Fatty acid primer desaturases

BRPI0413786AActive Publication Date: 2006-11-07MONSANTO TECHNOLOGY LLC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
BR · BR
Patent Type
Applications
Current Assignee / Owner
MONSANTO TECHNOLOGY LLC
Publication Date
2006-11-07

AI Technical Summary

Technical Problem

Current methods for producing polyunsaturated fatty acids (PUFAs) face challenges such as inefficient conversion rates, reliance on unsustainable natural sources, environmental pollutants, and high production costs, making it difficult to meet health recommendations and provide cost-effective dietary supplements.

Method used

The use of isolated nucleic acids encoding A6-desaturase enzymes from Primula species to transform plants, enabling the production of omega-3 fatty acids like stearidonic acid (SDA) in transgenic crops, which can be used to enrich food and feed products, thereby improving PUFA content and availability.

Benefits of technology

This approach enhances the production of SDA in plants, allowing for the development of food and feed products with increased omega-3 fatty acid content, addressing inefficiencies in existing methods and providing a sustainable, cost-effective source of PUFAs for dietary supplementation.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

"PRIMULA FATTY DESSATURASES". The present invention, in general, relates to methods and compositions that pertain to desaturase enzymes that modulate the number and location of double bonds in long-chain polyunsaturated fatty acids (LC-PUFA <39> s) . In particular, the present invention relates to methods and compositions for improving omega3 fatty acid profiles in plant products and parts using desaturase enzymes and nucleic acids encoding t enzymes. In particular embodiments, desaturase enzymes are <30> 6-desaturases from Primula. Also provided are improved soy oil compositions having SDA and an overall beneficial omega-3 fatty acid content relative to omega-6 fatty acids.
Need to check novelty before this filing date? Find Prior Art

