous proteins for several days, or even weeks, in vivo.

[008] In a first aspect, the present invention relates to a recombinant Gram-negative bacterial strain of attenuated virulence comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the sequence of Petition 870260073253, dated 07 / 23 / 2026, page 16 / 287 4 / 190 nucleotides encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the recombinant Gram-negative bacterial strain of attenuated virulence further comprises a deletion of a chromosomal gene encoding an endogenous growth-essential protein and an endogenous virulence plasmid comprising a nucleotide sequence comprising a gene encoding said endogenous growth-essential protein operatively linked to a promoter.

[009] In another aspect, the present invention relates to a recombinant Gram-negative bacterial strain of attenuated virulence comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the recombinant Gram-negative bacterial strain of attenuated virulence further comprises a modulation within an RNA thermosensor region upstream of a gene encoding an endogenous AraC-type DNA-binding protein.

[010] In another aspect, the present invention relates to a recombinant Gram-negative bacterial strain of attenuated virulence comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of an effector protein Petition 870260073253, dated 07 / 23 / 2026, page 17 / 287 5 / 190 bacterial is operatively linked to a promoter, and the heterologous protein is a protein involved in the induction or regulation of an interferon (IFN) response.

[011] In another aspect, the present invention relates to a recombinant Gram-negative bacterial strain of attenuated virulence comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter,and wherein the recombinant attenuated virulence Gram-negative bacterial strain further comprises a deletion of a chromosomal gene encoding an endogenous growth-essential protein and an endogenous virulence plasmid comprising a nucleotide sequence comprising a gene encoding said endogenous growth-essential protein operatively linked to a promoter for use in a method of treating cancer in a subject, the method comprising administering to the subject said recombinant attenuated virulence Gram-negative bacterial strain, wherein the recombinant attenuated virulence Gram-negative bacterial strain is administered in an amount sufficient to treat the subject. Similarly, the present invention relates to a method of treating cancer in a subject,comprising administering to the subject a recombinant Gram-negative bacterial strain of attenuated virulence comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of an effector protein, Petition 870260073253, dated 07 / 23 / 2026, page 18 / 287 6 / 190 bacterial, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the attenuated virulence recombinant Gram-negative bacterial strain further comprises a deletion of a chromosomal gene encoding an endogenous growth-essential protein and an endogenous virulence plasmid comprising a nucleotide sequence comprising a gene encoding said endogenous growth-essential protein operatively linked to a promoter, wherein the attenuated virulence recombinant Gram-negative bacterial strain is administered in an amount sufficient to treat the subject.

[012] Similarly, the present invention relates to the use of a recombinant Gram-negative bacterial strain of attenuated virulence comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter,and wherein the recombinant Gram-negative bacterial strain of attenuated virulence further comprises a deletion of a chromosomal gene encoding an endogenous growth-essential protein and an endogenous virulence plasmid comprising a nucleotide sequence comprising a gene encoding said endogenous growth-essential protein operatively linked to a promoter for the manufacture of a drug to treat cancer in a subject.

[013] In another aspect, the present invention relates to a recombinant Gram-negative bacterial strain of attenuated virulence that Petition 870260073253, dated 07 / 23 / 2026, page 19 / 287 7 / 190 comprises a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the recombinant attenuated virulence Gram-negative bacterial strain further comprises a modulation within an RNA thermosensor region upstream of a gene encoding an endogenous AraC-type DNA-binding protein for use in a cancer treatment method in a subject, the method comprising administering to the subject said recombinant attenuated virulence Gram-negative bacterial strain, wherein the recombinant attenuated virulence Gram-negative bacterial strain is administered in an amount sufficient to treat the subject.Similarly, the present invention relates to a method of treating cancer in a subject, comprising administering to the subject a recombinant attenuated virulence Gram-negative bacterial strain comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the recombinant attenuated virulence Gram-negative bacterial strain further comprises a modulation within an RNA thermosensor region upstream of a gene encoding an endogenous AraC-type DNA-binding protein, wherein the recombinant attenuated virulence Gram-negative bacterial strain is administered in an amount sufficient to... Petition 870260073253, dated 07 / 23 / 2026, page 20 / 287 8 / 190 treat the subject. Similarly, the present invention relates to the use of a recombinant attenuated virulence Gram-negative bacterial strain comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the recombinant attenuated virulence Gram-negative bacterial strain further comprises a modulation within an upstream RNA thermosensor region of a gene encoding an endogenous AraC-type DNA-binding protein for the manufacture of a drug to treat cancer in a subject.

[014] In another aspect, the present invention relates to a recombinant attenuated virulence Gram-negative bacterial strain comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the heterologous protein is a protein involved in the induction or regulation of an interferon (IFN) response for use in a cancer treatment method in a subject, the method comprising administering to the subject said recombinant attenuated virulence Gram-negative bacterial strain, wherein the recombinant attenuated virulence Gram-negative bacterial strain is administered in an amount sufficient to treat the subject. Petition 870260073253, dated 07 / 23 / 2026, page 21 / 287 9 / 190

[015] Similarly, the present invention relates to a method of treating cancer in a subject, comprising administering to the subject a recombinant attenuated virulence Gram-negative bacterial strain comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the heterologous protein is a protein involved in the induction or regulation of an interferon (IFN) response, wherein the recombinant attenuated virulence Gram-negative bacterial strain is administered in an amount sufficient to treat the subject.

[016] Similarly, the present invention relates to the use of a recombinant Gram-negative bacterial strain of attenuated virulence comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the heterologous protein is a protein involved in the induction or regulation of an interferon (IFN) response for the manufacture of a drug to treat cancer in a subject.

[017] In another aspect, the present invention relates to a pharmaceutical composition comprising a recombinant Gram-negative bacterial strain of attenuated virulence and a pharmaceutically-modified carrier. Petition 870260073253, dated 07 / 23 / 2026, page 22 / 287 10 / 190 acceptable, wherein the recombinant Gram-negative bacterial strain of attenuated virulence comprises a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the recombinant Gram-negative bacterial strain of attenuated virulence further comprises a deletion of a chromosomal gene encoding an endogenous growth-essential protein and an endogenous virulence plasmid comprising a nucleotide sequence comprising a gene encoding said endogenous growth-essential protein operatively linked to a promoter.

[018] In another aspect, the present invention relates to a pharmaceutical composition comprising a recombinant attenuated virulence Gram-negative bacterial strain and a pharmaceutically acceptable carrier, wherein the recombinant attenuated virulence Gram-negative bacterial strain comprises a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a bacterial effector protein release signal, wherein the nucleotide sequence encoding the bacterial effector protein release signal is operatively linked to a promoter, and wherein the recombinant attenuated virulence Gram-negative bacterial strain further comprises a modulation within an RNA thermosensor region upstream of a gene encoding an endogenous AraC-type DNA-binding protein. Petition 870260073253, dated 07 / 23 / 2026, page 23 / 287 11 / 190

[019] In another aspect, the present invention relates to a pharmaceutical composition comprising a recombinant Gram-negative bacterial strain of attenuated virulence and a pharmaceutically acceptable carrier, wherein the recombinant Gram-negative bacterial strain of attenuated virulence comprises a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the heterologous protein is a protein involved in the induction or regulation of an interferon (IFN) response. Brief Description of the Figures

[020] Fig. 1: Characterization of T3SS protein release. Schematic representation of T3SS-dependent protein secretion into the adjacent medium (in vitro secretion) (left side) or into eukaryotic cells (right side). I: shows the type 3 secretion system. II indicates proteins secreted into the adjacent medium. III shows proteins translocated across the membrane into the cytosol of eukaryotic cells (VII). VI shows a stretch of the two bacterial membranes where the T3SS is embedded and the bacterial cytosol below. IV is a fusion protein bound to the N-terminal fragment YopE1-138 (V).

[021] Fig. 2: Description of the type III secretion-based release toolbox. (A) Vector maps of the pBad_Si1 and pBad_Si2 cloning plasmids used to generate fusion constructs with YopE1-138. The SycE chaperone and the YopE1-138 fusion are under the native Y. enterocolitica promoter. The two plasmids differ only in the presence of an arabinose-inducible EGFP present in pBad_Si1. (B) Multiple cloning site directly Petition 870260073253, dated 07 / 23 / 2026, page 24 / 287 12 / 190 following the yopEi-138 fragment in the pBad_Si1 and pBad_Si2 plasmids.

[022] Figs. 3A to Q: Y. enterocolitica strains used in this study. List of Y. enterocolitica strains used in this study providing information on strains, plasmids and source proteins for T3SS-dependent release encoded in corresponding plasmids. In addition, information on oligonucleotides used for the construction of the corresponding plasmid, the source plasmid and antibiotic resistances is provided.

[023] Fig. 4: The W227 virulence plasmid of Yersinia enterocolitica, pYV. The 69,673 bp Yersinia (pYV) virulence plasmid of the W227 strain drawn to scale. T3SS effector proteins, origin of replication and arsenic resistance (encoded by the arsC, B, R and H genes) are indicated: I: origin of replication, II: yopO, III: yopP, IV: yopQ, V: yopT, VI: sycT, VII: yopM, VIII: yopD, IX: yopB, and H.

[024] Fig. 5: Release of enhanced synthetic pro-apoptotic proteins. Release of unique synthetic proteins consisting of single or tandem repeats of BH3 domains originating from t-BID or BAX pro-apoptotic proteins leads to enhanced apoptosis induction in 4T1 and B16F10 cancer cells. 4T1 (I) or B16F10 (II) cells were infected with ΔyopHOPEMT from Y. enterocolitica encoding pBad-MycHisA IV: extended domain of YopE1138-tBID BH3, V: YopE1-138-connector-tBID BH3, VI: YopE1-138-tBID BH3, VII: YopE1138-(tBID BH3)2, VIII: YopE1-138-tBID BH3 - BAX BH3 or IX: YopE1-138- BAX BH3 - tBID BH3. A titration of bacteria added to the cells (MOI) was performed for each strain, cell counts determined, and IC50 calculated using nonlinear regression. MOI IC50 is indicated (III).

[025] Fig. 6: Induction of apoptosis by synthetic pro-apoptotic proteins encoded by pYV. The release of a single repeat or a repeat in Petition 870260073253, dated 07 / 23 / 2026, page 25 / 287 13 / 190 tandem BID BH3 domain encoded in pYV leads to the induction of apoptosis in 4T1 and B16F10 cancer cells. 4T1 (I) or B16F10 (II) cells were infected with Y. enterocolitica ΔHOPEMT + IV: pYV-YopE1-138-BH3-Bid, or V: + pYVYopE1-138-(BH3-Bid)2 or VI: with Y. enterocolitica ΔHOPEMT pBad-MycHisAYopE1-138-(BH3-Bid)2 for 3 hours. A titration of the bacteria added to the cells (MOI) was performed for each strain, cell counts determined, and IC50 (III) calculated using nonlinear regression.

[026] Fig. 7: Tumor colonization of ΔyopH,O,P,E,M,T of Y. enterocolitica injected iv in the 4T1 breast cancer allograft model. Bacterial counts in tumors are indicated as colony-forming units (CFU) per gram of tissue (III). Counts were evaluated in tumors on day 8 (I) and 14 (II) post-infection. Each point represents an individual mouse. The horizontal dashed line indicates the limit of detection.

[027] Fig. 8: Biodistribution of ΔyopH,O,P,E,M,T of Y. enterocolitica injected iv in the 4T1 breast cancer allograft model. Bacterial counts in blood (I), spleen (II), liver, lung (IV), and tumor (V) are indicated as colony-forming units (CFU) per gram of tissue or per ml of blood (VI). Counts were assessed on day 14 post-infection. Each point represents an individual mouse. The horizontal dashed line indicates the detection limit. * indicates a mouse with large metastases found in the lung.

[028] Fig. 9: Delay in tumor progression in wild-type Balb / C mice allografted with 4T1 breast cancer cells. Wild-type Balb / C mice allografted with 4T1 breast cancer cells were injected iv with I: PBS or II: 1*107dHOPEMT of Y. enterocolitica ΔHairpinI-VirF + pYV-YopE1-138(BH3-Bid)2, once the tumor reached a size of 150 to 250 mm3. The day of iv bacterial injection was Petition 870260073253, dated 07 / 23 / 2026, p. 26 / 287 14 / 190 defined as day 0. Tumor volume was measured during the following days (III; day 0 to day 9 after IV bacterial injection) using calipers. The relative tumor volume, normalized to the tumor volume on day 0, is indicated (IV) as mm3. The mean is indicated with symbols; described error bars show the standard error of the mean. Statistical significance is measured with a 2-way ANOVA, * indicates a p-value < 0.05, ** a p-value < 0.005.

[029] Fig. 10: Tumor progression in wild-type Balb / C mice allografted with 4T1 breast cancer cells. Wild-type Balb / C mice allografted with 4T1 breast cancer cells were injected iv with I: PBS or II: 1*107 dHOPEMT of Y. enterocolitica once the tumor reached a size of 150 to 250 mm3. The day of iv bacterial injection was defined as day 0. Tumor volume was measured during the following days (III; day 0 to day 9 after iv bacterial injection) with calipers. The relative tumor volume, normalized to the tumor volume on day 0, is indicated (IV) as mm3. The mean is indicated with symbols; described error bars show the standard error of the mean.

[030] Fig. 11: Regulation of secretion based on T3SS controlling the expression of the master regulator VirF. A: In vitro secretion assay (performed at 37°C) with ΔH×ßáÕ᜜ᤤ strains of Y. enterocolitica releasing YopE1-138-(tBID BH3)2. VirF expression is controlled by its natural promoter (I + II), an arabinose-inducible promoter (III + IV), or its natural promoter with a deletion of its hairpin loop region I controlling temperature-dependent expression (V). The secretion assay was performed in the absence of arabinose (I, III, and V) or in the presence of 0.2% arabinose (II and IV). Secreted YopE1-138-(tBID BH3)2 was detected using Western blotting with an antibody that recognizes the YopE1-138 region. B: In vitro secretion assay (performed at 37°C) with ΔHOPEMT strains of Y. enterocolitica that release Petition 870260073253, dated 07 / 23 / 2026, page 27 / 287 15 / 190 CARD domains of murine YopE1-138-RIG1. VirF expression is under the control of its natural promoter (I + II), or its natural promoter with a deletion of its hairpin loop region controlling temperature-dependent expression (III). The secretion assay was performed in the absence of arabinose (I and III) or in the presence of 0.2% arabinose (II). Secreted murine YopE1-138-RIG1 CARD domains were detected using Western blotting with an antibody that recognizes the YopE1-138 region.

[031] Fig. 12: In vitro growth comparison: In vitro growth comparison for II: ΔΗΟΡΕΜΤ of Y. enterocolitica, III: ΔΗΟΡΕΜΤ of Y. enterocolitica Δasd, IV: ΔΗΟΡΕΜΤ of Y. enterocolitica Δasd + pBAD-MycHisAasd, V: ΔΗΟΡΕΜΤ from Y. enterocolitica Δasd + pBAD-MycHisA-asd (reverse orientation), VI: ΔΗΟΡΕΜΤfrom Y. enterocolitica encoding YopE1-138-(tBID BH3)2 in pYV and VII: ΔΗΟΡΕΜΤ of Y. enterocolitica Δasd + pYV-asd-YopE1-138-(tBID BH3)2. Bacteria were inoculated into liquid culture and cultured for 3 hours. Subsequently, the OD600 (I) was determined for all strains.

[032] Fig. 13: Tumor colonization with Y. enterocolitica ΔHOPEMT + pBad-MycHisA-asd ΔHOPEMT and pBad-MycHisA-asd stability: Wild-type C57BL / 6 mice allografted with B16F10 melanoma cells were injected iv with 1*106Y. enterocolitica ΔHOPEMT + pBadMycHisA-asd ΔHOPEMT. On day 1 (I) or day 4 (II) after iv injection of bacteria, blood (V), spleen (VI), liver (VII), lung (VIII), and tumor (IX) were isolated, homogenized, serially diluted, and plated on LB-agar plates containing nalidixic acid (and no ampicillin, -IV) or on LB-agar plates with ampicillin (+IV), selective for pBad-MycHisA-asd. Bacterial counts in the respective samples are indicated as colony-forming units (CFU) per gram of tissue or ml of blood (III). Each point represents an individual mouse. The horizontal dotted line indicates the limit of Petition 870260073253, dated 07 / 23 / 2026, p. 28 / 287 16 / 190 detection.

[033] Fig. 14: Tumor colonization with Y. enterocolitica ΔHOPEMT Δasd + pBad-MycHisA-asd: Wild-type Balb / C mice allografted with 4T1 breast cancer cells were injected iv with 1*10⁶ Y. enterocolitica ΔHOPEMT Δasd + pBad-MycHisA-asd. On the indicated days after iv bacterial injection (I), tumors were isolated, homogenized, serially diluted, and plated on LB-agar plates containing nalidixic acid. Bacterial counts in tumors are indicated as colony-forming units (CFU) per gram of tissue (II). Each point represents an individual mouse. The horizontal dashed line indicates the detection limit.

[034] Fig. 15: Genetic stability of pYV: Stability of native pYV or pYV-asd in solid tumors in vivo. Wild-type Balb / C mice allografted sc with 4T1 breast cancer cells were injected iv with 1*107 II: ΔHOPEMT of Y. enterocolitica + pYV-YopE1-138-(tBID BH3)2, III: ΔHOPEMT of Y. enterocolitica ΔHairpinI-virF + pYV-YopE1-138-(tBID BH3)2 or IV: ΔHOPEMT of Y. enterocolitica Δasd + pYV-asd-YopE1-138-(tBID BH3)2. On day 9 after IV injection of bacteria, tumors were isolated, homogenized, serially diluted, and plated on LB-agar plates containing nalidixic acid. After growth on these plates, single colonies from individual mice were re-selected onto LB-agar plates with and without sodium arsenite, selective for pYV. For each mouse, the percentage of colonies growing on agar plates containing arsenite to the number of colonies growing on plates not containing arsenite is indicated (I: as %).100% indicates that all isolated colonies from a solid tumor still contain the pYV plasmid.

[035] Fig. 16: Tumor colonization: Wild-type Balb / C mice allografted sc with 4T1 breast cancer cells were injected iv with Petition 870260073253, dated 07 / 23 / 2026, page 29 / 287 17 / 190 1*107II: Y. enterocolitica ΔHOPEMT + pYV-YopEi-i38-(tBID BH3)2, III: Y. enterocolitica ΔHOPEMT ΔHairpinI-virF + pYV-YopE1-138-(tBID BH3)2 or IV: Y. enterocolitica ΔHOPEMT Δasd + pYV-asd-YopE1-138-(tBID BH3)2. On day 9 after iv injection of bacteria, tumors were isolated, homogenized, serially diluted, and plated on LB-agar plates containing nalidixic acid. Bacterial counts in tumors are indicated as colony-forming units (CFU) per gram of tissue (I). Each point represents an individual mouse. The horizontal dashed line indicates the detection limit.

[036] Fig. 17: Release of type I interferon response-inducing proteins via the bacterial T3SS-Rig1 pathway. Release of human and murine RIG1 CARD domains leads to type I IFN induction in an IFN reporter B16F10 cell line. Reporter B16F10 cells were infected with I: Y. enterocolitica ΔHOPEMT, or Y. enterocolitica ΔHOPEMT encoding a pBadMycHisA-derived plasmid; II: human YopE1-138-RIG1 CARD domains; III: murine YopE1-138-RIG1 CARD domains. A titration of the bacteria added to the cells (IV: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated based on the secreted alkaline phosphatase activity (V: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[037] Fig. 18: Release of type I interferon response-inducing proteins via the bacterial T3SS-Rig1 pathway. Release of human RIG1 CARD domains leads to type I IFN induction in a B16F10 IFN reporter cell line. B16F10 reporter cells were infected with I: Y. enterocolitica ΔHOPEMT, or Y. enterocolitica ΔHOPEMT encoding a pBadMycHisA-derived plasmid; II: YopE1-138-MycHis; III: human YopE1-138-RIG1 CARD domains. A titration of the bacteria added to the cells Petition 870260073253, dated 07 / 23 / 2026, page 30 / 287 18 / 190 (IV: indicated as MOI) was performed for each strain, and IFN stimulation was assessed based on the activity of secreted alkaline phosphatase (V: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[038] Fig. 19: Release of type I interferon response-inducing proteins via the bacterial T3SS-Rig1 pathway: positive control. The positive control in the same experiment as Fig. 18 used IFN gamma to stimulate the IFN reporter B16F10 cell line. Reporter B16F10 cells were stimulated with murine IFN gamma. A titer of IFN gamma was added to the cells (I: indicated as U / ml), and IFN stimulation was assessed based on the activity of secreted alkaline phosphatase (II: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[039] Fig. 20: Release of type I interferon response-inducing proteins via the bacterial T3SS-Rig1 pathway. Release of murine Rig1 CARD domains encoded by pYV leads to type I IFN induction in the B16F10 cancer cell line. B16F10 cells were infected with I: ΔH×ßáÕÜT from Y. enterocolitica, or ΔH×ßáÕÜT from Y. enterocolitica encoding in pYV II: CARD domains of murine YopE1-138-Rig1. A titration of the bacteria added to the cells (III: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated by adding cell supernatant to an IFN reporter cell line based on the secreted alkaline phosphatase activity (IV: OD650) that is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[040] Fig. 21: Release of type I interferon response-inducing proteins via the bacterial T3SS-Rig1 pathway. The release of domains Petition 870260073253, dated 07 / 23 / 2026, page 31 / 287 19 / 190 CARD of murine Rigl encoded by pYV leads to type I IFN induction in the 4T1 cancer cell line. 4T1 cells were infected with I: ΔHOPEMT of Y. enterocolitica, or ΔHOPEMT of Y. enterocolitica encoding in the pYV II: CARD domains of murine YopE1-138-Rig1. A titration of the bacteria added to the cells (III: indicated as MOI) was performed for each strain, and IFN stimulation was assessed by adding cell supernatant to an IFN reporter cell line based on the secreted alkaline phosphatase activity (IV: OD650) that is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[041] Fig. 22: Release of type I interferon response-inducing proteins via the bacterial T3SS-STING pathway. The release of cyclic dinucleotide-generating enzymes leads to the induction of type I IFN in a B16F10 IFN reporter cell line. B16F10 reporter cells were infected with I:ΔH×ßáÕΜΤ from Y. enterocolitica, or ΔH×ßáÕΜΤ from Y. enterocolitica encoding in a pBadMycHisA-derived plasmid II:YopE1-138-WspR from P. aeruginosa (with adapted stem domain). A titration of the bacteria added to the cells (III: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated based on the secreted alkaline phosphatase activity (IV: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[042] Fig. 23: Release of type I interferon response-inducing proteins via the bacterial T3SS-STING pathway. The release of cyclic dinucleotide-generating enzymes leads to the induction of type I IFN in a B16F10 IFN reporter cell line. B16F10 reporter cells were left untreated (I), or infected with II: ΔHOPEMT of Y. enterocolitica, or Petition 870260073253, dated 07 / 23 / 2026, p. 32 / 287 20 / 190 ΔHOPEMT of Y. enterocolitica encoding in a pBadMycHisA-derived plasmid III: YopE1-138- DncV of V. cholerae, IV: YopE1-138- DisA-like protein of B. cereus, V: YopE1-138- cGAS of Anemonae or VI: YopE1138- MycHis. A titration of the bacteria added to the cells (VII: indicated as MOI) was performed for each strain, and IFN stimulation was assessed based on the activity of secreted alkaline phosphatase (VIII: OD650) which is under the control of the I-ISG54 promoter which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[043] Fig. 24: T3SS-dependent secretion of IRF3 in culture supernatant. In vitro secretion experiment of I: ΔHOPEMT of Y. enterocolitica + YopE1-138- murine tBID BH3 and II: ΔHOPEMT of Y. enterocolitica + YopE1-138- murine IRF3 Ser397Asp. The protein content of total bacterial lysates (A) and precipitated culture supernatants (B) was analyzed by Western blotting using an anti-YopE antibody. The written numbers indicate the molecular weight in kDa at the corresponding height.

[044] Fig. 25: Release of type I interferon response-inducing proteins via bacterial T3SS to immune cells - via Rig1 and STING. Release of CARD domains from murine Rig1 and cyclic dinucleotide-generating enzymes leads to the induction of type I IFN in a RAW264.7 IFN reporter cell line. RAW264.7 reporter cells were infected with I: Y. enterocolitica ΔHOPEMT, or Y. enterocolitica ΔHOPEMT encoding a pBadMycHisA-derived plasmid; II: V. cholerae YopE1-138-DncV; III: B. cereus YopE1-138-DisA-like protein; IV: Anemonae YopE1-138cGAS; or V: murine Rig1 YopE1-138-CARD domains. A titration of the bacteria added to the cells (VI: indicated as MOI) was performed for each strain, and IFN stimulation was assessed based on the secreted alkaline phosphatase activity (VII: OD650) that is under the control of Petition 870260073253, dated 07 / 23 / 2026, page 33 / 287 21 / 190 promoter I-ISG54 which is comprised of the ISG54 promoter inducible by IFN enhanced by a multimeric ISRE.

[045] Fig. 26: Tumor colonization of Y. enterocolitica strains injected iv in the B16F10 breast cancer allograft model. Wild-type C57BL / 6 mice allografted sc with B16F10 melanoma cancer cells were injected iv with I: PBS, II: 1*107dHOPEMT of Y. enterocolitica, III: dHOPEMT of Y. enterocolitica + pYV-YopE1-138 - murine RIG1 CARDsi-246 or IV: dHOPEMT of Y. enterocolitica ΔHairpinI-VirF + pYV-YopE1-138 murine RIG1 CARDsi-246 once the tumor reached a size of 100 to 315 mm3. Bacterial counts in tumors are indicated as colony-forming units (CFU) per gram of tissue (V). Counts were evaluated in tumors on day 5 or 8 post-infection. Each point represents an individual mouse. The horizontal dashed line indicates the limit of detection.

[046] Fig. 27: Release of type I interferon response-inducing proteins via bacterial T3SS-RIG1. Release of CARD domains from human and murine RIG1 leads to the induction of type I IFN in an IFN reporter B16F10 cell line. B16F10 cells were infected with I: Y. enterocolitica ΔHOPEMT, or Y. enterocolitica ΔHOPEMT encoding a pBadMycHisA-derived plasmid II: YopE1-138-domains CARD1-245 of human RIG1, III: YopE1-138-domains CARD of murine RIG1 1-246, IV: YopE1-138-domains CARD of murine RIG1 1-229, V: YopE1-138-domains CARD of murine RIG1 1-218. A titration of the bacteria added to the cells (VI: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated based on the secreted alkaline phosphatase activity (VII: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE. Petition 870260073253, dated 07 / 23 / 2026, p. 34 / 287 22 / 190

[047] Fig. 28: Release of type I interferon response-inducing proteins via bacterial T3SS-RIG1. Release of CARD domains from human and murine RIG1 leads to the induction of type I IFN in an IFN reporter RAW cell line. RAW reporter cells were infected with I: Y. enterocolitica ΔHOPEMT, or Y. enterocolitica ΔHOPEMT encoding a pBadMycHisA-derived plasmid II: YopE1-138-domains CARD1-245 of human RIG1, III: YopE1-138-domains CARD of murine RIG1 1-246, IV: YopE1-138-domains CARD of murine RIG1 1-229, V: YopE1-138-domains CARD of murine RIG1 1-218. A titration of the bacteria added to the cells (VI: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated based on the secreted alkaline phosphatase activity (VII: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[048] Fig. 29: Release of type I interferon response-inducing proteins via the bacterial T3SS-MDA5 pathway. Release of murine MDA5 leads to type I IFN induction in a B16F10 IFN reporter cell line. B16F10 reporter cells were infected with I: ΔH×ßáÕΜT from Y. enterocolitica, or ΔH×ßáÕΜT from Y. enterocolitica encoding in a pBadMycHisA-derived plasmid II: YopE1-138-MDA5 from murine 1-294, HI: YopE1-138-MDA5 from murine 1-231. A titration of the bacteria added to the cells (IV: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated based on the secreted alkaline phosphatase activity (V: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[049] Fig. 30: Release of type I interferon response-inducing proteins via bacterial T3SS - MAVS. CARD release from MAVS leads to type I IFN induction in a B16F10 reporter cell line. Petition 870260073253, dated 07 / 23 / 2026, page 35 / 287 23 / 190 IFN. Reporter B16F10 cells were infected with I: ΔH×ßáÕÜT from Y. enterocolitica, or ΔH×ßáÕÜT from Y. enterocolitica encoding a plasmid derived from pBadMycHisA II: YopE1-138-domains CARD of murine RIG1 1-246, III: YopE1-138-cGAS161-522 human, IV: YopE1-138-CARD1-100 of human MAVS. A titration of the bacteria added to the cells (V: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated based on the secreted alkaline phosphatase activity (VI: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[050] Fig. 31: Release of type I interferon response-inducing proteins via bacterial T3SS-MAVS. Release of MAVS CARD leads to type I IFN induction in a RAW macrophage cell line reporting IFN. RAW macrophage reporter cells were infected with I: Y. enterocolitica ΔHOPEMT, or Y. enterocolitica ΔHOPEMT encoding a plasmid derived from pBadMycHisA II: murine RIG1 1-246 YopE1-138-CARD domains, HI: human YopE1-138-cGAS161-522, IV: human MAVS YopE1-138-CARD1-100. A titration of the bacteria added to the cells (V: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated based on the secreted alkaline phosphatase activity (VI: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[051] Fig. 32: Release of type I interferon response-inducing proteins via the bacterial T3SS-STING pathway. The release of cyclic dinucleotide-generating enzymes leads to the induction of type I IFN in a B16F10 IFN reporter cell line. B16F10 reporter cells were infected with I: ΔHOPEMT from Y. enterocolitica, or ΔHOPEMT from Y. enterocolitica encoding a pBadMycHisA-derived plasmid II: YopE1-138-cGAS from Petition 870260073253, dated 07 / 23 / 2026, p. 36 / 287 24 / 190 Anemonae, III: YopEi-138-Anemonae CGAS60-422, IV: YopEi-i38-cGASi6i-522 human, V: YopEi-138-CdaAi0i-273 from Listeria, VI: YopEi-138-DncV from V. cholerae, VII: YopEi138-DisA-like protein from B. cereus. A titration of the bacteria added to the cells (VIII: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated based on the activity of secreted alkaline phosphatase (IX: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[052] Fig. 33: Release of type I interferon response-inducing proteins via the bacterial T3SS-STING pathway. The release of cyclic dinucleotide-generating enzymes leads to the induction of type I IFN in a RAW IFN reporter macrophage cell line. RAW macrophage reporter cells were infected with I: ΔHOPEMT from Y. enterocolitica, or ΔHOPEMT from Y. enterocolitica encoding a pBadMycHisA-derived plasmid; II: YopEi-138-cGAS from Anemonae; III: YopEi-i38-cGAS60-422 from Anemonae; IV: YopEi-i38-cGASi6i-522 from humans; V: YopEi-i38-CdaAi0i-273 from Listeria; VI: YopEi-138-DncV from V. cholerae; VII: YopEi-138-DisA-like protein from B. cereus.A titration of the bacteria added to the cells (VIII: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated based on the secreted alkaline phosphatase activity (IX: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[053] Fig. 34: Release of type I interferon response-inducing proteins via bacterial T3SS and comparison to small molecular agonists of STING. The release of cyclic dinucleotide-generating enzymes leads to the induction of type I IFN in a B16F10 IFN reporter cell line. B16F10 reporter cells were infected with Y I:ΔHOPEMT. Petition 870260073253, dated 07 / 23 / 2026, page 37 / 287 25 / 190 enterocolitica, or ΔH×ṣṣṭ of Y. enterocolitica encoding in a plasmid derived from pBadMycHisA II: YopE1-138-cGAS from Anemonae, III: YopE1-138-cGAS161522 human, IV: YopE1-138-CARD1-218 domains from murine RIG1. A titration of the bacteria added to the cells (V: indicated as MOI) was performed, and IFN stimulation was assessed based on the activity of secreted alkaline phosphatase (VI: OD650) which is under the control of the I-ISG54 promoter which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[054] Fig. 35: Release of type I interferon response-inducing proteins via bacterial T3SS and comparison to small molecular STING agonists. The release of a cyclic dinucleotide leads to the induction of type I IFN in a B16F10 IFN reporter cell line. B16F10 reporter cells treated with small molecular STING agonist 2'3'-c-diAM(PS)2 (Rp,Rp). A titration of the compound (I: indicated as micromolar) was performed, and IFN stimulation was assessed based on the activity of secreted alkaline phosphatase (II: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[055] Fig. 36: Release of type I interferon response-inducing proteins via bacterial T3SS and comparison to small molecular agonists of STING. The release of cyclic dinucleotide-generating enzymes leads to the induction of type I IFN in a RAW IFN reporter cell line. RAW reporter cells were infected with I: ΔHOPEMT from Y. enterocolitica, or ΔHOPEMT from Y. enterocolitica encoding a pBadMycHisA-derived plasmid; II: YopE1-138-cGAS from Anemonae; III: YopE1-138-cGAS161-522 from humans; IV: YopE1-138-CARD1-218 domains from murine RIG1). A titration of the bacteria added to the cells (V: indicated as MOI) was performed, and the Petition 870260073253, dated 07 / 23 / 2026, page 38 / 287 26 / 190 IFN stimulation was evaluated based on the activity of secreted alkaline phosphatase (VI: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[056] Fig. 37: Release of type I interferon response-inducing proteins via bacterial T3SS and comparison to small molecular STING agonists. The release of a cyclic dinucleotide leads to the induction of type I IFN in a RAW IFN reporter cell line. RAW reporter cells were treated with the small molecular STING agonist 2'3'-c-diAM(PS)2 (Rp,Rp). A titration of the compound (I: indicated as micromolar) was performed, and IFN stimulation was assessed based on the activity of secreted alkaline phosphatase (II: OD650) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[057] Fig. 38: Release of type I interferon response-inducing proteins via bacterial T3SS and proof of T3SS-RIG1 and MAVS dependence. Release of RIG1 CARD domains or MAVS CARD fused to YopE1138 leads to the induction of type I IFN in an IFN reporter RAW cell line, which is strictly T3SS dependent. RAW reporter cells were infected with I: ΔHOPEMT of Y. enterocolitica, or II: ΔHOPEMT-yop B of Y. enterocolitica, or ΔHOPEMT of Y. enterocolitica encoding in a pBadMycHisA-derived plasmid III: YopE1-138-CARDi-246 domains of murine RIG1, V: YopE1-138-CARD1-100 of human MAVS or ΔHOPEMT-yopB of Y. enterocolitica encoding in a pBadMycHisA-derived plasmid IV: YopE1-138-CARDi-246 domains of murine RIG1, VI: Human MAVS ΥορΕι-138-CARDi-ioo. A titration of the bacteria added to the cells (VII: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated based on the Petition 870260073253, dated 07 / 23 / 2026, p. 39 / 287 27 / 190 activity of secreted lucia luciferase (VIII: OD650) which is under the control of the I-ISG54 promoter which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE.

