Combinatorial methods and compositions for the treatment of melanoma

Abstract

COMBINATION METHODS AND COMPOSITIONS FOR TREATMENT OF MELANOMA The present invention provides a rational basis for combining dehydration therapy together with selected chemotherapeutic agents that do not currently exist for the treatment of melanoma. The present invention is based on the inventors' finding that AKt3 regulates apoptosis and that V599E B-Raf regulates vascular growth and development in melanoma. The inventors are the first to recognize an effective combined targeted therapy for the treatment of melanoma. In one embodiment, the invention proposes a method for inducing apoptosis in a melanoma tumor cell by reducing AKt3 activity. In another embodiment, the invention provides a method for inducing apoptosis in a melanoma tumor cell comprising contacting a melanoma cell with an agent that reduces AKt3 activity. Consequently, the proposed method restores normal apoptotic sensitivity to a melanoma tumor cell, thereby allowing administration of a lower concentration of chemotherapeutic agents resulting in reduced toxicity to a patient. The inventors of the present invention contemplate a method for treating a melnoma tumor in a mammal which comprises: administering to a melanoma tumor an effective amount of an apoptosis inducing agent; and administering to a melanoma tumor an effective amount of an agent to reduce angiogenesis and cell proliferation. Also described herein is a method for treating a melanoma in a mammal, comprising: administering to a melanoma tumor in a mammal an effective amount of an agent that reduces AKt3 activity, administering to a melanoma tumor in a mammal of an effective amount of a V599E B-Raf activity-reducing agent, thereby treating a melanoma tumor. In another aspect, the invention proposes a pharmaceutical composition for treating a melanoma tumor comprising: an agent that reduces AKt3 activity; and a vehicle.

Description

* # * COMBINATORY METHODS AND COMPOSITIONS FOR THEMELANOMA TREATMENT * # *CROSS REFERENCE TO RELATED ORDERSThis application claims priority under 35 U.S.C. § 119 of a U.S. provisional application Serial No. 60 / 554,509 filed on March 19, 2004, which application is incorporated in its entirety by reference.REFERENCE TO SPONSORSHIPThis application is sponsored by The Foreman Foundation for Melanoma Research and American Cancer Society (RSG-04-053-01-GMC).BACKGROUND OF THE INVENTIONOf the three main forms of skin cancer, malignant melanoma represents the highest risk of mortality resulting from metastasis (Schalick et al., Blackwell Science, Inc. Maiden, MA 180-348 (1998); Jemal et al., J. Nat. Cancer Inst. 93: 678-683 (2001); and Jemal et al., Ca: a CancerJournal for Clinicians 52: 23-47 (2002)). The prognosis for patients in the late stages of this disease remains very poor with an average survival of six to ten months. (Jemal et al., Ca: A Cancer Journal for Clinicians 52: 23-47 (2002); and Soengas et al., Oncogen 22: 3138-3151 (2003)).Currently, there is no effective long-term treatment for patients suffering from advanced stages of this cancer despite many clinical tests that are testing the effectiveness of a wide variety of therapeutic agents ranging from surgery to immuno-, radio- and chemotherapy(Soengas et al., Oncogen 22: 3138-3151 (2003); Serrone et al., Melanoma Res.: 51-58 (1999); Grossman et al., Cancer Metastasis Rev. 20: 3-11 (2001); Heimbach et al., Int. J. Cancer 93: 617-622 (2001); Ballo et al., Surgical Clinics North Am. 83: 323-342 (2003); and Hersey, P., Int. Med. J. 33: 33-43 (2003)). The lack of effective therapeutic regimens is due, in part, to a lack of information about the predominant genes altered during the development of melanoma and the therapy specifically aimed at correcting these defects (Serrone et al., J. Exp. Clin. Cancer Res. 19: 21-34 (2000); and Atkins et al., Nature Rev. Drug Dis. 1: 491-492 (2002)).Patients with metastatic malignant melanoma (Stage IV) have an average survival time of approximately one year (Balch et al., 1993; Koh, 1991). The current standard treatment consists of combining chemotherapy with agents such as cisplatin, DTIC, and BCNU, with or without cytokines such as interleukin-2 (IL-2) or interferon-alpha (IFN-alpha) (Balch et al., 1993 ; Koh, 1991; Legha and Buzaid, 1993). Response rates to chemotherapy have been reported to be in the range of up to 60%, however only 5% of patients have long-term survival, regardless of the therapeutic regimen employed. Conventional chemotherapy aims to control cancer growth by targeting rapidly growing cells. However, this function is not specific, since many normal cells, such as those in the bone marrow and intestinal epithelium, also have a levelbaseline proliferation. Therefore, many normal cells in the body are also susceptible to the toxic effects of chemotherapy and conventional chemotherapy can confer a substantial degree of morbidity on the patient. Clearly, new approaches to the treatment of metastatic melanoma are needed.The Akt protein kinase family consists of three members, Aktl / PKBa, Akt2 / PKBP, and Akt3 / PKBy, who share a high degree of structural similarity (Brazil et al., Cell 111: 293-303 (2002); and Nicholson et al., Cell Signal 14: 381-395 (2002)). Family membersshare an extensive structural similarity with each other, presenting more than 80¾ of (Nicholson KM, Anderson NG. Cell Signal. 14 (5): 381-95 (2002), Datta SR et al. Genes Dev. 13 (22): 2905- 27 (1999).). All isoforms of Aktshare important structural characteristics with three distinct functional domains (Testa JR, Bellacosa. A. Proc. Nat'l Acad. Sci. USA. 98 (20): 10983-5 (2001), Nicholson KM, Anderson NG. Cell Signal 14 (5): 381-95 (2002), Scheid MP, Woodgett JR. Nat. Rev. Mol. Cell Biol. 2 (10): 760-8 (2001), Scheid MP, Woodgett JR. FEBS Lett. 546 (1): 108-12 (2003), Bellacosa A et al. Cancer. Biol. Ther. 3 (3): 268-75. Epub 2004 (2004), Brazil DP et al. Trends Biochem. Sci. 29 (5 ): 233-42 (2004), Brazil, DP et al. Cell 111: 293-303 (2002), Brazil DP, Hemmings BA. Trends Biochem. Sci .. 26 (11): 657-64 (2001), Datta SR et al. Genes Dev.13 (22): 2905-27 (1999). One is the homology domain toamino terminal plecstrin (PI-I) that mediates interactionsprotein-protein and protein-lipid. This domain consists of approximately one hundred amino acids, resembling the three phosphoinositide binding domains in other signaling molecules (Lietzke SE et al. Mol Cell. 6 (2): 385-94 (2000), Ferguson KM et al. Mol Cell. 6 (2): 373-84 (2000).). The second domain is a catalytic region of a carboxy terminal kinase that mediates the phosphorylation of substrate proteins. It has a high degree of similarity to those in protein kinase A (PKA) and protein kinase C (PKC) (Jones PE et al. Cell Regul. 2 (12): 1001-9 (1991), Andjelkovic M, Jones PF, Grossniklaus U, Cron P, Schier AF, Dick M, Bilbe G, Hemmings BA. Developmental regulation of expression and activity of multiple forms of the Drosophila RAC protein kinase. J. Biol Chem. 270 (8): 4066-75 (1995). ). The third domain is a tail region with an important regulatory role. This region is sometimes called the tail or regulator domain. Within the last two regions are residues of serine and threonine whosePhosphorylation is necessary for Akt activation. The sites vary slightly depending on the specific Akt isoform. The first site in all three isoforms is a threonine at amino acid position 308 / 309 / 305 and Aktl / 2 / 3 respectively. The second site is a serine occurring within the C-terminal hydrophobic tail at amino acid positions 473 / 474 / 472 on Aktl / 2 / 3 respectively. Phosphorylation at the two sites occurring in response to growth factors or other extracellular stimuliis essential for maximum Akt activation(Alessi DR,Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P, Hemmings BA. Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J. 15 (23): 6541-51 (1996).). Akt can also be phosphorylated in other residues; however, the functional significance of this phosphorylation is an area of ​​continuous investigation (Alessi DR, Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P, Hemmings BA. Mechanism of activation of protein kinase B by insulin. and IGF-1 EMBO J. 15 (23): 6541-51 (1996).). In addition, although Akt3 recomposition variants devoid of serine 472 phosphorylation site have been identified, the cellular role of this variant remains uncertain (Brodbeck D, Hill MM, Hemmings BA. J. Biol. Chem. 276 (31): 29550 -8. Epub 2001 (2001).). Nor is it known whether this variant is present or whether it plays any role in melanoma cells.Although all isoforms can be expressed in a particular cell type, only certain isoforms can be active. It also appears that each isoform can perform both unique and common functions in cells. (Brazil et al., Cell 111: 293-303 (2002); and Nicholson et al., Cell Signal 14: 381-395 (2002); Chen et al., Genes Dev. 15: 2203-2208 (2001); and Cho et al., Science 292: 1728-1731 (2001)). Knockout mice devoid of Aktl are stunted and have increased rates of spontaneous apoptosis in the testes and thymus (Chen et al., Genes Dev. 15: 2203-2208 (2001); Cho et al., J. Biol. Chem. 276: 38349-38352 (2001); Peng et al., Genes Dev. 17: 1352-1365 (2003)).On the other hand, Akt2 knockout mice have impaired insulin regulation, consequently a defective ability to reduce blood glucose levels due to defects in the action of insulin on the liver and skeletal muscle (Cho et al., Science 292: 1728 -1731 (2001); Peng et al., Genes Dev. 17: 1352-1365 (2003)). There is currently no published report describing the phenotype associated with the knockout mouse for Akt3; therefore, very little is known about the specific functions of Akt3 or its role in human cancer.Genetic amplification that increases Aktl or Akt2 expression has been reported in cancers of the stomach, ovary, pancreas and breast (Staal, SP, Proc. Nat. Acad. Sciences ISA84: 5034-5037 (1987); Cheng et al., Proc Nat. Acad. Sciences USA89: 9267-9271 (1992); Cheng et al., Proc. Nat. Acad. Sciences USA93: 3636-3641 (1996); Lu et al., Chung-Hua I Hsueh Tsa Chih [Journal Chinese Physician] 75: 679-682 (1995); Bellacosa et al., Int. J. Cancer 64: 280-285 (1995); and van Dekken et al., Cancer Res. 59: 749-752 (1999)) . Although no Akt activating mutations have been identified in melanomas (Waldmann et al., Arch. Dermatol. Res. 293: 368-372 (2001); Waldmann et al., Melanoma Res. 12: 45-50 (2002)), blocking total Akt function targeting P13K (with P13K inhibitors Wortmanina or Ly-294002) inhibits cell proliferation and reduces the sensitivity of melanoma cells to UV radiation (Krasilnikov et al., Mol. Carcinogenesis 24: 64-69 (1999)). Total Akt activity was also measured in melanomas using immunohistochemistryto demonstrate increased levels of total phosphorylated Akt in severely dysplastic nevi and metastatic melanomas compared to normal or slightly dysplastic nevi (Dhawan et al., Cancer Res. 62: 7335-7342 (2002)). At theHowever, the role played by individual Akt isoforms and mechanisms that lead to deregulation of specific Akt isoforms in melanoma is unknown. Recently, the phosphoinositide 3-kinase (P13K) / Akt signaling pathway has been found to play a critical role inmelanoma tumorigenesis (Stahl et al., Cancer Res. 63: 2891-2897 (2003)). It was discovered that the activityunregulated Akt by loss of PTEN phosphatase, a negative regulator of P13.K / A.kt signaling, reduced the apoptotic capacity of melanoma cells and thereby regulated melanoma tumorigenesis (Stahl et al., Cancer Res. 63: 2891-2897 (2003)).The Raf family of serine / threonine kinase protein consists of three members, A-Raf, B-Raf, and C-Raf. (Mercer et al., Biochim. Biophys. Acta 1653: 25-40 (2003)). The Raf family members consist of intermediate molecules in the MAPK pathway (Ras / Raf / MAPK kinase (MEK) / kinase regulated by extracellular signal (ERK), which is a signal transduction pathway that transfers extracellular signals from the cell membrane to the nucleus by through an ordered series of consecutive phosphorylation events (Mercer et al., Biochim. Biophys. Acta 1653: 25-40 (2003), Smalley. Int. J. Cancer 104: 527-32 (2003)). Typically a ligand extracellular ifbinds to your tyrosine kinase receptor, leading to activationRas and initiation of a cascade of phosphorylation events (Mercer et al.z Biochim. Biophys. Acta 1653: 25-40 (2003), Smalley. Int. J Cancer 104: 527-32 (2003)). Activated Ras produces the phosphorylation and activation of Raf, which in turn phosphorylates and activates MEK1 MEK2. MEK kinases, in turn, phosphorylate and activate ERK1 and ERK2 (Chong et al., Cell Signal 15: 163-62 (2003)), which phosphorylates several cytoplasmic and nuclear targets which ultimately leads to the expression of proteins that play important roles on cell growth and survival (Chang et al., Int. J. Oncol. 22: 469-80 (2003)).The mutations leading to B-Raf activation have been found in most sporadic melanomas, mainly B-RAF the most mutated gene in melanomas with a mutation rate ranging from 60 to 90% (Davies et al., Nature 417: 949 -54 (2002); Pollock et al., Nat. Genet. 33: 19-20 (2003); Brose et al., Cancer Res. 62: 6997-7000 (2002); and Yazdi et al., J. Invest Dermatol 121: 1160-62 (2003)). Most B-RAF mutations occur as a result of replacing a single wrong sense base that converts T to A in nucleotide 1796 that. replaces a Valine in place of a Glutamic Acid at codon 599 (V599E) in exon 15 (Davies et al., Nature 417: 949-54 (2002)). This mutation increases the basal activity of the B-Raf kinase resulting in the hyperactivity of the MPAK pathway evidenced by constitutively high levels of the downstream MEK and ERK kinases (Davies et al., Nature 417: 949-54 (2002)). B-RAF mutations are acquired, somatic, post-zygotic events that do nothave been identified in familial melanomas (Lang et al. Hum. Mutat. 21: 3.7-30 (2003); Laud et al., Cancer Res. 63: 3061-65 (2003); and Meyer et al, Int. J. Cancer 106: 78-80 (2003)).RNA interference (RNAi) is a post-transcriptional gene silencing mechanism specific to the polynucleotide sequence performed by two-stranded RNA that results in the degradation of a specific messenger RNA (mRNA), thereby reducing the expression of a desired encoded target polypeptide by mRNA (see, for example, WO 99 / 32619; WO 01 / 75164; US patent No. 6,506,559; Fire et al., Nature 391: 806-11 (1998); Sharp,Genes Dev. 13: 13941 (1999); Elbashir et al. Nature 4: 11: 494-98 (2001); Harborth et al., J. Cell Sci. 114: 455765 (2001)). RNAi is mediated by two-stranded polynucleotides as also described in this document below, by two-stranded RNA (dsRNA), for example, which has sequences that correspond to the exonic sequences that encode portions of the polypeptides for which expression is compromised. It is reported that RNAi is not performed by two-strand RNA polynucleotides that share a sequence identity with intronic or promoter sequences (Elbashir et al., 2001). RNAi pathways were best characterized in Drosophila and Caenorhabditis elegans, but * # * small interfering RNA * # * polynucleotides (siRNA) that interfere with the expression of specific polypeptides in higher eukaryotes such as mammals (including humans) already were consideredrados (Tuschl, 2001 Chem biochem. 2: 239-245; Sharp, 2001 Genes Dev. 15: 485; Bernstein et al., 2001 RNA 7: 1509;Zamore, 2002 Science 296: 1265; Plaster, 2002 Science 296: 1263; Zamore, 2001 Nat. Struct. Biol. 8: 746; Matzke et al., 2001 Science 293: 1080; Scadden et al., 2001 EMBO Rep. 2: 1107, for example).According to the current non-limiting model, the RNAi pathway is initiated by the cleavage of long ATP-dependent dsRNA into fragments of two strands having approximately 18-27 (such as, 19, 20, 21, 22, 23, 24 , 25, 26 etc., for example) long nucleotide base pairs, called small interfering RNAs(siRNAs) (see review by Hutvagner et al., Curr. Opin. Gen. Dev. 12: 225-32 (2002); Elbashir et al., 2001; Nyknen et al., Cell 107: 309-21 (2001) Bass, Cell 101: 235-38 (2000)); Zamore et al., Cell 101: 25-33 (2000)). InDrosophila, an enzyme known as * # * mincer * # * cleaves the longest two-strand RNA in siRNAs; Picadora belongs to the RNase III family of dsRNA-specific endonucleases (WO 01 / 68836; Bernstein et al., Nature 409: 363-66 (2001)).In addition, according to this non-limiting model, the siRNA duplexes are incorporated into a protein complex, followed by an ATP-dependent siRNA unwinding, which then generates an active RNA-induced silencing complex (RISC). (WO 01 / 68836). The complex recognizes and cleaves a target RNA that is complementary to the siRNA guide strand, thereby interfering with expressionof a specific protein. (Hutvagner et al., Above).In C. elegans and Drosophila, RNAi can be mediated by long two-strand RNA polynucleotides (WO 99 / 32619; WO 01 / 75164; Fire et al., 1998; Clemens et al., Proc. Natl. Acad. Sci. USA 97: 6499-6503 (2000); Kisielow et al., Biochem. J. 363: 1-5 (2002); see also WO 01 / 92513 (RNA-mediated silencing in yeast)). In mammalian cells, however, transfection with long dsRNA polynucleotides (that is, having more than 30 base pairs) leads to the activation of a non-specific sequence response that globally blocks the initiation of protein synthesis and produces degradation of mRNA (Bass, Nature 411: 428-29 (2001)). Transfection of human and other mammalian cells with two-strand RNAs having approximately 18-27 base pairs of nucleotides in length specifically interferes with the sequence in the expression of specific polypeptides encoded by messenger RNAs (mRNAs) containing the nucleotide sequences correspondents (WO 01 / 75164; Elbashir et al., 2001;Elbashir et al., Genes Dev. 15: 188-200 (2001); Harborth et al., J. Cell Sci. 114: 4557-65 (2001); Carthew et al., Curr. Opin. Cell Biol. 13: 244-48 (2001); Mailand et al., Nature Cell Biol. Advance Online Publication (March 18, 2002); Mailand et al. 2002 Nature Cell Biol. 4: 317).SiRNA polynucleotides may have certain advantages compared to other polynucleotides known in the art for use in altering specific gene expression sequence or modulation to result in altered levels of an encoded polypeptide product.These advantages include lower concentrations of effective siRNA polynucleotides, greater stability of siRNA polynucleotides, and shorter lengths of siRNA polynucleotides compared to such other polynucleotides (antisense, ribozyme or triplex polynucleotides, for example). As a brief explanation of the background, polynucleotides * # * antisense * # * specifically bind the sequence to target nucleic acids, such as mRNA or DNA, to prevent DNA transcription or mRNA translation (see, for example, US patent No. 5,168,053; US patent No. 5,190,931; US ​​patent No. 5,135,917; US patent No. 5,087,617; see also, for example, Clusel et al., 1993 Nucl. Acids Res. 21: 3405-11, describing antisense oligonucleotides * # * in dumbbells * # *). Polynucleotides * # * ribozyme * # * can target any RNA transcription and are capable of catalytically cleaving such transcripts, thereby impairing mRNA translation (see, for example, US patent No. 5,272,262; US patent No. 5,144,019; and US Patent Nos. 5,168,053, 5,180,818, 5,116,742 and 5,093,246; US 2002 / 193579). DNA triplex molecules refer to single strands of DNA that bind to duplex DNA to form a triplex collinear molecule, thus preventingtranscription (see, for example, U.S. Pat. No. 5,176,996, which describes methods for producing synthetic 5 'oligonucleotides that bind to target sites in duplex DNA). Suchthree filament structures are unstable and formonly transiently under physiological conditions. Like thesingle-stranded polynucleotides do not diffuse easily into cells and are therefore susceptible to nuclease digestion, the development of single-stranded DNA for antisense or triplex technologies often requires chemically modified nucleotides to increase stability and absorption by cells. SiRNAs, on the other hand, are easily absorbed by intact cells, are effective in interfering with the expression of specific polypeptides at concentrations that are of several orders of magnitude below those necessary for both antisense and ribozyme polynucleotides, and do not require the use of chemically modified nucleotides.Malignant melanoma is hair cancer with the most significant impact on man, with the highest risk of death from metastasis. Both the incidence and mortality rates continue to rise every year, with no effective long-term treatment on the horizon. In part, this reflects the lack of identification of the critical genes involved and specific therapy aimed at correcting these defects. Consequently, there is a need in the technique to identify the critical genes involved and specific therapies aimed at correcting these defects, and targeted reduction of the gene (s) identified as being decisive in the signaling pathways of P13K / Akt and MEK / ERK. The identification of a gene as a selective target provides new therapeutic opportunities for patients with melanoma.Therefore, a primary objective, characteristic or advantage of the present invention is to improve the state of the art.Another objective, feature or advantage of the present invention is to propose a method for reducing the activity of Akt3 in a cancer cell, thus returning normal apoptotic sensitivity to a cancer cell.Another objective, feature or advantage of the present invention is to propose a method for inducing apoptosis in a cancer cell with an agent that reduces Akt3 activity.Another objective, feature or advantage of the present invention is the proposition of a combinatorial approach to the treatment of melanomas by restoring normal apoptotic sensitivity to a melanoma tumor cell, by reducing cell proliferation and growth of the melanoma tumor cell, and by inhibition vascularization of the melanoma tumor cell.Another objective, feature or advantage of the present invention is to propose a method of treating melanomas that reduces the size of the tumor more efficiently than conventional methods. Another objective, characteristic or advantage ofThe present invention consists of proposing a method of treating melanomas that requires a lower concentration of chemotherapy to be used, thereby reducing toxicity to the patient.These and other objectives, characteristics or advantages will become apparent by reading the description of the invention that follows.BRIEF SUMMARY OF THE INVENTIONThe present invention provides a rationale for combining target therapy together with selected chemotherapeutics, which does not currently exist for the treatment of melanoma. The present invention is based on the discovery of the inventors of the present invention that Akt3 regulates apoptosis and that V599E B-Raf regulates vascular growth and development in melanoma. The inventors are the first to recognize an effective combined target therapy for the treatment of melanoma. In one embodiment, the invention proposes a method for inducing apoptosis in a melanoma tumor cell by reducing Akt3 activity. In another embodiment, the invention proposes a method for inducing apoptosis in a melanoma tumor cell that comprises placing a melanoma tumor cell in contact with an agent that reduces Akt3 activity. Consequently, the proposed method restores normal apoptotic sensitivity to a melanoma tumor cell, thus allowing the administration of a lower concentration of chemotherapeutic agents resulting in reduced toxicity to a patient. The inventors of the present invention contemplate a method for treating a melanoma tumor in a mammal comprising: administering to a melanoma tumor an effective amount of an agent to induceapoptosis; and administration to a melanoma tumor of aeffective amount of an agent to reduce angiogenesis and cell proliferation.Also described in the present invention is a method for the treatment of a melanoma in a mammal, comprising: administering, to a melanoma tumor in a mammal, an effective amount of an agent that reduces Akt3 activity, administration, to a melanoma tumor in a mammal, an effective amount of an agent that reduces the activity of V599E B-Raf, thus treating a melanoma tumor.In another aspect, the invention proposes a pharmaceutical composition for the treatment of a melanoma tumor that comprises: an agent that reduces the activity of Akt 3; and a vehicle.These and other modalities of the invention will become apparent with reference to the Detailed Description which follows. All references disclosed in this document are incorporated in full into this document as a reference, as if each one had been incorporated individually.BRIEF DESCRIPTION OF THE DRAWINGSFigure 1 shows the identification of Akt3 involvement in malignant melanoma. A. Akt activity in the UACC 903 melanoma cell line is regulated by PTEN. Western blot analysis showing the expression of phosphorylated Akt, total Akt, PTEN and a-enolase (control ofloading). Cell lines 36A, 29A and 37A aregenetically related cell lines created fromfrom the UACC 903 progenitor cell line thatexpress PTEN. Reversent tumorigenic cell lines derived from the 36A cell line are considered isogenic, differing only in PTEN expression. Melanocytes serve as a control for normal cells. The graph represents densitometric scans of 2 separate Western blots to quantitatively demonstrate the level of phosphorylated Akt to total in each cell line; bars, ± mean standard error; statistic, One-Way ANOVA followed by Dunnet Multiple Comparisons against melanocyte control, * P<0.5. B. siRNA for each of the Akt isoforms demonstrates the specificity of the abatement of each Akt isoform expressed ectopically in the UACC 903 cell line. Constructs expressing HA-Aktl, HA-Akt2 or HA-Akt3 with identifiers were co-identified. nucleofected together with the specific siRNA for Aktl, Akt2 or Akt3 in UACC 903 cells. Controls consisted ofnon-nucleofected or vector-nucleofected cells only. Western blots were probed with antibodies to HA to detect the ectopically expressed protein as well as a-enolase, which served as a loading control. C. The abatement of Akt3, but not Aktl or Akt2, mediated by siRNA, changes the level of phosphorylated Akt (activity) in the melanoma cell lines UACC 903, WM1 15 and SK-MEL-24. Western blot analysis showing the expression of phosphorylated Akt, Akt3, Akt2 and a-enolase after nucleofection with 50 (left) or 100 pmoles (right) for each respective siRNA. Controls were non-nucleofected ornucleofected cells with mixed siRNA. The data are representative of a minimum of 2 separate experiments. The loading control for these experiments was a-enolase. D. Phosphorylated Akt3 is reduced when the PTEN protein is present in the tumorigenic model UACC 903 (PTEN). Akt3 and Akt2 were immunoprecipitated from cell lines in the tumorigenic model of UACC 903 (PTEN) and analyzed by Western blot with an antibody that recognizes phosphorylated Akt. The cell lines 36A, 29A and 37A that express PTEN were derived from the UACC 903 progenitor cell line that does not contain the PTEN protein. The two reversible tumorigenic cell lines were derived from the 36A cell line and no longer express PTEN. A negative antigen control is shown together with the positive and negative controls for Akt3 and Akt2. The controls for Akt3 and Akt2 were HEK 298T or LNCaP cells respectively, without treatment (positive) or treated with LY-294002 (negative), a P13K inhibitor. E. Akt3 activity is reduced in the presence of PTEN in the modeltumorigenic profile of UACC 903 (PTEN). The immunoprecipitated Akt3 was used in an in vitro kinase assay in which Crosstide was phosphorylated by Akt3 to estimate the activity. The graph shows the activity after subtracting the antigen-free control; bars, ± standard mean error; statistic, One-Way ANOVA followed by Dunnet Multiple Comparisons against melanocyte control, * P<0.05.Figure 2 shows that an increase in Akt3 expression and activity occurs during the progression of themelanoma. A. An increase in the level of phosphorylated Akt (active) occurs during the phase of radial growth in the melanoma tumor progression model. Western blot comparing the amount of phosphorylated Akt in melanocytes with low-pass melanoma cell lines established from primary tumors in the radial (WM35 and WM3211) and vertical (WM115, WM98.1 and WM278) growth stages. The total Akt is shown as a control. B. Comparison of Akt3 expression with Akt2 expression in the melanoma tumor progression model. Western blots showing the expression levels of Akt3 and Akt2 are shown together with a-enolase as a loading control. C. Akt3 is preferentially activated in cell lines of the melanoma tumor progression model compared to Akt2. Akt3 or Akt2 from each cell line was precipitated and subjected to Western blot analysis to measure the amount of phosphorylated Akt in the immunoprecipitate. D. Akt3 is preferably overexpressed in metastatic melanomas from human patients as compared to melanocytes. Akt3 and Akt2 expression were measured from metastatic melanomas derived from 31 tumors. Akt3 and Akt2 expression was normalized with the expression of ot-enolase. The graph quantitatively compares the level of Akt.3 or Akt2 expression in each tumor compared to melanocytes. The bars represent the average values ​​from densitometric scans of 3 separate Western blots; bars, ± mean standard error. 