Description

Descriptive Report of the Patent of Invention for "GRA- XO DESATURASES OF PRIMULA". Background of the Invention This application claims priority of the U.S. Provisional Patent Application. To be. No. 60 / 496,751, filed August 21, 2003, the entire disclosure of which is specifically incorporated herein by reference. 1. Field of Invention The invention generally relates to desaturase enzymes that modulate the number and location of double bonds in long-chain polyunsaturated fatty acids (LC-PUFA's). In particular, the invention relates to the improvement of fatty acid profiles using desaturase enzymes and nucleic acids encoding such desaturase enzymes. 2. Description of the Related Technique The primary products of fatty acid biosynthesis in most organisms are composed of 16 and 18 carbons. The relative relationship of chain lengths and the degree of unsaturation of these fatty acids varies widely among species. Mammals, for example, primarily produce saturated and monounsaturated fatty acids, while most SDA higher plants produce fatty acids with one, two or three double bonds, the latter two comprising polyunsaturated fatty acids (PUFAs). Two main families of PUFAs are omega-3 fatty acids (also represented as "n-3" fatty acids), exemplified by eicosapentaenoic acid (EPA, 20:4, n-3), and omega-6 fatty acids (also represented as "n-6" fatty acids, exemplified by arachidonic acid (ARA, 20:4, n-6). PUFAs are important components of cell plasma membrane and adipose tissue, where they can be found in forms such as phospholipids and as triglycerides, respectively. PUFAs are necessary for proper development in mammals, particularly infant brain development, and for tissue formation and repair. Several disorders respond to treatment with fatty acids. xos Supplementation with PUFAs has been shown to reduce the rate of restenosis after angioplasty. The health benefits of certain dietary omega-3 fatty acids for cardiovascular disease and rheumatoid arthritis have also been well documented (Simopoulos, 1997; James et al., 2000). In addition, PUFAs have been suggested for use in treatments for asthma and psoriasis. Evidence indicates that PUFAs may be involved in calcium metabolism, suggesting that PUFAs may be useful in the treatment or prevention of osteoporosis and kidney or urinary tract stones. Most SDA evidence for health benefits applies to the long-chain omega-3 fats, EPA and docosahexaenoic acid (DHA, 22:6) that are in fish and fish oil. With this evidence base, health authorities and nutritionists in Canada (Scientific Review Committee, 1990, Nutrition Recommendations, Minister of National Health and Welfare, Canada, Ottowa), Europe (de Deckerer et al., 1998), UK (The British Nutrition Foundation, 1992, Unsaturated fatty-acids - nutritional and physiological significance: The report of the British Nutrition Foundation's Task Force, Chapman and Hall, London) and the United States (Simopoulos et al., 1999) have recommended increased consumption. in the diet of these PUFAs. PUFAs can also be used to treat diabetes (U.S. Patent N Q 4,826,877; Horrobin et al., 1993). Altered fatty acid metabolism and composition have been demonstrated in diabetic animals. These changes have been suggested to be involved in some of the long-term ADS complications that result from diabetes, including retinopathy, neuropathy, nephropathy, and damage to the reproductive system. Evening primrose oil, which contains y-linolenic acid (GLA, 18:3, A6, 9, 12), has been shown to prevent and reverse diabetic nerve damage. PUFAs such as linoleic acid (LA ; 18:2, A9. 12) and α-linolenic acid (ALA, 18:3, A9, 12, 15), are considered essential fatty acids in the diet because mammals lack the ability to synthesize these acids. However, when ingested, mammals have the ability to metabolize LA and ALA to form the n-6 and n-3 families of long-chain polyunsaturated fatty acids (LC-PUFA). These LC-PUFA's are important cellular components that provide fluidity to membranes and that function as precursors of biologically active eicosanoids such as prostaglandins, prostacyclins and leukotrienes, which regulate normal physiological functions. Arachidonic acid is the main precursor for the synthesis of eicosanoids, which include leukotrienes, prostaglandins and thromboxanes and which also play a role in the process of inflammation. Administration of an omega-3 fatty acid, such as SDA, has been shown to inhibit leukotriene biosynthesis (U.S. Patent N. 2 5,158,975). Consumption of SDA has been shown to lead to a decrease in blood levels of the pro-inflammatory cytokines TNF-a and IL-1 p (PCT US 0306870). In mammals, LC-PUFA formation is rate limited by the A6 desaturation step, which converts LA to y-linolenic acid (GLA, 18:3, A6, 9, 12) and ALA to SDA (18:4, A6 , 9, 12, 15). Many physiological and pathological conditions have been shown to depress this metabolic step in the same way and consequently, the production of LC-PUFA. To overcome the rate limiting step and increase tissue levels of EPA, one could consume large amounts of ALA. However, consumption of only moderate amounts of SDA provides a sufficient source of EPA, as SDA is about four times more efficient than ALA in raising tissue EPA levels in humans (Copending U.S. Application Ser.N 2 10 / 384,369). In the same studies, SDA administration was also able to increase tissue levels of docosapentaenoic acid (DPA), which is a product of EPA prolongation. Alternatively, bypassing A6 desaturation through dietary supplementation with EPA or DHA can effectively alleviate many pathological conditions associated with low PUFA levels. However, as presented in more detail below, currently available sources of PUFA are not desirable for a multitude of reasons. The need for a reliable and cost-effective source of PUFAs has stimulated interest in alternative sources of PUFAs. The main long-chain PUFAs of importance include DHA and EPA, which are primarily found in different types of oil. from fish and ARA, found in filamentous fungi such as Mortierella. For DHA, several sources exist for commercial production including a variety of marine organisms, oils obtained from cold water marine fish and egg yolk fractions. The commercial sources of SDA r include the plant genera Trichodesma, Borago (borage) and Echium. However, there are several disadvantages associated with commercially producing PUFAs from natural sources. Natural sources of PUFAs, such as animals and plants, tend to have highly heterogeneous oil compositions. Oils obtained from these sources therefore may require extensive purification to separate one or more desired PUFAs or to produce an oil that is enriched in one or more PUFAs. Natural sources of PUFAs are also subject to uncontrollable fluctuations in availability. Fish stocks can undergo natural variation or can be depleted by overfishing. Furthermore, even with overwhelming evidence of their therapeutic benefits, dietary recommendations regarding omega-3 fatty acids are not met. Fish oils have unpleasant tastes and odors, which can be economically impossible to separate from the desired product and can make such products unacceptable as food supplements. Animal oils, and particularly fish oils, can accumulate environmental pollutants. Foods can be fortified with fish oils, but again, such enrichment is problematic because of cost and declining fish stocks worldwide. This problem is also an impediment to the consumption and ingestion of whole fish. Nevertheless, if health messages increasing fish intake were accepted by communities, there would likely be a problem in satisfying rinmanda nnr naixp Further pxistpm nproblems with sustainability of this industry, which relies heavily on wild fish stocks rather than those fed by aquaculture (Naylor et al., 2000). Other natural limitations favor a new method for producing omega-3 fatty acids. Weather and disease can cause SDA yields to fluctuate from both fish and plant sources. At arable land available for the production of alternative oil-producing crops is subject to competition from constantly expanding human populations and the associated growing need for food production on the remaining arable lands. Crops that produce PUFAs, such as borage, have not been adapted for commercial cultivation and may not perform well in monoculture. The cultivation of such crops is thus not economically competitive where more profitable and better established crops can be grown. Large-scale fermentation of organisms such as Mortierella is also expensive. Natural animal tissues contain low amounts of ARA and are difficult to process. Microorganisms such as Porphyridium and Mortierella are difficult to grow on a commercial scale. Several enzymes are involved in the biosynthesis of PUFAs. LA (18:2, A9, 12) is produced from oleic acid (OA, 18:1, A9) by an A12-desaturase while ALA (18:3, A9, 12, 15) is produced from LA by an A15-desaturase. SDA (18:4, A6, 9, 12, 15) and GLA (18:3, A6, 9, 12) are produced from LA and ALA by an A6-desaturase. However, as stated above, mammals cannot desaturate beyond the A9 position and therefore cannot convert oleic acid to LA. Likewise, ALA cannot be synthesized by mammals. Other eukaryotes, including fungi and plants, have enzymes that desaturate at the carbon 12 and carbon 15 positions. The major polyunsaturated fatty acids of animals are therefore derived from the diet through subsequent desaturation and prolongation of dietary LA and ALA. Several genes encoding desaturases have been described. For example, the U.S. Patent No 9 5,952,544 describes isolated and cloned nucleic acid fragments from Brassica napus that encode fatty acid desaturase enzymes. Expression of the nucleic acid fragments of patent 5,952,544 resulted in the accumulation of ALA. However, in transgenic plants that express the B. napus A15-desaturase, substantial LA remains unconverted by the desaturase. More active enzymes that convert larger amounts of LA to ALA would be advantageous. The levels of Increased ALA allows an A6-desaturase, when co-expressed with a nucleic acid encoding the A15-desaturase, to act on ALA, thereby producing increased levels of SDA. Because of the multitude of beneficial uses for SDA, there is a need to create a substantial increase in SDA production. Nucleic acids from various sources were sought after for use in increasing SDA production. However, innovations that would allow improved commercial production of land-based crops are still needed (see, for example, Reed et al., 2000). Furthermore, the use of desaturase polynucleotides derived from organisms such as Caeno-rhabditis elegans (Meesapyodsuk et al., 2000) is not ideal for the commercial production of enriched plant seed oils. Genes encoding A6-desaturases have been isolated from two species of Evening Primrose, P. farí-nosa and P. vialii and found to be active in yeast, but the function in plants has not been shown (Sayanova et al., 2003). Therefore, it would be advantageous to obtain genetic material involved in PUFA biosynthesis and express the isolated material in a plant system, in particular a land-based terrestrial crop plant system, that could be manipulated to provide the production of commercial quantities of one or more more PUFAs. There is also a need to increase the intake of omega-3 fat in humans and animals. Thus, there is a need to provide a wide range of foods and food supplements enriched with omega-3 so that people can choose feed, feed ingredients, foods and food ingredients that suit their usual dietary habits. Particularly advantageous would be seed oils with increased SDA. Crnrantamonto oviefo arxonoe um onirlrv nrovn Al A available in vegetable oils. However, there is poor conversion of ingested ALA to longer-chain omega-3 fatty acids such as EPA and DHA. It was demonstrated in the U.S. co-pending Being. No. 10 / 384,369 for "Treatment And Prevention Of Inflammatory Disorders," that increased ALA intake by the community averaged from 1 / g day to 14 g / day by the use of Flaxseed oil only modestly increased plasma levels of phospholipid EPA. A 14-fold increase in ALA intake resulted in a 2-fold increase in plasma phospholipid EPA (Manzioris et al., 1994). Thus, for this purpose, there is a need for efficient and commercially viable production of PUFAs using fatty acid desaturases, genes encoding them, and recombinant methods of producing them. A need also exists for oils containing higher relative proportions of specific PUFAs and food compositions and supplements that contain them. A need also exists for reliable cost-effective methods of producing specific PUFAs. Despite SDA inefficiencies and low yields as described above, the production of omega-3 fatty acids through the terrestrial food chain is a beneficial undertaking for public health and, in particular, for SDA production. SDA is important because, as described above, there is low conversion of ALA to EPA. This is because the initial enzyme in the conversion, A6-desaturase, has low activity in humans and is rate limited. Evidence that A6-desaturase is rate limited is provided by studies demonstrating that the conversion of its substrate, ALA, is less efficient than the conversion of its product, SDA to EPA in mice and rats (Yamazaki et al. , 1992; Huang, 1991). Based on such studies, it is observed that in commercial oilseed crops such as canola, soybean, corn, sunflower, safflower or flax, the conversion of some fraction of the mono and polyunsaturated fatty acids that typify the oil of their seeds to SDA requires the seed-specific expression of multiple desaturase enzymes, which include A6-, A12- and / or A15-desaturases. Plant-derived oils that express high levels of A6, A12, and A15-desaturases are rich in SDA and other omega-3 fatty acids. Such oils can be used to produce foods and food supplements enriched in omega-3 fatty acids, and consumption of such foods effectively increases tissue levels of EPA and DHA. Food and foodstuffs, such as milk, margarine and sausages, all made or prepared with omega-3 enriched oils, will provide therapeutic benefits. It has been shown that people can have an omega-3 intake comparable to EPA and DHA of at least 1.8 g / day without altering their dietary habits 5 by using foods containing oils enriched with omega-3 fatty acids. Thus, there is a strong need for new A6-desaturase nucleic acids for use in transgenic crop plants with PUFA-enriched oils, as well as the improved oils so produced. 10 SUMMARY OF THE INVENTION In one aspect, the invention provides isolated nucleic acids that encode a polypeptide capable of desaturating a fatty acid molecule at carbon 6 (A6-desaturase). These can be used to transform cells or modify the fatty acid composition of a plant or the oil produced by a plant. One embodiment of the invention is an isolated polynucleotide sequence isolated from a Primrose species having unique desaturase activity. In certain embodiments, the isolated polynucleotides are isolated, for example, from Primrose juliae, P. alpicola, P. waltonii, P. farínosa, or P. floríndae. In certain other embodiments of the invention, the 20 polynucleotides encode a polypeptide having at least 90% sequence identity to the SDA polypeptide sequence SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 46 or SEQ ID NO: 48, including at least about 92%, 95%, 98%, and 99% homology to these sequences. Those skilled in the re-25 technique will know that because these sequences are related, a given polypeptide may simultaneously share 90% or greater homology with more than one of these ooliopeptide sequences. In certain embodiments, a sequence provided by the invention has a substrate selectivity for α-linolenic acid relative to linoleic acid, as described herein. 30 In other embodiments, there is substrate selectivity of at least 2:1 for α-linolenic acid relative to linoleic acid, including from about 2:1 to about 2.9:1. In another aspect, the invention provides an isolated polynucleotide encoding a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 6, comprising a sequence selected from the group consisting of: (a) a polynucleotide encoding the polypeptide of SEQ ID NO: 4, SEQ ID NO: 5, SEO ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 46 or SEQ ID NO: 48; (b) a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 45 or SEQ ID NO: 47; (c) a polynucleotide that hybridizes to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 45 or SEQ ID NO: 47 or a complement thereof, under conditions of 5X SSC, 50% formamide and 42°C; and (d) a polynucleotide that encodes a polypeptide with at least 90% sequence identity to a polypeptide sequence of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 46 or SEQ ID NO: 48. In yet another aspect, the invention provides a recombinant vector comprising an isolated polynucleotide according to the invention. The term "recombinant vector" as used herein includes any recombinant segment of DNA that it is desired to introduce into a host cell, tissue and / or organism and specifically includes expression cassettes isolated from a starting polynucleotide. A recombinant vector can be linear or circular. In various aspects, a recombinant vector may comprise at least one additional sequence chosen from the group consisting of: regulatory sequences operably linked to the polynucleotide; selection markers operably linked to the polynucleotide; marker sequences operably linked to the polynucleotide; a purification moiety operably linked to the polynucleotide; and a targeting sequence operably linked to the polynucleotide. In yet another aspect, the invention provides cells, such as mammalian, plant, insect, yeast, and bacterial cells transformed with the polynucleotides of the present invention. In another mode, cells are transformed with recombinant vectors containing constitutive and tissue-specific promoters in addition to the polynucleotides of the present invention. In certain embodiments of the invention, such cells may be further defined as transformed with a nucleic acid 5 sequence that encodes a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 12 and / or 15. The invention also provides a polypeptide comprising the amino acid sequence of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 46 or SEQ ID NO: 48; or a fragment thereof having desaturase activity which desaturates a fatty acid molecule at carbon 6. Yet another aspect of the invention provides a method of producing seed oil containing omega-3 fatty acids from plant seeds, comprising the steps of (a) obtaining seeds from a plant according to the invention; and (b) extracting the SDA oil from said seeds. Examples of such a plant include canola, soybeans, soybeans, rapeseed, sunflower, cotton, cocoa, peanuts, safflower, coconut, flax, palm oil, Brassica napus oilseed and corn. Preferred methods of transforming such plant cells include the use of Agrobacterium Ti and Ri 20 plasmids, electroporation and high velocity ballistic bombardment. In yet another aspect, the invention provides a method of producing a plant comprising seed oil containing altered levels of omega-3 fatty acids comprising introducing a recombinant vector of the invention into an oil-producing plant. In the method, introducing the recombinant vector may comprise genetic transformation. In embodiment, the transformation comprises the steps of: (a) transforming a vegeta cell! with a recombinant vector of the invention; and (b) regenerating the plant from the plant cell, in which the plant has altered levels of omega-3 fatty acids relative to a corresponding plant of the same genotype that was not transformed with the vector. In the method, the plant, for example, can be selected from the group consisting of Arabidopsis thaliana, seed oilseeds from Brassica, rapeseed, sunflower, safflower, canola, corn, soybeans, cotton, flax, jojoba, tallow tree, tobacco, cocoa, peanuts, fruit plants, citrus plants and plants that produce nuts and berries. The plant may be further defined as transformed with a nucleic acid sequence encoding a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 12 and / or 15. The plant may comprise increased SDA. The method may further comprise introducing the recombinant vector into a plurality of oil producing plants and screening the plants or their progeny having inherited the recombinant vector for a plant having a desired omega-3 fatty acid profile. In yet another aspect, the invention provides an endogenous soybean oil having an SDA content of from about 5% to about 50% and a gamma-linoleic acid content of less than about 10%. The SDA content, in certain embodiments, may be further defined as from about 5% to about 32%, from about 5% to about 35%, from about 15% to about 30%, from about 22% to about 30% and from about 22% to about 40%. The gamma-linoleic acid content, in other embodiments, may be defined as less than about 10, 8, 5, and / or about 3%. In particular embodiments, the stearidonic acid content can be from about 15% to about 35% and the gamma-linoleic acid content less than 5%. In still other embodiments, the seed may comprise an omega-3 to omega-6 fatty acid ratio of from about 0.35:1 to about 3.5:1, including from about 1:1 to about 3, 5:1 and from about 2:1 to about 3.5:1. In yet another aspect, the invention provides a method of increasing the nutritional value of an edible product for human or animal consumption, comprising adding a soybean seed oil provided by the invention to the edible product. In certain embodiments, the product is human and / or animal food. The edible product can also be animal feed and / or a food supplement. In the method, soybean seed oil can increase the SDA content of the food product and / or can increase the omega-3 to omega-6 fatty acid ratio of the food product. Food grade may lack SDA prior to addition of soybean seed oil. In yet another aspect, the invention provides a method of manufacturing food or feed, comprising adding a soybean seed oil provided by the invention to the starting food or feed ingredients to produce the food or feed. In certain embodiments, the method is further defined as a method of manufacturing food and / or feed. The invention also provides food or feed manufactured by the method. In yet another aspect, the invention comprises a method of delivering SDA to a human or animal, comprising administering the soybean oil according to claim 1 to the human or animal site. In the method, soybean oil can be administered in an edible composition, including food or feed. Examples of food include beverages, infused foods, sauces, condiments, salad dressings, fruit juices, syrups, desserts, icings and fillings, lightly frozen products, confectionery or in-between foods. The edible composition can be substantially a liquid or solid. The edible composition can also be a food supplement and / or nutraceutical. In the method, the soybean oil can be administered to a human and / or an animal. Examples of animals to which the oil 20 can be administered include farm animals or poultry. BRIEF DESCRIPTION SDA FIGURES The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of the specific embodiments presented herein. FIGURE 1 shows the alignment of Primrose Juliae A6 desaturases PjD6D-1 and PjDGD-2 (SEQ iD NOs: 4 and 5), Evening Primrose Pa6D-1 and Pa6D-2 (SEQ ID NOs: 22 and 24), Evening Primrose waltonii PwD6D (SEQ ID NO: 26), Evening Primrose D6D-2 (SEQ ID NO: 46), Evening Primrose D6D (SEQ ID NO: 48), Borago officinalis D6D (SEQ ID NO: 59) and Echium gentianoides D6D ( SEQ ID NO: 60). FIGURE 2 shows the pMON67011 vector map. FIGURE 3 shows the pMON83950 vector map. FIGURE 4 shows the pMON77245 vector map. FIGURE 5 shows the pMON77247 vector map. FIGURE 6 shows the pMON82821 vector map. FIGURE 7 shows the pMON82822 vector map. FIGURE 8 shows the pMON83961 vector map. FIGURE 9 shows the pMON83962 vector map. FIGURE 10 shows the pMON83963 vector map. FIGURE 11 shows the pMON83964 vector map. FIGURE 12 shows the pMON83965 vector map. FIGURE 13 shows the pMON83966 vector map. DETAILED DESCRIPTION OF THE INVENTION The invention overcomes the limitations of the prior art by providing methods and compositions for raising plants with improved PUFA content. Modifying the fatty acid content of an organism such as a plant has many advantages, including improved nutrition and health benefits. Modification of the fatty acid content can be used to obtain beneficial levels or profiles of desired PUFA's in plants, plant parts and plant products, including plant seed oils. For example, when desired PUFA's are produced in the seed tissue of a plant, the oil can be isolated from the seeds typically resulting in an oil superior to desired PUFAs or an oil having a desired fatty acid content or profile, which in turn can instead be used to provide beneficial characteristics in foodstuffs and other products. The invention in particular embodiments provides endogenous soybean oil having SDA while also containing a beneficial oleic acid content. Various aspects of the invention include methods and compositions for modifying the PUFA content of a cell, for example, modifying the PUFA content of a plant cell(s). Compositions related to the invention include novel iso- lated, polynucleotide constructs and plants and / or plant parts transformed by the polynucleotides of the invention. The isolated polynucleotide may encode Primula fatty acid desaturases and, in particular, may encode a Primula Δ6-desaturase. Host cells can be manipulated to express a polynucleotide that encodes a desaturase polypeptide(s) that catalyzes the desaturation of a fatty acid(s). Some aspects of the invention include desaturase polypeptides and polynucleotides encoding the same. Various embodiments of the invention may use combinations of desaturase polynucleotides and the encoded polypeptides which typically depend on the host cell, availability of substrate(s) and desired end product(s). "Desaturase" refers to a polypeptide that can desaturate or catalyze the formation of a double bond between consecutive carbons of one or more fatty acids to produce a mono- or polyunsaturated fatty acid or a precursor thereof. Of particular interest are polypeptides that can catalyze the conversion of oleic acid to LA, LA to ALA, or ALA to SDA, which includes enzymes that desaturate at positions 12, 15, or 6. The term "polypeptide" refers to any chain of amino acids, regardless of length or post-translational modification (eg, glycosylation or phosphorylation). Considerations for choosing a specific polypeptide having desaturase activity include, but are not limited to, the optimal pH of the polypeptide, whether the polypeptide is a rate-limiting enzyme or a component thereof, whether the desaturase used is essential for the synthesis of 25 a desired PUFA, and / or whether a cofactor is required by the polypeptide. The expressed polypeptide preferably has characteristics that are compatible with the biochemical environment of its location in the host cell. For example the polypeptide may have to compete for substrate(s). Analyzes of the Km and specific activity of a polypeptide in question may be considered in determining the suitability of a given polypeptide to modify the production, level or profile of PUFA(s) in a given host cell. The polypeptide used in a particular situation lar is one that typically can function under the conditions present in the intended host cell, but otherwise can be any desaturase polypeptide having a desired characteristic or being capable of modifying the relative production, level or profile of a PUFA(s) desired(s) or any other desired characteristics as discussed herein. The substrate(s) for the expressed enzyme may be produced by the host cell or may be exogenously provided. To obtain expression, the polypeptide(s) of the present invention are encoded by the polynucleotides as described below. The inventors have isolated and produced enzymes from Primula that exhibit A6-desaturase activity. Sequences encoding the A6-desaturase can be expressed in transgenic plants, microorganisms or animals to produce increased synthesis of SDA. Other polynucleotides that are substantially identical to the A6-desaturase polynucleotides provided herein, or that encode polypeptides that are substantially identical to the A6-desaturase polypeptides, can also be used. "Substantially identical" refers to an amino acid sequence or nucleic acid sequence that exhibits, in order to enhance preference, at least 90%, 95%, 98, or 99% identity to the A6- desaturase in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 46 or SEQ ID NO: 48 or sequences encoding these polypeptides. Polypeptide or polynucleotide comparisons can be performed using sequence analysis software, for example, the Sequence Analysis software package from the GCG Wisconsin Package (Accelrys, San Diego, CA), MEGAIign (DNAStar, Inc., 1228 S. Park St. ., Madison, Wis. 53715) and MacVetor (Oxford Molecular Group, 2105 S. Bascom Avenue, Suite 200, Campbell, Calif. 