[058] Fig. 39: Release of type I interferon response-inducing proteins via bacterial T3SS in crude tumor isolate cell mixture - RIG1. Release of RIG1 CARD domains fused to YopE1-138 leads to type I IFN induction in crude tumor isolate. Wild-type Balb / C mice allografted with EMT6 breast cancer cells were sacrificed when the tumor reached a volume of > 200 mm3. Tumors were crushed, digested, and seeded as single-cell suspension in 24-well plates. These cells from two different tumors were infected with I and III: ΔHOPEMT of Y. enterocolitica, or II and IV: ΔHOPEMT of Y. enterocolitica encoding a plasmid derived from pBadMycHisA, YopE1-138- CARD1246 domains of murine RIG1. A titration of the bacteria added to the cells (V: indicated as MOI) was performed for each strain, and IFN stimulation was assessed using an ELISA at Interferon beta (VI: picogram / milliliter).Dashed lines indicated corresponding untreated tumors; I / II and III / IV are all cells derived from the same tumor.

[059] Fig. 40: Tumor progression in Balb / C wild-type mice allografted with EMT6 breast cancer cells. Balb / C wild-type mice allografted with EMT6 breast cancer cells were intratumorally injected with PBS once the tumor reached a size of 60 to 130 mm3. The day of the first intratumoral PBS injection was defined as day 0, treatments were performed on d0, d1, d5, d6, d10 and d11. Tumor volume was measured during the following days (I: day -11 to day 80 after the first bacterial injection) with calibrators. The relative tumor volume (tumor volume on day Petition 870260073253, dated 07 / 23 / 2026, page 40 / 287 28 / 190 corresponding divided by the tumor volume on d0) as mm3, is indicated log-2 transformed (II) for each mouse.

[060] Fig. 41: Tumor progression in wild-type Balb / C mice allografted with EMT6 breast cancer cells. Wild-type Balb / C mice allografted with EMT6 breast cancer cells were intratumorally injected with 7.5*107 dHOPEMT of Y. enterocolitica once the tumor reached a size of 60 to 130 mm3. The day of the first intratumoral bacterial injection was defined as day 0, treatments were performed on d0, d1, d5, d6, d10 and d11. Tumor volume was measured during the following days (I: day -11 to day 80 after the first bacterial injection) with calibrators. The relative tumor volume (tumor volume on the corresponding day divided by the tumor volume on d0) as mm3, is indicated log-2 transformed (II) for each mouse.

[061] Fig. 42: Tumor progression in wild-type Balb / C mice sc allografted with EMT6 breast cancer cells. Wild-type Balb / C mice sc allografted with EMT6 breast cancer cells were intratumorally injected with 7.5*107dHOPEMT from Y. enterocolitica encoding a plasmid derived from murine RIG1 pBadMycHisA YopE1138-domains CARD1-246 once the tumor reached a size of 60 to 130 mm3. The day of the first intratumoral bacterial injection was defined as day 0, treatments were performed on d0, d1, d5, d6, d10 and d11. Tumor volume was measured during the following days (I: day -11 to day 80 after the first bacterial injection) with calibrators. The relative tumor volume (tumor volume on the corresponding day divided by the tumor volume on d0) as mm3, is indicated as log-2 transformed (II) for each mouse.

[062] Fig. 43: Tumor progression in wild-type Balb / C mice allografted with EMT6 breast cancer cells. Petition 870260073253, dated 07 / 23 / 2026, page 41 / 287 29 / 190 Wild-type Balb / C mice sc allografted with EMT6 breast cancer cells were intratumorally injected with 7.5*107 dHOPEMT from Y. enterocolitica encoding a plasmid derived from human pBadMycHisA YopE1138-cGAS161-522 once the tumor reached a size of 60 to 130 mm3. The day of the first intratumoral bacterial injection was defined as day 0, treatments were performed on d0, d1, d5, d6, d10, and d11. Tumor volume was measured during the following days (I: day -11 to day 80 after the first bacterial injection) with calibrators. The relative tumor volume (tumor volume on the corresponding day divided by the tumor volume on d0) as mm3, is indicated log-2 transformed (II) for each mouse.

[063] Fig. 44: Tumor progression in wild-type Balb / C mice allografted sc on the contralateral side with EMT6 breast cancer cells after a first complete remission. Wild-type Balb / C mice allografted sc with EMT6 breast cancer cells were treated as described above (Figs. 40 to 43) intratumorally with 7.5*107II: Y. enterocolitica dHOPEMT encoding a murine RIG1 pBadMycHisA YopE1-138-CARD1-246 domain-derived plasmid, III: Y. enterocolitica dHOPEMT encoding a human pBadMycHisA YopE1138-cGAS161-522 derived plasmid once the tumor reached a size of 60 to 130 mm3. The day of intratumoral bacterial injection was defined as day 0. Mice with complete tumor regression (or I: unexposed mice as control) were allografted sc with EMT6 breast cancer cells in the contralateral flank.Tumor volume was measured over the following days (IV: up to day 80 after the first bacterial injection) using calipers. Absolute tumor volume is indicated (V) as mm3 for each mouse.

[064] Fig. 45: Tumor progression in Balb / C type mice Petition 870260073253, dated 07 / 23 / 2026, p. 42 / 287 30 / 190 wild-type allografted sc with EMT6 breast cancer cells. Wild-type Balb / C mice allografted sc with EMT6 breast cancer cells were injected iv with I: PBS, or 5*106II: Y. enterocolitica dHOPEMT, III: Y. enterocolitica dHOPEMT pYV-YopE1-138-(tBID BH3)2, IV: Y. enterocolitica dHOPEMT ΔHairpinI-VirF pYV-YopE1-138-(tBID BH3)2, V: Y. enterocolitica dHOPEMT ΔHairpinI-VirF Δasd pYV-asd-YopE1-138-(tBID BH3)2 once the tumor reached a size of 80 to 250 mm3. The day of IV bacterial injection was defined as day 0, all mice were treated intraperitoneally with Desferal on day 1. Tumor volume was measured during the following days (VI: day 0 to day 15 after the first bacterial injection) using calipers. The median tumor volume is indicated (VII) as mm3.

[065] Fig. 46: Tumor progression in C57BL / 6 wild-type mice allografted with B16F10 melanoma cells. Wild-type C57BL / 6 mice allografted with B16F10 melanoma cells were injected intratumorally with I: PBS, or 7.5*107II: dHOPEMT from Y. enterocolitica, III: encoding a plasmid derived from murine RIG1 pBadMycHisA YopE1-138-CARD1-246 domains, IV: dHOPEMT from Y. enterocolitica encoding a plasmid derived from human pBadMycHisA YopE1138-cGAS161-522 once the tumor reached a size of 60 to 130 mm3. The day of the first intratumoral injection of bacteria was defined as day 0, treatments were performed on d0, d1, d2, d3, d6 and d9. The tumor volume was measured during the following days (V: days) with calipers. The mean tumor volume is indicated (VI) as mm3.

[066] Fig. 47: Biodistribution of Y. enterocolitica subsp. palearctica in the B16F10 melanoma mouse allograft model: classification according to physical appearance. I: Dias, II: fraction of mice with a classification, III: MRS40 wt of Y. enterocolitica, IV: ΔyopH,O,P,E,M,T of Y. Petition 870260073253, dated 07 / 23 / 2026, p. 43 / 287 31 / 190 enterocolitica. The arrow indicates the day of IV injection of 2x10⁵ bacteria.

[067] Fig. 48: Biodistribution of Y. enterocolitica subsp. palearctica in the B16F10 melanoma mouse allograft model: classification according to behavior. I: Days, II: fraction of mice with a classification, III: MRS40 wt of Y. enterocolitica, IV: ΔyopH,O,P,E,M,T of Y. enterocolitica. The arrow indicates the day of infection iv with 2x105 bacteria.

[068] Fig. 49: Biodistribution of Y. enterocolitica subsp. palearctica in the B16F10 melanoma mouse allograft model: mouse weights. The weight of the mice was assessed daily following iv infection with bacteria. I: Days, II: body weight in grams, III: MRS40 wt of Y. enterocolitica, IV: ΔyopH,O,P,E,M,T of Y. enterocolitica. The arrow indicates the day of iv infection with 2x105 bacteria.

[069] Fig. 50: Biodistribution of Y. enterocolitica subsp. palearctica in the B16F10 melanoma mouse allograft model: biodistribution of ΔyopH,O,P,E,M,T of Y. enterocolitica. Organ counts at the indicated time were evaluated by organ homogenization, serial dilution, and counting of resulting colony-forming units (CFU). The day of iv bacterial injection was defined as day 0; all mice were treated ip with Desferal on d-1. I: ΔyopH,O,P,E,M,T of Y. enterocolitica, II: CFU per gram of tissue or mL of blood, III: day 1, IV: day 4, V: blood, VI: spleen, VII: liver, VIII: lung, IX: tumor. * indicates a mouse without any visible tumor.

[070] Fig. 51: Biodistribution of Y. enterocolitica subsp. palearctica in the B16F10 melanoma mouse allograft model: biodistribution of MRS40 wt of Y. enterocolitica. Organ counts at the indicated time were evaluated by organ homogenization, serial dilution, and counting of resulting colony-forming units (CFU). The day of the iv injection of Petition 870260073253, dated 07 / 23 / 2026, page 44 / 287 32 / 190 bacteria was defined as day 0, all mice were treated ip with Desferal on d-1. I: MRS40 wt of Y. enterocolitica, II: CFU per gram of tissue or mL of blood, III: day 1, IV: day 4, V: blood, VI: spleen, VII: liver, VIII: lung, IX: tumor.

[071] Fig. 52: Release of type I interferon response-inducing proteins via bacterial T3SS - Bacterially released MAVS from T3SS functions independently of endogenous MAVS. Release of the CARD T3SS pathway from MAVS leads to the induction of type I IFN in a RAW MAVSKO macrophage IFN (luciferase) reporter cell line. RAW MAVSKO macrophage reporter cells were infected with I: ΔHOPEMT of Y. enterocolitica, or II: ΔHOPEMT of Y. enterocolitica-yopB, III: ΔHOPEMT of Y. enterocolitica encoding a plasmid derived from pBadMycHisA, ΥορEi-138-CARDi-ioo of human MAVS or IV: ΔHOPEMT of Y. enterocolitica-yopB encoding a plasmid derived from pBadMycHisA YopE1-138-CARD1-100 of human MAVS.A titration of the bacteria added to the cells (V: indicated as MOI) was performed for each strain, and IFN stimulation was evaluated based on luciferase activity (VI: RLU - relative luminescence units) which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE. Detailed Description of the Invention

[072] The present invention relates to recombinant Gram-negative bacterial strains of attenuated virulence and their use in a method of treating cancer, for example, a malignant solid tumor in a subject.

[073] For the purposes of interpreting this descriptive report, the following definitions will apply and, where appropriate, terms used in the singular will also include the plural and vice versa. It should be understood that the terminology used here is for the purpose of describing only Petition 870260073253, dated 07 / 23 / 2026, page 45 / 287 33 / 190 specific modalities and is not intended to be restrictive.

[074] The term “Gram-negative bacterial strain” as used in the present invention includes the following bacteria: Aeromonas salmonicida, Aeromonas hydrophila, Aeromonas veronii, Anaeromyxobacter dehalogenans, Bordetella bronchiseptica, Bordetella parapertussis, Bordetella pertussis, Bradyrhizobium japonicum, Burkholderia cenocepacia, Burkholderia cepacia, Burkholderia mallei, Burkholderia pseudomallei, Chlamydia muridarum, Chlamydia trachmoatis, Chlamydophila abortus, Chlamydophila pneumoniae, Chromobacterium violaceum, Citrobacter rodentium, Desulfovibrio vulgaris, Edwardsiella tarda, Endozoicomonas elysicola, Erwinia amylovora, Escherichia albertii, Escherichia coli, Lawsonia intracellularis, Mesorhizobium loti, Myxococcus xanthus, Pantoea agglomerans, Photobacterium damseIae, Photorhabdus luminescens, Photorabdus temperate, Pseudoalteromonas spongiae, Pseudomonas aeruginosa, Pseudomonas plecoglossicida, Pseudomonas syringae, Ralstonia solanacearum, Rhizobium sp.,Salmonella enterica and other Salmonella sp., Shigella flexneri and other Shigella sp., Sodalis glossinidius, Vibrio alginolyticus, Vibrio azureus, Vibrio campellii, Vibrio caribbenthicus, Vibrio harvey, Vibrio parahaemolyticus, Vibrio tasmaniensis, Vibrio tubiashii, Xanthomonas axonopodis, Xanthomonas campestris, Xanthomonas oryzae, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis. The preferred Gram-negative bacterial strains of the invention are Gram-negative bacterial strains composed of the Enterobacteriaceae and Pseudomonadaceae families. The Gram-negative bacterial strain of the present invention is typically used for heterologous protein release by bacterial T3SS into eukaryotic cells in vitro and / or in vivo, preferably in vivo.

[075] The term “recombinant virulence Gram-negative bacterial strain Petition 870260073253, dated 07 / 23 / 2026, p. 46 / 287 "34 / 190 attenuated" as used in the present invention refers to a recombinant Gram-negative bacterial strain of attenuated virulence genetically transformed with a nucleotide molecule as a vector. The virulence of such a recombinant Gram-negative bacterial strain is usually attenuated by the deletion of bacterial effector proteins having virulence activity that are transported by one or more bacterial proteins, which are part of a secretion system mechanism. Such effector proteins are released by a secretion system mechanism into host cells where they exert their virulence activity on various host proteins and cellular mechanisms. Many different effector proteins are known, transported by various types of secretion systems and exhibiting a large repertoire of biochemical activities that modulate the functions of host regulatory molecules.The virulence of the recombinant Gram-negative bacterial strain used in the present invention can be further attenuated by the lack of a siderophore normally or occasionally produced by the Gram-negative bacterial strain, such that the strain does not produce the siderophore, for example, it is deficient in siderophore production. Thus, in a preferred embodiment, a recombinant Gram-negative bacterial strain of attenuated virulence is used that lacks a siderophore normally or occasionally produced by the Gram-negative bacterial strain, such that the strain does not produce the siderophore, for example, it is deficient in siderophore production; more preferably, a Yersinia strain, in particular, Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T, Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T ΔHαίΓρίηΙvirF or Y.enterocolitica MRS40 ΔyopH,O,P,E,M,T Δasd pYV-asd which lacks a siderophore normally or occasionally produced by the Gram-negative bacterial strain so that the strain does not produce the siderophore, for example, it is deficient in the production of a siderophore, in particular, it is deficient in. Petition 870260073253, dated 07 / 23 / 2026, p. 47 / 287 Yersiniabactin production. Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T, which is deficient in Yersiniabactin production, was described in WO02077249 and was filed on September 24, 2001, in accordance with the Budapest Treaty on International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure with the Belgian Coordinated Collections of Microorganisms (BCCM), and accession number LMG P-21013 was provided. The recombinant Gram-negative bacterial strain of attenuated virulence preferably does not produce at least one, preferably at least two siderophores; for example, it is deficient in the production of at least one, preferably at least two siderophores; more preferably, the recombinant Gram-negative bacterial strain of attenuated virulence does not produce any siderophores.

[076] The terms siderophore, iron siderophore or iron chelator, which are used interchangeably herein, refer to compounds with high affinity for iron, for example, small compounds with high affinity for iron.

[077] The siderophores of Gram-negative bacteria are, for example, Enterobactin and dihydroxybenzoylserine synthesized by Salmonella, Escherichia, Klebsiella, Shigella, Serratia (but used by all enterobacteria), Pyoverdines synthesized by Pseudomonas, Vibriobactin synthesized by Vibrio, Acinetobactin and Acinetoferrin by Acinetobacter, Yersiniabactin and Aerobactin synthesized by Yersinia, Ornibactin synthesized by Burkholderia, Salmochelin synthesized by Salmonella, Aerobactin synthesized by Escherichia, Shigella, Salmonella and Yersinia, Alcaligin synthesized by Bordetella, Bisucaberin synthesized by Vibrio.

[078] Siderophores include hydroxamate, catecholate, and mixed-linker siderophores. Several siderophores have been approved for use to date. Petition 870260073253, dated 07 / 23 / 2026, p. 48 / 287 36 / 190 in humans, primarily for the purpose of treating iron overload. The preferred siderophores are Deferoxamine (also known as deferrioxamine B, deferroxamine B, DFO-B, DFOA, DFB or desferal), Deferrioxamine E, Deferasirox (Exjade, Desirox, Defrijet, Desifer) and Deferiprone (Ferriprox).

[079] The term “an endogenous growth-essential protein” used in the present invention refers to proteins of the recombinant Gram-negative bacterial strain of attenuated virulence without which the Gram-negative bacterial strain cannot grow. Endogenous growth-essential proteins are, for example, an enzyme essential for amino acid production, an enzyme involved in peptidoglycan biosynthesis, an enzyme involved in LPS biosynthesis, an enzyme involved in nucleotide synthesis, or a translation initiation factor.

[080] The term “an enzyme essential for amino acid production” used in the present invention refers to enzymes that are related to the production of amino acids by the recombinant Gram-negative bacterial strain of attenuated virulence and without which the Gram-negative bacterial strain cannot grow.The essential enzymes for amino acid production include, for example, aspartate-beta-semialdehyde dehydrogenase (asd), glutamine synthetase (glnA), tryptophanyl tRNA synthetase (trpS), or serine hydroxymethyltransferase (glyA), or transketolase 1 (tktA), transketolase 2 (tktB), ribulose-phosphate 3-epimerase (rpe), ribose-5-phosphate isomerase A (rpiA), transaldolase A (talA), transaldolase B (talB), phosphoribosylpyrophosphate synthase (prs), ATP phosphoribosyltransferase (hisG), bifunctional histidine biosynthesis protein HisIE (hisI), 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamine)methylideneamine]imidazole-4-carboxamide isomerase. (hisA), HisH subunit of Imidazole glycerol phosphate synthase (hisH), HisF subunit of Imidazole glycerol phosphate synthase (hisF), bifunctional protein of. Petition 870260073253, dated 07 / 23 / 2026, page 49 / 287 37 / 190 Histidine biosynthesis HisB (hisB), Histidinol-phosphate aminotransferase (hisC), Histidinol dehydrogenase (hisD), 3-dehydroquinate synthase (aroB), 3-dehydroquinate dehydratase (aroD), Shikimate dehydrogenase (NADP(+)) (aroE), Shikimate kinase 2 (aroL), Shikimate kinase 1 (aroK), 3-phosphoshikimate 1-carboxyvinyltransferase (aroA), Chorismate synthase (aroC), P-protein (pheA), T-protein (tyrA), Aromatic amino acid aminotransferase (tyrB), Phospho-2-dehydro-3-deoxyheptonate aldolase (aroG), Phospho-2-dehydro-3-deoxyheptonate aldolase (aroH), Phospho-2-dehydro-3-deoxyheptonate aldolase (aroF), Quinate / Shikimate dehydrogenase (ydiB), ATP-dependent isoenzyme 1 of 6-phosphofructokinase (pfkA), ATP-dependent isoenzyme 2 of 6-phosphofructokinase (pfkB), Fructose-bisphosphate aldolase class 2 (fbaA), Fructose-bisphosphate aldolase class 1 (fbaB), Triosephosphate isomerase (tpiA), Pyruvate kinase I (pykF), Pyruvate kinase II (pykA), Glyceraldehyde-3-phosphate dehydrogenase A (gapA),Fosfoglierato cinase (pgk), fosfoglierato mutase dependente de 2,3bisfosfoglierato (gpmA), fosfoglierato mutase independente de 2,3bisfosfoglierato (gpmM / yibO), Fosfoglierato mutase provável (ytjC / gpmB), enolase (eno), D-3-phosphoglycerate deshydrogenase (serA), Fosfoserina aminotransferase (serC), Fosfoserina fosfatase (serB), L-serina desidratase 1 (sdaA), L-serina desidratase 2 (sdaB), L-treonina desidratase catabólica (tdcB), Ltreonina desidratase biosyntética (ilvA), L-serina desidratase (tdcG), Serina acetiltransferase (cysE), Cystathionine synthase A (cysK), Cisteína synthase B (cysM), betacistationase (malY), Cystathionine beta-lyase (metC), 5-methyltetra-hidropteroyltriglutamate-homocisteína methyltransferase (metE), Methionine synthase (metH), S-adenosylmethionine synthase (metK), Cystathionine gama-synthase (metB), Homosserina O-succinyltransferase (metA), 5'-methylthioadenosine / S-adenosylhomocisteína nucleosidase (mtnN), S-ribosyl-homocysteine ​​lyase (luxS), cystathione beta lyase,cystathione gamma lyase, Serine hydroxymethyltransferase (glyA), Glycine, Petition 870260073253, dated 07 / 23 / 2026, page 50 / 287 38 / 190 hydroxymethyltransferase (itaE), small subunit of 3-isopropylmalate dehydratase (leuD), large subunit of 3-isopropylmalate dehydratase (leuC), 3-isopropylmalate dehydrogenase (leuB), L-threonine biosynthetic dehydratase (ilvA), large subunit of acetolactate synthase isoenzyme 3 (ilvl), small subunit of acetolactate synthase isoenzyme 3 (ilvH), small subunit of acetolactate synthase isoenzyme 1 (ilvN), small subunit of acetolactate synthase isoenzyme 2 (ilvM), ketolactic acid reductase (NADP(+)) (ilvC), dihydroxyacid dehydratase (ilvD), branched-chain amino acid aminotransferase (ilvE), Bifunctional aspartokinase / homoserine dehydrogenase 1 (thrA), Bifunctional aspartokinase / homoserine dehydrogenase 2 (metL), 2-isopropyl malate synthase (leuA), Glutamate-pyruvate aminotransferase (alaA), Aspartate aminotransferase (aspC), Bifunctional aspartokinase / homoserine dehydrogenase 1 (thrA), Bifunctional aspartokinase / homoserine dehydrogenase 2 (metL),Lysine-sensitive aspartokinase 3 (lysC), Aspartate semialdehyde dehydrogenase (asd), 2-keto-3-deoxygalactonate aldolase (yagE), 4-hydroxytetrahydrodipicolinate synthase (dapA), 4-hydroxytetrahydrodipicolinate reductase (dapB), 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate Nsuccinyltransferase (dapD), Succinyldiaminopimelate desuccinylase (dapE), Diaminopimelate epimerase (dapF), Putative lyase (yjhH), Acetylornithine / succinyldiaminopimelate aminotransferase (argD), Citrate synthase (gltA), Aconitate hydratase B (acnB), Aconitate hydratase A (acnA), Uncharacterized putative aconitate hydratase (ybhJ), Isocitrate dehydrogenase (icd), Aspartate aminotransferase (aspC), Glutamate-pyruvate aminotransferase (alaA), Long chain [NADPH] glutamate synthase (gltB), Short chain [NADPH] glutamate synthase (gltD), Glutamine synthetase (glnA), Amino acid acetyltransferase (argA), Acetylglutamate kinase (argB), N-acetyl-gamma-glutamyl phosphate reductase (argC), Acetylornithine / succinyldiaminopimelate Petition 870260073253, dated 07 / 23 / 2026, page 51 / 287 39 / 190 aminotransferase (argD), Acetylornithine deacetylase (argE), F-chain of ornithine carbamoyltransferase (argF), I-chain of ornithine carbamoyltransferase (argl), Argininosuccinate synthase (argG), Argininosuccinate lyase (argH), Glutamate 5-kinase (proB), Gamma-glutamyl phosphate reductase (proA), Pyrroline 5-carboxylate reductase (proC), Ornithine cyclodesaminase, Leucine tRNA ligase (leuS), Glutamine tRNA ligase (glnS), Serine tRNA ligase (serS), beta subunit of glycine tRNA ligase (glyS), alpha subunit of glycine tRNA ligase (glyQ), Tyrosine tRNA ligase (tyrS), Threonine tRNA ligase (thrS), alpha subunit of Phenylalanine tRNA ligase (pheS), beta subunit of Phenylalanine-tRNA ligase (pheT), Arginine-tRNA ligase (argS), Histidine-tRNA ligase (hisS), Valine-tRNA ligase (valS), Alanine-tRNA ligase (alaS), Isoleucine-tRNA ligase (ileS), Proline-tRNA ligase (proS), Cysteine-tRNA ligase (cysS), Asparagine-tRNA ligase (asnS), Aspartate-tRNA ligase (aspS), Glutamate-tRNA ligase (gltX),Tryptophan-tRNA ligase (trpS), beta subunit of Glycine-tRNA ligase (glyS), Methionine-tRNA ligase (metG), Fisin-tRNA ligase (lysS). The preferred essential enzymes for amino acid production are tktA, rpe, prs, aroK, tyrB, aroH, fbaA, gapA, pgk, eno, tdcG, cysE, metK, glyA, asd, dapA / B / D / E / F, argC, proCgl, ser, glyuSQ, glyS / SQ tyrS, thrS, pheS / T, argS, hisS, valS, alaS, ileS, proS, cysS, asnS, aspS, gltX, trpS, glyS, metG, lysS, but preferred are asd, glyA, leuS, glnS, serS, glyS / Q, tyrS, pheS / S, pheS / S, hiss / S, argS valS, alaS, ileS, proS, cysS, asnS, aspS, gltX, trpS, glyS, metG, lysS, the most preferred is asd.,

[081] The terms “Gram-negative bacterial strain deficient in producing an amino acid essential for growth” and “auxotrophic mutant” are used interchangeably in the present invention and refer to Gram-negative bacterial strains that cannot grow in the absence of at least one exogenously supplied essential amino acid or a precursor thereof. The amino acid that the strain is deficient in producing is, for example, Petition 870260073253, dated 07 / 23 / 2026, p. 52 / 287 40 / 190 aspartate, meso-2,6-diaminopimelic acid, aromatic amino acids, or leucine-arginine. Such a strain can be generated by, for example, deletion of the aspartate-beta-semialdehyde dehydrogenase gene (asd). Such an auxotrophic mutant cannot grow in the absence of exogenous meso-2,6-diaminopimelic acid. The mutation, for example, deletion of the aspartate-beta-semialdehyde dehydrogenase gene, is preferred here for a Gram-negative bacterial strain deficient in producing an amino acid essential for the growth of the present invention.

[082] The term “Gram-negative bacterial strain deficient in producing adhesion proteins that bind to the surface of the eukaryotic cell or extracellular matrix” refers to mutant Gram-negative bacterial strains that do not express at least one adhesion protein compared to the adhesion proteins expressed by the corresponding wild-type strain. Adhesion proteins may include, for example, extended polymeric adhesion molecules such as pili / fimbriae or non-fimbrial adhesins. Fimbrial adhesins include type-1 pili (such as E. coli Fim-pili with FimH adhesin), P-pili (such as Pap-pili with PapG adhesin from E. coli), type 4 pili (such as pilin protein from, for example, P. aeruginosa) or curb (Csg proteins with CsgA adhesin from S. enterica). Non-fimbrial adhesions include trimeric autotranscarrier adhesins such as YadA from Y. enterocolitica, BpaA (B. pseudomallei), Hia (H. influenzae), BadA (B. henselae), NadA (N. meningitidis) or UspAl (M.catarrhalis) as well as other autotransporting adhesins such as AIDA-1 (E. coli) as well as other adhesins / invasins such as InvA from Y. enterocolitica or Intimin (E. coli) or members of the Dr family or Afa family (E. coli). The terms YadA and InvA as used in the present invention refer to proteins from Y. enterocolitica. The autotransporting YadA7 binds to different forms of collagen as well as fibronectin, while the invasin InvA8 binds to... Petition 870260073253, dated 07 / 23 / 2026, p. 53 / 287 41 / 190 β-integrins in the eukaryotic cell membrane. If the Gram-negative bacterial strain is a strain of Y. enterocolitica, the strain is preferably deficient in InvA and / or YadA.

[083] As used in the present invention, the term “Enterobacteriaceae family” comprises a family of Gram-negative facultative anaerobic rod-shaped bacteria found in soil, water, plants, and animals, which frequently occur as pathogens in vertebrates. The bacteria in this family share a similar physiology and demonstrate conservation within functional elements and genes of their respective genomes. As well as being oxidase-negative, all members of this family are glucose fermenters and most are nitrate reducers. The Enterobacteriaceae bacteria of the invention may be any bacteria of this family and specifically include, but are not limited to, bacteria of the following genera: Escherichia, Shigella, Edwardsiella, Salmonella, Citrobacter, Klebsiella, Enterobacter, Serratia, Proteus, Erwinia, Morganella, Providencia, or Yersinia.Em modalidades mais específicas, a bactéria é da espécie Escherichia coli, Escherichia blattae, Escherichia fergusonii, Escherichia hermanii, Escherichia vuneris, Salmonella enterica, Salmonella bongori, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella sonnei, Enterobacter aerogenes, Enterobacter gergoviae, Enterobacter sakazakii, Enterobacter cloacae, Enterobacter agglomerans, Klebsiella pneumoniae, Klebsiella oxitoca, Serratia marcescens, Yersinia pseudotuberculosis, Yersinia pestis, Yersinia enterocolitica, Erwinia amylovora, Proteus mirabilis, Proteus vulgaris, Proteus penneri, Proteus hauseri, Providencia alcalifaciens ou Morganella morganii.

[084] Preferably, the Gram-negative bacterial strain is selected from the group consisting of Yersinia, Escherichia, Salmonella, Shigella, Pseudomonas, Chlamydia, Erwinia, Pantoea, Vibrio, Burkholderia, Ralstonia, Petition 870260073253, 07 / 23 / 2026, pág. 54 / 287 42 / 190 Xanthomonas, Chromobacterium, Sodalis, Citrobacter, Edwardsiella, Rhizobiae, Aeromonas, Photorhabdus, Bordetella and Desulfovibrio, more preferably, from the group consisting of the genera Yersinia, Escherichia, Salmonella and Pseudomonas, most preferably, from the group consisting of the genera Yersinia and Salmonella, in particular, Yersinia.

[085] The term “Yersinia” as used in the present invention includes all species of Yersinia, including Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis. Yersinia enterocolitica is preferred.

[086] The term “Salmonella” as used in this invention includes all species of Salmonella, including Salmonella enterica and S. bongori. Salmonella enterica is preferred.

[087] Promoter as used in the present invention refers to a nucleic acid sequence that regulates the expression of a transcriptional unit. A “promoter region” is a regulatory region capable of binding to RNA polymerase in a cell and initiating transcription of a downstream coding sequence (3' direction). Within the promoter region will be found a transcription initiation site (conveniently defined by mapping with S1 nuclease), as well as protein-binding domains (consensus sequences) responsible for RNA polymerase binding such as the putative -35 region and the Pribnow box. The term “operatively linked” when describing the relationship between two nucleotides, for example, DNA regions, simply means that they are functionally related to each other and they are located in the same nucleic acid fragment.A promoter is operatively linked to a structural gene if it controls the transcription of the gene and is located in the same nucleic acid fragment as the gene. Usually, the promoter is functional in the so-called Gram-negative bacterial strain, that is, the promoter is capable of expressing the fusion protein present. Petition 870260073253, dated 07 / 23 / 2026, page 55 / 287 43 / 190 invention, that is, the promoter is capable of expressing the fusion protein of the present invention without additional genetic engineering or expression of other proteins. Furthermore, a functional promoter must not be naturally counter-regulated to the bacterial T3SS.

[088] The term “extrachromosomal genetic element” used in the present invention refers to a genetic element other than a chromosome that is endogenously harbored by the Gram-negative bacterial strain of the present invention, such as a virulence plasmid, or that is an exogenous genetic element with which the Gram-negative bacterial strain is transformed and that is transiently or stably integrated into the chromosome or into a genetic element other than a chromosome that is endogenously harbored, such as a virulence plasmid.Such an extrachromosomal genetic element may be a vector such as an expression vector, a vector for homologous recombination or other integration into the chromosome or into a genetic element other than a chromosome that is endogenously harbored such as a virulence plasmid, DNA fragments for homologous recombination or other integration into the chromosome or into a genetic element other than a chromosome that is endogenously harbored such as a virulence plasmid, or a specific insertion into the guidance site of the RNA element on the chromosome or into a genetic element other than a chromosome that is endogenously harbored such as a virulence plasmid, such as CRISPR / Cas9 and related guide RNA.

[089] The term “RNA thermosensing region” used in the present invention refers to a temperature-sensitive non-coding RNA sequence that is regulating the gene expression of related genes. Usually, RNA thermosensing regions function by forming a secondary structure such as a hairpin loop RNA, Petition 870260073253, dated 07 / 23 / 2026, p. 56 / 287 44 / 190, which is formed stably at a repressive temperature and unstably at a permissive temperature, and which is masking an RNA sequence essential for translation, such as a ribosome binding site, thereby regulating the expression of a gene related to that essential RNA sequence.

[090] The term “hairpin RNA structure or parts thereof” used herein refers to a secondary RNA structure formed by intramolecular base pairing leading to a hairpin loop structure. The intramolecular base pairing, usually within the same RNA strand, is formed due to complementary nucleotide sequences or parts thereof.

[091] The term “AraC-type DNA-binding protein”, also referred to as the AraC / XylS family, used in the present invention refers to bacterial transcriptional regulatory proteins that bind to DNA via a helix-turn-helix motif. Most members of the AraC-type DNA-binding proteins are positive transcriptional regulators and can be characterized by a minimal DNA-binding domain extending over a 100-residue stretch containing two helix-turn-helix subdomains. AraC-type DNA-binding proteins specifically include, but are not limited to: VirF, LcrF, YbtA, Rns, MxiE, AraC, XylS, ExsA, PerA, MmsR, RhaS, TcpN, HrpX, HrpB, GadX, HilC, HilD, MarA, CafR, FapR, and InvF are preferred. of relevant virulence mechanisms, such as VirF, LcrF, YbtA, Rns, MxiE, ExsA, PerA, HrpX, HrpB, GadX, HilC, HilD, TcpN, CafR, FapR and InvF.The most preferred proteins are AraC-type DNA-binding proteins involved in regulating the activity of the type three secretion system, such as VirF, LcrF, MxiE, ExsA, PerA, HrpX, HrpB, GadX, HilC, HilD, and InvF; VirF and / or LcrF are the most preferred. Petition 870260073253, dated 07 / 23 / 2026, page 57 / 287 45 / 190

[092] The term release used in the present invention refers to the transport of a protein from a recombinant attenuated virulence Gram-negative bacterial strain to a eukaryotic cell, including the steps of expression of heterologous proteins in the recombinant virulence attenuated Gram-negative bacterial strain, secretion of the expressed protein(s) from such recombinant attenuated Gram-negative bacterial strain, and translocation of the secreted protein(s) from such recombinant attenuated Gram-negative bacterial strain into the cytosol of the eukaryotic cell. Consequently, the terms release signal or secretion signal, which are used interchangeably in the present invention, refer to a polypeptide sequence that can be recognized by the secretion and translocation system of the Gram-negative bacterial strain and directs the release of a protein from the Gram-negative bacterial strain to eukaryotic cells.

[093] The term bacterial effector protein release signal used in the present invention refers to a release signal of a functional bacterial effector protein in the recombinant Gram-negative bacterial strain, that is, enabling a heterologous protein expressed in the recombinant Gram-negative bacterial strain to be secreted from such recombinant Gram-negative bacterial strain by a secretion system such as a type III, type IV or type VI secretion system or to be translocated by such recombinant Gram-negative bacterial strain into the cytosol of a eukaryotic cell by a secretion system such as a type III, type IV or type VI secretion system. The term bacterial effector protein release signal used in the present invention also includes a fragment of a bacterial effector protein release signal, that is, shorter versions of a release signal, for example, a release signal comprising up to 10, Petition 870260073253, dated 07 / 23 / 2026, page 58 / 287 46 / 190 preferably, up to 20, more preferably up to 50, even more preferably up to 100, in particular up to 140 amino acids of a release signal, for example, of a naturally occurring release signal. Thus, a nucleotide sequence such as, for example, a DNA sequence encoding a release signal of a bacterial effector protein may encode a full-length release signal or a fragment thereof, wherein the fragment usually comprises up to 30, preferably up to 60, more preferably up to 150, even more preferably up to 300, in particular up to 420 nucleic acids.