0 value aboverepresents the increase factor in expression about whatoccurs in melanocytes; differences only> 2-times were recorded as significant. E. Akt3 expression and activity, but not Akt2, increases in tumors from melanoma patients compared to melanocytes. The activity was determined by immunoprecipitation of Akt3 and Akt2 followed by Western blot analysis with an antibody that recognizes phosphorylated Akt to determine the percentage of tumors in which phosphorylated Akt3 or Akt2 (active) could be detected; statistics, t test, * P<0.05.Figure 3 shows the mechanism that serves as the basis for the unregulated activity of Akt3 in malignant melanomas. A. A reduced expression (activity) of PTEN specifically increases Akt3 activity in melanocytes and: B. WM35 cells of the radial growth phase (radial growth phase). The siRNA-mediated reduction of PTEN is shown alone (control) or in combination with mixed siRNA or with siRNA against Aktl, Akt2 or Akt3. Western blot analysis shows the expression of phosphorylated Akt, Akt3, Akt2 and PTEN. ot-enolase served as loading control. C. Akt3 overexpression in human melanocytes increases the levels of phosphorylated Akt. Akt3 wild type, Akt3 dead (inactive) or Akt3 myristoylated (active) were nucleofected in melanocytes. Analogous constructions for Akt2 served as controls (data not shown). Akt phosphorylation (activity) was measured by Western blot analysis to measure phosphorylated Akt levels. The blind arrowhead shows the endogenously located Akt3active while the arrowhead indicates Akt3 active with an ectopically expressed HA identifier.Figure 4 shows that an increase in the activity ofAkt3 promotes the development of the melanoma tumor by reducing the rates of apoptosis. A. PTEN-mediated reduction of Akt3 activity inhibits the development of the melanoma tumor. The sizes of tumors formed by UACC 903 progenitor melanoma cells, the isogenic cell line 36A (which retain PTEN) and reversible (which do not have PTEN) were measured 10 days before injection in nude mice. Values ​​are averages of a minimum of six injection sites in three mice per cell line, bars, ± mean standard error; statistic, One-Way ANOVA followed by Dunnet Multiple Comparisons compared to UACC 903, * P<0.05. B. Infra-regulationAkt3-mediated siRNA reduces the tumorigenic potential of UACC 903 melanoma cells. siRNA against Akt3, Akt2 and Aktl were nucleofected into UACC 903 cells and after 48 hours the cells were injected into nude mice. The size of. tumors were measured 10 days later. Controls are UACC 903 nucleofected cells with buffer alone or with a mixed siRNA. Values ​​are averages of a minimum of six injection sites in three mice per cell line; bars, ± mean standard error; One-Way ANOVA statistic followed by Dunnet Multiple Comparisons compared to UACC 903, * P<0.05. C.D.E.F. The reduction mediated by PTEN or by Akt3 siRNA increases apoptosis in tumors that grow in mus mice. THEquantification (C, D) and photographs (E, F) of cellspositive for TUNEL in tumor masses derived fromUACC cells903 that expressPTEN (36A) or nucleofectedwith siRNA insiAkt3 and siAkt2;bars, ± mean standard error;statistic,Kruskal-Wallisfollowed byComparisonsMultiples ofDunnet against UACCTumorswere analyzed 4 days laterinjectioncells innaked mice; magnification, 200X.The controls were cellsUACC 903orUACC 903 cellsnucleofected with bufferonly.Thewhite nuclei represent cells sufferingapoptosis.Figure 5illustrates a demonstration thatliposomesare onlynon-toxic to melanoma cells.addition ofliposomes avarious concentrations did not reducenumber ofviable cells. In fact, they increasedviability of cells inall concentrations ofhours. Methods: Toxicityof liposomes was evaluatedin1205 Lu using assaysMTS at 24, 48 and 72 hours laterof addingliposomes at concentrations of 6.2550 pM.Figure 6 illustrates a demonstrationthat thecellsinmelanoma absorb easilytheliposomes.Methods:Labeled liposomes (green) wereadded toUACC 903 melanoma cellscultivatedin culture. Atimages show the nuclei ofcells to the left (counterdyed with DAPI)and cellsthat absorbed liposomeslabeled on the right;40X magnification. Approximately 99¾of the cells absorbliposomes.Figure 7 illustrates the quantification of liposome absorption by melanoma cells. Methods. Labeled liposomes or liposomes containing labeled siRNA were added to cells cultured in culture at a concentration of 20 nM. One hour later the cells were fixed with 5% paraformaldehyde, counter-stained with DAPI and the% of cells that had absorbed the labeled product were counted.Figure 8 illustrates a demonstration of uniformity in size and size distribution of liposomes. Methods: Left: Scanning electron microscopy graph showing the uniform size of the liposomes. Right: Liposome size distribution determined by light scattering analysis. The graph shows the limits of liposome sizes, with the average size occurring between 70-80 nm.Figure 9 illustrates a demonstration of liposomes delivering sets of siRNA to melanoma cells. Methods: red and green labeled siRNAs were added to melanoma cells growing in culture. One hour after the absorption of the cells, they were fixed in 4% paraformaldehyde and counter-stained with DAPI. The left side shows the cell nuclei stained blue, followed by red siRNA and green siRNA. The last column is a merged image, 40X magnification.Figure 10 illustrates a demonstration of the duration of slaughter by undetectable siRNA of protein expressionin 1205 Lu melanoma cells. Methods: The duration ofprotein abatement by undetectable siRNA from Invitrogen was determined to be more than 8 days old. siRNA was transferred to the 1205 Lu melanoma cell line by nucleofection. Western blot analysis of5 levels of B-Raf protein were performed at 2-day intervals until day 8. siRNA against C-Raf served as a control. In addition to reduced B-Raf expression, the activity of pErk l ' / 2 downstream in the signaling pathway was also reduced for 8 days. Erk-2 served as a loading control for10 protein.Figure 11 illustrates a demonstration of depletion of protein expression following the delivery of siRNA in liposome-mediated melanoma cells. The siRNA liposome complexes targeting the mutant B-Raf can disassemble 50¾ of 200 nM protein expression. This indicates a baseline; higher concentrations will increase the slaughter. Methods: The siRNA liposome complexes were added to the cells at a concentration of 100 or 200 nM. Lysates were collected after 72 hours and 20 analyzed by Western blot.Figure 12 shows that the siRNA-mediated reduction of the mutantV599E B-Raf reduces the downstream activity of MEK and ERK in melanoma. The siRNA-mediated slaughter of B-Raf and C-Raf reduces the levels of each respective protein 24 and 48 25 hours after nucleofection in the melanoma cell lines UACC 903 (a), 1205 Lu (B) and C8161 (C ). siRNAblended was used as a control whereas lamin A / C siRNA was used as an additional control for cellsUACC 903. Only siRNA for B-Raf reduced the levels of active MEK and ERK (phosphorylated) downstream of B-Raf in UACC 903 and 1205 LU cells containingV599E B-Raf. ERK2 is used as a loading control.Figure 13 shows that the development of the melanoma tumor was inhibited withV599E B-Raf but not with siRNA for C-Raf or mixed siRNA. The siRNA-mediated abatement of B-Raf protein continued for 6 to 8 rounds after nucleofection in UACC 903 (A) and 1205 Lu (B) cell lines growing in culture. A corresponding reduction was seen in ERK1 / ERK2 (B) levels. ERK2 served as a loading control. The siRNA-mediated reduction of B-Raf led to a reduction in the tumorigenic potential of UACC 903 (C) and 1206 Lu (D) cells. siRNA against B-Raf, C-Raf and mixed siRNA were introduced into UACC 903 or 1205 Lu cells (white arrow) and 36 hours later the cells were injected into nude mice (black arrow). The size of the tumors was measured at 2-day intervals. Si-RNA-mediated B-Raf infra-regulation reduced the tumorigenic potential of UACC 903 and 1205 Lu melanoma cells. Control cells were nucleofected with buffer only, a mixed siRNA or siRNA against C-Raf. The values ​​are averages of a minimum of 12 injection sites in six mice with two separate experiments. Bars ± standard error.Figure 14 shows that the pharmacological inhibition of B-Raf activity using BAY 43-9005 inhibits thedevelopment of the melanoma tumor. A, BAY 43-9006 inhibitsboth wild-type and mutant B-Raf activityV599E B-Raf. The B-Raf of the wild type or the mutantV599E B-Raf equipped with HA identifier were expressed in HEK 2931 cells exposed to 5 pmol / L BAY 43-9006 or DMSO vehicle. Ha indicates the ectopically expressed B-Raf protein. Activation or inhibition of the MAPK pathway was determined to contain levelsfrom pMEK and pERK, ERK2 served as a loading control; B, BAY 43-9006 reduces the levels of pMEK and pERK (activity) in UACC 903 melanoma cells containing themutantV599E B-Raf in a way that responds to dosing. Western blot analysis of reduced levels of pMEK and pERK in UACC 903 cells with increasing concentrations of BAY 43-9006. The loading control was ERK2. C, Pretreatment of mice with BAY 43-9006 inhibits the development of melanoma tumors. Four days before the 5 x 10 injection8UACC 903 cells, mice were pretreated twice i.p. with 50 mg / kg of BAY 43-9006 or DMSO vehicle, which continued every two days (blind arrowhead). The tumor size is shown at 2-day intervals until the 22nd. Bars, ± standard error. D, A reduction in tumor cell proliferation accompanies siRNA-mediated inhibition of melanoma tumor development. A five to eight fold reduction in bromo-deoxy-uridine positive cells occurs after siRNA-mediated inhibition of B-Raf, but not C-Raf or mixed siRNA. *P<0.05. Columns, averages from six different tumors with four to six fields counted per tumor; bars, ± standard error.Figure 15 shows that inhibition of B-Raf activity using BAY 43-9006 inhibits the development of melanoma tumor. The effects of treatment with BAY 43-9006 are shown on tumor development in UACC 903 (A) and 1205 Lu (B). UACC 903 and 1205 Lu cells were injected into nude mice and the tumor was allowed to develop until day 6 when the mice received i.p. every two days BAY 43-9006 dissolved in DMSO (blind arrowheads). The control conditions consisted of treatment with DMSO only. Raf kinase inhibitor BAY 43-9006 reduces the tumorigenic potential of melanoma cells containing the proteinV599E B-Raf at concentrations> 50 mg / kg. C, Reduced amounts of phosphorylated (active) ERK were observed for those cells after treatment with BAY 43-9006 but not with vehicle treatment. Immunohistochemical comparison of the number of pERK positive cells in UACC 903 tumor sections treated with 50 mg / kg BAY 43-9006 (in DMSO) or in DMSO vehicle only. A three-fold difference was detected between cells treated with the control vehicle and with BAY 43-9006 (D). *, P<0.05. Columns, averages from six different tumors with four to six fields counted per tumor; bars, ± standard error.Figure 16 shows the mechanism behind the inhibition of melanoma tumor development after pharmacological or siRNA-mediated inhibition ofV599E Mutant B-Raf in melanoma tumors. Comparison of rates ofvascular development (A), apoptosis (B) and proliferation(C) in tumors paired in time and space exposed to BAY 43-9006 or to vehicle (DMSO). Tumors matched by size or time and that developed in parallel were compared to identify the effects of B-Raf inhibition on tumor development. A difference in vascular development was the first statistically significant difference (*, P<0.05) observed after treatment of UACC 903 tumors with BAY 43-9006, which was followed by an increase in apoptosis (*, P<0.05) and a reduction in cell proliferation (*, P<0.05). Columns, averages from two separate experiments with four to six fields analyzed from each of six tumors per experiment; bars, ± standard error.Figure 17 shows that siRNA and pharmacological inhibition of V599E B-Raf reduces VEGF secretion from melanoma cells. VEGF secretion was measured from UACC 903 or 1205 Lu cells growing in culture by ELISA assay after nucleofection or with B-Raf or with VEGF siRNA (A) or after treatment with increasing concentrations of BAY 43-9006 ( B). C-Raf and mixed siRNA served as controls. Bars, ± standard error. The effects of a reduction in VEGF expression are shown on thetumor development UACC 903 (C) and 1205 Lu (D). The tumor size is shown two days apart until Day 17.5. Reducing VEGF expression inhibits melanoma tumor development in a way thatoccurs after the reduction of V599E B-Raf expression.Points, averages from six different tumors; bars, ± standard error.Figure 18: shows the Akt3 region that causes preferential activation in melanoma. Activation is measured as phosphorylation levels; darker bands indicating greater activity. The lower bands indicate endogenous Akt activity. The Akt3 domains were exchanged with the Akt2 domains and the constructs containing the chimeric constructs were nucleofected in the WM35 melanoma cell line. Akt3 and Akt2 myristylated served as positive controls. Akt3 (T305A / S472A) and Akt2 (T309A / S474A) exterminated served as negative controls. The transfer of wild-type Akt3 led to an increase in activity unlike what occurred with wild-type Akt2 which did not. The constructs in which the plecstrin (PH) homology domain from Akt3 (amino acids 1-110) was interchanged with those from Akt2 were used to identify the Akt3 region that leads to activation in melanoma cells. Note that only constructs containing the Akt3 catalytic and regulatory (CR) domains (derived from amino acids 111-497) led to activation. This maps the region from amino acids 111-497 as being critical for Akt3 activation in human melanomas. This is a critical site for targeted therapy that would specifically prevent Akt3 activation in melanomas. METHODS: wild type constructs identified with HA and chimeric constructions PH-Akt3-C / R-Akt2 and PH-Akt2-C / R-Akt3 were prepared by switching the homology domains toplecstrin (PH) (from amino acids 1-110) and the catalytic domain (from 111-479 of Akt3 or 481 in Akt2). The constructs were nucleofected in the WM35 melanoma cell line using the NHEM-NEO Nucleofector de Amaxa nucleotide reagent, 48 hours later being analyzed by Western blot analysis by probing with an antibody to be-473 from Akt.DETAILED DESCRIPTION OF THE PREFERRED MODE.The present invention is directed in part to the discovery that Akt3 is an important serine / threonine kinase protein and plays a role in the survival of melanoma, so that melanoma tumor cells are resistant to apoptosis. A melanoma model that reflects the importance of Akt in melanoma tumorigenesis was used to identify Akt3 as the predominantly deregulated isoform during melanoma tumorigenesis. As demonstrated in this document, selective abatement of Akt3, but not Aktl or Akt2, reduces the level of total phosphorylated Akt and reduces the tumorigenic potential of melanoma cells. Consequently, Akt3 provides a therapeutic target for melanoma cancer.The present invention is also directed in part to the discovery that B-Raf plays a role in the growth and proliferation of melanoma. It has now been discovered that inhibiting or reducing Graf expression reduces the proliferation of tumor cells and the formation of new blood vessels (angiogenesis). It should be noted that due towandering sequence data the substitution of valine (V)by glutamic acid (E) in B-Raf actually corresponds to codon 600 and nucleotide 1799 (not 1796) in the correct version as presented in Accession number to the NCBI gene bank NT_007914. Kumar et al., Clinical Cancer Research, 9: 3362-3368 (2003). However, in this application we use the incorrect nucleotide and codon numbers throughout the document for historical and familiarity reasons.The inventors of the present invention contemplate a combination therapy for the treatment of tumor cells that encompasses the induction of apoptosis and the reduction of cell proliferation and angiogenesis. In one embodiment, apoptosis is induced by the reduction of Akt3 activity and cell proliferation and angiogenesis are reduced by reducing the activity of V599E B-Raf. The inventors of the present invention also contemplate that the reduction of Akt3 activity in a tumor cell reduces the apoptotic threshold in tumor cells especially in melanoma cells, allowing lower doses of chemotherapy to be employed than that based on conventional treatments. Thus, patients would receive more effective treatment and have less side effects from toxic chemotherapy drugs.To assist in understanding the report and claims, the definitions below are given.DEFINITIONSAs used herein, the term * # * siRNA * # * means either: (i) a two-strand RNA oligonucleotide or polynucleotide, which has 18 base pairs, 19 pairsbase, 20 base pairs, 21 base pairs, 22 base pairs, 23 base pairs, 24 base pairs, 25 base pairs, 26 base pairs, 27 base pairs, 28 base pairs, 29 pairs bases or 30 base pairs in lengthand which is capable of interfering with the expression and activity of an Akt3 polypeptide or a variant of the Akt3 polypeptide, comprising a single siRNA strand a portion of an RNA polynucleotide sequence encoding the Akt3 polypeptide, its variant or a complementary sequence her; (ii) an oligonucleotide or polynucleotide of a single strand, of 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides or 30 nucleotides in length and which is capable of interfering in the expression and / or activity of an Akt3 target polypeptide or a variant of the Akt3 polypeptidez or else it looks for a complementary sequence to result in a dsRNA that is capable of interfering with target polypeptide expression,such a single strand oligonucleotide comprising a portion of an RNA polynucleotide sequence encoding the PTP-1B polypeptide, its variant or acomplementary sequence to it; or (iii) an oligonucleotide, or polynucleotide, of (i) or (ii) above having such an oligonucleotide or polynucleotide one, two, three or four nucleic acid changes or substitutions inits interior.* # * Nucleic acid * # * or * # * polynucleotide * # *, as used herein, refers to polymers of any length containing purine and pyrimidine, both polyribucleotides and polidesoxy-ribonucleotides or polyribo-polidesoxy-ribonucleotides. This includes one-strand and two-strand molecules, that is, DNA-DNA, DNA-RNA and RNA-RNA hybrids, as well as * # * protein nucleic acids * # * (PNA) formed by the conjugation of bases to a backbone of amino acids. This also includes amino acids containing modified bases.A * # * gene * # * refers to a set of nucleotides that encodes a polypeptide and includes nucleic acids from cDNA and genomic DNA.A * # * vector * # * is any means for transferring a nucleic acid to a host cell. A vector can be a replicon to which another segment of DNA can be attached in order to produce replication of a linked segment. A * # * replica * # * is any genetic element (plasmid, phage, cosmid, chromosome, virus, for example) that functions as an autonomous unit of DNA replication in vivo, that is, capable of replication under its own control. The term * # * vector * # * includes both viral and non-viral means for introducing nucleic acid into a cell in vitro, ex vivo or in vivo. Viral vectors include retrovirus, adeno-associated virus, pox, baculovirus, vaccinia, herpes simplex, Epstein-Barr and adenovirus vectors. Non-viral vectors include, without limitation, plasmid, liposomes, lipids withelectrical charge (cytofectins), DNA-protein complexes, andbiopolymers. In addition to a nucleic acid, a vector may also contain one or more regulatory regions, and / or selectable markers useful in selecting, measuring and monitoring the results of nucleic acid transfer (to which tissues the transfer was made, duration of expression, etc.). ).A * # * cassette * # * refers to a segment of DNA that can be inserted into a vector at specific restriction sites. The DNA segment encodes a polypeptide of interest and the cassette and restriction sites are designed to ensure insertion of the cassette into the appropriate reading frame for transcription and translation. A cell will have been * # * transfected * # * by exogenous or heterologous DNAwhen such DNA has been introduced into the cell. A cell will have been * # * transformed * # * by exogenous or heterologous DNAwhen the transfected DNA has made a phenotypic change. The transforming DNA can be integrated (covalently linked) to the chromosomal DNA constituting the cell's genome. A * # * nucleic acid molecule * # * refers to the polymeric form of ribo-nucleoside phosphate ester (adenosine, guanosine, uridine or cytidine; * # * RNA molecules * # *) or deoxy-ribonucleosides (deoxy-adenosine , deoxy-guanosine, deoxy-thymidine or deoxy-cytidine; * # * DNA molecules * # *), or any phosphoester analog thereof, such as phosphorus-thioathio-acts and thioesters, and / or in the form of a single filament, or in a two-filament helix. Two-strand DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and specifically a DNA or RNA molecule,it refers only to the primary and secondary structure of the molecule, and does not limit it to any specific tertiary form. Thus, this term includes two-stranded DNA found, among others, in linear or circular DNA molecules (restriction fragments, for example), plasmids and chromosomes. Discussing the structure of the DNA molecules of two specific strands, the sequences can be described in this document according to the normal convention of only giving the sequence in the 5 'to 3' direction along the non-transcribed DNA strand ( that is, the filament that has a sequence homologous to RNArn). A * # * recombinant DNA molecule * # * is a DNA molecule that has undergone molecular biological manipulation.The present invention contemplates the isolation of melanoma from a gene encoding a human Akt3 protein or polypeptide of the invention, including a full length or neutrally occurring form of Akt3any human Akt3 specific antigen fragment. As used herein, * # * Akt3 * # * refers to the Akt3 polypeptide, and * # * akt3 * # * refers to a gene that encodes the Akt3 polypeptide.The term * # * Akt3 * # * refers to nucleic acid (DNA and RNA), protein (or polypeptide) Akt3, its polymorphic variants, alleles, mutants and homologous interspecies that have (i) substantial homology between nucleotide sequences with the nucleotide sequence of Accession Number AJ245709 (RNArn of Homo sapiens stops serine / threonineAkt-3 kinase (Akt3 gene) gi | 5804885 | emb | AJ245709.1 IHSA245709 [5804885]); Accession Number AF135794 (Homo sapiens AKT3 protein kinase mRNA, complete cds giI 4574743 | gbIAF135794, 1 (AF135794 [4574743]); Accession number NM_005465 (homologous transcription variant 1 RNAm 3 (protein kinase B, range) (AKT3) of Homo sapiens gi murine viral thymoma v-Akt oncogene | 32307164 I ref | NM_005465, 3 | [32307164]); Accession number NM_181690 (homologous transcription variant 2 RNAm 3 (protein kinase B, gamma ) (AKT3) of oncogene v-akt of Homo sapiens murine viral thymoma gi132307162) ref | NM-181690.11 [32307162]); Accession number AY005799 (Homo sapiens protein kinase B gamma 1 (AKT3) mRNA, complete cds, alternatively recomposed giI 15072339 IgbIAY0Q5799.1 | [15072339]); Accession Number AF124141 (Homo sapiens protein kinase B gamma mRNA, complete gi cds [4757578 | gbIAF124141, 1IAF124141 [4757578]); or (ii) substantial sequence homology with the amino acid sequence encoding CAB53537 Accession Number (Akt-3 protein [Homo sapiens] gi | 5804886 | emb | CAB53537.1 | [5804886]); Accession number AAD24196 (protein kinase AKT3 [Homo sapiens] gi | 4574744 | gbIAAD24196.1 | AF135794_1 [4574744]); Accession Number AAF91073 (protein kinase B range 1 [Homo sapiens] gi115072340 | gbIAAF91073, 11 [15072340]); Accession Number AAD29089 (protein kinase B range [Homo sapiens] gi | 4757579 | gb | AAD29089.1 | AF124141_1[4757579]); Accession Number NP_005456 (murine viral thymoma oncogene v-akt homolog 3 isoform 1; protein kinase B gamma, RAC-y serine / threonine proteinkinase; serine threonine kinase protein, Akt-3 [Homo sapiens] giI488549Z | ref | NP_005456. 1J [4885549]); Accession number NP_859029 (homologous isoform 2 of oncogene v-akt of murine viral thymoma; protein kinase B gamma; RAC-y serine threonine kinase protein; serine threonine kinase protein, Akt-3 [Homo sapiens] gi | 32307163 | ref | NP_859029. 