95008). Such software matches similar sequences by assigning degrees of similarity or identity. Related desaturases are encompassed by the present invention, including disclosed SDA variants A6-desaturases that occur naturally within the same or different species of Evening Primrose. The desatura- related sections can be identified by their ability to function in substantially the same way as the disclosed desaturases; that is, having A6-desaturase activity. Related desaturases can also be identified by sorting the sequence database for sequence homologs to the disclosed desaturases, by hybridizing a probe based on the disclosed desaturases in a library constructed from the source organism, or by RT-PCR using mRNA from the source organism and primers based on the disclosed desaturases. The invention therefore provides nucleic acids which hybridize under stringent conditions to a desaturase coding sequence described herein. Those skilled in the art understand that conditions can be made less severe by increasing the salt concentration and decreasing the temperature. Thus, hybridization conditions can be easily manipulated and so will generally be a method of choice depending on the desired results. An example of high stringency conditions is 5X SSC, 50% formamide and 42°C. By conducting a wash under such conditions, for example for 10 minutes, those sequences that do not hybridize to a particular target sequence under these conditions can be removed. In another aspect of the invention, vectors containing a nucleic acid or fragment thereof, containing a promoter, an A6-desaturase coding sequence and a termination region can be transferred into an organism in which the promoter and termination regions are functional. Accordingly, organisms that produce recombinant A6-desaturase are provided by this invention. Yet another aspect of this invention provides isolated A6-desaturase, which can be purified from recombinant organisms by standard protein purification methods. (PorexAmnin, ?er Ausubel et al., iyy4). Various aspects of the invention include the nucleic acid sequences encoding desaturases described herein. Nucleic acids can be isolated from Primula including SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 45 or SEQ ID NO: 47 and others. A cloning strategy based on oligonucleotide primers designed to amplify sequences identified as potential fatty acid desaturases, based on BLAST searches of the genomic DNA database, can be used to sequence individual clones. These clones can then be functionally characterized. Nucleic acid constructs can be provided so that they integrate into the genome of a host cell or are autonomously duplicated (e.g., episomally duplicated) in the host cell. For the production of ALA and / or SDA, the expression cassettes (i.e., a polynucleotide that encodes a protein that is operably linked to the nucleic acid sequence(s) that direct(s) the expression of the polynucleotide) in the General uses include an expression cassette that provides for the expression of a polynucleotide encoding an A6-desaturase. In certain embodiments a host cell may have wild-type oleic acid content. Methods and compositions for constructing expression vectors, when verified in light of the disclosures provided herein, for the expression of Evening Primrose desaturase enzymes will be apparent to one skilled in the art. Expression vectors, as described herein, are DNA or RNA molecules engineered for the controlled expression of a desired polynucleotide, for example, the polynucleotides encoding A6-desaturase. Examples of vectors include plasmids, bacteriophages, cosmids or viruses. Carrier vectors, for example (Wolk et al. 1984; Bustos et al., 1991) are also considered in accordance with the present invention. Reviews of vectors and methods of preparing and using them can be found in Sambrook et al. (2001); Goeddel (1990); and Perbal (1988). Sequence elements capable of effecting the expression of a polynucleotide include promoters, enhancer elements, upstream activating sequences, transcription termination signals, and polyadenylation sites. Polynucleotides encoding desaturases can be placed under the transcriptional control of a strong promoter. In some cases this leads to an increase in the amount of desaturase enzyme expressed and a concomitant increase in the fatty acid produced as a result of the enzyme-catalyzed reaction. There are a wide variety of plant promoter sequences that can be used to direct tissue-specific expression of polynucleotides encoding desaturases in transgenic plants. Indeed, in particular embodiments of the invention, the promoter used is a seed specific promoter. Examples of such promoters include the 5' regulatory regions of such genes as napin (Kridl et al., Seed Sci. Res. 1:209:219, 1991), phaseolin (Bustos, et al., Plant Cell, 1(9) : 839 to 853, 1989), soybean trypsin inhibitor (Riggs, et al., Plant Cell 1(6): 609 to 621, 1989), ACP (Baerson et al., Plant Mol. Biol., 22(2) ): 255 to 267, 1993), stearoyl-ACP desaturase (Slocombe et al., Plant Physiol. 104(4): 167 to 176, 1994), soybean a' subunit of p-conglycinin (P-Gm7S, see for For example, Chen et al., Proc. Natl. Acad. Sci. 83: 8560 to 8564, 1986), Vicia faba USP (P-Vf.Usp, see for example SEQ ID NOs: 1, 2 and 3, Application of U.S. Patent 10 / 429,516 ), The globulin promoter (see e.g. Belanger and Kriz, Genet. 129: 863 to 872 (1991), Soybean alpha subunit of p-conglycinin (7S alpha) (U.S. Patent Application 10 / 235,618, incorporated by reference) and Zea mays oleosin L3 promoter (P-Zm.L3, see, for example, Hong et al., Plant Mol. Biol., 34(3): 549 to 555, 1997). are in zeins, which are a group of storage proteins found in the endosperm of corn, are included. Genomic clones for the zein genes have been isolated (Pedersen et al., Cell 29: 1015 to 1026 (1982) and Russell et al., Transgenic Res. 6(2): 157 to 168) and the promoters of these clones, including the 15 kD, 16 kD, 19 kD, 22 kD, 27 kD and genes can also be used. The skilled artisan can determine vectors and regulatory elements (making operably linked promoters and coding regions) suitable for expression in a particular host cell. "Operably linked" in this context means that promoter and terminator sequences function effectively to regulate transcription. As another example, a suitable vector for the expression of A6-desaturase in transgenic plants may comprise a seed-specific promoter sequence derived from heliantinin, napin or glycinine operably linked to the coding region of A6-desaturase and further operably linked to a seed storage protein termination signal or to the nopaline synthase termination signal. As another example, a vector for use in expressing A6-desaturase in plants may comprise a constitutive promoter or a tissue-specific promoter operably linked to the A6-desaturase coding region and further operably linked to a constitutive or tissue-specific terminator. or to the nopaline synthase termination signal. SDA modifications to nucleotide sequences or regulatory elements described herein that maintain the functions considered herein are within the scope of this invention. Such modifications include insertions, substitutions and deletions and specifically substitutions that reflect the degeneracy of the genetic code. Standard techniques for constructing such recombinant vectors are well known to those skilled in the art and can be found in references such as Sambrook et al. (2001) or any of the myriad of laboratory manuals on recombinant DNA technology that are widely available. A variety of strategies are available for linking DNA fragments, the choice of which SDA depends on the nature of the SDA endings of the DNA fragments. It is further envisaged in accordance with the present invention to include in a nucleic acid vector other nucleotide sequence elements that facilitate cloning, expression or processing, for example sequences encoding signal peptides, a sequence encoding KDEL, which is required for the retention of proteins in the endoplasmic reticulum or sequences encoding transit peptides that direct A6-desaturase to the chloroplast. Such sequences are known to a person skilled in the art. An optimized transit peptide is described, for example, by Van den Broeck et al. (1985). Prokaryotic and eukaryotic signal sequences are described, for example, by Michaelis et al. (1982). Polynucleotides encoding desired desaturases can be identified in a variety of ways. As an example, a source of the desired desaturase, for example Primula genomic or cDNA libraries, is screened with enzymatically or chemically synthesized detectable probes, which can be manufactured from DNA, RNA or nucleotides that are not naturally occurring or mixtures of the same. Probes can be enzymatically synthesized from polynucleotides of known desaturases by normal or reduced stringency hybridization methods. Oligonucleotide probes can also be used to screen sources and can be based on sequences of known desaturases, including sequences conserved among known desaturases or on peptide sequences obtained from the desired purified protein. Oligonucleotide probes based on amino acid sequences may be degenerate to encompass the degeneracy of the genetic code or may be biased in favor of the preferred codons of the source organism. Oligonucleotides can also be used as primers for PCR from reverse transcribed mRNA from a known or suspected source; the PCR product can be the full-length cDNA or can be used to generate a probe to obtain the desired full-size cDNA. Alternatively, a desired protein can be fully sequenced and full synthesis of a DNA encoding this polypeptide performed. Once the desired genomic DNA or cDNA has been isolated, it can be sequenced by known methods. It is recognized in the art that such methods are error prone, such that multiple sequencing of the same region is routine and is still expected to lead to measurable rates of error in the resulting deduced sequence, particularly in regions having repeated domains, extensive secondary or unusual base compositions, such as regions with high content of ba-30 and GC. When discrepancies arise, resequencing can be done and can use special methods. Special methods may include altering sequencing conditions using: different temperatures; enzyme but different; proteins that alter the ability of oligonucleotides to form higher-order structures; altered nucleotides such as ITP or methylated dGTP; different gel compositions, for example by adding formamide; different primers or primers located at different distances from the problem region; or different patterns such as single-stranded DNAs. mRNA sequencing can also be used. Some or all of the coding sequence for a polypeptide having desaturase activity may be from a natural source. In some situations, however, it is desirable to modify all or a portion of the codons, for example, to enhance expression, by using host-preferred codons. Host-preferred codons can be determined from the codons of highest frequency in proteins expressed in the greatest amount in a particular host species and / or tissue of interest. Thus, the coding sequence for a polypeptide having desaturase activity can be synthesized in whole or in part. All or portions of the DNA can also be synthesized to remove any sequences or regions of secondary structure destabilization that would be present in the transcribed mRNA. All or portions of the DNA can also be synthesized to change the base composition to one more preferable in the desired host cell. Methods for synthesizing sequences and bringing the sequences together are well established in the literature. In vitro mutagenesis and selection, site-directed mutagenesis or other means can be used to obtain mutations of naturally occurring desaturase genes to produce a polypeptide having in vivo desaturase activity with more desirable physical and kinetic parameters for host cell function. , such as a longer half-life or a higher rate of production of a desired polyunsaturated fatty acid. Once the polynucleotide encoding a desaturase polypeptide has been obtained, it is placed in a vector capable of replication in a host cell or is propagated in vitro using techniques such as PCR or long PCR. Replicator vectors may include fonts mids, phages, viruses, cosmids and others. Desirable vectors include those useful for mutagenesis of the gene of interest or for expressing the gene of interest in host cells. The long PCR technique has made the in vitro propagation of large constructs possible, so that modifications to the gene of interest, such as mutagenesis or addition of expression signals, and propagation of the resulting constructs can occur entirely in vitro without the use of a replicator vector or a host cell. For expression of a desaturase polypeptide, the functional transcriptional and translational initiation and termination regions are operably linked to the polynucleotide encoding the desaturase polypeptide. Expression of the polypeptide coding region can occur in vitro or in a host cell. Transcriptional and translational initiation and termination regions are derived from a variety of non-exclusive sources, including the polynucleotide to be expressed, genes known or suspected to be capable of expression in the system, expression vectors, chemical synthesis or from an endogenous site in a desired host cell. Expression in a host cell can be carried out in either a transient or a stable manner. Transient expression can occur from introduced constructs which contain expression signals functional in the host cell, but which constructs do not duplicate and rarely integrate into the host cell or where the host cell is not proliferative. Transient expression can also be accomplished by inducing the activity of a regulatable promoter operably linked to the gene of interest, although such inducible systems often exhibit a low basal level of expression. Stable expression can be achieved by introducing a construct that can integrate into the host genome or that autonomously replicates in the host cell. Stable expression of the gene of interest can be selected through the use of a selectable marker located on or transfected into the expression construct, followed by selection for cells expressing the marker. when the expression stability results from integration, integration of constructs may occur randomly within the host genome or may be targeted through the use of constructs containing regions of homology to the host genome sufficient to target recombination with the host site. Where constructs are targeted at an endogenous site, all or some of the transcriptional and translational regulatory regions may be provided by the endogenous site. When increased expression of the desaturase polypeptide in the source organism is desired, several methods can be used. Additional genes encoding the desaturase polypeptide can be introduced into the host organism. Expression at the native desaturase site can also be increased through homologous recombination, for example by inserting a stronger promoter into the host genome to cause increased expression, by removing destabilizing sequences from the mRNA or encoded protein by deleting this one. information from the host genome or by adding stabilizing sequences to the mRNA (U.S. Patent N 2 4,910,141). It is considered that more than one polynucleotide encoding a desaturase or a polynucleotide encoding more than one desaturase can be introduced and propagated in a host cell through the use of episomal or integrated expression vectors. Where two or more genes are expressed from vectors that replicate separately, it is desirable for each vector to have a different means of replication. Each construct introduced, whether integrated or not, must have a different means of selection and must lack homology to the other constructs to keep the expression stable and prevent the regrouping of elements between the constructs. The judicious choices of regulatory regions, means of selection and method of propagation of the introduced construct can be experimentally determined so that all introduced polynucleotides are expressed at the levels necessary to provide the synthesis of the desired products. When necessary for transformation, the encoded sequence The A6-desaturase enzyme of the present invention can be inserted into a plant transformation vector, for example the binary vector described by Bevan (1984). Plant transformation vectors can be derived by modifying the natural gene transfer system of Agrobacterium tu-mefaciens. The natural system comprises large Ti (tumor-inducing) plasmids containing a large segment, known as T-DNA, which is transferred to transformed plants. Another segment of the Ti plasmid, the vir region, is responsible for T-DNA transfer. The T-DNA region is limited by the terminal repeats. In the modified binary vectors the tumor-inducing genes were suppressed and the vir region functions are used to transfer the foreign DNA limited by the T-DNA limiting sequences. The T region also contains a selectable marker for antibiotic resistance and a multiple cloning site to insert sequences to be transferred. Such engineered strains are known as "disarmed" strains of A. tumefaciens and allow efficient transformation of T-region-limited sequences into plant nuclear genomes. The object invention finds many applications. Probes based on the polynucleotides of the present invention may find use in methods of isolating related molecules or in methods of detecting organisms that express desaturases. When used as probes, the polynucleotides or oligonucleotides must be detectable. This is usually accomplished by attaching a label to an internal site, for example by incorporating a modified residue or at the 5' or 3' terminus. Such labels may be directly detectable, may bind to a secondary molecule that is detectably labeled, or may bind to an unlabeled secondary molecule and a detectably labeled tertiary molecule; this process can be extended as long as is practical to obtain a satisfactorily detectable signal without unacceptable levels of background signal. Secondary, tertiary or bridging systems may include the use of antibodies directed against any other molecule, including labels or other antibodies, or may involve any molecules that link together, for example a bioti- na-streptavidin / avidin. Detectable labels typically include radioactive isotopes, molecules that chemically or enzymatically produce or alter light, enzymes that produce detectable reaction products, magnetic molecules, fluorescent molecules, or molecules whose fluorescence or light-emitting characteristics change upon binding. Examples of labeling methods can be found in U.S. Patent. No 2 5,011,770. Alternatively, binding of target molecules can be directly detected by measuring the change in solution heat at the binding of the probe to be targeted using isothermal titration calorimetry or by coating the probe or target on a surface and detecting the change in dispersion of the target. surface light produced by binding the target or probe, respectively, as can be done with the BIAcore system. Constructs comprising the gene of interest can be introduced into a host cell by standard techniques. For convenience, a host cell that has been manipulated by any method to accept a DNA sequence or construct will be referred to herein as "transformed" or "recombinant". The object host will have at least one copy of the expression construct and may have two or more, for example, depending on whether the gene is integrated into the genome, amplified, or is present in an extrachromosomal element having multiple copy numbers. The transformed host cell can be identified by selection for a marker contained in the introduced construct. Alternatively, a separate marker construct can be introduced with the desired construct, as many transformation techniques introduce many DNA molecules into host cells. Typically, transformed hosts are selected for their ability to grow on selective media. Selective media may incorporate an antibiotic or lack a factor necessary for the growth of the untransformed host, such as a nutrient or growth factor. An introduced marker gene therefore can confer antibiotic resistance or encode an essential growth factor or enzyme and allow growth in selective media when expressed in the transformed host. The selection of a host transformed can also occur when the expressed marker protein can be detected, either directly or indirectly. The marker protein can be expressed alone or as a fusion to another protein. The marker protein can be. detected by its enzymatic activity; for example, beta-galactosidase can convert substrate X-gal to a colored product and luciferase can convert luciferin to a light-emitting product. The marker protein can be detected by its light-producing or modifying characteristics; for example, the green fluorescent protein from Aequo-rea victoria fluoresces when illuminated with blue light. Antibodies can be used to detect the marker protein or a molecular tag, for example, on a protein of interest. Cells expressing the marker or label protein can be selected, for example, visually or by techniques such as FACS or panning using antibodies. Desirably, resistance to kanamycin and the aminoglycoside G418 are of interest, as is the ability to grow on medium lacking uracil, leucine, lysine, or tryptophan. Of particular interest is the A6-desaturase-mediated production of PUFA's in eukaryotic host cells. Eukaryotic cells include plant cells, such as those from crop plants that produce oil, and other cells sensitive to genetic manipulation including fungal cells. Cells can be grown or formed as part or all of a host organism including a plant. In a preferred embodiment, the host is a plant cell that produces and / or can exogenously take up the supplied substrate(s) for an α6-desaturase and preferably produces large amounts of one or more of the substrates. The transformed host cell is cultured under appropriate conditions adapted to a desired end result. For host cells to grow in culture, conditions are typically optimized to produce the highest or most economical yield of PUFAs, with respect to selected desaturase activity. Media conditions that can be optimized include: carbon source, nitrogen source, substrate addition, final concentration of substrate added, form of substrate added, aerobic or anaerobic cultivation, cultivation temperature, inducing agent, induction temperature, induction growth phase, harvest growth phase, pH, density and selection maintenance . Another aspect of the present invention provides transgenic plants or progeny of plants containing the isolated DNA of the invention. Both monocots and dicots are considered. Plant cells are transformed with an isolated DNA encoding A6-desaturase by any plant transformation method. The transformed plant cell, often a callus or leaf disc culture, is regenerated into a complete transgenic plant by methods well known to a person skilled in the art (eg Horsch et al., 1985). In one embodiment, the transgenic plant is selected from the group consisting of Arabidopsis thaliana, canola, soybean, soybean, rapeseed, sunflower, cotton, cocoa, peanut, safflower, coconut, flax, palm oil, Brassica napus oilseed, corn, jojoba, suet tree, tobacco, fruit plants, citrus plants or plants that produce nuts and berries. Since the progeny of transformed plants inherit the polynucleotide encoding the A6-desaturase, the seeds or cuttings from the transformed plants can be used to maintain the transgenic plant lineage. The present invention further provides a method of providing transgenic plants with an increased content of ALA and / or SDA. This method includes, for example, introducing DNA encoding A6-desaturase into plant cells that lack or have low levels of SDA but contain ALA and regenerating plants with increased SDA content from the transgenic cells. In certain embodiments of the invention, a DNA encoding an A15- and / or A12-desaturase can also be introduced into plant cells. Such plants may or may not comprise endogenous A12- and / or A15-desaturase activity. In certain embodiments, commercially cultivated modified crop plants are considered to be the transgenic organism, including, but not limited to, Arabidopsis thaliana, canola, soybean, soybean, rapeseed, sunflower, cotton, cocoa, peanut, safflower, coconut, flax, palm oil, Brassica napus oilseed, corn, jojoba, tallow tree, tobacco, fruit plants, citrus plants or plants that produce nuts and berries. The present invention further provides a method of providing transgenic plants which may contain elevated levels of ALA and / or SDA, wherein said elevated levels are greater than levels found in untransformed plants. Expression vectors comprising DNA encoding an A6-desaturase, and / or an A12-desaturase and / or an A15-desaturase, can be constructed by methods of recombinant technology known to a person skilled in the art (Sambrook et al. , 2001). In particular, commercially grown crop plants are considered to be the transgenic organism, including, but not limited to, Arabidopsis thaliana, canola, soybean, soybean, rapeseed, sunflower, cotton, cocoa, peanut, safflower, coconut, flax, oil palm oil, Brassica napus oilseed and corn. For dietary supplementation, the purified PUFAs, the transformed plants or plant parts or derivatives thereof, can be incorporated into cooking oils, fats or margarines formulated so that in normal use the recipient can receive the desired amount. PUFAs can also be incorporated into infant formulas, nutritional supplements, or other food products and may find use as anti-inflammatory or cholesterol-lowering agents. As used herein, "edible composition" is defined as compositions that can be ingested by a mammal such as foodstuffs, nutritional substances and pharmaceutical compositions. As used herein "foodstuffs" refers to substances that can be used or prepared for use as food for a mammal and include substances that can be used in the preparation of food (such as frying oils) or food additives. For example, foodstuffs include animals used for human consumption or any product thereof, such as, for example, eggs. Typical foodstuffs include but are not limited to beverages (e.g. soft drinks, beverages, ready-to-use beverages), infused foods (e.g. fruits and vegetables), sauces, condiments, salad dressings, fruit juices, syrups, desserts (e.g. puddings, gelatin, icings and fillings, baked goods and frozen desserts such as sorbets and sorbets), soft frozen products (e.g. soft frozen custards, soft frozen sorbets and yoghurts, soft frozen toppings such as whipped milk and non-milk toppings), oils and emulsified products ( e.g. butter for making cakes, margarine, mayonnaise, butter, cooking oil and salad dressings) and intermediate wet foods (eg rice and dog food). In addition, the edible compositions described herein can also be taken as an additive or supplement contained in foods and beverages. These may be formulated together with a nutritional substance such as various vitamins and minerals and incorporated into substantially liquid compositions such as nutrient drinks, soy milks and soups; substantially solid compositions; and gelatins or used in the form of a powder to be incorporated into various foods. The effective ingredient content in such a functional or health food may be similar to the dose contained in a typical pharmaceutical agent. Purified PUFAs, transformed plants or plant parts can also be incorporated into animal feed, particularly from farm animals. In this way, the animals themselves can benefit from a PUFA-rich diet, while human consumers of food products produced from such farmed animals can also benefit. It is expected in certain embodiments that DAS will be converted to EPA in animals and thus such animals may benefit from an increase in EPA from consumption of SDA. For pharmaceutical (human or veterinary) use, the compositions in general can be administered orally but can be administered by any route by which they can be successfully absorbed, e.g. parenterally (i.e. subcutaneously, intramuscularly or intravenously), rectally , vaginally or topically, for example as an ointment for the skin or lotion. Plants or plant parts transformed with PUFAs of the present invention can be administered alone or in combination with a pharmaceutically acceptable carrier or excipient. Where available, gelatin capsules are the preferred form of oral administration. THE Dietary supplementation as presented above may also provide an oral route of administration. The unsaturated acids of the present invention can be administered in conjugated forms or as salts, esters, amides or prodrugs of the fatty acids. Any pharmaceutically acceptable salt is encompassed by the present invention; especially preferred 10 are the sodium, potassium or lithium salts. Also encompassed are salts of N-alkylpolyhydroxamine, such as N-methyl glucamine, found in PCT publication WO 96 / 33155. Preferred esters are ethyl esters. As solid salts, PUFAs can also be administered in tablet form. For intravenous administration, the PUFAs or derivatives thereof can be incorporated into commercial formulations such as intralipids. If desired, regions of a desaturase polypeptide important for desaturase activity can be determined through routine mutagenesis followed by expression of the resulting mutant-20 polypeptides and determination of their activities. Mutants can include substitutions, deletions, insertions and point mutations or combinations thereof. Substitutions can be made on the basis of conserved hydrophobicity or hydrophilicity (Kyte and Doolittle, 1982) or on the basis of the ability to assume similar polypeptide secondary structure (Chou and 25 Fasman, 1978). A typical functional analysis begins with deletion mutagenesis to determine the N- and C-terminal boundaries of the protein required for function, and two deletions, insertions, or internal point mutants are made to determine further regions required for function. Other techniques such as cassette mutagenesis or total synthesis may also be used. Deletion mutagenesis is performed, for example, using exonucleases to sequentially remove the 5' or 3' coding regions. Kits are available for such techniques. After the deletion, the region The coding region is completed by the ligation of oligonucleotides containing start or stop codons to the deleted coding region after the 5' or 3' deletion, respectively. Alternatively, oligonucleotides encoding start or start codons are inserted into the coding region by a variety of methods including site-directed mutagenesis, mutagenic PCR, or by ligation into the digested DNA at existing restriction sites. Internal deletions can be similarly fabricated through a variety of methods including the use of existing restriction sites on the DNA, by the use of mutagenic primers through site-directed mutagenesis or mutagenic PCR. Insertions are made by methods such as ligand screening mutagenesis, site-directed mutagenesis or mutagenic PCR. Point mutations are made through techniques such as site-directed mutagenesis or mutagenic PCR. Chemical mutagenesis can also be used to identify regions of a desaturase polypeptide important for activity. Such structure-function analysis can determine which regions can be deleted, which regions tolerate insertions, and which point mutations allow the mutant protein to function in substantially the same way as the native desaturase. All such mutant proteins and nucleotide sequences encoding them are within the scope of the present invention. As described above, certain embodiments of the current invention pertain to plant transformation constructs. For example, one aspect of the current invention is a plant transformation vector comprising one or more desaturase genes or cDNAs. Exemplary coding sequences for use with the invention include Primrose juliae A6-desaturase (SEQ ID NOs: 2 and 3). In certain embodiments, antisense desaturase sequences may also be used with the invention. Exemplary nucleic acid-encoding desaturases include at least 20, 40, 80, 120, 300 and up to the natural length of the nucleic acid sequences of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 45 or SEQ ID NO: 47. In certain aspects, a nucleic acid may encode 1, 2, 3, 4 or more desaturase enzymes. In particular embodiments, a nucleic acid may encode an A6- and an Al5-desaturase. Vectors used for plant transformation may include, for example, plasmids, cosmids, YACs (artificial yeast chromosomes), BACs (bacterial artificial chromosomes) or any other suitable cloning system, as well as DNA fragments thereof. So when the term "vector" or "expression vector" is used, all of the above types of vectors, as well as the nucleic acid sequences isolated from them, are included. It is considered that the use of cloning