[094] As used in the present invention, the secretion of a protein refers to the outward transport of a heterologous protein across the cell membrane of a recombinant Gram-negative bacterial strain of attenuated virulence. The translocation of a protein refers to the transport of a heterologous protein from a recombinant Gram-negative bacterial strain of attenuated virulence across the plasma membrane of a eukaryotic cell into the cytosol of such eukaryotic cell.

[095] The term bacterial protein, which is part of a secretion system mechanism as used in the present invention, refers to bacterial proteins that constitute essential components of the bacterial type 3 secretion system (T3SS), type 4 secretion system (T4SS), and type 6 secretion system (T6SS), preferably T3SS. Without such proteins, the respective secretion system is not functional in translocating proteins to host cells, even if all other components of the secretion system and the bacterial effector protein to be translocated are still encoded and produced.

[096] The term bacterial effector protein as used in the present invention refers to bacterial proteins transported by systems of Petition 870260073253, dated 07 / 23 / 2026, page 59 / 287 47 / 190 secretion, for example, by bacterial proteins, which are part of a secretion system mechanism in host cells. Such effector proteins are released by a secretion system in a host cell where they exert, for example, virulence activity for various host proteins and cellular mechanisms. Many different effector proteins are known, transported by various types of secretion systems and exhibiting a large repertoire of biochemical activities that modulate the functions of host regulatory molecules. Secretion systems include type 3 secretion system (T3SS), type 4 secretion system (T4SS), and type 6 secretion system (T6SS). Some effector proteins (such as Shigella flexneri IpaC) also belong to the class of bacterial proteins, which are part of a secretion system mechanism and allow protein translocation.The recombinant Gram-negative bacterial strain of attenuated virulence used in the present invention usually comprises bacterial proteins that constitute essential components of the bacterial type 3 secretion system (T3SS), type 4 secretion system (T4SS) and / or type 6 secretion system (T6SS), preferably the type 3 secretion system (T3SS). The term "bacterial proteins that constitute essential components of the bacterial T3SS" as used in the present invention refers to proteins that naturally form the injectisosome, for example, the injection needle, or are otherwise essential for its function in protein translocation in eukaryotic cells.The proteins that form the injectisosome or are otherwise essential for its function in protein translocation in eukaryotic cells include, but are not limited to: SctC, YscC, MxiD, InvG, SsaC, EscC, HrcC, HrcC (Secretin), SctD, YscD, MxiG, Prg, SsaD, EscD, HrpQ, HrpW, FliG (Outer MS ring protein), SctJ, YscJ, MxiJ, PrgK, SsaJ, EscJ, HrcJ, HrcJ, FliF (Inner MS ring protein), SctR, YscR, Spa24, SpaP, SpaP, SsaR, EscR, HrcR, HrcR, FliP. Petition 870260073253, dated 07 / 23 / 2026, page 60 / 287 48 / 190 (minor export apparatus protein), SctS, YscS, Spa9 (SpaQ), SpaQ, SsaS, EscS, HrcS, HrcS, FliQ (minor export apparatus protein), SctT, YscT, Spa29 (SpaR), SpaR, SsaT, EscT, HrcT, HrcT, FliR (minor export apparatus protein), SctU, YscU, Spa40, SpaS, SpaS, SsaU, EscU, HrcU, HrcU, FlhB (export apparatus switching protein), SctV, YscV, MxiA, InvA, SsaV, EscV, HrcV, HrcV, FlhA (major export apparatus protein), SctK, YscK, MxiK, OrgA, HrpD (accessory cytosolic protein), SctQ, YscQ, Spa33, SpaO, SpaO, SsaQ, EscQ, HrcQA+B, HrcQ, FliM + FliN (C ring protein), SctL, YscL, MxiN, OrgB, SsaK, EscL, Orf5, HrpE, HrpF, FliH (Stator), SctN, YscN, Spa47, SpaL, InvC, SsaN, EscN, HrcN, HrcN, Flil (ATPase) Ssal, EscI, rOrf8, HrpB, HrpJ, (internal rod protein), SctP,YscP, Spa32, SpaN, InvJ, SsaP, EscP, Orfl6, HrpP, HpaP, FliK (Needle length regulator), LcrV, IpaD, SipD (hydrophilic translocator, needle tip protein), YopB, IpaBse, SipB, HKD, HKD, SpD, SpD PopF1, PopF2 (hydrophobic translocator, pore protein), YopD, IpaC, SipC, SseD, EspB (hydrophobic translocator, pore protein), YscW, MxiM, InvH (Pilotin), SctW, YopN, MxiC, InvE, SsaL, Sep, HAp, HAp (Gatekeeper).,

[097] The term “T6SS effector protein” or “bacterial T6SS effector protein” as used in the present invention refers to proteins that are naturally injected by T6S systems into the cytosol of eukaryotic cells or bacteria and to proteins that are naturally secreted by T6S systems that can, for example, form translocation pores in the eukaryotic membrane. The term “T4SS effector protein” or “bacterial T4SS effector protein” as used in the present invention refers to proteins that are naturally injected by T4S systems into the cytosol of eukaryotic cells and to proteins that are naturally secreted by T4S systems that can, for example, form Petition 870260073253, dated 07 / 23 / 2026, page 61 / 287 49 / 190 the translocation pore in the eukaryotic membrane.

[098] The term “T3SS effector protein” or “bacterial T3SS effector protein” as used in the present invention refers to proteins that are naturally injected by T3S systems into the cytosol of eukaryotic cells and to proteins that are naturally secreted by T3S systems that can, for example, form the translocation pore in the eukaryotic membrane (including pore-forming translocators (such as Yersinia YopB and YopD) and spike proteins such as Yersinia LcrV). Preferably, proteins that are naturally injected by T3S systems into the cytosol of eukaryotic cells are used. These virulence factors will paralyze or reprogram the eukaryotic cell to the benefit of the pathogen.Effector T3Ss exhibit a large repertoire of biochemical activities and modulate the function of crucial host regulatory molecules and include the protein families AvrA, AvrB, AvrBs2, AvrBS3, AvrBsT, AvrD, AvrD1, AvrPphB, AvrPphB, AvrPphB, AvrPphB, AvrBs2 AvrPpiBPto, AvrPto, AvrPtoB, AvrRpm1, AvrRpt2, AvrXv3, CigR, EspF, EspG, EspH, EspZ, ExoS, ExoT, GogB, GtgA, GtgE, GALA family of proteins, HopAB2, HopAO1, HopM, HopD2, HopD2, HopD2, HopD HopPtoE, HopPtoF, HopPtoN, HopUl, HsvB, IcsB, IpaA, IpaB, IpaC, IpaH, IpaH7,8, IpaH9,8, IpgBl, IpgB2, IpgD, LcrV, Map, OspC1, OspE2, OspG, OspG, OspB, OspB PipB2, PopB, PopP2, PthXo1, PthXo6, PthXo7, SifA, SifB, SipA / SspA, SipB, SipC / SspC, SipD / SspD, SlrP, SopA, SopB / SigD, SopD, SopE, SopE2, SopEsa, SpC / Sp, SpP, SpP, SpP, SpvC, SrfH, SrH, Sse, SseB, SseC, SseD, SseF, SseG, Ssel / SrfH, SseJ, SseK1, SseK2, SseK3, SseL, SspH1, SspH2, SteA, SteB, SteC, SteD, SteE, Tir TccP2, VirPhA, VirPhA, VirPhA, SseJ XopD, YopB, YopD YopE, YopH, YopJ, YopM, YopO, YopP, YopT, YpkA.

[099] The term “recombinant Gram-negative bacterial strain of attenuated virulence that accumulates in a malignant solid tumor” or “recombinant Gram-negative bacterial strain of attenuated virulence that accumulates in a tumor Petition 870260073253, dated 07 / 23 / 2026, p. 62 / 287 The term "50 / 190 malignant solid tumor" as used in the present invention refers to a recombinant attenuated virulence Gram-negative bacterial strain that replicates within a malignant solid tumor, thereby increasing the bacterial count of this recombinant attenuated virulence Gram-negative bacterial strain within the malignant solid tumor. Surprisingly, it has been found that the recombinant attenuated virulence Gram-negative bacterial strain, after administration to the subject, accumulates specifically in the malignant solid tumor, that is, it accumulates specifically in the organ where the malignant tumor is present, wherein the bacterial counts of the recombinant attenuated virulence Gram-negative bacterial strain in organs where no malignant solid tumor is present are low or undetectable.

[0100] In the case of extracellular resident bacteria such as Yersinia, the bacteria accumulate primarily within the intercellular space formed between tumor cells. Intracellular growing bacteria, such as Salmonella, will most often invade tumor cells and reside within such cells, while extracellular accumulations may still occur. Bacterial counts of recombinant Gram-negative bacterial strain of attenuated virulence accumulated within malignant solid tumor may be, for example, in the range of 10⁴ to 10⁹ bacteria per gram of tumor tissue.

[0101] The term “cancer” as used in the present invention refers to a disease in which abnormal cells divide uncontrollably and can invade nearby tissues. Cancer cells can also spread to other parts of the body through the blood and lymphatic systems. There are several main types of cancer. Carcinoma is a cancer that begins in the skin or in tissues that line or cover internal organs. Sarcoma is a cancer that begins in bone, cartilage, fat, muscle, blood vessels, or other connective or supportive tissue. Leukemia is a cancer that begins in the tissue that Petition 870260073253, dated 07 / 23 / 2026, page 63 / 287 51 / 190 forms the blood, such as bone marrow, and causes large numbers of abnormal blood cells to be produced and enter the bloodstream. Lymphoma and multiple myeloma are cancers that begin in the cells of the immune system. Cancers of the central nervous system are cancers that begin in the tissues of the brain and spinal cord. The term cancer used in the present invention includes solid tumors, that is, solid malignant tumors such as, for example, sarcomas, carcinomas and lymphomas, and non-solid tumors such as, for example, leukemias (blood cancers). Solid malignant tumors are preferred.

[0102] The term malignant solid tumor or indication of malignant solid tumor used in the present invention refers to an abnormal mass of tissue that usually does not contain cysts or fluid areas. Solid tumors can be benign (non-cancerous) or malignant (cancerous). Malignant solid tumors are treated with the methods of the present invention. Different types of malignant solid tumors are named for the type of cells that form them. Examples of malignant solid tumors are sarcomas, carcinomas, and lymphomas. Leukemias (blood cancers) generally do not form malignant solid tumors (definition according to the National Cancer Institute of the NIH).Solid malignant tumors include, but are not limited to, abnormal masses of cells that can originate from different types of tissue such as the liver, colon, colorectal, skin, breast, pancreas, cervix, uterine body, bladder, gallbladder, kidney, larynx, lip, oral cavity, esophagus, ovary, prostate, stomach, testicles, thyroid gland, or lung, and therefore include solid malignant tumors of the liver, colon, colorectal, skin, breast, pancreas, cervix, uterine body, bladder, gallbladder, kidney, larynx, lip, oral cavity, esophagus, ovary, prostate, stomach, testicles, thyroid gland, or lung. The preferred solid malignant tumors that can be treated with the methods... Petition 870260073253, dated 07 / 23 / 2026, p. 64 / 287 52 / 190 of the present invention are solid malignant tumors originating from the skin, breast, liver, pancreas, bladder, prostate, and colon, and therefore include solid malignant tumors of the skin, breast, liver, pancreas, bladder, prostate, and colon. Equally preferred solid malignant tumors that can be treated with the methods of the present invention are solid malignant tumors associated with liver cancer, such as hepatocellular carcinoma.

[0103] The term “bacterial effector protein that is virulent to eukaryotic cells” as used in the present invention refers to bacterial effector proteins that are transported by secretion systems in host cells where they exert their virulence activity on various host proteins and cellular mechanisms. Many different effector proteins are known, transported by various types of secretion systems and exhibiting a large repertoire of biochemical activities that modulate the functions of host regulatory molecules. Secretion systems include type 3 secretion system (T3SS), type 4 secretion system (T4SS), and type 6 secretion system (T6SS). Importantly, some effector proteins that are virulent to eukaryotic cells (such as Shigella flexneri IpaC) also belong to the class of bacterial proteins that are part of a secretion system mechanism.If the bacterial effector protein that is virulent to eukaryotic cells is also essential for the function of the secretion mechanism, such a protein is excluded from this definition. The T3SS effector proteins that are virulent to eukaryotic cells refer to proteins such as YopE, YopH, YopJ, YopM, YopO, YopP, YopT of Y. enterocolitica or OspF, IpgD, IpgB1 of Shigella flexneri or SopE, SopB, SptP of Salmonella enterica or ExoS, ExoT, ExoU, ExoY of P. aeruginosa or Tir, Map, EspF, EspG, EspH, EspZ of E. coli. The T4SS effector proteins that are virulent to eukaryotic cells refer to proteins such as LidA, SidC, SidG, SidH, SdhA, SidJ, SdjA, SdeA, SdeA, SdeC. Petition 870260073253, dated 07 / 23 / 2026, p. 65 / 287 53 / 190 LepA, LepB, WipA, WipB, YlfA, YlfB, VipA, VipF, VipD, VpdA, VpdB, DrrA, LegL3, LegL5, LegL7, LegLC4, LegLC8, LegC5, LegG2, Ceg10, Ceg23, Ceg29 of Legionella pneumophila or BepA, BepB, BepC, BepD, BepE, BepF, BepG of Bartonella henselae or VirD2, VirE2, VirE3, VirF of Agrobacterium tumefaciens or CagA of H. pylori or pertussis toxin of Bordetella pertussis. The T6SS effector proteins that are virulent to eukaryotic cells refer to proteins such as VgrG proteins of Vibrio cholerae (such as VgrG1).

[0104] The term “T3SS effector protein that is virulent to eukaryotic cells” or “bacterial T3SS effector protein that is virulent to eukaryotic cells” as used in the present invention refers to proteins that are naturally injected by T3S systems into the cytosol of eukaryotic cells and to proteins that are naturally secreted by T3S systems that can, for example, form the translocation pore in the eukaryotic membrane, which are virulence factors for eukaryotic cells, i.e., proteins that paralyze or reprogram the eukaryotic cell to the benefit of the pathogen.Effectors exhibit a wide repertoire of biochemical activities and modulate the function of crucial host regulatory mechanisms such as, for example, phagocytosis and the actin cytoskeleton, inflammatory signaling, apoptosis, endocytosis or secretory pathways2,9 and include AvrA, AvrB, AvrBs2, AvrBS3, AvrBsT, AvrD, AvrD1, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, AvrRpm1, AvrRpt2, AvrXv3, CigR, EspF, EspG, EspH, EspZ, ExoS, ExoT, GogB, GtgA, GtgE, GALA protein family, HopAB2, HopAO1, HopI1, HopM1, HopN1, HopPtoD2, HopPtoE, HopPtoF, HopPtoN, HopU1, HsvB, IcsB, IpaA, IpaH, IpaH7,8, IpaH9,8, IpgB1, IpgB2, IpgD, LcrV, Map, OspCl, OspE2, OspF, OspG, OspI, PipB, PipB2, PopB, PopP2, PthXo1, PthXo6, PthXo7, SifA, SifB, SipA / SspA„ SlrP, SopA, SopB / SigD, SopD, SopE, SopE2, SpiC / SsaB, SptP, SpvB, SpvC, SrfH, SrfJ, Sse, SseB, SseC, SseD, SseF, SseG, Ssel / SrfH, SseJ, SseK1, SseK2, SseK3, SseL, SspH1, SspH2,. Petition 870260073253, dated 07 / 23 / 2026, p. 66 / 287 54 / 190 SteA, SteB, SteC, SteD, SteE, TccP2, Tyr, VirA, VirPphA, VopF, XopD, YopE, YopH, YopJ, YopM, YopO, YopP, YopT, YpkA.

[0105] The Yersinia T3SS effector genes that are virulent to a eukaryotic cell and can be deleted / mutated from, for example, Y. enterocolitica are YopE, YopH, YopM, YopO, YopP (also called YopJ), and YopT10. The respective effector genes that are virulent to a eukaryotic cell can be deleted / mutated from Shigella flexneri (e.g., OspF, IpgD, IpgB1), Salmonella enterica (e.g., SopE, SopB, SptP), P. aeruginosa (e.g., ExoS, ExoT, ExoU, ExoY), or E. coli (e.g., Tir, Map, EspF, EspG, EspH, EspZ). The nucleic acid sequences of these genes are available to experts in the technique, for example, in the Genebank Database (yopH, yopO, yopE, yopP, yopM, yopT from NC 002120 GI: 10955536; S. flexneri effector proteins from AF386526.1 GI: 18462515; S. enterica effectors from NC016810.1 GE378697983 or FQ312003.1 GI:301156631; aeruginosa from AE004091.2 GI:110227054 or CP000438.1 GI:115583796 and effector proteins of E. coli from NC_011601.1 GE215485161).

[0106] For the purposes of the present invention, genes are indicated by lowercase letters and in italics to distinguish them from proteins. In the case of genes (indicated by lowercase letters and in italics) following a bacterial species name (such as E. coli), they refer to a mutation of the corresponding gene in the corresponding bacterial species. For example, YopE refers to the effector protein encoded by the yopE gene. Y. enterocolitica yopE represents a Y. enterocolitica having a mutation in the yopE gene.

[0107] As used in the present invention, the terms polypeptide, peptide, protein, polypeptide and peptide are used interchangeably to designate a series of amino acid residues connected to each other by peptide bonds between alpha-amino and Petition 870260073253, dated 07 / 23 / 2026, p. 67 / 287 55 / 190 carboxy of adjacent residues. Proteins with an amino acid sequence comprising at least 10 amino acids, more preferably at least 20 amino acids, are preferred.

[0108] According to the present invention, “a heterologous protein” includes naturally occurring proteins or parts thereof and also includes artificially modified proteins or parts thereof. As used in the present invention, the term “heterologous protein” refers to a protein or part thereof, except the T3SS effector protein or its N-terminal fragment, to which it may be fused. In particular, the heterologous protein as used herein refers to a protein or part thereof that does not belong to the proteome, i.e., the entire natural protein complement of the specific attenuated virulence recombinant Gram-negative bacterial strain provided and used by the invention, for example, that does not belong to the proteome, i.e., the entire natural protein complement of a specific bacterial strain of the genera Yersinia, Escherichia, Salmonella or Pseudomonas. Usually, the heterologous protein is of animal origin, including human origin.Preferably, the heterologous protein is a human protein or a part thereof. More preferably, the heterologous protein is selected from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or the regulation of apoptosis, cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR-related proteins, nanobody fusion constructs and nanobodies, bacterial T3SS effectors, bacterial T4SS effectors, and viral proteins. Particularly preferably, the heterologous protein is selected from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in... Petition 870260073253, dated 07 / 23 / 2026, page 68 / 287 56 / 190 apoptosis or regulation of apoptosis, cell cycle regulators, ankyrin repeat proteins, reporter proteins, small GTPases, GPCR-related proteins, nanobody fusion constructs, bacterial T3SS effectors, bacterial T4SS effectors, and viral proteins. Particularly preferred are even more selected heterologous proteins from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or regulation of apoptosis, cell cycle regulators, and ankyrin repeat proteins.Most preferred are proteins involved in apoptosis or the regulation of apoptosis, or proteins involved in the induction or regulation of an interferon (IFN) response, in particular, proteins involved in the induction or regulation of an interferon (IFN) response in animals, preferably heterologous proteins involved in human apoptosis or the regulation of apoptosis, or proteins involved in the induction or regulation of an interferon (IFN) response in humans. Proteins involved in the induction or regulation of an interferon (IFN) response are preferably proteins involved in the induction or regulation of a type I interferon (IFN) response, more preferably, proteins involved in the induction or regulation of a type I interferon (IFN) response in humans.

[0109] In some embodiments, the Gram-negative bacterial strain of the present invention comprises two nucleotide sequences encoding identical or two different heterologous proteins fused independently of each other in the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein.

[0110] In some embodiments, the Gram-negative bacterial strain of the present invention comprises three nucleotide sequences that encode the Petition 870260073253, dated 07 / 23 / 2026, page 69 / 287 57 / 190 identical or three different heterologous proteins fused independently of each other in the frame at the 3' end of a nucleotide sequence that encodes a release signal from a bacterial effector protein.

[0111] The heterologous protein expressed by the recombinant Gram-negative bacterial strain of attenuated virulence usually has a molecular weight between 1 and 150 kDa, preferably between 1 and 120 kDa, more preferably between 1 and 100 kDa, most preferably between 10 and 80 kDa.

[0112] In some embodiments, a portion of a heterologous protein comprises a domain of a heterologous protein. Thus, in some embodiments, the Gram-negative bacterial strain of the present invention comprises a nucleotide sequence encoding a domain of a heterologous protein. Preferably, the Gram-negative bacterial strain of the present invention comprises a nucleotide sequence encoding one or two domains of a heterologous protein, more preferably two domains of a heterologous protein.

[0113] In some embodiments, the Gram-negative bacterial strain of the present invention comprises a nucleotide sequence encoding repeated domains of a heterologous protein or two or more domains of different heterologous proteins fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein.

[0114] The term “heterologous proteins belonging to the same functional class of proteins” as used in the present invention refers to heterologous proteins that have the same function, for example, heterologous proteins having enzymatic activity, heterologous proteins that act in the same pathway such as, for example, cell cycle regulation, or share a specific common characteristic such as, for example, belonging to the same Petition 870260073253, dated 07 / 23 / 2026, p. 70 / 287 58 / 190 class of bacterial effector proteins. Functional classes of proteins include, for example, proteins involved in apoptosis or regulation of apoptosis, proteins that act as cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, proteins involved in the induction or regulation of an interferon (IFN) response, reporter proteins, transcription factors, proteases, small GTPases, GPCR-related proteins, nanobody fusion constructs and nanobodies, bacterial T3SS effectors, bacterial T4SS effectors, or viral proteins that act together in the biological process of establishing virulence for eukaryotic cells.

[0115] According to the present invention, “a domain of a heterologous protein” includes domains of naturally occurring proteins and also includes domains of artificially modified proteins. As used in the present invention, the term “domain of a heterologous protein” refers to a domain of a heterologous protein except for a domain of a T3SS effector protein or a domain except for a domain comprising the N-terminal fragment thereof to which it can be fused to obtain a fusion protein.In particular, the heterologous protein domain as used in the present invention refers to a heterologous protein domain that does not belong to the proteome, i.e., the entire natural protein complement of the specific recombinant Gram-negative bacterial strain provided and used by the invention, for example, that does not belong to the proteome, i.e., the entire natural protein complement of a specific bacterial strain of the genera Yersinia, Escherichia, Salmonella, or Pseudomonas. Usually, the heterologous protein domain is of animal origin, including human origin. Preferably, the heterologous protein domain is a human protein domain. More preferably, the heterologous protein domain is a domain of a... Petition 870260073253, dated 07 / 23 / 2026, page 71 / 287 59 / 190 selected protein from the group consisting of proteins involved in apoptosis or regulation of apoptosis, proteins involved in the induction or regulation of an interferon (IFN) response, cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR-related proteins, nanobody fusion constructs and nanobodies, bacterial T3SS effectors, bacterial T4SS effectors, and viral proteins.Particularly preferred is the heterologous protein domain, a selected protein domain consisting of proteins involved in apoptosis or apoptosis regulation, proteins involved in the induction or regulation of an interferon (IFN) response, cell cycle regulators, ankyrin repeat proteins, reporter proteins, small GTPases, GPCR-related proteins, nanobody fusion constructs, bacterial T3SS effectors, bacterial T4SS effectors, and viral proteins. Even more particularly preferred are heterologous protein domains selected from the group consisting of proteins involved in apoptosis or apoptosis regulation, proteins involved in the induction or regulation of an interferon (IFN) response, cell cycle regulators, and ankyrin repeat proteins.Most preferred are protein domains involved in the induction or regulation of an interferon (IFN) response, such as animal proteins involved in the induction or regulation of an interferon (IFN) response, preferably heterologous human protein domains involved in the induction or regulation of an interferon (IFN) response.

[0116] The term “repeated domains of a heterologous protein” as used in the present invention refers to a fusion protein consisting of multiple repetitions of a domain of a heterologous protein, wherein these domains may be directly fused together or where a connector Petition 870260073253, dated 07 / 23 / 2026, page 72 / 287 60 / 190 variable, for example, a connector between 1 and 30, preferably between 2 and 15, more preferably between 3 and 10 amino acids, can be introduced between the domains. Preferably, identical repeated domains or repeated domains that have an amino acid sequence identity greater than 80%, usually greater than 85%, preferably greater than 90%, even more preferably greater than 95%, in particular greater than 96%, more particularly greater than 97%, even more particularly greater than 98%, more particularly greater than 99%, are used. Identical domains that have an amino acid identity of 100% are also preferred.Preferably, two repeated domains, more preferably two identical repeated domains, or two repeated domains having an amino acid sequence identity greater than 90%, preferably greater than 95%, most preferably 100%, are comprised by the fusion protein as referred to in the present invention. More than two, for example, three, four, five, or six repeated domains are also contemplated by the present invention.

[0117] The term “two or more different heterologous protein domains” as used in the present invention refers to a fusion protein consisting of one or more repeats of at least two different heterologous protein domains, for example, at least two heterologous protein domains having an amino acid sequence identity of 80% or less, preferably 60% or less, more preferably 40% or less, wherein these different domains may be directly fused together or where a variable connector, for example, a connector between 1 and 30, preferably between 2 and 15, more preferably between 3 and 10 amino acids, may be introduced between the domains. Preferably, two different heterologous protein domains are comprised by the fusion protein as referred to in the present invention. More than two, for example, three, Petition 870260073253, dated 07 / 23 / 2026, page 73 / 287 61 / 190 four, five or six different heterologous protein domains are also considered by the present invention.

[0118] The domain of a heterologous protein expressed by the recombinant Gram-negative bacterial strain usually has a molecular weight between 1 and 50 kDa, preferably between 1 and 30 kDa, more preferably between 1 and 20 kDa, most preferably between 1 and 10 kDa.

[0119] According to the present invention, “proteins involved in the induction or regulation of an IFN response” include, but are not limited to, cGAS, STING, TRIF, TBK1, IKKePsiIon, IRF3, TREX1, VPS34, ATG9a, DDX3, LC3, DDX41, IFI16, MRE11, DNA-PK, RIG1, MDA5, LGP2, IPS1 / MAVS / CARDif / VISA, Trim25, Trim32, Trim56, Riplet, TRAF2, TRAF3, TRAF5, TANK, IRF3, IRF7, IRF9, STAT1, STAT2, PKR, TLR3, TLR7, TLR9, DAI, IFI16, IFIX, MRE11, DDX41, LSm14A, LRRFIP1, DHX9, DHX36, DHX29, DHX15, Ku70, IFNAR1, IFNAR2, TYK2, JAK1, ISGF3, IL10R2, IFNLR1, IFNGR1, IFNGR2, JAK2, STAT4, cyclic dinucleotide generating enzymes (cyclic di-AMP, cyclic di-GMP and cyclic di-GAMP cyclases) such as WspR, DncV, DisA and DisA-type, CdaA, CdaS and cGAS or a fragment thereof.

[0120] According to the present invention, proteins involved in the induction or regulation of a type I IFN response include, but are not limited to, cGAS, STING, TRIF, TBK1, IKKePsiIon, IRF3, TREX1, VPS34, ATG9a, DDX3, LC3, DDX41, IFI16, MRE11, DNA-PK, RIG1, MDA5, LGP2, IPS1 / MAVS / CARDif / VISA, Trim25, Trim32, Trim56, Riplet, TRAF2, TRAF3, TRAF5, TANK, IRF3, IRF7, IRF9, STAT1, STAT2, PKR, TLR3, TLR7, TLR9, DAI, IFI16, IFIX, MRE11, DDX41, LSm14A, LRRFIP1, DHX9, DHX36, DHX29, DHX15, Ku70, cyclic dinucleotide-generating enzymes (cyclic di-AMP, cyclic di-GMP and cyclic diGAMP cyclases) such as WspR, DncV, DisA and DisA-type, CdaA, CdaS and cGAS or a fragment thereof. Petition 870260073253, dated 07 / 23 / 2026, p. 74 / 287 62 / 190 regulation of a type I IFN response are selected from the group consisting of cGAS, STING, TRIF, TBK1, IKKePsiIon, IRF3, TREX1, VPS34, ATG9a, DDX3, LC3, DDX41, IFI16, MRE11, DNA-PK, RIG1, MDA5, LGP2, IPS-1 / MAVS / CARDif / VISA, Trim25, Trim32, Trim56, Riplet, TRAF2, TRAF3, TRAF5, TANK, IRF3, IRF7, IRF9, STAT1, STAT2, PKR, LSm14A, LRRFIP1, DHX29, DHX15 and cyclic dinucleotide generating enzymes such as cyclic di-AMP, cyclic di-GMP and di-GAMP cyclases. Selected cyclic compounds from the group consisting of WspR, DncV, DisA and DisA type, CdaA, CdaS and cGAS or a fragment thereof.

[0121] Preferred proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of cGAS (as Uniprot. Q8N884 for the human protein), RIG1 (as Uniprot. 095786 for the human protein), MDA5 (as Uniprot. Q9BYX4 for the human protein), IPS-1 / MAVS (as Uniprot. Q7Z434 for the human protein), IRF3 (as Uniprot. Q14653 for the human protein), IRF7 (as Uniprot. Q92985 for the human protein), IRF9 (as Uniprot. Q00978 for the human protein) and cyclic dinucleotide generating enzymes such as cyclic di-AMP, cyclic diGMP and cyclic di-GAMP cyclases selected from the group consisting of WspR (as Uniprot. Q9HXT9 for the P. aeruginosa protein), DncV (as Uniprot. Q9KVG7 for the V. cholerae protein), DisA and DisA type (as Uniprot. Q812L9 for the B. cereus protein), CdaA (as Uniprot. Q8Y5E4 for the L. monocytogenes protein), CdaS (as Uniprot.031854 or active constitutive L44F mutation as in Seq ID No. 114 for B. subtilis protein) and cGAS (as Uniprot. Q8N884 for human protein) or a fragment of these proteins.

[0122] IPS-1 / MAVS / CARDif / VISA refers to the eukaryotic mitochondrial antiviral signaling protein containing an N-terminal CARD domain and with the Uniprot identifier (www.uniprot.org) Q7Z434 for the human sequence and Q8VCF0 for the murine sequence. The terms IPS-1 / MAVS, MAVS / IPS-1 and Petition 870260073253, dated 07 / 23 / 2026, p. 75 / 287 63 / 190 MAVS are used interchangeably here and refer to the eukaryotic mitochondrial antiviral signaling protein containing an N-terminal CARD domain and with the Uniprot identifier (www.uniprot.org) Q7Z434 for the human sequence and Q8VCF0 for the murine sequence.

[0123] In some embodiments, the heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of a protein containing the CARD domain or a fragment thereof and cyclic dinucleotide generating enzymes such as cyclic di-AMP, cyclic di-GMP and cyclic di-GAMP cyclases or a fragment thereof.

[0124] A fragment of a heterologous protein involved in the induction or regulation of an IFN response or a type I IFN response usually contains between 25 and 1,000 amino acids, preferably between 50 and 600 amino acids, more preferably between 100 and 400 amino acids, even more preferably between 100 and 362 amino acids. In some embodiments, a fragment of a heterologous protein involved in the induction or regulation of an IFN response or a type I IFN response comprises an N-terminal fragment of the heterologous proteins involved in the induction or regulation of an IFN response or a type I IFN response that usually contains between 25 and 1,000 amino acids.000 amino acids, preferably between 50 and 600 amino acids, more preferably between 100 and 400 amino acids, even more preferably between 100 and 362 amino acids, in particular between 100 and 246 amino acids, or comprises an N-terminal fragment of heterologous proteins involved in the induction or regulation of an IFN response or a type I IFN response having a deletion of an amino acid sequence containing between 1 and 160 amino acids from the N-terminal amino acids, preferably a deletion of an amino acid sequence containing N-terminal amino acids 1 to 59 or N-terminal amino acids 1 to 160, and wherein the N-terminal fragment... Petition 870260073253, dated 07 / 23 / 2026, p. 76 / 287 The 64 / 190 terminal of heterologous proteins involved in the induction or regulation of an IFN response or a type I IFN response usually contains between 25 and 1,000 amino acids, preferably between 50 and 600 amino acids, more preferably between 100 and 400 amino acids, and even more preferably between 100 and 362 amino acids.

[0125] A fragment of a protein containing heterologous CARD domains involved in the induction or regulation of an IFN response or a type I IFN response usually contains an amino acid sequence from N-terminal amino acid 1 to any N-terminal amino acid 100 to 500, preferably an amino acid sequence from N-terminal amino acid 1 to any N-terminal amino acid 100 to 400, more preferably an amino acid sequence from N-terminal amino acid 1 to any N-terminal amino acid 100 to 300, more preferably an amino acid sequence from N-terminal amino acid 1 to any N-terminal amino acid 100 to 294, most preferably an amino acid sequence from N-terminal amino acid 1 to any N-terminal amino acid 100 to 246.

[0126] In some embodiments, a fragment of a CARD domain containing heterologous proteins involved in the induction or regulation of an IFN response or a type I IFN response contains an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 294, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 246, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 245, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 229, a sequence of Petition 870260073253, dated 07 / 23 / 2026, p. 77 / 287 65 / 190 amino acids comprising at least N-terminal amino acid 1 and no more than N-terminal amino acid 228, an amino acid sequence comprising at least N-terminal amino acid 1 and no more than N-terminal amino acid 218, an amino acid sequence comprising at least N-terminal amino acid 1 and no more than N-terminal amino acid 217, an amino acid sequence comprising at least N-terminal amino acid 1 and no more than N-terminal amino acid 100, and an amino acid sequence comprising at least N-terminal amino acid 1 and no more than N-terminal amino acid 101, more particularly an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least N-terminal amino acid 1 and no more than N-terminal amino acid 245, an amino acid sequence comprising at least N-terminal amino acid 1 and no more than N-terminal amino acid 228,an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 217 and an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 100 of a human CARD domain.

[0127] In some preferred embodiments, a fragment of a CARD domain containing heterologous proteins involved in the induction or regulation of an IFN response or a type I IFN response contains an amino acid sequence selected from the group consisting of an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 294, an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 246, an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 245, an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 229, an amino acid sequence from Petition 870260073253, dated 07 / 23 / 2026, p. 78 / 287 66 / 190 amino acid N-terminal 1 to amino acid N-terminal 228, an amino acid sequence from amino acid N-terminal 1 to amino acid N-terminal 218, an amino acid sequence from amino acid N-terminal 1 to amino acid N-terminal 217, an amino acid sequence from amino acid N-terminal 1 to amino acid N-terminal 100, an amino acid sequence from amino acid N-terminal 1 to amino acid N-terminal 101, more particularly an amino acid sequence selected from the group consisting of an amino acid sequence from amino acid N-terminal 1 to amino acid N-terminal 245, an amino acid sequence from amino acid N-terminal 1 to amino acid N-terminal 228, an amino acid sequence from amino acid N-terminal 1 to amino acid N-terminal 217 and an amino acid sequence from amino acid N-terminal 1 to amino acid N-terminal 100 of a human CARD domain.