1 I [32307163])The term * # * B-Raf * # * refers to nucleic acid (DNA and RNA), B-Raf protein (or polypeptide), its polymorphic variants, alleles, mutants and homologous interspecies that have (i) substantial homology between nucleotide sequences with the B-Raf nucleotide sequence found in GenBank (NM_004333), mRNA of a BI homolog (B-Raf) of Homo sapiens v-raf murine viral sarcoma, gi I 33188458 | ref INM__004333, 2 | [33188458]. The sequenceof cognate protein for B-Raf is GenBank Accession Number P15056. A B-Raf protein found on the GenBank is M95712 B-Raf protein mRNA (BRAF) from homo s apiens, cdscomplete giI41387219 | gbIM95712,2 | HUMBRAF [41387219]A * # * control sample * # * refers to a sample of biological material representative of healthy, cancer-free animals. The level of Akt3 or B-Raf in a control sample or the number of copies of corresponding coding genes is preferably typical of the general population of normal, cancer-free individuals of the same species. This sample can be collected from an animal in order to be used in the methods described in thisinvention or may consist of any biological material representative of normal animals free of cancer obtained for other reasons, but which is nonetheless suitable for use in the methods of the present invention. A control sample can also be obtained from normal tissue from the animal that has cancer or is suspected of having cancer. A control sample can also refer to a given level of Akt3, representative of the cancer-free population that has been previously established based on measurements of normal cancer-free individuals. Alternatively, a biological control sample may refer to a sample that is obtained from a different individual or be a normalized value based on baseline data obtained from a population. In addition, a control sample can be defined for a specific age, sex, ethnicity or other demographic parameters, in some situations, the control is implicit in the specific measurement, an example of an implicit control is the case where a detection method it can only detect Akt3, or the corresponding number of gene copies, when a level greater than that of a normal, cancer-free individual is present, a typical control level for a gene consists of two copies per cell. Another example is found in the context of an immunohistochemical assay in which the level of control for the assay is known. Other cases of such controls are within the knowledge of those skilled in the art.A level of polypeptides or polynucleotidesAkt3 or B-Raf * # * to be expectedin a sample ofcontrol refers to a level that represents a typical cancer-free sample and from which a high or diagnostic presence of polypeptide or polynucleotide Akt3 can be distinguished. It is preferable that the level * # * that is expected * * * is controlled for such factors as age, sex, medical history etc. of the mammal, as well as for the specific biological patient being tested.The term * # * tumor cell * # * means a cell that is a component of a tumor in a patient, or a cell that is determined to be intended to become a component of a tumor, that is, a cell that is a component of a tumor. a precancerous lesion in a patient.* # * DNAc * # * refers to complementary or copy DNA produced from an RNA template by the action of RNA-dependent DNA polymerase (reverse transcriptase). Thus, a * # * cDNA clone * # * means a duplex DNA sequence complementary to an RNA molecule of interest, carried in a cloning vector or amplified by PCR. This term includes genes from which intervening sequences have been removed.* # * Cloning vector * # * refers to plasmid or phage DNA or other DNA sequence that is capable of replicating in a host cell. The cloning vector is characterized by one or more endonuclease recognition sites where such DNA sequences can be cut in a determinable manner without loss of essential biological DNA function, which may contain a marker suitable for use in identifying cells transformed.* # * Expression vector * # * refers to a vehicle or vector similar to a cloning vector but which is capable of expressing a sequence of nucleic acids that has been cloned into it after transformation into a host. A sequence of nucleic acids is * # * expressed * # * when it is transcribed to produce an RNArn sequence. In most cases, this transcript will be translated to produce the amino acid sequence. The cloned gene is generally placed under control (that is, operably linked to) an expression control sequence.* # * Expression control sequence * # * or * # * regulatory sequence * # * refers to a sequence of nucleotides that controls or regulates the expression of structural genes when operably linked to those genes. These include, for example, the lac systems, the trp system, the lambda phage major operator and promoter regions, the fd coating protein control region, and other sequences known to control gene expression in prokaryotic or eukaryotic cells. Expression control sequences will vary depending on whether the vector was designed to express the gene operably linked in a prokaryotic or eukaryotic host, and may contain transcriptional elements such as enhancer elements, termination sequences, tissue-specific elements or sites of translation initiation and termination.* # * Operably linked * # * means that the promoter controls the initiation of gene expression. A promoter is operably linked to a proximal DNA sequence ifafter introduction to a host cell, the promoter determines the transcription of the proximal DNA sequence (s) into one or more RNA species. A promoter is operably linked to a DNA sequence if the promoter is able to initiate transcription of that DNA sequence.* # * Hostesses * # * means eukaryotes. The term includes an organism or cell that is the recipient of a replicable expression vector.The introduction of nucleic acids into the host cell by any method known in the art, including those described in this document, will be referred to herein as * # * transformation * # *. The cells into which the nucleic acids described above have been introduced are considered to also include the progeny of such cells.The nucleic acids referred to herein as * # * isolated * # * are nucleic acids separated from the nucleic acids of the genomic DNA or cellular RNA of their source of origin (for example, as it exists in cells or in a mixture of acids nucleic acids such as in a library) and may have undergone other processing. * # * Isolated * # *, as used herein, refers to sequences of nucleic acids or amino acids that are free of at least 60%, preferably 75%, and more preferably 90% free of other components, with which they are naturally associated with. Nucleic acids (polynucleotides) * # * isolated * # * include nucleic acids obtained by methodsdescribed in this document, similar methods or othersuitable methods, including essentially pure nucleic acids, nucleic acids produced by chemical synthesis by combinations of biological and chemical methods and recombinant nucleic acids that are isolated. Nucleic acids referred to herein as * # * recombinants * # * are nucleic acids that have been produced by recombinant DNA methodology, including those nucleic acids that are generated by procedures that depend on an artificial replication method, such as polymerase chain reaction (PCR) or cloning into a vector using restriction enzymes. Nucleic acids * # * recombinants * # * are also those that result from recombination events that occur by natural cell mechanisms, but are selected after introduction into the cells of nucleic acids designed to allow for a desired recombination event or to make it likely. Portions of isolated nucleic acids encoding polypeptides that have a particular function can be identified and isolated by the method of Jasin, M.z et al., U.S. Patent No. 4,952,501, for example.As used herein, the terms * # * protein * # * and * # * polypeptide * # * are synonymous, * # * peptides * # * are defined as fragments or portions of polypeptides, preferably fragments or portions that have at least a functional activity (proteolysis, adhesion, fusion, antigenic or intracellular activity, for example) as the complete polypeptide sequence.The term * # * patient * # * or * # * individual * # * are used interchangeably and refer to mammals such as human patients and non-human primates as well as to experimental animals such as rabbits, rats and mice and other animals.* # * Biological sample * # *, as used herein, is a sample of tissue or biological fluid that contains nucleic acids or Akt3 and / or B-Raf polypeptides, such as, for example, a protein, polynucleotide or cancer transcript melanoma. Such samples include, without limitation, tissue isolated from humans, biological samples may also include sections of tissue such as biopsy and autopsy samples, frozen sections taken for histological purposes, blood, plasma, serum, sputum, feces, tears, mucus , hair, skin etc. Biological samples also include explants and cultures of primary and / or transformed cells derived from patient tissues. A biological sample is typically obtained from a eukaryotic organism, preferably from eukaryotes such as fungi, plants, insects, protozoa, birds, fish, reptiles and preferably a mammal such as rat, mouse, bovine, canine, guinea pig or rabbit, being most preferable such as a primate such as chimpanzees or humans.* # * Cancer * # * or * # * malignancy * # * are used interchangeably and refer to any of a number of diseases that are characterized by uncontrolled and abnormal cell proliferation, by the ability of affected cells to spread locally or throughbloodstream and lymphatic system to other parts of the chorus (ie, to metastasize), as well as by any of a number of specific structural and / or molecular characteristics. A cell * # * cancerous * # * or * # * malignant * # * is considered to be a cell that has specific structural properties, being devoid of differentiation and capable of invasion and metastasis. Examples of cancers consist of cancer of the skin, kidney, colon, breast, prostate and liver. (See DeVita, V. et al. (Eds.), 2001, Cancer Principles and Practice of Oncology, 6th. Ed., Lippincott Williams & Wilkins, Philadelphia, Pa.); this reference is fully incorporated for all purposes in this document as a reference.The terms * # * apoptosis * # * and * # * programmed cell death * # *(PCD) are used interchangeably and describe the molecular and morphological processes that lead to controlled cell self-destruction (see, for example, Kerr J.F.R. et al., 1972, Br. J. Cancer. 26: 239-257). Apoptotic cell death can be induced by a variety of stimuli, such as cell surface receptor binding, starvation, growth factor / survival factor deprivation, heat shock, hypoxia, DNA damage, viral infection and cytotoxic / chemotherapeutic agents . The apoptotic process is involved in embryogenesis, differentiation, proliferation / homeostasis, removal of defects, therefore of harmful cells and especially in the regulation and function of the immune system. Therefore, dysfunction or dysregulation of the apoptotic program is implicated in a variety ofpathological conditions such as immunodeficiency, autoimmune diseases, neurodegenerative diseases and cancer. Apoptotic cells can be recognized by stereotypical morphological changes: the cell shrinks, presents deformation and loses contact with its neighboring cells. Its chromatin condenses and finally the cell is fragmented into compact structures contained by a membrane, called * # * apoptotic bodies * # * containing cytosol, condensed chromatin and organelles. Apoptotic bodies are swallowed by macrophages and are thus removed from the tissue without causing an inflammatory response. This is in contrast to the necrotic mode of cell death in which cells suffer a major insult, resulting in loss of membrane integrity, swelling and rupture of the cells. During necrosis, the cell contents are released souncontrolled in the cell environment, which results in damage to the surrounding cells and an intense inflammatory response in the corresponding tissue. See, for example, Tomei L.D. and Cope F.O., eds., 1991, Apoptosis: The Molecular Basis of Cell Death, Plainville, N.Y .: Cold Spring Harbor Laboratory Press; Isaacs J.T., 1993, Environ. HealthPerspect. 101 (suppl 5): 27-33; each of these references being fully incorporated into this document for all purposes as a reference. A variety of apoptosis assays are well known to those skilled in the art (DNA fragmentation assays, radioactive proliferation assays, DNA scaling assays for treated cells, cell fluorescence microscopy assaysstained with 4,6-diamidino-2-phenylindole (DAPI) and the like).* # * Conservatively modified variants * # * apply to both amino acid and nucleic acid sequences. Concerning specific nucleic acid sequences, conservatively modified variants refer to those nucleic acids that encode identical or essentially identical amino acid sequences, or in cases where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Due to the degeneration of the genetic code, a large number of functionally identical nucleic acids encode any given polypeptide. The codons CGU, CGC, CGA, CGG, AGA and AGG all encode the amino acid arginine. Thus, in any position where an arginine is specified by a codon, the codon can be changed to any of the corresponding codons described without changing the encoded polypeptide. Such variations of nucleic acids are * # * silent substitutions * # * or * # * silent variations * # *, which consist of a kind of * # * conservatively modified variations * # *. Each polynucleotide sequence described in this document and which encodes a polypeptide also describes any and all possible silent variations, unless otherwise noted. Thus, silent substitutions are an implicit feature of any nucleic acid sequence that encodes an amino acid. Those skilled in the art will recognize that each codon in a nucleic acid (except AUG, which is usuallythe single codon for methionine) can be modified to produce a functionally identical molecule by standard techniques. In some embodiments, the nucleotide sequences that encode the enzymes are preferably optimized for expression in a specific host cell (yeast, mammal, fungal plant and the like, for example) used to produce the enzymes.With regard to amino acid sequences, those skilled in the art will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide or protein sequence that alter, add or delete a single amino acid or a small percentage of amino acid in the coded sequence are a * # * conservatively modified variant * # * in cases where the change results in the replacement of an amino acid with a chemically analogous amino acid. Conservative substitution tables that provide functionally analog amino acids are well known in the art. See, for example, Davis et al., * # * Basic Methods in Molecular Biology * # * Appleton & Lange, Norwalk, Connecticut (1994). Such conservatively modified variants are in addition to the polymorphic variants, interspecies homologues and alleles of the invention and do not exclude them.Each of the following eight groups contains amino acids that are conservative substitutions for each other: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4)Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L),Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine(Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cystine (C), Methionine (M) (see, for example, Creighton, 1984, Proteins).The terms * # * identical * # * or percentage of * # * identity * # * within the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or that have a percentage specified number of amino acid or nucleotide residues that are the same (i.e., approximately 70% identity, preferably 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of identity covering a specified region (the Akt3 gene sequence associated with melanoma, for example), when compared and aligned for maximum correspondence covering a comparison window or designated region) as measured using BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection. Such strings are then considered to be * # * substantially identical * # *. This definition also refers to the completion of a test sequence. The definition also includes strings that have deletions and / or additions, as well as those that have substitutions. As will be described below, preferred algorithms can take intervals and the like into account. It is preferable that the identity exists covering a region that has at least approximately 25 amino acids or nucleotides oflength or, more preferable, that covers a region that is 50-100 amino acids or nucleotides in length.For sequence comparison, typically a sequence acts as a reference sequence, to which the test sequences are compared. When using a sequence comparison algorithm, the test and reference sequences are launched on a computer, subsequence coordinates are designated, if necessary, and parameters are assigned to the sequence algorithm program. Program parameters can be used by default, or alternate parameters can be assigned. The sequence comparison algorithm then calculates the percentage of identity between the strings for the test sequence in relation to the reference sequence, based on the program parameters.A * # * comparison window * # *, as used at present, includes reference to a segment of any of the number of contiguous positions selected from the group consisting of 20 to 60, usually from approximately 50 to approximately 200, with more being usual from about 100 to about 150 where one sequence can be compared to a reference sequence of the same number of contiguous positions after two sequences have been optimally aligned. The methods of aligningstrings for comparison are well known in the art. The optimal alignment of strings for comparison can beobtained, for example, with the local homology algorithm ofSmith & Waterman, 1991, Adv. Appl. Math. 2: 482, with Needleman & Wunsch's homology alignment algorithm, 1970, J-Mol. Biol. 48: 443, by Pearson & Lipman's similarity search method, 1988, Proc. Nat'l. Acad. Sci. USA 85: 2444, by computerized implementations of these algorithms (GAP, BESTFIT, PASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), Or by manual alignment and visual inspection ( See, for example, Current Protocols in Molecular Biology (Ausubel et al., 1995 eds. Supplement).Another example of an algorithm that is suitable for determining the percentage of sequence identity and sequence similarity is the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., 1977, Nuc. Acids Res. 25: 3389-3402 and in Altschul et al., 1990, J. Mol. Biol. 215: 403-410, respectively. Osoftware for conducting BLAST analyzes is available to the public through the National Center for Biotechnology Information (http: / / www. ncbi. nlm. nih.gov / ). This algorithm first involves identifying pairs of high-count strings (HSPs) by identifying short words of length W in the searched sequence, which either match or satisfy some positive T threshold count when aligned with a word of the same length in a database string. T refers to the neighborhood word count threshold (Altschul et al., Above). These neighborhood wordsRight initials act as seeds to start searches to find longer HSPs that contain them. The correct words are extended in both directions along each sequence to the point at which the cumulative alignment count can be increased. Cumulative counts are calculated using, for nucleotide sequences, the M parameters (reward count for a pair of matching residues; always>0) and N (penalty count for unmatched residues; always<0). For amino acid sequences, a counting matrix is ​​used to calculate the cumulative count. The extension of the correct words in each direction isinterrupted when: the cumulative alignment count falls from the amount X of its maximum reached value; the count drops to zero or below, due to the accumulation of one or more negative count residual alignments; or when the end of one of the strings has been reached. The BLAST algorithm's W, T and X parameters determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses a word length (W) of 11, an expectation (E) of 10, M = 5, N = -4 and a comparison of the two filaments. For amino acid sequences, the BLASTP program uses a word length of 3, and expectation (E) of 10, and the BLOSUM62 counting matrix by default (see Henikoff & Henikoff, 1989, Proc. Natl. Acad. Sei. USA 89: 10915),alignments (B) of 50, expectation (E) of 10, M = 5, N = -4, and a comparison of the two filaments.The BLAST algorithm also conducts a statistical analysis of the similarity between two sequences (see, for example, Karlin & Altschul, 1993, Proc. Natl. Acad. Sci. USA 90: 5873-5787). A measure of similarity provided by the BLAST algorithm is the minimum sum probability (P (N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. A nucleic acid, for example, is considered similar to a reference sequence if the minimum sum probability in a comparison of the test nucleic acid with the reference nucleic acid is less than approximately 0.2, more preferably less than approximately 0 .01, and more preferably less than approximately 0.001.An indication that two sequences of nucleic acids or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically trans-reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as will be described below. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, in cases where two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under drastic conditions, as will be described below. Yet another indication that two nucleic acid sequences are substantiallyidentical is that the same primers can be used to amplify the sequence.The expression * # * hybridizes selectively (or specifically) to * # * refers to the binding, duplexing, or hybridization of a molecule only to a nucleotide sequence under drastic hybridization conditions when that sequence is present in a complex mixture (DNA or total library or cell RNA, for example).The expression * # * drastic hybridization conditions * # * refers to conditions in which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acid, but with no other sequence. The drastic conditions are sequence dependent and will be different in different circumstances. Longer strings hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, 1993, * # * Overview of principles of hybridization and the strategy of nucleic acid assays * # * in Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes. Generally, drastic conditions are selected to be approximately 5-10 ° C below the thermal melting point (TM) for the specific sequence at the defined ionic intensity pH. Tm is the temperature (under conditions of defined ionic intensity, pH and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence in equilibrium (as the target sequences are present in excess, at TM, 50% of the probes are occupied in equilibrium).Drastic conditions will be those in which the salt concentration is less than approximately 1.0 M sodium ion, typically 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 at 8.3 and the temperature is at least approximately 30 ° C for short probes (from 10 to 50 nucleotides, for example) and at least approximately 60 ° C for long probes (above 50 nucleotides, for example). Drastic conditions can be achieved with the addition of destabilizing agents such as formamide. For a selective or specific hybridization, a positive sign is at least twice the background hybridization, optionally 10 times the background hybridization. Exemplary drastic hybridization conditions can be as follows: 50% formamide, 5 x SSC, and 1% SDS, incubation at 42 ° C, or 5 x SSC, 1% SDS, incubation at 65 ° C, with washing in 0.2 x SSC and 0.1% SDS at 65 ° C. Such washes can be conducted for 5, 15, 30, 60, 120 or more minutes. For PCR, a temperature of approximately 36 ° C is typical for low-drastic amplification, although annealing temperatures can vary between approximately 32 ° C and 48 ° C, depending on the length of the primer. For PCR amplification with a high degree of drasticity, a temperature of approximately 62 ° C is typical, although annealing temperatures of a high degree of drasticity can vary from approximately 50 ° C to approximately 65 ° C., Depending on the length of the initiator and givesspecificity. Typical cycle conditions for both high-grade and low-grade amplificationsdrasticity include a denaturation phase of 90 ° C-95 ° C for 30 sec-2 min., an annealing phase that lasts 30 sec-2. min., and an extension phase of approximately 72 ° C for 1-2 min.Nucleic acids that do not hybridize to each other under drastic conditions remain substantially identical if the polypeptides encoding them are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneration allowed by the genetic code. In such cases, nucleic acids typically hybridize under moderately drastic hybridization conditions. * # * Moderately drastic hybridization conditions * exemplary * includes hybridization in a 40% formamide buffer, 1 m NaCl, 1% SDS at 37 ° C, and a wash in 1 x SSC at 45 ° Ç. Such washes can be conducted for 5, 15, 30, 60, 120 or more minutes, a positive hybridization is at least twice that of the bottom. Those skilled in the art will readily recognize that alternative hybridization and washing conditions can be used to provide conditions of similar drasticity.Standard reference works that present the general principles of recombinant DNA technology include J. Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 2a. Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y .; P.B. Kaufman et al., (Eds), 1995, Handbook of Molecular and Cellular Methods in Biologyand Medicine, CRC Press, Boca Raton; M.J. McPherson (ed),1991, Directed Mutagenesis: A Practical Approach, IRL Press,Oxford; J. Jones, 1992, Amino Acid and Peptide Synthesis,Oxford Science Publications, Oxford; B.M. Austen and O.M.R.Westwood, 1991, Protein Targeting and Secretion, IRL Press, Oxford; D.N Glover (ed), 1985, DNA Cloning, Volumes I and II;M.J. Gait (ed), 1984, Oligonucleotide Synthesis; B.D. Hames and S.J. Higgins (eds), 1984, Nucleic Acid Hybridization; Wu and Grossman (eds), Methods in Enzymology (Academic Press, Inc.), Vol. 154 and Vol. 155; Quirke and Taylor (eds), 1991, PCR-A Practical Approach; Hames and Higgins (eds), 1984, Transcription and Translation; R.I. Freshney (ed), 1986,Animal Cell Culture; Immobilized Cells and Enzymes, 1986,IRL Press; Perbal, 1984, A Practical Guide to Molecular Cloning; J.H. Miller and M.P. Calos (eds), 1987, Gene Transfer Vectors for Mammalian Cells, Cold Spring Harbor Laboratory Press; M.J. Bishop (ed), 1998, Guide to HumanGenome Computing, 2a. Ed., Academic Press, San • Diego, Calif .; L.F. Peruski and A.H. Peruski 1997, The Internet and the New Biology: Tools for Genomic and Molecular Research, American Society for Microbiology, Washington, D.C.The term * # * reduces Akt3 activity * # * is used at present to refer to a reduction of approximately 25% to approximately 100% in Akt3 activity. The invention contemplates the inhibition of Akt3 by any (a) agent that reduces the level of Akt3 mRNA or the level of Akt3 protein produced by the cell when the agent is administered to the cell or (b) an agent that affects the level of Akt3 mRNA orprotein via the PI3K / Akt signal transduction pathwayresulting in a reduction in the level of Akt3 mRNA or the level of Akt3 protein produced by the cell when the agent-is administered to the cell, or (c) agent that reduces Akt3 activity, such as by phosphorylation or dephosphorylation. Agents that reduce the activity of downstream pathways that remove products from Akt3 activity and reducing the activity of upstream pathways provide reagents for Akt3 also fall under this term. A reduction or change in Akt3 activity can be measured by any known method including, without limitation, kinase assays, by phosphorylation status in Western blot analyzes, or by levels of protein expression.The term * # * reduces the activity of V599E B-Raf * # * is used in this document to refer to a reduction of approximately 25% to approximately 100% in B-Raf activity. The invention contemplates the inhibition of B-Raf by any (a) agent that reduces the level of V599E mRNA B-Raf or the level of V599E protein produced by the cell when the agent is administered to the cell or (b) any agent which affects the level of mRNA or B-Raf protein via the MPK or ERK signal transduction pathway resulting in a reduction in the level of V599E B-Raf mRNA or the level of V599E protein produced by the cell when the agent is administered to the cell, or (c) any agent that reduces B-Raf activity, such as by means of phosphorylation or dephosphorylation. Agents that reduce the activity of downstream pathways that remove V599E B-Raf activity products and reduceupstream track activity provides reagents for V599EB-Raf also fall under this term. A reduction or change in B-Raf activity can be measured by any known method including, without limitation, kinase assays, phosphorylation status in Western blot analysis, or levels of protein expression.The term * # * treatment of a melanoma * # * refers to the prohibition, alleviation, improvement, interruption, control, delay or reversion of progression, or the reduction of tumor development in mammals and the increase in apoptosis rates or induction of apoptosis in a tumor cell.As used herein, the term * # * angiogenesis * # *, when used in reference to reduced vascularization, means that the amount of new blood vessel formation that occurs in the presence of an agent is reduced below the amount of vessel formation that occur in the absence of an exogenously added agent. Methods for determining the amount of blood vessel formation in a tissue, including immunohistochemical methods, are well known in the art by quantifying the number of vessels that are stained positive for the CD-31 antigen or the area in the tumor occupied by CD-31 positive vessels.Detection of Akt3 and / or B-Raf Nucleic AcidsIn some embodiments of the present invention, nucleic acids encoding an Akt3 or B-Raf polypeptide, including the full length Akt3 or B-Raf protein, or any derivative, homologous variant or fragmentits derivative of a melanoma cell, will be used. SuchNucleic acids are useful for any of a number of applications, including the production of Akt3 or B-Raf protein, for diagnostic assays, for therapeutic applications, for Akt3-specific or B-Raf-specific probes for assays for compounds that are bind and / or modulate Akt3 or B-Raf, for the identification and / or isolation of Akt3 or B-Raf counterparts from other species or mice, and other applications.A. General Recombinant DNA MethodsNumerous applications of the present invention involve cloning, synthesis, maintenance, mutagenesis and other manipulations of nucleic acid sequences that can be conducted using routine techniques in the field of recombinant genetics. Basic texts describing the general methods of use in this invention include Sambrook et al., Molecular Cloning, a Laboratory Manual (2nd. Ed. 1989); Kriegler, 1990, Gene Transfer and Expression: a Laboratory Manual; and Current Protocols in Molecular Biology, 1995, (Ausubel et al., eds.).For nucleic acids, sizes are given either in kilobases (kb) or in base pairs (bp). These are estimates derived from electrophoresis on agarose or acrylamide gel, from sequenced nucleic acids or from published DNA sequences. For proteins, dimensions are given in kilodaltons (kDa) or amino acid residue numbers. Protein sizes are estimated from gel electrophoresis, proteinsequenced, from sequences derived from amino acids or published protein sequences.Oligonucleotides that are not commercially available can be chemically synthesized according to the solid phase phosphoramidite triester method first described by Beaucage & Caruthers, 1981, Tetrahedron Letts. 22: 1859-1862, using an automated synthesizer, as described in Van Devanter et al., 1984, Nucleic Acids Res. 12: 6159-6168. Purification of oligonucleotides is produced either by electrophoresis on native acrylamide gel or by anion exchange HPLC as described in Pearson & Reanier, 1983, J. Chrom. 255: 137-149.The sequence of cloned genes and synthetic oligonucleotides can be verified after cloning using, for example, the chain termination method for sequencing two-strand templates from Wallace et al., 1981, Gene 16: 21-26 .B. Isolation and detection of Akt3 and / or B-Raf nucleotide sequencesIn some embodiments of the present invention, the nucleic acids of Akt3 and / or B-Raf will be isolated and cloned using recombinant methods. Such modalities are used, for example, to isolate the Akt3 and / or B-Raf polynucleotides for the expression of protein or during the generation of variants, derivatives, expression cassettes or other sequences derived from Akt3 and / or B-Raf , to monitor the gene expression of Akt3 and / or B-Raf, for thedetermination of Akt3 and / or B-Raf sequences in severalspecies for diagnostic purposes in a patient, that is, to detect mutations in a, three and / or B-Raf or for genotype and / or forensic applications.Polymorphic variants, alleles and homologous interspecies and nucleic acids that are substantially identical to those of the Akt3 or B-Raf gene can be isolated using either Akt3 or B-Raf nucleic acid probes and oligonucleotides by library selection under conditions drastic hybridization. Alternatively, expression libraries can be used to clone Akt3 or B-Raf proteins, polymorphic variants, alleles and interspecies homologues by detecting immunologically expressed homologs with purified antisera or antibodies launched against an Akt3 or B-Raf polypeptide, which also recognize and selectively bind to the Akt3 or B-Raf counterpart.To produce an Akt3 cDNA library, one must choose a source that is rich in Akt3 RNA. To produce a B-Raf cDNA library, one must choose a source that is rich in B-Raf RNA. The mRNA is then produced in cDNA using reverse transcriptase, ligated into a recombinant vector, and transfected into a recombinant host for propagation, selection and cloning. Methods for preparing and selecting cDNA libraries are well known (see, for example, Gubler & Hoffman, 1983, Gene 25: 263-269; Sambrook et al., Above; Ausubel et al., Above).For a genomic library, DNA is extracted from the tissue and is either mechanically sheared or enzymatically digested to produce fragments of approximately 12-20 kb. The fragments are then separated by gradient centrifugation of undesirable sizes and are constructed in bacteriophage vectors A. These vectors and facts are packaged in vitro. The recombinant phage is analyzed by plaque hybridization as described in Benton & Davis, 1977, Science 196: 180-182 Colony hybridization is conducted in the manner generally described in Grunstein et al., 1975, Proc. Natl. Acad. Know. USA 72: 3961-3965.Akt3 or B-Raf homologues more distantly related can be identified using any of a number of well-known techniques, including by hybridizing an Akt3 probe or a B-Raf probe to a genomic or cDNA library using moderately drastic conditions, or in low drastic conditions using probes from regions that are selective for Akt3 or B-Raf, such as specific probes generated for the C-terminal domain, for example. In addition, a distant homologue can be amplified from a nucleic acid library using sets of degenerate primers, that is, primers that incorporate all possible codons that encode a given amino acid sequence, based specifically on a stretch of extremely conserved amino acids. Such initiators arewell known to those skilled in the art, and are availablenumerous programs, on the Internet, for example, for degenerate starter projects.In certain embodiments, Akt3 or B-Raf polynucleotides will be detected using hybridization-based methods to determine, for example, levels of Akt3 or B-Raf RNA or to detect specific DNA sequences, for diagnostic purposes, for example. The genetic expression of Akt3 and / or B-Raf, for example, can be analyzed by techniques known in the art, by Northern blot, reverse transcription and by amplification of mRNA by PCR, including quantitative PCR analysis of mRNA levels with procedures Real-time PCR (reverse transcriptase-TAQMAN ™ amplification, for example), dot analysis, in situ hybridization, RNase protection, probing of DNA microchip sets, for example, and the like.In another modality, high density oligonucleotide analysis technology (GeneChip ™), for example) can be used to identify orthologists, alleles, conservatively modified variants and polymorphic variants of Akt3 and / or B-Raf, or to monitor Akt3 and / or B-Raf mRNA levels. In the case where a homologue is linked to a known disease, such as melanoma, for example, they can be used with GeneChip ™ as a diagnostic tool in the detection of melanoma in a biological sample, see, for example, Gunthand et al., 1998, AIDS Res. Hum. Retroviruses 14: 869-876; Kozal et al., 1996,Nat. Med. 2: 753-759; Matson et al., 1995, Anal. Biochem.224: 110-106; Lockhart et al., 1996, Nat. Biotechnol. 14: 1675-1680; Gingeras et al., 1998, Genome Res. 8: 435-448; Hacia et al., 1998, Nucleic Acids Res. 26: 3865-3866.The detection of Akt3 and / or B-Raf polynucleotides and polypeptides may involve quantitative or qualitative detection of the polypeptide or polynucleotide and may involve a real comparison with a control value, or, alternatively, can be conducted in such a way that the detection itself indicates inherently an increased level of Akt3 and / or B-Raf.In certain modalities, for example, the diagnosis of melanoma cancer, the activity level of polynucleotides, polypeptides or Akt3 and / or B-Raf proteins will be quantified, in such modalities, the difference between a high level of Akt3 and / or B- Raf and a normal level of control is preferably significant. Typically, a diagnostic presence, that is, an overexpression or an increase in Akt3 and / or B-Raf polypeptide or nucleic acid, represents an increase of at least approximately 1.5, 2, 3, 5, 10 or more at the polypeptide level orpolynucleotide of Akt3 and / or B-Raf in the biological sample compared to the expected level in a non-cancerous sample. The detection of Akt3 and / or B-Raf can be conducted in vitro, that is, in cells within a biological sample taken from the patient, or in vivo. In one embodiment, an increased level of Akt3 and / or B-Raf is used as a diagnostic marker for Akt3 and / or B-Raf respectively. As used at present, a * # * diagnostic presence * # * indicatesany level of Akt3 or B-Raf that is higher than expected in a non-cancerous sample. In one embodiment, assays are performed for an Akt3 or B-Raf polypeptide or polynucleotide in a biological sample 5 under conditions where a normal level of Akt3 or B-Raf polypeptide or polynucleotide, that is, the typical level of a non-cancerous sample, that is, cancer-free, would not be detected. In such assays, therefore, the detection of any Akt3 and / or B-Raf 10 polypeptide or nucleic acid in the biological sample indicates a diagnostic presence, or an increased level.As will be described below, any of a number of methods can be used to detect Akt3 and / or B-Raf. a level of Akt3 and / or B-Raf 15 polynucleotide can be detected by detecting any cognitive DNA or RNA from Akt3 or B-Raf, including genomic DNA, RNArn and cDNA. An Akt3 or B-Raf polypeptide can be detected by detecting an Akt3 and / or B-Raf polypeptide itself, or by detecting Akt3 and / or B-Raf protein activity. Detection can involve quantifying the level of Akt3 and / or B-Raf (genomic DNA, cDNA, mRNA or protein level, the protein activity, for example), or alternatively, it can be a qualitative assessment of the level, or the presence or absence of Akt3 and / or B-Raf, 25 especially compared to a control level. Any of a number of methods can be used todetection of any of the aforementioned, as will beDescribed below. Such methods include, for example, hybridization, amplification and other assays.In certain embodiments, the ability to detect an increased level, or diagnostic presence, in a cell is used as a marker for cancer cells, that is, to monitor the number or location of cancer cells in a patient, as detected in vivo or in vitro.Typically, the Akt3 polynucleotides or polypeptides detected in the present invention will have at least approximately 70% identity, and preferably 75%, 80%, 85%, 86% 87%, 88%, 89%, 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of identity, covering a region of at least approximately 50, 100, 200 or more nucleotides, or 20, 50 100 or more amino acids, with a naturally occurring Akt3 gene. Such polynucleotides or polypeptides can represent functional or non-functional forms of Akt3, or any variant, derivative or fragment thereof.1. Number of copies detectionIn one embodiment, for the diagnosis or presence of cancer, for example, the number of copies, that is, the number of Akt3 genes in a cell, is evaluated. Usually for an autosomal gene given, an animal has two copies of each gene. The number of copies can be increased, however, by genetic amplification or duplication, in cancer cells, for example, or reduced by deletion. The methods ofevaluation of the number of copies of a specific gene are wellknown to those skilled in the art and include, among others, assays based on hybridization and amplification.a) Tests based on hybridizationAny of a series of hybridization-based assays can be used to detect the Akt3 gene or the number of copies of the Akt3 genes in the cells of a biological sample. One such method is by Southern blot. In a Southern blot, genomic DNA is typically fragmented, separated by electrophoresis, transferred to a membrane and subsequently hybridized to an Akt3-specific probe. For determining the number of copies, comparing the intensity of the hybridization signal from the probe to the target region with a signal from a control probe to a region of normal genomic DNA (an unamplified portion of the same cell, tissue, organ, or similar or related to such a cell, organ tissue, for example) provides an estimate of the relative number of copies of Akt3. The Southern blot methodology is known in the art and is described, for example, in Ausubel et al., Or Sambrook et al., Above.An alternative means of determining the number of copies of Akt3 genes in a sample is by in situ hybridization, by fluorescence in situ hybridization or FISH, for example. In situ hybridization assays are well known (Angerer, 1987, Meth. Enzymol. 152: 649, for example). Generally, in situ hybridization comprises the following main steps: (1) fixation of the tissue or biological structure to be analyzed; (2) pre-treatmenthybridizing the biological structure to increase the accessibility of the target DNA, and to reduce non-specific binding; (3) hybridization of the mixture of amino acids to the nucleic acid in the biological structure or tissue; (4) post-hybridization washes to remove fragments of nucleic acids that did not bind during hybridization; and (5) detecting the hybridized nucleic acid fragments.The probes used in such applications are typically labeled, with radioisotopes or fluorescent reporters. Preferred probes are long enough, from approximately 50, 100 or 200 nucleotides to approximately 1000 or more nucleotides, for example, in order to specifically hybridize the target nucleic acid (s) under drastic conditions.The present invention contemplates that * # * comparative probe * # * methods, such as comparative genomic hybridization (CGH) are used to detect the amplification of the Akt3 gene. In comparative genomic hybridization methods, a * # * test * # * collection of nucleic acids is labeled with a first label whereas a second collection (from a healthy cell or tissue, for example) is labeled with a second label. The hybridization ratio of nucleic acids is determined by the relationship between the binding of the first and second labels to each fiber in an array. The difference in the relationship between signals from the two labels, due to the amplification of the gene, in the test collection, for example, is detected and the relationship provides ameasure of the number of copies of the Akt3 gene.Hybridization protocols suitable for use with the methods of the invention are described, for example, in Albertson, 1984, EMBO J. 3: 1227-1234; Pinkel, 1988, Proc. Natl. Acad. Sci. USA 85: 9138-9142; EPO Pub. No. 430, 402; Methods in Molecular Biology, Vol. 33: In Situ Hybridization Protocols, Choo, Ed., 1994, Humana Press, Totowa, N. J., and the like.b) Amplification-based testsIn another embodiment, amplification-based assays are used to detect Akt3 or to measure the number of copies of Akt3 genes. In such assays, the nucleic acid sequences of Akt3 act as a template in an amplification reaction (Polymerase Chain Reaction, or PCR, for example). In a quantitative amplification, the amount of amplification product will be proportional to the amount of the template in the original sample. Comparison to suitable controls provides a measure of the number of copies of the Akt3 gene. Quantitative amplification methods are well known to those skilled in the art. Detailed protocols for quantitative PCR are given, for example, in Innis et al., 1990, PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc. N.Y.). The nucleic acid sequence for Akt3 is sufficient to allow those skilled in the art to routinely select primers to amplify any portion of the gene.In some embodiments, a TaqMan-based assay is used for the quantification of Akt3 polynucleotides. Tests based on TaqManuse a probefluorogenic oligonucleotide © containing a 5 'fluorescent dye and a 3' extinguishing agent. The probe hybridizes to a PCR product, but cannot itself be extended due to a blocking agent at the 3 'end. When the PCR product is amplified in subsequent cycles, the 5 'nuclease activity of the polymerase, AmpliTaq, for example, results in the dividing of the TaqMan probe. This dividing separates the 5 'fluorescent dye and the 3' extinguishing agent, thus resulting in an increase in fluorescence as an amplification function (see, for example, the literature provided by Perkin-Elmer, for example,www.perkin-elmer.com ).Other suitable amplification methods that are contemplated by the invention include, without limitation, ligase chain reaction (LCR) (see, Wu and Wallace, 1989, Genomics 4: 560, Landegren et al., 1988, Science 241: 1077, andBarringer et al., 1990, Gene 89: 117), amplification oftranscription (Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86: 1173), self-sustained sequence replication(Guatelli et al., 1990, Proc. Nat. Acad. Sci. USA 87: 1874), dot PCR, and linker adapter PCR etc.2. Akt3 and / or B-Raf expression detection.a) Tests based on Direct HybridizationMethods of detecting and / or quantifying the level oftranscriptions of Akt3 and / or B-Raf genes (mRNA or cDNA produced from them) using techniques; nucleic acid hybridization methods are known to thosein the technique (see, Sambrook et al., 1989, Molecular Cloning:A Laboratory Manual / 2D Ed., Vols 1-3, Cold Spring Harbor Press, New York).One method for assessing the presence, absence or amount of Akt3 cDNA, for example, involves a Northern blot. In short, in a typical modality, mRNA is isolated from a given biological sample, subjected to electrophoresis to separate the mRNA species and transferred from the gel to a nitrocellulose membrane. The labeled Akt3 probes are then hybridized to the membrane for the identification and / or quantification of the mRNA.b) Amplification-Based AssaysIn another embodiment, an Akt3 and / or B-Raf transcription (Akt3 mRNA, for example) is detected using amplification-based methods (RT-PRC, for example). RT-PCR methods are known to those skilled in the art in the technique (see, for example, Ausubel et al., above). It is preferable to use quantitative RT-PCR, thus allowing comparison of the levels of mRNA in a sample with a control sample or control value.3. Detection of Akt3 and / or B-Raf Polypeptide ExpressionIn addition to detecting Akt3 and / or B-Raf genes and gene expression using nucleic acid and hybridization technology, Akt3 and / or B-Raf levels can also be detected and / or quantified by detecting or quantifying the polypeptide. Akt3 or B-Raf polypeptides are detected and quantified by any of a number of means well known to those skilled in the art. These includebiochemical analytical methods such as electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography and the like, or various immunological methods such as precipitin reactions in fluid or gel, immunodiffusion ( single or double), immuno-electrophoresis, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISA s), immunofluorescent assays, Western blot and the like. The detection of Akt3 polypeptide will be discussed below.C. Expression in prokaryotes and eukaryotesIn some embodiments, it is desirable to produce Akt3 and / or B-Raf polypeptides using recombinant technology. To obtain high-level expression of a cloned gene or cloned nucleic acid such as cDNA encoding an Akt3 or B-Raf polypeptide, an Akt3 or B-Raf sequence is typically subcloned into an expression vector containing a strong promoter to direct transcription, a transcription / translation terminator and, if it is for a nucleic acid encoding a protein, a ribosome binding site for translation initiation. Suitable bacterial promoters are known in the art and are described in Sambrook et al. and in Ausubel et al., for example. Bacterial expression systems for the expression of the Akt3 protein are available from E. coli, Bacillus sp. , and Salmonella, for example. (Paiva et al., 1983, Gene 22: 229-235; Mosbach et al., 1983, Nature 302: 543-545.) Kits for such expression systems arecommercially available. Expression systems for mammalian cells, yeast and insect cells are known in the art and are also commercially available. In one embodiment, the eukaryotic expression vector is an adenoviral vector, an adeno-associated vector or a retroviral vector.For therapeutic applications, a, three and / or B-Raf nucleic acids are introduced into a cell, in vitro, in vivo or ex vivo, using any of a wide number of methods including, without limitation, infection with viral vectors, liposome-based methods, biolistic protein acceleration (the gene gun) and naked DNA injection. Such therapeutically useful nucleic acids include, without limitation, coding sequences for full length Akt3 or B-Raf, coding sequences for a fragment, domain, derivative or variant of Akt3 or B-Raf, antisense sequences of Akt3 or B -Raf, siRNA sequences from Akt3 or B-Raf, and ribozymes from Akt3 or B-Raf. Typically such sequences will be operably linked to a promoter, but in numerous applications, a nucleic acid will be administered to a cell that is itself directly therapeutically effective, certain molecules of antisense siRNA or ribozyme.The promoter used to direct the expression of a heterologous nucleic acid depends on the specific application. The promoter is optionally positioned approximately the same distance from the heterologous transcription start sitethat he is from the transcription start site on hisnatural environment. As is known in the art, however, some variation in this distance can be tolerated without losing the promoter function.In addition to the promoter, the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements necessary for the expression of the nucleic acid encoding Akt3 or encoding B-Raf in host cells. A typical expression cassette, therefore, contains a promoter operably linked to the nucleic acid sequence encoding an Akt3 or B-Raf polypeptide, and the signals necessary for efficient transcriptional polyadenylation, ribosome binding sites and translation termination. The nucleic acid sequence encoding an Akt3 or B-Raf polypeptide can be linked to a cleavable signal peptide sequence to promote secretion of the protein encoded by the transfected cell. Additional elements of the cassette may include enhancers, and, if genomic DNA is used as the structural gene, introns with functional donor recomposition and acceptor sites.In addition to a promoter sequence, the expression cassette must also contain a transcription termination region downstream of the structural gene to provide efficient termination. The termination region can be obtained from the same gene as the promoter sequence or it can be obtained from different genes.The specific expression vector used to transport genetic information to the cell is notespecially critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells can be used. Useful expression vectors, for example, can consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids, E. coli El plasmids, pCRl, pBR322, pMal-C2, pET, pGEX (Smith et al., 1988, Gene 67: 31-4'0), pMB9 and its derivatives, plasmids such as RP4; Phage DNAs, the numerous phage 1 derivatives of NM98 9, for example, and DNA from other phages, such as M13 and phage DNA from a filamentous filament; yeast plasmids such as the 2m plasmid and its derivatives; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like. Mammalian expression vectors contemplated for use in the invention include vectors with inducible promoters, such as dihydrofolate reductase (DHFR) promoter, as well as any expression vector with a DHFR expression vector or a DHFR / co-amplification vector / methotrexate, such as pED (cloning site PstI, Sail, Sbal, Smal and EcoRI, expressing the vector for both the cloned and DHFR gene; see Kaufman, Current Protocols in Molecular Biology, 16.12 (1991). Alternatively, a co-vector amplification of glutamine synthetase / methionine sulfoximine, such as pEE14(HindIII, Xbal, Smal, Sbal, EcoRI and Bell cloning site, where the vector expresses glutamine synthase and the cloned gene; Celltech). In another embodiment, a vector that directs episomic expression under the control of Epstein Barr Virus (EBV) can be used, such as pREP4 (cloning site BamHI, Sfil, Xhol, Notl, NhelI, HindIII, Nhel, PvuII and Kpnl, constitutive promoter of Sarcoma Rous long virus terminal repeat (RSV-LTR), selectable hygromycin marker; Invitrogen), pCEP4 (BamHI, Sfil, Xhol, Notl, Nhel, HindIII, Nhel, PvuII and Kpnl cloning site, immediate human cytomegalovirus (hCMV) gene, selectable hygromycin marker; Invitrogen), pMEP4 (cloning site Kpnl, Pvul, Nhel, HindIII, Notl, Xhol, Sfil, BamHI, inducible metallothionein lia promoter, selectable marker hygromycin: Invitrogen), pREP8 (BamHI, Xhol, Notl, HindIII, Nhel and Kpnl cloning site, RSV-LTR promoter, selectable histidinol marker; Invitrogen), pREP9 (Kpnl, Nhel, HindIII, Nhel, Nhel, cloning site and Kpnl, RSV-LTR promoter, selectable istidinol marker; Invitrogen), pREP9 (Kpnl, Nhel, HindIII, Notl, Xhol, Sfil, and BamHI cloning site, RSV-LTR promoter, selectable G418 marker; Invitrogen), and pEBVHis (RSV-LTR promoter, selectable hygromycin marker, N-terminal peptide purified by ProBond resin and cleaved by enterokinase; Invitrogen). Selectable mammalian expression vectors for use in the invention include, without limitation, pRc / CMV (HindIII, BstXI, Notl, Sbal, and Apal cloning site, G418 selection; Invitrogen),pRc / RSV (HindIII, Spel, BstXI, Notl, Xbal, cloning site,selection of G418; Invitrogen), and others. The mammalian expression vectors in vaccinia virus (see Kaufman / 1991, above) contemplated by this invention include, without limitation, pSCll (Smal cloning site, selection of TK- and .beta.