systems with large insert capabilities will allow the introduction of large DNA sequences comprising more than one selected gene. According to the invention, this can be used to introduce various nucleic acids encoding desaturase. The introduction of such sequences can be facilitated by the use of bacterial or yeast artificial chromosomes (BACs or YACs, respectively) or even plant artificial chromosomes. For example, the use of BACs for Agrobacterium-mediated transformation was reported by Hamilton et al. (1996). Particularly useful for transformation are expression cassettes that have been isolated from such vectors. DNA segments used to transform plant cells, of course, will generally comprise the cDNA, gene or genes that it is desired to introduce and have expressed in the host cells. These DNA segments may further include structures such as promoters, enhancers, polylinkers or even regulatory genes as desired. The DNA or gene segment chosen for cellular introduction will often encode a protein that will be expressed in the resulting recombinant cells that result in a screenable or selectable tract and / or that will impart an improved phenotype to the resulting transgenic plant. However, this may not always be the case and the present invention also encompasses transgenic plants that incorporate unexpressed transgenes. Preferred components likely to be included with vectors used in the present invention are as follows. In one embodiment the present invention utilizes certain promoters. Examples of such promoters that can be used with the present invention include, but are not limited to, 35S of CaMV (Cauliflower Mosaic Virus), 34S of FMV (Scrofula Mosaic Virus) (see, for example, U.S. Patent. No. 5,378,619, the contents of which are incorporated herein in their entirety), Napin (from Brassica), 7S (from soybean), Globulin and Lee (from corn). The napin promoter and promoters that are regulated during plant seed maturation are of particular interest for use with the present invention. All such promoters and transcriptional regulatory elements, alone or in combination, are contemplated for use in the present replicable expression vectors and are known to a person skilled in the art. The DNA sequence between the transcription start site and the start of the coding sequence, that is, the untranslated leader sequence, can also influence gene expression. One may thus wish to use a particular leader sequence with a transform constructs of the invention. Preferred leader sequences are considered to include those that comprise sequences predicted to direct optimal expression of the linked gene, i.e., include a consensus preferred leader sequence that can enhance or maintain mRNA stability and prevent improper initiation of translation. The choice of such sequences will be known to those skilled in the art given the present description. Sequences that are derived from genes that are highly expressed in plants will typically be preferred. Transformation constructs prepared in accordance with the invention will typically include a 3'-end DNA sequence that acts as a signal to terminate transcription and allow polyadenylation of the mRNA produced by the coding sequences operably linked to a desaturase gene. (eg cDNA). In one embodiment of the invention, the native terminator of a desaturase gene is used. Alternatively, a heterologous 3' end may enhance the expression of desaturase encoding regions. The examples of Pains judged to be useful include those of the Agrobacterium tumefaciens nopaline synthase gene (3' end nos) (Bevan et al., 1983), the terminator for the T7 transcript of the Agrobacterium tumefaciens octopine synthase gene, the 3' end ' of potato or tomato protease inhibitor genes I or II and the CaMV 35S terminator (tml3') - Regulatory elements such as an Adh intron (Callis et al., 1987), sucrose synthase intron (Vasil et al. , 1989) or omega element TMV (Gallie et al., 1989), may be further included where desired. Using a selectable or screenable marker protein, one can provide or enhance the ability to identify transformants. "Marker genes" are genes that impart a distinct phenotype to cells that express the marker protein and thus allow such transformed cells to be distinguished FROM cells that do not have the marker. Such genes may encode a selectable or screenable marker, depending on whether the marker confers a trait that can be "selected" by chemical means, i.e., through the use of a selective agent (e.g., a herbicide, antibiotic, or the like) or whether it is simply a trait that can be identified by observation or testing, that is, by "screening" (eg, the green fluorescent protein). Of course, many examples of suitable marker proteins are known in the art and can be used in the practice of the invention. Suitable methods for transforming plant cells or other cells for use with the current invention are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct release of DNA such as by mediated transformation. by protoplast PEG (Omirulleh et al., 1993), by desiccation / inhibition-mediated DNA uptake (Potrykus et al., 1985), by electroporation (U.S. Patent N e 5,384,253, specifically incorporated herein by reference in its entirety), by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Patent No. 2 5,302,523, specifically incorporated herein by reference in its entirety; and U.S. Patent No 2 5,464,765, specifically incorporated herein by reference in its entirety. de), by Agrobacterium-mediated transformation (U.S. Patent No. 5,591,616 and U.S. Patent No. 5,563,055; both specifically incorporated herein by reference) and by accelerating DNA-coated particles (U.S. Patent No. e 5,550,318; U.S. Patent N-5,538,877; and U.S. Patent No Q 5,538,880; each specifically incorporated herein by reference in their entirety), etc. Through the application of techniques such as these, cells from virtually any plant species can be stably transformed and these cells developed into transgenic plants. After effecting the delivery of exogenous DNA to the recipient cells, the next steps generally concern the identification of the transformed cells for further plant cultivation and regeneration. In order to improve the ability to identify transformants, one may wish to use a selectable marker or screenable gene with a transformation vector prepared in accordance with the invention. In this case, the potentially transformed cell population could then generally be assayed by exposing the cells to a selective agent or agents, or the cells could be screened for the desired marker gene trait. Cells that survive exposure to the selective agent, or cells that have been scored positive in a screening assay, can be grown in media that support plant regeneration. In an exemplary embodiment, the MS and N6 media may be modified by the inclusion of other substances such as growth regulators. One of such growth regulators is dicamba or 2,4-D. However, other growth regulators can be used, including NAA, NAA + 2,4-D or picloram. Enhancement of media in this or other ways has been found to facilitate the growth of cells at specific developmental stages. Tissue can be maintained in a basic medium with growth regulators until sufficient tissue is available to begin plant regeneration efforts or follow repeated rounds of manual selection, until tissue morphology is suitable for regeneration, typically at least 2 weeks, then transferred to media conducive to embryoid maturation. Cultures are transferred every 2 weeks in this medium. Bud development will signal time to transfer to medium that lacks growth regulators. To confirm the presence of exogenous DNA or "transgene(s)" in the regenerated plants, a variety of assays can be performed. Such assays include, for example, "molecular biological" assays such as Southern and Northern blotting and PCR®; "biochemical" assays, such as detecting the presence of a protein product, for example, by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and also by analyzing the phenotype of the whole regenerated plant. In addition to directing the transformation of a particular plant genotype with a construct prepared in accordance with the current invention, transgenic plants can be artificially produced by crossing a plant having a selected DNA of the invention with a second plant lacking the DNA. Plant generation techniques can also be used to introduce multiple desaturases, for example A6, A12, and / or A15-desaturase(s) into a single plant. In this way, A6-desaturase can be effectively up-regulated. By breeding plants homozygous for an A6-desaturase activity and / or other desaturase activity (eg, A12- and / or Al5-desaturase activity) beneficial metabolites can be increased in the plant. As presented above, a selected desaturase gene can be introduced into a particular plant variety by crossing, without the need to always directly transform a plant of that given variety. Therefore, the current invention not only encompasses a plant directly transformed or regenerated from cells which have been transformed in accordance with the current invention, but also the progeny of such plants. As used herein the term "progeny" denotes the progeny of any generation of a precursor plant prepared in accordance with the present invention, wherein the progeny comprise a selected DNA construct prepared in accordance with the invention. "Breed" a plant to provide a plant strain having one or more trans added genes or alleles relative to a parent plant lineage, as disclosed herein, is defined as those techniques that result in a particular sequence being introduced into a plant lineage by crossing a parent plant lineage with a donor plant lineage. which comprises a transgene or allele of the invention. To achieve this, for example, the following steps can be carried out: (a) plant seeds from the first (starter lineage) and second (donor plant lineage comprising a desired transgene or allele) precursor plants; (b) growing the seeds of the first and second precursor plants into flower-bearing plants; (c) pollinating a flower of the first parent plant with pollen of the second parent plant; and (d) harvesting the seeds produced in the precursor plant bearing the fertilized flower. Backcrossing is defined herein as the process including the steps of: (a) crossing a plant of a first genotype containing a desired gene, DNA sequence or element to a plant of a second genotype lacking said gene, DNA sequence or desired element; (b) selecting one or more progeny plants containing the desired gene, DNA sequence or element; (c) crossing the progeny plant with a plant of the second genotype; and (d) repeating steps (b) and (c) for the purpose of transferring a desired DNA sequence from a plant of a first genotype to a plant of a second genotype. The introgression of a DNA element into a plant genotype is defined as the result of the backcross conversion process. A plant genotype into which a DNA sequence has been introgressed may be referred to as a genotype, lineage, congenital or hybrid converted by backcrossing. Similarly, a plant genotype that lacks the desired DNA sequence may be referred to as an unconverted genotype, lineage, congenital or hybrid. Examples The following examples are included to illustrate embodiments of the invention. It should be appreciated by those skilled in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in the practice of the invention. However, those skilled in the art should, in view of the present description, appreciate that many changes can be made to the specific embodiments that are disclosed and still obtain the same or similar result without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related can be substituted in place of the agents described herein although the same or similar results would be obtained. All such substitutes and similar modifications evident to those skilled in the art are considered to be within the spirit, scope and concept of the invention as defined by the appended claims. Example 1 Cloning of A6 Desaturase Sequences from Evening Primrose juliae Cloning of Primrose juliae A6 desaturase (PjD6D) was achieved by PCR amplification of a region of partial internal genomic DNA using degenerate oligonucleotides, followed by bidirectional genomic marching. Total genomic DNA was isolated from P. juliae (Collector's Nursery, Battleground WA) using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA), following the manufacturer's procedure. Initially, a 552 base pair fragment corresponding to positions 687 to 1238 of SEQ ID NO: 1 was isolated using degenerate oligonucleotides BO-1 For and BO-2 Rev as described by Garcia-Maroto et al. (2002). The fragment was cloned into pCR®4-TOPO® (Invitrogen, Carlsbad, CA) to produce the pMON83955 vector and the insert was sequenced. The BO-1 For and BO-2 Rev primers were as follows: BO-1 For: 5-ATMAGYATYGGTTGGTGGAARTGG-3' (SEQ ID NO: 6) BO-2 Rev: 5'-AATCCACCRTGRAACCARTCCAT-3' (SEQ ID NO: 7) To determine the genomic flanking sequence of the pMON83955 insert, a Universal Genome Walker® Kit (BD Biosciences, Palo 30 Alto, CA) was used, following the manufacturer's procedure. Four P. juliae genomic libraries were generated by digestion of DNA with four restriction enzymes: EcoRV, Pvull, Stul and Dral. After a step of purification, digests were connected to an adapter provided in the kit. The procedure then involved two PCR reactions, each with a gene-specific primer and an adapter primer. The secondary PCR reaction used a dilution of the products from the primary PCR reaction as a standard. For the 5' direction, primers PD6D R8 and PD6D R2 were used for the primary and secondary PCR reactions, respectively. For the 3' direction, primers PD6D F8 and PD6D F3 were used for the primary and secondary PCR reactions, respectively. The primer sequences are given below: PD6D R8: 5'-CACACATGACCGGATAAAACGACCAGT-3' (SEQ ID NO: 8) PD6D R2: 5'-GGGAATGTACTGGAGGTCAGGGTCGTA-3' (SEQ ID NO: 9) PD6D F8: 5'-CGTGCAGTTCAGCTTGAACCATTTCTC -3' (SEQ ID NO: 10 ) PD6D F3: 5-TGCAGGGACACTCAACATATCGTGCCC-3' (SEQ ID NO: 11) The genomic march in the 5' direction produced a 574 base pair fragment from the EcoRV library. This product was cloned into p-CR®4-TOPO® (Invitrogen) giving pMON83956 and the insert was sequenced. The resulting sequence does not contain a start codon of the putative delta 6 desaturase gene and so another set of PCR reactions was performed using gene-specific primers designed to walk in the 5' direction of the pMON83956 insert. The primers used for the second 5'-walking genome set were PD6D R15 and PD6D R14 for the primary and secondary PCR reactions, respectively. The sequences are given below: PD6D R15: 5'- GTAGGTTGGTGGAGAAGGGAGGGAGGA-3' (SEQ ID NO: 12) PD6D R14: 5'-GGAAGGGGGATGGTAAGCGAGGAAAGC-3' (SEQ ID NO: 13) A 328 bp-long product from the Stul library was cloned into pCR®4-TOPO® (Invitrogen) giving pMON83958 and the insert was sequenced. This insert contained 2 potential start codons, 44 bases apart. The first start codon corresponds to position 87 and the second to position 135 of SEQ ID NO: 1. The genomic march in the 3' direction resulted in a 773 base pair fragment of the Dral library. This product was cloned into pCR®4-TOPO®, giving pMON83957. The insert was sequenced and found to contain 292 base pairs of the coding region for the putative delta 6 desaturase gene, followed by a stop codon at position 1473 with respect to SEQ ID NO: 1. The insects from pMON83955, pMON83956, pMON83957 and pMON83958 were aligned to form a composite sequence, SEQ ID NO: 1. Three primers were designed to PCR amplify 2 different lengths of the P. juliae genomic DNA coding sequence, reflecting the two codons starting points found in pMON83958. The longer of the two sequences, PjD6D-1, was amplified using the forward primer Pj D6D F2 and the reverse primer Pj D6D R1. The shorter of the two, PjD6D-2, was amplified using the forward primer Pj D6D F1 and the reverse primer Pj D6D R1. The two putative delta 6 desaturase coding sequences were each then ligated into the yeast expression vector pYES2.1-TOPO. In sequencing, the plasmid containing PjD6D-1 was designated pMON83950 (SEQ ID NO: 3) and the plasmid containing PjD6D-2 was designated pMON67011 (SEQ ID NO: 2). The primer sequences are given below: Pj D6D F2: 5'-GTCGACATGGAAAACACATTTTCACCACCACCT-3' (SEQ ID NO: 14) Pj D6D F1: 5'-GTCGACATGACTAAGACCATTTACATAACCAGC-3' (SEQ ID NO: 15) Pj D6D R1: 5'-CCTGCAGGTCACCCGACATTTTTAACAGCCTCC C-3' (SEQ ID NO: 16) The two PjA6 desaturase clones, PjD6D-2 and PjD6D-1, encode potential polypeptides of 446 amino acids and 462 amino acids, given in SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The initial MET site of the shortest peptide sequence (PjD6D-2) is located 16 amino acids downstream of the first MET site of the longest sequence (PjD6D-1). At 3' from the second MET, the sequences are identical. These sequences have high similarity to other plant A6 desaturases (FIGURE 1), including an N-terminal cytochrome b5 domain that is found in all front-end desaturases (Napier et al., 2003). Within the b5 domain The eight invariant residues characteristic of the cytochrome b5 superfamily and the H-P-G-G-binding heme motif are found, which have been shown to be essential for enzymatic activity (Napier et al., 1997, Sa-yanova et al, 1999, Sperling and Heinz 2001). Within the desaturase domain of the putative PjD6D desaturase are three conserved histidine boxes that are characteristic of all membrane-bound desaturases (Shanklin et al., 1994). A distinctive feature found in all front-end desaturases is that the third histidine box contains a glutamine residue in the first position (Q-x-x-H-H) rather than a histidine (Napier et al., 1997, Napier et al., 2003, Sperling and Heinz 2001). The deduced amino acid sequence of PjD6D had approximately 88% identity with the Primrose vialii and P. farínosa desaturases and approximately 64% identity with the Echium pitardii and E. gentianoides desaturases. Visual inspection of the multiple sequence alignment shown in FIGURE 1 suggests that the P. juliae A6 desaturase sequence does not contain any introns. This was observed in the A6 desaturases of Primrose and Echium species (Sayanova et al., 2003, Garcia-Maroto et al., 2002). Example 2 Yeast Transformation and Expression The constructs pMON83950 (FIGURE 3) and pMON67011 (FIGURE 2) were introduced into the host strain of Saccharomyces cerevisiae INVSd (Invitrogen), which is auxotrophic for uracil, using the PEG / Li Ac protocol as described in the Invitrogen manual for pYES2.1 / V5-His-TOP. Transformants were selected on plates fabricated from SC minimal medium minus uracil with 2% glucose. Transformant colonies were used to inoculate 5 ml of SC minimal medium minus uracil and 2% glucose and cultured overnight at 30°C. For induction, stationary phase yeast cells were pelleted and resuspended in SC minimal medium minus uracil supplemented with 2% galactose and cultured for 3 days at 15°C. o C. When exogenous fatty acids were fed to cultures, 0.01% LA (A9.12-18:2) was added with the 0.1% Tergitol emulsifier. The cultures were cultivated for 3 days at 15°C and subsequently harvested by centrifugation. Cell pellets were washed once with sterile TE buffer pH 7.5 to remove medium and lyophilized for 24 hours. The host strain transformed with the vector containing the LacZ gene was used as a negative control in all studies. Lipids were extracted from lyophilized yeast pellets by adding 0.1 ml of toluene and incubating overnight at room temperature. The extracted lipids were converted to fatty acid methyl esters (FAMEs) in situ by the addition of 0.5 ml of sodium methoxide. 0.6N in methanol and incubating for 45 min. The FAMEs were extracted by adding 0.8 ml of 10% (w / v) NaCl and 0.15 ml of heptane. The heptane layer containing FAMEs was removed and used directly for gas chromatography (GC). FAMEs were identified on a Hewlett-Packard 5890 II Plus GC (Hewlett-Packard, Palo Alto, CA) equipped with a flame ionization detector and a capillary column (omegawax 250; 30 m x 0.25 mm i.d. x 0.25 pm; Supelco, Bellefonte, PA). A slit ratio of 100:1 was used for injections. The injector was held at 250°C and the flame ionization detector was held at 270°C. The column temperature was maintained at 180°C for 1.5 min following injection, increased to 240°C at 40°C / min and maintained at 245°C for 3.38 min. Table 1 shows the fatty acid composition for clones of P. juliae expressing yeast pMON67011 (PjD6D-2), pMON83950 (PjD6D-1) or Mortierella alpina A6 desaturase, pMON77205. The expected products for the A6 desaturation of LA and ALA were observed for both the P. juliae clones (Table 1, GLA and SDA, respectively), demonstrating that the clones contained in pMON67011 and pMON83950 are A6 desaturases. Substrate selectivity was determined by feeding equal amounts of LA and ALA. M. alpina is a filamentous fungus that accumulates high levels of the fatty acid n-6 ​​arachidonic acid and was expected to have an A6 desaturase with an n-6 selectivity. Table 2 shows the substrate selectivities of n-3:n-6 SDA A6 desaturases from P. juliae and M. alpina. An n-3:n-6 selectivity of ~0.8 was observed for the A6 desaturase from M. alpina. An n-3:n-6 selectivity of —1.5 to 1.9 was observed for both clones. of the A6 desaturase from P. juliae. Table 1: Comparison of fatty acid composition of yeast expressing different A6 desaturases FA Gene Vector in LA* GLA* ALA* SDA* medium pMON67011 P. juliae D6D-2 - 2.0 0.0 0.0 0.0 pMON67011 P. juliae D6D-2 - 2.5 0.0 0.1 0.0 PMON67011 P. juliae D6D-2 LA 25.7 14.0 0.0 0.0 pMON67011 P. juliae D6D-2 LA 28.4 16.8 0.1 0.0 pMON67011 P. juliae D6D-2 ALA 0.3 0.1 24.4 16.8 PMON67011 P. juliae D6D-2 ALA 0.3 0.1 30.6 19.0 pMON67011 P. juliae D6D-2 LA+ALA 22.7 6.0 18 .0 8.5 pMON67011 P. juliae D6D-2 LA+ALA 24.3 5.8 20.4 8.9 PMON83950 P. juliae D6D-1 - 2.3 0.0 0.3 0.0 pMON83950 P. juliae D6D-1 - 2.3 0.0 0.2 0.0 pMON83950 P. juliae D6D-1 LA 26.3 15.0 0.0 0.0 PMON83950 P. juliae D6D-1 LA 23.5 16, 6 0.0 0.0 PMON83950 P. juliae D6D-1 ALA 0.6 0.2 37.3 17.5 PMON83950 P. juliae D6D-1 ALA 0.7 0.1 33.9 17.4 pMON83950 P. juliae D6D-1 LA+ALA 18.8 4.3 17.1 9.4 PMON83950 P. juliae D6D-1 LA+ALA 16.9 4.8 15.7 9.8 PMON77205 M. alpina D6D - 1.7 0.0 0.2 0.0 PMON77205 M. alpina D6D - 1.0 0.0 0.0 0.0 PMON77205 M. alpina D6D LA 56.8 6.0 0.0 0.0 PMON77205 M. alpina D6D LA 25.4 4.6 0.2 0.0 pMON77205 M. a pMON77205 M. alpina D6D ALA 0.9 0.0 23.0 5.0 pMON77205 M. alpina D6D LA+ALA 34.8 1.3 39.7 1.1 pMON77205 M. alpina D6D LA+ALA 18.7 2.8 18.4 2.2 **Reported as a % of the total for all analytes included in the GC-FID chromatogram, including but not shown (16:0, 16:1, 18:0, 20:0, 20:1, 20:2, 22:0, 22:1, 22:2 • • • • • • • • • • • • • • • • • • • • • • The • • • • • • • • • • • • • •• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Table 2. Comparison of n-3:n-6 substrate selectivities for A6 desaturases from P. juliae and M. alpina. Gene vector FA in the middle % of GL conv% of conv. N-A* Ratio of SDA* 3:n-6** PMON67011 P. juliae D6D-2LA+ALA 21.0 32.1 1.53 PMON67011 P. juliae D6D-2LA+ALA 19.2 30.3 1, 58 PMON83950 P. juliae D6D-1LA+ALA 18.7 35.4 1.89 PMON83950 P. juliae D6D-1 LA+ALA 22.2 38.4 1.73 PMON77205 M. alpina D6D LA+ALA 3.6 2 .8 0.78 PMON77205 M. alpina D6D LA+ALA 12.8 10.5 0.82 * The percentage of conversion to GLA was calculated by dividing the value for GLA (Table 1) by the sum of the values ​​for LA and GLA (Table 1). The same calculation was done for SDA using the sum of ALA and SDA (Table 1). ** The n-3:n-6 ratio was calculated by dividing the % conv. of SDA by % conv. of GLA. Example 3 Plant Transformation and Expression of Evening Primrose A6-desaturase P. juliae A6-desaturase activity was evaluated in soybean by combining it with an A15-desaturase from Neurospora crassa (NcD15D), pMON77245 (FIGURE 4) or Aspergillus nidulans (AnD15D), pMON77247 (FIGURE 5). The pMON77245 vector was constructed in three steps. The first P. juliae A6-desaturase (PjD6D-2) was placed behind the seed-specific 7S alpha' promoter by digesting pMON67011 with Sse8387 I, followed by removing the 3' and Sal I projections and then ligating the resulting fragment into the EcoRI and the substituted Xhol sites of the pMON68527 expression vector generating the PMON77243 vector. Second, the PjD6D-2 expression cassette was removed from pMON77243 by digestion with NotI, followed by a substitution reaction, and then the resulting fragment was ligated into the EcoRV site of the 2T binary vector pMON77244. Finally, a codon-optimized NcD15D (SEQ ID NO: 17) under the control of a 7S alpha seed-specific promoter was combined with PjD6D-2 by digestion of the pMON77227 with NotI and then ligating the resulting NcD15D expression cassette fragment into the digested NotI pMON77344 to give pMON77245 (FIGURE 4). The pMON77247 vector (FIGURE 5) was constructed by digesting the pMON77242 vector with Not I and ligating the resulting expression cassette fragment comprising a codon-optimized AnD15D (SEQ ID NO: 18) linked to the 7S alpha promoter at the Not I site of pMON77244. The vectors pMON77245 and pMON77247 were transformed into soybean using the method of Martinell et al. (U.S. Patent No. 6,384,301, the disclosure of which is incorporated herein by reference in its entirety). The expression of the PjD6D-2 coding sequence was measured by determining the fatty acid composition of immature R1 transgenic soybean seeds (approximately 30 days after flowering), including both homozygotes and heterozygotes, by gas chromatography of methyl ester derivatives. (PCT US03 / 16144, filed May 21, 2003, the entire disclosure of which is specifically incorporated herein by reference). The levels of PA (palmitic acid, 16:0), SA (stearic acid, 18:0), OA, LA, GLA, ALA and SDA are expressed as a percentage of the total weight of fatty acids measured and are shown in Tables 3 and 4 below. The non-transgenic control strain was A3525. Whenever possible, five individual seeds were analyzed from each event. The individual seed of a majority of pMON77245 transgenic events were found to accumulate measurable amounts of SDA. In all cases, SDA levels were higher than those of GLA, with an average SDA:GLA ratio for each event ranging from 2:1 to a high of 8:1. The highest isolated seed value was observed from event GM_A38083, which contained 32.0% SDA and 2.6% GLA, with an SDA:GLA ratio of 12:1. Of the 12 events shown below, 9 had SDA values ​​>10% in at least one seed out of five. As the SDA values ​​increased, the levels of PA, SA and OA did not vary significantly from the control levels; however, there is a strong negative correlation with LA. In seeds that accumulated SDA, GLA levels remained low, between 2.3 to 5.5%. ALA levels have increased along with SDA levels. TABLE 3: Relative Area Percentage Results (Approx. percentage by weight) of R1 seeds transformed with pMON77245 isolated pMON77245 Fatty acid (weight percent) Lineage PA SA OA LA GLA UA SDA A3525 11.47 5.21 16.5 56.75 0 9.15 9 ​​A3525 11.66 4.53 18.54 54.9 0 9, 51 9 A3525 11.8 5.42 16.66 56.04 0 9.14 9 A3525 11.41 4.91 17.64 56 0 9.08 9 A3525 11.56 4.36 17.86 56.55 0 8.77 0 GM A38005 12.57 4.19 18.45 53.99 0 10.8 0 GM A38005 13.73 4.77 19.32 52.42 0 9.76 0 GM A38005 14.81 4.74 19.09 36.84 5.23 10.3 8.98 GM A38005 13.4 4.71 18.34 53.26 0 10.29 0 GM A38005 13.21 4.38 19.97 52.19 0 10 .25 0 GM A38005 13.08 4.78 17.99 53.56 0 10.59 0 GM A38013 12.91 4.45 19.72 40.8 4.57 9.56 7.99 GM_A38013 12.45 4 .38 18.9 55.04 0 9.23 0 GM A38013 13.04 4.68 17.38 40.36 4.66 10.27 9.61 GM A38013 13.26 4.34 17.14 40.03 4.6 10.17 10.46 GM A38013 11.67 4.26 22.5 44.26 3.3 8.95 5.05 GM A38021 12.95 4.33 19.39 53.48 0 9.85 0 GM A38021 13.07 4.87 18.12 54.1 0 9.84 0 GM A38021 13.14 4.27 22.76 34.62 2.3 13.7 9.2 GM A38021 12.98 4, 08 21.58 39.6 1.6 13.7 6.45 GM A38021 13.21 4.34 17.24 29.03 1.78 19.07 15.31 GM A38043 13.1 4.26 19, 58 52.44 0 10.62 0 GM A38043 13.09 4.3 20.01 52.83 0 9.77 0 GM A38043 14.01 4.35 22.05 29.98 4.39 12.18 13, 05 GM A38043 13.32 4.26 19.41 51.85 0 11.16 0 GM A38043 12.8 4.34 19.81 53 0 10.05 0 pMON77245 Fatty acid (percent by weight) GM A38048 13.44 5.5 18.01 44.46 2.28 10.7 5.61 GM A38048 13.43 4.8 18.57 44.25 2.34 10, 93 5.68 GM A38048 13.14 4.47 18.88 44.97 2.33 10.78 5.44 GM A38048 12.98 4.89 17.79 44.92 2.43 11.23 5.76 GMA38048 13.3 4.56 17.95 35.88 3.41 13.15 11.75 GM A38060 12.73 4.94 17.37 43.16 4.01 10.4 7.39 GM A38060 12.85 5.19 15.27 35.1 5.32 11.88 14.39 GM A38060 12.73 4.99 16.41 43.44 3.95 10.25 8.23 ​​GM A38060 13.06 5.34 16 .06 42.75 4.04 10.32 8.43 GM A38060 12.85 5.25 16.45 42.68 4.01 10.39 8.36 GM A38064 13.32 5 18.8 42 3.86 10.16 6.87 GM A38064 13.07 4.72 18.97 42.1 3.59 9.95 7.6 GM A38064 13.45 4.84 19.7 41.67 3.8 9.92 6 .62 GM A38064 12.66 4.61 19.09 43.21 3.52 9.85 7.05 GM A38064 13.03 4.73 19.58 36.38 4.94 11.28 10.06 GM A38069 12.9 4.71 21.24 41.12 2.64 11.43 5.97 GM A38069 12.74 4.76 20.35 51.21 0 10.94 0 GM A38069 12.93 4.77 20, 5 51.27 0 10.53 0 GM A38069 13.18 4.69 18.85 38.76 3.3 12.34 8.87 GM A38069 13.08 4.79 19.16 52.08 0 10.89 0 GM A38083 13.33 5.28 21.73 27.31 2.48 15.28 13.35 GM A38083 12.8 4.96 16.85 11.52 2.64 18.11 32.02 GM A38083 12.32 5.07 22 .23 13.59 2.52 17.46 25.56 GM A38083 13.22 4.26 20.83 15.89 3.81 14.69 26.12 GM A38083 13.74 4.61 17.03 20, 93 4.84 13.82 23.91 GM A38084 12.9 4.04 22.66 41.63 3.37 9.07 5.28 GM A38084 13.38 3.94 28.07 25.81 4.9 11.37 11.42 GM A38084 13.92 3.75 31.36 32.26 2.89 9.23 5.51 GM A38084 14.42 4.12 27.17 33.26 3.28 11.57 5 .77 GM A38084 12.74 3.95 22.59 40.82 3.3 9.68 5.91 pMON77245 Fatty acid (percent by weight) GM A38089 13.05 4.48 22.37 42.63 2.55 9.3 4.59 GM A38089 13.15 4.63 18.82 53.48 0 9.03 0 GMA38089 12.67 4.41 20.59 51.87 0 9.42 0.07 GM A38089 12.64 4.29 20.56 52.58 0 8.96 0 GMA38089 12.72 4.57 21.81 50 .79 0 9.16 0 GM A38094 12.62 4.57 18.97 52.96 0 9.9 0.11 GM A38094 13.3 5.08 17.08 34.49 5.35 11.39 12, 35 GMA38094 13.08 4.52 18.38 38.95 5.41 9.88 8.82 GM A38094 13.41 5 17.27 38.5 5.49 10.26 9.1 GMA38094 12.58 4, 46 20.06 40.28 4.88 9.5 7.25 The individual seed of pMON77247 transgenic events accumulated similar amounts of SDA when compared to pMON77245, with the exception of event GM A38083 which accumulated significantly higher levels of SDA. The levels of PA, SA, OA and LA were 5 similar to the control levels shown in Table 3. Overall, SDA levels were higher than those of GLA with an average SDA:GLA ratio for each event ranging from 1:1 to 1.6:1, which was lower than that observed for pMON77245. TABLE 4: Relative Area Percentage Results (Approx. 