[0128] A fragment of cyclic dinucleotide-generating enzymes such as cyclic di-AMP, cyclic di-GMP and cyclic di-GAMP cyclases usually contains an amino acid sequence from N-terminal amino acid 1 to any N-terminal amino acid 100 to 600, preferably an amino acid sequence from N-terminal amino acid 50 to any N-terminal amino acid 100 to 550, more preferably an amino acid sequence from N-terminal amino acid 60 to any N-terminal amino acid 100 to 530, in particular, an amino acid sequence from N-terminal amino acid 60 to N-terminal amino acid 530, an amino acid sequence from N-terminal amino acid 146 to N-terminal amino acid 507 or an amino acid sequence from N-terminal amino acid 161 to N-terminal amino acid 530, more particularly an amino acid sequence from the N-terminal amino acid 161 to the N-terminal amino acid 530 of human cGAS.In some embodiments, a cGAS fragment contains, in particular, an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least the... Petition 870260073253, dated 07 / 23 / 2026, p. 79 / 287 67 / 190 amino acid N-terminal 60 and no more than amino acid N-terminal 422, an amino acid sequence comprising at least amino acid N-terminal 146 and no more than amino acid N-terminal 507, and an amino acid sequence comprising at least amino acid N-terminal 161 and no more than amino acid N-terminal 522. In some embodiments, a cGAS fragment contains more particularly an amino acid sequence selected from the group consisting of an amino acid sequence from amino acid N-terminal 60 to amino acid N-terminal 422, an amino acid sequence from amino acid N-terminal 146 to amino acid N-terminal 507, and an amino acid sequence from amino acid N-terminal 161 to amino acid N-terminal 522.

[0129] In a more preferred embodiment, the heterologous protein involved in the induction or regulation of a type I IFN response is selected from the group consisting of the CARD domain comprising RIG1, MDA5 and MAVS / IPS-1 or a fragment thereof and cGAS and a fragment thereof, in particular, selected from the group consisting of the CARD domain comprising RIG1 and a fragment thereof, the CARD domain comprising MAVS / IPS-1 and a fragment thereof, and cGAS and a fragment thereof. Fragments of these proteins are particularly preferred.In this most preferred embodiment, the CARD domain comprising RIG1, MDA5, MAVS / IPS-1 comprises the naturally occurring CARD domain(s) and additionally C-terminal amino acids following the naturally occurring CARD domain(s) comprising the naturally occurring helicase domain in the case of RIG-1 or a fragment thereof, preferably a fragment containing 1 to 500, more preferably 1 to 250, even more preferably 1 to 150 amino acids in which the naturally occurring helicase domain or fragment thereof is not functional, i.e., does not bind a CARD domain, or comprises downstream the C sequence. Petition 870260073253, dated 07 / 23 / 2026, page 80 / 287 68 / 190 terminal in the case of MAVS / IPS-1 or a fragment thereof, preferably a fragment containing 1 to 500, more preferably 1 to 250, even more preferably 1 to 150 amino acids. In these embodiments, cGAS and a fragment thereof usually comprise the naturally occurring synthase domain (NTase core and C-terminal domain; amino acids 160 to 522 of human cGAS as described in 65e as Uniprot. Q8N884 for the human protein), preferably, cGAS and a fragment thereof comprise the naturally occurring synthase domain but have a deletion of a portion or the entire N-terminal domain, preferably a deletion of the entire N-terminal helical extension (N-terminal helical extension; amino acids 1 to 160 of human cGAS as described in 65e as Uniprot. Q8N884 for the human protein). Deletion of a portion or the entire N-terminal domain is preferably a deletion of amino acids 1 to 59.

[0130] In some embodiments, heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of the RIG-like receptor (RLR) family (such as RIG1 and MDA5) and a fragment thereof, other proteins containing the CARD domain involved in antiviral signaling and type I IFN induction (such as MAVS / IPS-1) and a fragment thereof, and cyclic dinucleotide-generating enzymes such as cyclic di-AMP, cyclic di-GMP and cyclic di-GAMP cyclases selected from the group consisting of WspR, DncV, DisA and DisA-like, CdaA, CdaS and cGAS, and a fragment thereof, leading to STING stimulation.

[0131] In some embodiments, the heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of RIG1, MDA5, LGP2, MAVS / IPS-1, WspR, DncV, DisA and DisA-like, CdaA, CdaS and cGAS or a fragment thereof, more preferably selected from the group consisting of RIG1, WspR, DncV, DisA-like and Petition 870260073253, dated 07 / 23 / 2026, p. 81 / 287 69 / 190 cGAS or a fragment thereof.

[0132] In a more preferred embodiment, the protein involved in the induction or regulation of a type I IFN response is selected from the group consisting of RIG1, MDA5, MAVS / IPS-1, WspR, DncV, DisA and DisA-like, CdaA and cGAS or a fragment thereof, even more preferably, selected from the group consisting of RIG1, MDA5, MAVS / IPS-1, WspR, DncV, DisA-like, CdaA and cGAS or a fragment thereof, in particular, selected from the group consisting of RIG1, MAVS / IPS-1 and cGAS or a fragment thereof. Fragments of these proteins are particularly preferred.

[0133] In this most preferred embodiment, a fragment of RIG1, MDA5, MAVS / IPS-1 usually contains an amino acid sequence from N-terminal amino acid 1 to any N-terminal amino acid 100 to 500, preferably an amino acid sequence from N-terminal amino acid 1 to any N-terminal amino acid 100 to 400, most preferably an amino acid sequence from N-terminal amino acid 1 to any N-terminal amino acid 100 to 300.

[0134] In this most preferred embodiment, a fragment of RIG 1 contains an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 246, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 245, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 229, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 228, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 218, and an amino acid sequence comprising at least the N-terminal amino acid 1 and no more Petition 870260073253, dated 07 / 23 / 2026, p. 82 / 287 70 / 190 that the N-terminal amino acid 217; and a fragment of MAVS / IPS-1 contains an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 100 and an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the N-terminal amino acid 101.

[0135] In this more preferred embodiment, a fragment of RIG 1 contains more particularly an amino acid sequence selected from the group consisting of an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 246, an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 245, an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 229, an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 228, an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 218 and an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 217; and a fragment of MAVS / IPS-1 contains more particularly a selected amino acid sequence from the group consisting of an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 100 and an amino acid sequence from N-terminal amino acid 1 to N-terminal amino acid 101.

[0136] In this most preferred embodiment, a cGAS fragment usually contains an amino acid sequence from N-terminal amino acid 1 to any N-terminal amino acid 100 to 600, preferably an amino acid sequence from N-terminal amino acid 50 to any N-terminal amino acid 100 to 550, more preferably an amino acid sequence from N-terminal amino acid 60 to any N-terminal amino acid 100 to 530, in particular, an amino acid sequence from N-terminal amino acid 60 to amino acid N Petition 870260073253, dated 07 / 23 / 2026, p. 83 / 287 71 / 190 terminal 530, an amino acid sequence from N-terminal amino acid 146 to N-terminal amino acid 507 or an amino acid sequence from N-terminal amino acid 161 to N-terminal amino acid 530, more particularly an amino acid sequence from N-terminal amino acid 60 to N-terminal amino acid 530, or an amino acid sequence from N-terminal amino acid 161 to N-terminal amino acid 530 of human cGAS.

[0137] In this most preferred embodiment, a cGAS fragment contains, in particular, an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least the N-terminal amino acid 60 and no more than the N-terminal amino acid 422, an amino acid sequence comprising at least the N-terminal amino acid 146 and no more than the N-terminal amino acid 507, and an amino acid sequence comprising at least the N-terminal amino acid 161 and no more than the N-terminal amino acid 522.

[0138] In this most preferred embodiment, a cGAS fragment contains more particularly an amino acid sequence selected from the group consisting of an amino acid sequence from N-terminal amino acid 60 to N-terminal amino acid 422, an amino acid sequence from N-terminal amino acid 146 to N-terminal amino acid 507, an amino acid sequence from N-terminal amino acid 161 to N-terminal amino acid 522.

[0139] In a further preferred embodiment, the protein involved in inducing or regulating a type I IFN response is selected from the group consisting of human RIG1 CARD1-245 domains (SEQ ID NO: 37), human RIG1 CARD1-228 domains (SEQ ID NO: 128), human RIG1 CARD1-217 domains (SEQ ID NO: 129), murine RIG1 CARD1-246 domains (SEQ ID NO: 38), murine RIG1 CARD1-229 domains (SEQ ID NO: 110), murine RIG1 CARD1-218 domains (SEQ ID NO: 111), human MAVS CARD1-100 domain (SEQ ID NO: 116), Petition 870260073253, dated 07 / 23 / 2026, page 84 / 287 72 / 190 domain CARD1-101 from murine MAVS (SEQ ID NO: 130), cGAS from N. vectensis (SEQ ID NO: 43), CGAS161-522 from humans (SEQ ID NO: 115), CGAS146-507 from murine (SEQ ID NO: 131) and CGAS60-422 from N. vectensis (SEQ ID NO: 117).

[0140] In a particularly preferred embodiment, the protein involved in the induction or regulation of a type I IFN response is selected from the group consisting of human RIG1 CARD1-245 domains (SEQ ID NO: 37), human RIG1 CARD1-228 domains (SEQ ID NO: 128), human RIG1 CARD1-217 domains (SEQ ID NO: 129), human MAVS CARD1-100 domain (SEQ ID NO: 116) and human CGAS161-522 (SEQ ID NO: 115).

[0141] In a more particularly preferred embodiment, the protein involved in inducing or regulating a type I IFN response is selected from the group consisting of human RIG1 CARD1-245 domains, murine RIG1 CARD1246 domains, murine RIG1 CARD1-229 domains, murine RIG1 CARD1-218 domains, human MAVS1-100, N. vectensis cGAS, human cGAS161-522 and N. vectensis cGAS60-422.

[0142] The RIG-like receptor (RLR) family comprises selected proteins from the group consisting of RIG1, MDA5, and LGP2. The preferred heterologous proteins involved in the induction or regulation of a type I IFN response are the RIG1 and MDA5 proteins containing the CARD domain, in particular, the RIG1 protein containing the CARD domain. Other proteins containing the CARD domain involved in the induction of type I IFN comprise selected proteins from the group consisting of MAVS / IPS-1.

[0143] In some preferred embodiments, the heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group of proteins comprising a RIG1 CARD domain, an MDA5 CARD domain and / or a MAVS / IPS-1 CARD domain, and WspR, Petition 870260073253, dated 07 / 23 / 2026, page 85 / 287 73 / 190 DncV, DisA and DisA-type, CdaA, CdaS and cGAS and a fragment thereof, preferably selected from the group of proteins comprising a CARD domain of RIG1 and / or a CARD domain of MAVS / IPS-1 and WspR, DncV, DisA and DisA-type, CdaA and cGAS or a fragment thereof.

[0144] In some preferred embodiments, the heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of a CARD domain of RIG1, a CARD domain of MDA5, a CARD domain of MAVS / IPS-1, WspR, DncV, DisA and DisA-like, CdaA, CdaS and cGAS, more preferably, selected from the group consisting of a CARD domain of RIG1, WspR, DncV, DisA-like and cGAS.

[0145] In some preferred embodiments, the heterologous proteins involved in the induction or regulation of a type I IFN response comprise one or more (e.g., two, three, or four) CARD domains, preferably comprising one or more (e.g., two, three, or four) CARD domains of RIG1, MDA5, and / or MAVS / IPS-1, preferably of RIG1 and / or MAVS / IPS-1. In a more preferred embodiment, the heterologous proteins involved in the induction or regulation of a type I IFN response comprise the CARD domains of RIG1 or MDA5, in particular, RIG1.

[0146] In some embodiments, the heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of a type I IFN response-inducing protein without enzymatic function or a type I IFN response-inducing protein with enzymatic function. A type I IFN response-inducing protein without enzymatic function covered by the present invention usually comprises at least one CARD domain, preferably two CARD domains. A CARD domain is typically composed of a cluster of six to seven alpha helices, Petition 870260073253, dated 07 / 23 / 2026, p. 86 / 287 74 / 190 preferably, an arrangement of six to seven antiparallel alpha helices with a hydrophobic core and an outer face composed of charged residues. A type I IFN response-inducing protein with enzymatic function encompassed by the present invention usually comprises a cyclic dinucleotide-generating enzyme (cyclic di-AMP, cyclic di-GMP and cyclic di-GAMP cyclases) or a domain thereof, leading to STING stimulation, preferably a diadenylate cyclase (DAC), diguanylate cyclase (DGC) or GMP-AMP cyclase (GAC) or domain thereof.

[0147] According to the present invention, proteins involved in apoptosis or regulation of apoptosis include, but are not limited to, Bad, Bcl2, Bak, Bmt, Bax, Puma, Noxa, Bim, Bcl-XL, Apaf1, Caspase 9, Caspase 3, Caspase 6, Caspase 7, Caspase 10, DFFA, DFFB, ROCK1, APP, CAD, ICAD, CAD, EndoG, AIF, HtrA2, Smac / Diablo, Arts, ATM, ATR, Bok / Mtd, Bmf, Mcl-1(S), IAP family, LC8, PP2B, 14-3-3 proteins, PKA, PKC, PI3K, Erk1 / 2, p90RSK, TRAF2, TRADD, FADD, Daxx, Caspase8, Caspase2, RIP, RAIDD, MKK7, JNK, FLIPs, FKHR, GSK3, CDKs and their inhibitors such as the INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)) and the Cip1 / Waf1 / Kip1-2 family (p21(Cip1 / Waf1), p27(Kip1), p57(Kip2).Preferably, Bad, Bmt, Bcl2, Bak, Bax, Puma, Noxa, Bim, Bcl-xL, Caspase9, Caspase3, Caspase6, Caspase7, Smac / Diablo, Bok / Mtd, Bmf, Mcl-1(S), LC8, PP2B, TRADD, Daxx, Caspase8, Caspase2, RIP, RAIDD, FKHR, CDKs and their inhibitors such as the INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)), most preferably, BIM, Bid, truncated Bid, FADD, Caspase 3 (and its subunits), Bax, Bad, Akt, CDKs and their inhibitors such as the INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)) are used11-13. Additionally, proteins involved in apoptosis or the regulation of apoptosis include DIVA, BclXs, Nbk / Bik, Hrk / Dp5, Bid and tBid, Egl-1, Bcl-Gs, Cytochrome C, Beclin, CED-13, BNIP1, BNIP3, Bcl-B, Bcl-W, Ced-9, A1, NR13, Bfl-1, Caspase 1, Caspase 2, Caspase. Petition 870260073253, dated 07 / 23 / 2026, p. 87 / 287 75 / 190 4, Caspase 5 and Caspase 8.

[0148] Proteins involved in apoptosis or the regulation of apoptosis are selected from the group consisting of pro-apoptotic proteins, anti-apoptotic proteins, inhibitors of apoptosis prevention pathways, and inhibitors of pro-survival signaling or pathways. Pro-apoptotic proteins comprise proteins selected from the group consisting of Bax, Bak, Diva, Bcl-Xs, Nbk / Bik, Hrk / Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Apaf1, Smac / Diablo, BNIP1, BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, Cytochrome C, FADD, the Caspase family and CDKs and their inhibitors such as the INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)) or selected from the group consisting of Bax, Bak, Diva, Bcl-Xs, Nbk / Bik, Hrk / Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Egl-1, Apaf1, Smac / Diablo, BNIP1, BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, Cytochrome C, FADD and the Caspase family.Bax, Bak, Diva, Bcl-Xs, Nbk / Bik, Hrk / Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Egl-1, Apaf1, BNIP1, BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, Smac / Diablo, FADD, the Caspase family, CDKs and their inhibitors such as the INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)). Bax, Bak, Diva, Bcl-Xs, Nbk / Bik, Hrk / Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Apaf1, BNIP1, BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, Smac / Diablo, FADD, the Caspase family, are also preferred.

[0149] Anti-apoptotic proteins comprise selected proteins from the group consisting of Bcl-2, Bcl-XI, Bcl-B, Bcl-W, Mcl-1, Ced-9, A1, NR13, IAP family and Bfl-1. Bcl-2, Bcl-XI, Bcl-B, Bcl-W, Mcl-1, Ced-9, A1, NR13 and Bfl-1 are preferred. Inhibitors of apoptosis prevention pathways comprise selected proteins from the group consisting of Bad, Noxa and Cdc25A. Bad and Noxa are preferred.

[0150] Signaling inhibitors or pro-survival pathways comprise selected proteins from the group consisting of PTEN, ROCK, PP2A, PHLPP, JNK, Petition 870260073253, dated 07 / 23 / 2026, page 88 / 287 76 / 190 p38. PTEN, ROCK, PP2A and PHLPP are preferred.

[0151] In some embodiments, heterologous proteins involved in apoptosis or apoptosis regulation are selected from the group consisting of only BH3 proteins, caspases, and intracellular signaling proteins controlling apoptosis death receptors. Only BH3 proteins are preferred.

[0152] The BH3-only proteins comprise selected proteins from the group consisting of Bad, BIM, Bid and tBid, Puma, Bik / Nbk, Bod, Hrk / Dp5, BNIP1, BNIP3, Bmf, Noxa, Mcl-1, Bcl-Gs, Beclin 1, Egl-1 and CED-13. Bad, BIM, Bid and tBid are preferred, in particular tBid.

[0153] Caspases comprise proteins selected from the group consisting of Caspase 1, Caspase 2, Caspase 3, Caspase 4, Caspase 5, Caspase 6, Caspase 7, Caspase 8, Caspase 9, Caspase 10. Caspase 3, Caspase 8 and Caspase 9 are preferred.

[0154] Intracellular signaling proteins controlling apoptosis death receptors comprise selected proteins from the group consisting of FADD, TRADD, ASC, BAP31, GULP1 / CED-6, CIDEA, MFG-E8, CIDEC, RIPK1 / RIP1, CRADD, RIPK3 / RIP3, Crk, SHB, CrkL, DAXX, the 14-3-3 family, FLIP, DFF40 and 45, PEA-15, SODD. FADD and TRADD are preferred.

[0155] In some embodiments, two heterologous proteins involved in apoptosis or apoptosis regulation are understood by the Gram-negative bacterial strain, wherein one protein is a pro-apoptotic protein and the other protein is an inhibitor of apoptosis prevention pathways, or wherein one protein is a pro-apoptotic protein and the other protein is an inhibitor of pro-survival signaling or pathways.

[0156] The pro-apoptotic proteins covered by the present invention usually have an alpha helical structure, preferably a helix. Petition 870260073253, dated 07 / 23 / 2026, page 89 / 287 77 / 190 hydrophobic surrounded by amphipathic helices and usually comprising at least one of the BH1, BH2, BH3 or BH4 domains, preferably comprising at least one BH3 domain. Usually, the pro-apoptotic proteins covered by the present invention do not have enzymatic activity.

[0157] The anti-apoptotic proteins covered by the present invention usually have an alpha helical structure, preferably a hydrophobic helix surrounded by amphipathic helices, and comprise a combination of different BH1, BH2, BH3 and BH4 domains, preferably a combination of different BH1, BH2, BH3 and BH4 domains in which a BH1 and a BH2 domain are present, more preferably BH4-BH3-BH1-BH2, BH1-BH2, BH4-BH1BH2 or BH3-BH1-BH2 (from the N to the C-terminal). Additionally, proteins containing at least one BIR domain are also covered.

[0158] Apoptosis prevention pathway inhibitors covered by the present invention usually have an alpha helical structure, preferably a hydrophobic helix surrounded by amphipathic helices, and usually comprise a BH3 domain.

[0159] The BH1, BH2, BH3, or BH4 domains usually each have between about 5 and about 50 amino acids in length. Thus, in some embodiments, the heterologous protein involved in apoptosis or apoptosis regulation is selected from the group consisting of heterologous proteins involved in apoptosis or apoptosis regulation that are about 5 to about 200, preferably about 5 to about 150, more preferably about 5 to about 100, most preferably about 5 to about 50, in particular, about 5 to about 25 amino acids in length.

[0160] In some embodiments, the Gram-negative bacterial strain of the present invention comprises a nucleotide sequence encoding two domains of a heterologous protein involved in apoptosis or regulation. Petition 870260073253, dated 07 / 23 / 2026, p. 90 / 287 78 / 190 of apoptosis, preferably, two repeated, more preferably, two identical repeated domains of a protein involved in apoptosis or regulation of apoptosis, or two domains of different proteins involved in apoptosis or regulation of apoptosis, most preferably, two identical repeated domains of a protein involved in apoptosis or regulation of apoptosis. In some embodiments, the Gram-negative bacterial strain of the present invention comprises a nucleotide sequence encoding two domains of a heterologous protein involved in apoptosis or regulation of apoptosis, wherein one is a domain of a pro-apoptotic protein and the other is a domain of a protein that is an inhibitor of apoptosis prevention pathways, or wherein one is a domain of a pro-apoptotic protein and the other domain is a domain of a protein that is an inhibitor of signaling or pro-survival pathways.

[0161] A particularly preferred heterologous protein is the BH3 domain of the apoptosis inducer tBID, more particularly the BH3 domain comprising a sequence selected from the group consisting of SEQ ID NOs: 29 to 32, preferably SEQ ID NO: 31 or SEQ ID NO: 32. Equally preferred is the BH3 domain of the apoptosis regulator BAX, more particularly the BAX domain comprising a sequence selected from the group consisting of SEQ ID NOs: 33 to 36, preferably SEQ ID NO: 35 or SEQ ID NO: 36. Human and murine sequences are given in SEQ ID NOs, but tBID and BAX BH3 domains from all other species are equally included.

[0162] In some embodiments, the heterologous protein repeat domains are the BH3 domain, preferably, tBID apoptosis inducer BH3 repeat domains, more preferably, tBID apoptosis inducer BH3 repeat domains comprised by SEQ ID NO: 29 to 32 or SEQ ID NO: 25 or SEQ ID NO: 19, even more preferably, two BH3 repeat domains Petition 870260073253, dated 07 / 23 / 2026, p. 91 / 287 79 / 190 of the tBID apoptosis inducer, most preferably, two BH3 repeat domains of the tBID apoptosis inducer comprised by SEQ ID NO: 29 to 32 or SEQ ID NO: 25 or SEQ ID NO: 19, in particular, two BH3 repeat domains of the tBID apoptosis inducer comprised by the sequence SEQ ID NO: 27. Thus, in a preferred embodiment, the Gram-negative bacterial strain and / or vector of the present invention comprises a second DNA sequence encoding two repeat domains of a BH3 domain, more preferably, two BH3 repeat domains of the tBID apoptosis inducer. The two repeat domains may be connected by a connector of 1 to 30 amino acids in length, preferably 2 to 15 amino acids, more preferably 3 to 10 amino acids in length.

[0163] In some embodiments, the two or more different heterologous protein domains are heterologous protein domains belonging to the same functional class of proteins; preferably, the different heterologous proteins of the two or more domains are different heterologous proteins from the class of proteins involved in apoptosis or apoptosis regulation. In a preferred embodiment, the two or more different heterologous protein domains are the BH3 domain of the apoptosis inducer tBID and the BH3 domain of the apoptosis regulator BAX, in particular, the fused BH3 domains comprised by the sequence SEQ ID NO: 24 and 28. The two different heterologous protein domains may be connected by a connector of 1 to 30 amino acids in length, preferably 2 to 15 amino acids, more preferably 3 to 10 amino acids in length.

[0164] Another particularly preferred heterologous protein is a domain of a protein involved in the induction or regulation of a type I IFN response, more particularly a CARD domain of RIG1 comprising a sequence selected from the group consisting of SEQ ID NOs: 37, 38, 110, 111, Petition 870260073253, dated 07 / 23 / 2026, page 92 / 287 80 / 190 128, 129, an MDA5 CARD domain comprising a sequence selected from the group consisting of SEQ ID NOs: 44 to 47, 112, 113, preferably SEQ ID NOs: 112 or 113, or an MAVS / IPS-1 CARD domain comprising a sequence selected from the group consisting of SEQ ID NO: 116, 48 to 49, preferably SEQ ID NO: 116, full-length cGAS such as N. vectensis cGAS (SEQ ID NO: 43), human cGAS161-522 (SEQ ID NO: 115), N. vectensis cGAS60-422 (SEQ ID NO: 117) or murine cGAS146-507 (SEQ ID NO: 131). More specifically, a CARD domain of RIG1 comprising a sequence selected from the group consisting of SEQ ID NOs: 37, 38, 110, 111, 128, 129, a CARD domain protein comprising MAVS / IPS-1 comprising a sequence selected from the group consisting of SEQ ID NO: 116, 48 to 49, preferably SEQ ID NO: 116, and full-length cGAS such as cGAS from N. vectensis (SEQ ID NO: 43), human cGAS161-522 (SEQ ID NO: 115), cGAS60-422 from N.vectensis (SEQ ID NO: 117) or murine cGAS146-507 (SEQ ID NO: 131).

[0165] In some embodiments, the heterologous protein is a prodrug-converting enzyme. In these embodiments, the recombinant Gram-negative bacterial strain of attenuated virulence preferably expresses and secretes a prodrug-converting enzyme. A prodrug-converting enzyme, as referred to in the present invention, comprises enzymes that convert non-toxic prodrugs into a toxic drug, preferably enzymes selected from the group consisting of cytosine deaminase, purine nucleoside phosphorylase, thymidine kinase, beta-galactosidase, carboxylesterases, nitroreductase, carboxypeptidases and beta-glucuronidases, more preferably enzymes selected from the group consisting of cytosine deaminase, purine nucleoside phosphorylase, thymidine kinase and beta-galactosidase.

[0166] The term “protease cleavage site” as used in this Petition 870260073253, dated 07 / 23 / 2026, page 93 / 287 The invention relates to a specific amino acid motif within an amino acid sequence, for example, within an amino acid sequence of a protein or a fusion protein, which is cleaved by a specific protease that recognizes the amino acid motif. For review see 14. Examples of protease cleavage sites are amino acid motifs, which are cleaved by a protease selected from the group consisting of enterokinase (light chain), enteropeptidase, precision protease, human rhinovirus protease (HRV 3C), TEV protease, TVMV protease, Factor Xa protease, and thrombin. The following amino acid motif is recognized by the respective protease: Asp-Asp-Asp-Asp-Lys: Enterokinase (light chain) / Enteropeptidase Leu-Glu-Val-Leu-Phe-Gln / Gly-Pro: Protease PreScission / human rhinovirus protease (HRV 3C) - Glu-Asn-Leu-Tyr-Phe-Gln-Ser and modified motifs based on Glu-XX-Tyr-X-Gln-Gly / Ser (where X is any amino acid) recognized by the TEV (tobacco etch virus) protease. - Glu-Thr-Val-Arg-Phe-Gln-Ser: TVMV protease - Ile-(Glu or Asp)-Gly-Arg: FactorXa protease - Leu-Val-Pro-Arg / Gly-Ser: Thrombin.

[0167] Covered by protease cleavage sites as used in the present invention is ubiquitin. Thus, in some preferred embodiments, ubiquitin is used as a protease cleavage site, i.e., a nucleotide sequence encoding ubiquitin as a protease cleavage site, which can be cleaved by a specific ubiquitin-processing protease at the N-terminal site, for example, which can be cleaved by a specific ubiquitin-processing protease called Deubiquitinating enzyme at the N-terminal site endogenously in the cell where the protein Petition 870260073253, dated 07 / 23 / 2026, p. 94 / 287 82 / 190 of the fusion was delivered. Ubiquitin is processed at its C-terminus by a group of endogenous C-terminal proteases specific to ubiquitin (deubiquitinating enzymes, DUBs). The cleavage of ubiquitin by DUBs supposedly occurs at the C-terminus of ubiquitin itself (after G76).

[0168] An individual, subject, or patient is a vertebrate. In certain embodiments, the vertebrate is a mammal. Mammals include, but are not limited to, primates (including human and non-human primates) and rodents (e.g., mice and rats). In preferred embodiments, a subject is a human being.

[0169] The term mutation is used in the present invention as a generic term and includes single base pair and multiple base pair changes. Such mutations may include substitutions, frameshift mutations, deletions, insertions, and truncations.

[0170] The term nuclear localization signal as used herein refers to an amino acid sequence that marks a protein for import into the nucleus of a eukaryotic cell and preferably includes a viral nuclear localization signal, such as the NLS derived from the large T antigen SV40 (PPKKKRKV).

[0171] The term multiple cloning site as used in the present invention refers to a short DNA sequence containing multiple restriction sites for cleavage by restriction endonucleases such as AclI, HindIII, SspI, MluCI, Tsp509I, PciI, AgeI, BspMI, BfuAI, SexAI, MluI, BceAI, HpyCH4IV, HpyCH4III, BaeI, BsaXI, AflIII, Spel, BsrI, Bmrl, BgIII, AfeI, AluI, StuI, ScaI, ClaI, BspDI, p1-SceI, NsiI, AseI, SwaI, CspCI, MfeI, BssSI, BmgBI, PmlI, DraIII, AleI, EcoP15I, PvuII, AlwNI, BtsIMutI, TspRI, Ndel, NlaIII, CviAII, FatI, MslI, FspEI, XcmI, BstXI, PflMI, BccI, NcoI, BseYI, FauI, SmaI, NciI, AvrII, MnlI, Petition 870260073253, dated 07 / 23 / 2026, p. 95 / 287 83 / 190 BbvCI, Nb.BbvCI, Nt.BbvCI, SbfI, Bpu10I, Bsu36I, EcoNI, HpyAV, BstNI, PspGI, StyI, BcgI, PvuI, BstUI, EagI, RsrII, BsiEI, BsiWI, BsmBI, Hpy9I, MspJI, MspJI, SgrAI, BfaI, BspCNI, XhoI, Earl, AcuI, PstI, BpmI, DdeI, SfcI, AfLII, BpuEI, SmlI, AvaI, BsoBI, MboII, Bbsl, XmnI, BsmI, Nb.BsmI, EcoRIII, HGal, Zral, Zral, Pth1 PshAI, AhdI, DrdI, Eco53kI, SacI, BseRI, PleI, Nt.BstNBI, MlyI, HinfI, EcoRV, MboI, Sau3AI, DpnII BfuCI, DpnI, BsaBI, TfiI, BsrDI, Nb.Bsr, BcDI, BcbI, NBIbc. BstAPI, SfaNI, SphI, NmeAIII, NaeI, NgOMIV, BglI, AsiSI, BtgZI, HinPlI, HhaI, BssHII, NotI, Fnu4HI, Cac8I, MwoI, NheI, BmtI, SapI, BspQI, Nt. 1286I, AlwI, Nt.AlwI, BamHI, FokI, BtsCI, HaeIII, PhoI, FseI, SfiI, NarI, CasI, SfoI, pluTI, AscI, EciI, BsmFI, ApaI, PspOMI, Sau96I, NlaIV, Accn5I, Bsal, BstHII, BstI, HII AvaII, BanI, BaeGI, BsaHI, BanII, Rsal, CviQI, BstZ17I, BciVI, SalI, Nt.BsmAI, BsmAI, BcoDI, ApaLI, BsgI, Acd, Hpy166II, Tsp45I, HpaI, PmeI, HincII, BsiHKAI, ApoI, NspI, BsrFI, BstYI, HaeII, CviKI-1, EcoO109I, PpuMI, I-CeuI, SnaBI, I-SceI, BSpHI, BspEI, MmeI, TaqaI, NruI, Hpy188I, Hpy188III, NcoI, NotI, EcoRI, EcoRV, BamHI, NheI, SacI, SalI, BstBI. The term "multiple cloning site" as used in the present invention further refers to a short DNA sequence used for recombination events such as, for example, in the Gateway cloning strategy or for methods such as Gibbson assembly or top cloning.

[0172] The term “wild-type strain” or “wild-type Gram-negative bacterial strain” as used in the present invention refers to a naturally occurring variant or a naturally occurring variant containing genetic modifications allowing the use of vectors, such as deletion mutations in restriction endonucleases or antibiotic resistance genes. These strains contain chromosomal DNA as well as, in some cases (e.g., Y. enterocolitica, S. flexneri), a non-virulence plasmid. Petition 870260073253, dated 07 / 23 / 2026, page 96 / 287 84 / 190 modified.

[0173] The term “wild-type Yersinia strain” as used in the present invention refers to a naturally occurring variant (such as Y. enterocolitica E40) or a naturally occurring variant containing genetic modifications allowing the use of vectors, such as deletion mutations in restriction endonucleases or antibiotic resistance genes (such as Y. enterocolitica MRS40, the ampicillin-sensitive derivative of Y. enterocolitica E40). These strains contain chromosomal DNA as well as an unmodified virulence plasmid (called pYV). Y. enterocolitica subsp. palearctica refers to the low-pathogenic strains of Y. enterocolitica, which are the opposite of the highly virulent strains of subsp. enterocolitica15,16. Y. enterocolitica subsp. palearctica lacks, in comparison with Y. enterocolitica subsp. enterocolitica, a high pathogenicity island (HPI). This HPI encodes the iron siderophore called Yersiniabactin17. The lack of Yersiniabactin in Y.enterocolitica subsp. palearctica makes its subspecies less pathogenic and dependent on systemic accessible iron induced by persistent infection in, for example, the liver or spleen17. Iron can become accessible to the bacteria in an individual, for example, by pretreatment with Deferoxamine, an iron chelator used to treat iron overload in patients18.

[0174] The term “compreendem” is generally used in the sense of including, that is, allowing the presence of one or more characteristics or components.

[0175] The term “about” refers to a range of values ​​± 10% of a specified value. For example, the phrase “about 200” includes ± 10% of 200, or from 180 to 220.

[0176] In one aspect the present invention provides a bacterial strain Petition 870260073253, dated 07 / 23 / 2026, p. 97 / 287 85 / 190 A recombinant Gram-negative attenuated virulence strain comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the recombinant Gram-negative attenuated virulence strain further comprises a deletion of a chromosomal gene encoding an endogenous growth-essential protein and an endogenous virulence plasmid comprising a nucleotide sequence comprising a gene encoding said endogenous growth-essential protein operatively linked to a promoter.

[0177] In another aspect, the present invention provides a recombinant Gram-negative bacterial strain of attenuated virulence comprising a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a bacterial effector protein release signal, wherein the nucleotide sequence encoding the bacterial effector protein release signal is operatively linked to a promoter, and wherein the recombinant Gram-negative bacterial strain of attenuated virulence further comprises an RNA modulation within an RNA thermosensor region upstream of a gene encoding an endogenous AraC-type DNA-binding protein.

[0178] In another aspect, the present invention provides a recombinant Gram-negative bacterial strain of attenuated virulence comprising a nucleotide molecule comprising a sequence of Petition 870260073253, dated 07 / 23 / 2026, page 98 / 287 86 / 190 nucleotides encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the heterologous protein is a protein involved in the induction or regulation of an interferon (IFN) response.

[0179] In another aspect, the present invention provides a recombinant attenuated virulence Gram-negative bacterial strain, as described herein, for use in a method of treating cancer in a subject, comprising the method of administering to the subject said recombinant attenuated virulence Gram-negative bacterial strain, wherein the recombinant attenuated virulence Gram-negative bacterial strain is administered in an amount that is sufficient to treat the subject.Preferably, the present invention provides a recombinant attenuated virulence Gram-negative bacterial strain, as described herein, for use in a method of treating a malignant solid cancerous tumor in a subject, wherein the recombinant attenuated virulence Gram-negative bacterial strain accumulates in the malignant solid tumor, comprising the method of administering said recombinant attenuated virulence Gram-negative bacterial strain to the subject, wherein the recombinant attenuated virulence Gram-negative bacterial strain is administered in an amount sufficient to treat the subject.