-gal), pMJ601 (site of cloning Sall, Smal, Afll, NarI, BspMII, BamHI, Apal, Nhel, SacII, Kpnl, and HindII; selection of TK-e beta (0) -gal), and pTKgptFIS (cloning site EcoRI, PstI, Sall, AccI , Hindu, Sbal, BamHII, and Hpa, selection of TK or XPRT).Elements that are typically included in the expression vectors also include a replicon that functions in E. coli, a gene that encodes antibiotic resistance to allow selection of bacteria that contain recombinant plasmids and unique restriction sites in non-essential regions of the plasmid for allow the insertion of eukaryotic sequences. The specific antibiotic resistance gene chosen is not critical, and any of the many resistance genes known in the art may be suitable. Prokaryotic sequences are optionally selected in such a way that they do not interfere with DNA replication in eukaryotic cells, if necessary.Once a specific recombinant DNA molecule has been identified and isolated, several methods known in the art can be used to propagate it. Once the appropriate host system or culture conditions have been established, recombinant expression vectors can be propagated and prepared in quantity. The vectors ofExpressions that can be used include, without limitation, the following vectors or their derivatives: human or animal viruses such as vaccinia virus or adenovirus; insect viruses such as baculovirus; yeast vectors; bacteriophage vectors (À, for example) and plasmid and cosmid DNA vectors, to name just a few and are known to those skilled in the art.In addition, a strain of host cells can be chosen that modulates the expression of the inserted sequences or modifies and processes the genetic product in a specifically desired way. Different host cells have characteristic and specific mechanisms for translational and post-translational processing and protein modification. Suitable cell lines and host systems can be chosen to ensure the desired modification and processing of the expressed foreign protein. Yeast expression can produce a biologically active product. Expression in eukaryotic cells increases the likelihood of folding * # * native * # *. In addition, expression in mammalian cells can provide an instrument for the reconstitution or constitution of Akt3 and / or B-Raf activity in melanoma. In addition, different expression systems in vector / host can affect processing reactions, such as proteolytic cleavages to a different extent.Standard transfection methods are used to produce bacterial, mammalian, yeast or insect cell lines that express large amounts ofan Akt3 or B-Raf protein, which are then purified using standard techniques (see, for example, Colley et al., 1989, J. Biol. Chem. 264: 17619-17622; * # * Guide to Protein Purification * # * in Methods in Enzymology, Vol. 182, 1990 (Deutscher, Ed.). Transformation of eukaryotic and prokaryotic cells is conducted according to standard techniques (see, for example, Morrison, 1977, J. Bact. 132: 349 -351; Clark-Curtiss & Curtiss, Methods in Enzymology 101: 347-362, 1983 (Wu et al., Eds.).Any of the well-known procedures for introducing foreign nucleotide sequences into host cells can be used. These include the use of reagents such as Superfect (Qiagen), liposomes, calcium phosphate transfection, polybrene, protoplast fusion, electroporation, microinjection plasmid vectors, viral vectors, acceleration of biological particles (the gene gun) or anyone other well-known methods for introducing genomic DNA, cDNA, cloned synthetic DNA or other foreign genetic material into a host cell (see, for example, Sambrook, et al., above).After the expression vector has been introduced into the cells, the transfected cells are cultured under conditions that favor the expression of the Akt3 and / or B-Raf polypeptide, which is recovered from the culture using standard techniques identified below. Methods of culturing prokaryotic or eukaryotic cells are well known and are taught, for example, in Ausubel et al., Sambrook etal., and in Freshney, 1993, Culture of Animal Cells, 3. sup.rd.Ed., a Wiley-Liss publication.Any of the well-known procedures for introducing foreign nucleotide sequences into host cells can be used to introduce a vector, a targeting vector, for example, into cells. Any of the well-known procedures for introducing foreign nucleotide sequences into host cells can be used. As will be given below, the nucleic acids of the present invention can be introduced into cells by any genetic transfer mechanism, such as, for example, by virus-mediated gene delivery, calcium phosphate-mediated gene delivery, electroporation, microinjection or proteoliposomes. The transduced cells can then be infused (in a pharmaceutically acceptable vehicle, for example) or transplanted homotopically back to the patient by standard methods for the cell or tissue uncle. Standard methods are known for the transplantation or infusion of several cells in a patient.The delivery of nucleic acid or vector to cells can be through a variety of mechanisms. As an example, delivery can be via a liposome, using commercially available liposome preparations such as LIPOFECTIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, Md.), SUPERFECT (Qiagen, Inc. Hilden, Germany) and TRANSFECT (Promega Biotec, Inc., Madison,Wis), as well as other liposomes developed according towith standard procedures in the art. In addition, the nucleic acid or vector of the present invention can be supplied in vivo by electroporation, for which the technology is available from Genetronics, Inc. (San Diego, Calif) as well as through a SONOPORATION machine (ImaRx Pharmaceutical Corp ., Tucson, Ariz.).As an example, vector delivery can bevia a viral system, such as a retroviral vector system that can package a recombinant retroviral genome (see, 62, 63, for example). 0 retrovirusrecombinant can then be used to infect and therefore supply the infected cells with nucleic acids. The exact method of introducing nucleic acid into mammalian cells is, of course, not limited to the use of retroviral vectors. Other techniques are widely available for this procedure including the use of adenoviral vectors, adeno-associated viral vectors (AAV), lentiviral vectors, pseudo-typical retroviral vectors. Physical transduction techniques, such as liposome and receptor-mediated delivery and other mechanisms of endocytosis, can also be used. This invention can be used in conjunction with any of these and other commonly used gene transfer methods.Induction of Apoptosis in a Cancer Cell byReduction of Akt3 Activity Levels in Cell.In one embodiment, the present invention proposes methods of inducing apoptosis in a tumor cell ofmelanoma by placing a cell in contact with an agentwhich reduces Akt3 activity. In a preferred embodiment, the agent is a siRNA molecule.A siRNA polynucleotide is an RNA nucleic acid molecule that mediates the effect of RNA interference, a silencing mechanism of the post-transcriptional gene. a siRNA polynucleotide preferably comprises a two-stranded RNA (dsRNA), but is not intended to be SO limited and can comprise a single-stranded RNA (see, for example, Martinez et al. Cell 110: 563- 574 (2002)). A siRNA polynucleotide may comprise other naturally occurring, recombinant, or synthetic polymers of a single strand or two strands (ribonucleotides or deoxy-ribonucleotides or a combination of the two) and / or nucleotide analogs as provided in the present invention ( an oligonucleotide or polynucleotide or the like, for example, typically in the 5 'to 3' phosphodiester bond). Consequently, it should be noted that certain exemplary sequences described in this document as DNA sequences capable of directing the transcription of a modality of the siRNA polynucleotides of the present invention are also intended to describe the corresponding RNA sequences and their complements, given the well-established principles. complementary nucleotide base pairings. A siRNA can be transcribed using as a template a DNA (genomic, cDNA or synthetic) that contains an RNA polymerase promoter, a U6 promoter or the H1 RNA polymerase III promoter, for example, u then the siRNA can be a molecule of RNAsynthetically derived. In certain embodiments, the siRNA polynucleotide of the present invention may have blunt ends, that is, each nucleotide in a duplex strand is perfectly complementary (by Watson-Crick base pairing, for example) with a nucleotide from the opposite strand. In certain other embodiments, at least one strand of the siRNA polynucleotide of the present invention has at least one, and preferably two, riucleotides that * # * hang * # * (i.e., that do not form a base pair with a complementary base in the opposite strand) at the 3 'end of one of the strands, or preferably of the two strands, of the siRNA polynucleotide. In certain other embodiments of the invention, each strand of the siRNA polynucleotide duplex has a pendant portion of two nucleotides at the 3 'end. The pendant part of two nucleotides is preferably a thymidine (TT) dinucleotide, but it can also comprise other bases, consisting, for example, of a TC dinucleotide or a TG dinucleotide or any other dinucleotide. For a discussion of the 3 'ends of the siRNA polynucleotides see, for example, WO 01 / 75164.Preferred siRNA polynucleotides comprise two-strand oligomeric nucleotides that have approximately 18-30 base pairs of nucleotides, preferably 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 base pairs, and in other preferred embodiments approximately 19, 20, 21, 22 or 23 base pairs or approximately 27base pairs, with the use of * # * approximately * # * indicating,as described above, that in certain modalities and under certain conditions, the process cleavage steps that can give rise to functional siRNA polynucleotides that are capable of interfering with the expression of a polypeptideselected video may not be absolutely efficient. Therefore, siRNA polynucleotides, having * # * approximately * # * 18, 19, 20, 21, 22, 23, 24, or 25 base pairs, for example, can include one or more molecules ofsiRNA polynucleotides that may differ (by nucleotide insertion or deletion, for example) in the length of one, two, three or four base pairs, as a non-limiting theory, as a consequence of processing variability, in biosynthesis, or in artificial synthesis. The siRNA polynucleotides contemplated by the present invention may also comprise a polynucleotide sequence that presents a variability by differing (by substitution of nucleotides, including transition or trans-version, for example) of one, two, three or four nucleotides of a specific q , the differences occurring in any of the positions, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of a specific siRNA polynucleotide sequence, or at positions 20, 21, 22, 23, 24, 25, 26, or 27 of siRNA polynucleotides depending on the length of the molecule, either located in one direction or in an antisense polynucleotide strand of two filaments. The nucleotide substitution can occur only in one strand, as an example in the antisense filament, of a two-polynucleotidefilaments, and the complementary nucleotide with which the substitute nucleotide would typically form a base pair by hydrogen bonding may not necessarily be correspondingly replaced in the strand in the sense. In preferred embodiments, siRNA polynucleotides are homogeneous with respect to a specific nucleotide sequence. As described herein, siRNA polynucleotides interfere with the expression of the Akt3 polypeptide of the invention. These polynucleotides can also find uses as probes or primers.Polynucleotides which are siRNA polynucleotides of the present invention may in certain embodiments be derived from a single strand polynucleotide comprising a single strand oligonucleotide fragment (having approximately 18-30 nucleotides, for example, which should be understood to include any integer number of nucleotides including and between 18 and 30) and its reverse complement, typically separated by a spacer sequence. As determined by such modalities, the spacer cleavage provides the single-stranded oligonucleotide fragment and its reverse complement so that they can ring to form (optionally with additional process steps that can result in the addition or removal of one, two , three or more nucleotides from the 3 'end and / or the 5' end of one of the strands or both) the two-strand siRNA polynucleotide of the present invention. In certain embodiments, the spacer has a length that allows it to bethe fragment and its reverse complement will ring to form a two-filament structure (like apolynucleotide in a hairpin, for example), before dividing the spacer (and, optionally,subsequent processing that may result in the addition or removal of one, two, three, four or more nucleotides from the 3 'end and / or the 5' end of one of the filaments or both). A spacer sequence can therefore consist of any polynucleotide sequence as proposed in this document, which is located between two regions of complementary polynucleotide sequence that, when annealed to a two-stranded nucleic acid, comprise a siRNA polynucleotide. It is preferable that the spacer sequence comprises at least 4 nucleotides, although in certain embodiments, the spacer may comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20, 21-25, 26-30, 31-40, 41-50, 51-70, 71-90, 92-110, 111-150, 151-200 or more nucleotides. Examples ofsiRNA polynucleotides derived from a single nucleotide strand comprising two complementary nucleotide sequences separated by a spacer have already been described. (Brummelkamp et al., 2002 Science 296: 550;Paddison et al., 2002 Genes Develop. 16: 948; Paul et al. Nat. Biotechnol. 20: 505-508 (2002); Grabarek et al.,BioTechniques 34: 734-44 (2003)).Polynucleotide variants may contain one or more substitutions, additions, deletions and / or insertions, ofsuch that the activity of the siRNA polynucleotide does notsubstantially reduced, as described above. The effect on siRNA polynucleotide activity can generally be assessed in the manner described above or using conventional methods. The variants preferably have at least approximately 75%, 78%, 80%, 85%, 87%, 88% or 89% and being more preferable at leastapproximately 90%, 92%, 95%, 96%, 97%, 98% or 99% ofidentity with a portion of a polynucleotide sequence that encodes a native Akt3. The percentage ofidentity can be easily determined by comparisonof the polynucleotide sequences with the corresponding portion of a full length Akt3 polynucleotide, such as those known in the art and cited herein, using any method, including the use of computer algorithms well known to those skilled in the art, such as such as the Align or BLAST algorithm (Altschul, J. Mol. Biol. 219: 555-565, 1991; Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915-10919, 1992), which is available on the NCBI website (see [online] Internet:<URL:http: / / www / nebi.nlm.nih.gov / cgi-bin / BLAST ). Default parameters can be used.Certain polynucleotide variants of siRNA are substantially homologous to a portion of a native PTP 1B gene. Single-stranded nucleic acids derived (by thermal denaturation, for example) from such polynucleotide variants are able to hybridize under moderately drastic conditions at anaturally occurring DNA or RNA sequencewhatencodes a native Akt3 polypeptide (or a complementary sequence). A polynucleotide that hybridizes detectably in moderately drastic conditions may have a nucleotide sequence that includes at least 10 consecutive nucleotides, with 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 being more preferable , 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides complementary to a specific polynucleotide. In certain preferred embodiments, that sequence (or its complement) will be specific to an Akt polypeptide for which expression is desired, and in certain other modalities, the sequence (or its complement) can be shared by Akt3 and a or more isoforms of Akt for which interference with polypeptide expression is desired. In certain preferred embodiments, that sequence (or its complement) will be specific to a B-Raf polypeptide for which expression is desired, and in certain other modalities, the sequence (or its complement) can be shared by B-Raf and one or more isoforms of Raf for which interference with polypeptide expression is desired.Suitable moderately drastic conditions include, for example, prewash in a solution of 5 x SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0); hybridization at 50 ° C ~ 70 ° C, 5 x SSC for 1-16 hours (overnight, for example); followed by washing once or twice at 22-65 ° C for 20-40 minutes with one or more of each 2x,0.5x and 0.2x SSC containing 0.05-0.1% SDS. Foradditional drasticityz conditions can include a wash in 0.1 x SSC and 0.1% SDS at 50-60 ° C for 15-40 minutes. As is known to those skilled in the art, variations in the degree of drasticity of hybridization conditions can be obtained by changing the time, temperature, and / or concentration of the solutions used for the prehybridization, hybridization and washing steps. The appropriate conditions may also depend in part on the specific nucleotide sequences of the probe used, and on the tested nucleic acid sample analyzed by blot. Consequently, it will be noted that suitably drastic conditions can be easily selected without undue experimentation, when the desired selectivity of the probe is identified, based on its ability to hybridize to one or more test sequences, not hybridizing to certain other test sequences. .The sequence-specific siRNA polynucleotides of the present invention can be designed using one or more of several criteria. To design a siRNA polynucleotide that has 19 consecutive nucleotides identical to a sequence encoding a polypeptide of interest, for example (Akt3, and other polypeptides described in this document, for example), the open reading frame of the polynucleotide sequence can be scanned for sequences of 21 bases that have one or more of the following characteristics: (1) an Ai T / GiC ratio of approximately 1: 1, but not above 2: 1 or 1: 2; (2) an AA dinucleotide or a CA dinucleotide in the5 'end; (3) an internal melting temperature in the clamp handle below 55 ° C; (4) a homodimer melting temperature below 37 ° C (the melting temperature calculations as described in (3) and (4) can be determined using computer software known to those skilled in the art); (5) a sequence of at least 16 consecutive nucleotides not identified as being present in any of the other known polynucleotide sequences (such an assessment can be easily determined using computer programs available to those skilled in the art such as BLAST to search for bases publicly available data). Alternatively, a siRNA polynucleotide sequence can be designed and selected using commercially available computer software from various representatives (OligoEngine. TM. (Seattle, Wash); Dharmacon, Inc. (Lafayette, Colo.); Ambion Inc (Austin, Tex); and QIAGEN, Inc. (Valencia, Calif.)). (See also Elbashir et al., Genes & Development 15: 188-200 (2000); Elbashir et al., Nature 411: 494-98 (2001); and (online) Internet: URL<http: / / www.mp-ibpc.gwdg.de / abtdeilungen / 100 / 105 / Tuschl_MIV2(3).sub.--2002.df.). The siRNA polynucleotides can then be tested for their ability to interfere with expression of the target polypeptide according to the methods known in and described herein. Determining the effectiveness of a siRNA polynucleotide includes not only considering its ability to interfere with polypeptide expression, but also includes theconsideration of the siRNA polynucleotide manifesting effectsundesirable toxicants / such as apoptosis of a cell whose death is not a desired effect of RNA interference (interference with Akt3 expression in a cell, for example).Those skilled in the art will readily note that as a result of the degeneration of the genetic code, many nucleotide sequences can encode a polypeptide as described in this document. That is, an amino acid can be encoded by one of several different codons and those skilled in the art can easily determine that, although a sequence of nucleotidesspecifies may differ from one another (which can be determined by the alignment methods described in this document and known in the art), the sequences can encode polypeptides with identical amino acid sequences. As an example, the amino acid leucine in a polypeptide can be encoded by one of six different codons (TTA, TTG, CTT, CTC, CTA, and CTG) as serine (TCT, TCC, TCA, TCG, AGT and AGC). Other amino acids, such as proline, alanine and valine, for example, can be encoded by any of four different codons (CCT, CCC, CCA, CCG for proline; GCT, GCC, GCA, GCG for alanine; and GTT, GTC, GTA, GTG for valine). Some of these polynucleotides have minimal homology to the nucleotide sequence of any native gene. Even so, polynucleotides that vary due to differences in the use of codons are specifically contemplated by the present invention.Polynucleotides, including target polynucleotides (polynucleotides capable of encoding a target polypeptide of interest, for example) can be prepared using any of a variety of techniques, which will be useful for the preparation of specifically desired polynucleotides and siRNA and for the identification and selection of desirable sequences to be used in siRNA polynucleotides. A polynucleotide, for example, can be amplified from cDNA prepared from a suitable cell or tissue uncle. Such polynucleotides can be amplified by means of polymerase chain reaction (PCR). For this approach, sequence specific primers can be designed based on the sequences given in this document or else the primers can be acquired or synthesized, an amplified portion can be used to isolate a full-length gene, or a desired portion of it, from a suitable library (from human melanoma cDNA, for example), using well-known techniques. Among such techniques, a library (of cDNA or genomics) is examined using one or more polynucleotide probes or probes suitable for amplification. It is preferable that a library is selected by size to include larger molecules. Randomly stimulated libraries may also be preferred foridentification of 5 'and upstream regions of genes. Genomic libraries are preferred for obtaining introns and for extending 5 'sequences. The appropriate sequences for a siRNA polynucleotidecontemplated by the present invention can also be selected from a library of siRNA polynucleotide sequences.For hybridization techniques, a partial sequence can be labeled (for notch translation, for example, or for end labeling with32P), using well-known techniques, a bacterial or bacteriophage library can then be examined for hybridization filters containing denatured bacterial colonies (or lawns containing phage plates) with the labeled probe (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, 2001). Colonies or hybridization plates are selected and expanded and the DNA is isolated for further analysis. The clones can be analyzed to determine the amount of additional sequence, by PCR, for example, using a primer from the partial sequence and a vector primer. Restriction maps and partial sequences can be generated to identify one or more overlapping clones. A full-length cDNA molecule can be generated by ligating suitable fragments, using well-known techniques.Alternatively, numerous amplification techniques are known in the art for obtaining a full-length coding sequence from a partial cDNA sequence. In such techniques, amplification is generally conducted by PCR. such a techniqueis known as a * # * rapid amplification ofDNAc * # * or RACE. This technique involves the use of an internal primer and an external primer, which hybridizes to a polyA region or a vector sequence, to identify sequences that are 5 'or 3' from a known sequence. Any of a variety of commercially available kits can be used to drive the amplification step. The initiators can be designed using, for example, software well known in the art. Primers (or oligonucleotides for other uses contemplated herein, including, for example, antisense probes and oligonucleotides) are preferably 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29, 30, 31 or 32 nucleotides in length, have a GC content of at least 40% and anneal to the target sequence at temperatures between approximately 54 ° C and 72 ° C. The amplified region can be sequenced as described above, and the overlapping sequences can be assembled in a contiguous sequence. Certain oligonucleotides contemplated by the present invention may, for some preferred embodiments, have lengths of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33-335, 35-40, 41-45, 46-50, 56-60, 62-70, 72-80, 82-90, or more nucleotides.The nucleotide sequences as described herein can be linked to a variety of other nucleotide sequences, using established recombinant DNA techniques. A polynucleotide, for example, can be cloned into any of a variety of cloning vectors, including plasmids, phagemids, derivatives ofÀ phages, and cosmids. The vectors of specific interest include expression vectors, replication vectors, probe generation vectors and sequencing vectors. In general, a suitable vector contains an origin of functional replication in at least one organism, convenient restriction endonuclease sites and one or more selectable markers (See, for example, WO 01 / 96584; WO 01 / 29058; US patent no. 6,326,193; US 2002 / 0007051).Other elements will depend on the intended use and will become apparent to those skilled in the art. The invention, for example, contemplates the use of siRNA polynucleotide sequences in the preparation of recombinant nucleic acid constructs including vectors to interfere with the expression of a desired target polypeptide such as an Akt3 or B-Raf polypeptide in vivo; the invention also contemplates the generation of transgenic animals or * # * knockout * # * for siRNA and cells (cells, for example, cell clones, lineages or organisms in which the expression of one or more desired polypeptides (a target polypeptide, for example) example) is totally or partially compromised). A siRNA polynucleotide that is capable of interfering with the expression of a desired polypeptide (a target polypeptide, for example) as set out in this document, therefore includes any siRNA polynucleotide that, when placed in contact with a patient or with a biological source, as provided in this document, under such conditions and for such a sufficient time that expression of the target polypeptide occursin the absence of the siRNA polynucleotide, results in astatistically significant reduction (referred to alternatively as a * # * dejection * # * expression) in the level of target polypeptide expression that can be detected. It is preferable that the reduction is greater than 10%, more preferable above 20%, more preferable above 30%, more preferable above 40%, 50%, 60%, 70%, 75%, 80%, 85% , 90%, 95%, or 98% with respect to the level of polypeptide expression detected in the absence of siRNA, using conventional methods for determining polypeptide expression as is known in the art and set forth herein. It is preferred that the presence of siRNA polynucleotide in a cell does not result in or cause any undesirable toxic effects, such as, for example, the apoptosis or death of a cell in which apoptosis is not a desired RNA interference effect.The exemplary 19-mere sequences for aKT3 siRNA as described herein are for human Akt3 (NM_005465): Akt3 duplex 2: CUAUCUACAUUCCGGAAAG; Akt3 duplex 4: GAAUUUACAGCUCAGACUA; and duplex 5 for Akt3: CAGCUCAGACUAUUACAAU.Exemplary 25-sequences for Akt3 siRNA as described in the present are the following: Initiator Name Akt3 Sequence # 2 Direction CUUGGACUAUCUACAUUCCGGAAAG Akt3 # 2 Antisense CUUUCCGGAAUGUAGAUAGUCCAAG AktU AAUAkt3 # 5 Antisense AUUGUAAUAGUCUGAGCUGUAAAUUExemplary sequences of 25 B-Raf siRNA as described herein are for human B-Raf mutant: 5 'GGUCUAGCUACAGAGAAAUCUCGAU 3' and for human B-Raf 5 'of the native type GGACAAAGAAUUGGAUCUGGAUCAU 3'.The present invention also relates to the use of a virus-mediated strategy that results in the silencing of a target gene, PTEN, by means of siRNA. The