10 by weight) of isolated pMON77247 R1 seeds PMON77247 Fatty acid (percent by weight) Line PA SA AO LA GLA ALA SDA GM A38909 12.18 4.19 20.66 44.94 3.52 8.65 4.87 GM A38909 12.25 3.84 22.37 44.89 2.95 8.22 4.46 GM A38909 12.06 4.67 22.95 43.37 3.31 8.32 4.86 GM A38909 12.64 4.63 17.61 45.99 3 .66 9.01 5.44 GM A38909 12.28 4.2 19.42 46.1 3.1 9.01 4.82 GM A38941 13.95 4.87 18.03 40.2 7.08 7, 87 6.92 GMA38941 13.76 4.38 19.72 33.62 8.94 8.57 9.95 pMON77247 Fatty acid (weight percent) GM A38941 13.15 4.91 17.89 52.06 0.75 9.52 0.8 GM A38941 12.73 4.27 22.23 42.14 4.98 7, 44 5.15 GM A38941 12.73 4.34 19.37 52.34 0.36 9.53 0.37 GM A38946 13.02 4.68 17.4 44.66 4.54 8.83 5.89 GM A38946 13.17 4.42 17.35 43.71 5.01 8.91 6.49 GM A38946 13.63 4.24 18.96 38.16 6.36 8.89 8.75 GM A38946 13, 32 4.6 17.76 43.37 4.8 8.94 6.2 GMA38946 13.32 4.5 18.07 43.24 4.71 8.95 6.23 GM A38977 13.43 5.18 21 .3 40.54 4.43 8.51 5.62 GM A38977 13.6 4.92 21.44 40.95 4.26 8.41 5.42 GM A38977 13.17 4.23 21.61 38, 02 5.45 8.38 8.07 GM A38977 13.06 4.97 21.93 37.82 5.75 8.63 6.86 GM A38977 13.33 4.5 22.96 37.43 5.54 8.42 6.76 GM A39047 13.22 4.21 20.95 31.88 7.8 9.01 11.72 GM A39047 13.34 4.47 19.14 31.1 7.54 9.9 13 .35 GM A39047 13.79 4.32 18.82 32.97 8.26 9.07 11.68 GM A39047 13.16 4.38 19.34 29.61 7.94 9.97 14.44 GMA39047 12 .65 4.25 17.48 50.71 1.49 9.92 2.45 Example 4 Primula juliae A6-desaturase activity in combination with Neurospora crassa A15-desaturase in canola Primula juliae A6-desaturase activity in combination 5 with A15-desaturase Neurospora crassa was evaluated by canola transformation with MON82822 (FIGURE 7). pMON82822 contained a native NcD15D (SEQ ID NO: 19) as well as PjD6D-2, both inserted into a seed-specific expression cassette under the control of the na-pin promoter (PCT US03 / 16144, the description of which is specifically here incorporated by reference). The pMON82822 vector was constructed by digesting pMON77214 (PCT US03 / 16144) with Pmel and BamHI (substituted) and ligating the resulting native NcD15D napin cassette into the EcoRV site of the 2T binary vector pMON71801 to generate pMON82820. Then, pMON82819 was digested with NotI, the ends were replaced, and the resulting PjD6D-2 napin expression cassette was ligated into the substituted AscI site of pMON82820 to generate pMON82822. 5 A second vector, pMON82821, was also constructed containing of codon-optimized NcD15D (SEQ ID NO: 17) and PjD6D-2 pMON82821 by first digesting pMON67011 with Sail and Sse83871 and ligating the resulting PjD6D-2 fragment into the Sail and Xhol (substituted) sites of the napin expression cassette in pMON82800 giving pMON82819. The con-10 napin cassette having a codon-optimized NcD15D was constructed by digesting pMON67024 with Pmel and BamHI (substituted) and ligating the resulting fragment into an EcoRV-digested 2T binary vector, pMON71801, yielding pMON82801. Finally, pMON82819 was digested with NotI, replaced, and the resulting PjD6D-2 napin expression cassette was ligated into the substituted NotI site of pMON82801 giving pMON82821. pMON82822 was transformed into canola (Brassica napus) using a modification of the protocol described by Radke et al., (Plant Cell Reports 11:499 to 505, 1992). In summary, canola seeds of the cultivar 'E-bony' (Monsanto Canada, Inc., Winnipeg, Canada) were disinfected and germinated in vitro as described in Radke et al., 1992. tobacco, explant preparation and inoculation of explants with ABI strain Agrobacterium tumefaciens (Koncz and Schell, Mol Gen Genet 204: 383 to 396 (1986)) containing the desired vector were as described with the Agrobacterium being maintained in LB medium (solid or liquid). -25 do) containing 75 mg / l spectinomycin, 25 mg / l chloramphenicol and 50 mg / l kanamycin. For plant transformation including callus induction, bud regeneration, maturation and rooting, glyphosate selection was used instead of kanamycin selection as described in Radke et al., 1992. Specifically, the callus induction medium B5-1 30 was supplemented with 500 mg / l carbenicillin and 50 mg / l Timentin (Duchefa Biochemie BV) to inhibit the growth of Agrobacterium and kanamycin was omitted from the medium. The B5BZ sprout regeneration medium contained, in addition, 500 mg / l of carbenicillin, 50 mg / l of Timentin and 45 mg / l of glyphosate with explants being transferred to fresh medium every two weeks. Glyphosate-selected shoots were transferred to hormone-free B5-0 bud maturation medium containing 300 mg / L carbenicillin and 45 mg / L glyphosate for two weeks and finally the shoots were transferred to B5 root induction medium containing 45 mg / l glyphosate. The rooted green seedlings were transplanted into potted soil and acclimated to greenhouse conditions. The plants were kept in a greenhouse under standard conditions. The fatty acid composition of mature seed was determined by GC analysis of methyl ester-derived lipids as done above for soybean transformants. GC analysis of canola seed from plants transformed with pMON82822 produced 199 events with SDA levels ranging from 0.12 to 4.49% (% by weight, 100 seed pools). Example 5 Construction and transformation of PjD6D expression vectors for Soy, Corn and Canola The expression of the isolated PjD6D sequences is evaluated in planta for canola, corn and soybean under the expression of a seed-specific promoter. A soybean expression vector is constructed by digesting pMON77243 with Not I and ligating the resulting fragment containing PjD6D-2 into the Not I site of the binary vector pMON17227. A canola expression vector is constructed by digesting pMON83950 with Sail and Sse8387l (bluntly done) and ligating the resulting fragment, which contains the PjD6D-1 coding region into the Sail and Xhol (substituted) sites of the Canola expression vector cassette. pMON82800 seed-specific napin. The resulting plasmid is then digested with Not I followed by ligation of the resulting napin PjD6D-1 expression cassette into the Not I site of the binary vector pMON17227. A maize expression vector is constructed by digesting pMON83950 with Sal I (substituted) and Sse838721 (blunt) and ligating the resulting PjD6D-1 fragment into the Sfil site (blunt) of the globulin expression cassette in pMON71084. The resulting vector is then digested with Pmel and Hindi 11 and the expression cassette is then ligated into the HpaI and Hindlli sites of the binary vector pMON30167. P. juliae A6-desaturase activity in maize is evaluated in combination with a maize codon-optimized Neurospora crassa A15-desaturase (NcD15Dnno) (SEQ ID NO: 20). The pMON67011 vector is digested with Sail and Sse83871 (made abruptly) and the resulting PjD6D-2 fragment is ligated into the Sfi (substituted) of the globulin expression cassette in pMON71084 to give pMON82823. Then, pMON82806 (PCT US03 / 16144) is digested with Pmel and Hindlli and the resulting NcD15Dnno globulin cassette is ligated into the Notl (substituted) and Hindlli sites of the 1T binary vector pMON30167 to give pMON82824. Finally the PjD6D-2 cassette of the globulin is combined with the NcD15Dnno of the globulin by digesting pMON82823 with PmeI and Hindlli and ligating the resulting fragment into the SmaI and Hindlli sites of pMON82824 giving pMON82825. The resulting vector is introduced into corn via the Agrobacterium tumefaciens mediated transformation as known to a person skilled in the art, for example, U.S. Patent. No. 6,603,061. Example 6 Cloning of A6 Desaturase Sequences from Evening Primrose waltonii and Evening Primrose Alpicola Cloning of Primrose waltonii A6 desaturase (PwD6D) and P. alpicola A6 desaturase (PaD6D) genes was achieved by PCR amplification of a region of partial internal genomic DNA using degenerate oligonucleotides, followed by bidirectional genomic marching. Total genomic DNA was isolated from P. waltonii and P. alpicola (Collector's Nursery) using the DNeasy Plant Mini Kit (Qiagen), following the manufacturer's procedure. Two fragments were isolated from P. alpicola genomic DNA using the degenerate oligonucleotides BO-1 For and BO-2 Rev as described by Garcia-Maroto et al. 2002: BO-1 For: 5 -ATMAGYATYGGTTGGTGGAARTGG-3' (SEQ ID NO: 6) BO-2 Rev: 5 -AATCCACCRTGRAACCARTCCAT-3' (SEQ ID NO: 7) The first P. alpicola fragment had 550 base pairs in length and corresponded to positions 553 to 1103 of SEQ ID NO: 21. This fragment was cloned into pCR®4-TOPO® (Invitrogen) to produce vector pMON83977 (no intron). The second P. alpicola fragment was 550 base pairs in length and corresponded to positions 763 to 1313 of SEQ ID NO: 23. This fragment was cloned into pCR®4-TOPO® (Invitrogen) to produce the vector pMON83975 (contains intron ). A fragment was obtained from P. waltonii that was 550 base pairs in length and corresponded to positions 763 to 1313 of SEQ ID NO: 25. This fragment was cloned into pCR®4-TOPO® (Invitrogen) to produce the pMON83976 vector. The polypeptide sequences encoded by SEQ ID NOs: 21, 23 and 25 are given in SEQ ID NOs: 22, 24 and 26, respectively. To determine the genomic flanking sequences of the pMON83975, pMON83976 and pMON83977 inserts, a Universal Genome Walker® Kit (BD Biosciences) was used, following the manufacturer's procedure. Four genomic libraries for each Primrose species were generated by digestion of DNA with four restriction enzymes: EcoRV, Pvull, Stul and Dral. After a purification step, the digests were connected to an adapter provided in the kit. The procedure then involved two PCR reactions, each with a gene-specific primer and an adapter primer. The secondary PCR reaction used a dilution of the products of the primary PCR reaction as a standard. A. pMON83975 (PaD6D-2) For the 5' direction, primers PD6D R7 and PD6D R1 were used for the primary and secondary PCR reactions, respectively. For the 3' direction, primers PD6D F7 and PD6D F1 were used for the primary and secondary PCR reactions, respectively. The primer sequences are given below: PD6D R7: 5-CACACATGACCGGATAAAACGTCCAGT-3' (SEQ ID NO: 27) PD6D R1: 5-AGGGATATACTGGAGGTCGGGGTCGTA-3' (SEQ ID NO: 28) PD6D F7: 5'-GAGCTATTCCGTTACGGGGATACAACA -3' (SEQ ID NO: 29) PD6D F1: 5 - TGCAGGGACACTTAACATATCGTGCCC-3' (SEQ ID NO: 30) The genomic march in the 5' direction produced a fragment of 751 base pairs from the EcoRV library. This product was cloned into p-CR®4-TOPO® (Invitrogen) giving pMON83978 and the insert was sequenced. The resulting sequence does not contain a putative delta 6 desaturase gene start codon and so another set of PCR reactions was performed using gene-specific primers designed to walk in the 5' direction of the pMON83978 insert. The primers used for the second set of genomic marching in the 5' direction were PD6D R17 and PD6D R16 for the primary and secondary PCR reactions, respectively. The sequences are given below: PD6D R17: 5'-GTGAAAGTTGTTGAGGAGGGATCGGTA-3' (SEQ ID NO: 31) PD6D R16: 5'-GTGGAAGGAGGATGGTAAGCGAGGAAA-3' (SEQ ID NO: 32) A 473 base pair long product from the Pvull library was cloned into pCR®4-TOPO® giving pMON83980 and the insert was sequenced. This insert contained a start codon corresponding to position 1 of SEQ ID NO: 23. Genomic march in the 3' direction resulted in a 942 base pair fragment of the Dral library. This product was cloned into pCR®4-TOPO®, giving pMON83979. The insert was sequenced and found to contain 294 base pairs of the coding region for the putative delta 6 desaturase gene, followed by a stop codon at position 1549 with respect to SEQ ID NO: 23. Inserts from pMON83975, pMON83978, pMON83980 and pMON83979 were aligned to form a composite sequence of a putative A6 desaturase gene for P. alpicola giving PaD6D-2, SEQ ID NO: 23. Two primers were designed to PCR amplify the template of the loitura o horta comnlota of the gonomic DNA of the P alpicnla. The primer sequences are given below: Pa D6D F1: 5'-GTCGACATGGCTAACAAATCTCAAAACAGGTTA C-3' (SEQ ID NO: 33) Pa D6D R1: 5'-CCTGCAGGTCACCCGAGAGTTTTAACAGCCTCC-3" (SEQ ID NO: 34) The PCR amplified fragment (SEQ ID NO: 23) was then ligated into the yeast expression vector pYES2.1-TOPO giving the vector PMON83968. B. pMON83976 (PwD6D) A putative A6 desaturase was amplified by PCR of P. waltonii genomic DNA using primers Pa D6D F1 (SEQ ID NO: 33) and Pa D6D R1 (SEQ ID NO: 34) shown above. The PCR amplified fragment (SEQ ID NO: 25) was then ligated into the pYES2.1-TOPO yeast expression vector giving the pMON83967 vector. C. pMON83977 (PaD6D-1) For the 5' direction, primers PD6D R9 and PD6D R4 were used for the primary and secondary PCR reactions, respectively. For the 3' direction, primers PD6D F9 and PD6D F4 were used for the primary and secondary PCR reactions, respectively. The primers are given below: PD6D R9: 5'-CACACATTACCGGATAAAACGTCCAGT -3' (SEQ ID NO: 35) PD6D R4: 5'-AGGAATATACTGGAGGTCTGGGTCGTA-3' (SEQ ID NO: 36) PD6D F9: 5'- ATTTTTCTTCGGACGTATACATGGGCC -3' (SEQ ID NO: 37 ) PD6D F4: 5'- TTCGGGGACACTGAACATATCGTGCCC-3' (SEQ ID NO: 38) The genomic march in the 5' direction produced a 979 base pair fragment of the Stul library. This product was cloned into pCR®4-TOPO® (Invitrogen) giving pMON83981 and the insect was sequenced. The resulting sequence contained the putative delta 6 desaturase start codon at position 1 with respect to SEQ ID NO: 21. Genomic march in the 3' direction resulted in a 1028 base pair fragment of the Dral library. This product was cloned into pCR®4-TOPO® (Invitrogen), giving pMON83982. The insert was sequenced and found to contain 295 base pairs of the coding region for the putative delta 6 desaturase gene, followed by a stop codon at position 1339 with respect to SEQ ID NO: 21. Inserts from pMON83977, pMON83981 and pMON83982 were aligned to form a composite sequence of a second putative A6 desaturase gene for P. alpicola giving PaD6D-1, SEQ ID NO: 21. Two primers were designed to PCR amplify the complete open reading frame of P. alpicola genomic DNA. The primer sequences are given below. Mp D6D-F2: 5'-GTCGACATGGCCAACACTAGTTACATTTCCAGC T-3' (SEQ ID NO: 39) Mp D6D-R2: 5'- GATATCACCCCAGAGTGTTAACAGCTTCCCAG-3' (SEQ ID NO: 40) The amplified PCR fragment was then ligated into the yeast expression vector pYES2.1-TOPO giving the vector pMON67026 (SEQ ID NO 21). Alignment of PaD6D-2 and PwD6D (also abbreviated PRI-waD6D) with other characterized plant A6 desaturase genes revealed that these two genes contained a single intron corresponding to positions 476 to 676 in SEQ ID NO: 23 and positions 476 to 651 in SEQ ID NO: 25. This was observed in A6 desaturases from Primula and Echium species (Sa-yanova et al., 2003, Garcia-Maroto et al., 2002). The three A6 desaturase clones encode potential polypeptides of 446 amino acids for PaD6D-1 (SEQ ID NO: 22), 449 amino acids for PaD6D-2 (SEQ ID NO: 24), and 449 amino acids for PwD6D (SEQ ID NO: 26). ). These sequences have high similarity to other plant A6 desaturases (FIGURE 1), including a b domain 5 of N-terminal cytochrome, which is found in all front-end desaturases (Napier et al., 2003). within domain b 5 of cytochrome is found the eight invariant residues characteristic of the b superfamily 5 cytochrome and the H-P-G-G binding heme motif, which has been shown to be essential for enzymatic activity (Napier et al., 1997, Sayanova et al, 1999, Sperling and Heinz 2001). Within the desaturase domain of the PaD6D-1, PaD6D-2 and PwD6D desaturases are three conserved histidine boxes that are characteristic of all membrane-bound desaturases (Shanklin et al., 1994). A distinctive feature found in all front-end desaturases is that the third histidine box contains a glutamine residue in the first position (Q-x-x-H-H) rather than a histidine (Napier et al., 1997, Napier et al., 2003, Sperling and Heinz 2001). The deduced amino acid sequence of PaD6D-1 had approximately 80% identity to PaD6D-2 and approximately 80% identity to PwD6D. However, the two intron-containing genes, PaD6D-2 and PwD6D, are more similar to each other with approximately 97% identity, than the two P. alpi-cola genes, PaD6D-1 and PaD6D are to each other. Example 7 Additional Cloning of Evening Primrose A6 Desaturase Sequences Genomic DNA was isolated from P. farínosa and P. floríndae using a Sarkosyl / CTAB lysis system. Five grams of tissue of each species were ground in a mortar and pestle with liquid nitrogen until ground into a fine powder. The powdered tissue was then resuspended in lysis buffer (140 mM sorbitol, 220 mM Tris-HCl, pH 8.0, 22 mM ethylenediaminetetraacetic acid (EDTA), 800 mM sodium chloride (NaCl), 1% N-laurylsarcosine and 0.8% hexadecyltrimethyl ammonium bromide (CTAB)) and incubated for 1 hour at 65°C with gentle inversion every 10 minutes. After incubation, 10 ml of chloroform was added to the lysis suspension and incubated at room temperature with gentle rocking for 20 minutes. The lysis suspension was centrifuged for 10 minutes at 12,000 X g. The aqueous layer was transferred to a clean tube and the nucleic acid precipitated with 0.6% isopropanol. The nucleic acid pellet was resuspended in 4 ml of a solution containing 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1 M NaCl and 20 mg Proteinase K. The nucleic acid was resuspended. it was then incubated for 2 hours at 63°C. Proteinase K was then heat inactivated by incubation at 75°C for 20 minutes. RNase (2.5 p.g) was added to the solution and incubated at 37°C for 1 hour. The solution was extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) 2 times. The purified genomic DNA was then ethanol precipitated. Approximately 3 pg of genomic DNA was digested in separate reactions with the restriction endonucleases EcoRI, Hindlll, Kpnl, Sail and Xhol. After digestion, each reaction was purified using a QIAquick® PCR purification (Qiagen, Valencia, CA) following the manufacturer's protocol. Digested genomic DNA was eluted from the purification columns using 100 µl of elution buffer provided in the kit. Intramolecular interactions favoring binding were performed in a volume of 200 pl using 20 pl of digested genomic DNA eluted in a PEG-free ligation reaction with 800 ligase units (M0202L) (New England Biolabs, Beverly MA) during overnight at 16°C, followed by heat inactivation at 75°C for 10 minutes. After binding, the reaction was further purified using a QIAquick® PCR Purification Kit. Inverse PCR was performed using 6 to 20 ng of purified ligated DNA and 10 to 20 pg of primer and the Expand Long Standard PCR System (Roche Applied Science, Indianapolis, IN). The primers are shown in Table 5 and were designed using a combination of available sequence data and data spanning the desaturase domain. Thermal cycling conditions consisted of an initial incubation at 94°C for 2 minutes; 10 cycles of 94°C for 20 seconds, 52°C for 30 seconds and 68°C for 8 minutes; followed by 25 cycles of 94°C for 30 seconds, 52°C for 30 seconds and 68°C for 8 minutes plus 10 seconds per cycle. After cycling was completed, another incubation at 68°C for 7 minutes was performed. Visible reverse PCR library products after agarose electrophoresis were cloned into pCR®2.1-TOPO or pCR®4Blunt-TOPO (Invitrogen) following the manufacturer's protocol. The following reverse library fragments (approximately sized) were cloned: P. fer / nosa-EcoRI (6 kb) and P f / or / ndae-Hindlll (3 kb). DNA sequencing was performed on an Applied Biosystems 3730x1 DNA Analyzer, using Big Dye® Terminator v3.0. Initial table: the frarimmanncs i icadn»; in the initiation of inverse PCR -------- C7......- - • - - .. . J of the 5' and 3' regions of the delta 6 desaturase genes. Initiator Species Sequence SEQ ID NO P. farinosa Pf1107F1 TGGAGGTCTGGGTCGTAATC 41 PÍ1107R1 CTTCGGACGTATACATGGGC 42 P. florindae Pf1113-1F2 TCGTAATCCAGGCTATTGCA 43 PÍ1113-1R2 TTTTCTTCGGACGTCCATGT The putative sequences were aligned with public data to determine the approximate region of the open reading frame (ORF) a-encompassed by each gene. Primers to amplify the ORF of each gene were designed based on inverse aligned PCR data. Proof proof polymerases were used to amplify putative delta 6 genes to ensure final product fidelity. The primers used in the final cloning of the putative delta 6 desaturase genes are shown in Table 6. The products were cloned into pUC19 or pCR®4Blunt-TOPO (Invitrogen). DNA sequencing was performed on an Applied Biosystems 3730x1 DNA Analyzer, using Big Dye® Terminator v3.0. Two putative delta 6 desaturase genes were cloned: P. farinosa (PfaD6D) (pMON84809) (SEQ ID NO: 45) and P. florindae (PflD6D) (pMON84810) (SEQ ID NO: 47). Table 6. Primers used to amplify delta 6 desaturase genes. initiator Sequence SEQ ID NO: Pfarinosa754 FGACGATTTTTGAGTGAGAGTTAATTTGAGTCAATAATA 49 Pfarinosa2447R CGACATCATAGACAATCATCAAGACACCGT PflorindastartF ATACCCCCTCAAAACACCCCCAAAT PflorindaestopR CTCAATATCACCCGAGAGTTTTAACAGCCT Two primers were designed to amplify the complete PfaD6D open reading frame of pMON84809. The resulting fragment was ligated into the pYES2.1-TOPO yeast expression vector giving pMON67065. The two primers are given below. Pfar F1: 5-GTCGACAACAATGTCCAACACATATCCACCAAATC -3' (SEQ ID NO: 53) Pfar R1: 5 - CCTGCAGGTCACCCCAGAGTGTTAACAGCTTC -3' (SEQ ID NO: 54) The two primers were designed to amplify the entire P-flD6D gene containing two exons and an intron of pMON84810. The resulting fragment was ligated into the pYES2.1-TOPO vector giving pMON67067. The two primers are given below. Pw F1: 5'-GTCGACAIGGCTAACAAATCTCAAAC -3' (SEQ ID NO: 55) Pw R2: 5'- CCTGCAGGTCACCCGAGAGT -3' (SEQ ID NO: 56) The two A6 desaturase clones encode potential polypeptides of 454 amino acids for PfaD6D (SEQ ID NO: 46) and 449 amino acids for PIID6D (SEQ ID NO: 48). These sequences have high similarity to other plant A6 desaturases (FIGURE 1), including an N-terminal cytochrome b5 domain, which is found in all front-end desaturases (Napier et al., 2003). Within the cytochrome b domain 5 the eight invariant residues characteristic of the cytochrome bs superfamily and the H-P-G-G binding heme motif are found, which have been shown to be essential for enzymatic activity (Napier et al., 1997, Sayanova et al, 1999, Sperling and Heinz 2001). Within the desaturase domain of the putative PflD6D and PfaD6D desaturases are three conserved histidine boxes that are characteristic of all membrane-bound desaturases (Shanklin et al., 1994). A distinctive feature found in all front-end desaturases is that the third histidine box contains a glutamine residue in the first position (Q-x-x-H-H) rather than a histidine (Napier et al., 1997, Napier et al., 2003, Sperling et al., 2003, Sperling et al. Heinz 2001). Example 8 intron removal Alignment of the three Primrose clones PaD6D-2 (SEQ ID NO: 22), PwD6D (SEQ ID NO: 25) and PflD6D (SEQ ID NO: 47) revealed extensive similarity between the DNA sequences. PaD6D-2 had approximately 97% identity to PwD6D and approximately 98% identity to PflD6D. PwD6D had approximately 98% identity to P-flD6D. A 2-step PCR procedure was used to remove the intron region of each gene. In summary, the procedure entails amplification of the two exons in separate PCRs, followed by a second round of PCR amplification to combine the two exons together. The same set of primers was used for each gene amplification because of the extensive similarity between the three A6 desaturase genes. Two sets of primers were designed to amplify the exon 1 of the PwD6D insert in pMON83967. The size of the amplified product was 475 base pairs and corresponded to exon 1 of PwD6D. The two primers are given below. Pw F1: 5'- GTCGACATGGCTAACAAATCTCAAAC -3' (SEQ ID NO: 55) Pw R1: 5'-GTAATGCCCAGAGTCGTGACCTATCCATCCGCACTGGATCC-3' (SEQ ID NO: 57) Exon 2 was amplified by PCR from pMON83967 using the primers shown below. The size of the amplified product was 875 base pairs. Pw F2: 5'-GATCCAGTGCGGATGGATAGGTCACGACTCTGGGCATTACCG-3' (SEQ ID NO: 58) Pw R2: 5'-CCTGCAGGTCACCCGAGAGT-3' (SEQ ID NO: 56) The amplified exon1 and exon2 products were then combined together with primers Pw F1 and Pw R2 to PCR amplify the complete ORF minus the original intron. The resulting 1350 base pair fragment was ligated into the pYES2.1-TOPO yeast expression vector giving pMON67062. Removal of the intron region of PaD6D-2 in pMON83968 and PflD6D in pMON84810 was done using the same procedure as described above for PwD6D. Exon sizes were the same as those of PwD6D. The resulting 1350 base pair combined exon fragments were ligated into the pYES2.1-TOPO yeast expression vector giving pMON67063 for PaD6D-2 and pMON67064 for P-flD6D. Example 9 Yeast Transformation and Expression The constructs pMON83950 (FIGURE 3), pMON67011 (FIGURE 2), pMON67026, pMON67062, pMON67064 and pMON67065 were introduced into the uracil-auxotrophic Saccharomyces cerevisiae strain INVSd (Invitrogen) using the S. cerevisiae EasyComp Transformation Kit (Invi-trogen). Transformants were selected on plates made of SC minimal medium minus uracil with 2% glucose. The colonies of transformants were used to inoculate 5 ml of SC minimal medium minus uracil and 2% glucose and were grown overnight at 30°C. For induction, stationary phase yeast cells were pelleted and resuspended in SC minus medium minus uracil supplemented with 2% galactose and cultured for 1 day at 25°C followed by 3 days at 15°C. When exogenous fatty acids were fed to cultures, 0.01% (v / v) of LA (A9, 12-18:2) and 0.01% of ALA (A9, 12, 15-18:3) were added with the emulsifier 0.1% (w / v) of Tergitol. Cultures were grown 1 day at 25°C followed by 3 days at 15°C and subsequently harvested by centrifugation. Cell pellets were washed once with sterile TE buffer pH 7.5 to remove medium and lyophilized for 24 h. The host strain transformed with the vector containing the LacZ gene was used as a negative control in all studies. FAMEs were prepared from lyophilized yeast pellets by transmethylation with 0.5 ml of 5% (v / v) H2SO4 in methanol containing 0.075 mg / ml of 2,6-Di-tert-butyl-4-methoxyphenol per 90 min at 90°C. FAMEs were extracted by adding 0.9 ml of 10% (w / v) NaCl and 0.3 ml of heptane. The heptane layer containing FAMEs was removed and used directly for GC as described in Example 2. The results shown in Table 7 demonstrate that the P. juliae clones pMON67011 and pMON83950, the P. alpicola clones pMON67026 and pMON67063, the P. waltonii clone pMON67062, the P. florindae clone pMON67064 and the P. farinosa clone pMON67065 exhibited A6-desaturase activity in a yeast expression system. The data in Table 8 demonstrate that each Primula clone encodes a protein with selectivity for substrate n-3 or n-6 fatty acids. Table 7: Primrose r.lnnes A6 destamrase activity in a yeast expression system. FA Gene Vector in LA* GLA* ALA* SDA* LacZ-1 LacZ 0.0 0.0 0.0 0.0 LacZ-2 LacZ 0.0 0.0 0.0 0.0 FA Gene Vector in LA* GLA* ALA* SDA* LacZ-3 LacZ - 0.0 0.0 0.0 0.0 LacZ-1 LacZ LA + ALA 23.5 0.0 20.6 0.0 LacZ medium -2 LacZ LA + ALA 20.3 0.0 16.6 0.0 LacZ-3 LacZ LA + ALA 29.1 0.0 28.0 0.0 pMON67011 P. juliae D6D-2 - 0.0 0, 0 0.0 0.0 pMON67011 P. juliae D6D-2 - 0.0 0.0 0.0 0.0 PMON67011 P. juliae D6D-2 - 0.2 0.0 0.0 0.0 pMON67011 P. juliae D6D-2 LA + ALA 18.7 6.5 12.2 8.4 PMON67011 P. juliae D6D-2 LA + ALA 14.7 5.4 9.6 7.6 pMON67011 P. juliae D6D-2 LA + ALA 18.6 5.1 14.6 8.8 pMON67026 P. alpicola D6D1 - 0.0 0.0 0.0 0.0 PMON67026 P. alpicola D6D-1 - 0.0 0.0 0.0 0, 0 pMON67026 P. alpicola D6D-1 - 0.0 0.0 0.0 0.0 PMON67026 P. alpicola D6D-1 LA + ALA 23.0 3.6 21.8 1.5 PMON67026 P. alpicola D6D-1 LA + ALA 19.1 3.7 17.9 1.5 PMON67026 P. alpicola D6D-1 LA + ALA 22.6 3.1 24.1 1.5 pMON83950 P. juliae D6D-1 - 0.0 0, 0 0.0 0.0 pMON83950 P. juliae D6D-1 - 0.0 0.0 0.0 0.0 pMON83950 P. juliae D6D-1 - 0.0 0.0 0.0 0.0 PMON83950 P. juliae D6D-1 LA + ALA 21.2 4.0 14.9 6.7 PMON83950 P. juliae D6D-1 LA + ALA 13.9 4.2 8.8 6.0 PMON83950 P. juliae D6D-1 LA + ALA 21.7 4.3 16.8 8.3 PMON67062 P. waltonii D6D - 0.0 0.0 0.0 0 .0 pMON67062 P. waltonii D6D - 0.0 0.0 0.0 0.0 pMON67062 P. waltonii D6D - 0.0 0.0 0.0 0.0 pMON67062 P. waltonii D6D LA + ALA 17.5 5 .7 12.1 7.1 pMON67062 P. waltonii D6D LA + ALA 12.8 4.8 8.6 6.0 PMON67062 P. waltonii D6D LA + ALA 20.9 5.2 16.8 8.4 pMON67063 P . alpicola D6D-2 - 0.0 0.0 0.0 0.0 pMON67063 P. alpicola D6D-2 - 0.0 0.0 0.0 0.0 FA Gene Vector in LA* GLA* ALA* SDA* medium pMON67063 P. alpicola D6D-2 - 0.0 0.0 0.0 0.0 pMON67063 P. alpicola D6D-2 LA + ALA 19.9 3.7 13 .4 6.7 PMON67063 P. alpicola D6D-2 LA + ALA 16.0 3.6 9.5 5.6 pMON67063 P. alpicola D6D2-LA + ALA 19.8 3.6 14.9 7.8 PMON67064 P florindae D6D - 0.0 0.0 0.0 0.0 pMON67064 P. florindae D6D - 0.0 0.0 0.0 0.0 pMON67064 P. florindae D6D - 0.0 0.0 0.0 0 .0 pMON67064 P. florindae D6D LA + ALA 17.4 5.6 12.0 6.9 pMON67064 P. florindae D6D LA + ALA 12.8 4.8 8.3 5.9 pMON67064 P. florindae D6D LA + ALA 17.1 4.5 14.6 8.3 PMON67065 P. farínosa D6D - 0.0 0.0 0.0 0.0 PMON67065 P. farínosa D6D - 0.0 0.0 0.0 0.0 pMON67065 P Farínosa D6D - 0.0 0.0 0.0 0.0 PMON67065 P. farínosa D6D LA + ALA 22.1 0.9 19.7 0.3 pMON67065 P. farínosa D6D LA + ALA 28.8 0.8 27.5 0.2 pMON67065 P. farínosa D6D LA + ALA 21.1 0.8 22.7 0.3 'Reported as a % of the total for all analytes included in the GC-FID chromatogram, including (16:0, 16:1, 18:0, 20:0, 20:1, 20:2, 22:0, 22 :1,22:2) Table 8: Comparison of n-3:n-6 substrate selectivities for Evening Primrose A6 desaturases. Sample Gene Vector I % conv.