[0180] In some embodiments, the recombinant Gram-negative bacterial strain of attenuated virulence is deficient in the production of at least one bacterial effector protein that is virulent to eukaryotic cells.

[0181] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence is transformed with a Petition 870260073253, dated 07 / 23 / 2026, page 99 / 287 87 / 190 nucleotide molecule, for example, a vector that comprises the 5' to 3' direction: a prosecutor; a first nucleotide sequence that encodes a release signal for a bacterial effector protein, operatively linked to said promoter; a second nucleotide sequence that codes for a heterologous protein fused to the 3' end of said first nucleotide sequence.

[0182] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence is transformed with a nucleotide molecule, for example, a vector comprising in the 5' to 3' direction: a first nucleotide sequence that encodes a release signal or a fragment thereof from a bacterial effector protein; a second nucleotide sequence that codes for a heterologous protein fused to the 3' end of said first nucleotide sequence.

[0183] Preferably, the nucleotide sequence encoding a heterologous protein is flanked at its 3' end by a nucleotide sequence homologous to the nucleotide sequence of the endogenous virulence chromosome or plasmid at the 3' end of a bacterial effector protein release signal or a fragment thereof. More preferably, this nucleotide sequence flanking the homologous protein at its 3' end is homologous to a nucleotide sequence located within 10 kbp on the endogenous virulence chromosome or plasmid at the 3' end of the bacterial effector protein release signal or a fragment thereof. In particular, this sequence of Petition 870260073253, dated 07 / 23 / 2026, page 100 / 287 The 88 / 190 nucleotides flanking the homologous protein at its 3' end are homologous to a nucleotide sequence within the same operon on the chromosome or on an endogenous virulence plasmid as the release signal of a bacterial effector protein or a fragment thereof. In this embodiment, the transformation is usually performed so that the fused nucleotide sequence is inserted by homologous recombination into an endogenous virulence plasmid or chromosome, preferably into an endogenous virulence plasmid, of the recombinant Gram-negative bacterial strain of attenuated virulence, and the fused nucleotide sequence is operatively linked to a promoter of an endogenous virulence plasmid or chromosome, for example, of a chromosomal pathogenicity island. Preferably, the fused nucleotide sequence is operatively linked to a promoter of an endogenous virulence plasmid.In this embodiment, the nucleotide sequence comprises a release signal or a fragment thereof from a bacterial effector protein, preferably a fragment thereof, which provides homologous recombination at the homologous site on the chromosome or on an endogenous virulence plasmid, preferably on an endogenous virulence plasmid, to result in the nucleotide sequence to be placed in the structure at the 3' end of the release signal of the endogenous or chromosomal virulence plasmid that is operatively linked to the endogenous promoter.

[0184] In another embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence or the recombinant Gram-negative bacterial strain of attenuated virulence is transformed with a nucleotide molecule, preferably a DNA nucleotide molecule, comprising a nucleotide sequence encoding a heterologous protein and a nucleotide sequence that is homologous or Petition 870260073253, dated 07 / 23 / 2026, p. 101 / 287 89 / 190 identical to a nucleotide sequence encoding a release signal of a bacterial effector protein or that is homologous or identical to a nucleotide sequence encoding a fragment of a release signal of a bacterial effector protein, wherein the release signal of a bacterial effector protein or a fragment thereof is encoded in the chromosome or in an endogenous virulence plasmid of the recombinant Gram-negative bacterial strain of attenuated virulence. Preferably, the nucleotide sequence that is homologous or identical to a nucleotide sequence of a release signal of a bacterial effector protein or to a fragment thereof is located at the 5' end of the nucleotide sequence encoding a heterologous protein.More preferably, the nucleotide sequence encoding a heterologous protein is flanked at its 3' end by a nucleotide sequence homologous to the nucleotide sequence of the endogenous virulence chromosome or plasmid at the 3' end of the release signal of a bacterial effector protein or a fragment thereof. Even more preferably, this nucleotide sequence flanking the homologous protein at its 3' end is homologous to the nucleotide sequence located within 10 kbp on the chromosome or in an endogenous virulence plasmid at the 3' end of the release signal of a bacterial effector protein or a fragment thereof. In particular, this nucleotide sequence flanking the homologous protein at its 3' end is homologous to the nucleotide sequence and is within the same operon on the chromosome or in an endogenous virulence plasmid as the release signal of a bacterial effector protein or a fragment thereof.In this method, the transformation is usually carried out in such a way that the nucleotide sequence encoding a heterologous protein is inserted into an endogenous virulence plasmid or a chromosome of the bacterial strain. Petition 870260073253, dated 07 / 23 / 2026, page 102 / 287 90 / 190 A recombinant Gram-negative bacterium of attenuated virulence, preferably on an endogenous virulence plasmid, at the 3' end of a release signal of a bacterial effector protein encoded by the chromosome or endogenous virulence plasmid, wherein heterologous proteins fused to the release signal are expressed and secreted.

[0185] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence comprises a deletion of a chromosomal gene encoding an endogenous growth-essential protein and an endogenous virulence plasmid comprising a nucleotide sequence comprising a gene encoding said endogenous growth-essential protein operatively linked to a promoter. Typically, the gene encoding the endogenous growth-essential protein in the endogenous virulence plasmid encodes the same endogenous growth-essential protein as encoded by the deleted chromosomal gene. Preferably, the gene encoding an endogenous growth-essential enzyme located in the endogenous virulence plasmid comprises its endogenous promoter and its endogenous transcriptional terminator.In the case of a recombinant Gram-negative bacterial strain of attenuated virulence being a strain of Yersinia, the gene encoding an endogenous enzyme essential for growth is located in the endogenous virulence plasmid pYV and preferably comprises its endogenous promoter and its endogenous transcriptional terminator. The gene encoding the endogenous enzyme essential for growth, the endogenous promoter, and the endogenous transcriptional terminator are preferably located 122 bp upstream of the start of orf155 (SycO) in the endogenous virulence plasmid, for example, in pYV. The gene encoding the endogenous enzyme essential for growth, the endogenous promoter, and the terminator. Petition 870260073253, dated 07 / 23 / 2026, page 103 / 287 Endogenous transcriptional 91 / 190s usually replace an insertion sequence found in pYVe40, the virulence plasmid of Y. enterocolitica strains MRS40 and E40, but not in pYVe227, the virulence plasmid of Y. enterocolitica W22703 (Genbank: AF102990,1).

[0186] If the recombinant Gram-negative bacterial strain of attenuated virulence is a strain of Yersinia, the endogenous virulence plasmid is pYV (Yersinia Virulence Plasmid). If the recombinant Gram-negative bacterial strain of attenuated virulence is a strain of Salmonella, the endogenous insertion site is one of the gene clusters called SpiI or SpiII (for Salmonella pathogenicity island), a position where an effector protein is encoded elsewhere, or alternatively, one of the Salmonella virulence plasmids (SVPs).

[0187] Preferably, the nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein is inserted into an endogenous virulence plasmid at the native site of a bacterial effector protein, for example, at the native site of a virulence factor, preferably, in the case of the recombinant attenuated virulence Gram-negative bacterial strain being a Yersinia strain, at the native site of YopE or another Yop (YopH, YopO, YopP, YopM, YopT), preferably at the native site of YopE, or in the case of the recombinant attenuated virulence Gram-negative bacterial strain being a Salmonella strain, at the native site of an effector protein encoded within SpiI, SpiII or encoded elsewhere, preferably at the native site of an effector protein encoded within SpiI or SpiII, more preferably at the native site SopE or SteA.Preferably, the nucleotide sequence encoding a heterologous protein is fused into the structure at the 3' end of a sequence of... Petition 870260073253, dated 07 / 23 / 2026, p. 104 / 287 92 / 190 nucleotides encoding a release signal of a bacterial effector protein are operatively linked to a native promoter of a bacterial effector protein present in an endogenous virulence plasmid, for example, in the case of the attenuated virulence recombinant Gram-negative bacterial strain being a Yersinia strain, to a native promoter of a Yersinia virulon gene as outlined below, more preferably to the native YopE promoter or another Yop promoter (YopH, YopO, YopP, YopM, YopT), preferably to the native YopE promoter or, in the case of the attenuated virulence recombinant Gram-negative bacterial strain being a Salmonella strain, to a native SpiI or SpiII pathogenicity island promoter or of an effector protein encoded elsewhere as outlined below, more preferably to the native SopE, InvB or SteA promoter.

[0188] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence comprises a deletion of a chromosomal gene encoding an endogenous growth-essential protein and an endogenous virulence plasmid comprising a nucleotide sequence comprising a gene encoding said endogenous growth-essential protein operatively linked to a promoter, wherein the gene encoding an endogenous growth-essential protein is selected from a gene encoding an enzyme essential for amino acid production, a gene encoding an enzyme involved in peptidoglycan biosynthesis, a gene encoding an enzyme involved in LPS biosynthesis, a gene encoding an enzyme involved in nucleotide synthesis, and a gene encoding a translation initiation factor.

[0189] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence comprises a deletion of a chromosomal gene encoding an endogenous protein essential for the Petition 870260073253, dated 07 / 23 / 2026, page 105 / 287 93 / 190 growth and an endogenous virulence plasmid comprising a nucleotide sequence comprising a gene encoding said endogenous growth-essential protein operatively linked to a promoter, wherein the gene encoding an endogenous growth-essential enzyme is a gene encoding an enzyme essential for amino acid production, wherein the enzyme essential for amino acid production is selected from the group consisting of aspartate-beta-semialdehyde dehydrogenase (asd), glutamine synthetase (glnA), tryptophanyl tRNA synthetase (trpS) or serine hydroxymethyltransferase (glyA) or Transketolase 1 (tktA), Transketolase 2 (tktB), Ribulose-phosphate 3-epimerase (rpe), Ribose-5-phosphate isomerase A (rpiA), Transaldolase A (talA), Transaldolase B (talB), phosphoribosylpyrophosphate synthase (prs), ATP phosphoribosyltransferase (hisG), bifunctional histidine biosynthesis protein HisIE (hisl),1-(5-phosphoribosyl)-5-[(5-phosphoribosylamine)methylidenoamine] Imidazole-4-carboxamide isomerase (hisA), HisH subunit of Imidazole glycerol phosphate synthase (hisH), HisF subunit of Imidazole glycerol phosphate synthase (hisF), Histidine biosynthesis bifunctional protein HisB (hisB), Histidinol-phosphate aminotransferase (hisC), Histidinol dehydrogenase (hisD), 3-dehydroquinate synthase (aroB), 3-dehydroquinate dehydratase (aroD), Shikimate dehydrogenase (NADP(+)) (aroE), Shikimate kinase 2 (aroF), Shikimate kinase 1 (aroK), 3-phosphoshikimate 1-carboxyvinyltransferase (aroA), Chorismate synthase (aroC), P-protein (pheA), T-protein (tyrA), Aromatic amino acid aminotransferase (tyrB), Phospho-2-dehydro-3-deoxyheptonate aldolase (aroG), Phospho-2-dehydro-3-deoxyheptonate aldolase (aroH), Phospho-2-dehydro-3-deoxyheptonate aldolase (aroF), Quinate / Shikimate dehydrogenase (ydiB), ATP-dependent isoenzyme 1 of 6-phosphofructokinase (pfkA),ATP-dependent phosphofructokinase isoenzyme 2 (pfkB), Fructose-bisphosphate aldolase class 2 (fbaA), Fructose-bisphosphate, Petition 870260073253, dated 07 / 23 / 2026, page 106 / 287 94 / 190 aldolase class 1 (fbaB), Triosephosphate isomerase (tpiA), Pyruvate kinase I (pykF), Pyruvate kinase II (pykA), Glyceraldeído-3-phosphate dehydrogenase A (gapA), Phosphoglycerate kinase (pgk), phosphoglycerate mutase dependent of 2,3bisphosphoglycerate (gpmA), phosphoglycerate independent mutase of 2,3bisphosphoglycerate (gpmM / yibO), Phosphoglycerate mutase tested (ytjC / gpmB), enolase (eno), D-3-phosphoglycerate dehydrogenase (serA), Phosphoserine aminotransferase (serC), Phosphoserine phosphatase (serB), L-serine dehydratase 1 (sdaA), L-serine dehydratase 2 (sdaB), L-threonine dehydratase catabolica (tdcB), L-threonine dehydratase biosynthetica (ilvA), L-serine dehydratase (tdcG), Serine acetyltransferase (cysE), Cysteine ​​synthase A (cysK), Cysteine ​​synthase B (cysM), betacysthionase (malY), Cystathionine beta-lyase (metC), 5-methyltetra-hidropteroyltriglutamate-homocysteine ​​methyltransferase (metE), Methionine synthase (metH), S-adenosylmethionine synthase (metK), Cystathionine gamma-synthase (metB),Homoserine O-succinyltransferase (metA), 5'-methylthioadenosine / S-adenosylmocysteine ​​nucleosidase (mtnN), S-ribosyl-homocysteine ​​lyase (luxS), cystathionine beta lyase, cystathionine gamma lyase, serine hydroxymethyltransferase (glyA), glycine hydroxymethyltransferase (itaE), small subunit of 3-isopropyl malate dehydratase (leuD), large subunit of 3-isopropyl malate dehydratase (leuC), 3-isopropyl malate dehydrogenase (leuB), L-threonine biosynthetic dehydratase (ilvA), large subunit of acetolactate synthase isoenzyme 3 (ilvl), small subunit of acetolactate synthase isoenzyme 3 (ilvH), small subunit of isoenzyme 1 Acetolactate synthase (ilvN), small subunit of acetolactate synthase 2 isoenzyme (ilvM), ketolactic acid reductase (NADP(+)) (ilvC), dihydroxy acid dehydratase (ilvD), branched-chain amino acid aminotransferase (ilvE), bifunctional aspartokinase / homoserine dehydrogenase 1 (thrA), bifunctional aspartokinase / homoserine dehydrogenase 2 (metL),2isopropylmalate synthase (leuA), Glutamate-pyruvate aminotransferase (alaA), Petition 870260073253, dated 07 / 23 / 2026, page 107 / 287 95 / 190 Aspartate aminotransferase (aspC), Bifunctional aspartokinase / homoserine dehydrogenase 1 (thrA), Bifunctional aspartokinase / homoserine dehydrogenase 2 (metL), Lysine-sensitive aspartokinase 3 (lysC), Aspartate semialdehyde dehydrogenase (asd), 2-keto-3-deoxygalactonate aldolase (yagE), 4-hydroxytetrahydrodipicolinate synthase (dapA), 4-hydroxytetrahydrodipicolinate reductase (dapB), 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate Nsuccinyltransferase (dapD), Succinyldiaminopimelate desuccinylase (dapE), Diaminopimelate epimerase (dapF), Putative lyase (yjhH), Acetylornithine / succinyldiaminopimelate aminotransferase (argD), Citrate synthase (gltA), Aconitate hydratase B (acnB), Aconitate hydratase A (acnA), Putative uncharacterized aconitate hydratase (ybhJ), Isocitrate dehydrogenase (icd), Aspartate aminotransferase (aspC), Glutamate-pyruvate aminotransferase (alaA), Long chain [NADPH] glutamate synthase (gltB), Short chain [NADPH] glutamate synthase (gltD), Glutamine synthetase (glnA), Amino acid acetyltransferase (argA), Acetylglutamate kinase (argB), N-acetyl-gamma-glutamyl phosphate reductase (argC), Acetylornithine / succinyldiaminopimelate aminotransferase (argD), Acetylornithine deacetylase (argE), F chain of ornithine carbamoyltransferase (argF), I chain of ornithine carbamoyltransferase (argI), argininosuccinate synthase (argG), argininosuccinate lyase (argH), glutamate 5-kinase (proB), gamma-glutamyl phosphate reductase (proA), pyrroline 5-carboxylate reductase (proC), ornithine cyclodesaminase, leucine-tRNA ligase (leuS),Glutamine tRNA ligase (glnS), Serine tRNA ligase (serS), Glycine tRNA ligase beta subunit (glyS), Glycine tRNA ligase alpha subunit (glyQ), Tyrosine tRNA ligase (tyrS), Threonine tRNA ligase (thrS), Phenylalanine tRNA ligase alpha subunit (pheS), Phenylalanine tRNA ligase beta subunit (pheT), Arginine tRNA ligase (argS), Histidine tRNA ligase (hisS), Valine tRNA ligase (valS), Alanine tRNA ligase (alaS), Isoleucine tRNA ligase (ileS), Proline tRNA Petition 870260073253, dated 07 / 23 / 2026, page 108 / 287 96 / 190 ligase (proS), Cysteine-tRNA ligase (cysS), Asparagine-tRNA ligase (asnS), Aspartate-tRNA ligase (aspS), Glutamate-tRNA ligase (gltX), Tryptophan-tRNA ligase (trpS), beta subunit of Glycine-tRNA ligase (glycine), Methion-GRNA ligase (Glyna), Lysine-tRNA ligase (lysS). The preferred essential enzymes for amino acid production are tktA, rpe, prs, aroK, tyrB, aroH, fbaA, gapA, pgk, eno, tdcG, cysE, metK, glyA, asd, dapA / B / D / E / F, argC, proCgl, ser, glyuSQ, glyS / SQ tyrS, thrS, pheS / T, argS, hisS, valS, alaS, ileS, proS, cysS, asnS, aspS, gltX, trpS, glyS, metG, lysS, as the most preferred are asd, glyA, leuS, glnS, serS, glyS / Q, tS, pheS / S, arg / T hisS, valS, alaS, ileS, proS, cysS, asnS, aspS, gltX, trpS, glyS, metG, lysS, the most preferred is asd.

[0190] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence further comprises a modulation within an RNA thermosensor region upstream of a gene encoding an endogenous AraC-type DNA-binding protein. The modulation within an RNA thermosensor region upstream of a gene encoding an endogenous AraC-type DNA-binding protein may be a deletion, an insertion, or a substitution within the RNA thermosensor region. A deletion or insertion usually comprises a deletion or insertion of one or more, preferably between about 30 and about 100 nucleotides, more preferably between about 40 and about 60 nucleotides. A substitution usually comprises a substitution of one or more, preferably between about 3 and about 30 nucleotides, more preferably between about 3 and about 15 nucleotides.Preferably, the modulation within an RNA thermosensor region upstream of a gene encoding an endogenous AraC-type DNA-binding protein is a deletion, preferably between about 30 and about 100 nucleotides, more preferably between about 100. Petition 870260073253, dated 07 / 23 / 2026, p. 109 / 287 97 / 190 and approximately 60 nucleotides within an RNA thermosensor region upstream of a gene encoding an endogenous AraC-type DNA-binding protein. The endogenous AraC-type DNA-binding protein and the RNA thermosensor region upstream of a gene encoding the AraC-type DNA-binding protein are usually located in the endogenous virulence plasmid comprised by the recombinant attenuated virulence Gram-negative bacterial strain. The AraC-type DNA-binding protein is preferably selected from the group consisting of VirF, LcrF, MxiE, ExsA, PerA, HrpX, HrpB, GadX, HilC, HilD, and InvF. More preferably, the AraC-type DNA-binding protein is selected from the group consisting of VirF and LcrF. In some embodiments, the recombinant Gram-negative bacterial strain of attenuated virulence is Yersinia enterolitica, and the AraC-type DNA-binding protein is VirF.Preferably, the modulation within an RNA thermosensor region upstream of a gene encoding an endogenous AraC-type DNA-binding protein comprises a modulation that interferes with a hairpin loop RNA, preferably Hairpin I, upstream of the gene encoding an endogenous AraC-type DNA-binding protein. More preferably, the modulation within an RNA thermosensor region upstream of a gene encoding an endogenous AraC-type DNA-binding protein comprises a deletion that removes a hairpin loop RNA structure or parts thereof, preferably parts of hairpin I, upstream of the gene encoding an endogenous AraC-type DNA-binding protein.A deletion that removes a hairpin loop RNA structure or parts thereof usually comprises a deletion of between about 30 and about 100 nucleotides, preferably between about 40 and about 60 nucleotides. In some embodiments, the recombinant Gram-negative bacterial strain of... Petition 870260073253, dated 07 / 23 / 2026, page 110 / 287 98 / 190 attenuated virulence is Yersinia enterolitica, the deletion comprises a deletion of nucleotides at positions -111 to -57 upstream of the virF coding sequence (where 1 is 1 base upstream of the A of the ATG start codon of the virF coding sequence).

[0191] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence is selected from the group consisting of the genera Yersinia, Escherichia, Salmonella, and Pseudomonas. In another embodiment, the recombinant Gram-negative bacterial strain of attenuated virulence is selected from the group consisting of the genera Yersinia and Salmonella. Preferably, the recombinant Gram-negative bacterial strain of attenuated virulence is a strain of Yersinia, more preferably a strain of Yersinia enterocolitica. Most preferably, it is Yersinia enterocolitica E40 (0:9, biotype 2)19 or ampicillin-sensitive derivatives thereof, such as Y. enterocolitica MRS40 (also called Y. enterocolitica subsp. palearctica MRS40) as described in20. Y. enterocolitica E40 and its derivative Y. enterocolitica MRS40 as described in 20 is identical to Y. enterocolitica subsp. palearctica E40 and its derivative Y. enterocolitica subsp. palearctica MRS40 as described in 15,17,21.Preferably, the recombinant Gram-negative bacterial strain of attenuated virulence is a Salmonella strain, more preferably a Salmonella enterica strain. The most preferred is Salmonella enterica Serovar Typhimurium SL1344 as described by the Public Health England Culture Collection (NCTC 13347).

[0192] In some embodiments of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence is a strain that does not produce a siderophore, for example, is deficient in the production of a siderophore, preferably, does not produce siderophores, for example, is deficient in the production of any siderophore. Such a strain is, for example, Y. enterocolitica subsp. palearctica MRS40 as described in 15, 17, 20, 21 which does not produce Yersiniabactin and Petition 870260073253, dated 07 / 23 / 2026, p. 111 / 287 99 / 190 is preferred.

[0193] In one embodiment of the present invention, the release signal of a bacterial effector protein comprises a bacterial effector protein or an N-terminal fragment thereof, preferably a bacterial effector protein that is virulent to eukaryotic cells or an N-terminal fragment thereof.

[0194] In one embodiment of the present invention, the release signal of a bacterial effector protein is a bacterial T3SS effector protein comprising a bacterial T3SS effector protein or an N-terminal fragment thereof, wherein the T3SS effector protein or an N-terminal fragment thereof may comprise a chaperone-binding site. A T3SS effector protein or an N-terminal fragment thereof comprising a chaperone-binding site is particularly useful as a release signal in the present invention.The preferred T3SS effector proteins or N-terminal fragments of these are selected from the group consisting of SopE, SopE2, SptP, YopE, ExoS, SipA, SipB, SipD, SopA, SopB, SopD, IpgB1, IpgD, SipA, SifA, SJ, SJ, SJ YopJ, AvrA, AvrBsT, YopT, YopH, YpkA, Tir, EspF, TccP2, IpgB2, OspF, Map, OspG, OspI, IpaH, SspHl,VopF, ExoS, ExoT, HopAB2, XopD, AvrRpt2, HopAOL, HopUD2, HopD2 family proteins GALA, AvrBs2, AvrD1, AvrBS3, YopO, YopP, YopE, YopM, YopT, EspG, EspH, EspZ, IpaA, IpaB, IpaC, VirA, IcsB, OspC1, OspE2, IpaH9,8, IpaH7, AvrB, AvrP, AvrP, AvrphD, Avr AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, VirPphA, AvrRpm1, HopPtoE, HopPtoF, HopPtoN, PopB, PopP2, AvrBs3, XopD and AvrXv3.The most preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SptP, YopE, ExoS, SopB, IpgB1, IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO, YopP, YopE, YopM, YopT, wherein the most preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of IpgB1. Petition 870260073253, dated 07 / 23 / 2026, page 112 / 287 100 / 190 SopE, SopB, SptP, OspF, IpgD, YopH, YopO, YopP, YopE, YopM, YopT, in particular, YopE or an N-terminal fragment thereof. The equally preferred T3SS effector proteins or N-terminal fragments of these are selected from the group consisting of SopE, SopE2, SptP, SteA, SipA, SipB, SipD, SopA, SopB, SopD, IpgBl, IpgD, SipC, Sif, Sif, SJ, SJ, Sse, Sse SrfH, YopJ, AvrA, AvrBsT, YopH, YpkA, Tir, EspF, TccP2, IpgB2, OspF, Map, OspG, OspI, IpaH, VopF, ExoS, ExoT, HopAB2, AvrRpt2, HopAOl, HopUl, GALA family of proteins, Avr12, Avr YopO, YopP, YopE, YopT, EspG, EspH, EspZ, IpaA, IpaB, IpaC, VirA, IcsB, OspC1, OspE2, IpaH9,8, IpaH7,8, AvrB, AvrD, AvrPphB, AvrPphC, AvrPphPto, AvrPBPto, AvrPBPto, AvrPBPto, AvrPphB VirPphA, AvrRpml, HopPtoD2, HopPtoE, HopPtoF, HopPtoN, PopB, PopP2, AvrBs3, XopD, and AvrXv3.The most preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SptP, SteA, SifB, SopB, IpgB1, IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO, YopP, YopE, YopT, in particular, SopE, SteA or YopE or an N-terminal fragment thereof, more particularly SteA or YopE or an N-terminal fragment thereof, more particularly YopE or an N-terminal fragment thereof.

[0195] In some embodiments, the release signal of a bacterial effector protein is encoded by a nucleotide sequence comprising the bacterial effector protein or an N-terminal fragment thereof, wherein the N-terminal fragment thereof includes at least the first 10, preferably at least the first 20, most preferably at least the first 100 amino acids of the bacterial T3SS effector protein.

[0196] In some embodiments, the bacterial effector protein release signal is encoded by a nucleotide sequence comprising the Petition 870260073253, dated 07 / 23 / 2026, page 113 / 287 101 / 190 bacterial T3SS effector protein or an N-terminal fragment thereof, wherein the bacterial T3SS effector protein or the N-terminal fragment thereof comprises a chaperone binding site.

[0197] Preferred T3SS effector proteins or an N-terminal fragment thereof comprising a chaperone-binding site comprise the following combinations of chaperone-binding site and T3SS effector protein or N-terminal fragment thereof: SycE-YopE, InvB-SopE, SicP-SptP, SycT-YopT, SycO-YopO, SycN / YscB-YopN, SycH-YopH, SpcS-ExoS, CesF-EspF, SycD-YopB, SycD-YopD. SycE-YopE, InvB-SopE, SycTYopT, SycO-YopO, SycN / YscB-YopN, SycH-YopH, SpcS-ExoS, CesF-EspF are more preferred. The most preferred is a YopE or an N-terminal fragment thereof comprising the SycE chaperone binding site, such as an N-terminal fragment of a YopE effector protein containing the 138 N-terminal amino acids of the YopE effector protein designated herein as YopE1-138 and as shown in SEQ ID NO.2, or a SopE or an N-terminal fragment thereof comprising the InvB chaperone binding site as uch, an N-terminal fragment of a SopE effector protein containing the 81 or 105 N-terminal amino acids of the SopE effector protein designated herein as SopE1-81 or SopE1-105 respectively, and as shown in SEQ ID Nos.: 6 and 7.

[0198] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence is a strain of Yersinia and the bacterial effector protein release signal comprises a YopE effector protein or an N-terminal portion, preferably the YopE effector protein of Y. enterocolitica or an N-terminal portion thereof. Preferably, the SycE binding site is comprised within the N-terminal portion of the YopE effector protein. In relation to this, an N-terminal fragment of a YopE effector protein may comprise the 12, 16, 18, 52, 53, 80 or 138 N-terminal amino acids22-24. The Petition 870260073253, dated 07 / 23 / 2026, page 114 / 287 102 / 190 most preferred is an N-terminal fragment of a YopE effector protein containing the 138 N-terminal amino acids of the YopE effector protein, for example, as described in Forsberg and Wolf-Watz25 designated here as YopE1138 and as shown in SEQ ID NO.: 2.

[0199] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence is a Salmonella strain and the bacterial effector protein release signal encoded by a nucleotide sequence comprises a SopE or SteA effector protein or an N-terminal portion thereof, preferably the Salmonella enterica SopE or SteA effector protein or an N-terminal portion thereof. Preferably, the chaperone binding site is comprised within the N-terminal portion of the SopE effector protein. In relation to this, an N-terminal fragment of a SopE effector protein may comprise the 81 or 105 N-terminal amino acids. Most preferably is the full-length SteA (SEQ ID NO: 5) and an N-terminal fragment of a SopE effector protein containing the 105 N-terminal amino acids of the effector protein, for example, as described in SEQ ID NO.: 7.

[0200] A specialist in the technique is familiar with methods for identifying polypeptide sequences of an effector protein that are capable of releasing a protein. For example, one method is described by Sory et al.19. Briefly, polypeptide sequences of, for example, various portions of Yop proteins can be fused to a reporter enzyme, such as the calmodulin-activated adenylate cyclase (or Cya) domain of Bordetella pertussis cyclolysin. The release of a YopCya hybrid protein into the cytosol of eukaryotic cells is indicated by the appearance of cyclase activity in the infected eukaryotic cells leading to cAMP accumulation. Using such a method, a specialist in the technique can determine, if desired, the minimum required sequence, i.e., a sequence of contiguous amino acids. Petition 870260073253, dated 07 / 23 / 2026, page 115 / 287 103 / 190 of shorter length, which is capable of releasing a protein, see, for example, 19. Consequently, preferred release signals of the present invention consist of at least the minimum amino acid sequence of a T3SS effector protein that is capable of releasing a protein.

[0201] In one embodiment, the present invention provides a recombinant Gram-negative bacterial strain of attenuated virulence that is deficient in the production of at least one bacterial effector protein, more preferably, that is deficient in the production of at least one bacterial effector protein that is virulent to eukaryotic cells, even more preferably, that is deficient in the production of at least one T3SS effector protein, most preferably, that is deficient in the production of at least one T3SS effector protein that is virulent to eukaryotic cells.In some embodiments, recombinant Gram-negative bacterial strains of attenuated virulence are deficient in the production of at least one, preferably at least two, more preferably at least three, even more preferably at least four, in particular at least five, more particularly at least six, most particularly all bacterial effector proteins that are virulent to eukaryotic cells.In some embodiments, recombinant Gram-negative bacterial strains of attenuated virulence are deficient in the production of at least one, preferably at least two, more preferably at least three, even more preferably at least four, in particular at least five, more particularly at least six, most particularly all bacterial effector functional proteins that are virulent to eukaryotic cells, such that the resulting recombinant Gram-negative bacterial strain of attenuated virulence produces fewer bacterial effector proteins or produces bacterial effector proteins to a lesser extent compared with the... Petition 870260073253, dated 07 / 23 / 2026, page 116 / 287 104 / 190 wild-type Gram-negative bacterial strain that has not had its virulence attenuated, i.e., compared to the wild-type Gram-negative bacterial strain that normally produces bacterial effector proteins, or such that the resulting attenuated virulence recombinant Gram-negative bacterial strain no longer produces any functional bacterial effector proteins that are virulent to eukaryotic cells.

[0202] According to the present invention, such a mutant Gram-negative bacterial strain, that is, such a recombinant Gram-negative bacterial strain of attenuated virulence that is deficient in the production of at least one bacterial effector protein, for example, that is deficient in the production of at least one bacterial effector protein that is virulent to eukaryotic cells, for example, such a mutant Yersinia strain can be generated by introducing at least one mutation in at least one effector-coding gene. Preferably, such effector-coding genes include YopE, YopH, YopO / YpkA, YopM, YopP / YopJ and YopT with respect to a Yersinia strain.Preferably, such effector-encoding genes include AvrA, CigR, GogB, GtgA, GtgE, PipB, SifB, SipA / SspA, SipB, SipC / SspC, SipD / SspD, SlrP, SopB / SigD, SopA, SpiC / SsaB, SseB, SseC, SseD, SseF, SseG, Ssel / SrfH, SopD, SopE, SopE2, SspH1, SspH2, PipB2, SifA, SopD2, SseJ, SseK1, SseK2, SseK3, SseL, SteC, SteA, SteB, SteD, SteE, SpvB, SpvC, SpvD, Srff, SptP, as it relates to a strain of Salmonella. Most preferably, all effector-coding genes are deleted. A qualified technician can use any number of standard techniques to generate mutations in these T3SS effector genes. Sambrook et al. describe such techniques in detail. See Sambrook et al.26.

[0203] According to the present invention, the mutation can be generated in the promoter region of an effector-coding gene so that the expression of such effector gene is abolished. Petition 870260073253, dated 07 / 23 / 2026, p. 117 / 287 105 / 190

[0204] The mutation can also be generated in the coding region of an effector-coding gene such that the catalytic activity of the encoded effector protein is abolished. The “catalytic activity” of an effector protein usually refers to the anti-target cellular function of an effector protein, i.e., toxicity. Such activity is driven by catalytic motifs in the catalytic domain of an effector protein. Approaches to identifying the catalytic domain and / or catalytic motifs of an effector protein are well known to those skilled in the art. See, for example,27,28.

[0205] Consequently, a preferred mutation of the present invention is a deletion of the entire catalytic domain. Another preferred mutation is a frameshift mutation in an effector-coding gene such that the catalytic domain is not present in the expressed protein product of such a frameshifted gene. A more preferred mutation is a mutation with the deletion of the entire coding region of the effector protein. Other mutations are also considered by the present invention, such as small deletions or base pair substitutions, which are generated in the catalytic motifs of an effector protein leading to the destruction of the catalytic activity of a given effector protein.

[0206] Mutations that are generated in the genes of functional bacterial effector proteins can be introduced into a particular strain by several methods. One method involves cloning a mutated gene into a “suicide” vector that is capable of introducing the mutated sequence into the strain through allelic exchange. An example of such a “suicide” vector is described by29.

[0207] In this way, mutations generated in multiple genes can be successively introduced into a Gram-negative bacterial strain, giving rise to polymutants, for example, a six-fold mutant recombinant strain. The order in which these mutated sequences are introduced is not important. Petition 870260073253, dated 07 / 23 / 2026, pp. 118 / 287 106 / 190 Under some circumstances, it may be desirable to mutate only some, but not all, of the effector genes. Consequently, the present invention also contemplates polymutant Yersinia other than sextuple mutant Yersinia, for example, double mutant, triple mutant, quadruple mutant and quintuple mutant strains. For the purpose of releasing proteins, the secretion and translocation system of the mutant strain needs to be intact.

[0208] A preferred recombinant Gram-negative bacterial strain of attenuated virulence of the present invention is a sextuple mutant strain of Yersinia in which all effector-coding genes are mutated such that the resulting Yersinia no longer produces any functional effector proteins. Such a sextuple mutant strain of Yersinia is designated as ΔyopH,O,P,E,M,T for Y. enterocolitica. As an example, such a sextuple mutant can be produced from the Y. enterocolitica MRS40 strain giving rise to Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T, (also called Y. enterocolitica subsp. palearctica MRS40 ΔyopH,O,P,E,M,T or Y. enterocolitica ΔyopH,O,P,E,M,T herein) which is preferred. The Y.Yersiniabactin enterocolitica MRS40 ΔyopH,O,P,E,M,T, which is deficient in the production of Yersiniabactin, was described in WO02077249 and was filed on September 24, 2001, in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the purposes of Patent Procedure with the Belgian Coordinated Collections of Microorganisms (BCCM) and accession number LMG P-21013.