use of this strategy results in a markedly reduced expression of PTEN, thus leading to an increase in total phosphorylated Akt. This virus-mediated strategy is useful in identifying the mechanism behind the dysregulation of Akt3 in melanomas in order to model biological processes or to provide therapy for this cancer.The present invention also relates to vectors and constructs that include or encode siRNA polynucleotides of the present invention, and specifically to * # * recombinant nucleic acid constructs * # * that include any nucleic acid such as the DNA polynucleotide segment that can be transcribed to produce the siRNA polynucleotides specific for the Akt3 polynucleotide according to the invention as set out above; to host cells that are genetically constructed with vectors and / or constructs of the invention and to the production of polynucleotides, polypeptides and / or siRNA fusion proteins of the invention, or their fragments or variants, by recombinant techniques. The siRNA sequences described in the presentdocument how RNA polynucleotides can be constructedto produce corresponding DNA sequences using well-established methodologies such as those described herein. Thus, a DNA polynucleotide, for example, can be generated from any siRNA sequence described herein, such that the siRNA sequences of the present invention are recognized as well as providing the corresponding DNA polynucleotides (and their complements) . These DNA polynucleotides are, therefore, encompassed by the invention contemplates, to be incorporated, for example, into the recombinant nucleic acid constructs of the present invention from which siRNA can be transcribed.In another embodiment, the agent is a siRNA molecule, the siRNA molecule comprising a polynucleotide that has the sequence of 5 'GGUCUAGCUACAGAGAAAUCUCGAU 3' or its complement. In yet another embodiment, the agent is a siRNA molecule, the siRNA molecule comprising a polynucleotide that has the sequence 5 'CUAUCUACAUUCCGGAAAG 3'In yet another embodiment, the agent is a siRNA molecule, comprising a siRNA molecule polynucleotide that has the sequence 5 'GAAUUUACAGCUCAGACUA 3', or its complement. In another embodiment, the agent is a siRNA molecule, the siRNA molecule comprising a polynucleotide that has the sequence of 5 'CAGCUCAGACUAUUACAAU 3', or its complement. In a further embodiment, the agent is a siRNA molecule, the siRNA molecule comprising a polynucleotide that has the sequence of 5 'CUUGGACUAUCUACAUUCCGGAAAG 3', or itscomplement. In yet another embodiment, the agent is a siRNA molecule, the siRNA molecule comprising a polynucleotide that has the sequence of 5 'CUUUCCGGAAUGUAGAUAGUCCAAG 3', or its complement. In aIn yet another embodiment, the agent is a siRNA molecule, the siRNA molecule comprising a polynucleotide that has the sequence of 5 'GAUGAAGAAUUUACAGCUCAGACUA 3', or its complement. In yet another embodiment, the agent is a siRNA molecule, the siRNA molecule comprising a 10 polynucleotide that has the 5 'sequenceUAGUCUGAGCUGUAAAUUCUUCAUC 3 ', or its complement. In yet another embodiment, the agent is a siRNA molecule, the siRNA molecule comprising a polynucleotide that has the 5 'sequence. AAUUUACAGCUCAGACUAUUACAAU 3 ', or your15 complement. In yet another embodiment, the agent is a siRNA molecule, the siRNA molecule comprising a polynucleotide that has the sequence of 5 'AAUUGUAAUAGUCUGAGCUGUAAAUU 3', or its complement, in a preferred embodiment, the agent comes into contact with a 20 cell using any of the well-known procedures for introducing foreign nucleotide sequences into host cells. These include, but are not limited to, a liposome, a nanoliposome, a ceramide-containing nanoliposome, a proteoliposome, a nanoparticle material, a calcium phosphate-silicate nanoparticulate material, a calcium phosphate nanoparticulate material, a nanoparticulate material silicon dioxide, ananocrystalline particulate material, a material insemiconductor nanoparticles, a nanodendrimer, a virus, a supply of nucleotides mediated by nucleotides of calcium phosphate, poly (D-arginine), electroporation and microinjection. The use of nanoliposome, and a material in nanoparticles, a nanodendrimer for the delivery of agents to a cell is demonstrated in Figures 5-11 and described in more detail in order Serial No. 10 / 835,520, filed on April 26, 2004 , incorporated by reference in this document.Anti-sense polynucleotidesIn another embodiment, the agent is an antisense polynucleotide.Specifically contemplated modalities refer to the kT infrarregulation of Akt3 activity by the use of antisense polynucleotides, that is, a complementarity of nucleic acid a, and that one can preferably hybridize specifically to a nucleic acid sequence of encoding mRNA, for example, Akt3 mRNA or a sub-sequence thereof. Binding of the antisense nucleotide to Akt3 mRNA reduces the translation and / or stability of Akt3 or B-Raf mRNA.Within the context of the invention, polynucleotidesantisense may comprise naturally occurring nucleotides or synthetic species formed from naturally occurring subunits or their close counterparts. Antisense polynucleotides can also have altered sugar moieties or inter-sugar bondschanged. Examples of these are phosphorothioate andother sulfur-containing species that are well known for use in the art. All such analogs are covered by this invention as long as they function effectively to hybridize Akt3 or B-Raf mRNA. For a general review, see, for example, Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of gene Expression, CRC Press, 1989; and Synthesis 1: 1-5 (1988).AntagonistsThe present invention also contemplates a modality in which the agent that reduces Akt3 activity is found in an antisense polynucleotide. The invention also relates to variants of the Akt3 proteins that function as Akt3 antagonists. Variants of the Akt3 protein can be generated by mutagenesis (mutation or truncation of the Akt3 protein at discontinuous points, for example). An Akt3 protein antagonist can inhibit one or more of the activities of the naturally occurring form of Akt3 by, for example, competitively binding to a downstream or upstream member of a cell signaling cascade that includes the Akt3 protein . Thus, specific biological effects can be obtained by treatment with a limited function variant. The present invention contemplates the treatment of a patient with a variant that has a subset of the biological activities of the naturally occurring form of the protein and which has less side effects on a patient compared to treatment with the naturally occurring form of the Akt3 proteins.Variants of the Akt3 protein that will function as Akt3 antagonists can be identified by examining combinatorial libraries of mutants (truncated mutants, for example) of the Akt3 proteins for Akt3 antagonist activity. The present invention contemplates that a library of variegated variants of Akt3 is generated by combinatorial mutagenesis at the level of nucleic acid and is encoded by a library of variegated genes. A variegated library of Akt3 variants can be produced by enzymatically linking, for example, a mixture of synthetic oligonucleotides in the gene sequences in such a way that a degenerate set of potential Akt3 sequences that can be expressed as individual polypeptides, or alternatively, as a set of larger fusion proteins (for phage display, for example) containing the set of Akt3 strings inside. There are a variety of methods that can be used to produce libraries of potential Akt3 variants from a degenerate oligonucleotide sequence. The chemical synthesis of a degenerate gene sequence can be conducted on an automatic DNA synthesizer, and the synthetic gene is then linked into an expression vectorappropriate. The use of a degenerate set of genes allows the provision in a mixture of all the sequences that encode the desired set of potential Akt3 sequences. Methods for the synthesis of degenerate oligonucleotides are well known in the art. See, forexample, Narang, 1983. Tetrahedron 39: 3; Itakura, et al.,1984. Annu. Rev. Biochem. 53: 323; Itakura,et al., 1984.Science 198: 1056; Ike, et al., 1983. Nucl. Acids Res. 11: 477.RibozymesIn yet another embodiment, the agent is a ribozyme. A ribozyme can be used to target and inhibit Akt3 transcription. A ribozyme is an RNA molecule that catalytically cleaves other RNA molecules. different types of ribozymes have been described, including group I ribozymes, hammerhead ribozymes, hairpin ribozymes, RNase P, and ax head ribozymes (see, for example, Castanotto et al. 1994, Adv. In Pharmacology 25: 289-317 for a general review of the properties of ribozymes).The general characteristics of ribozymes in hair grain are described, for example, in Hampel et al., 1990, Nucl. Acids Res., 18: 299-304; Hampel et al., 1990, European patent publication No. 0 360 257; U.S. Patent No. 5,254,678. Preparation methods are known to those skilled in the art (see, for example, Wong-Staal et al., WO 94 / 26877; Ojwang et al., 1993, Proc. Natl. Acad. Sci. USA, 90: 6340-6344 ; Yamada et al., 1994, Human Gene Therapy 1: 39-45; Leavitt et al., 1995, Proc. Natl. Acad. Sci. USA, 92: 699-703; Leavitt et al., 1994, Human Gene Therapy 5:1151-120; and Yamada et al., 1994, Virology 205: 121-126).Akt3 Polypeptide Activity InhibitorsIn yet another modality, Akt3 activityis reduced by the agent that is an inhibitor of the polypeptide ofAkt3. This can be achieved in a number of ways, including providing a dominant negative Akt3 polypeptide, a form, of Akt3 itself, for example, which has no activity and which, when present in the same cell as a functional Akt3, reduces or eliminates Akt3 activity from functional Akt3. The design of dominant negative forms is well known to those skilled in the art and is described, for example, in Herskowitz, 1987, Nature, 329: 219-22. In addition, inactive variants of polypeptide (muteins) can be used, testing, for example, for the ability to inhibit Akt3 activity. Methods of making muteins are well known to those skilled in the art (see, for example, U.S. Patent No. 5,486,463, 5,422,260, 5,116,943, 4,752,585, 4,518,504). In addition, any small molecule, such as any peptide, Mann, nucleotide, lipid, carbohydrate, or any other organic or inorganic molecule can be examined for the ability to bind to Akt3 or to inhibit its activity.PeptidesIn another embodiment, the agent, a peptide that corresponds to the contiguous amino acid sequences of the plecstrin homology domain, or the Akt3 catalytic or regulator domain, will reduce Akt3 activity. Without wishing to be surrounded by this theory, the peptide is contemplated to act as a pseudosubstrate or as a competitive inhibitor, thus inhibiting Akt3 activity. In another embodiment, the peptide acts as a pseudo-substrate for the Akt3 (tail) catalytic or regulatory domain.In yet another embodiment, the peptide acts as a competitive inhibitor for the Akt3 catalytic domain. The inventors also contemplate that the peptide acts as a competitive inhibitor for the homology domain of Akt3 plecstrin. In yet another modality, the peptide acts as a competitive inhibitor for the regulatory domain of Akt3. Those skilled in the art can readily design and determine whether a peptide reduces Akt3 activity. Obata T et al. J. Biol. Chem. 275 (46): 36108-15 (2000), Niv MY et al. J. Biol. Chem. 279 (2): 1242-55. Epub 2003 (2004), Luo Y et al. Biochemistry. 43 (5): 1254-63 (2004).The cells are incubated, for example, with the peptide under appropriate conditions to assess Akt3 activity. Akt3 activity is evaluated and compared with an appropriate control, such as the activity of the same cells incubated under the same conditions in the absence of the peptide or a mixed peptide, for example, using Western blot analysis with an antibody that recognizes threonine 305 or serine 472. Antibodies that recognize Akt3 are available from a number of sources, including Stratagene (La Jolla, CA) and IGeneX, Inc. (Paio Alto) to name a few. Alternatively, Akt3 activity could be assessed for Akt3 immunoprecipitation using the immunoprecipitate in an in vitro kinase assay in which Crosstide, a synthetic peptide substrate for Akt3 available from Discover Rx Corporation, Fremont, CA is phosphorylated by Akt3 to estimate your activity. Angreater or lesser phosphorylation activity compared to thecontrol indicates that the test peptide reduces the activity of the Akt3 in question.A peptide comprises approximately 5 to 30amino acid residues in length, preferably between 10 and 20 amino acids in length. The sequences ofpeptides of the present invention can be synthesized by the solid phase peptide synthesis method (from BOC orFmoc, for example) by solution phase synthesis, or byany other suitable technique including combinations of the above methods. The BOC and Fmoc methods, which are established and are widely used, are described in Merrifield, J. Am. Chem. Soc. 88: 2149 (1963); Meienhofer, Hormonal Proteins and Peptides, C.H. Li, Ed., Academic Press, 1983, pp. 48-267; and Barany and Merrifield, in The Peptides, E. Gross and J. Meienhofer, Eds., Academic Press, New York, 1980, pp. 3-285. Solid phase peptide synthesis methods are described in Merrifield, R.B., Science, 232: 341 (1986); Carpino, L. A. and Han, G.Y., J. Org. Chem., 37: 3404 (1972); and Gauspohl, H. et al., Synthesis, 5: 315 (1992)). The instructions for these references are incorporated by reference into this document.Small MoleculesThe present invention also contemplates a modality in which the agent that reduces Akt3 activity is a small molecule. Small molecules can also be used to regulate, for example, the function of the described kinase, kinase receptors, molecules that interact with kinase receptors, and molecules in the signaling pathwayskinase receptors. Those skilled in the art will understand how to generate small molecules of this type, and exemplary libraries and methods for the isolation of small molecule regulators. The * # * small molecules * # *, as used in the present, bind, preferably to Akt3 and / or B-Raf and inhibit at least one of its functions.Modulators and Connection CompoundsThe compounds tested as modulators of an Akt3 and / or B-Raf protein can consist of any small chemical compound, a biological entity, such as a protein, sugar, nucleic acid or lipid. Typically the test compounds will be small chemical molecules and peptides. Essentially any chemical compound can be used as a modulator or potential binding compound in the assays of the invention, although the compounds can more often be dissolved in aqueous or organic solutions (especially based on DMSO). The assays are designed to test large chemical libraries by automating the assay steps and providing compounds from any convenient source for assays, which are typically conducted in parallel (in microtiter formats on microtiter plates in robotic assays, for example) . It should be noted that there are many suppliers of chemical compounds including Sigma (St. Louis, Mo.), Aldrich (St. Louis, Mo.), Sigma-Aldrich (St. Louis, Mo.), Fluka Chemika-Biochemica Analytik (Buchs ,Switzerland) and the like.The present invention contemplates high-throughput test methods that cover the provision of a combinatorial chemical library or peptides containing a large number of potential therapeutic compounds (potential modulating and binding compounds). Such * # * combinatorial chemical libraries * # * are then tested in one or more assays, as used at present, to identify those library members (specific chemical species or subclasses) that have a desired characteristic activity, the compounds thus identified can serve as * # * conventional * # * first-line compounds or can themselves be used as potential or actual therapeutic agents.A combinatorial chemical library is a collection of various chemical compounds generated either by chemical synthesis or biological synthesis, by combining a series of chemical * # * modules * # * such as reagents, A linear combinatorial chemical library such as a polypeptide library it is formed by combining a set of chemical building blocks (amino acids) in any way possible for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such a combinatorial mixture of chemical modules.The preparation of combinatorial chemical libraries is well known to those skilled in the art. Such combinatorial chemical libraries include, without limitation, peptide libraries (see, for example, U.S. Patent No. 5,010,175, Furka, 1991, Int. J. Pept. Prot. Res. 37: 487-493 and Houghton et al., 1991, Nature 354: 84-88). Other chemicals for generating chemical diversity libraries can also be used. Such biochemical products include, without limitation: peptides (PCT publication No. WO 91 / 19735, for example), encoded peptides (PCT publication No. WO 93 / 20242, for example), random bio-oligomers (PCT publication No. W092 / 00091, for example), benzodiazepines (US patent No. 5,288,514, for example), diversomers such as hydantoins, benzodiazepines and dipeptides (Hobbs et al., 1993, Proc. Nat. Acad. Sci. USA 90: 6909-6913 ),vinyl polypeptides (Hagihara et al., 1992, J. Amer.Chem. Soc. 114: 6568), non-peptide glucose peptidomimetics (Hirschmann et al., 1992, J. Amer. Chem. Soc. 114: 9217-9218), analogous organic syntheses of small compound libraries (Chen et al. , 1994, J. Amer. Chem. Soc. 116: 2661), oligocarbamates (Cho et al., 1993, Science 261: 1303), and / or peptidylphosphonates (Campbell et al., 1994, J. Org. Chem. 59 : 658), nucleic acid libraries (see Ausubel, Berger and Sambrook, all above), peptide nucleic acid libraries (see, for example, US patent No. 5,539,083), antibody libraries (see, for example, Vaughn et al., 1996, Nature Biotechnology, 14: 309-314 and PCT / US96 / 10287), carbohydrate libraries (see, for example, Liang et al., 1996, Science, 274: 1520-1522 and US patent N 5,593,853),libraries of small organic molecules (see, for example, benzodiazepines, Baum, 1993, C&EN, January 18,page 33; isoprenoids, U.S. Patent No. 5,569,588; thiazolidinones and metathiazanones, U.S. Patent No. 5,549,974; pyrrolidines, U.S. Patent Nos. 5,525,735 and 5,519,134; morpholino compounds, U.S. Patent No. 5,506,337; benzodiaze-pinas, U.S. Patent No. 5,288,514, and the like).Devices for the preparation of combinatorial libraries are commercially available (see, for example,example, 357 MPS, 390 MPS, Advanced Chem Tech, Louisville Ky., Symphony, Rainin, Woburn, Mass. , 433A Applied Biosystems, Foster City, Calif., 9050 Plus, Millipore, Bedford, Mass.). In addition, numerous librariescombinatorial compounds are themselves commercially available (see, for example, ComGenex, Princeton, NJ, Tripos, Inc., St. Louis, Mo., 3D Pharmaceuticals, Exton, Pa., Martek Biosciences, Columbia, Md., etc.) .Chemotherapeutic AgentsIn another embodiment, apoptosis is induced by reducing the activity of Akt3 in conjunction with chemotherapeutic agents. As used herein, chemotherapy includes treatment with a single chemotherapeutic agent or a combination of agent. Chemotherapeutic agents that can be used with the invention include, without limitation, alkylating agents, antime-tabolites, antibiotics, natural products or plant derivatives, hormones and steroids (including synthetic analogs), and platinum drugs as described in Soengas MS, Lowe SW. Apoptosis and Melanoma Chemoresistance. Oncogene. 2003 May 19; 22 (20): 3138-51. Examples ofagents that fall into these classes are given below. Alkylating agents include, without limitation, for example, nitrous ureas, nitrogen mustard and triazenes. Nitrous urea includes, without limitation, carmustine, lomustine and semustine, for example. Nitrogen mustard includes, without limitation, cyclophosphomide, for example. Triazenes include, without limitation, dacarbazine and temozolomide, for example. The FDA has approved dacarbazia for use in the treatment of melanoma. Antimetabolites include, without limitation, folic acid antagonists, pyrimidine analogs, purine analogs and adenosine deaminase inhibitors: methotrexate, 5-fluoracil, floxuridine, cytarabine, 6-mercaptopurine, 6-thioguanine, fludarabine phosphate, eostatine, fludarabine phosphate, eost gemcitabine. Antibodies that can be used with the present invention include, without limitation, anthracyclines, for example. Examples of anthracyclines include, without limitation, doxorubicin (adriamycin). Natural products or plant derivatives that can be used with the present invention include, without limitation, crease alkaloids, for example, epipodophyllotoxins, taxanes. Examples of vinca alkaloids include, without limitation, vincristine and vinblastine. Examples of epipodophyllotoxins include, without limitation, etopeide, for example. Taxanes include, without limitation, taxol, paclitaxel and docetaxel. Hormonal analogs and steroids that can be used with the present invention include, without limitation, antiestrogen, for exampleexample, 17.alpha-ethinyl estradiol, diethylstilbestrol, testosterone, prednisone, fluoxymesterone, propionatedromostanolone, testolactone, megestrol acetate, tamoxifen, methyl prednisolone, methyl testosterone, prednisone-tarpaulin, .triamcinolone, chlorotryanisene, hydroxy progesterone, amino glutetimide, estramustine, progesterone medroxy acetate, leuprolide, flutamide, toramide, flutamide, toramida, toramide, flutamide, toramide, flutamide, toramide. Platinum drugs that can be used with the present invention include, without limitation, cisplatin, carboplatin, hydroxy urea, amsacrine, procarbazine, mitotane, mitoxantrone, levamisole and hexamethyl melamine, for example.Methods for the safe and effective administration of most of these chemotherapeutic agents are known to those skilled in the art. In addition, its administration is described in the standard literature. The administration of many of the chemotherapeutic agents is described, for example, in the * # * Physicians' Desk Reference * # * (PDR), for example, edition of (Medical Economics Company, Montvale, N.J. 07645-1742, USA); whose content is incorporated into this document as a reference.IrradiationIrradiation can optionally be added to the treatment regimes of the present invention. The term * # * irradiation * # *, as used herein, has its conventional meaning and is only limited insofar as irradiation X has sufficient energy to penetrate the body and is capable of inducing the release of tumor-specific antigens in vivo. The optimal radiation intensity to damage a specific type of tumor is known to those skilled in the art.ApoptosisThose skilled in the art would know how to detect and / or measure apoptosis using a variety of methods, such as using a propidium iodide flow cytometry assay described in Dengler et al., (1995) Anticancer Drugs 6: 522-32, o by the test and deoxy nucleotidyl transferase terminal in situ and notch translation (TUNNEL analysis) described in Gorczyca (1993) Cancer Res. 53: 1945-51.Treatment of a Melanoma TumorThe present invention is based in part on theinventors' observations showing that Akt3 regulates apoptosis andV599E B-Raf regulates vascular growth and development. This is a significant finding, as it first identifies an effective combined therapeutic product targeting melanoma. As will be discussed below, reducing Akt3 activity will increase the sensitivity of melanoma cells to apoptosis; therefore, agents that act through apoptosis such as conventional chemotherapeutic products are more effective when Akt3 activity is reduced in melanoma cells. In one embodiment, the present invention proposes a method for treating a melanoma tumor in a mammal comprising: administration to a tumor in a mammal of an effective amount of an agent that reduces the activity of V599E B-Raf, and administration to a tumor in a mammal of an effective amount of an agent that reduces Akt3 activity, thereby reducing the size of a tumor.In a preferred embodiment, the agent for thereduction in Akt3 activity is a siRNA molecule. In another embodiment, the agent is a siRNA molecule, comprising .. the siRNA molecule that reduces the activity of Akt3 a polynucleotide that has a sequence of 5 'GGUCUAGCUACAGAGAAAUCUCGAU 3', 5 'CUAUCUACAUUCCGGAAAG 3', 5 'GAAUUACAGAGAGAG 3 'CAGCUCAGACUAUUACAAU 3', 5'CUUGGACUAUCUACAUUCCGGAAAG 3 ', 5'CUUUCCGGAAUGUAGAUAGUCCAAG 3', 5'GAUGAAGAAUUUACAGCUCAGACUA 3 ', 5'UAGUCUGAGCUGUAAAUUCUUCAUC 3', 5'AAUUUACAGCUCAGACUAUUACAAU 3 ', 5'AUUGUAAUAGUCUGAGCUGUAAAUU 3', or their complements.In one embodiment, the agent for reducing B-Raf activity is a siRNA molecule. in a preferred embodiment, the agent is a siRNA molecule, comprising the siRNA molecule that reduces B-Raf activity, a polynucleotide that has a sequence of 5 'GGUCUAGCUACAGAGAAAUCUCGAU 3' and / or 5 'GGACAAAGAAUGUGAAUGUGUCUCUU 3'.In a preferred embodiment, the Akt3-reducing agent contacts a cell using any of the well-known procedures for introducing foreign nucleotide sequences into host cells. These include a liposome, a nanoliposome, a ceramide-containing nanoliposome, a proteoliposome, a nanoparticulate material, a calcium phosphate-silicate nanoparticulate material, a calcium phosphate nanoparticulate material, a silicon dioxide nanoparticulate material, a nanocrystalline particulate material, amaterial in semiconductor nanoparticles, a nanodendrimer,a virus, a supply of nucleotides mediated by nucleotides of calcium phosphate, poly (D-arginine), electroporation and microinjection. The use of a nanoliposome, a material in nanoparticles, a nanodendrimer for supplying agents to a cell is demonstrated in Figures 5-11 and described in more detail in patent application Serial No. 10 / 835,520, filed on April 26 2004, incorporated by reference into this document.In a preferred embodiment, the agent that reduces B-Raf activity contacts a cell using any of the well-known procedures for introducing foreign nucleotide sequences into host cells. These include a liposome, a nanoliposome, a nanoliposome containing ceramide, a proteoliposome, a nanoparticle material, a calcium phosphorus-silicate nanoparticle material, a calcium phosphate nanoparticle material, a silicon dioxide nanoparticle material, a material in nanocrystalline particles, a material in semiconductor nanoparticles, a nanodendrimer, a virus, a supply of nucleotides mediated by nucleotides of calcium phosphate, poly (D-arginine), electroporation and microinjection. The use of a nanoliposome, a material in nanoparticles, a nanodendrimer for supplying agents to a cell is demonstrated in Figures 5-11 and described in more detail in patent application Serial No. 10 / 835,520, filed in 26April 2004, incorporated into this document by way ofof reference.In a preferred embodiment, the present invention proposes a method for the use of nanotechnology as the strategy for administering multiple agents to inhibit the development of melanoma tumor and to increase and induce apoptosis. Akt3 peptide combinations; Akt3 siRNA, V599E B-Raf siRNA, Paclitaxel, Carboplatin, Carmustine, Dacarbazine or Vinblastine are simultaneously loaded into non-toxic liposomes. These liposomes effectively deliver this charge to melanoma cells that grow in culture. This is the first demonstration of the simultaneous delivery of different therapeutic products into cancer cells using a single delivery agent. Liposomes that carry therapeutic agents in combination would move into the bloodstream and enter the tumor's vascular mass to be absorbed by exposed melanoma cells. This results in a targeted