% conv. Ratio of GLA* to SDA* n-3:n-6 1 LacZ-1 LacZ 0.00 0.00 0.00 2 LacZ-2 LacZ 0.00 0.00 00 0.00 3 LacZ-3 LacZ 0.00 0.00 0.00 4 PMON67011 P. juliae D6D-2 25.75 40.64 1.58 5 pMON67011 P. juliae D6D-2 26.98 44.07 1 .63 6 PMON67011 P. juliae D6D-2 21.64 37.78 1.75 7 pMON67026 P. alpicola D6D-1 13.60 6.39 0.47 8 PMON67026 P. alpicola D6D-1 16.06 7.83 0.49 9 PMON67026 P. alpicola D6D-1 12.12 5.83 0.48 10 PMON83950 P. juliae D6D-1 15.82 31.14 1.97 11 pMON83950 P. juliae D6D-1 23.23 40, 72 1.75 12 PMON83950 P. juliae D6D-1 16.58 32.92 1.99 13 PMON67062 P. waltonii D6D 24.46 36.80 1.50 14 PMON67062 P. waltonii D6D 27.05 41.15 1, 52 15 PMON67062 P. waltonii D6D 19.77 33.41 1.69 16 pMON67063 P. alpicola D6D-2 15.74 33.48 2.13 17 PMON67063 P. alpicola D6D-2 18.53 36.82 1.99 18 pMON67063 P. alpicola D6D-2 15.37 34.39 2.24 19 PMON67064 P. florindae D6D 24.34 36.72 1.51 20 pMON67064 P. florindae D6D 27.29 41.56 1.52 21 PMON67064 P florindae D6D 20.96 36.13 1.72 22 pMO N67065 P. farinosa D6D 4.07 1.25 0.31 23 PMON67065 P. farinosa D6D 2.77 0.79 0.29 24 PMON67065 P. farinosa D6D 3.70 1.09 0.29 * Percent conversion to GLA was calculated by dividing the value for GLA (Table 1) by the sum of the values ​​for LA and GLA (Table 1). The same calculation was done for SDA using the sum of ALA and SDA (Table 1). ** The n-3:n-6 ratio was calculated by dividing the % conv. of SDA by % of conv. of GLA. Example 10 Cloning, Transformation and Expression of Arabidopsis After confirming the activity of Primula A6 desaturases in yeast, the genes were then cloned into pMON73273 (a binary vector containing the constitutive 35S CaMV promoter) for expression in A-rabidopsis thaliana to determine in planta activity. PwD6D and PaD6D-2 were cloned with intact introns. The following vectors were transformed into Arabidopsis: pMON83961 (MaD6D) (FIGURE 8), pMON83962 (PjD6D-1) (FIGURE 9), pMON83963 (PaD6D-2) (FIGURE 10), pMON84964 (PjD6D-2) (FIGURE 11), pMON84965 (PaD6D-1) (FIGURE 12) and pMON83966 (PwD6D) (FIGURE 13). Arabidopsis plants were grown by sowing seeds in 10.16 cm (4 inch) pots containing MetroMix 200 saturated with water in reverse osmosis (ROW) (The Scotts Company, Columbus, OH). The plants were vernalized by placing the pots in a flat covered cultivation chamber between 4 and 7°C, 8 hours light / day for 4 to 7 days. The plans were transferred to a cultivation chamber at 22°C, 55% relative humidity and 16 hours of light / day at an average intensity of 160 to 200 pEinstein / s / m 2 . The cover was lifted and slid 2.54 cm (1 inch) after germination and then removed when true leaves had formed. Plants were bottom watered as needed with ROW until 2 to 3 weeks after germination. The plants were then bottom watered, as needed, with a solution of Plantex 15-15-18 (Plantex Corporation Ottawa, Canada) at 50 ppm N 2 . Pots were thinned so that 1 plant remained per pot 2 to 3 weeks after germination. Once the plants began to curl, the primary inflorescence was cut to encourage the growth of axillary shoots. Transgenic Arabidopsis thaliana plants were obtained as described by Bent et al. Science, 265: 1856 to 1860, 1994 or Bechtold et al., C. R. Acad. Sci, Life Sciences, 316: 1194 to 1199, 1993. Cultures of the ABI strain of Agrobacterium tumefaciens containing one of the trans- pMON69804, pMON69812 or pMON69815 formation were grown overnight in LB (10% bacto-tryptone, 5% yeast extract and 10% NaCI with kanamycin (75 mg / l), chloramphenicol (25 mg / l) and spectinomycin ( 100 mg / l) The bacterial culture was centrifuged and resuspended in 5% sucrose + 0.05% Silwet-77 solution. The aerial portions of whole Arabidopsis thaliana Columbia plants (at about 5 to 7 weeks of age) were immersed in the resulting solution for 2 to 3 seconds. Excess solution was removed by drying the plants on paper towels. The immersed plants were placed on their side on a covered plane and transferred to a cultivation chamber at 19° C. After 16 to 24 hours the dome was removed and the plants were placed in an upright position. When the plants reached maturity, water was denied for 2 to 7 days prior to seed harvest. The harvested seed was passed through a stainless steel mesh sieve ((16 holes / cm) 40 holes / inch) to remove the fragments. The harvested seeds described above were sown in plans containing MetroMix 200 saturated with ROW (The Scotts Company). The plants were seeded and germinated as described above. After the true leaves emerged, the seedlings were sprayed with Roundup to select how many transformed plants. The fatty acid composition of mature seed (R2) was determined by GC analysis of methyl ester-derived lipids as done above for soybean seed. The values ​​for the pooled seeds of each transgenic event are shown in Table 9. The n-3 or n-6 substrate selectivities that were observed in the yeast assays were confirmed in planta. Table 9 Arabidopsis Seed Fatty Acid Analysis Gene Line Construct PA SA OA LA GLA ALA SDA MaD6D At S54435:@ PMON83961 7.47 3.73 14.18 26.31 2.3 17.3 0.72 MaD6D At S54436:@ PMON83961 7.44 3.91 14 .72 25.51 1.72 18.57 0.44 MaD6D At S54437:@ PMON83961 7.65 3.72 14.51 28.49 0.37 17.97 0 Gene Line Construct PA SA CA .A 3LA ALA SDA MaD6D At S54438:@ pMON83961 7.65 3.53 13.55 25.48: 2.09 19.18 3.87 MaD6D At S54439:@ pMON83961 7.7 3, 51 13.691 27.81 1.63 17.0711 3.45 MaD6D At S54440:@ PMON83961 7.38 3.55 14.42 25.95 1.6 18.26 3.53 MaD6D At S54441:@ pMON83961 7.24 3.54 13.53 24.24 4.4 17.68 1.52 MaD6D At S54442:@ pMON83961 7.29 3.6 14.7 25.31 3.58 16.45 0.98 MaD6D At S54443:@ PMON83961 7.01 3.61 14.46 27.25 0.44 18.49 0 MaD6D At S54444:@ pMON83961 7.68 3.75 14.34 27.89 1.19 17.95 0.05 PjD6D-1 At S54446:@ PMON83962 7.5 3.34 13.52 25.05 2.06 13.81 5.93 PjD6D-1 At S54447:@ PMON83962 7.29 3.15 14.03 26.18 1.64 14 5.25 PjD6D-1 At S54448:@ pMON83962 7.2 3.08 13.37 27.24 0.49 17 2.72 PjD6D-1 At S54449:@ PMON83962 7.24 3.17 14.28 27.52 0.46 16.65 2.44 PjD6D-1 At S54450:@ PMON83962 7.24 3.18 13.38 26.3 1.32 15.16 4.92 PjD6D-1 At S54451:@ PMON83962 7.53 3 .04 14.49 28.01 1.8 13.03 4.79 PjD6D-1 At S54452:@ pMON83962 7.59 3.44 13.16 25.54 1.72 13.3 6.69 PJD6D-1 At S54453:@ PMON8396 2 7.22 3.21 14.05 26.72 1.14 14.35 4.48 PjD6D-1 At S54454: pMON83962 6.98 3.23 13.48 25.12 2.27 12.62 6, 55 PjD6D-1 At S54455:@ PMON83962 7.34 3.18 14.63 27.07 0.16 18.57 1.1 PjD6D-1 At S54456:@ PMON83962 7.26 3.44 15.8 27.83 0.5 15.81 2.45 PjD6D-1 At S54457:@ PMON83962 7.41 3.11 14.03 27.39 1.92 12.97 4.95 PjD6D-1 At S54458:@ PMON83962 7.2 3 .26 13.38 26.18 1.31 14.54 5.1 PjD6D-1 At S54459:@ PJD6D-1 At S54460:@ PMON83962 7.21 3.19 13.48 26.35 1.32 14.36 5.16 PjD6D-1 At S54461 pMON83962 7.18 3.34 13.5 26.64 0.79 15.65 3 .96 PjD6D-1 At S54462:@ pMON83962 7.11 3.15 13.88 27.28 1.12 15.02 3.84 PID6D-1 At S54463:@ nM0N83962 7 4 3 19 13 27 26 35 0 81 17 58 2 93 PjD6D-1 At S54464:@ PMON83962 7.57 3.34 13.72 26.12 1.24 15.26 4.69 PaD6D-2 At S54466:@ PMON83963 7.25 3.18 14.44 26 .54 1.46 14.44 4.45 PaD6D-2 At S54467:@ PMON83963 7.28 3.07 14.66 27.82 0.31 17.25 1.59 PaD6D-2 At S54468:@ pMON83963 7, 34 3.22 15.05 26.37 2.01 13.14 (4.86 PaD6D-2 At S5446 9:@ pMON83963 6.91 2.94 14.35 26.77 1.32 14.33 (4.38 Gene Line Construct PA SA OA LA GLA ALA SDA PaD6D-2 At S54470:@ pMON83963 7.36 3.26 13.31 27.8 1.36 13.39 4.52 PaD6D-2 At S54471:@ PMON83963 7.14 3.07 14.38 25.73 3.26 11.32 6.18 PaD6D-2 At S54472:@ PMON83963 7.67 3.28 14.01 27.82 0 19.54 0.3 PaD6D-2 At S54473 :@ pMON83963 7.48 3.27 13.95 26.26 2.12 13.24 5.57 PaD6D-2 At S54474:@ PMON83963 7.22 3.01 14.95 27.87 1.02 14.5 3.48 PaD6D-2 At S54475:@ pMON83963 7.44 3.07 13.33 26.46 1.58 14.27 5.24 PaD6D-2 At S54476:@ PMON83963 7.35 3.17 14.22 27 .48 0.8 15.51 3.25 PaD6D-2 At S54477:@ PMON83963 8.01 2.7 15.85 30.18 0 16.8 0 PaD6D-2 At S54478:@ pMON83963 7.45 3.05 13.47 27.48 0.13 19.53 0.84 PaD6D-2 At S54479:@ PMON83963 7.14 2.99 15.32 27.71 0.24 17.74 0.9 PaD6D-2 At S54480: @ PMON83963 7.37 3.1 14.8 27.87 0.07 18.64 0.45 PaD6D-2 At S54481: @ PMON83963 7.39 3.2 13.49 27.32 0.1 19.9 0 .6 PaD6D-2 At S54482:@ pMON83963 7.29 3.1 13.72 27.63 0.25 17.96 1.63 PaD6D-2 At S54483:@ pMON83963 7.04 2.97 15.2 28, 08 0 18.71 0.1 PaD6D-2 At S54484:@ pMON839 63 7.09 2.89 14.89 28.18 0.05 19.73 0 PaD6D-2 At S54485:@ PMON83963 7.17 2.93 15.33 27.21 1.52 13.48 4.57 PjD6D -2 At S54487:@ pMON83964 7.18 3.06 14.91 27.66 0.79 15.58 3 PjD6D-2 At S54488:@ PMON83964 7.36 3.09 14.13 27.75 1.34 14 .21 4.15 PjD6D-2 At S54489:@ PMON83964 7.48 2.9 13.86 27.52 0.6 16.94 2.95 PjD6D-2 At S54490:@ pMON83964 7.39 3.08 14, 12 27.93 0.63 16.23 2.88 PjD6D-2 At S54491:@ PMON83964 7.35 3.05 15.03 28.07 0 19.04 0.16 PjD6D-2 At S54492:@ PMON83964 7, 59 3.07 14.84 27.99 0 19.18 0.33 PjD6D-2 At S54493:@PMON83964 7.36 2.97 13.57 28.18 0.68 16.38 2.96 PjD6D-2 At S54494:@ PMON83964 7.39 3.03 13.37 27.5 0.98 15.71 3.96 PjD6D-2 At_S54495:@ pMON83964 7.46 2.98 13.59 26.97 1.02 16.11 3.83 PjD6D-2 At_S54496:@ pMON83964 7.65 3.02 14.54 27.83 0.35 17.43 1.87 PjD6D-2 At_S54497:@ pMON83964 7.62 2.94 13.64 28.44 0.89 15.27 3.61 PjD6D-2 At S54498:@ pMON83964 7.55 3.06 14.06 27.53 1.01 14.89 4.37 PjD6D-2 At S54499:@ pMON83964 7.19 3 .12 14.62 26.77 1.55 13.28 5.14 PjD6D-2 At S54500:@ pM ON83964 7.42 2.9 13.83 27.84 0.39 17.55 2.3 Gene Line Construct PA SA DA LA GLA ALA SDA PjD6D-2 At S54501:@ PMON83964 7.51 3.09 14.23 28.21 3 19.5 3.1 PjD6D-2 At S54502:@ pMON83964 7.41 3 13 .56k 27.41( 3.81 16.36( 3.33 PjD6D-2 At S54503:@ pMON83964 7.33 2.95 13.46 26.74 1.09 15.92 4.28 PaD6D-1 At S54505 :@ PMON83965 7.24 2.97 14.25 27.24 0.96 19.3 3.21 PaD6D-1 At S54506:@ pMON83965 7.37 3.12 14.25 26.81 1.26 19.08 0.24 PaD6D-1 At S54507:@ PMON83965 7.48 3.03 15.61 26.86 0.52 18.75 0.09 PaD6D-1 At S54508:@ pMON83965 7.61 3.07 13.41 25 .28 2.2 19.67 0.51 PaD6D-1 At S54509:@ PMON83965 7.33 3.24 14.21 25.71 2.32 18.64 0.48 PaD6D-1 At S54510:@ PMON83965 7, 66 3.09 15.86 24.84 1.1 18.88 0.23 PaD6D-1 At S54511:@ PMON83965 7.55 3.08 15.2 25.25 0.94 19.36 0.21 PaD6D- 1 At S54512:@ pMON83965 7.43 3.16 13.51 26 1.37 19.63 0.29 PaD6D-1 At S54513:@ PMON83965 8.11 3.3 14.94 24.33 0.45 20, 26 0.12 PaD6D-1 At S54514:@ pMON83965 7.35 3.14 14.18 26.35 1.36 19.27 0.36 PaD6D-1 At S54515:@ PMON83965 7.52 2.95 12.14 26.65 0.63 22.45 0.21 PaD6D-1 At S 54516:@ PMON83965 7.86 3.29 15.13 23.72 0.74 20.03 0.21 PaD6D-1 At S54517:@ PMON83965 7.2 3.49 15.25 27.77 0.26 18, 140 PaD6D-1 At S54518:@ pMON83965 7.17 2.81 15.7 23.13 0.06 20.40 PaD6D-1 At S54519:@ PMON83965 6.9 3.07 15.34 26.65 0 .14 ​​19.19 0 PaD6D-1 At S54520:@ PMON83965 8.64 3.7 15.97 20.96 0.97 18.39 0.28 PaD6D-1 At S54521:@ PMON83965 7.2 3.19 13 .39 26.03 1.63 19.36 0.32 PaD6D-1 At S54522:@ pMON83965 8.77 3.69 15.83 20.94 0 18.92 0 PaD6D-1 At S54523:@ PMON83965 7.43 3.33 14.1 26.94 0.23 19.93 0 PwD6D At S54524: @ PMON83966 7.37 3.17 15.27 25.68 2.72 13.22 4.36 PwD6D At S54525: @ PMON83966 7 .15 3.38 14.38 25.61 2.86 12.9 4.82 PwD6 D At CtRAROK / Q pMON83966 R 77 R ~ J - 14 RR . . , — — 27.25 0.23 17 54 1.19 PwD6D At S54527:@ PMON83966 7.01 3.45 15.06 26.18 1.43 14.72 3.88 PwD6D At S54528:@ PMON83966 7.21 3, 04 14.6 27.87 0.11 18.52 0.65 PwD6D At S54530:@PMON83966 7.59 3.17 15.34 21.81 0.77 17.64 2.92 PwD6D At S54531:@PMON83966 7 .4 3.58 14.39 26.71 0.4 17.68 11.74 PwD6D At S54532:@ PMON83966 6.28 3.44 14.76 24.09 2.51 12.87 '6.1 Gene Line Construct PA SA OA LA GLA ALA SDA PwD6D At S54533:@ pMON83966 7.01 3.48 14.15 25.54 2.01 12.98 5.54 PwD6D At S54534:@ pMON83966 7.35 3.35 14 .6 26.37 2.25 13.61 4.32 PwD6D At S54535:@ pMON83966 7.24 3.56 14.59 27.04 0.45 17.02 2.17 PwD6D At S54536:@ pMON83966 7.22 3.54 13.14 25.92 1.49 15.35 4.53 PwD6D At S54537:@ pMON83966 7.18 3.6 13.51 26.27 1.61 15.03 4.02 PwD6D At S54538:@ pMON83966 7.75 3.29 13.57 25.43 2.33 13.96 5.35 PwD6D At S54539:@ PMON83966 7.15 3.13 14.86 26.63 0.16 18.99 0.35 PwD6D At S54540:@ PMON83966 7.66 3.28 14.22 26.2 0.97 16.45 3.24 PwD6D At S54541:@ pMON83966 7.39 2.98 13.83 27.29 0 20.28 0 PwD6D At S54542:@ PMON83966 7.39 3.32 14.71 26.08 1.56 14 4.18 control At S54543:@ pMON26140 6.82 3.04 14.82 25.91 0 20.07 0 control At S54544 :@ pMON26140 7.49 3.23 13.69 27.33 0 19.77 0 control At S54545:@ pMON26140 7.32 3.23 15.05 27.47 0 18.6 0 control At S54546:@ pMON26140 7 .52 3.3 13.73 27.15 0 19.86 0 control At S54547:@ pMON26140 7.44 3.21 14.21 27.43 0 19.36 0 control At S54548:@ PMON26140 7.39 3.25 14.1 27.05 0 19.59 0 control At S54549:@ pMON26140 7.71 3.28 13.61 27.98 0 20 0 control At S54550:@ pMON26140 7.62 3.24 13.58 28.28 0 18.83 0 control At S54551:@ pMON26140 7.52 3.18 14.73 27.27 0 19.78 0 control At S54552:@ PMON26140 7.44 3.21 14.95 27.69 0 18.43 0 control At S54553:@ pMON26140 7.72 3.26 13.74 27.2 0 19.94 0 control At S54554:@ pMON26140 7.3 3.11 15.09 27.73 0 18.75 0 control At S54555:@ pMON26140 7.44 2.99 14.51 29.21 0 18.34 0 control At S54556:@ pMON26140 7.52 3.19 15 .22 27.24 0 18.92 0 control At S54557: @ pMON26140 7.49 3.07 14.6 28.87 0 18.17 0 control At S54558: @ pMON26140 7.45 3.11 14.72 27, 88 0 18.88 0 control At S54559: @ pMON26140 7.63 3.26 14.39 27.12 0 19.57 0 control At S54560: @ PMON26140 7.74 3.15 13.17 28.5 0 19, 61 0 control At S54561: @ PMON26140 7.39 3.15 14.34 27.06 0 19.42 0 control At S54562: @ PMON26140 7.25 3.12 15.78 27.96 0 17.93 0 Gene Line Construct PA SA OA LA GLA ALA SDA control At S54563:@ PMON26140 7.59 3.24 14.32 27.2 0 19.54 0 control At S54564:@ pMON26140 6.73 2.82 16.17 26, 66 0 18.63 0 control At S54565: @ PMON26140 7.2 3 15.14 27.78 0 18.66 0 control At S54566: @ pMON26140 7.33 3.16 14.6 27.28 0 19.26 0 Example 10 Canola Transformation and Expression The vectors pMON83961, pMON83962, pMON83963 and pMON83964 described in Example 9 were also transformed into Canola according to the methods in Example 4. pMON70500 was included as a negative control. The fatty acid composition of the leaves was determined by GC analysis of methyl ester-derived lipids. The data are shown in Table 10. Once again the substrate selectivities observed in yeast and Arabidopsis were confirmed. Table 10 Fatty Acid Analysis of Canola Leaf Fabric Event Construction PA SA OA LA GLA ALA SDA BN G8912 PMON70500 11.64 0.63 0.39 10.68 0 53.2 0 BN G8913 PMON70500 12.31 0.79 0.57 11.93 0 53.87 0 BN G8914 PMON70500 16.59 1.72 2.09 20.81 0 47.72 0 BN G8915 PMON70500 11.74 0.82 0.27 7.86 0 58.66 0 BN G8918 PMON70500 10.14 0.59 0, 35 11.18 0 52.94 0 BNG8919 PMON70500 10.47 0.75 0.43 13.63 0 50.63 0 BN G8925 PMON70500 11.3 0.72 0.51 13.69 0 50.95 0 BN G8926 PMON70500 11.61 0.84 0.77 15.8 0 49.08 0 BN G8928 PMON70500 10.93 0.69 0.63 16.22 0 49.41 0 BN G8929 PMON70500 15.53 2.06 2.18 13.04 0 47.53 0 BN G9007 PMON83961 14.54 1.83 2.23 11.27 3.3 46.08 1.5 BNG9008 pMON83961 16.91 2.38 1.41 10.26 3.81 46 .21 2.01 BN G9009 pMON83961 17.11 1.86 3.04 16.21 0.48 47.15 0.23 BN G9011 PMON83961 18.45 2.27 3.2 19.45 7.25 37.69 1.95 BNG9013 PMON83961 17.95 2.39 2.66 20.5 1.29 44.84 0.37 BN G9014 pMON83961 16.65 1.94 1.83 12 4.73 42.26 2.79 BN G9033 pMON83962 16.89 2.23 1.16 16.35 0 50.45 2.52 BN G9034 pMON83962 15.83 2.16 1.64 15.89 0 50.66 1.11 BN G9035 pMON83962 16.36 3.18 2.74 p3 0 40.73 3.14 BN G9036 PMON83962 17.01 2.65 2.4 21, 09 0.37 41.23 5.12 BN G9037 pMON83962 16.08 2.64 1.82 17.68 0.17 44.39 3.29 BN G8828 pMON83963 13.18 1.32 2.58 14 0.15 47.07 4.1 BN G8829 pMON83963 11.56 1.34 1.42 12.07 0.66 37.31 7.55 BN G8830 PMON83963 12.49 1.37 1.31 12.24 0.31 41, 45 5.87 BN G9020 pMON83963 16.66 2.54 4.3 23.54 1.42 41.6 0 BN G9021 pMON83963 16.72 1.91 2.01 14.58 0 47.55 1.36 BN G9024 pMON83964 18.32 2.63 2.14 25.17 0.63 37.29 5.34 BN G9025 pMON83964 18.41 2.42 3.16 26.57 0 39.23 0.51 BN G9026 pMON83964 12.23 1.53 1.8 15.08 0.14 42.48 2.99 All compositions and methods disclosed and claimed herein can be made and performed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that variations can be applied to the compositions and methods and in the steps or sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related can be substituted in place of the agents described herein although the same or similar results are obtained. All such substitutes and similar modifications evident to those skilled in the art are considered to be within the spirit, scope and concept of the invention as defined by the appended claims. REFERENCES The references listed below are hereby incorporated by reference to the extent that they supplement, explain, provide a foregoing •: *: : •* : •* 74 assignor or disclose the methodology, techniques and / or compositions used herein. U.S. Patent 4,826,877 U.S. Patent 4,910,141 U.S. Patent 5,011,770 U.S. Patent 5,158,975 U.S. Patent 5,302,523 U.S. Patent 5,378,619 U.S. Patent 5,384,253 U.S. Patent 5,464,765 U.S. Patent 5,538,877 U.S. Patent 5,538,880 U.S. Patent 5,550,318 U.S. Patent 5,563,055 U.S. Patent 5,591,616 U.S. Patent 5,952,544 U.S. Patent 6,603,061 Ausubel et al., In: Current Protocols in Molecular Biology, Green Publishing Assoc., NY, 1994. Baerson et al., Plant Mol. Biol., 22(2): 255 to 267, 1993. Bevan et al., Nucleic Acids Res., 11(2): 369 to 385, 1983. Bevan, Nucleic Acids Res., 12: 8111, 1984. Bustos et al., J. Bacteriol., 174: 7525 to 7533, 1991. Bustos, et al., Plant Cell, 1(9): 839 to 853, 1989. Callis et al., Genes Dev., 1: 1183 to 1200, 1987. Chen et al., Proc. natl. academy Sci. USA, 83: 8560 to 8564, 1986. Chou and Fasman, Adv. Enzymol.. 47: 45 to 148. 1978. de Deckerer, Eur. J. Clin. Nutr., 52: 749, 1998. Garcia-Maroto et al., Lipids, 37 (4), 2002 Gelvin et al., In: Plant Molecular Biology Manual, 1990. Goeddel, In: Methods in Enzymology, Perbal (Ed.), Academic Press, John Wiley and Sones, 185, 1988. Hamilton et al., Proc. natl. academy Sci. USA, 93(18): 9975 to 9979, 1996. Hong et al., Plant Mol. Biol., 34(3): 549 to 555, 1997. Horrobin et al., Am. J. Clin. Nutr., 57(Suppl): 732S to 737S, 1993. Horsch et al., Science, 227: 1229, 1985. Huang, Biochem. Biophys. Minutes, 1082: 319, 1991. James et al., Semin. Arthritis Rheum., 28: 85, 2000. Kaeppler et al., Plant Cell Reports, 9: 415 to 418, 1990. Koncz and Shell, Mol. Gen. Genet., 204: 383 to 396, 1986. Kridl et al., Seed Sci. Res., 1: 209: 219, 1991. Kyte and Doolittle, J. Mol. Biol., 157: 105 to 132, 1982. Manzioris et al., Am. J. Clin. Nutr., 59:1304, 1994. Michaelis et al., Ann. Rev. Microbiol., 36: 425, 1982. Napier et al., Biochem. J., 328, 717 to 720, 1997. Napier et al., Prostaglandins Leukot. Essence Fatty Acids, 68 (2), 135 to 143, 2003. Naylorectal., Nature, 405: 1017, 2000. Omirulleh et al., Plant Mol. Biol., 21(3): 415 to 428, 1993. PCT Order US03 / 16144 PCT Application WO 96 / 33155 PCT Application WO 03 / 06870 Pedersen et al., Cell, 29: 1015 to 1026, 1982. Potrykus et al., Mol. Gen. Genet, 199(2): 169 to 177, 1985. Potrykus et al., Mol. Gen. Genet., 199: 183 to 188, 1985. Radke et al., Plant Cell Reports, 11: 499 to 505, 1992. Reed et al., Plant Physiol., 122: 715 to 720, 2000. Riggs, et al., Plant Cell, 1(6): 609 to 621, 1989. Russell et al., Transgenic Res., 6(2): 157 to 168 Sambrook et al., In: Molecular cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001. Sayanova et al., FEBS Let., 542: 100 to 104, 2003. Sayanova et al., Plant Physiol., 121, 641 to 646, 1999. Shanklin et al., Biochemistry 33, 12787 to 12794, 1994. Simopoulos et al., Am. Col. Nutr., 18: 487, 1999. Slocombe et al., Plant Physiol., 104(4): 167 to 176, 1994. Sperling and Heinz, Eur. J. Lipid Sci. Technolo., 103, 158 to 180, 2001. Van den Broeck et al., Nature, 313: 358, 1985. Vasil et al., Plant Physiol., 91:1575 to 1579, 1989. Wolk et al., Proc. natl. academy Sci. USA, 1561 to 1565, 1984. Yamazaki et al., Biochem. Biophys. Acta, 1123:18, 19992. SEQUENCE LISTING <110> Ursin, Virginia Froman, Byron Gonzales, Jennifer LaRosa, Thomas J. Screen, Steven E. Dong, Fenggao <120> FATTY ACID DESATURASES FROM PRIMULA <130> MONS:044WO <160> 60 <140> UNKNOWN <141> 2004-08-20 <140> 60 / 496,751 <141> 2003-08-21 <170> Patentin version 3.1 <210> 1 <211> 1953 <212> DNA <213> Primula juliae <400> 1 tatatatata tatatatata atcccaaaca aacactgtca cttgcaaaac aaactcaacc 60 cacgtactt atcccttttc cccaaaatgg aaaacacatt ttcaccacca cctactaaca 120 ccaattccaa ccccatgact aagaccattt acataaccag ctcagaactt gaaaaacata 180 acaagccagg tgacctatgg atatcaattc acggtcaagt ttacgacgtt tcttcctggg 240 ctgcgcttca cccggggggc atcgctcccc tcctcgccct tgcaggacat gatgtgaccg 300 acgctttcct cgcttaccat ccccctycca cctcccgcct cctccctccc ttctccacca 360 acctacttct agaaaaacat tccgtgtccg agacctcttc cgactatcgc aaacttctag 420 acagctttca taagatgggc atgtttcgtg ccaggggcca cactgcctac gcgacctttg 480 tcattatgat acttatgttg gtttcctctg tgactggggt gctttgcagt gagaatccgt 540 gggtgcattt ggtttgtgga gcggcaatgg ggtttgcctg gatccagtgc ggatggatag 600 gtcatgattc cggacattac cggataatga ctgacaggaa atggaaccgg ttcgctcaga 660 tcctgagctc aaactgcctc caagggatta gtatcgggtg gtggaagtgg aaccacaacg 720 cgcaccacat tgcctgcaat agtctggagt acgaccctga cctccagtac attcccttgt 780 tggttgfgtc cccgaagttc tttaactccc tcacttctcg-'tttctacgac aagaagctga 840 acttcgacgg tgtgtcgagg tttttggttc aataccagca ctggtcgttt tatccggtca 900 tgtgtgttgc taggctgaac atgcttgcgc agtcgtttat actgcttttt tcgaggaggg 960 aggtggcgaa cagggtgcag gagattcttg gactagcggt tttttggctt tggtttccgc 1020 tcctgctttc ttgccttcct aattggggtg agagaataat gtttttgctc gcgagctact 1080 ccgttacggg gatacaacac gtgcagttca gcttgaacca tttctcatct gacgtttacg 1140 tgggcccacc cgtaggtaac gattggttta agaaacagac tgcagggaca ctcaacatat 1200 cgtgcccggc gtggatggat tggttccacg gtggattgca gtttcaggtc gagcaccact 1260 tgttcccgcg gatgcctagg ggtcagtttc ggaagatttc tccttttgtg agggatttgt 1320 gtaagaaaca caatttgact tacaatattg cgtcttttac taaagcaaat gtgttgacgc 1380 ttgagaccct gagaaacaca gccattgagg ctcgggacct ctctaatccg atcccaaaga 1440 atatggtgtg ggaggctgtt aaaaatgtcg ggtgaaattg actatgtgtt ttgctattgg 1500 agcttcaatt tcgtgattgt cgtttaaggg ggtatacaca atcaccagat aatcaaacgt 1560 tttctgttgt atttcgttct tgttatttac atttgtagag tggctcatgt aactgacttg 1620 tgtcgaatcg ttaagcctaa attackagtgt aacaatttag tttctgtcca atttgagaaa 1680 tagaaaagtt tggttgagcc ttttttttct tctaatttct tcaacaggct tattgagtgc 1740 cttatttgcc acatacttaa gcgaaatgct ccaagtgcgc tagccgcaga tgtataaatt 1800 gtctttttcg gcttcaagtt ttaactgtat aacgtcattt cggcttatcg taatggttca 1860 aattagctgc ttttgttttg acaattgtcc taagcaggca ctgatcaaca ctatcagttg 1920 ttctttccct ggtaaaaaag aactgttgaa ttt 1953 <210> 2 <211> 1341 <212> DNA <213> Primula juliae <400> 2 atgactaaga ccatttacat aaccagctca gaacttgaaa aacataacaa gccaggtgac 60 ctatggatat caattcacgg tcaagtttac gacgtttctt cctgggctgc gcttcacccg 120 gggggcatcg ctcccctcct cgcccttgca ggacatgatg tgaccgacgc tttcctcgct 180 taccatcccc cttccacctc ccgcctcctc cctcccttct ccaccaacct acttcragaa 240 aaacattccg tgtccgagac ctcttccggc tatcgcaaac ttctagacag ctttcataag 300 atgggcatgt ttcgtgccag gggccacact gcctacgcga cctttgtcat tatgatactt 360 atgttggttt cctctgtgac tggggtgctt tgcagtgaga atccgtgggt gcatttggtt 420 tgtggagcgg caatggggtt tgcctggatc cagtgcggat ggataggtca tgaitccgga 480 cattaccgga taatgactga caggaaatgg aaccggttcg ctcagatcct gagctcaaac 540 tgcctccaag ggattagcat cgggtggtgg aagtggaacc acaacgcgca ccacattgcc 600 tgcaatagtc tggagtacga ccctgacctc cagtacattc ccttgttggt tgtgtccccg 660 aagttcttta actccctcac ttctcgtttc tacgacaaga agctgaactt cgacggtgtg 720 tcgaggtttt tggttcaata ccagcactgg tcgttttatc cggtcatgtg tgttgctagg 780 ctgaacatgc ttgcgcagtc gtttatactg cttttttcga ggagggaggt ggcgaacagg 840 gtgcaggaga ttcttggact agcggttttt tggctttggt ttccgctcct gctttcttgc 900 cttcctaatt ggggtgagag aataatgttt ttgctcgcga gctactccgt tacggggata 960 caacacgtgc agttcagctt gaaccatttc tcatctgacg tttacgtggg cccacccgta 1020 ggtaacgatt ggtttaagaa acagactgca gggacactca acatatcgtg cccggcgtgg 1080 atggattggt tccatggcgg gttgcagttt caggtcgagc accacttgtt cccgcggatg 1140 cctaggggtc agtttcggaa gatttctcct tttgtgaggg atttgtgtaa gaaacacaat 1200 ttgacttaca atattgcgtc ttttactaaa gcaaatgtgt tgacgcttga gaccctgaga 1260 aacacagcca ttgaggctcg ggacctctct aatccgatcc caaagaatat ggtgtgggag 1320 gctgttaaaa atgtcgggtg a 1341 <210> 3 <211> 1389 <212> DNA <213> Primula juliae <400> 3 atggaaaaca cattttcacc accacctact aacaccaatt ccaaccccat gactaagacc 60 atttacataa ccagctcaga acttgaaaaa cataacaagc caggtgacct atggatatca 120 attcacggtc aagtttacga cgtttcttcc tgggctgcgc ttcacccgggg gggcatcgct 180 cccctcctcg cccttgcagg acatgatgtg accgacgctt tcctcgctta ccatccccct 240 tccacctccc gcctcctccc tcccttctcc accaacctac ttctagaaaa acattccgtg 300 tccgagacct cttccgacta tcgcaaactt ctagacagct ttcataagat gggcatgttt 360 cgtgccagag gccacactgc ctacgcgacc tttgtcatta tgatacttat gttggtttcc 420 tctgtgactg gggtgctttg cagtgagaat ccgtgggtgc atttggtttg tggagcggca 480 atggggtttg cctggatcca gtgcggatgg ataggtcatg attccggaca ttaccggata 540 atgactgaca ggaaatggaa ccggttcgct cagatcctga gctcaaactg cctccaaggg 600 attagcatcg ggtggtggaa gtggaaccac aacgcgcacc acattgcctg caatagtctg 660 gagtacgacc ctgacctcca gtacattccc ttgttggttg tgtccccgaa gttctttaac 720 tccctcactt ctcgtttcta cgacaagaag ctgaacttcg acggtgtgtc gaggtttttg 780 gttcaatacc agcactggtc gttttatccg gtcatgtgtg ttgctaggct gaacatgctt 840 gcgcagtcgt ttatactgct tttttcgagg agggaggtgg cgaacagggt gcaggagatt 900 cttggactag cggttttttg gctttggttt ccgctcctgc tttcttgcct tcctaattgg 960 ggtgagagaa taatgttttt gctcgcgagc tactccgtta cggggataca acacgtgcag 1020 ttcagcttga accatttctc atctgacgtt tacgtgggcc cacccgtagg taacgattgg 1080 tttaagaaac agactgcagg gacactcaac atatcgtgcc cggcgtggat ggattggttc 1140 catggcgggt tgcagtttca ggtcgagcac cacttgttcc cgcggatgcc taggggtcag 1200 tttcggaaga tttctccttt tgtgagggat ttgtgtaaga aacacaattt gacttacaat 1260 attgcgtctt ttactaaagc aaatgtgttg acgcttgaga ccctgagaaa cacagccatt 1320 gaggctcggg acctctctaa tccgatccca aagaatatgg tgtgggaggc tgttaaaaat 1380 gtcgggtga 1389 <210> 4 <211> 446 <212> PRT <213> Prímula juliae <400> 4 Lys Thr Ile 5 Tyr Ile Thr Ser Ser 10 Glu Leu Glu Lys His 15 Asn Met 1 Thr Lys Pro Gly Asp Leu Trp Ile Ser lie His Gly Gin Vai Tyr Asp Vai 20 25 30 Ser Ser Trp Ala Ala Leu His Pro Gly Gly lie Ala Pro Leu Leu Ala 35 40 45 Leu Ala Gly His Asp Vai Thr Asp Ala Phe Leu Ala Tyr His Pro Pro 50 55 60 Ser Thr Ser Arg Leu Leu Pro Pro Phe Ser Thr Asn Leu Leu Leu Glu 65 70 75 80 Lys His Ser Vai Ser Glu Thr Ser Ser Asp Tyr Arg Lys Leu Leu Asp 85 90 95 Ser Phe His Lys Met Gly Met Phe Arg Ala Arg Gly His Thr Ala Tyr 100 105 110 Ala Thr Phe Vai lie Met lie Leu Met Leu Vai Ser Ser Vai Thr Gly 115 120 125 Vai Leu Cys Ser Glu Asn Pro Trp Vai His Leu Vai Cys Gly Ala Ala 130 135 140 Met 145 Gly Phe Ala Trp He 150 Gin Cys Gly Trp He 155 Gly His Asp Ser Gly 160 His Tyr Arg He Met Thr Asp Arg Lys Trp Asn Arg Phe Ala Gin He 165 170 175 Leu Ser Ser Asn Cys Leu Gin Gly He Ser He Gly Trp Trp Lys Trp 180 185 190 Asn His Asn Ala His His He Ala Cys Asn Ser Leu Glu Tyr Asp Pro 195 200 205 Asp Leu Gin Tyr He Pro Leu Leu Vai Vai Ser Pro Lys Phe Phe Asn 210 215 220 Ser Leu Thr Ser Arg Phe Tyr Asp Lys Lys Leu Asn Phe Asp Gly Vai 225 230 235 240 Ser Arg Phe Leu Vai Gin Tyr Gin His Trp Ser Phe Tyr Pro Vai Met 245 250 255 Cys Vai Ala Arg Leu Asn Met Leu Ala Gin Ser Phe He Leu Leu Phe 260 265 270 Ser Arg Arg Glu Vai Ala Asn Arg Vai Gin Glu He Leu Gly Leu Ala 275 280 285 Vai Phe Trp Leu Trp Phe Pro Leu Leu Leu Ser Cys Leu Pro Asn Trp 290 295 300 Gly Glu Arg He Met Phe Leu Leu Wing Ser Tyr Ser Vai Thr Gly He 305 310 315 320 Gin His Vai Gin Phe Ser Leu Asn His Phe Ser Ser Asp Vai Tyr Vai 325 330 335 Gly Pro Pro Vai Gly Asn Asp Trp Phe Lys Lys Gin Thr Ala Gly Thr 340 345 350 Leu Asnlie Ser Cys Pro Wing Trp Met Asp Trp Phe His Gly Gly Leu 355 360 365 Gin Phe Gin Vai Glu His His Leu Phe Pro Arg Met Pro Arg Gly Gin 370 375 380 Phe Arg Lys He Ser Pro Phe Vai Arg Asp Leu Cys Lys Lys His Asn 385 390 395 400 Leu Thr Tyr Asn He Ala Ser Phe Thr Lys Ala Asn Vai Leu Thr Leu 405 410 415 Glu Thr Leu Arg Asn Thr Ala He Glu Ala Arg Asp Leu Ser Asn Pro 420 425 430 He is Pro Lys Asn Met Go trp Glu Allah Go Lys ass Go gly <210> 5 <211> 462 <212> PRT <213> Primula juliae <400> 5 Met Glu Asn Thr Phe Ser Pro Pro Pro Thr Asn Thr Asn Ser Asn 15 10 15 Pro Met Thr Lys Thr 20 Tyr He Ser 25 Ser GxU Leu Glu 30 His Asn Lys Pro Gly Asp Leu Trp He Ser He His Gly Gin Vai Tyr Asp Val 35 40 45 Ser Ser Trp Ala Ala Leu His Pro Gly Gly He Ala Pro Leu Leu Ward 50 55 60 Read Ala Gly His Asp Vai Thr Asp Wing Phe Leu Ala Tyr His Pro Pro To be Thr To be Arg read read Pro Pro Ph To be Thr ass read read read Glu Lys His Ser Vai Ser Glu Thr Ser Ser Asp Tyr Arg Lys Leu Leu Asp To be Ph His met met Ph Arg Allah His Allah Wing Thr 130 Phe Va 1 Tie Met He 135 Leu Met Leu Val Ser 140 Ser Val Thr Gly Val Leu Cys Ser Glu Asn Pro Trp Val His Leu Val Cys Gly Wing Wing 145 150 155 160 Met Gly Phe Ala Trp He Gin Cys Gly Trp He Gly His Asp Ser Gly 165 170 175 His Tyr Ara He Met Thr Asp Arg Lys Trp Asn Arg Phe Ala Gin 185 190 hey Leu Ser Ser 195 Asn Cys Leu Gin Gly 200 He Ser He Gly Trp 205 Trp Lys Trp Asn His Asn Ala His His He Ala Cys Asn Ser Leu Glu Tyr Asp Pro 210 215 220 Asp Leu Gin Tyr He Pro Leu Leu Vai Vai Ser Pro Lys Phe Phe Asn 225 230 235 240 Ser Leu Thr Ser Arg Phe Tyr Asp Lys Lys Leu Asn Phe Asp Gly Vai 245 250 255 Ser Arg Phe Leu Vai Gin Tyr Gin His Trp Ser Phe Tyr Pro Vai Met 260 265 270 Cys Vai Ala Arg Leu Asn Met Leu Ala Gin Ser Phe He Leu Leu Phe 275 280 285 Ser Arg Arg Glu Vai Ala Asn Arg Vai Gin Glu He Leu Gly Leu Ala 290 295 300 Vai Phe Trp Leu Trp Phe Pro Leu Leu Leu Ser Cys Leu Pro Asn Trp 305 310 315 320 Gly Glu Arg He Met Phe Leu Leu Ala Ser Tyr Ser Vai Thr Gly He 325 330 335 Gin His Vai Gin Phe Ser Leu Asn His Phe Ser Ser Asp Vai Tyr Vai 340 345 350 Gly Pro Pro Vai Gly Asn Asp Trp Phe Lys Lys Gin Thr Ala Gly Thr 355 360 365 Leu Asn He Ser Cys Pro Ala Trp Met Asp Trp Phe His Gly Gly Leu 370 375 380 Gin Phe Gin Vai Glu His His Leu Phe Pro Arg Met Pro Arg Gly Gin 385 390 395 400 Phe Arg L ys He Ser Pro Phe Vai Arg Asp Leu Cys Lys Lys His Asn 405 410 415 Leu Thr Tyr Asn He Ala Ser Phe Thr Lys Ala Asn Vai Leu Thr Leu 420 425 430 Glu Thr Leu Arg Asn Thr Ala He Glu Ala Arg Asp Leu Ser Asn Pro 435 440 445 He Pro Lys Asn Met Vai Trp Glu Ala Vai Lys Asn Vai Gly 450 455 460 <210> 6 <211> 24 <212> DNA <213> Artificial <220> <223> Launcher <400> 6 atmagyatyg gttggtggaa rtgg <210> 7 <211> 23 <212> DNA <213> Artificial <220> <223> Launcher <400> 7 aatccaccrt graaccartc cat <210> 8 <211> 27 <212> DNA <213> Artificial <220> <223> Launcher <400> 8 cacacatgac cggataaaac gaccagt <21 0> 9 <211> 27 <212> DNA <213> Artificial <220> <223> Launcher gggaatgtac tggaggtcag ggtcgta <210> 10 <211> 27 <212> DNA <213> Artificial <220> <223> Initiator <400> 10 cgtgcagttc agcttgaacc atttctc <210> 11 <211> 27 <212> DNA <213> Artificial <220> <223> Launcher <400> 11 tgcagggaca ctcaacatat cgtgccc <210> 12 <211> 27 <212> DNA <213> Artificial <220> <223> Initiator <400> 12 gtaggttggt ggagaaggga gggagga <210> 13 <211> 27 <212> DNA <213> Artificial <220> <223> Initiator <400> 13 ggaaggggga tggtaagcga ggaaagc <210> 14 <211> 33 <212> DNA <213> Artificial <220> <223> Launcher <400> 14 gtcgacatgg aaaacacatt ttcaccacca <210> 15 <211> 33 <212> DNA <213> Artificial <220> <223> Launcher <400> 15 gtcgacatga ctaagaccat ttacataacc <210> 16 <211> 34 <212> DNA <213> Artificial <220> <223> Launcher <400> 16 cctgcaggtc accgacatt tttaacagcc <210> 17 <211> 1290 <212> DNA <213> Neurospora crassa <400> 17 Met Glu Asn Thr Phe Ser Pro Pro 1 5 Met Thr Lys Thr lie Tyr lie Thr cct 33 age 33 tccc 34 Pro Thr Asn Thr Asn Ser Asn Pro 10 15 Ser Ser Glu Leu Glu Lys His Asn 25 30 Lys Pro Gly 35 Asp Leu Trp He Ser 40 He His Gly Gin Vai 45 Tyr Asp Vai Ser Trp Wing Wing Leu His Pro Gly Gly He Wing Pro Leu Leu Wing 50 55 60 Leu Wing Gly His Asp Vai Thr Asp Wing Phe Leu Wing Tyr His Pro Pro 65 70 75 80 Ser Thr Ser Arg Leu Leu Pro Pro Phe Ser Thr Asn Leu Leu Leu Glu 85 90 95 Lys His Ser Vai Ser Glu Thr Ser Ser Asp Tyr Arg Lys Leu Leu Asp 100 105 110 Ser Phe His Lys Met Gly Met Phe Arg Wing Arg Gly His Thr Wing Tyr 115 120 125 Wing Thr Phe Vai He Met He Leu Met Leu Vai Ser Ser Vai Thr Gly 130 135 140 Vai Leu Cys Ser Glu Asn Pro Trp Vai His Leu Vai Cys Gly Wing Wing 145 150 155 160 Met Gly Phe Ala Trp He Gin Cys Gly Trp He Gly His Asp Ser Gly 165 170 175 His Tyr Arg He Met Thr Asp Arg Lys Trp Asn Arg Phe Ala Gin He 180 185 190 Leu Ser Ser Asn Cys Leu Gin Gly He Ser He Gly Trp Trp Lys Trp 195 200 205 Asn His Asn Ala His His He Ala Cys Asn Ser Leu Glu Tyr Asp Pro 210 215 220 Asp Leu Gin Tyr He Pro Leu Leu Vai Go Ser Pro Lys Phe Phe Asn 225 230 235 240 Ser Leu Thr Ser Arg Phe Ty r Asp Lys Lys Leu Asn Phe Asp Gly Vai 245 250 255 Ser Arg Phe Leu Vai Gin Tyr Gin His Trp Ser Phe Tyr Pro Vai Met 260 265 270 Cys Vai Ala Arg Leu Asn Met Leu Ala Gin Ser Phe He Leu Leu Phe 275 280 285 Ser Arg Arg Glu Go Wing Asn Arg Go Gin Glu He Leu Gly Leu Wing 290 295 300 Go Phe Trp Leu Trp Phe Pro Leu Leu Leu Ser Cys Leu Pro Asn Trp 305 310 315 320 Gly Glu Arg lie Met Phe Leu Leu Ala Ser Tyr Ser Vai Thr Gly lie Gin His Vai Gin Phe Ser Leu Asn His Phe Ser Ser Asp Vai Tyr Vai Gly Pro Pro Vai Gly Asn Asp Trp Phe Lys Lys Gin Thr Ala Gly Thr Leu Asn lie Ser Cys Pro Ala Trp Met Asp Trp Phe His Gly Gly Leu Gin Phe Gin Vai Glu His His Leu Phe Pro Arg Met Pro Arg Gly Gin Phe Arg Lys lie Ser Pro Phe Vai Arg Asp Leu Cys Lys Lys His Asn Leu Thr Tyr Asn lie Ala Ser Phe Thr Lys Ala Asn Vai Leu Thr Leu Glu Thr Leu Arg Asn Thr Ala lie Glu Ala Arg Asp Leu Ser Asn Pro lie Pro Lys Asn Met Vai Trp Glu Ala Vai Lys Asn Vai Gly 450 455 460 <210> 18 <211> 1209 <212> DNA <213> Aspergillus nidulans <400> 18 atggctgtca ctactaggtc acacaaagcc gccgctgcca ccgaacctga agttgtgtct 60 acaggagtgg atgcagtcag cgctgccgca ccaagcagta gtagctcctc atcctcccaa 120 aagtcagctg agcctatcga atatccagac atcaagacaa ttcgtgacgc tataccagac 180 cactgcttta gacctcgcgt ttggatatcc atggcgtact ttattcgcga ttttgcaatg 240 gctttcggcc tcggatactt ggcatggcaa tacatccctt tgattgcaag taccccattg 300 agatacggag cttgggcttt gtacggttac ctccagggac tcgtctgtac tggaatttgg 360 atcttggctc acgaatgcgg tcacggagcc ttttctagac acacctggtt caacaacgtt 420 atgggttgga ttggtcactc tttcctacta gtcccatatt ttagctggaa attttcccat 480 caccgtcatc ataggttcac cggacatatg gaaaaagata tggcgttcgt tccagccacg 540 gaggcggaca gaaatcagag aaaactagct aatctctata tqgacaaaga gactgcggag 600 atgttcgagg atgttcctat tgtgcagttg gttaaactaa ttgctcacca actcgccggt 660 tggcagatgt atctcttgtt caacgttagt gccggaaaag gctccaaaca gtgggaaacc 720 ggcaaaggtg gaatgggatg gctccgcgtg agccatttcg aaccaagttc agccgttttc 780 agaaacagcg aagcaattta catagctcta agcgatctcg gacttatgat tatgggatac 840 attctctacc aggcagccca agttgttgga tggcaaatgg ttggtctctt gtattttcaa 900 cagtacttct gggttcacca ttggctcgtt gccatcactt accttcatca cacacacgaa 960 gaagttcacc actttgatgc agattcttgg acatttgtta agggtgccct cgctaccgtg 1020 gacagagact tcggtttcat cggcaagcac ctcttccata acatcattga ccatcatgtt 1080 gttcatcacc tcttcccaag aatccctttc tactacgctg aagaagctac caattcaata 1140 agacctatgc tcggacctct ttaccacaga gatgaccgtt ctttcatggg gcaactctgg 1200 tacaacttca cacactgcaa atgggttgtc cctgatcctc aagtgccagg tgctctaatc 1260 tgggctcaca ccgttcagag tactcagtaa 1290 <210> 19 <211> 1290 <212> DNA <213> Neurospora crassa <400> 19 atggccgcaa ccgcgaccac tctcgctgaa atagaaaaga agaaggaaga gattacacta 60 cagacaatca agaatgccat accaaagcac tgttttaacc gtagtttgct tatttcaagt 120 gcctacgtcg tcagagacct cctctacgca tcagttttgt tctattttgc acttcatatt 180 gatacgctct tctcatccca gctccttagg atcttggcat ggacagctta cggtttcatg 240 caaggctgcg tgggaacggg tatatggata ttggcacatg aatgcggaca cggagctttt 300 agcccttacc aaacctggaa cgacgttgtt gggtggaccc ttcattctct tctcatggtc 360 ccttacttct cttggaaaat aacccacgca aggcaccaca gatatacgaa caataccgag 420 agggacacag ccttcgttcc ctggaccgag aaggaatacg acaccagacc tcgttacttc 480 cctgcatggt tcgagatgtt tgaagacaca ccagtgtata acttgatttc attgctcgcc 540 catcagatcg ccggctggca aatgtacctc tgcttctacg tctcagccgg agccaaaagt 600 aagcctgttc cacaaggcaa gcagtccgga tggtttggag gtcaacaatc tgcatcacac 660 tttgacccag gaagctctct atggaccgaa aaccagcgcc atctaatcgc aatctccgac 720 cttggactcc ttctcgtggc cgccgcgaat tggtacttgg ctcaacaagt tggtgttcta 780 agaatggtgc tcatttacgt cgtcccctac ttttgggtcc accactggct agtcgccatc 840 acgtacctcc accacactca cccãtccata ccacactaca ccgactctac ctggacattc 900 actaaaggag cactctcaac agtggatcgt gacttcggat ttataggaag gcacttcttt 960 caccacatca ttgatcacca cgtcgttcat cacttgttca ataggatacc attctatcac 1020 gcagaggaag ctactaacgc aataatacca gttctcggtg atatgtacca tagagaagaa 1080 accggattcc tctggagtct tatggaaact tataaaaact gtcgctttgt tggcgtggag 1140 aacgatgtgg gtaaggaggg agttctccat tgggttttcg aagaaaagaa aggcgctaaa 1200 gctgaatag 1209 <210> 20 <211> 1290 <212> DNA <213> Neurospora crassa <400> 20 atggcggtca ccacccgcag ccacaaggcc gcggccgcca ccgagcccga ggttgtcagc 60 accggcgttg acgccgtctc tgctgctgct ccctcctcct cctcctcctc ttccagccaa 120 aagtcggccg agcccatcga ataccccgac atcaagacca tccgcgacgc catccccgac 180 cactgcttcc gcccgcgcgt ctggatctcc atggcctact tcatccgcga cttcgccatg 240 gcctttggcc tcggctacct cgcctggcag tacatccccc tgatcgcctc caccccgctc 300 cgctacggcg cctgggctct gtacggctac ctccagggtc tcgtctgcac gggcatctgg 360 attctggcgc acgagtgcgg ccacggcgcc ttctcgaggc acacgtggtt caacaacgtc 420 atggggtgga ttggccactc cttcctcttg gtcccttact tcagctggaa gttcagccac 480 catcgccacc atcgcttcac cggccacatg gagaaggaca tggcgtttgt gcctgccacc 540 gaggctgatc gcaaccagag gaagctggcc aacttgtaca tggacaagga gacggccgag 600 atgtttgagg atgtgcccat tgtccagctc gtcaagctca tcgcccacca gctggccggc 660 tggcagatgt acctcctctt caacgtctcc gccggtaagg gcagcaagca gtgggagact 720 ggcaagggcg gcatgggctg gttgagggtt agccactttg agccttcctc tgctgtgttc 780 cgcaactccg aggccatcta cattgccctg tccgatcttg gtctcatgat catgggctac 840 atcctctacc aggccgcgca ggttgttggc tggcagatgg tgggtctgct gtacttccag 900 cagtacttct gggttcacca ttggttggtc gccatcactt acctccacca cacccacgag 960 gaagtccacc actttgacgc cgactcgtgg accttcgtca agggcgctct cgccaccgtc 1020 gaccgcgatt ttggcttcat tggcaagcac ctcttccaca acattatcga ccaccacgtc 1080 gtccaccact tgttccctcg catccccttc tactacgccg aagaagccac caactcgatc 1140 cgccccatgc tcggccccct ctaccaccgc gacgaccgct ccttcatggg ccagctgtgg 1200 cacaacttca cccaccgcaa grgggrcgtt ccggaccccc aggtccccgg cgcgcttatt 1260 tgggcgcaca ccgttcagag cacccagtaa <210> 21 <2H> 1341 <212> DNA <213> Primrose alpicola <400> 21 atggccaaca ctagttacat ttccagctca gacctcaaaa ctcataataa ggctgacgac 60 ctttggatat ccattcacgg ccaagtgtac gatgtctccg cctgggccac ccaccacccc 120 ggaggtgcct ctctcctcct cgcccttgca ggcaatgatg tcactgatgc cttcctcgcc 180 taccaccctc cctccacctg ccacctcctc cctcctcttt ctaccaacat cctcctcgaa 240 aactactccg tctcccacat ctcctccaat taccgcaacc tcctcaatca tttccacaag 300 ctcggcctat tccgtaccag ggcccacacc gctttcacta cattcttcat catgatactt 360 atgttcttta ttagtgtaac cggaatattt tgcagtgata gtttatgggt ccatttggcg 420 tgcggtggct tgatggggtt tgcatggatt caatgcggat ggatagcgca cgactctggg 480 cattaccgga taacatcaag taggaaatgg aatagattcg ctcagatcct taccggaaat 540 tgcctccagg ggttgagtat tgggtggtgg aagtggaacc ataacgccca ccacatcgct 600 tgcaatagcc tagactacga tccggacctc cagtatattc ctttattggt cgtgtccccg 660 aagtttttca actccatcac ttctcgtttt tatgataaga agctgaactt cgatggtgtg 720 tcgaggtttt tagtcagcta ccaacactgg acgttttatc cggtcatgtg tgttgctagg 780 tttaacatga ttgcacagtc ggttatacat ctcttctcga atagaaacgt gactgatagg 840 gtcctagaga ttttcggact aggggtgttc tgggtttggt attcgctcct actttcgtgc 900 cttcctgatt ggggtgagcg aataatgttt gtgattgcgt gctatttcgt tactgggata 960 caacacgtac agttcagtgt aaaccatttt tcttcggacg tatacatggg ccctccagta 1020 ggtaacgatt ggtttaaaaa acagacttcg gggacactga acatatcgtg cccaccctgg 1080 atggattggt tccacggtgg gttgcagttt caagtggagc accacttgtt cccgcggatg 1140 ccgaggggtc aattcaggaa gatctctcct tttgtaaagg atctgtgtaa taaacacaat 1200 ctgccttaca atatcgcgtc ttttaccatg gcaaacgtgt tgacgcttag gaccctaaga 1260 aatacggcca tcgaggctcg ggacctttct aatccgattc caaagaatat ggtctgggaa 1320 gctgttaaca ctctggggtg a 1341 <210> 22 <211> 446 <212> PRT <213> Primrose Peacock <400> 22 Met 1 Ala Asn Thr Ser 5 Tyr He Ser Ser Ser 10 Asp Leu Lys Thr His 15 Asn Lys Ala Asp Asp 20 Leu Trp He Ser He 25 His Gly Gin Vai Tyr 30 Asp Vai Ser Ala Trp 35 Ala Thr His His Pro 40 Gly Gly Ala Ser Leu 45 Leu Leu Ala Leu Ala 50 Gly Asn Asp Vai Thr 55 Asp Ala Phe Leu Ala 60 Tyr His Pro Pro Ser 65 Thr Cys His Leu Leu 70 Pro Pro Leu Ser Thr 75 Asn He Leu Leu Glu 80 Asn Tyr Ser Vai Ser 85 His He Ser Ser Asn 90 Tyr Arg Asn Leu Leu 95 Asn His Phe His Lys Leu Gly Leu Phe Arg Thr Arg Ala His Thr Ala Phe 100 105 110 Thr Thr Phe Phe He Met He Leu Met Phe Phe He Ser Vai Thr Gly 115 120 125 lie Phe 130 Cys Ser Asp Ser Leu 135 Trp Vai His Leu Ala 140 Cys Gly Gly Leu Met Gly Phe Ala Trp He Gin Cys Gly Trp He Ala His Asp Ser Gly 145 150 155 160 His Tyr Arg He Thr Ser Ser Arg Lys Trp Asn Arg Phe Ala Gin He 165 170 175 Leu Thr Gly Asn Cys Leu Gin Gly Leu Ser He Gly Trp Trp Lys Trp 180 185 190 Asn His Asn Ala His His lie Ala Cys Asn Ser Leu Asp Tyr Asp Pro 195 200 205 Asp Leu Gin Tyr He Pro Leu Leu Vai Vai Ser Pro Lys Phe Phe Asn 210 215 220 Ser He Thr Ser Arg Phe Tyr Asp Lys Lys Leu Asn Phe Asp Gly Vai 225 230 235 240 Ser Arg Phe Lsu Vai Ser Tyr Gin His Trp Thr Phe Tyr Pro Vai Met 245 250 255 Cys Vai Ala Arg Phe Asn Met He Ala Gin Ser Vai He His Leu Phe 260 265 270 Ser Asn Arg Asn Vai Thr Asp Arg Vai Leu Glu He Phe Gly Leu Gly 275 280 285 Vai Phe Trp Vai Trp Tyr Ser Leu Leu Leu Ser Cys Leu Pro Asp Trp 290 295 300 Gly Glu Arg He Met Phe Vai Ile Ala Cys Tyr Phe Vai Thr Gly He 305 310 315 320 Gin His Vai Gin Phe Ser Vai Asn His Phe Ser Asp Vai Tyr Met 325 330 335 Gly Pro Pro Vai Gly Asn Asp Trp Phe Lys Lys Gin Thr Ser Gly Thr 340 345 350 Leu Asn He Ser Cys Pro Pro Trp Met Asp Trp Phe His Gly Gly Leu 355 360 365 Gin Phe Gin Vai Glu His His Leu Phe Pro Arg Met Pro Arg Gly Gin 370 375 380 Phe Arg Lys He Ser Pro Phe Vai Lys Asp Leu Cys Asn Lys His Asn 385 390 395 4 00 Leu Pro Tyr Asn He Ala Ser Phe Thr Met Ala Asn Vai Leu Thr Leu 405 410 415 Arg Thr Leu Arg Asn Thr Ala He Glu Ala Arg Asp Leu Ser Asn Pro 420 425 430 He Pro Lys Asn Met Vai Trp Glu Ala Vai Asn Thr Leu Gly 435 440 4 4 5 <213> Primrose Peacock <400> 23 atggctaaca aatctcaaac aggttacata accagctcag acctgaaagg tcacaataag 60 gcaggtgatc tatggatatc aatccacggg caggtctacg acgtgtcctc gtgggccagc 120 cttcacccgg ggggcagtgc ccccctcctg gccctcgcag gacacgacgt gaccgacgct 180 ttcctcgctt accatccccc ttccaccgcc cgcctcctcc ctcccctctc cgctaacctc 240 cttctgcaac accattccgt ctcccccacc tcctccgatt accgctccct cctcaacaac 300 tttcataaac ttggtctgtt ccgcgccagg ggccacaccg cttacgcaac cttcgtcttc 360 atgatagcga tgtttgtaat gagcgtaacc ggagtgcttt ttagcgacga tgcgtggatc 420 catctggctt gcgccggagc aatggggatt gcctggatcc agtgcggatg gataggtcgg 480 tagactaatt tattagtaca tatttaatat ttaaaatacc atattcttaa atcttattta 540 aattttggta tgtatcaata tagcttaaaa caaaaagtaa aaataagtag aatgtatact 600 taaaatagat attaactatg agtttttgat aattaagatt caaattatgt actaaatgat 660 catttttcct ggataggtca cgactctggg cattaccgga tgatgtctga caggaaatgg 720 aaccggtttg cgcaaatcct gagcgcaaac tgcctccagg ggattagcat cgggtggtgg 780 aagtggaacc acaacgcaca ccacatcgct tgcaatagcc tggagtacga ccccgacctc 840 cagtatatcc ctttgctcgt tgtctcccccc aagtttttca actcccttac ttctcgtttc 900 tacaacaaga aactgaactt cgacggtgtg gcgaggttct tggtttgcta ccagcactgg 960 acgttttatc cggtcatgtg tgtcgctagg ctgaacatga tcgtgcagtc gtttataacg 1020 ctttttttga atagggaggt ggcgcatagg gcgcaagaga ttttgggact tgctgtgttt 1080 tgggtttggt ttccgctttt actttcttgc ttacctaatt ggggtgagag gataatgttt 1140 ctgcttgtga gctattccgt tacggggata caacacgtgc agttcagctt gaaccatttt 1200 tcttcggacg tctacgtggg tccgccagta ggtaacgact ggttcaagaa acagactgca 1260 gggacactta acatatcgtg cccagcgtgg atggattggt tccatggtgg gttgcaattt 1320 caggtcgagc accacttgtt cccgcggatg cctaggagtc agtttaggaa gatttctcct 1380 tttgtgaggg atttgtgtaa gaaacacaat ttgccttaca acatcgcgtc ttttactaaa 1440 gcgaatgtgt taacgcttaa gacgctgaga aatacggccg ttgaggctcg ggacctctct 1500 aatccgatcc caaagaatat ggtgtgggag gctgttaaaa ctctcgggtg a 1551 <210> 24 <211> 449 <212> PRT <213> Primrose Peacock <400> 24 Thr Ser Ser Asp Leu 15 Lys Met 1 Wing Asn Lys Ser 5 Gin Thr Gly Tyr He 10 Gly His Asn Lys 20 Wing Gly Asp Leu Trp 25 He Ser He His Gly 30 Gin Vai Tyr Asp Vai 35 Ser Ser Trp Wing Ser 40 Leu His Pro Gly Gly 45 Ser Wing Pro Leu Leu 50 Wing Leu Wing Gly His 55 Asp Vai Thr Asp Wing 60 Phe Leu Wing Tyr His 65 Pro Pro Ser Thr Wing 70 Arg Leu Leu Pro Pro 75 Leu Ser Wing Asn Leu 80 Leu Leu Gin His His 85 Ser Vai Ser Pro Thr 90 Ser Ser Asp Tyr Arg 95 Ser Leu Leu Asn Asn 100 Phe His Lys Leu Gly 105 Leu Phe Arg Ala Arg 110 Gly His Thr Ala Tyr 115 Ala Thr Phe Vai Phe 120 Met He Ala Met Phe 125 Vai Met Ser Vai Thr 130 Gly Vai Leu Phe Ser 135 Asp Asp Ala Trp He 140 His Leu Ala Cys Gly Wing Asp Ser Wing Gin Trp Lys Tyr Asp Phe Phe Asp Gly Pro Go Thr Leu Gly Leu Pro Asn Thr Gly go tyr Gly Wing Gly Gly Arg Ser Lys His read Thr be asn Met Wing Gly His lie Leu Trp Asn Pro Asp Asn Ser Go Ala Met Cys Phle Leu Ala Go Trp Gly he he gin Go Gly Thr Leu Read Gin Gin Phe Asn Leu read Lys Pro He Gly He Tyr Arg be wingman His Asn Read Gin read Thr Arg Ph Go Ala Asn Arg Phe Trp Glu Arg His Vai Pro Pro asn he Phe Gin Arg Lys Pro Tyr Thr Leu Pro Lys Trp Wing met met Asn Cys His wing Tyr He Being Arg read go Arg Leu Glu Go go trp He Met Gin Phe Go Gly be Cys Go Glu He Ser asn he Arg Asn Asn Met hey gin be Asp Read Gin His He Pro Leu Phe Tyr Cys Tyr Asn Met His wing Phe Pro Phle Leu Be Leu Asn Asp Pro Wing His His Pro Ph Wing Ser Thr Wing go trp Cys Gly Arg Lys Gly He Cys wing read go Asn Lys Gin His hey go Arg Wing Leu Leu read go Asn His Trp Ph Trp Met Read Ph Go Arg Phe Thr Go Glu Glu Wing Trp He Trp Asn be he Asn Ser Will be Lys Leu Trp Thr Gin Ser Gin Glu read Ser be tyr Phe Ser Lys Lys Asp Trp Pro Arg Asp Leu Lys Ala Gly His Arg Ph Gly Trp Leu Glu Pro Lys Asn Ph Phe Tyr Phhe He he read Wing Arg Go Lys Cys Leu be go be Asp Gin Thr Phe His Met Pro Cys Lys asn go Asp Leu Thr Leu gly <210 25 <211> <400> 25 atggctaaca aatctcaaac aggttacata accagctcag acctgaaaag ccacaataag 60 gcaggtgatc tatggatatc aatccacggg caggtctacg acgtgtcctc gtgggccagt 120 cttcacccgg ggggctctgc cccccttctg gccctcgcag gacacgacgt taccgacgct 180 ttcctcgctt accatcctcc ttccaccgcc cgcctcctcc ctcccctctc cgctaacctc 240 cttctacaac accactccgt ctcccccaca tcctccgatt accgatccct cctcaacaac 300 tttcacaaac ttggcctgtt ccgctccagg ggccacaccg cttacgccac cttcgtcttc 360 atgataacga tgtttgtaat gagcgtaacc ggagtgctct tcagcgacga tgcgtgggtc 420 catctggctt gcggcggagc aatggggatt gcctggatcc agtgcggatg gataggtcgg 480 tagagtaatt tattagtaca tatttaaaat accatattct taaatcttat ttaaattttg 540 gtatgtatca atctttttat gtactaatat atacttaaaa tagatattaa ctatgagttt 600 ttgataatta agtttcaaat tatgtactaa atgatcaatt ttcctggata ggtcacgact 660 ctgggcatta ccggatgatg tctgacagga aatggaaccg gttcgcgcaa atcctgagcg 720 caaactgcct ccaggggatt agcatcgggt ggtggaagtg gaaccacaac gcgcaccaca 780 tcgcttgcaa tagcctggaa tacgaccccg acctccagta tatccctttg ctcgtcgtct 840 cccccaaatt tttcaactcc cttacttctc gtttctacaa caagaaactg aacttcgacg 900 gtgtgtcgag gttcttggtt tgctaccagc actggacgtt ttatccggtc atgtgtgtcg 960 ctaggctgaa catgctcgtg cagtcgttta taacgctttt ttcgaatagg gaggtggcgc 1020 atagggcgca agagattttg ggacttgctg tgttttgggt ttggtttccg cttttagttt 1080 cttgcttacc taattggggt gagaggataa tgtttctgct tgtgagctat tccgtacgg 1140 ggatacaaca cgtgcagttc agcttgaacc atttttcttc ggacgtctac gtgggtccgc 1200 cagtaggtaa cgactggttc aagaaacaga ctgcagggac actgaacata tcgtgcccgg 1260 cgtggatgga ttggttccat ggtgggttgc aatttcaggt ggagcaccac ttgttcccgc 1320 ggatgcctag gagtcagttt aggaagattt ctccttttgt gagggatttg tgtaagaaac 1380 acaatttgcc ttacaacatc gcgtctttta ctaaagcgaa tgtgttgacg cttaagacgc 1440 tgagaaatac ggccgttgag gctcgggacc tctctaatcc gatcccaaag aacatggtgt 1500 gggaggctgt taaaactctc gggtga 1526 <210> 26 <211> 449 <212> PRT <213> Primrose waltonii <400> 26 Met Wing Asn Lys Ser Gin Thr Gly 1 5 Ser His Asn Lys Ala Gly Asp Leu 20 Tyr Asp Vai Ser Ser Trp Ala Ser 35 40 Leu Leu Ala Leu Ala Gly His Asp 50 55 His Pro Pro Ser Thr Wing Arg Leu 65 70 Leu Leu Gin His His Ser Vai Ser Leu Leu Asn Asn Phe His Lys Leu Thr Wing Tyr Wing Thr Phe Vai Phe 115 120 Go Thr Gly Go Leu Phe Ser Asp 130 135 Tyr lie Thr Ser Ser Asp Leu Lys 10 15 Trp He Ser He His Gly Gin Vai 25 30 Read His Pro Gly Gly Ser Wing Pro 45 Go Thr Asp Ala Phe Leu Ala Tyr 60 Leu Pro Pro Leu Ser Wing Asn Leu 75 80 Pro Thr Ser Ser Asp Tyr Arg Ser 90 95 Gly Leu Phe Arg Ser Arg Gly His 105 110 Met He Thr Met Phe Vai Met Ser Asp Ala Trp Vai His Leu Ala Cys 140 Gly 145 Gly Ala Met Glylie 150 Ala Trp He Gin Cys 155 Gly Trp He Gly His 160 Asp Ser Gly His Tyr Arg Met Met Ser Asp Arg Lys Trp Asn Arg Phe 165 170 175 Ala Gin lie Leu Ser Ala Asn Cys Leu Gin Gly He Ser He Gly Trp 180 185 190 Trp Lys Trp Asn His Asn Ala His His He Ala Cys Asn Ser Leu Glu 195 200 205 Tyr Asp Pro Asp Leu Gin Tyr He Pro Leu Leu Vai Vai Ser Pro Lys 210 215 220 Phe Phe Asn Ser Leu Thr Ser Arg Phe Tyr Asn Lys Lys Leu Asn Phe 225 230 235 240 Asp Gly Go Serg Phe Leu Vai Cys Tyr Gin His Trp Thr Phe Tyr 245 250 255 Pro Vai Met Cys Vai Ala Arg Leu Asn Met Leu Vai Gin Ser Phe He 260 265 270 Thr Leu Phe Ser Asn Arg Glu Vai Ala His Arg Ala Gin Glu He Leu 275 280 285 Gly Leu Ala Vai Phe Trp Vai Trp Phe Pro Leu Leu Vai Ser Cys Leu 290 295 300 Pro Asn Trp Gly Glu Arg He Met Phe Leu Leu Vai Ser Tyr Ser Vai 305 310 315 320 Thr Gly Tie Gin His Vai Gin Phe Ser Leu Asn His Phe Ser Ser Asp 325 330 335 Vai Tyr Vai Gly Pro Pro Vai Gly Asn Asp Trp Phe Lys Lys Gin Thr 340 345 350 Gly T Wing hr Leu Asn lie Ser Cys Pro Ala Trp Met Asp Trp Phe His 355 360 365 Gly Gly Leu Gin Phe Gin Va 1 Glu His His Leu Phe Pro Arg Met Pro 370 375 380 Arg Ser Gin Phe Arg Lys He Ser Pro Phe Vai Arg Asp Leu Cys Lys 385 390 395 400 Lys His Asn Leu Pro Tyr Asn He Ala Ser Phe Thr Lys Ala Asn Vai 405 410 415 Leu Thr Leu Lys Thr Leu Arg Asn Thr Ala Vai Glu Ala Arg Asp Leu 420 425 430 Ser Asn Pro lie Pro Lys Asn Met Vai Trp Glu Wing Vai Lys Thr Leu 435 440 445 gly <210> 27 <211> 27 <223> Description of Artificial Sequence: Synthetic Primer <400> 21 cacacatgac cggataaaac gtccagt 27 <210> 28 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 28 agggatatac tggaggtcgg ggtcgta 27 <210> 29 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 29 gagctattcc gttacgggga tacaaca 27 <210> 30 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 30 tgcagggaca cttaacatat cgtgccc 27 <210> 31 <211> 27 <212> DNA <220> <223> Description of Artificial Sequence: Synthetic Primer x to nn-x 1 V V' X gtgaaagttg ttgaggaggg atcggta 27 <210> 32 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 32 gtggaaggag gatggtaagc gaggaaa 27 <210> 33 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 33 gtcgacatgg ctaacaaatc tcaaacaggt tac 33 <210> 34 ^211^33 <212> DNA <213> Artificial Sequence <22 0> <223> Description of Artificial Sequence: Synthetic Primer cctgcaggtc accgagagt tttaacagcc tcc 33 <210> 35 <223> Description of Artificial Sequence: Synthetic Primer <400> 35 cacacattac cggataaaac gtccagt <210> 36 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 36 aggaatatac tggaggtctg ggtcgta 27 <210> 37 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 37 atttttcttc ggacgtatac atgggcc 27 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 38 ttcggggaca ctgaacatat cgtgccc 27 <210> 39 <211> 34 <212> DNA <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 39 gtcgacatgg ccaacactag ttacatttcc agct 34 <210> 40 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 40 gatatcaccc cagagtgtta acagcttccc ag 32 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 41 tggagggtctg ggtcgtaatc 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 42 cttcggacgt attackgggc 20 <210> 43 <211> 20 <212> DNA <223> Artificial Sequence Description: Synthetic Primer <400> 43 tcgtaatcca ggctattgca 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence Description: Synthetic Primer <400> 44 ttttcttcgg acgtccatgt <210> 45 <211> 1365 <212> DNA <213> Primrose farinosa <400> 45 atgtccaaca aaaacccata tccgcctggg gatgtcaccg ttctctacca aacctcctca actactttct gatagttttt ggatggatag ttcgctcaga aaccataacg attcctttat aagaagctga tatccggtaa tcaaatagaa tggtattcgc gcatgctact gacgtataca ctgaacatat gagcaccact aaggatttgt gtgttgacgc atcccaaaga catatccacc ataaacctga ccccccacca acaccttcct acatcctcct atcatttcca tcatcatgat gggtccattt cgcacgactc tccttatcgg ctcaccacat tggtagtttc acttcgacgg tgtgtgttgc aggtgcccaa tcctactttc ttgttacggg tgggccctcc cgtgcccgcc tgttcccacg gtaataaaca ttaggaccct atatggtctg aaatcccaaa agacctttgg cctcggaggt cgcctaccac cgaaaactac caagctcggc acttatgttc ggcgtgcggt tgggcattac aaattgcctc cgcttgcaat ttcaaagttt tgtgtcgagg taggtttaac tagggttcta gtgccttcct gatacaacac cgtaggtaac ctggatggat gatgccgagg caatctgcct gagaaatacg ggaagctgtt actagtcatt atatccattc gcctctctcc cctccctcca tccgtctccc ctattccgta tttctcagtg ggcttgatgg cggataacat caggggttga agcctagatt ttcaactcca ttcttagtta atggttgcac gaggttttcg gattggggcg gtacagttca gattggttta tggttccacg ggtcaattta tacaatatcg gccattgagg aacactctgg acatttccag acggccacgt tcctcgccct cctgccgcct acacctcctc caaaggccca taaccggaat ggttcgcatg caagcaggaa gtattgggtg acgacccgga tcacttctgg gctaccaaca agtcggttat gactaggcgt agcgaataat gtgtaaaccact cat aaaaacagac gtgggattgcac gtgagacc ctcagacctc gtacgatgtc cgcaggcaat tctccctcct tgactaccgc tacgactttc attttgcagt gatccaatgt atggaataga gtggaagtgg tctccagtat tttctatgat ctggacgttt acatgttttc gttctgggtt gtttgtgatt tttttcttcg tgcagggaca gtttcaaatc tccttttgta tatggctaac ttctaatccg <210> 46 <211> 454 <212> PRT <400> 46 Met 1 Ser Asn Thr Tyr 5 Pro Pro Asn Pro Lys 10 Thr Ser His Tyr He 15 Ser Ser Ser Asp Leu Lys Thr His Asn Lys Pro Glu Asp Leu Trp He Ser 20 25 30 lie His Gly His Vai Tyr Asp Go Ser Ala Trp Ala Pro His His Leu 35 40 45 Gly Gly Ala Ser Leu Leu Ala Leu Ala Gly Asn Asp Vai Thr Asp 50 55 60 Thr Phe Leu Ala Tyr His Pro Pro Ser Thr Cys Arg Leu Pro Pro 65 70 75 80 Phe Ser Thr Asn He Leu Leu Glu Asn Tyr Ser Vai Ser His Thr Ser 85 90 95 Ser Asp Tyr Arg Asn Leu Leu Asn His Phe His Lys Leu Gly Leu Phe 100 105 110 Arg Thr Lys Ala His Thr Thr Phe Thr Thr Phe Phe He Met He Leu 115 120 125 Met Phe Phe Leu Ser Val Thr Gly He Phe Cys Ser Asp Ser Phe Trp 130 135 140 Vai His Leu Ala Cys Gly Gly Leu Met Gly Phe Ala Trp He Gin Cys 145 150 155 160 Gly Trp lie Ala His Asp Ser Gly His Tyr Arg He Thr Ser Ser Arg 165 170 175 Lys Trp Asn Arg Phe Ala Gin He Leu He Gly Asn Cys Leu Gin Gly 180 185 190 Leu Ser He Gly Trp Trp Lys Trp Asn His Asn Ala His His He Ala 195 200 205 Cys Asn Ser Leu Asp Tyr Asp Pro As p Leu Gin Tyr He Pro Leu Leu 210 215 220 Will Be Ser Lys Phe Phe Asn Ser He Thr Ser Gly Phe Tyr Asp 225 230 235 240 Lys Lys Leu Asn Phe Asp Gly Will Be Arg Phe Leu Will Be Tyr Gin 245 250 255 His Trp Thr Phe Tyr Pro Go Met Cys Go Ala Arg Phe Asn Ms v Go 260 265 270 Ala Gin Ser Vai He His Go Phe Ser Asn Arg Lys Go Pro Asn Arg 275 280 285 Go Leu Glu Go Phe Gly Leu Gly Go Phe Trp Vai Trp Tyr Ser Leu 290 295 300 Leu Leu Ser Cys Leu Pro Asp Trp Gly Glu Arg He Met Phe Vai He 305 310 315 320 Ala Cys Tyr Phe Vai Thr Gly He Gin His Vai Gin Phe Ser Vai Asn 325 330 J 3 6 His Phe Ser Ser Asp Vai Tyr Met Gly Pro Go Gly Asn Asp Trp 340 345 350 Phe Lys Lys 3 55 Gin Thr Ala Gly Thr 360 Leu Asn He Ser Cys 365 Pro Pro Trp Met Asp Trp Phe His Gly Gly Leu Gin Phe Gin He Glu His His Leu 370 375 380 Phe Pro Arg Met Pro Arg Gly Gin Phe Arg Lys He Ser Pro Phe Vai 385 390 395 400 Lys Asp Leu Cys Asn Lys His Asn Leu Pro Tyr Asn He Ala Ser Phe 405 410 415 Thr Met Ala Asn Vai Leu Thr Leu Arg Thr Leu Arg Asn Thr Ala He 420 425 430 Glu Ala Trp Asp Leu Ser Asn Pro He Pro Lys Asn Met Vai Trp Glu 435 440 445 Ala Vai Asn Thr Leu Gly 450 <210> 47 <211> 1559 <212> DNA <213> Primula florindae <400> 47 atggctaaca aatctcaaac aggttacata accagctcag acctgaaagg gcaggtgatc tatggatatc aatccacggt caggtctacg acgtgtcctc cttcacccgg ggggcagtgc ccccctcctg gccctcgcag gacacgacgt ttcctcgctt accatccccc ttccaccgcc cgccttctcc ctcccctctc cttctacaac accactccgt ctcccccacc tcctctgatt accgctccct tttcataaac ttggcctgtt ccgcaccagg ggccacaccg cttacgcaac atgatagcga tgtttgtaat gagcgtgacc ggagtgcttt ttagcgacga catctggctt gcgccggagc aatggggatt gcctggatcc aatgcggatg tagactaatc tattagtaca taaaaacata tttaatattt aaaataccat cttatttaaa ttttggtatg tatcaatatg ggttaaaaca aaaagtaaaa tgtatactta aaatagatat taactatgag tttttgataa ttaagattca taaatgatca tttttcctgg ataggtcacg actctgggca ttaccggatg ggaaatggaa ccggtttgcg caaatcctga gcgcaaactg cctccagggg ggtggtggaa gtggaaccac aacgcgcacc acatcgcttg caatagcctg ccgacctcca gtatatccct ttgctcgtcg tctcccccaa gtttttcaac ctcgtttcta caacaagaaa ctgaacttcg acggtgtgtc gaggttcttg agcactggac gttttatccg gtcatgtgtg tcgctaggct gaacatgctc ttataacgct tttttcgaat agggaggtgg cgcatagggc gcaagagatt ctgtgttttg ggtttggttt ccgcttttac tttcttgctt acctaattgg taatgtttct gcttgtgagc tattccatta cggggataca acacgtgcag accatttttc ttcggacgtc tatgtgggtc cgccagtagg taacgactgg agactgcagg gacacttaac atatcgtgcc cggcgtggat ggattggttc tgcagtttca ggtcgagcac cacttgttcc cgcggatgcc taggagtcag tttctccttt tgtgagggat ttgtgtaaga aacacaattt gccttacaac ttactaaagc gaatgtgttg acgcttaaga cgctgagaaa tacagccgtt acctctctaa tccgatccca aagaatatgg tgtgggaggc tgttaaaact ccacaataag gtgggccagc gaccgacgct cgctaacctc cctcaacaac cttcgtcttc tgcgtgggtc gataggtcgg attcttaaat ataagtagaa aattatgtac atgtctgaca attagcatcg gattacgacc tcccttactt gtttgctacc gtgcagtcgt ttgggacttg ggtgagagga tttagcttga ttcaagaaac catggtgggt tttaggaaga atcgcgtctt gaggctcggg ctcgggtga <210> 48 <211> 449 <212> PRT <400> 48 Met Wing Asn Lys 1 Gly His Asn Lys Tyr Asp Will Be Leu Leu Ala Leu His Pro Pro Ser Leu Leu Gin His Leu Leu Asn Asn Thr Wing Tyr Wing Go Thr Gly Go Ala Gly Ala Met Asp Ser Gly His Ala Gin He Leu Trp Lys Trp Asn Tyr Asp Pro Asp Phe Phe Asn Ser Asp Gly Will Be Pro Vai Met Cys Thr Leu Phe Ser Gly Leu Ala Vai Pro Asn Trp Gly Thr Gly He Gin Go Tyr Go Gly Ser Gin Thr Gly Ala Gly Asp Leu Ser Trp Ala Ser Ala Gly His Asp Thr Wing Arg Leu His Ser Vai Ser Phe His Lys Leu Thr Phe Vai Phe Read Phe Ser Asp Gly He Ala Trp Tyr Arg Met Met Ser Ala Asn Cys His Asn Ala His Leu Gin Tyr He Read Thr Ser Arg Arg Phe Leu Vai Go Ala Arg Leu Asn Arg Glu Go Phe Trp Go Trp Glu Arg He Met His Vai Gin Phe Pro Pro Go Gly Tyr He Thr Ser Trp He Ser He 25 Read His Pro Gly Go Thr Asp Wing Leu Pro Pro Leu Pro Thr Ser Ser Gly Leu Phe Arg Met He Ala Met Asp Ala Trp Go He is Gin Cys Gly Ser Asp Arg Lys Leu Gin Gly He His He Ala Cys Pro Leu Leu Vai Phe Tyr Asn Lys 23b Cys Tyr Gin His Asn Met Leu Vai Ala His Arg Ala Phe Pro Leu Leu Phe Leu Leu Vai Ser Leu Asn His Asn Asp Trp Phe Ser Asp Leu Lys His Gly Gin Vai Gly Ser Wing Pro 45 Phe Leu Ala Tyr Ser Ala Asn Leu Asp Tyr Arg Ser Thr Arg Gly His Phe Vai Met Ser His Leu Ala Cys Trp He Gly His Trp Asn Arg Phe Ser He Gly Trp Asn Ser Leu Asp It will be Pro Lys Lys Leu Asn Phe Trp Thr Phe Tyr Gin Ser Phe He Gin Glu He Leu Leu Ser Cys Leu Ser Tyr Ser He Phe Ser Ser Asp Lys Lys Gin Thr Wing Gly Thr 355 Leu Asn He Ser Cys 360 Pro Wing Trp Met Asp 365 Trp Phe His Gly Gly Leu Gin Phe Gin Vai Glu His His Leu Phe Pro Arg Met Pro 370 375 380 Arg Ser Gin Phe Arg Lys He Ser Pro Phe Vai Arg Asp Leu Cys Lys 385 390 395 400 Lys His Asn Leu Pro Tyr Asn He Ala Ser Phe Thr Lys Ala Asn Vai 405 410 415 Leu Thr Leu Lys Thr Leu Arg Asn Thr Ala Vai Glu Ala Arg Asp Leu 420 425 430 Ser Asn Pro lie Pro Lys Asn Met Go Trp Glu Wing Go Lys Thr Leu 435 440 445 gly <210> 49 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 49 gacgattttt gagtgagagt taatttgagt caataata 38 <210> 50 <2H> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 50 cgacatcata gacaatcatc aagacaccgt 30 <210> 51 <211> 25 <212> DNA <213> Artificial Sequence •. : :.: : : : 106 <223> Description of Artificial Sequence: Synthetic Primer <400> 51 ataccccctc aaaacacccc caaat <210> 52 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 52 ctcaatatca cccgagagtt ttaacagcct 30 <210> 53 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 53 gtcgacaaca atgtccaaca catatccacc aaatc 35 <210> 54 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence : Synthetic Primer <400> 54 cctacaaatc accccaaaat attaacaact tc 32 <210> 55 <211> 26 <212> DNA •• and " • • •• • <223> Artificial Sequence Description: Synthetic Primer <400> 55 gtcgacatgg ctaacaaatc tcaaac 26 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence Description: Synthetic Primer <400> 56 cctgcaggtc accgagagt 20 <210> 57 <211> 41 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic Primer <400> 57 gtaatgccca gagtcgtgac ctatccatcc gcactggatc c 41 <210> 58 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 58 gatccagtgc ggatggatag gtcacgactc tgggcattac eg 42 <210> 59 <211> 448 <212> PRT <213> Borago officinalis <400> 59 Met Ala Ala Gin lie Lys Lys Tyr lie Thr Ser Asp Glu Leu Lys Asn His Asp Lys Pro 20 Gly Asp Leu Trp He 25 Ser He Gin Gly Lys 30 Ala Tyr Asp Go To Be Asp Trp Go Lys Asp His Pro Gly Gly Ser Phe Pro Leu 35 40 45 Lys Ser Leu Ala Gly Gin Glu Vai Thr Asp Ala Phe Vai Ala Phe His 50 55 60 Pro Ala Ser Thr Trp Lys Asn Leu Asp Lys Phe Phe Thr Gly Tyr Tyr 65 70 75 80 Leu Lys Asp Tyr Ser Vai Ser Glu Vai Ser Lys Asp Tyr Arg Lys Leu 85 90 95 Vai Phe Glu Phe Ser Lys Met Gly Leu Tyr Asp Lys Lys Gly His He 100 105 HO Met Phe Ala Thr Leu Cys Phe He Ala Met Leu Phe Ala Met Ser Vai 115 120 125 Tyr Gly Vai Leu Phe Cys Glu Gly Vai Leu Vai His Leu Phe Ser Gly 130 135 140 Cys Leu Met Gly Phe Leu Trp He Gin Ser Gly Trp He Gly His Asp 145 150 155 160 Ala Gly His Tyr Met Gonna Be Asp Ser Arg Leu Asn Lys Phe Met 165 170 175 Gly He Phe Ala Ala Asn Cys Leu Ser Gly He Ser He Gly Trp Trp 180 185 190 Lys Trp Asn His Asn Ala His His He Ala Cys Asn Ser Leu Glu Tyr 195 200 205 Asp Pro Asp Leu Gin Tyr He Pro Phe Leu Will Go Ser Lys Phe 210 215 220 Phe Gly Ser Leu Thr Ser His Phe Tyr Glu Lys Arg Leu Thr Phe Asp 225 230 235 240 Ser Leu Ser Arg Phe Phe Vai Ser Tyr Gin His Trp Thr Phe Tyr Pro 245 250 255 He Met Cys Ala Ala Arg Leu Asn Met Tyr Vai Gin Ser Leu He Met 260 265 270 Leu Lsu Thr Lys Arg Asn Vai Ser Tyr Arg Ala His Glu Leu Leu Gly 275 280 285 Cys Leu Vai Phe Ser He Trp Tyr Pro Leu Leu Vai Ser Cys Leu Pro 290 295 300 Asn Trp Gly Glu Arg He Met Phe Vai He Ala Ser Leu Ser Vai Thr 305 310 315 320 Gly Met Gin Gin Vai Gin Phe Ser Leu Asn His Phe Ser Ser Ser Vai 325 330 335 Tyr Vai Gly Lys Pro Lys Gly' Asn Asn Trp Phe Glu Lys Gin Thr Asp 34 0 345 350 Gly Thr Leu Asp He Ser Cys Pro Pro Trp Met Asp Trp Phe His Gly 355 360 365 Gly Leu 370 Gin Phe Gin He Glu 375 His His Leu Phe Pro 380 Lys Met Pro Arg Cys Asn Leu Arg Lys He Ser Pro Tyr Vai He Glu Leu Cys Lys Lys 385 390 395 400 His Asn Leu Pro Tyr Asn Tyr Ala Ser Phe Ser Lys Ala Asn Glu Met 405 410 415 Thr Leu Arg Thr Leu Arg Asn Thr Ala Leu Gin Ala Arg Asp He Thr 420 425 430 Lys Pro Leu Pro Lys Asn Leu Vai Trp Glu Ala Leu His Thr His Gly 435 440 445 <210> 60 <211> 448 <212> PRT <213> Echium gentianoides <400> 60 Met 1 Ala Asn Ala He 5 Lys Lys Tyr He Thr 10 Ala Glu Glu Leu Lys 15 Lys His Asp Lys Glu Gly Asp Leu Trp He Ser He Gin Gly Lys Vai Tyr 20 25 30 Asp Vai Ser Asp Trp Leu Lys Asp His Pro Gly Gly Lys Phe Pro Leu 35 40 45 Leu Ser Leu Ala Gly Gin Glu Vai Thr Asp Ala Phe Vai Ala Phe His 50 55 60 Ser Gly Ser Thr Trp Lys Phe Leu Asp Ser Phe Phe Thr Gly Tyr Tyr 65 70 75 80 Leu Lys Asp Tyr Ser Vai Ser Glu Vai Ser Lys Asp Tyr Arg Lys Leu 85 90 95 Vai Phe Glu Phe Asn Lys Met Gly Leu Phe Asp Lys Lys Gly His He 100 105 110 Vai Leu Vai Thr Vai Leu Phe He Ala Met Met Phe Ala Met Ser Vai 115 120 125 Tyr Gly Vai Leu Phe Cys Glu Gly Vai Leu Vai His Leu Leu Ala Gly 130 135 140 Gly Leu Met Gly Phe Vai Trp He Gin Ser Gly Trp He Gly His Asp 145 150 155 160 Ala Gly His Tyr He Vai Met Pro Asn Pro Arg Leu Asn Lys Leu Met 165 170 175 Gly He Vai Ala Gly Asn Cys Leu Ser Gly He Ser He Gly Trp Trp 180 185 190 Lys Trp Asn His Asn Ala His His He Ala Cys Asn Ser Leu Asp Tyr 195 200 205 Asp Pro Leu Gin Tyr He Pro Phe Leu Vai Vai ~ Ser Lys T on ASp 210 215 220 Phe Ser Ser Leu Thr Ser His Phe Tyr Glu Lys Lys Leu Thr Phe Asp 225 230 235 240 Ser Leu Ser Arg Phe Phe Vai Ser His Gin His Trp Thr Phe Tyr Pro 245 250 255 Vai Met Cys Ser Ala Arg Vai Asn Met Phe Vai Gin Ser Leu He Met 260 265 270 Leu Leu Thr Lys Arg Asn Vai Phe Tyr Arg Ser Gin Glu Leu Leu Gly 275 280 285 Leu Vai Vai Phe Trp lie Trp Tyr Pro Leu Leu Vai Ser Cys Leu Pro 290 295 300 Asn Trp Gly Glu Arg He Met Phe Vai Vai Ala Ser Leu Ser Vai Thr 305 310 315 320 Gly Met Gin Vai Gin Phe Ser Leu Asn His Phe Ser Ala Ser Vai 325 330 335 Tyr Vai Gly Gin Pro Lys Gly Asn Asp Trp Phe Glu Lys Gin Thr Cys 340 345 350 Gly Thr Leu Asp lie Ser Cys Pro Ser Trp Met Asp Trp Phe His Gly 355 360 365 Gly Leu Gin Phe Gin Vai Glu His His Leu Phe Pro Lys Leu Pro Arg 370 375 380 Cys His Leu Arg Lys He Ser Pro Phe Vai Met Glu Leu Cys Lys Lys 385 390 395 400 His Asn Leu Ser Tyr Asn Cys Ala Ser Phe Ser Glu Ala Asn Glu Met 405 410 415 Thr Leu Arg Thr Leu Arg Asp Thr Ala Leu Gin Ala Arg Asp Leu Thr 420 425 430 Lys Pro Leu Pro Lys Asn Leu Vai Trp Glu Ala Leu Asn Thr His Gly 435 440 445