[0209] Most preferred is Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T comprising a deletion in the endogenous virulence plasmid pYV that removes a hairpin loop RNA structure or parts thereof, such as a deletion of Hairpin I upstream of the gene encoding an endogenous DNA-binding protein of the AraC type ^Hairpinl-virF) such Petition 870260073253, dated 07 / 23 / 2026, p. 119 / 287 107 / 190 as Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T ΔΗα^ρϊηΙ-νϊΓΕ (also called Y. enterocolitica ΔyopH,O,P,E,M,T ΔΗαΐφΐηΙ-νίΓΕ). Equally preferred is Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T comprising a deletion of a chromosomal gene encoding asd and the endogenous virulence plasmid pYV comprising a nucleotide sequence comprising a gene encoding asd operatively linked to a promoter (pYV-asd) such as Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T Δasd pYV-asd (also referred to as Y. enterocolitica ΔyopH,O,P,E,M,T Δasd pYV-asd herein). Particularly preferred is Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T Δasd ΔΗαΐφΐηΙ- virF pYV-asd comprising both modifications as described above (also called Y. enterocolitica ΔyopH,O,P,E,M,T Δasd ΔHairpinI-virF pYV-asd here). Particularly preferred strains are Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T ΔHairpinI-virF (also called Y. enterocolitica ΔyopH,O,P,E,M,T ΔHairpinI-virF), Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T Δasd pYV-asd (also called Y. enterocolitica ΔyopH,O,P,E,M,T Δasd pYV-asd here) or Y. enterocolitica MRS40 ΔyopH,O,P,E,M,T Δasd ΔHairpinI-virF pYV-asd (also called Y. enterocolitica ΔyopH,O,P,E,M,T Δasd ΔHairpinI-virF pYV-asd (here)) that are deficient in the production of a siderophore, preferably do not produce siderophores, for example, are deficient in the production of any siderophore, as is the case with all strains of Y. enterocolitica subsp. palearctica. Thus, equally particularly preferred strains are Y. enterocolitica subsp. palearctica ΔyopH,O,P,E,M,T ΔHairpinI-virF (also called Y. enterocolitica subsp. palearctica ΔyopH,O,P,E,M,T ΔHairpinI-virF), Y. enterocolitica subsp. palearctica ΔyopH,O,P,E,M,T Δasd pYV-asd also called Y. enterocolitica ΔyopH,O,P,E,M,T Δasd pYV-asd here) or Y. enterocolitica subsp. palearctica ΔyopH,O,P,E,M,T Δasd ΔHairpinI-virF pYV-asd (also called Y. Petition 870260073253, dated 07 / 23 / 2026, pp. 120 / 287 108 / 190 enterocolitica ΔyopH,O,P,E,M,T Δasd ΔΗα^ρϊηΙ-νϊΓΕ pYV-asd here).

[0210] The vector-like nucleotide molecules that can be used according to the invention to transform a Gram-negative bacterial strain may depend on the Gram-negative bacterial strains used, as is known to the expert. The nucleotide molecules that can be used according to the invention include expression vectors (including synthetic or otherwise modified versions generated from endogenous virulence plasmids), vectors for virulence or chromosomal plasmid insertion, and nucleotide sequences such as, for example, DNA fragments for virulence or chromosomal plasmid insertion. Expression vectors that are useful in, for example, strains of Yersinia, Escherichia, Salmonella, or Pseudomonas are, for example, pUC, pBad, pACYC, pUCP20, and pET plasmids.Vectors for virulence or chromosomal plasmid insertion that are useful in, for example, strains of Yersinia, Escherichia, Salmonella, or Pseudomonas are, for example, pKNG101. DNA fragments for virulence or chromosomal plasmid insertion refer to methods used in, for example, strains of Yersinia, Escherichia, Salmonella, or Pseudomonas, such as lambda-red genetic engineering. Vectors for insertion of virulence or chromosomal plasmids or DNA fragments for insertion of virulence or chromosomal plasmids can insert the nucleotide sequences of the present invention so that, for example, the nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein is operatively linked to an endogenous promoter of the recombinant Gram-negative bacterial strain of attenuated virulence.Thus, if a vector is used for the insertion of a virulence plasmid or chromosome, or a DNA fragment for... Petition 870260073253, dated 07 / 23 / 2026, pp. 121 / 287 109 / 190 virulence or chromosomal plasmid insertion is used, an endogenous promoter can be encoded in endogenous bacterial DNA (chromosomal or plasmid DNA) and only the respective nucleotide sequence will be provided by the manipulated vector for virulence or chromosomal plasmid insertion, or DNA fragment for virulence or chromosomal plasmid insertion.Alternatively, if a vector for virulence or chromosomal plasmid insertion or a nucleotide molecule such as, for example, a nucleotide sequence for virulence or chromosomal plasmid insertion is used, an endogenous promoter and the release signal of a bacterial effector protein can be encoded in the endogenous bacterial DNA (chromosomal or plasmid DNA) and only the nucleotide molecule such as, for example, a nucleotide sequence encoding the heterologous proteins will be provided by a vector for virulence or chromosomal plasmid insertion or by a nucleotide molecule such as, for example, a nucleotide sequence for virulence or chromosomal plasmid insertion.Thus, it is not necessarily required that a promoter be comprised by the vector used for the transformation of recombinant Gram-negative bacterial strains of attenuated virulence; that is, the recombinant Gram-negative bacterial strains of attenuated virulence of the present invention can be transformed with a vector that does not comprise a promoter.

[0211] In a preferred embodiment, the nucleotide molecule, for example, the vector of the present invention comprises in the 5' to 3' direction: a first nucleotide sequence that encodes a release signal or a fragment thereof from a bacterial effector protein; a second nucleotide sequence encoding a heterologous protein fused to the 3' end of said first sequence Petition 870260073253, dated 07 / 23 / 2026, page 122 / 287 110 / 190 nucleotide.

[0212] A preferred vector, for example, a preferred expression vector for Yersinia is selected from the group consisting of pBad_Si_1 and pBad_Si_2. pBad_Si2 was constructed by cloning the SycE-YopE1-138 fragment containing endogenous promoters for YopE and SycE from purified pYV40 into the KpnI / HindIII site of pBad-MycHisA (Invitrogen). Additional modifications include the removal of the NcoI / BgIII fragment from pBad-MycHisA by digestion, treatment, and religation with the Klenow fragment. Furthermore, at the 3' end of YopE1138, the following cleavage sites were added: XbaI-XhoI-BstBI-(HindIII). The pBad_Si1 is identical to pBad_Si2, but encodes amplified EGFP from pEGFP-Cl (Clontech) at the NcoI / BgIII site under the Arabinose-inducible promoter. Equally preferred is the use of modified versions of the endogenous virulence plasmid of Yersinia pYV encoding heterologous proteins as fusions with a T3SS signal sequence.A preferred vector, for example, a preferred expression vector for Salmonella, is selected from the group consisting of pSi_266, pSi_267, pSi_268, and pSi_269. Plasmids pSi_266, pSi_267, pSi_268, and pSi_269 containing the corresponding endogenous promoter and the SteA1-20 fragment (pSi_266), the full-length SteA sequence (pSi_267), the SopE1-81 fragment (pSi_268), or the SopE1-105 fragment (pSi_269) were amplified from S. enterica SL1344 genomic DNA and cloned into the NcoI / KpnI site of pBad-MycHisA (Invitrogen).

[0213] The nucleotide molecules, for example, the vectors of the present invention, may include other sequence elements such as a 3' termination sequence (including a stop codon and a poly A sequence), or a gene that confers resistance to a drug that allows the selection of transformants having received the present vector.

[0214] Nucleotide molecules, for example, the vectors of the present Petition 870260073253, dated 07 / 23 / 2026, pp. 123 / 287 111 / 190 invention, can be transformed by various known methods into recombinant Gram-negative bacterial strains of attenuated virulence. For the purpose of the present invention, transformation methods for the introduction of a vector include, but are not limited to, electroporation, calcium phosphate-mediated transformation, conjugation, or combinations thereof. For example, a nucleotide molecule, for example, a vector, can be transformed into a first bacterial strain by a standard electroporation procedure. Subsequently, such a nucleotide molecule, for example, a vector, can be transferred from the first bacterial strain to the desired strain by conjugation, a process also called mobilization. The transformant (i.e., Gram-negative bacterial strains that have incorporated the vector) can be selected, for example, with antibiotics. These techniques are well known in the art. See, for example, 19.

[0215] According to the present invention, the promoter operatively linked to the bacterial effector protein of the recombinant Gram-negative bacterial strain of attenuated virulence of the invention may be a native promoter of a T3SS effector protein of the respective strain or a compatible bacterial strain or a promoter used in expression vectors that are useful in, for example, strains of Yersinia, Escherichia, Salmonella or Pseudomonas, for example, pUC and pBad. Such promoters are the T7 promoter, Plac promoter or the arabinose-inducible Ara-bad promoter.

[0216] If the recombinant Gram-negative bacterial strain of attenuated virulence is a strain of Yersinia, the promoter may be a Yersinia virulon gene. A Yersinia virulon gene refers to genes in the Yersinia pYV plasmid whose expression is controlled by temperature and contact with a target cell. Such genes include genes encoding elements of the secretion mechanism (the Ysc genes), genes encoding translocators (YopB, YopD and Petition 870260073253, dated 07 / 23 / 2026, pp. 124 / 287 112 / 190 LcrV), genes encoding control elements (YopN, TyeA, and LcrG), genes encoding T3SS effector chaperones (SycD, SycE, SycH, SycN, SycO, and SycT), and genes encoding effectors (YopE, YopH, YopO / YpkA, YopM, YopT, and YopP / YopJ), as well as other pYV-encoded proteins such as VirF and YadA.

[0217] In a preferred embodiment of the present invention, the promoter is the native promoter of a functional T3SS-encoding effector gene. If the recombinant Gram-negative bacterial strain of attenuated virulence is a Yersinia strain, the promoter is selected from any of YopE, YopH, YopO / YpkA, YopM, and YopP / YopJ. More preferably, the promoter is YopE or SycE. The most preferred is the YopE promoter.

[0218] If the recombinant Gram-negative bacterial strain of attenuated virulence is a Salmonella strain, the promoter may be a SpiI or SpiII pathogenicity island or an effector protein encoded elsewhere. Such genes include genes encoding secretion mechanism elements, genes encoding translocators, genes encoding control elements, genes encoding T3SS effector chaperones, and genes encoding effectors as well as other proteins encoded by SPI-1 or SPI-2. In a preferred embodiment of the present invention, the promoter is the native promoter of a functional T3SS-encoding effector gene. If the recombinant Gram-negative bacterial strain of attenuated virulence is a Salmonella strain, the promoter is selected from any of the effector proteins. More preferably, the promoter is from SopE, InvB, or SteA.

[0219] In some embodiments, the promoter is an artificially inducible promoter, such as, for example, the Arabinose-inducible promoter, which is preferred. In this case, arabinose is usually supplied to the bacteria and will induce bacterial expression of the protein to be released.

[0220] In one embodiment of the present invention, the Gram bacterial strain Petition 870260073253, dated 07 / 23 / 2026, pp. 125 / 287 The recombinant 113 / 190 negative attenuated virulence strain comprises a nucleotide sequence encoding a protease cleavage site. The protease cleavage site is usually located on the nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein between the nucleotide sequence encoding a heterologous protein and the nucleotide sequence encoding a release signal. The generation of a functional and generally applicable cleavage site allows cleavage of the release signal after translocation.Since the release signal can interfere with the correct localization and / or function of the translocated protein within target cells, the introduction of a protease cleavage site between the release signal and the protein of interest provides the release of nearly native proteins into eukaryotic cells. Preferably, the protease cleavage site is an amino acid motif that is cleaved by a protease or its catalytic domains, selected from the group consisting of enterokinase (light chain), enteropeptidase, protease precision, human rhinovirus 3C protease, TEV protease, TVMV protease, Factor Xa protease, and thrombin, more preferably, an amino acid motif that is cleaved by TEV protease.Equally preferable, the protease cleavage site is an amino acid motif that is cleaved by a protease or its catalytic domains, selected from the group consisting of enterokinase (light chain), enteropeptidase, protease precision, human rhinovirus 3C protease, TEV protease, TVMV protease, Factor Xa protease, ubiquitin-processing protease, called Deubiquitinating enzyme, and thrombin. Most preferred is an amino acid motif that is cleaved by TEV protease or by a ubiquitin-processing protease. Petition 870260073253, dated 07 / 23 / 2026, pp. 126 / 287 114 / 190

[0221] Thus, in another embodiment of the present invention, the heterologous protein is cleaved from the release signal of a bacterial effector protein by a protease. Preferred cleavage methods are methods in which: a) the protease is translocated into the eukaryotic cell by a recombinant Gram-negative bacterial strain of attenuated virulence, as described in the present invention, which expresses a fusion protein comprising the bacterial effector protein release signal and the protease as a heterologous protein; or b) The protease is expressed constitutively or transiently in the eukaryotic cell.

[0222] Usually, the recombinant Gram-negative bacterial strain of attenuated virulence used to release a desired protein into a eukaryotic cell and the recombinant Gram-negative bacterial strain of attenuated virulence that translocates the protease into the eukaryotic cell are different.

[0223] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence comprises another nucleotide sequence encoding a labeling molecule or an acceptor site for a labeling molecule. The additional nucleotide sequence encoding a labeling molecule or an acceptor site for a labeling molecule is usually fused to the 5' or 3' end of the nucleotide sequence encoding a heterologous protein. A preferred labeling molecule or acceptor site for a labeling molecule is selected from the group consisting of enhanced green fluorescent protein (EGFP), coumarin, coumarin ligase acceptor site, resorufin, resorufin ligase acceptor site, the tetra-cysteine ​​motif in use with FlAsH / ReAsH dye (life technologies). The most preferred is resorufin and a resorufin ligase acceptor site or Petition 870260073253, dated 07 / 23 / 2026, pp. 127 / 287 115 / 190 EGFP. The use of a labeling molecule or an acceptor site for a labeling molecule will lead to the attachment of a labeling molecule to heterologous proteins of interest, which will be delivered as such into the eukaryotic cell and allows for protein tracking by, for example, live cell microscopy.

[0224] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence comprises another nucleotide sequence encoding a peptide marker. The additional nucleotide sequence encoding a peptide marker is usually fused to the 5' or 3' end of the nucleotide sequence encoding a heterologous protein. A preferred peptide marker is selected from the group consisting of Myc-tag, His-tag, Flag-tag, HA tag, Strep tag, or V5 tag, or a combination of two or more markers from these groups. The most preferred is Myc-tag, Flag-tag, His-tag, and Myc and His markers combined. The use of a peptide marker will lead to traceability of the labeled protein, for example, by immunofluorescence or Western blotting using anti-marker antibodies.Furthermore, the use of a peptide marker allows for affinity purification of the desired protein after secretion into the culture supernatant or after translocation into eukaryotic cells, in both cases using a purification method suitable for the corresponding marker (e.g., metal chelate affinity purification in use with a His-tag antibody-based purification or anti-Flag in use with the Flag-tag).

[0225] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence comprises another nucleotide sequence encoding a nuclear localization signal (NLS). The additional nucleotide sequence encoding a nuclear localization signal Petition 870260073253, dated 07 / 23 / 2026, pp. 128 / 287 116 / 190 (NLS) is usually fused to the 5' or 3' end of the nucleotide sequence encoding a heterologous protein wherein said additional nucleotide sequence encodes a nuclear localization signal (NLS). A preferred NLS is selected from the group consisting of large SV40 T antigen NLS and derivatives thereof30 as well as other viral NLS. The most preferred is the large SV40 T antigen NLS and derivatives thereof.

[0226] In one embodiment of the present invention, the recombinant Gram-negative bacterial strain of attenuated virulence comprises a multiple cloning site. The multiple cloning site is usually located at the 3' end of the nucleotide sequence encoding a release signal of a bacterial effector protein and / or at the 5' or 3' end of the nucleotide sequence encoding a heterologous protein. One or more multiple cloning sites may be comprised of the vector. A preferred multiple cloning site is selected from the restriction enzyme group consisting of XhoI, XbaI, HindIII, NcoI, NotI, EcoRI, EcoRV, BamHI, NheI, SacI, SalI, BstBI. The most preferred are XbaI, XhoI, BstBI and HindIII.

[0227] The fused protein expressed by the recombinant Gram-negative bacterial strain of attenuated virulence of the present invention is also referred to as a “fusion protein” or a “hybrid protein”, that is, a fused or hybrid release signal protein and a heterologous protein. The fusion protein may also comprise, for example, a release signal and two or more different heterologous proteins.

[0228] The present invention contemplates methods for treating cancer in a subject, for example, treating solid malignant tumors, including the release of heterologous proteins, as described above, into cancer cells, for example, into cells of a malignant solid tumor. The proteins can be released, i.e., translocated into the cancer cell, for example, into cells of Petition 870260073253, dated 07 / 23 / 2026, pp. 129 / 287 117 / 190 a malignant solid tumor at the time of administration of the recombinant attenuated virulence Gram-negative bacterial strain to a subject or it may be released, i.e., translocated into the cancer cell, for example, into the cells of a malignant solid tumor at a later time, for example, after the recombinant attenuated virulence Gram-negative bacterial strain has reached a cancer cell, for example, the site of the malignant solid tumor and / or has reached a cancer cell, for example, the site of the malignant solid tumor and has replicated as described above. The timing of release may be regulated, for example, by the promoter used to express heterologous proteins in the recombinant attenuated virulence Gram-negative bacterial strain. In the first case, a constitutive promoter or, more preferably, an endogenous promoter of a bacterial effector protein may drive heterologous proteins.In the case of delayed protein release, an artificially inducible promoter, such as the Arabinose-inducible promoter, can drive heterologous proteins. In this case, arabinose will be administered to a subject once the bacteria have reached and accumulated at the desired site. The arabinose will then induce bacterial expression of the protein to be released.

[0229] Thus, in one modality the cancer treatment method comprises i) cultivate the recombinant Gram-negative bacterial strain of attenuated virulence as described in the present invention; ii) administering to the subject said recombinant attenuated virulence Gram-negative bacterial strain by contacting a cancer cell with the recombinant attenuated virulence Gram-negative bacterial strain of i) wherein a fusion protein comprising a release signal of a bacterial effector protein and the heterologous protein is expressed by the strain Petition 870260073253, dated 07 / 23 / 2026, page 130 / 287 118 / 190 recombinant Gram-negative bacterial strain of attenuated virulence and is translocated into the cancer cell; and optionally iii) cleave the fusion protein so that the heterologous protein is cleaved from the release signal of the bacterial effector protein within the cancer cell, wherein the recombinant Gram-negative bacterial strain of attenuated virulence is administered in an amount that is sufficient to treat the subject.

[0230] Cancer cells that release heterologous proteins are usually cancer cells from selected non-solid tumors, specifically from the group consisting of Sarcoma, Leukemia, Lymphoma, Multiple Myeloma, Central Nervous System Cancers, and Solid Malignant Tumors, which include, but are not limited to, abnormal masses of cells that may originate from different types of tissue such as liver, colon, colorectal, skin, breast, pancreas, uterine cervix, uterine body, bladder, gallbladder, kidney, larynx, lip, oral cavity, esophagus, ovary, prostate, stomach, testicles, thyroid gland, or lung, and therefore include solid malignant tumors of the liver, colon, colorectal, skin, breast, pancreas, uterine cervix, uterine body, bladder, gallbladder, kidney, larynx, lip, oral cavity, esophagus, ovary, prostate, stomach, testicles, thyroid gland or lung.Preferably, cancerous cells that release heterologous proteins are solid malignant tumors.

[0231] Thus, in a preferred embodiment, cancer is a malignant solid tumor and the method comprises i) cultivate the recombinant Gram-negative bacterial strain of attenuated virulence as described in the present invention; ii) administering the said recombinant Gram-negative bacterial strain of attenuated virulence to the subject by contacting a cell of a malignant solid tumor with the recombinant Gram-negative bacterial strain of Petition 870260073253, dated 07 / 23 / 2026, page 131 / 287 119 / 190 attenuated virulence of i) wherein a fusion protein comprising a bacterial effector protein release signal and the heterologous protein is expressed by the attenuated virulence recombinant Gram-negative bacterial strain and is translocated into a malignant solid tumor cell; and optionally iii) cleaving the fusion protein so that the heterologous protein is cleaved from the bacterial effector protein release signal within a malignant solid tumor cell, wherein the attenuated virulence recombinant Gram-negative bacterial strain is administered in an amount sufficient to treat the subject.

[0232] In some embodiments, at least two fusion proteins comprising a bacterial effector protein release signal and a heterologous protein are expressed by the recombinant Gram-negative bacterial strain of attenuated virulence and are translocated into the eukaryotic cell, for example, the cancer cell, by the methods of the present invention.

[0233] The recombinant Gram-negative bacterial strain of attenuated virulence can be cultured so that a fusion protein comprising the bacterial effector protein release signal and heterologous proteins is expressed according to methods known in the art (e.g., FDA, Bacteriologic Analytical Manual (BAM), chapter 8: Yersinia enterocolitica). Preferably, the recombinant Gram-negative bacterial strain of attenuated virulence can be cultured in Brain-Heart infusion broth, for example, at 28°C. For the induction of T3SS expression and, for example, YopE / SycE promoter-dependent genes, the bacteria can be cultured at 37°C.

[0234] In one form, the cancer cell, for example, the cell of Petition 870260073253, dated 07 / 23 / 2026, page 132 / 287 120 / 190 a malignant solid tumor is contacted with two recombinant Gram-negative bacterial strains of attenuated virulence (i), wherein the first recombinant Gram-negative bacterial strain of attenuated virulence expresses a first fusion protein comprising the release signal of the bacterial effector protein and a first heterologous protein, and the second recombinant Gram-negative bacterial strain of attenuated virulence expresses a second fusion protein comprising the release signal of the bacterial effector protein and a second heterologous protein, such that the first and second fusion proteins are translocated into the cell of a malignant solid tumor. This modality provides co-infection of a cancer cell, for example, a cell of a malignant solid tumor, with two bacterial strains as a valid method to release, for example, two different hybrid proteins into individual cells to encompass their functional interaction.

[0235] The expert in the technique can also use various assays to determine whether the release of a fusion protein is successful. For example, the fusion protein can be detected by immunofluorescence using antibodies that recognize a fused marker (such as Myc-tag). The determination can also be based on the enzymatic activity of the protein being released, for example, the assay described by19.

[0236] The present invention also provides a pharmaceutical composition comprising a recombinant attenuated virulence Gram-negative bacterial strain, as described herein, optionally comprising a suitable pharmaceutically acceptable carrier. Thus, the present invention also provides a pharmaceutical composition comprising a recombinant attenuated virulence Gram-negative bacterial strain, as described herein, for use in a treatment method. Petition 870260073253, dated 07 / 23 / 2026, page 133 / 287 121 / 190 of cancer, for example, a malignant solid tumor in a subject.

[0237] Recombinant Gram-negative bacteria of attenuated virulence may be compounded for convenient and effective administration in an amount sufficient to treat the subject as a pharmaceutical composition with a suitable pharmaceutically acceptable carrier. A unit dosage form of the recombinant Gram-negative bacteria of attenuated virulence or of the pharmaceutical composition to be administered may, for example, contain the recombinant Gram-negative bacteria of attenuated virulence in an amount of about 10⁵ to about 10⁹ bacteria per mL, preferably about 10⁶ to about 10⁸ bacteria per mL, more preferably about 10⁷ to about 10⁸ bacteria per mL, most preferably about 10⁸ bacteria per mL.

[0238] By “quantity sufficient to treat the subject” or “effective quantity” as used interchangeably in the present invention is meant a quantity of a bacterium or bacteria, high enough to significantly and positively modify the condition being treated, but low enough to avoid serious side effects (with a reasonable risk / benefit ratio), within the scope of sound medical judgment. An effective quantity of a bacterium will vary with the particular objective to be achieved, the age and physical condition of the subject being treated, the duration of treatment, the nature of concurrent therapy and the specific bacterium used. The effective quantity of a bacterium will therefore be the minimum quantity that will provide the desired effect.Usually, a quantity of about 10⁵ to about 10⁹ bacteria, for example, about 10⁵ to about 10⁹ bacteria / m² of body surface area, preferably about 10⁶ to about 10⁸ bacteria, for example, about 10⁶ to about 10⁸ bacteria / m² of body surface area, more preferably about 10⁷ to about 10⁸. Petition 870260073253, dated 07 / 23 / 2026, p. 134 / 287 122 / 190 bacteria, for example, from about 107 to about 108 bacteria / m2 of body surface area, most preferably 108 bacteria, for example, 108 bacteria / m2 of body surface area are administered to the subject.

[0239] A single dose of the recombinant Gram-negative bacterial strain of attenuated virulence to administer to a subject, for example, a human to treat cancer, for example, a malignant solid tumor, is usually from about 10⁴ to about 10¹⁰ bacteria, for example, from about 10⁴ bacteria / m² of body surface area to about 10¹⁰ bacteria / m² of body surface area, preferably from about 10⁵ to about 10⁹ bacteria, for example, from about 10⁵ to about 10⁹ bacteria / m² of body surface area, more preferably from about 10⁶ to about 10⁸ bacteria, for example, from about 10⁶ to about 10⁸ bacteria / m² of body surface area, even more preferably from about 10⁷ to about 10⁸ bacteria, for example, from about 10 to about 10 bacteria / m² of body surface area, most preferably 10⁸ bacteria, for example, 10⁸ bacteria / m² of body surface area of ​​total recombinant Gram-negative bacteria of attenuated virulence.

[0240] Examples of substances that can serve as pharmaceutical carriers are sugars, such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetates; powdered tragacanth; malt; gelatin; talc; stearic acid; magnesium stearate; calcium sulfate; calcium carbonate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and theobroma oil; polyols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; agar; alginic acid; pyrogen-free water; isotonic saline; cranberry extracts and phosphate buffer solution; skimmed milk powder; as well as other compatible non-toxic substances used in Petition 870260073253, dated 07 / 23 / 2026, page 135 / 287 123 / 190 pharmaceutical formulations such as Vitamin C, estrogen and echinacea, for example. Humectants and lubricants such as sodium lauryl sulfate, as well as coloring agents, flavoring agents, lubricants, excipients, tablet-forming agents, stabilizers, antioxidants and preservatives may also be present.

[0241] The modes of administration of recombinant Gram-negative bacteria of attenuated virulence to a subject may be selected from the group consisting of intravenous, intratumoral, intraperitoneal and oral administration. Although this invention is not intended to be limited by any particular mode of application, intravenous or intratumoral administration of the bacteria or pharmaceutical compositions is preferred.

[0242] Depending on the route of administration, it may be necessary for the active ingredients comprising the bacteria to be coated in a material to protect said organisms from the action of enzymes, acids, and other natural conditions that may inactivate said organisms. In order to administer bacteria by administration other than parenteral, they must be coated by or administered with a material to prevent inactivation. For example, bacteria may be co-administered with enzyme inhibitors or in liposomes. Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DFP), and trasilol. Liposomes include P40 water-in-oil-in-water emulsions as well as conventional and specifically designed liposomes that carry bacteria, such as Lactobacilli, or their by-products to an internal target of a host subject.

[0243] A bacterium can be administered alone or in conjunction with a second, different bacterium. Any number of different bacteria can be used together. By “in conjunction with” we mean together, substantially simultaneously or sequentially. The compositions Petition 870260073253, dated 07 / 23 / 2026, pp. 136 / 287 124 / 190 can also be administered in tablet, pill or capsule form, for example, as a lyophilized capsule comprising the bacteria or pharmaceutical compositions of the present invention or as a frozen solution of bacteria or pharmaceutical compositions of the present invention containing DMSO or glycerol. Another preferred embodiment involves the preparation of a lyophilized capsule of the bacteria or pharmaceutical compositions of the present invention. Yet another preferred embodiment involves the preparation of a heat-dried capsule of the bacteria or pharmaceutical compositions of the present invention.

[0244] Recombinant Gram-negative bacteria of attenuated virulence or the pharmaceutical composition to be administered may be administered by injection. Suitable forms for injectable use include monoseptic or sterile aqueous solutions (when water-soluble) or sterile dispersions and powders for the extemporaneous preparation of injectable solutions or sterile dispersions. In all cases, the form must be monoseptic or sterile and must be fluid to the extent that it is easily aspirated by syringe. It must be stable under the manufacturing and storage conditions. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures thereof and vegetable oils. Appropriate fluidity may be maintained, for example, by the use of a coating such as lecithin, or by maintaining the required particle size in the case of dispersion.In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of injectable compositions can be achieved by using absorption-delaying agents in the compositions, for example, aluminum monostearate and gelatin.

[0245] In some embodiments of the present invention, the bacterial strain Petition 870260073253, dated 07 / 23 / 2026, page 137 / 287 125 / 190 A recombinant Gram-negative bacterium of attenuated virulence is co-administered with a siderophore to the subject.

[0246] These modalities are preferred. Siderophores that can be co-administered include hydroxamate, catecholate, and mixed-linker siderophores. Preferred siderophores are Deferoxamine (also known as deferrioxamine B, deferrioxamine B, DFO-B, DFOA, DFB, or deferal), Deferrioxamine E, Deferasirox (Exjade, Desirox, Defrijet, Desifer), and Deferiprone (Ferriprox), with Deferoxamine being the most preferred. Deferoxamine is a bacterial siderophore produced by the actinobacterium Streptomyces pilosus and is commercially available from, for example, Novartis Pharma Schweiz AG (Switzerland).

[0247] Co-administration with a siderophore may precede, concurrent with, or follow administration of the attenuated recombinant Gram-negative bacterial strain. Preferably, a siderophore is administered before administration of the attenuated recombinant Gram-negative bacterial strain, more preferably at least 1 hour, preferably at least 6 hours, most preferably at least 12 hours, in particular at least 24 hours before administration of the attenuated recombinant Gram-negative bacterial strain to the subject. In a particular embodiment, the subject is pre-treated with desfreoxamine 24 hours before infection with the attenuated recombinant Gram-negative bacterial strain in order to allow bacterial growth.Usually, a siderophore is co-administered in a single dose of about 0.5 x 10⁻⁵ Mol to about 1 x 10⁻³ Mol, more preferably, about 1 x 10⁻⁵ Mol to about 1 x 10⁻⁴ Mol, preferably, about 3.5 x 10⁻⁵ Mol to about 1.1 x 10⁻⁴ Mol per kg of body weight. Usually, deferoxamine is co-administered in a single dose of about 20 mg to about 60 mg, preferably, about 20 mg to 60 mg. Petition 870260073253, dated 07 / 23 / 2026, pp. 138 / 287 126 / 190 about 60 mg per kg of body weight.

[0248] The dosage regimens for administering the attenuated virulence recombinant Gram-negative bacterial strain or the pharmaceutical composition described in the present invention will vary with the particular objective to be achieved, the age and physical condition of the subject being treated, the duration of treatment, the nature of concurrent therapy, and the specific bacteria used, as known to those skilled in the art. The attenuated virulence recombinant Gram-negative bacterial strain is usually administered to the subject according to a dosage regimen consisting of a single dose every 1 to 20 days, preferably every 1 to 10 days, more preferably every 1 to 7 days. The administration period is usually about 20 to about 60 days, preferably about 30 to 40 days. Alternatively, the administration period is usually about 8 to about 32 weeks, preferably about 8 to about 24 weeks, more preferably about 12 to about 16 weeks.

[0249] In another embodiment, the present invention provides a kit for treating cancer, for example, such as solid malignant tumors, preferably in humans. Such kits will generally comprise the recombinant Gram-negative bacterial strain of attenuated virulence or the pharmaceutical composition described in the present invention, and instructions for using the kit. In some embodiments, the kits include a carrier, packaging, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the containers including one of the separate elements to be used in a method described in the present invention. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In other embodiments, the containers are formed from a variety of materials, such as glass or plastic. Petition 870260073253, dated 07 / 23 / 2026, page 139 / 287 127 / 190 Examples Example 1: A) Materials and Methods

[0250] Bacterial strains and growth conditions. The strains used in this study are listed in Figs. 3A for ME coli Top10, used for purification and plasmid cloning, and E. coli Sm10 λ pir, used for conjugation, as well as E. coli BW1961031, used to propagate pKNG101, were routinely cultured on LB agar plates and in LB broth at 37 °C. Ampicillin was used at a concentration of 200 pg / ml (Yersinia) or 100 pg / ml (E. coli) to select expression vectors. Streptomycin was used at a concentration of 100 pg / ml to select suicide vectors. Y. enterocolitica MRS40 (0:9, biotype 2)20, an E40 derivative not resistant to Ampicillin19, and strains derived from it were usually cultured in Brain Heart Infusion (BHI; Difco) in RT. For all Y. enterocolitica strains, nalidixic acid was added (35 pg / ml) and all Y. strainsenterocolitica asd were additionally supplemented with 100 pg / ml of meso-2,6-diaminopimelic acid (mDAP, Sigma Aldrich). S. enterica SL1344 were usually cultured on LB agar plates and in LB broth at 37 °C. Ampicillin was used at a concentration of 100 pg / ml to select expression vectors in S. enterica.

[0251] Genetic manipulations of Y. enterocolitica. Genetic manipulations of Y. enterocolitica have been described32,33. Briefly, mutants for gene modification or deletion in pYV plasmids or chromosomes were constructed by 2-fragment overlap PCR using purified pYV40 plasmid or genomic DNA as a template, leading to 200 to 250 bp of flanking sequences on both sides of the deleted or modified portion of the respective gene. Resulting fragments were cloned into Petition 870260073253, dated 07 / 23 / 2026, pp. 140 / 287 128 / 190 pKNG10129 in E. coli BW1961031. Plasmids verified in the sequence were transformed into E. coli Sm10 λ pir, from which the plasmids were mobilized into the corresponding Y. enterocolitica strain. Mutants carrying the integrated vector were propagated for several generations without selection pressure. Then, sucrose was used to select clones that had lost the vector. Finally, the mutants were identified by colony PCR. Specific mutants (pSi_408, pSi_419) are listed in Table III.

[0252] Plasmid construction. Plasmid pBad_Si2 or pBad_Si1 (Fig. 2) were used for cloning fusion proteins with the 138 N-terminal amino acids of YopE (SEQ ID No. 2). pBad_Si2 was constructed by cloning the SycE-YopE1-138 fragment containing endogenous promoters for YopE and SycE from purified pYV40 into the KpnI / HindIII site of pBad-MycHisA (Invitrogen). Additional modifications included the removal of the NcoI / Bglll fragment from pBadMycHisA by digestion, treatment, and Klenow fragment re-ligation. A bidirectional transcriptional terminator (BBa_B1006; iGEM foundation) was cloned into a KpnI-treated and Klenow-treated cleavage site (pBad_Si2) or Bglll cleavage site (pBad_Si1). Additionally, at the 3' end of YopE1-138, the following cleavage sites were added: XbaI-XhoI-BstBI-(HindIII) (Fig. 2B). pBad_Si1 is identical to pBad_Si2, but encodes amplified EGFP from pEGFP-C1 (Clontech) at the NcoI / Bglll site under the Arabinose-inducible promoter.Plasmids pSi_266, pSi_267, pSi_268, and pSi_269 containing the corresponding endogenous promoter and the SteA1_20 fragment (pSi_266), the full-length SteA sequence (pSi_267), the SopE1_81 fragment (pSi_268), or the SopE1_105 fragment (pSi_269) were amplified from S. enterica SL1344 genomic DNA and cloned into the NcoI / KpnI site of pBad-MycHisA (Invitrogen).