destruction of melanoma cells in tumors, leading to tumor regression. The clinical utility of this approach is to provide therapeutic products in combination in tumors. Covalent attachment of anti-CD63 antibody to the pegalation segment extending from the liposome will lead to preferential absorption by melanoma cells. Thus, the stromal tissue absorbs a small amount of the liposome, or none at all, demonstrating targeted liposome delivery. The immunoliposome can improve absorption in melanoma tumor cells incompared to the control stromal tissue.In another embodiment, the agent that reduces Akt3 activity is an antisense polynucleotide. In one embodiment, the agent that reduces B-Raf activity is an antisense polynucleotide.In yet another modality, the agent that reduces Akt3 activity is a ribozyme. In yet another embodiment, the agent that reduces B-Raf activity is a ribozyme. Ribozymes can be used to target and inhibit the transcription of Akt3, B-Raf or both.In yet another embodiment, the activity of Akt3 is reduced by the agent that is an inhibitor of the Akt3 polypeptide. This can be achieved in any of a number of ways, including providing a dominant negative Akt3 polypeptide, a form of Akt3, for example, which itself has no activity and which, when present in the same cell as the Functional Akt3, reduces or eliminates Akt3 activity from functional Akt3. In yet another embodiment, the activity of B-Raf is reduced by an agent that is an inhibitor of the B-Raf polypeptide. In a preferred embodiment, the B-Raf inhibitor is BAY 43-9006. B-Raf inhibitors include, without limitation, BAY 43-9006, (commercially available from BAYER) or other commercially available B-Raf inhibitors. In addition, B-Raf inhibitors may include competitive and non-competitive B-Raf inhibitors. A competitive B-Raf inhibitor is a molecule that binds to the B-Raf enzyme in a way that is mutually exclusive to the substrate bond. Typically, a competitive B-Raf inhibitor will bind to the active site. An inhibitor does notCompetitive use of B-Raf may be one that inhibits the synthesis of B-Raf, but its binding to the enzyme is not mutually exclusive compared to substrate binding. The B-Raf inhibitors contemplated by this invention are compounds that reduce the activity of B-Raf in animal cells without any significant effect on other cellular activities, at least at comparable concentrations. However, this inhibition can be achieved in any of a number of ways, including by providing a dominant negative B-Raf polypeptide, such as a form of B-Raf, for example, such that it itself has no activity and that , when present in the same cell as a functional B-Raf, reduces or eliminates the B-Raf activity of the functional B-Raf.In yet another modality, the agent that reduces the activity of Akt3 is a peptide that corresponds to the contiguous amino acid sequences of the domain of homology to plecstrin or the catalytic domain or the regulator of Akt3.The present invention also contemplates a modality in which the agent that reduces Akt3 activity is a small molecule. In another embodiment, the present invention also contemplates modalities in which the agent that reduces the activity of B-Raf is a small molecule.In another embodiment, the method for treating a melanoma tumor includes the administration of chemotherapeutic agents. As used herein, chemotherapy includes treatment with a single chemotherapeutic agent or a combination of agents. Chemotherapeutic agents that can be usedwith the inventioninclude, without limitation, alkylating agents, antimetabolites, antibiotics, natural products or plant derivatives, hormones and steroids (including synthetic analogs) and platinum drugs, as described.In another embodiment, the method for treating a melanoma tumor in a mammal includes irradiation therapy.In preferred embodiments, the methods of the present invention can be used for the treatment of melanomas as they have a significant effect on cell death (by apoptosis, for example), as well as on proliferation and angiogenesis. Those skilled in the art would be familiar with methods that measure the size of a tumor to measure, for example, regression or reduction in tumor size, angiogenesis and apoptosis. It is advantageous that chemotherapeutic agents can be administered at relatively low doses (and / or less frequently), to minimize the potential toxic side effects against normal untransformed cells.Thus, the present invention also proposes methods of inducing a significant level of cancer cell death (apoptosis, for example) and inhibiting the development of a melanoma tumor in a melanoma patient, comprising administration, concomitantly or in sequence. effective amounts of an agent that reduces Akt3 activity and an agent that reduces B-Raf activity. As used at present, * # * concurrently * # * refers to simultaneously in time, or to different timesduring the course of a common treatment program; and the administration * # * in sequence * # * of one of the agents of the method to reduce the activity of Akt3 or B-Raf, and of an additional agent to reduce the activity of B-Raf or Akt3, the second agent being able be administered substantially immediately after the first agent, or the second agent can be administered after an effective period of time after the first agent; the effective time period is the amount of time given to achieve the maximum benefit from the administration of the first agent.0 targeting Akt3 together withV599E B-Raf and with selected chemotherapeutic products have a synergistic effect, more potent and prolonged than targeting each one alone. This provides a rationale for combining targeted therapies together with selected chemotherapeutic products, which currently does not exist for melanoma.Uses of Akt3 and / or B-Raf Protein and Akt3 and / or B-Raf Related ProteinsThe proteins of the invention have a number of different specific uses. Both Akt3 and B-Raf are key proteins contributing to the development of melanoma. The Akt3 and / or B-Raf protein and the Akt3 or B-Raf related protein are used to assess the status of the Akt3 and / or B-Raf gene products in normal tissues compared to cancerous tissues, thus elucidating the phenotype malignant. Typically, polypeptides from specific regions of an Akt3 or B-Raf protein can be usedto assess the presence of disturbances (such as deletions, insertions, mutations in points, etc.) in these regions (such as regions containing one or more motifs). A non-limiting example includes the use of antibodies that target the Akt3 and / or B-Raf protein and Akt3-related and / or B-Raf-related protein comprising the amino acid residues of one or more of the biological motifs contained in a Akt3 and / or B-Raf polypeptide sequence, respectively, in order to assess the characteristics of these regions in normal tissues compared to cancerous tissues or to obtain an immune response to the epitope. Alternatively, Akt3-related and / or B-Raf-related proteins that contain the amino acid residues of one or more of the biological motifs in the Akt3 and / or B-Raf protein, respectively, are used to select factors that interact in the region Akt3 and / or B-Raf.Fragments / subsequences of both Akt3 and B-Raf proteins are especially useful in the generation and characterization of domain-specific antibodies (antibodies that recognize, for example, an extracellular or intracellular epitope of an Akt3 or B-Raf protein), for identification of agents or cellular factors that bind to Akt3 or B-Raf, or to a specific structural domain of them, and in different therapeutic and diagnostic contexts, including, without limitation, diagnostic tests, cancer vaccines and methods of preparing such vaccines.The protein encoded by the Akt3 and / or B-Raf gene, or by analogs, homologues or fragments thereof, has avariety of uses, including, without limitation, the generation of antibodies and in the methods for the identification of ligands and other agents and cellular constituents that bind to an Akt3 and / or B-Raf gene product. Antibodies launched against an Akt3 or B-Raf protein or fragment thereof are useful in diagnostic and prognostic assays and imaging methodologies in the administration of human melanoma cancer characterized by the expression of Akt3 or B-Raf protein.Several immunological assays useful for the detection of Akt3 and / or B-Raf protein can be used, including, without limitation, different types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA) , immunocytochemical methods and the like. Antibodies can be labeled and used as immune imaging reagents capable of detecting cells that express Akt3 or B-Raf.Akt3 and / or B-Raf Antibodies in MelanomaAccording to the invention, the Akt3 and / or B-Raf polypeptide, encoded by the Akt3 isoform or the B-Raf isoform respectively, found in melanomas, includes fragments of them, including fusion proteins, and can be used as an antigen or immunogen to generate antibodies. It is preferred that the antibodies specifically bind to the human Akt3 isoform, but do not bind to other forms of Akt. It is preferable that the antibodies specifically bind to the human B-Raf isoform, but do not bind to other forms of B-Raf.A molecule is * # * antigenic * # * when it is able to specifically interact with an immune system antigen recognition molecule, such as an immunoglobulin (antibody) or T cell antigen receptor. An antigenic polypeptide or peptide contains at least at least approximately 5 and preferably at least approximately 10 amino acids. An antigenic portion of a molecule can be that portion that is immunodominant for recognition of the antibody or T cell receptor, or it can be a portion used to generate an antibody to the molecule by conjugating the antigenic portion to a molecule for immunization , a molecule that is antigenic does not need to be immunogenic itself, that is, be able to obtain an immune response without a vehicle.Such antibodies include, without limitation, polyclonal, monoclonal, chimeric, single-chain, Fab fragments and a Fab expression library. The anti-Akt3 antibodies of the present invention can be transreative, they can recognize Akt3 from different species, for example example. Similarly, the anti-B-Raf antibodies of the present invention can be transreative, they can recognize B-Raf from different species. Antibodies are more likely to be reactive. Alternatively, an antibody of the present invention can be specific for a single form of Akt3 or B-Raf. It is preferred that such an antibody is specific for human melanoma Akt3 or B-Raf.Several procedures known in the art canbe used for the production of polyclonal antibodies. To theantibody production, several host animals can be immunized by injection with the Akt3 or B-Raf polypeptide, or one. derived (fragment or fusion protein, for example) from it, including, without limitation, rabbits, mice, rats, sheep, goats, etc. In one embodiment, the Akt3 or B-Raf polypeptide or fragment thereof can be conjugated to an immunogenic vehicle, such as bovine serum albumin (BSA), for example, or mollusk hemocyanin (KLH). Various adjuvants can be used to increase the immune response, depending on the host species, including, without limitation, Freund (complete and incomplete), mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyols, polyions, peptides, emulsions oils, mollusk hemocyanins, dinitrophenol and potentially useful human adjuvants such as BCG (Calette-Guérin bacillus) and Corynebacterium parvum.For the preparation of monoclonal antibodies directed against the Akt3 or B-Raf polypeptide, or its fragment, analogue, or derivative, any technique that provides for the production of antibody molecules by continuous cell lines in culture can be used. These techniques include, without limitation, the hybridoma technique originally developed by Kohler and Milstein [Nature 256: 495-497 (1975)], as well as thetrioma, the human B cell hybridoma technique [Kozbor et al., Immunology Today 4: 72 1983); Cote et al., Proc. Natl. Acad. Know. USA 80: 2026-2030 (1983)] and the technique ofEBV hybridoma to produce monoclonal antibodieshumans [Cole et al., in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp 77-96 (1985)]. In aAdditional embodiment of the invention, monoclonal antibodies can be produced in germ-free animals [International Patent Publication No. WO 89 / 12690, published December 28. 1989]. In fact, according to the invention, techniques developed for the production of * # * chimeric antibodies * # * can be used [Morrison et al., J. Bacteriol. 159: 870 (1984); Neuberger et al., Nature 312: 604-608 (1984); Takeda et al. Nature 314: 452-454 (1985)] by recomposing genes from a murine antibody molecule specific for an Akt3 polypeptide together with genes from a human antibody molecule of suitable biological activity; such antibodies fall within the scope of the present invention. Such humanized or chimeric humanized antibodies are preferred for use in the therapy of human diseases (described below), since human or humanized antibodies are much less likely than xenogenic antibodies to induce an immune response, especially an allergic response.The techniques described for the production of single-chain Fv antibodies (scFv) [U.S. patents Nos. 5,476,768 and 5,132,405 granted to Huston; U.S. Patent No. 4,946,778] can be adapted to produce single chain antibodies specific for the Akt3 polypeptide. a further embodiment of the invention uses the techniques described for the construction of expression libraries ofFab [Huse et al., Science 246: 1275-1281 (1989)] to allow quick and easy identification of monoclonal Fab fragments with the desired specificity for an Akt3 polypeptide, or its derivatives or analogs.Antibody fragments that contain the idiotype of the antibody molecule can be generated by known techniques. Such fragments include, for example, without limitation, the F (ab ') fragment2 which can be produced by pepsin digestion of the antibody molecule; the Fab 'fragments that can be generated by reducing the disulfide bridges of the F (ab') 2 fragment and the Fab fragments that can be generated by treating the antibody molecule with papain and a reducing agent.In the production of antibodies, the examination for the desired antibody can be performed by techniques known in the art, radioimmunoassay, for example, ELISA (enzyme-linked immunosorbent assay), sandwich immunoassays * # *, immuno-radiometric assays, reactions of prepripitin by gel diffusion, immunodiffusion assays, immunoassays in situ (using colloidal gold labels, enzyme or radioisotopes, for example), Western blot analysis, precipitation reactions, agglutination assays (gel agglutination assays, for example, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assay, etc. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody isdetected by detecting the binding of a secondary or reagent antibody to the primary antibody. In another embodiment, the secondary antibody is labeled. Many means are known in the art for detecting binding in an immunoassay and fall within the scope of the present invention. To select an antibody that recognizes a specific epitope of an Akt3 or B-Raf polypeptide or its peptide, for example, one can test hybridomas generated for a product that binds to an Akt3 or B-Raf polypeptide fragment containing such an epitope. For the selection of an antibody specific to an Akt3 or B-Raf polypeptide or its peptide from a specific species of animal, one can select based on the positive binding with Akt3 or B-Raf polypeptide or peptide expressed by cells of that species or isolated from them.Identification of Molecules that Interact with Akt3 or B-RafThe protein and nucleic acid sequences for Akt3 and B-Raf found in melanoma allow those skilled in the art to identify proteins, small molecules and other agents that interact with Akt3 or B-Raf, as well as pathways activated by Akt3 or B-Raf through any of a variety of protocols accepted by the technique. For example, one of the systems called interaction trap (which is also referred to as * # * two-hybrid test * # *) can be used. In such systems, the molecules interact and reconstitute a transcription factor that drives the expression of a reporter gene, when the expression of the reporter gene is evaluated. Other systemsidentify protein-protein interactions in vivo by reconstituting a transcriptional eukaryotic activator, see, for example, US patent No. 5,955,280 issued September 21, 1999, US patent No. 5,925,523 issued July 20, 1999 1999, US Patent No. 5,846,722, issued December 8, 1998 and US Patent No. 6,004,746 issued December 21, 1999. Algorithms are also available in the art for predictions of genome-based protein function (see , for example, Marcotte, et al., Nature 402: November 4, 1999, 83-86).Alternatively, peptide libraries can be selected to identify molecules that interact with the Akt3 or B-Raf protein sequences. In such methods, peptides that bind to Akt3 or B-Raf are identified by testing libraries that encode a random or controlled collection of amino acids. The peptides encoded by the libraries are expressed as protein fusion proteins from the bacteriophage coating, the bacteriophage particles are then tested against the Akt3 or B-Raf protein (s), respectively.Consequently, peptides that have a wide variety of uses, such as therapeutic products, prognostic or diagnostic reagents, are thus identified without any prior information on the structure of the expected ligand or receptor molecule.Pharmaceutical CompositionIn one embodiment, a pharmaceutical compositionfor the treatment of a melanoma tumor comprises aagent that reduces Akt3 activity; and a vehicle is provided. Vehicles suitable for use with the present invention will be known to those skilled in the art. Such vehicles include, without limitation, a liposome, a nanoliposome, a nanoliposome containing ceramide, a proteolyma-canma, a material in nanoparticles of calcium phosphorus-silicate, a material in calcium phosphate nanoparticles, a material in silicon dioxide nanoparticles, a material in nanocrystalline particles, a material in semiconductor nanoparticles, poly (D-arginine), a nanodendrimer, a virus, a supply of nucleotides mediated by calcium phosphate nucleotides.In another embodiment, the pharmaceutical composition comprises an agent that includes, without limitation, a siRNA molecule, an antisense molecule, an antagonist, a ribozyme, an inhibitor, a peptide and a small molecule. In other embodiments, the small interfering RNA (siRNA) molecules include polynucleotides 5 'GGUCUAGCUACAGAGAAAUCUCGAU 3', 5 'CUAUCUACAUUCCGGAAAG 3', 5 'GAAUUACAGCUCAGACUA 3', 5 'CAGCUCAGACUACAGACAAAAAAAAAAAA ', 5' GAUGAAGAAUUUACAGCUCAGACUA 3 ', 5' UAGUCUGAGCUGUAAAUUCUUCAUC 3 ', 5' AAUUUACAGCUCAGACUAUUACAAU 3 ', 5' AUUGUAAUAGUCUGAGCUGUAAAUU 3 'or their supplements. In yet another embodiment, the pharmaceutical composition comprises an agent that is a peptide that acts as a pseudo-substrate for Akt3. In another modality, thepeptide acts as a pseudosubstrate for an Akt3 catalytic domain.In yet another modality, the agent that reduces Akt3 activity is a peptide that acts as a competitive inhibitor for Akt3. The inventors contemplate that the peptide can act as a competitive inhibitor for an Akt3 catalytic domain, an Akt3 plecstrin homology domain, and / or for an Akt3 regulatory domain. In yet another embodiment, the pharmaceutical composition includes an agent that reduces B-Raf activity. The inventors contemplate that the agent includes a siRNA molecule, an antisense molecule, an antagonist, a ribozyme, an inhibitor, a peptide and a small molecule. In another embodiment, the agent that reduces B-Raf activity is a small interfering RNA molecule (siRNA) comprising:a 5 'GGUCUAGCUACAGAGAAAUCUCGAU 3' polynucleotide or its complement or a 5 'GGACAAAGAAUUGGAUCUGGAUCAU 3' polynucleotide, or its complement.The Examples below are given by way ofillustration and not by way of limitationEXAMPLES FOR Akt3MATERIALS AND METHODSEXAMPLE 1: SiRNA-mediated Î ± -oformation of Akt isoforms:To demonstrate the specificity of siRNA against Aktl, Akt2 and Akt3 (Dharmacon) in UACC 903 cells,Aktl, Akt2 or Akt3 constructs identified with HA wereco-nucleofected together with each respective siRNA. The Akt constructs used for these studies have already been described (Sun et al., Am. J. Path 159: 431-437 (2001);Mitsuuchi et al., J. Cellular Biochem. 70: 433-441 (1998); and Brodbeck et al., J. Biol. Chem. 274: 9133-9136 (1999)). Each construct (5 gg), either alone or in combination with 100 pmol or 200 pmol of each respective siRNA, was introduced in 7 x 105 UACC 903 cells by nucleofection using an Arnaxa Nucleofector. The efficiency of the resulting transfection using constructs that expressed GFP was> 60%. Protein lysates were collected 72 hours later and Western blot analysis was conducted in the manner already described (Stahl et al., Cancer Res. 63: 2891-2897 (2003)). Nucleofection with siRNA was also used to kill the endogenous expression of Akt and / or PTEN (Dharmacon) isoforms in melanocytes and melanoma cell lines UACC 903, SK-MEL-24, WM115, and WM35. Amaxa's nucleofection reagents and protocols for melanocytes were also used with WM35 cells, while other cell lines were nucleofected using the Amaxa Solution R / K-17 program. The culture conditions for these cell lines were previously described (Stahl et al., Cancer Res. 63: 2891-2897 (2003); Hsu et al., In Human Cell Culture, JRWMaB Palsson, editor. Great Britain: Kluwer Academic Publishers. 259-274 (1999)).EXAMPLE 2: Western Blot Analysis, Immunoprecipitation and Kinase Assays:The procedure and the antibodies usedlikeWestern blot, except for Akt2 (Santa Cruz) and Akt3 (Upstate Biotech) have been reported previously (Stahl et al., Cancer Res. 63: 2891-2897 (2003)). To theimmunoprecipitation, the protein was collected after the addition of a protein lysis buffer (50 mM Tris-HCI pH 7.5, 0.1% Triton X-100, 1 mM EDTA, 1 mM EGTA, 50 mM NaCl, 10 mM sodium p-glycerol phosphate, 5 mM sodium pyrophosphate, 1 mM sodium orthovanadate, 0.1% 2-mercapto ethanol and 0.5% protease inhibitor cocktail (Sigma) ) for cell plates followed by rapid freezing in liquid nitrogen. Cell debris was granulated by centrifugation (> 10,000 xg) of lysates and protein concentration was quantified using the BioRad BCA Protein protein assay. The protein for immunoprecipitation (100 pg) was incubated with 1 pg of Akt2 or 5 pL of antibody to Akt3 overnight at 4 ° C with constant mixing. Then 15 µl balanced GammaBind G Sepharose sepharose microspheres (Amersham Biosciences) were added to each tube and incubated for 2 hours at 94 ° C) with constant mixing. The pellet beads were washed twice with lysis buffer to remove unbound antibodies and protein. The samples were then resuspended and subjected to electrophoresis under reducing conditions according to the protocol provided by Invitrogen Life Technologies with the NuPage Gel System. Western blots were probed with phosphor-Akt and quantifiedby densitometry as already described (Stahl et al. CancerRes. 63: 2891-2897 (2003)).For the Akt kinase assay, 15 pL of balanced GammBind G Sepharose microspheres were washed with 200 pL of lysis buffer, then incubated with 2 pg of Akt2 or 5 pL of Akt3 antibody in a volume of 400 pL at 4 ° C with constant mixing for> 2 hours. Microcystin (1 pM) from MP Biomedicals was added to the lysis buffer to ensure complete inactivation of cellular PPI and PP2 phosphatases. The antibody / sepharose complex was washed twice with 750 pL of lysis buffer, then incubated with 100 pg of protein in a 400 pL volume for>1.5 hours at 4 ° C with constant mixing. This complex was washed with 500 pL of lysis buffer (3X), then once with 500 pL of Assay Dilution Buffer (20 mM MOPS, pH 7.2, 25 mM p-glycerol phosphate, 1 mM sodium orthogonadate and 1 mM DTT). The PKA inhibitor peptide (10 pM) purchased from Santa Cruz 37.5 pM ATP, 17 mM MgC12 / 0.25 pCi / pL y-J2P-ATP, and 90 pM of Akt-specific Crosstide substrate purchased from Upstate Biotechnology were added to the tubes in assay dilution buffer and incubated at 35 ° C for 10 minutes with continuous mixing. Then, 20 µl of liquid was transferred to phosphocellulose paper, which was washed 3X for 5 minutes with 40 ml of 0.75% phosphoric acid. After a 5 minute wash with acetone, the phosphocellulose was allowed to dry, transferred to a scintillation vial with 5 ml of fluid for Amersham Biosciences scintillation and cpm were measured in a scintillation systemBeckman Coulter LS 3801 Liquid Scintillation System.EXAMPLE 3: Tumor Studies and Apoptosis Measurements:A collection of melanoma tumors from human patients was conducted according to protocols approved by the Penn State Human Subjects Protection Office, the Dana-Farber Cancer Institute Protocol Administration Office and Cooperative Human Tissue Network. Melanoma samples from files fixed with paraffin-encapsulated formalin were used for immunohistochemical characteristics for the measurement of phosphorylated Akt. Sixty-three melanoma samples from files fixed with formalin encapsulated in paraffin from melanocytic lesions were used for immunohistochemical experiments with the monoclonal antibody phosfor-Akt (Ser473) (Cell Signalling Technology) at a 1:50 titration according to the protocol recommended by the manufacturer. The specificity and the intensity of pretense was determined by qualitative comparison with controls of internal blood vessel endothelium, squamous epithelium or smooth muscle present in each sample.The tumor protein for Western blot or immunoprecipitation was collected using a mortar and pestle, cooled in liquid nitrogen to spray the tumor material instantly frozen in liquid nitrogen, which consisted of> 60% tumor material. One ml of protein lysis buffer was added to each 200 mg of tissue powder and sonicated for 2 minutes (at 15-second intervals) in an ice-filled sonicator bath. The samples were centrifuged (-12,000 x g) at 4 ° C for 10minutes. The supernatant was transferred to a clean tube and quantified using the BioRad BCA Protein Assay.Animal experimentation was conducted according to protocols approved by the Institutional Animal Care and Use Committee at Pennsylvania State College of Medicine. Naked female athymic mice were purchased from Harlan Sprague Dawley and the kinetic characteristics of the tumor were measured with 1 x 10 s.c.6 cells in 0.2 mL of DMEM containing 10% FBS above the left and right rib cage of 4-6 week old nude mice. For animal experimentation involving siRNA, 1 x 106 UACC 903 cells were nucleofected with siRNA to Akt isoforms and 48 hours later, cells nucleofected in 0.2 ml DMEM containing 10% FBS were injected s.c. above the left and right rib cage of the nude mice. The dimensions of the developing tumors were measured on alternate days using calipers. When measuring apoptosis, 5 x 106 cells were injected by site and 4-6 tumors were collected 4 days later. Apoptosis measurements were conducted on formalin-fixed tumor sections encapsulated in paraffin using Roche's TUNEL TMR Red Apoptosis apoptosis kit as described (Stahl et al. Cancer Res. 63: 2891-2897 (1003)). a minimum of 8 fields were counted from three to four different tumor sections, and the number of TUNEL positive cells was expressed as a percentage of apoptotic cells.EXAMPLE 4: Statistics:For statistical analysis, the t test was usedStudent for pairwise comparisons and One-way ANOVA or Kruskal