Claims

CLAIMS 1. Isolated polynucleotide encoding a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 6, wherein the polynucleotide is selected from the group consisting of: (a) a polynucleotide that encodes the polypeptide sequence of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 46 or SEQ ID NO: 48; (b) a polynucleotide comprising the nucleic acid sequence SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 45 or SEQ ID NO: 47; (c) a polynucleotide that hybridizes with SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 45 or SEQ ID NO: 47 or a complement thereof, under conditions of 5X SSC, 50% formamide and 42°C; and (d) a polynucleotide encoding a polypeptide with at least 90% sequence identity to a polypeptide sequence of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 46 or SEQ ID NO:

48.

2. Isolated polynucleotide according to claim 1, wherein the polynucleotide encodes the polypeptide with SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 46 or SEQ ID NO:

48.

3. Isolated polynucleotide according to claim 1, further encoding a polypeptide with at least 95% sequence identity to a polypeptide sequence of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 46 or SEQ ID NO:

48.

4. Isolated polynucleotide according to claim 1, which is operably linked to a heterologous promoter.

5. Isolated polypeptide comprising the polypeptide sequence SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 46 or SEQ ID NO: 48 or a fragment thereof. having desaturase activity that desaturates a fatty acid molecule at carbon 6.

6. Recombinant vector, comprising the isolated polynucleotide sequence as defined in claim 1.

7. Recombinant vector according to claim 6, further comprises at least one additional sequence selected from the group consisting of: (a) regulatory sequences operatively linked to the polynucleotide; (b) selection markers operatively linked to the polynucleotide; (c) marker sequences operatively linked to the polynucleotide; (d) a purification portion operatively linked to the polynucleotide; and (e) a targeting sequence operatively linked to the polynucleotide.

8. Recombinant vector according to claim 6, further comprising a promoter operably linked to said isolated polynucleotide.

9. Recombinant vector according to claim 8, wherein the promoter is a developmentally regulated, organelle-specific, tissue-specific, constitutive, or cell-specific promoter.

10. Recombinant vector according to claim 8, wherein said promoter is selected from the group consisting of 35S CaMV, 34S FMV, Napin, 7S alpha, 7S alpha', Glob and Lee.

11. Recombinant vector according to claim 6, which is an isolated expression cassette.

12. Transgenic plant is transformed with recombinant vector as defined in claim 6.

13. The transgenic plant according to claim 12 is further transformed with a nucleic acid sequence encoding a poly- a peptide having desaturase activity that desaturates a fatty acid molecule at carbon 12.

14. The transgenic plant according to claim 12 is further transformed with a nucleic acid sequence encoding a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 15.

15. Host cell, which is transformed with the recombinant vector as defined in claim 6.

16. Host cell according to claim 15, wherein said host cell expresses a protein encoded by said vector.

17. Host cell according to claim 15, wherein the cell has inherited said recombinant vector from a progenitor cell.

18. Host cell according to claim 15, wherein the cell has been transformed with said recombinant vector.

19. Host cell according to claim 15, which is a plant cell.

20. Plant seed as defined in claim 12, wherein the seed comprises the recombinant vector.

21. Method of producing seed oil containing omega-3 fatty acids from plant seeds comprising the steps of: (a) obtaining seeds from a plant as defined in claim 12; and (b) to extract the oil from said seeds.

22. Method of producing a plant comprising seed oil containing altered levels of omega-3 fatty acids, comprising introducing the recombinant vector as defined in claim 6 into an oil-producing plant.

23. Method according to claim 22, wherein introducing the recombinant vector comprises generating the plant.

24. Method according to claim 22, wherein introducing the recombinant vector comprises genetic transformation.

25. Method according to claim 22, wherein the plant is a plant selected from the group consisting of Arabidopsis thaliana, Brassica oilseed, rapeseed, sunflower, safflower, canola, corn, soybean, cotton, flax, jojoba, tallow tree, tobacco, cocoa, peanut, fruit trees, citrus plants, and plants that produce nuts and berries.

26. Method according to claim 22, wherein the plant is further defined as transformed with a nucleic acid sequence encoding a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 15.

27. Method according to claim 26, wherein the stearidonic acid is increased.

28. Method according to claim 22, which further comprises introducing the recombinant vector in claim 6 into a plurality of oil-producing plants and taking said plants or their progeny having inherited the recombinant vector into a plant having a desired omega-3 fatty acid profile.

29. Endogenous soybean seed oil having a stearidonic acid content of about 5% to about 50% and a gamma-linolenic acid content of less than 10%.

30. Soybean seed oil according to claim 29, wherein it further comprises less than 10% of alpha-linolenic acid, linoleic acid and gamma-linolenic acid combined.

31. Soybean seed oil according to claim 29, wherein the stearidonic acid content is further defined as from about 15% to about 35%.

32. Soybean seed oil according to claim 29, wherein the stearidonic acid content is further defined as being from about 22% to about 30%.

33. Soybean seed oil according to claim 29, wherein gamma-linolenic acid is further defined as less than 5%.

34. Soybean seed oil according to claim 29, wherein the stearidonic acid content is further defined as from about 15% to about 35% and the gamma-linolenic acid content is further defined as less than 5%.

35. Soybean seed oil according to claim 29, wherein the ratio of omega-3 to omega-6 fatty acids in the oil is from about 0.35:1 to about 3.5:

1.

36. Soybean seed oil according to claim 29, wherein the ratio of omega-3 to omega-6 fatty acids in the oil is from about 1:1 to about 3.5:

1.

37. Method of increasing the nutritional value of an edible product for human or non-human animal consumption, comprising adding soybean seed oil as defined in claim 29 to the edible product.

38. Method according to claim 37, wherein the edible product is selected from the group consisting of human food, animal feed and a food supplement.

39. Method according to claim 37, wherein soybean seed oil increases the stearidonic acid content of the edible product.

40. Method according to claim 37, wherein soybean seed oil increases the ratio of omega-3 to omega-6 fatty acids in the edible product.

41. Method according to claim 37, wherein the edible product lacks stearidonic acid before adding soybean seed oil.

42. Method of manufacturing feed and / or ration, comprising adding soybean seed oil as defined in claim 29 to the starting ingredients of the feed and / or ration to produce the feed and / or ration.

43. Food or feed, manufactured by the method defined in claim 42.

44. Method of delivering stearidonic acid to a human or non-human animal, comprising administering soybean seed oil as defined in claim 29 to said human or non-human animal. node.

45. Method according to claim 44, wherein soybean seed oil is administered in an edible composition.

46. ​​Method according to claim 45, wherein the edible composition is food or feed.

47. A method according to claim 46, wherein the food comprises beverages, infused foods, sauces, condiments, salad dressings, fruit juices, syrups, desserts, glazes and fillings, lightly frozen products, confectionery or intermediate food.

48. Method according to claim 45, wherein the edible composition is substantially a liquid or a solid.

49. Method according to claim 45, wherein the edible composition is a food supplement and / or a nutraceutical.

50. Method according to claim 44, wherein soybean seed oil is administered to a human being.

51. Method according to claim 44, wherein soybean seed oil is administered to a non-human animal.

52. Method according to claim 51, wherein soybean seed oil is administered to farm animals or domestic poultry. case.