[0253] Full-length genes or fragments thereof were amplified with the specific primers listed in Table I below and cloned Petition 870260073253, dated 07 / 23 / 2026, pp. 141 / 287 129 / 190 as fusions for YopEi-138 in plasmid pBad_Si2 or in the case of z-BIM (SEQ ID No. 16) in pBad_Si1 (see Table II below). For the SteA or SopE fusion, synthetic DNA constructs were cleaved by KpnI / Hindll and cloned into pSi_266, pSi_267, pSi_268, or pSi_269 respectively. In the case of bacterial species genes, purified genomic DNA was used as a template (S. flexneri M90T, Salmonella enterica subsp. enterica serovar Typhimurium SL1344, Bartonella henselae ATCC 49882). For human genes, a universal cDNA library (Clontech) was used if not otherwise established (Figs. 3A for M). Zebrafish genes were amplified from a cDNA library (a donation from M. Affolter). Linked plasmids were cloned into E. coli Top10. Sequenced plasmids were electroporated into the desired Y. enterocolitica or S. enterica strain using settings similar to those for standard E. coli electroporation. Table I (Initiator No. Si_: Sequence) Seq_Id_No_51: Initiator No.: Si_285 CATACCATGGGAGTGAG CAAGGGCGAG Seq_Id_No_52: Initiator No.: Si_286 GGAAGATCTttACTTGTACAGCTCGTCCAT Seq_Id_No_53: Initiator No.: Si_287 CGGGGTACCTCAACTAAATGACCGTGGTG Seq_Id_No_54: Initiator No.: Si_288 GTTAAAGCTTttcgaatctagactcgagCGTGGCGAACTGGTC Seq_Id_No_55: Initiator No.: Si_387 CGTAtctagaATGGACTGTGAGGTCAACAA Seq_Id_No_56: Initiator No.: Si_391 CGTAtctagaGGCAACCGCAGCA Seq_Id_No_57: Initiator No.: Si_389 Petition 870260073253, dated 07 / 23 / 2026, pp. 142 / 287 130 / 190 GTTAAAAGCTTTCAGTCCATCCCATTTCTg Seq_Id_No_58: Initiator No.: Si_436 CGTAtctagaATGCCCCGCCCC Seq_Id_No_59: Initiator No.: Si_437 GTTAAAGCTTCTACCCACCGTACTCGTCAAT Seq_Id_No_60: Initiator No.: Si_438 CGTAtctagaATGTCTGACACGTCCAGAGAG Seq_Id_No_61: Initiator No.: Si_439 GTTAAAGCTTTCATCTTCTTCGCAGGAAAAAG Seq_Id_No_62: Initiator No.: Si_463 CAGTctcgaggaaagcttgtttaagggc Seq_Id_No_63: Initiator No.: Si_464 cagtTTCGAAttagcgacggcgacg Seq_Id_No_64: Initiator No.: Si_476 GTTAAAGCTTttACTTGTACAGCTCGTCCAT Seq_Id_No_65: Initiator No.: Si_494 CGTAtctagaATGGCCGAGCCTTG Seq_Id_No_66: Initiator No.: Si_495 GTTAAAGCTTttaTTGAAGATTTGTGGCTCC Seq_Id_No_67: Initiator No.: Si_504 CGTAtctagaGAAAATCTGTATTTTCAAAGTGAAAATCTGTATTTTCAAAGTATGC CCCGCCCC Seq_Id_No_68: Initiator No.: Si_505 GTTAAAGCTTCCCACCGTACTCGTCAATtc Seq_Id_No_69: Initiator No.: Si_508 CGTAtctagaGAAAATCTGTATTTTCAAAGTGAAAATCTGTATTTTCAAAGTATGG CCGAGCCTTG Petition 870260073253, dated 07 / 23 / 2026, pp. 143 / 287 131 / 190 Seq_Id_No_70: Initiator No.: Si_509 GTTAAAGCTTTTGAAGATTTGTGGCTCCc Seq_Id_No_71: Initiator No.: Si_511 CGTAtctagaGAAAATCTGTATTTTCAAGTGAAAATCTGTATTTCAAAGTGTGA GCAAGGGCGAG Seq_Id_No_72: Initiator No.: Yes_512 CGTAtctagaGAAAATCTGTATTTTCAAGTGAAAATCTGTATTTCAAAGTCCGC CGAAAAAAAAACGTAAAGTTGTGAGCAAGGGCGAG Seq_Id_No_73: Initiator No.: Yes_513 GTTAAAGCTTttAAACTTTACGTTTTTTTTTCGGCGGCTTGTACAGCTCGTCCAT Seq_Id_No_74: Initiator No.: Yes_515 CGTAtctagaGAAAATCTGTATTTTCAAGTGAAAATCTGTATTTCAAAGTGATT ATAAAGATGATGATGATAAAATGGCCGAGCCTTG Seq_Id_No_75: Initiator No.: Yes_677 TTACTATTCGAAGAAATTATTCATAATATTGCCCGCCATCTGGCCCAAATTGGTG ATGAAATGGATCATTAAGCTTGGAGTA Seq_Id_No_76: Initiator No.: Yes_678 TACTCCAAGCTTAATGATCCATTTCATCACCAATTTGGGCCAGATGGCGGGCAA TATTATGAATAATTTCTTCGAATAGTAA Seq_Id_No_77: Initiator No.: Yes_682 TTACTACTCGAGAAAAACTGAGCGAATGTCTGCGCCGCATTGGTGATGAACTG GATAGCTAAGCTTGGAGTA Seq_Id_No_78: Initiator No.: Yes_683 TACTCCAAGCTTAGCTATCCAGTTCATCACCAATGCGGCGCAGACATTCGCTCAG TTTTTTCTCGAGTAGTAA Seq_Id_No_79: Initiator No.: Si_580 catgccatggatttatggtcatagatatgacctc Petition 870260073253, dated 07 / 23 / 2026, pp. 144 / 287 132 / 190 Seq_Id_No_80: Initiator No.: Si_612 CGGGGTACCatgaggtagcttatttcctgataaag Seq_Id_No_81: Initiator No.: Si_613 CGGGGTACCataattgtccaaatagttatggtagc Seq_Id_No_82: Initiator No.: Si_614 catgccatggCGGCAAGGCTCCTC Seq_Id_No_83: Initiator No.: Si_615 cggggtaccTTTATTTGTCAACACTGCCC Seq_Id_No_84: Initiator No.: Si_616 cggggtaccTGCGGGGTCTTTACTCG Seq_Id_No_85: Initiator No.: Si_585 CAGTctcgagATGCAGATCTTCGTCAAGAC Seq_Id_No_86: Initiator No.: Si_586 GTTAAAGCTTgctagcttcgaaACCACCACGTAGACGTAAGAC Seq_Id_No_87: Initiator No.: Si_588 cagtTTCGAAGATTATAAAGATGATGATGATAAAATGGCCGAGCCTTG Seq_Id_No_88: Initiator No. 733 TTACTACTCGAGGGGTGCCATCGATGCCGAAGAAATTATTCATAATATTGCCCG Seq_Id_No_89: Primer No. 735 TACTCCTTCGAATTAATGATCCATTTCATCACCAATTTG Seq_Id_No_90: Primer No. 736 TTACTACTCGAGGGGTGCCATCGATGCCAAAAAACTGAGCGAATGTCTGCG Seq_Id_No_91: Primer No. 738 TACTCCTTCGAATTAGCTATCCAGTTCATCACCAATG Seq_Id_No_92: Primer No. 734 TACTCCTTCGAAGGCACCATGATCCATTTCATCACCAATTTGG Seq_ID_No_93: Initiator No. 725: Petition 870260073253, dated 07 / 23 / 2026, pp. 145 / 287 133 / 190 TTACTATTCGAAGAAATTATTCATAATATTGCC Seq_ID_No_94: Primer No. 726: TACTCCAAGCTTACGGTTGAATATTATGATCCATTTCATCACCAATTTGG Seq_ID_No_95: Initiator No. 727: TTACTATTCGAAGCCGGTGGTGCCGAAGAAATTATTCATAATATTGCCC Seq_ID_No_96: Primer No. 728: TACTCCAAGCTTAATGATCCATTTCATCA Seq_ID_No_97: Primer No. 737: TACTCCTTCGAAGGCACCGCTATCCAGTTCATCACCAATG Seq_ID_No_101: Primer No. 869: gatcgtcgacTTAAGTTCAATGGAGCGTTTAATATC Seq_ID_No_102: Initiator No. 870: ctttgactggcgagaaacgcTCTTAACATGAG GCTGAGCTC Seq_ID_No_103: Initiator No. 871: GAGCTCAGCCTCATGTTAAGAgcgtttctcgccagtcaaag Seq_ID_No_104: Initiator No. 872: gatagcccccgagcctgtGCACTTTGTCATTAACCTCAGC Seq_ID_No_105: Starter No. 873: GCTGAGGTTAATGACAAAGTGCacaggctcgggggctatc Seq_ID_No_106: Starter No. 874: catgtctagaCCCTCAGCATAATAACGACTC Seq_ID_No_107: Starter No. 600: catgacatgtTGGCGTTTCTCGCC Seq_ID_No_108: Starter No. 601: catgacatgtATTAACCTCAGCCCTGACTATAAG Seq_ID_No_119: Starter No. 1010: cacatgtctagaCAACCGTTTCCGAAAGGTGATCTG Petition 870260073253, dated 07 / 23 / 2026, pp. 146 / 287 134 / 190 Seq_ID_No_120: Initiator No. 1012: atccCAagctTATTGGCGTTGGGTGGTAAAAATTTTG Seq_ID_No_121: Initiator No. 1021: cacatgtctagaATGACCGCCGAACAACGC Seq_ID_No_122: Initiator No. 1022: catgaagcttaCGGACCCGGATTTTGGCTC >Seq_ID_No_123: Initiator No. 1023: catgaagcttaCGGTTCTTCTTGAATAAAAAAATTTGAATG Seq_ID_No_124: Initiator No. 1024: catgaagcttaTTGCAGCACTTTCGGCCAATTT Seq_ID_No_125: Initiator No. 1025: cacatgtctagaATGAGCATTGTGTGTAGCGC Seq_ID_No_126: Primer No. 1026: catgaagcttaGCTTTCATCCACGGCCGG Seq_ID_No_127: Primer No. 1027: catgaagcttaATTACCGGTTTGGCGCAGC Table II: Cloned fusion proteins Protein to be released by T3SS Seq. ID. Protein No. Plasmid Structure Resulting Plasmid Name Primers. Si_Nr.: Primer Seq. ID. No. YopE1-138-MycHis 3 pBad-MycHisA (Invitrogen) pBad_Si_1 285 / 286 (EGFP), 287 / 288 (sycE-YopE1138) 51 / 52 and 53 / 54 YopE1-138-MycHis 3 pBad-MycHisA (Invitrogen) pBad_Si_2 287 / 288 (sycE-YopE1138) 53 / 54 Human YopE1-138-Bid 16 pBad_Si_2 pSi_85 387 / 391 55 / 56 Human YopE1-138-t-Bid 17 pBad_Si_2 pSi_87 389 / 391 55 / 57 Petition 870260073253, dated 07 / 23 / 2026, pp. 147 / 287 135 / 190 YopE1-138-ET1 9 pBad_Si_2 pSi_120 436 / 437 58 / 59 YopE1-138-z-BIM 16 pBad_Si_1 pSi_121 438 / 439 60 / 61 YopE1-138-TEV protease S219 pSi_12 pSi_121 463 / 464 62 / 63 YopE1-138-Ink4C 8 pBad_Si_2 pSi 151 494 / 495 65 / 66 YopE1-138-2xTEVsite - ET1 11 pBad_Si_2 pSi_156 504 / 507 / 665 YopE1-138-2xTEVsite - EGFP 98 pBad_Si_2 pSi_158 511 / 476 71 / 64 YopE1-138-2xTEVsite - EGFP - NLS 99 pBad_Si_2 pSi_159 511 / 513 71 / 173 -Ex-TEV-2 NLS - EGFP 100 pBad_Si_2 pSi_160 512 / 476 72 / 64 YopE1-138-2xTEVsite - INK4C 10 pBad_Si_2 pSi_161 508 / 509 69 / 70 YopE1-138-2xTEV - INK lag - 14C pBad_Si_2 pSi_164 515 / 509 74 / 70 BH3 part of murine tBID of optimized codon of YopE1138- Y. enterocolitica 19 pBad_Si_2 pSi_318 677 / 678 75 / 76 Part of BH3 of murine BH3 of optimized codon of YopE1138-E Y.enterocolitica 20 pBad_Si_2 pSi_322 682 / 683 77 / 78 SteA1-20 5 pBad-MycHisA (Invitrogen) pSi_266 580 / 612 79 / 80 SteA 4 pBad-MycHisA (Invitrogen) pSi_267 580 / 613 79 / 81 SopE1-81 6 pBad-MycHisA (Invitrogen) pSi_268 614 / 615 82 / 83 SopE1-105 7 pBad-MycHisA (Invitrogen) pSi_269 614 / 616 82 / 84 codon-optimized murine tBid of YopE1138- Y. enterocolitica 21 pBad_Si_2 pSi_315 Synthetic construct / YopE1-138-Ubiquitin 14 pBad_Si_2 pSi_236 585 / 586 85 / 86. Petition 870260073253, dated 07 / 23 / 2026, pp. 148 / 287 136 / 190 YopE1-138- Ubiquitin-Flag- INK4C-MycHis 15 pSi_236 pSi_237_II 588 / 509 87 / 70 BH3 portion of murine tBID with optimized codon of YopE1138-(Y. enterocolitica) ready for insertion of other domains 25 pBad_Si_2 pSi_357 733 / 735 88 / 89 BH3 portion of murine Bax with optimized codon of YopE1138-(Y. enterocolitica) ready for insertion of other domains 26 pBad_Si_2 pSi_358 736 / 738 ​​90 / 91 BH3 portion of murine tBID with optimized codon of YopE1138-(Y. enterocolitica)2 27 pSi_357 pSi_371 733 / 734 88 / 92 YopE1-138- murine tBID optimized codon BH3 part (138- Y. enterocolitica) 28 pSi_358 pSi_373 733 / 734 88 / 92 YopE1-138- Extended murine tBID optimized codon BH3 part 22 pBad_Si_2 pSi_353 725 / 726 93 / 94 YopE1-138- Connector 10 Aa - Murine tBID optimized codon BH3 part 23 pBad_Si_2 pSi_354 727 / 728 95 / 96 YopE1-138- BH3 part 24 pSi_357 pSi_374 736 / 737 90 / 97 Petition 870260073253, dated 07 / 23 / 2026, pp. 149 / 287 137 / 190 Synthetic construct / YopE1-138 - two CARD domains of murine RIG1 from optimized codon of Y. enterocolitica (Aa. 1245) 37 pBad_Si_2 pSi_453 Synthetic construct / YopE1-138 - two CARD domains of murine RIG1 from optimized codon of Y. enterocolitica (Aa. 1246) 38 pBad_Si_2 pSi_454 Synthetic construct / YopE1-138 - S. cerevisiae GCN4 from optimized codon of Y. enterocolitica (Aa. 249278) - P. aeruginosa WspR from optimized codon of Y. enterocolitica (Aa. 172347) 39 pBad_Si_2 pSi_452 Synthetic construct / YopE1-138- IRF3 S397D murine codon optimized from Y. enterocolitica 40 pBad_Si_2 pSi_428 Synthetic construct / YopE1-138- DncV from V. cholerae codon optimized from Y. enterocolitica (M3toL413) 41 pBad_Si_2 pSi_482 Synthetic construct / YopE1-138 - B. cereus _similar to 42 pBad_Si_2 pSi_483 Synthetic construct / Petition 870260073253, dated 07 / 23 / 2026, pp. 150 / 287 138 / 190 Y. enterocolitica optimized codon DisA (PDB: 2FB5; Aa. 76-205) YopE1-138 - Anemonae (N. vectensis) Y. enterocolitica optimized codon cGAS (Ensembl: A7SFB5. 1) 43 pBad_Si_2 pSi_484 Synthetic construct / YopE1-138 - CARD domains of murine Y. enterocolitica optimized codon RIG1 (Aa. 1-229) 110 pBad_Si_2 pSi_521 1021 / 1022 122 / 123 YopE1-138 - CARD domains of murine Y. enterocolitica optimized codon RIG1 (Aa. 1218) 111 pBad_Si_2 pSi_522 1021 / 1023 122 / 124 YopE1-138 - Murine codon-optimized MDA5 from Y. enterocolitica (Aa. 1294) 112 pBad_Si_2 pSi_517 Synthetic construct / YopE1-138 - Murine codon-optimized MDA5 from Y. enterocolitica (Aa. 1231) 113 pBad_Si_2 pSi_524 1025 / 1026 126 / 127 YopE1-138 - Human codon-optimized CGAS from Y. enterocolitica (Aa. 161522) 115 pBad_Si_2 pSi_515 Synthetic construct / YopE1-138 - Human codon-optimized MAVS CARD from Y. 116 pBad_Si_2 pSi_539 Synthetic construct / Petition 870260073253, dated 07 / 23 / 2026, pp. 151 / 287 139 / 1 enterocolitica (Aa. 1100) YopE1-138 Anemonae (N. vectensis) Otimized codon cGAS of Y. enterocolitica (Aa. 60422) (Ensembl: A7SFB5.1) 117 pBad_Si_2 pSi_503 1010 / 1012 120 / 121 YopE1-138 - Listeria CdaA of otimized codon of Y. enterocolitica (Aa. 101- 273) 118 pBad_Si_2 pSi_518 Synthetic construct / . Table III: Mutators for genetic modification Mutator / Con strut To be inserted in: Structure of plasmid Name of resulting plasmid Initiators If_No: Initiators Seq. Id. No. Used with special precursor strain YopE1-138 - BH3 of murine tBID pYV pKNG101 pSi_408 Synthetic gene / / YopE1-138 - (murine tBID BH3)2 pYV pKNG101 pSi_437 Synthetic gene / Mutated strain with pSi_408 YopE1-138 dois CARD domains of murine RIG1 of Y. enterocolitica codon otimized (Aa. 1-246) pYV pKNG101 pSi_456 (Seq ID No. 50) Synthetic gene / / pYV-asd pYV pKNG101 pSi_417 PCR1: 869 / 870; PCR2: PCR1:101 / 102; PCR2: Δ asd Petition 870260073253, dated 07 / 23 / 2026, pp. 152 / 287 140 / 190 871 / 872; PCR3: 873 / 874; overlapping PCR 869 / 874 103 / 104; PCR3: 105 / 106; Overlap PCR 101 / 106 pYV-virFhairpinI pYV pKNG101 pSi_441 Synthetic gene / / pYV-pAra- VirF pYV pKNG101 pSi_439 Synthetic gene / /

[0254] Yop secretion. Induction of yop regulon was performed by changing the culture at 37°C in BHI-Ox (secretion-permissive conditions)34. As a carbon source, glucose was added (4 mg / ml).

[0255] Total cell and supernatant fractions were separated by centrifugation at 20,800 g for 10 min at 4°C. The cell pellet was taken as the total cell fraction. Proteins in the supernatant were precipitated with 10% (w / v) trichloroacetic acid for 1 ha at 4°C. After centrifugation (20,800 g for 15 min) and supernatant removal, the resulting pellet was washed in ice-cold acetone overnight. Samples were centrifuged again, the supernatant was discarded, and the pellet was air-dried and resuspended in 1x SDS loading dye.

[0256] Secreted proteins were analyzed by SDS-PAGE; in each case, proteins secreted by 3 x 10⁸ bacteria were loaded per strip. Detection of specific secreted proteins by immunoblotting was performed using 12.5% ​​SDS-PAGE gels. For detection of proteins in whole cells, 2 x 10⁸ bacteria were loaded per strip, unless otherwise specified, and the proteins were separated on 12.5% ​​SDS-PAGE gels prior to immunoblotting detection.

[0257] Immunoblotting was performed using mouse monoclonal antibodies against YopE (MIPA193-13A9; 1:1000.35). The antiserum was pre-absorbed two Petition 870260073253, dated 07 / 23 / 2026, pp. 153 / 287 141 / 190 times overnight against Y. enterocolitica ΔH×ṣṭṭ asd to reduce background staining. Detection was performed with secondary antibodies directed against mouse antibodies and conjugated with horseradish peroxidase (1:5000; Southern biotech), prior to development with the chemiluminescent substrate ECL (LumiGlo, KPM).

[0258] Cell culture and infections. HeLa Ccl2 and B16F10 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FCS and 2 mM L-Glutamine (cDMEM). 4T1 cells were cultured in RPMI 1640 supplemented with 10% FCS and 2 mM L-Glutamine. Y. enterocolitica was cultured in BHI with additives overnight at RT, diluted in fresh BHI to an OD600 of 0.2 and cultured for 2 h at RT before a temperature change to a water bath shaker at 37 °C for a further 30 min or for 1 h in the case of EGFP release. Finally, the bacteria were collected by centrifugation (6,000 ref, 30 s) and washed once with DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine.Cells seeded in 96-well plates (for immunofluorescence) or 6-well plates (for Western blotting) were infected in indicated MOIs in DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. After adding bacteria, the plates were centrifuged for 1 min at 1750 rpm and incubated at 37 °C for the indicated time periods. Extracellular bacteria were killed with gentamicin (100 mg / ml) if indicated. In the case of immunofluorescence analysis, infection assays were stopped by fixation with 4% PFA. For Western blot analysis, cells were washed twice with ice-cold PBS and Phospho-safe lysis buffer (Novagen) was added to lyse the cells. After incubation on ice, the cells were centrifuged (16,000 rcf, 25 min, 4 °C). Supernatants were collected and... Petition 870260073253, dated 07 / 23 / 2026, pp. 154 / 287 Samples 142 / 190 were analyzed for total protein content by Bradford BCA assay (Pierce) prior to SDS PAGE and Western blotting using anti-Actin (Millipore), anti-Bid (Cell Signaling), anti-Myc (Santa Cruz), anti-Caspase-3 p17 (Cell Signaling), and anti-Ink4C (Cell Signaling) antibodies.

[0259] Western blotting of T3SS translocated proteins from infected cells. HeLa cells in 6-well plates were infected at an MOI of 100 as described above. In the case of co-infection with the TEV protease translocation strain Y. enterocolitica, the ODôoo of the strains was adjusted and the two bacterial suspensions were mixed in a tube at a 1:1 ratio (unless otherwise indicated) before addition to the cells. At the end of infection, the cells were washed twice with ice-cold PBS and collected by scraping into a small volume of ice-cold PBS. After centrifugation (16,000 rcf, 5 min, 4 °C), the pellet was dissolved in 0.002% digitonin supplemented with a protease inhibitor cocktail (Roche Complete, Roche). The dissolved pellets were incubated for 5 minutes on ice and then centrifuged (16,000 rcf, 25 min, 4 °C).The supernatants were collected and analyzed for total protein content by Bradford BCA assay (Pierce) prior to SDS PAGE and Western blotting using an anti-Myc antibody (Santa Cruz, 9E11) or anti-Ink4C antibody (Cell Signaling).

[0260] Automated Microscopy and Image Analysis. Images were automatically acquired with an ImageXpress Micro (Molecular Devices, Sunnyvale, USA). Quantification of anti-Myc staining intensity was performed using MetaXpress (Molecular Devices, Sunnyvale, USA). Regions within cells excluding nuclear regions and regions containing bacteria were manually selected (circles with an area of ​​40 pixels) and the average intensity was recorded. Biodistribution in mouse models of B16 tumor allograft. Petition 870260073253, dated 07 / 23 / 2026, page 155 / 287 143 / 190 F10 and 4T1

[0261] All animal experiments were approved (license 1908; Kantonales Veterinaramt Basel-Stadt) and conducted in accordance with local guidelines (Tierschutz-Verordnung, Basel-Stadt) and Swiss animal protection law (Tierschutz-Gesetz). Six-week-old C57Bl / 6 and BALB / c mice were ordered from Janvier Labs. After at least one week of accommodation, the mice were anesthetized using isoflurane and 100 pL of B16-F10 or 4T1 cells (1 x 10⁵–1 x 10⁶ cells) were subcutaneously injected into the flank of C57Bl / 6 and BALB / c, respectively. Throughout the experiment, the mice were scored for behavior and physical appearance, and surface temperature, as well as body weight, was measured.

[0262] Once tumors had developed, mice were administered an 8 mg / ml (10 ml / kg) desferal solution via ip injection. The following day, mice were infected with Y. enterocolitica MRS40 or Y. enterocolitica MRS40 ΔHOPEMT (2 x 10⁵, 1 x 10⁶, or 1 x 10⁷ bacteria) by tail vein injection. The iv inoculum administered to mice was validated by dilution slides. In some experiments, tumor progression was followed by daily measurements of tumor length and width with digital forceps. Tumor volume was determined as 0.523 x length x width². On the respective post-infection days, mice were sacrificed by CO₂ inhalation. A blood sample was immediately isolated via heart aspiration. The liver, spleen, lung, and tumor were isolated and their weights determined. The organs and the tumor were then homogenized.CFU in each sample was determined by serial dilution blotting on LB agar plates containing nalidixic acid (35 pg / ml).

[0263] Direct type I interferon activation assay. Melanoma cells Petition 870260073253, dated 07 / 23 / 2026, pp. 156 / 287 144 / 190 murine B16F10 macrophages, wild-type or knockout RAW264.7 macrophages for murine MAVS stably expressing secreted embryonic alkaline phosphatase (SEAP) or secreted Lucia luciferase under the control of the IISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE, were acquired from InvivoGen (B16-Blue ISG, RAW-Blue ISG, RAW-Lucia ISG, and RAW-Lucia ISG-KO-MAVS). Growth conditions and type I IFN assay were adapted from protocols provided by InvivoGen. Briefly, 12,500 B16-Blue ISG or 30,000 RAW-Blue cells, RAW-Lucia cells, or RAW-Lucia KO-MAVS ISG cells in 150 pL of test medium (RPMI + 2 mM L-glutamine + 10% FCS for B16-Blue ISG cells; DMEM + 2 mM L-glutamine + 10% FCS for RAW-Blue, RAW-Lucia, and RAW-Lucia KO-MAVS ISG cells) per well were seeded in a 96-well flat-bottom plate (NUNC or Corning).The following day, cells were infected with the bacterial strains to be evaluated by adding 15 pL per well of the desired multiplicity of infection (MOI, diluted in test medium). After 2 hours of incubation (37°C and 5% CO2), the bacteria were killed by adding test medium containing penicillin (100 U / mL) and streptomycin (100 pg / mL). Incubation was continued for 20 to 24 h. SEAP and luciferase detection followed the QUANTI-Blue™ and QUANTI-Luc™ protocols (InvivoGen), respectively. For SEAP detection: 20 pL of cell supernatant were incubated with 180 pL of detection reagent (QUANTI-Blue™, InvivoGen). The plate was incubated at 37°C and SEAP activity was measured by reading OD at 650 nm using a microplate reader (Molecular devices). As a positive control, murine IFN-γ (stock: 1,000,000 U / mL) diluted to the respective concentrations in test medium was used.For luciferase detection: To 20 pL of cell supernatant, 50 pL of detection reagent (QUANTI-Luc™, InvivoGen) were added to opaque plates (ThermoScientific). Luminescence was measured. Petition 870260073253, dated 07 / 23 / 2026, pages 157 / 287 145 / 190 immediately using a license plate reader (BioTek).

[0264] Indirect type I interferon activation assay. Murine B16F10 or 4T1 cells were infected with indicated multiplicities of infection (MOI) of the bacterial strains to be evaluated for a total of 4 h as described above. Cell supernatant was then transferred into murine B16F10 melanoma cells stably expressing secreted embryonic alkaline phosphatase (SEAP) under the control of the I-ISG54 promoter (comprising the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE; acquired from InvivoGen, B16-Blue ISG cells). Growth conditions and type I IFN assay were adapted from protocols provided by InvivoGen. Briefly, 12'500 B16-Blue ISG cells in 150 pL of test medium (RPMI + 2 mM L-glutamine + 10% FCS) per well were seeded in a 96-well flat-bottom plate (NUNC). The following day, all the medium was removed and 100 pL of cell supernatant from previously infected B16F10 or 4T1 cells was added.The plate was incubated for 20 to 24 hours at 37°C and 5% CO2. SEAP detection followed the QUANTI-Blue™ protocol (InvivoGen). 20 pL of cell supernatant were incubated with 180 pL of detection reagent (QUANTI-Blue™, InvivoGen). The plate was incubated at 37°C and SEAP activity was measured by OD reading at 650 nm using a microplate reader (Molecular devices).

[0265] Study of tumor progression in the B16F10 tumor allograft mouse model after intratumoral treatment. All animal experiments were approved by the relevant authorities and conducted in accordance with local guidelines and animal protection laws. Female C57Bl / 6 mice aged 5–7 weeks were ordered from Charles River (L'Arbresles). After at least one week of accommodation, the mice were anesthetized using isoflurane and 1 x 106 Petition 870260073253, dated 07 / 23 / 2026, pp. 158 / 287 146 / 190 B16-F10 cells in 200 pL of RPMI 1640 were subcutaneously injected into the right flank of mice. At regular intervals, the mice were monitored for behavior and physical appearance, and body weight was measured.

[0266] Treatments began when tumors reached a volume of 60 to 130 mm3 (defined as day 0). Mice were administered the bacterial strains to be evaluated on days 0, 1, 2, 3, 6, and 9 by intratumoral injection (7.5 x 107 bacteria in 50 µl of PBS per administration) under isoflurane anesthesia. The inoculum administered intratumorally to the mice was validated by dilution slides. As a control, mice were injected only with endotoxin-free PBS. 24 hours before the last bacterial treatment (day 8), mice were administered an 8 mg / ml (10 ml / kg) desferal solution via ip injection. Tumor progression was followed by measurements of tumor length and width with digital forceps. Tumor volume was determined as 0.5 x length x width2. A tumor volume exceeding 1,500 mm3 was defined as the humanitarian endpoint.

[0267] Study of tumor progression and redisplay in mouse models of EMT-6 tumor allograft after intratumoral treatment. All animal experiments were approved by the relevant authorities and conducted in accordance with local guidelines and animal protection laws. Female BALB / c (BALB / cByJ) mice aged 5–7 weeks were ordered from Charles River (L'Arbresles). After at least one week of accommodation, the mice were anesthetized using isoflurane and 1 x 10⁶ EMT-6 cells in 200 pL of RPMI 1640 were injected subcutaneously into the right flank of the mice. At regular intervals, the mice were monitored for behavior and Petition 870260073253, dated 07 / 23 / 2026, pp. 159 / 287 147 / 190 physical appearance and body weight were measured.

[0268] Treatments began when tumors reached a volume of 60 to 130 mm3 (defined as day 0). Mice were administered the bacterial strains to be evaluated on days 0, 1, 5, 6, 10, and 11 by intratumoral injection (7.5 x 107 bacteria in 50 pL of PBS per administration) under isoflurane anesthesia. The inoculum administered intratumorally to the mice was validated by dilution slides. As a control, mice were injected only with endotoxin-free PBS. 24 hours before the last bacterial treatment (day 10), mice were administered an 8 mg / ml (10 ml / kg) desferal solution via ip injection. Tumor progression was followed by measurements of tumor length and width with digital forceps. Tumor volume was determined as 0.5 x length x width2. A tumor volume exceeding 1,500 mm3 was defined as the humanitarian endpoint.Mice exhibiting complete tumor regression on day 54 after the start of treatment were anesthetized using isoflurane, and 1 x 10⁶ EMT-6 cells in 200 pL of RPMI 1640 were subcutaneously injected into the contralateral (left) flank relative to the first tumor cell injection. As a control group, unexposed mice that had not been previously grafted with EMT-6 cells were included. Tumor progression was followed by measurements of tumor length and width with digital forceps. Tumor volume was determined as 0.5 x length x width². A tumor volume exceeding 1,500 mm³ was defined as the humane endpoint.

[0269] Study of tumor progression in EMT-6 tumor allograft mouse models after intravenous treatment. All animal experiments were approved by the relevant authorities and conducted in accordance with local guidelines and animal protection laws. Petition 870260073253, dated 07 / 23 / 2026, pp. 160 / 287 148 / 190 female BALB / c (BALB / cByJ) mice aged 5–6 weeks were ordered from Charles River (L'Arbresles). After at least one week of accommodation, the mice were anesthetized using isoflurane and 1 x 10⁶ EMT-6 cells in 200 pL of RPMI 1640 were injected subcutaneously into the right flank of the mice. At regular intervals, the mice were monitored for behavior and physical appearance, and body weight was measured.

[0270] Mice were randomized into treatment groups when tumors reached a volume of 80 to 250 mm3 (defined as day 0). 24 hours before randomization (D-1), mice were administered an 8 mg / ml (10 ml / kg) desferal solution via ip injection. On day 0, mice were administered the bacterial strains to be evaluated by intravenous injection (5 x 106 bacteria in 100 pL of PBS per administration) under isoflurane anesthesia. The intravenously administered inoculum to the mice was validated by dilution slides. As a control, mice were injected only with endotoxin-free PBS. Tumor progression was followed by measurements of tumor length and width with digital forceps. Tumor volume was determined as 0.5 x length x width2. A tumor volume exceeding 1,500 mm3 was defined as the humanitarian endpoint.

[0271] Measurement of IFN3 secretion after infection of tumor cell isolates. All animal experiments were approved (license 1908; Kantonales Veterinaramt Basel-Stadt) and performed in accordance with local guidelines (Tierschutz-Verordnung, Basel-Stadt) and Swiss animal protection law (Tierschutz-Gesetz). Six-week-old BALB / c mice were ordered from Janvier Labs. After one week of accommodation, the mice were anesthetized using isoflurane and 100 pL of EMP cells. 149 / 190 (1 x 10⁶ cells) were subcutaneously injected into the flank of mice. Throughout the experiment, mice were scored for behavior and physical appearance, and surface temperature and body weight were measured. Tumor progression was tracked by measuring tumor length and width with digital calipers. Tumor volume was determined as 0.5 x length x width². On the day of the assay, tumors were isolated, cut into small 1–2 mm pieces, digested for 1–1.5 hours, and passed through a 70 µm nylon mesh to obtain a single-cell suspension. The cell count of this crude cell isolate was determined, and 300,000 cells per well were seeded in a 24-well flat-bottom (Corning) plate in growth medium (DMEM + L-glutamine + non-essential amino acids + 10% FCS).After 1 hour of incubation at 37°C and 5% CO2, the cells were infected with the bacterial strains to be evaluated by adding 100 pL per well of a bacterial titer (different MOI, diluted in growth medium). After 1 hour of incubation (37°C and 5% CO2), the bacteria were killed by adding growth medium containing penicillin (100 U / mL) and streptomycin (100 pg / mL). Incubation was continued for another 3 hours. The plate was centrifuged to collect all cells at the bottom of the well, and the supernatant was analyzed for IFNe concentration using the LumiKine™ Xpress murine IFN-β ELISA (Invivogen) according to the manufacturer's instructions. B) RESULTS A protein delivery system based on type 3 secretion of YopE fusion proteins.

[0272] Although the N-terminal of the effector YopE of Y. enterocolitica T3SS (SEQ ID No. 1) itself contains sufficient secretion signal to translocate heterologous proteins22, the chaperone binding site (CBS) for its chaperone Petition 870260073253, dated 07 / 23 / 2026, pp. 162 / 287 150 / 190 (SycE) is not included36. We selected the 138 N-terminal amino acids of YopE (SEQ ID No. 2) to be fused with proteins to be released, as this has been shown to provide the best results for the translocation of other heterologous T3S substrates24. As these 138 N-terminal amino acids of YopE contain CBS, we decided to co-express SycE. The cloned SycEYopE1-138 fragment of the purified Y. enterocolitica pYV40 virulence plasmid contains the endogenous promoters of YopE and its chaperone SycE (Fig. 2). Therefore, SycE and any YopE1-138 fusion protein are induced by a rapid temperature change from growth at RT to 37 °C. The culture time at 37 °C will affect the amount of fusion protein present in the bacteria. A multiple cloning site (MCS) was added at the 3' end of YopE1138 (Fig. 2 B) followed by a Myc and a 6xHis marker and a stop codon.

[0273] The source strain was carefully selected. First, to limit the translocation of endogenous effectors, we used a Y. enterocolitica strain that was deleted for all known effectors, Yop H, O, P, E, M, and T (designated ΔHßPáÕMÜT)37. In addition, we occasionally used an auxotrophic mutant that cannot grow in the absence of exogenous meso-2,6-diaminopimelic acid38. This strain was deleted for the aspartate-beta-semialdehyde dehydrogenase (Δasd) gene and classified as biosafety level 1 by the Swiss safety agency (amendment to A010088 / 2). Furthermore, we deleted the YadA and / or InvA adhesion proteins to offer a wide choice of base strains. Although the use of yadA or yadA / invA strains reduces the induced baseline signaling39, the amount of protein released is also affected40. Removal of the YopE1-138 appendix after translocation of the fusion protein into the eukaryotic cell.

[0274] Although the YopE1-138 fragment is of great benefit for bacterial clearance, it may hinder the function and / or localization of proteins. Petition 870260073253, dated 07 / 23 / 2026, pp. 163 / 287 151 / 190 fusion. Therefore, its removal after protein release would be optimal. To this end, we introduced two TEV cleavage sites (ENLYFQS)41-43 between YopE1138 and a fusion partner (the transcriptional regulator ET1-Myc (SEQ ID No. 9 and 11)44 and human INK4C (SEQ ID No. 8 and SEQ ID No. 10)). To maintain the advantages of the presented method, we further fused the TEV protease (variant S219V;45) with YopE1-138 (SEQ ID No. 12) in another Y. enterocolitica strain. HeLa cells were infected with both strains at once. To allow analysis of the translocated fraction of proteins only, the infected HeLa cells were lysed at 2 h pi with Digitonin, which is known not to lyse bacteria (46;). Western blot analysis revealed the presence of YopE1-138-TEV cleavage site 2x-ET1-Myc or YopE1-138-TEV cleavage site 2x-Flag-INK4C-Myc only when cells were infected with the corresponding strain.After overnight digestion of this cell lysate with purified TEV protease, a displaced band can be observed. This band corresponds to ET1-Myc or Flag-INK4C with the N-terminal remnants of the TEV cleavage site, most likely just a serine. After co-infection of cells with the strain releasing the TEV protease, the same cleaved ET1-Myc or Flag-INK4C fragment becomes visible, indicating that the TEV protease released via T3SS is functional and that single cells were infected by both bacterial strains. Although cleavage is not complete, most of the translocated protein is cleaved as early as 2 h after infection, and even overnight digestion with purified TEV protease did not provide better cleavage rates. As reported, protease-dependent cleavage of TEV may need fusion protein-dependent optimization.47,48The protease-dependent removal of TEV from the YopE1-138 appendix after translocation consequently provides, for the first time, a release of T3SS protein from near-native heterologous proteins, altering the amino acid composition by only one N-terminal amino acid. Petition 870260073253, dated 07 / 23 / 2026, pp. 164 / 287 152 / 190

[0275] An alternative method for protease-dependent cleavage of the YopE fragment of TEV consisted of incorporating Ubiquitin into the fusion protein of interest. In fact, Ubiquitin is processed at its C-terminus by a group of endogenous Ubiquitin-specific C-terminal proteases (Dubiquitinating enzymes, DUBs). Since the cleavage supposedly occurs at the C-terminus of Ubiquitin itself (after G76), the protein of interest must be free of additional amino acid sequences. This method was tested on the fusion protein YopE1-138-Ubiquitin-Flag-INK4C-MycHis. In control cells infected with bacteria expressing YopE1-138-Flag-INK4C-MycHis, a band corresponding to YopE1-138-Flag-INK4C-MycHis was found, indicative of efficient translocation of the fusion protein.When cells were infected for 1 h with bacteria expressing YopE1-138-Ubiquitin-Flag-INK4C-MycHis, an additional band corresponding to the size of Flag-INK4C-MycHis was visible, indicating that part of the fusion protein was cleaved. This result shows that the introduction of Ubiquitin into the fusion protein allows cleavage of the YopE1-138 fragment without the need for an exogenous protease. Attenuation of virulence by deletion / mutation of bacterial effector proteins with virulence activity against eukaryotic cells.

[0276] In the case of Y. enterocolitica, virulence was reduced by deletion of the six endogenous effector proteins, called “Yersinia external proteins (Yops), in detail YopH, O, P, E, M, T (MRS40 pIML421 [γορHΔI-352, γopOΔ65558, yopP23, yopE21, yopM23, yopT135])37. These Yops are encoded in the “Yersinia virulence plasmid (pYV), a plasmid with an approximate size of 70 kbp, in which the complete type 3 secretion system (T3SS) as well as other virulence factors are encoded (Fig. 4). YopH, O, P, E, M, and T are the six effector proteins that are released to host cells by the secretion system of three bacterial types in order to modulate and reduce the Petition 870260073253, dated 07 / 23 / 2026, pp. 165 / 287 153 / 190 immune system. Each Yop has a specific biochemical activity in the host cell. YopT cleaves the C-terminal cysteine ​​of Rho GTPases and thus removes the isoporenyl group securing the GTPases to the membrane. This inactivation of Rho due to mislocalization prevents phagocytosis by immune cells such as macrophages and neutrophils49. In the same pathway, YopE acts as a GTPase activating protein (GAP) for Rho GTPases, deactivating them. This results in decreased phagocytosis and inhibition of IL-1 beta release by immune cells49. In addition, YopO acts as a guanidine nucleotide dissociation inhibitor (GDI), deactivating Rho GTPases. YopO also possesses a serine / threonine kinase domain acting in a manner not yet defined on the actin cytoskeleton 49. YopH is a tyrosine phosphatase acting on focal adhesion proteins such as focal adhesion kinase (Fak), paxillin and others, thus strongly preventing phagocytosis by macrophages and neutrophils 49. It was found that YopP, called YopJ in Y.In the case of pseudotuberculosis or Y. pestis, YopP inactivates the MAPK / NFkB pathway in immune cells, preventing the release of TNFα and IL-8 from immune cells stimulated by the presence of the bacteria. Furthermore, YopP has been shown to induce apoptosis in immune cells, which may be related to the effect of the MAPK pathway, which in its activated state protects cells from apoptosis.49 The role of YopM is not yet fully clear, but it has been found to be associated with ribosomal S6 kinase 1 (RSK1) and protein kinase C-type 2 (PRK2). It appears that YopM could stimulate RSK1 phosphorylation and thus affect downstream targets, such as cell cycle progression.49 By deleting one or more of these Yops, the bacteria's defense mechanism against the immune system is dramatically affected.50 The mutation of the respective yops was confirmed by PCR in the respective region, and by in vitro secretion assay.In vitro secretion analysis by SDS-PAGE and Coomassie blue staining confirmed the absence of full-length YopH,O,M and YopE. Petition 870260073253, dated 07 / 23 / 2026, pp. 166 / 287 154 / 190

[0277] Furthermore, a Y. enterocolitica strain with deletions in asd (aspartate semaldehyde dehydrogenase) was constructed. The mutation in asd leads to a complete loss of growth capability without the addition of mesodiaminopimelic acid. This allows the generation of antibiotic-free plasmid maintenance systems based on the presence of asd in the respective plasmid. In a similar way, other auxotrophic mutants can be used. Increased generation of pro-apoptotic bacteria

[0278] In order to optimize the release of pro-apoptotic proteins, the transformed strains with different pro-apoptotic proteins were generated according to Table IV. Table IV: Transformed strains with different pro-apoptotic proteins Strain name, Strain of origin, Protein to be released by T3SS, Plasmid structure, Name of the resulting plasmid, Primers. Si_No.: Resistances YopE1-138 (BH3-extended part of codon-optimized murine tBID from Y. Enterocolitica) Y. enterocolitica AyopH,O,P,E,M,T Δasd YopE1-138 BH3 from Y. enterocolitica codon-optimized murine tBID extended (by 4 Aa) pBad_Si_2 pSi_353 Nal Amp YopE1-138 connector 10 Aa-(extended part of BH3 of murine codon-optimized tBID of YY enterocolitica AyopH,O,P,E,M,T Δasd YopE1-138 connector 10 Aa - BH3 of murine codon-optimized tBID of Y. enterocolitica pBad_Si_2 pSi_354 727 / 728 Nal Amp Petition 870260073253, dated 07 / 23 / 2026, pp. 167 / 287 155 / 190 Enterocolytica) YopE1-138 - Y. enterocolitica YopE1-138 - pSi_357 pSi_374 736 / 737 Nal Amp part AyopH,O,P,E,M,T BH3 of Bax extended from murine Δasd of BH3 of Bax murine codon of otimized of codon Y. otimized of enterocolitica Y. - BH3 of tBID Murine enterocolitica of - extended codon part of otimized of BH3 of tBID Y. murine of enterocolitica otimized codon of Y. Enterocolitica

[0279] Reducing the released proteins to the essential domains required for signaling (e.g., the BH3 domain of t-BID (SEQ ID No. 19)) can increase cell death efficiency (Fig. 5). While not linked by theory, this increase in efficiency is likely related to the increased amount of protein produced and subsequently released via T3SS due to the smaller size of the released protein. Introducing a connector between the YopE portion and the BH3 domain of tBID (SEQ ID No. 23) decreased efficiency, as did extending the BH3 domain with 4 additional amino acids (SEQ ID No. 22) (Fig. 5). Additionally, synthetic payloads with repetitions of such essential domains (e.g., the BH3 domain of t-BID (SEQ ID No. 27)) or combinations of these essential domains (e.g., the BH3 domain of t-BID and the BH3 domain of BAX (SEQ ID No. 24 and 28)) were generated.Surprisingly, it was discovered that chain repetitions of the same or different BH3 domains result in the induction of increased apoptosis in... Petition 870260073253, dated 07 / 23 / 2026, pp. 168 / 287 156 / 190 cancer cell lines (including 4T1 and B16F10 cells, Fig. 5). The IC50 (half the maximum inhibitory concentration), referring to the number of bacteria per eukaryotic cell (MOI) required to kill 50% of these cells, was decreased after the release of chain repeats of tBID BH3 domains compared to a single tBID BH3 domain (Fig. 5). This finding was surprising, since the protein size is increased by fusion with the second tBID BH3 domain. Because of this, decreased expression and release levels of YopE1-138-(tBID BH3)2 (SEQ ID No. 27) compared to tBID YopE1-138-BH3 (SEQ ID No. 19 and 25) would be expected, and may reach equivalent maximum levels. In order to achieve an increase in cell death activity, the fused tBID BH3 domains must act simultaneously side-by-side after release by the T3SS in eukaryotic cells.If only one tBID BH3 domain in the YopE1-138-(tBID BH3)2 construct is functional, at best the same efficiency with YopE1-138 tBID BH3 can be expected.

[0280] In order to increase the genetic stability of YopE1-138-(tBID BH3)2 (SEQ ID No. 27) for in vivo studies, we cloned YopE1-138-(tBID BH3)2 (SEQ ID No. 27) by homologous recombination into the Yersinia pYV virulence plasmid at the native YopE site and under the native YopE promoter (using pSI_408 and pSI_419 mutator plasmids). These mutators contain the DNA sequence encoding the desired protein, flanked by 200 to 250 bp of sequences on either side corresponding to the respective gene site where integration should occur. These plasmids are transformed into E. coli Sm10 λ pir, where the plasmids were mobilized into the corresponding Y. enterocolitica strain. Mutants carrying the integrated vector were propagated for several generations without selection pressure. Then, sucrose was used to select clones that had lost the vector. Finally, the mutants were Petition 870260073253, dated 07 / 23 / 2026, pp. 169 / 287 157 / 190 identified by colony PCR. The endogenous proteins for transport by the T3SS (called Yersinia external proteins, “Yops”) are encoded by Y. enterocolitica in this 70kb plasmid, termed the Yersinia Virulence Plasmid (pYV), which encodes the T3SS apparatus. Yersinia strains encoding YopE1-138-(tBID BH3) (SEQ ID No. 19 and 25) or YopE1-138-(tBID BH3)fe (SEQ ID No. 27) in the Yersinia virulence plasmid pYV at the native YopE site and under the native YopE promoter were evaluated for their ability to induce apoptosis in cancer cells (including 4T1 and B16F10 cells, Fig. 6).The IC50 (half the maximum inhibitory concentration), referring to the number of bacteria per eukaryotic cell (MOI) required to kill 50% of such cells, was found to decrease after the release of chain repeats of tBID BH3 domains compared to a single tBID BH3 domain, when both proteins are encoded in the Yersinia pYV virulence plasmid at the native YopE site and under the native YopE promoter (Fig. 6). This is consistent with the findings of the release generated by the expression plasmid of these proteins (Fig. 5). Again, this finding was surprising, since the protein size is increased by fusing a second t-BID BH3 domain. Due to this, decreased expression and release levels of YopE1-138-(tBID BH3)2 (SEQ ID No. 27) compared to tBID YopE1-138-BH3 (SEQ ID No. 19 and 25) would be expected, and may reach equivalent maximum levels.In order to achieve an increase in cell death activity, the fused tBID BH3 domains must simultaneously act side-by-side after release by the T3SS in eukaryotic cells. If only one tBID BH3 domain in the YopE1138-(tBID BH3)2 construct is functional, at best, the same efficiency with YopE1-138-tBID BH3 can be expected. Furthermore, Yersinia strains encoding YopE1-138-(tBID BH3)2 (SEQ ID No. 27) in the plasmid... Petition 870260073253, dated 07 / 23 / 2026, pp. 170 / 287 158 / 190 Yersinia pYV virulence at the native YopE site and under the native YopE promoter were compared for their ability to induce apoptosis in cancer cells to plasmid-derived expression release (pBad-MycHisA-based) of YopE1-138-(tBID BH3)2. Consistent with the higher number of pBad-MycHisA copies (20 to 25 copies) compared to pYV (1 to 6 copies are reported), pBad-MycHisA-based release of YopE1-138-(tBID BH3)2 (SEQ ID No. 27) resulted in a slightly decreased IC50 value in 4T1 and B16F10 cells (Fig. 6). Biodistribution studies in a murine melanoma model

[0281] In order to validate Gram-negative bacteria with mutation(s) in key virulence determinants as effectors of T3SS as a tumor-specific vehicle, murine allograft tumor studies using the well-established B16F10 melanoma model (ATCC No. CRL-6475) were performed. When the sc tumors reached a certain size (approximately 100 to 200 mm3), mice were iv-infected with 2 x 105 cfu of Y. enterocolitica subsp. palearctica MRS40 or Y. enterocolitica subsp. palearctica MRS40 AyopH,O,P,E,M,T. In order to allow bacterial growth, mice were pre-treated 24 h before infection with desfreoxamine. Mice infected with wt Y. enterocolitica subsp. palearctica MRS40 mice showed increased scores for physical appearance and behavior (Figs. 47-48) and exhibited significant weight loss during the first 48 hours of infection (Fig. 49), which prompted us to sacrifice all mice in this group on day 2 after infection.Conversely, mice infected with the attenuated virulence strain of Y. enterocolitica subsp. palearctica MRS40 AyopH,O,P,E,M,T showed no significant weight loss and scored normally for physical appearance and behavior (Figs. 47-49) as early as day 4 post-infection. In mice infected with the strain of... Petition 870260073253, dated 07 / 23 / 2026, pp. 171 / 287 159 / 190 wt (Y. enterocolitica subsp. palearctica MRS40), live bacteria were detected in all organs evaluated, and also in the blood (Fig. 51). While wt bacteria were found present in the malignant solid tumor, equally high or higher counts were found in other organs, highest in the spleen (Fig. 51). In striking contrast, in mice infected with live bacteria of Y. enterocolitica subsp. palearctica MRS40 AyopH,O,P,E,M,T were found primarily in the malignant solid tumor on day 1 post-infection, with low bacterial counts observed in the spleen, liver, and lung. Notably, on day 4 post-infection, the bacterial count in the malignant solid tumor increased by several orders of magnitude (reaching over 108 cfu / g of tumor tissue), while in all other organs evaluated, bacterial counts fell below the detection limit (Fig. 50). Y. enterocolitica subsp.palearctica MRS40 AyopH,O,P,E,M,T thus accumulated on day 4 after infection with a ratio of approximately (minimum) one million times at the site of the malignant solid tumor compared to the spleen or liver (when calculating the ratio against the detection limit).

[0282] Similar high numbers of bacteria per gram of solid tumors on day 5 or 8 after intravenous administration into the lateral tail vein of mice bearing B16F10 melanoma were measured for Y. enterocolitica dHOPEMT, Y. enterocolitica dHOPEMT + pYV-YopE1-138-murine RIG1 CARDs or Y. enterocolitica dHOPEMT ΔHairpinl-VirF + pYV-YopE1-138-murine RIG1 CARDs (Fig. 26). These validate that heterologous protein loading and additional mutations affecting T3SS (VirF) regulation do not influence bacterial colonization of solid tumors in murine models.

[0283] These results validate this strategy for attenuating virulence by mutating key virulence determinants to generate a bacterial vehicle specifically targeting the malignant solid tumor. Petition 870260073253, dated 07 / 23 / 2026, pp. 172 / 287 160 / 190 Validation of specific tumor growth in vivo up to day 14 after bacterial administration.

[0284] The tumor colonization experiment with genetically modified Y. enterocolitica was repeated in a syngeneic murine allograft model (4T1 breast cancer model) and bacterial colonization was monitored for two weeks. This time, mice were infected with 1 x 10⁶ colony-forming units (CFU) of Y. enterocolitica AyopH,O,P,E,M,T. While similar results were obtained to the B16F10 model in the first days after infection, we can further show that tumor colonization is consistently found on day 8 and up to day 14 after infection (Fig. 7). Furthermore, colonization remains highly specific with only low bacterial counts detected in all other organs evaluated (Fig. 8). These results indicate that Y. enterocolitica AyopH, O, P, E, M, T is capable of establishing persistent tumor colonization, thus preventing clearance by the immune system. Efficacy of Y. enterocolitica ΔH×ṣṭṭ in delaying tumor progression

[0285] In order to evaluate the impact of YopE1-138-(tBID BH3)2 released to tumor cells in vivo, we conducted studies in wild-type Balb / C mice allografted with 4T1 breast cancer cells. Our aim was to evaluate the Y. enterocolitica ΔH×ßáÕ᜜ᤤ strain encoding YopE1-138-(tBID BH3)2 in the Yersinia pYV virulence plasmid at the native YopE site and under the native YopE promoter, which is further optimized by deletion of the hairpin I region upstream of VirF in order to increase the amount of proteins released. Mice were injected intravenously with PBS or 1 x 10⁷ of Y. enterocolitica ΔHOPEMT ΔHairpinl-virF pYV-YopE1-138-(BH3 of tBID)₂, once the tumor reached a size of 150 to 250 mm⁳. The day of intravenous bacterial injection was defined as day 0. Tumor volume was measured during the following days. Petition 870260073253, dated 07 / 23 / 2026, pp. 173 / 287 161 / 190 (day 0 to day 9 after IV bacterial injection) using forceps. Tumor volume was normalized to day 0 tumor volume to compensate for any initial heterogeneity in tumor size. Treatment with Y. enterocolitica ΔHOPEMT ΔHairpinl-VirF pYV-YopE1-138-(BH3 de tBID)2 showed an impact on tumor volume progression, with statistically significant tumor reduction on days 8, 9, and 10 after bacterial administration (Fig. 9). Importantly, Y. enterocolitica ΔHOPEMT alone did not impact tumor progression in the 4T1 murine cancer model (Fig. 10). These findings highlight that these bacteria and their T3SS can be used to interfere with tumor progression. Y. enterocolitica ΔHOPEMT with a deletion within a thermosensor region of RNA upstream of a gene encoding an AraC-type DNA-binding protein.

[0286] The best-known Yersinia virulence genes are not expressed outside the eukaryotic host and are only induced after entering the host environment. The expression of these virulence genes is induced by a sudden increase in temperature related to entry into the host. In particular, pYV-encoded virulence factors such as T3SS and its effector proteins (the Yops) are regulated in this way. At room temperature (20 to 25 °C), the genes required for T3SS regulation, the formation of T3SS itself, and the released effectors are not expressed, and only after such a temperature increase to 37 °C is expression induced. The expression of most pYV-encoded virulence genes (yadA and T3SS-related genes) is temperature-induced and requires the AraC-type DNA-binding VirF protein in Y. enterocolitica (LcrF in another Yersinia species).Thermoregulation of LcrF expression is thought to occur through the fusion of an RNA stem-loop into mRNA at higher temperatures than when it does not. Petition 870260073253, dated 07 / 23 / 2026, pp. 174 / 287 The 162 / 190 fused gene is sequestering the ribosomal binding site, thus preventing translation51. In contrast, in Y. enterocolitica, VirF transcription has been shown to be primarily temperature-dependent52. More recent studies show a more complex scenario involving a thermolabile regulator called YmoA51, while the upstream RNA thermosensor of LcrF has been considered the main driver of LcrF temperature regulation and, therefore, of temperature-dependent virulence genes.

[0287] In order to increase secretion levels of a heterologously expressed pYV load under the native YopE promoter, we aimed to delete one of these hairpin RNA structures in Y. enterocolitica upstream of VirF. Although the importance of such hairpin RNAs has not been clearly shown in Y. enterocolitica and temperature induction has been attributed to changes in transcription, we were able to identify hairpin 151a upstream of VirF in Y. enterocolitica. Through homologous recombination, we removed portions of hairpin I (-111 to -57 as in 51) and assessed the secretion capacity of YopE1138-(BH3 of tBID)2 encoded by pYV (SEQ ID NO: 27) or murine RIG-1 YopE1-138CARD2 protein (SEQ ID NO: 38) (each at the native site of YopE) in an in vitro secretion assay (Fig. 11). Surprisingly, deletion of part of the hairpin I region upstream of VirF increased secretion by Y.enterocolitica heterologous proteins in vitro (Fig. 11 A and B), which is contrary to previous reports in Y. enterocolitica52, where VirF transcription was thought to be the main driver of thermoregulation.

[0288] In order to be able to artificially induce T3SS expression and protein release by T3SS, we replaced the endogenous VirF promoter in pYV in another strain with an Arabinose-inducible promoter such as Petition 870260073253, dated 07 / 23 / 2026, pp. 175 / 287 163 / 190 known from pBad-MycHisA. In addition to replacing the VirF promoter, we introduced the complete araC gene upstream (in reverse orientation). We then evaluated the secretion capacity of YopE1-138-(tBID BH3)2 (SEQ ID NO: 27) (encoded pYV; at the native site of YopE) in the absence or presence of Arabinose in an in vitro secretion assay (Fig. 11 A). Only after the addition of Arabinose was the heterologous protein shown to be secreted by T3SS, which is consistent with a regulation of VirF expression by Arabinose. Y. enterocolitica ΔHOPEMT with increased heterologous load stability (in vitro and in vivo)

[0289] Y. enterocolitica AyopH,O,P,E,M,T has been shown to be a highly specific strain for targeting solid tumors in our murine experiments, while the T3SS-dependent release of cytotoxic proteins has been found to be effective in cell culture on cancer cells. In order to combine these two characteristics, solid tumor colonizing bacteria need to be engineered to stably encode the cytotoxic payload for several days, or even weeks, in vivo. Due to regulatory requirements, the use of classical antibiotic resistance to maintain a foreign plasmid in bacteria is unfavorable. In murine allograft studies, we evaluated a system for maintaining an antibiotic resistance-free plasmid. This system is based on the chromosomal deletion of an essential gene (such as aspartate semialdehyde dehydrogenase, asd) and encodes the same gene in a heterologous plasmid to maintain bacterial growth.The addition of an asd deletion for plasmid maintenance has been shown before 53, although difficulties in reproducibility and persistence over several days have been reported 54. We adapted this system for use in Y. enterocolitica AyopH,O,P,E,M,T, where we additionally deleted the . Petition 870260073253, dated 07 / 23 / 2026, pp. 176 / 287 164 / 190 asd chromosomally encoded (resulting in Y. enterocolitica AyopH,O,P,E,M,T Δasd), which was then brought back into a medium copy number plasmid, pBad-MycHisA (pBad-MycHisA-asd). The asd gene was cloned from Y. enterocolitica 8081 and inserted into the Pcil site of pBad-MycHisA in forward and reverse orientation, respectively, with its endogenous promoter and transcriptional terminator. The growth behavior in the resulting strains of Y. enterocolitica AyopH,O,P,E,M,T Δasd + pBad-MycHisA-asd (direct or reverse orientation of asd) was compared with in vitro culture flasks (BHI medium) for wt and precursor strains of Y. enterocolitica AyopH,O,P,E,M,T Δasd (Fig. 12). In both orientations, pBad-MycHisA-asd rescued the phenotype observed after asd deletion (Fig. 12). Conversely, in the B16F10 melanoma mouse model as well as in the 4T1 model, we found that Y. enterocolitica AyopH,O,P,E,M,T Δasd + pBad-MycHisA-asd does not colonize solid tumors sufficiently (Figs.Figures 13 and 14) and from a few isolated colonies we found it was not possible to recover the pBadMycHisA-asd plasmid. Furthermore, isolated colonies from a B16F10 melanoma mouse model were checked for growth in ampicillin-containing plaques, which would favor the presence of the pBad-MycHisAasd plasmid encoding ampicillin resistance. On day 4 after IV injection, only a small fraction of isolated colonies exhibited ampicillin resistance (Fig. 13). This may reflect a loss of pBad-MycHisA-asd, but it could also be related to the loss of the ampicillin resistance gene or difficulties in restarting ampicillin resistance gene expression quickly enough to avoid ampicillin-induced death. In any case, tumor colonization with Y. enterocolitica AyopH,O,P,E,M,T Δasd + pBad-MycHisA-asd observed in the B16F10 melanoma mouse model as well as in the 4T1 model showed a rapid decrease in bacterial counts within. Petition 870260073253, dated 07 / 23 / 2026, pp. 177 / 287 165 / 190 of the solid tumor, which is unlike Y. enterocolitica AyopH,O,P,E,M,T. Thus, the chromosomal deletion of asd and complementation in pBad-MycHisA leads to a drastic reduction in bacterial fitness in vivo. This observation is consistent with reports of reduced viability at unbalanced levels of asd54.

[0290] Endogenous proteins for transport by the T3SS (called “Yersinia external proteins”, Yops) are encoded by Y. enterocolitica in a 70kb plasmid. This plasmid, named the Yersinia Virulence Plasmid (pYV), encodes the T3SS apparatus. We evaluated the stability of the pYV plasmid in the 4T1 murine allograft model. We successfully isolated pYV from strains collected on day 9 or 10 after infection of mice (Fig. 15). We performed further tests confirming the presence and functionality of T3SS from bacterial strains isolated after eight days of growth in a solid tumor in vivo. We consider pYV as a vector of choice to encode the heterologous payload for in vivo release. Nevertheless, we observed a percentage of bacterial colonies, therefore, indicating that the pYV plasmid was heterogeneous after growth for 9 to 10 days in 4T1 solid tumors in mice (Fig. 15). In addition to the intrinsic instability of pYV, the Y. strain...enterocolitica AyopH,O,P,E,M,T lost the selective virulence advantage by increasing Yop in vivo.

[0291] In order to stabilize the pYV and thus the heterologous cargo encoded in the pYV, we adapted the “asd” system for use in Y. enterocolitica AyopH,O,P,E,M,T in the pYV. We deleted the chromosomally encoded asd (resulting in Y. enterocolitica AyopH,O,P,E,M,TΔasd), which was then brought back into the pYV (called pYV-asd). The asd gene was cloned from Y. enterocolitica 8081 (Y. enterocolitica subsp. enterocolitica 8081; NCBI Reference Sequence: NC 008800.1) and inserted by homologous recombination into the pYV (to the natural insertion region before SycO) with its endogenous promoter and Petition 870260073253, dated 07 / 23 / 2026, pp. 178 / 287 166 / 190 transcriptional terminator. The growth behavior of the resulting Y. enterocolitica AyopH,O,P,E,M,T Δasd + pYV-asd strains was compared with in vitro culture flasks (BHI medium) for wt strains and precursor Y. enterocolitica AyopH,O,P,E,M,TΔasd (Fig. 12). pYV-asd was able to rescue the phenotype observed in the asd deletion (Fig. 12), although the rescue was not complete and a slight reduction in in vitro growth can be observed. Conversely, in the in vivo syngeneic 4T1 murine cancer model, we found that Y. enterocolitica ΔyopH,O,P,E,M,T Δasd + pYV-asd efficiently colonizes solid tumors (Fig. 16). Surprisingly, all colonies isolated on day 9–10 after injection from the solid tumor contained the pYV plasmid (selection on growth plates containing Arsenite; resistance to Arsenite is related to the presence of arsRBC genes in pYV 55) (Fig. 15).Consequently, pYV-asd surprisingly proved to be a stable in vivo vector for encoding heterologous proteins expressed in solid tumors, colonizing the bacteria for several days and weeks in a strain of Y. enterocolitica origin AyopH,O,P,E,M,TΔasd. Efficacy of Y. enterocolitica ΔHOPEMT in delaying tumor progression and the impact of altering VirF activity as well as increasing stability.

[0292] Similar experiments with 4T1 cells...

Claims

1. A recombinant Gram-negative bacterial strain of attenuated virulence, characterized in that it comprises a nucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused into the structure at the 3' end of a nucleotide sequence encoding a release signal of a bacterial effector protein, wherein the nucleotide sequence encoding the release signal of a bacterial effector protein is operatively linked to a promoter, and wherein the heterologous protein is a protein involved in the induction or regulation of an interferon (IFN) response, wherein the protein involved in the induction or regulation of an IFN response is a protein involved in the induction or regulation of a type I IFN response, wherein the heterologous protein involved in the induction or regulation of a type I IFN response is selected from the group consisting of the RIG-I-like receptor (RLR) family.another CARD domain containing proteins involved in antiviral signaling and type I IFN induction, and cyclic dinucleotide-generating enzymes such as cyclic di-AMP, cyclic di-GMP and cyclic di-GAMP cyclases selected from the group consisting of WspR, DncV, DisA and DisA-like, CdaA, CdaS and cGAS, leading to STING stimulation.

2. Recombinant Gram-negative bacterial strain of attenuated virulence according to claim 1, characterized in that the protein involved in the induction or regulation of an IFN response is a type I IFN response protein wherein the protein involved in the induction or regulation of a type I IFN response is selected from the group consisting of RIG1, MDA5, MAVS / IPS-1, WspR, DncV, DisA and DisA-like, CdaA and cGAS or a fragment thereof.

3. Recombinant Gram-negative bacterial strain of attenuated virulence of Petition 870260073253, dated 07 / 23 / 2026, page 204 / 287 2 / 4 according to claim 1 or 2, characterized in that the recombinant Gram-negative bacterial strain of attenuated virulence further comprises a deletion of a chromosomal gene encoding an endogenous growth-essential protein and an endogenous virulence plasmid comprising a nucleotide sequence comprising a gene encoding said endogenous growth-essential protein operatively linked to a promoter.

4. Recombinant Gram-negative bacterial strain of attenuated virulence according to claim 3, characterized in that said recombinant Gram-negative bacterial strain of attenuated virulence is deficient in the production of at least one bacterial effector protein.

5. Recombinant Gram-negative bacterial strain of attenuated virulence according to claim 3 or 4, characterized in that the gene encoding an endogenous protein essential for growth is selected from a gene encoding an enzyme essential for amino acid production, a gene encoding an enzyme involved in peptidoglycan biosynthesis, a gene encoding an enzyme involved in LPS biosynthesis, a gene encoding an enzyme involved in nucleotide synthesis, and a gene encoding a translation initiation factor.

6. Recombinant Gram-negative bacterial strain of attenuated virulence according to any one of claims 3 to 5, characterized in that the gene encoding an endogenous enzyme essential for growth is a gene encoding an enzyme essential for amino acid production, wherein the enzyme essential for amino acid production is aspartate beta-semialdehyde dehydrogenase (asd).

7. Recombinant Gram-negative bacterial strain of attenuated virulence according to any one of claims 1 to 6, characterized by the fact that the recombinant Gram-negative bacterial strain of attenuated virulence is a strain of Yersinia.

8. Recombinant Gram-negative bacterial strain of attenuated virulence according to any one of claims 3 to 7, characterized in that the gene encoding an endogenous enzyme essential for growth located in the endogenous virulence plasmid comprises its endogenous promoter and its endogenous transcriptional terminator.

9. Recombinant Gram-negative bacterial strain of attenuated virulence according to claim 8, characterized in that the gene encoding the endogenous enzyme essential for growth, its endogenous promoter and its endogenous transcriptional terminator are located 122 bp upstream of the start of orf155 (SycO) in the endogenous virulence plasmid.

10. Recombinant Gram-negative bacterial strain of attenuated virulence according to any one of claims 1 to 9, characterized in that the recombinant Gram-negative bacterial strain of attenuated virulence further comprises a modulation within a thermosensor region of RNA upstream of a gene encoding an endogenous AraC-type DNA-binding protein.

11. Recombinant Gram-negative bacterial strain of attenuated virulence according to claim 10, characterized in that the modulation within a thermosensor region of RNA upstream of a gene encoding an endogenous AraC-type DNA-binding protein comprises a deletion that removes a hairpin loop structure in the RNA or parts thereof upstream of the gene encoding an endogenous AraC-type DNA-binding protein.

12. Recombinant Gram-negative bacterial strain of attenuated virulence according to claim 10 or 11, characterized in that the AraC-type DNA-binding protein is VirF.

13. Recombinant Gram-negative bacterial strain of attenuated virulence according to any one of claims 1 to 12, characterized in that the recombinant Gram-negative bacterial strain of attenuated virulence is Yersinia enterolitica.

14. Recombinant Gram-negative bacterial strain of attenuated virulence according to any one of claims 1 to 13, characterized in that it is for use in a method of treating cancer in a subject, the method comprising administering to the subject said recombinant Gram-negative bacterial strain of attenuated virulence, wherein the recombinant Gram-negative bacterial strain of attenuated virulence is administered in an amount sufficient to treat the subject.

15. Use of a recombinant Gram-negative bacterial strain of attenuated virulence defined in any one of claims 1 to 14, characterized in that it is for the manufacture of a medicament to treat cancer in a subject.

Images