Wallis ANOVA on Ranks used for pairwise comparisons, followed by appropriate post hoc tests (Dunnett or Dunn). The results were considered significant at a value of P<0.05.Table 1. Relative intensity of p-Akt faking in common nevi, dysplastic nevi, primary melanomas and melasesLases from melanoma patientsCategory (# of samples) P-Akt sham intensity (%) Moderate to weak1 Intense2 Common nevi (14) 100 0a Dysplastic nevi (25) 88 12b Primary melanomas (15) 47 53c Metastatic melanomas (9) 33 67d1 Tumor cells were stained to an intensity similar to that of pericytes adjacent to blood vessels in the tumor section.Tumor cells were stained to a greater degree than that of pericytes adjacent to blood vessels in the tumor section. Statistics, p<0, 5 fora compared toc, fl is forh compared tod.EXPERIMENTAL RESULTSEXAMPLE 5: Isoform-specific siRNA identifies theAkt3 involvement in MelanomaIn a model of experimental genetic melanomarecently described (Stahl et al., Cancer Res. 63: 2891-2897 (2003)), it was demonstrated that the unregulated activity ofAkt (for loss of PTEN) played a critical role inmelanoma tumorigenesis by reducing the apoptotic capacity of melanoma cells (Stahl et al., Cancer Res. 63: 2891-2897 (2003)). We consider that, as this model reflects the importance of Akt in melanoma tumorigenesis, it could be used to identify specific Akt isoforms whose unregulated activity controls the development of the melanoma tumor. As a validation of previous results (Stahl et al., Cancer Res. 63: 2891-2897 (2003)), UACC 903 progenitor cells (-PTEN) had a high total phosphorylated Akt expression (a measure of activity) (Figure IA ). PTEN expression in UACC 903 resulted in reduced Akt activity in three independently derived cell lines (36A, 29A and 37A), which was reversed in reversing cell lines that lost functional PTEN activity (36A reversals) during tumorigenesis.To identify the predominant Akt isoform active in melanomas, we used siRNA specific to each Akt isoform to determine the extent to which each isoform reduced the amount of phosphorylated (active) Akt in the UACC 903 (-PTEN) progenitor cell line. The specificity of expression abatement for each isoform of Akt in UACC 903 cells was determined by co-nucleofectant constructs expressing HA-Aktl, HA-Akt2 or HA-Akt3 identified along with specific siRNA for each isoform. Attesting the specificity, it was observed that each Akt siRNA only reduced the expression of the Akt isoform against which it was produced, shown in Figure 1B. Inthen siRNA for each Akt isophorin was nucleofected in UACC 903 cell line as well as in two additional independently derived melanoma cell lines (WM115 and SK-MEL-24) to determine which siRNA reduced the phosphorylated (active) Akt level in these cells (Figure 1C).Although siRNA to Aktl or Akt2 has only a negligible, non-significant effect, siRNA to Akt3 significantly reduced the levels of total phosphorylated Akt, suggesting that Akt3 was the isoform that regulated tumor development in the UACC 903 (PTEN) model (Stahl et al., Cancer Res. 63: 2891-2897 (2003)) As all three melanoma cell lines derived independently indicated that Akt3 was the predominant active isoform in melanomas, subsequent experiments focused on examining Akt3 deregulation and used Akt2 as a control for comparison, since it has been reported to be amplified in a multiplicity of cancers (Chen et al., Proc. Nat. Acad. Sciences USA 89: 9267-9271 (1992); Cheng et al ., Proc. Nat. Acad. Sciences USA 93: 3636-3641 (1996); Lu et al., Chung-Hua I Hsueh Tsa Chih [Chinese Medical Journal] 75: 679-682 (1995); Bellacosa et al., J. Cancer 64: 280-285 (1995); and van Dekken et al., Cancer Res. 59: 749-752 (1999)).For a better confirmation that Akt3 was the predominant isoform whose activity was specifically reduced by PTEN in the UACC 903 (PTEN) tumorigenesis model, Akt3 activity was measured by immunoprecipitation of the total Akt3 or Akt2 of cell lysates, following -Western blot to assess the amount of phosphorylated (active) Akt in the immunoprecipitate (Figure 1D). Levels of phosphorylated Akt3, but not Akt2, were elevated in the UACC 903 progenitor cell line as well as in the two reversible tumorigenic 36A cell lines that do not contain PTEN. On the other hand, practically undetectable levels of phosphorylated Akt3 were observed in cell lines 36A, 29A or 37A, which had low levels of Akt activity, ostensibly due to the expression of PTEN (Stahl et al., Cancer Res. 63: 2891- 2897 (2003)). To verify that phosphorylated Akt levels reflected active akt, Akt3 and Akt2 were tested immunoprecipitated in an in vitro kinase assay, and the results for Akt3 are shown in Figure 1E. A statistically significant difference in Akt3 (Figure 1E), but not Akt2 (data not shown), was identified in reversals (-PTEN) compared to cells that expressed PTEN (P<0.05). Taken together, these results indicate that Akt3 activity was specifically regulated by PTEN in the UACC 903 (PTEN) tumorigenesis model.EXAMPLE 6; An increase in Akt3 activity occursEarly During the Progression of Melanoma Tumor.Melanocytes are considered to be capable of directly transforming into a melanoma (Herlyn, M., Molecular and cellular biology of melanoma: Austin: R.G. Landes Co. (1993)). Alternatively, melanocytes can follow a tumor progression model in which they develop in a gradual way from common nevi to neviatypical, in melanoma in situ (Phases of radial growth andvertical) and finally in metastatic melanomas (Herlyn,M., Molecular and cellular biology of melanoma: Austin: R. G. Landes Co. (1993)). Regardless of the process, the evolution of more aggressive tumor cells requires the accumulation of changes affecting the tumor suppressor genes and oncogenes. These, in turn, result in subpopulations of cells that have ever-increasing selective growth or survival advantages that promote the tumorigenic process.To provide evidence of selective Akt3 involvement during melanoma tumor progression, Akt3 and Akt2 expression and activity were measured in a melanoma tumor progression model (generously provided by Dr. Meenhard Herlyn) (Herlyn, M., Molecular and cellular biology of melanoma: Austin: RG Landes Co. (1993); Hsu et al., In Human Cell Culture JRWMaB Palsson, editor, Great Britain: Kluwer Academic Publishers. 259-274 (1999)). In this progression model, melanocytes are compared to low-pass cell lines established from primary melanoma tumors in the radial (WM35 and WM3211) and vertical (WM115, WM998.1 and WM278) phases. In comparison to melanocytes, Figure 2A shows that one of the two cell lines in the radial growth phase and all three cell lines in the vertical growth phase had a high level of phosphorylated Akt, which suggests that Akt activityincreased early during the development of melanomaprimary in the radial growth phase. Then he examinedthe expression of the Akt3 isoform by Western blot andcompared with the expression of Akt2 in these strains ofcells (Figure 2B). It was observed that the Akt3 expressionit was elevated in all cell lines except the cell line of the radial growth phase WM98.1 which was comparable to that of melanocytes. As the expression does not necessarily reflect an activity, the amount of active Akt3 was examined by immunoprecipitating Akt3 or Akt2 followed by Western blot analysis to measure the level of phosphorylated Akt in the immunoprecipitate. In comparison with melanocytes, Akt3 activity was elevated in all cell lines except for the WM35 radial growth phase (Figure 2C). Note that although the expression of Akt3 protein in the vertical growth phase cell line WM98.1 was analogous to that seen in melanocytes, Akt3 activity was significantly higher. In contrast to Akt3 results, Akt2 expression was elevated only in cell lines in the radial growth phase compared to melanocytes (Figure 2C). However, only the cell line in the WM3211 radial growth phase had a corresponding increase in Akt2 activity, but it also had a high Akt3 activity when compared to that of melanocytes. These data suggest that Akt3 was the active Akt isoform predominantly involved in the melanoma tumor progression model.EXAMPLE 7: Frequency of Akt3 Deregulation in Tumors from Melanoma PatientsAs the above experiments identified Akt3 as the predominantly active Akt isoform in both the tumorigenesis and melanoma tumor progression model in UACC 903 (PTEN), subsequent in vivo studies focused on establishing the frequency of Akt3 dysregulation in tumors from melanoma patients. The relative intensity of the total phosphorylated Akt was initially assessed in melanocytic lesions by immunohistochemical analysis of common nevi, dysplastic nevi, primary melanomas and metastases from patients with melanoma to determine the frequency of Akt activation (Table 1 ). Although moderate levels of dyeing were detected in 100% of common nevi, intense dyeing was observed in 12% of dysplastic nevi, 53% of primary melanomas and 67% of metastatic melanomas. These results suggest that although Akt activity may serve some unidentified role in the development of nevi, unregulated Akt activity is indicative of a more important role in advanced stage melanomas.The analysis of the genomic regions that contain the Aktl, Akt2 and Akt3 genes, from a published report (Bastian et al., Cancer Res. 58: 2170-2175 (1998)), did not find any amplification. However, the lq43-44 region containing Akt3 does show increases in copy number (Bastian et al., Cancer Res. 58: 2170-2175(1998); Thompson et al., Cancer Genet. Cytogenet. 83: 93-104(1995); Mertens et al., Cancer Res. 57: 2765-2780 (1997)),which suggests overexpression as a mechanism that contributes to an increase in Akt3 activity in melanomas. In contrast, the Aktl-containing 14q32 region and Akt2-containing 19ql3 region remain unchanged or tend to suffer a loss (Bastian et al., Cancer Res, 58: 2170-2175 (1998); Thompson et al., Cancer Genet. Cytogenet. 83: 93-104 (1995); Mertens et al., Cancer Res. 57: 2765-2780 (1997)). To establish whether the increase in Akt3 expression could be a selective mechanism leading to increased activity, protein lysates were extracted from tumors of melanoma patients to compare the level of expression and activity of Akt3 and Akt2. The protein was extracted from 31 metastatic melanomas and analyzed by Western blot to determine the level of expression and activity of Akt3 and Akt2 in the tumor material.Three independent Western blots were used to quantify expression in each sample, which was then compared to expression in melanocytes (Figure 2D). Altogether, 61% (19 / 31) of the tumors had an elevated expression of Akt3 protein, ranging from a ~ 2.9-fold increase over the expression observed in melanocytes compared to 10% (3 / 31) for Akt2. These results are consistent with the type of increases in the number of copies of the lq43-44 chromosome region containing the Akt3 gene reported in the literature as occurring in melanoma tumors (Bastian et al., Cancer Res, 58: 2170-2175 (1998 ); Thompson et al., Cancer Genet.Cytogenet. 83: 93-104 (1995); Mertens et al., Cancer Res. 57:2765-2780 (1997)). Approximately 55% (6 / 11) of primary site melanomas and 65% (13 / 20) of melanoma metastases had an increase in Akt3 expression. On the other hand, only negligible fluctuations were observed when comparing Akt2 expression in tumors with melanocytes (Figure 2D). Then the activity levels were measured by quantifying phosphorylated Akt in immunoprecipitates or Akt3 or Akt2. What was surprising was that phosphorylated Akt3 (active) was detected in 62 ± 0.02% (standard error) ofsamples (Figure 2E). On the other hand, no phosphorylated Akt2 (except for the positive control) was detected in these tumors. In addition, ~ 35% of tumors had high Akt3 activity compared to cultured melanocytes. these data confirm the involvement of Akt3 deregulation in> 60% of tumors from patients with advanced stage melanoma and suggests that increased expression is one of the mechanisms that contribute to the unregulated activity of Akt3 in melanomas.EXAMPLE 8: The Mechanisms Behind Akt3 Deregulation in MelanomasThe above experiments identified Akt3 as the predominantly active isoform in vitro in cell culture models and in vivo in patient tumors. As the UACC 903 (PTEN) early tumorigenesis model suggested that PTEN played a significant rolein regulating Akt activity in melanomas, we examined to see if reduced PTEN expression directly and specifically increased Akt3 activity. To achieve this goal, the expression (activity) of PTEN was killed by the siRNA in melanocytes and primary melanoma cells in the radial growth phase (WM35) to measure the effect on the phosphorylated Akt level. The cell line WM35 was chosen because these cells have negligible basal Akt3 activity and express the PTEN protein (see Figure 1C). As predicted, Figure 3A and Figure 3B show that siRNA-mediated infrarregulation of PTEN led to an increase in the total phosphorylated Akt (lanes 4 and11) whereas the control with mixed siRNA had a negligible, non-significant effect (lanes 2 and 9). The predominant Akt isoform activated after PTEN infra-regulation was determined by co-nucleofection of siRNA against PTEN together with siRNA to Aktl (lanes 5 and12) or Akt2 (lanes 6 and 13) or Akt3 (lanes 7 and 14). Only siRNA directed against Akt3 (lanes 7 and 14) lowered the phosphorylated Akt level to the level seen in non-nucleofected cells (lanes 1 and 8) or in nucleofected cells with mixed siRNA only (lanes 2 and 9). On the other hand, the reduction of levels of Aktl or Akt2 proteins did not reduce the amount of phosphorylated Akt, again attesting to the selectivity of Akt3 deregulation. Therefore, the selective regulation of Akt3 activity by PTEN is a significant mechanism for the activation of Akt3 inmelanomas, since the loss of PTEN increases the activityAkt3 without overexpression. Thus, a reduction in PTENcould, in turn, lead to an increase in the concentration of PIP3 (Phosphatidyl inositide 3,4,5-triphosphate) cell that would be effective to specifically increase Akt3 activity in melanomas. The mechanism behind this specificity is currently unknown.Studies involving tumor material from patients with melanoma indicated that an increase in Akt3 expression could also play a significant role in increasing Akt3 activity in melanomas. To investigate this possibility, Akt3 was overexpressed in melanocytes and WM35 cells (not shown) that expressed PTEN protein. Akt3 of the native type identified with HA, a version of Akt3 killed as T305a / S472A kinase (inactive) or a miristoilized Akt3 (active) was overexpressed in melanocytes (Figure 3C). The cells were deprived of growth factors for 24 hours, filled with complete medium and the lysates were collected 10 minutes later. Equivalent constructs for Akt2 were used (data not shown). Overexpression of native-type Akt3 and myristoylated Akt3 led to increased levels of total phosphorylated Akt; compared to the vector alone or to nucleofected cells with Akt3 killed as a kinase. In addition, siRNA-mediated abatement of PTEN in conjunction with Akt3 overexpression led to higher levels of phosphorylated Akt compared to native type Akt3 expression (data not shown). Thus, Akt3 overexpressionalone, or in combination with the loss of PTEN, it is an additional mechanism that contributes to the elevated activity of Akt3 in melanomas.EXAMPLE 9: Increased Akt3 Activity Promotes Tumorigenesis of Melanoma by Reducing Apoptosis.As the unregulated activity of Akt3 has been consistently observed in melanoma tumors, subsequent studies have focused on determining the mechanisms by which increased Akt3 activity promoted tumorigenesis. Cell lines of the UACC 903 tumorigenesis model (PTEN) were used to demonstrate that high Akt3 activity promoted melanoma tumorigenesis in a nude mouse model. One million cells from a progenitor UACC 903 (-PTEN) cell line, 36A (+ PTEN) or 36A reversible (-PTEN) were injected under the skin of 4-6 weeks old female nude mice, and the size of the tumor formed was measured 10 days later. Figure 4A shows that 36A cells with reduced Akt3 activity were non-tumorigenic compared to reversible UACC 903 and 36A progenitor cells that had high Akt3 activity (P<0.5). Although the tumorigenic potential of reversing 36A cells increased significantly compared to that of 36A cells, tumor development remained delayed due to the retention of a second melanoma suppressor gene on chromosome 10 that was used to create this model (Robertson et al. , Cancer Res, 59: 3596-3601 (1999)). To confirm these observations and demonstrate thespecificity of Akt3 involvement in melanoma tumorigenesis, we created a model of UACC 903 (Akt) using siRNA. The reduction of siRNA-mediated Akt3 expression (activity) in UACC 903 cells, shown in Figure 4B, significantly delayed tumor development compared to nucleofected cells with buffer alone, with mixed siRNA or with siRNA against Akt2 or Aktl (P<), 05). Thus, either by specifically reducing Akt3 activity using siRNA against Akt3 (Figure 4B) or by increasing PTEN expression (Figure 4A), the development of melanoma tumor in nude mice was inhibited.To establish whether increased apoptosis was the predominant mechanism behind tumor inhibition in vivo after reductions in Akt activity (Stahl et al., Cancer Res. 63: 2891-2897 (2003)) apoptosis was examined both in the UACC 903 (PTEN) model (Figures 4C, 4E) and in the UACC 903 (Akt) (Figures 4D, 4F) which differ in Akt3 activity. Non-tumorigenic 36A and UACC 903 and 36A tumorigenic reversible cell lines were injected subcutaneously in nude mice and 4 days later, matched tumor masses were collected in time and space that developed in parallel of each cell type to compare with magnitude of apoptosis, and were assessed by TUNEL (Stahl et al., Cancer Res. 63: 2891-2897 (2003)). A significantly higher number of apoptotic cells was observed in tumor masses of 36A (+ PTEN) that had a low Akt3 activity than in tumors formed from progenitor UACC 903 (-PTEN) cell lines or 36A(-PTEN), which had a great Akt3 activity (Figures 4C, 4E) (P<0.05). Similar results were observed in UACC 903 cells in which siRNA against Akt3 was used to reduce Akt3 expression (activity). Nucleofected cells with buffer alone or with siRNA against Akt2 had approximately 5 to 7 times less apoptotic cells than UACC 903 cells treated with siRNA against Akt3 (Figures 4D, 4F) (P<0.05). Thus, these results demonstrate that the activity of Akt3 preferentially regulates the extension of apoptosis, thus helping the survival of melanoma cells and promoting tumorigenesis.EXPERIMENTAL DISCUSSION FOR Akt3In the present invention, the inventors demonstrate that Akt3 is an important survival kinase, partly responsible for the development of melanoma. The UACC 903 (PTEN) melanoma model that reflects the importance of Akt in melanoma tumorigenesis was used to identify Akt3 as the predominantly deregulated isoform during melanoma tumorigenesis. The use of siRNA demonstrated that the selective killing of Akt3, but not that of Aktl or Akt2, reduced the level of total phosphorylated Akt and reduced the tumorigenic potential of melanoma cells. Similar results were found in two independently derived melanoma cell lines (WM 115 and SK-MEL-24), providing additional support for the significance of this discovery. The clinical relevance of this observation was validated bydemonstration that selective inhibition of Akt3 expression(by killing siRNA) or its activity (by PTEN expression) significantly reduced the development of the melanoma tumor.Two distinct mechanisms that lead to the activation ofAkt3 in melanomas were identified in this study. The first mechanism depends on the overexpression of the structurally normal Akt3 protein. Analysis of advanced stage melanomas from human patients showed increased expression in>60% of cases. Overexpression of Akt3 in melanocytes and WM35 cells leads to increased activity, confirming the results with the human tumor. Akt overexpression is not specific to melanomas, having already been documented in several human cancers with a series of studies reporting amplifications of Akt isoforms. Aktl amplification has been reported in stomach cancer (Staal, SO, Proc. Natl. Acad. Sci. USA 84: 5034-5037 (1987)), while Akt2 genetic amplification has been found in cancers of the ovary, pancreas, stomach and breast (Cheng et al., Proc. Nat. Acad. Sciences USA 89: 9267-9271 (1992); Ghent et al., Proc. Nat. Acad. Sciences USA 93: 3636-3641 (1996 ); Lu et al., Chung-Hua I Hsueh Tsa Chih [Chinese Medical Journal] 75: 679-682 (1995); Bellacosa et al., Int. J. Cancer 64: 280-285 (1995); and van Dekken et al., Cancer Res. 59: 748-752 (1999)). Although no amplification of the genomic regions containing the Akt genes has been reported in melanomas, several documents describe the increase in the number of copies of the long arm of chromosome 1 containing the Akt3 gene (Bastian et al., CancerRes. 58: 2170-2175 (1998); Thompson et al., Cancer Genet. Cytogenet. 83: 93-104 (1995); Mertens et al., Cancer Res. 57: 2765-2780 (1997)). On the other hand, the long arms of chromosome 14 and chromosome 19 containing the Aktl and Akt2 genes, respectively, tend to remain unchanged or suffer loss (Bastian et al., Cancer Res. 58: 2170-2175 (1998); Thompson et al ., Cancer Genet. Cytogenet. 83: 93-104 (1995); Mertens et al., Cancer Res. 57: 2765-2780 (1997)). Thus, the increase in the number of copies of the Akt3 gene is one of mechanisms that contribute to the increase in Akt3 expression and activity in the development of melanoma.The second mechanism identified that the selective activation of Akt3 in the UACC 903 (PTEN) model was due, in part, to the reduction of PTEN activity. an observation reported in melanocytes and primary melanoma cells that preserve PTEN expression (WM35) showed that siRNA-mediated PTEN reduction specifically increased Akt3 phosphorylation (activity), further reinforcing the significance of Akt3 involvement in development of melanoma. Published studies that characterize the genetic changes that occur in tumor material obtained from patients with melanoma provide additional support for the hypothesis that reduced PTEN expression plays a significant role in the early development of melanoma (Bastian et al., Cancer Res. 58: 2170-2175(1998); Thompson et al., Cancer Genet. Cytogenet. 83: 93-104 (1995); Mertens et al., Cancer Res. 57: 2765-2780 (1997), Parmiter et al., Cancer Genet. Cytogenet. 30: 313-317(1988)). Specifically, loss of a PTEN allele, or PTEN haploinsufficiency, usually occurs in early melanomas due to loss of the full copy of chromosome 10 (Bastian et al., Cancer Res. 58: 2170-2175 (1998); Thompson et al ., Cancer Genet. Cytogenet. 83: 93-104 (1995); Mertens et al., Cancer Res. 57: 2765-2780 (1997), Parmiter et al., Cancer Genet. Cytogenet. 30: 313-317 (1988 )). In these conditions, loss of chromosome 10 is expected to reduce PTEN expression in a subpopulation of developing melanoma cells leading to an increase in Akt3 activation, providing these cells with a selective growth and survival advantage. Therefore, a reduction in expression due to haploinsufficiency or loss of PTEN activity in melanoma plays an important role in the progression of the melanoma tumor due to the specific increase in Akt3 activity.The underlying molecular basis for the selective activation of Akt3, preferably Aktl and Akt2, after the reduction of PTEN expression in melanomas is unknown. However, we speculate that the mechanism that leads to this specificity involves a preferential interaction of PIPj or other proteins with the domain of homology to plecstrin (PH). The amino-terminal PH domain mediates protein-protein and lipid-protein interactions of PIPj. The PH domain of human Akt3 is -140 amino acids long (NCB1 accession number: NP_005456) and has 84% ​​and 78% identity to Aktl and Akt2, respectively (Brazil et al., Cell 111: 293-303 ( 2002); and Nicholson et al., Cell Signal14: 381-395 (2002)). In addition, within the PH domain are phosphorylation sites that differ between the Akt isoforms and that have fractions that have not yet been characterized. A ceramide-induced phosphorylation site, dependent5 of PKC zeta, for example, in threonine 34 (within the PH domain) leads to Aktl inactivation by preventing binding to PIPj (Powell et al., Mol. Cell Biol. 23: 7794-7808 (2003)) . On the other hand, Akt2 and Akt3 have a serine in this position, which can be phosphorylated and regulated differently. Our analysis of other potential phosphorylation sites within the PH domain of the three Akt isoforms identified three potential specific Akt3 sites. Akt3 Residue 21 is an asparagine whereas the equivalent sites in Aktl and Akt2 are threonines. Furthermore, it was also found that threonine 31 and tyrosine 49 of Akt3 differ from the other isoforms of Akt (Ans31 and Ser31 of Aktl and Akt2, respectively; Ala50 and Pro50 of Aktl and Akt2, respectively). Thus, a differential regulation of putative phosphorylation sites within the 20 pH domain of PIP lipid binding3 can provide a basis forthe specificity of Akt3 activation in melanomas. It is also possible that unsuspected interactions between known oncogenes could be selectively regulating the activation of the Akt isoform in melanomas. TCL1, for example, showed 25 that it selectively bound to the Akt3 pH domain and promoted Aktl hetero-oligomerization with Akt3 leading to transfosphorylation of Akt molecules in leukamogenesis(Laine et al., J. Biol. Chem. 277: 3743-3751 (2002)). TCL1or other factors not characterized in melanoma cells can promote selective activation of Akt3 in an analogous way;An increase in Akt3 activation also plays a significant role in the progression to more advanced aggressive tumors. Examination of Akt3 expression and activity in metastatic melanomas indicated that unregulated expression or activity occurs in>60% of advanced stage metastatic melanomas. However, it is currently unknown whether the presence of high Akt3 activity can predict a disease prognosis or the result of therapeutic regimens. Measuring Akt3 activation in melanomas offers hope as an unprecedented and more accurate prognostic indicator of disease outcome than histopathological measurements such as Breslow depth (ie, the distance measured in millimeters from the granular cell layer to the deepest tumor cell) and ulceration (that is, loss of the epidermis that overlaps with melanoma) that are currently used. A molecular-based test evaluating the activation status of Akt3 in melanocytic lesions may be more sensitive and less subjective when compared to a histological evaluation. This approach could also be useful for selecting suitable patients for clinical trials using drugs that are designed to target activated Akt3 or other members of this signaling pathway.This study showed that the use of siRNA or PTEN expression to reduce Akt3 activity caneffectively reduce the tumorigenic potential ofmelanoma altering apoptotic sensitivity. Thus, melanoma cells that have high levels of Akt3 activity are better suited to survive in the tumor environment in vivo and inhibition of Akt3 activity, directly or by interference with their upstream regulators, is likely to represent an anti-cancer strategy effective for patients with melanoma (Soengas et al., Oncogen 22: 3138-3151 (2003); Johnsone et al., Cell 108: 153-164 (2002)). In fact, as the vast majority of chemotherapeutic agents act by inducing apoptosis, it could be predicted that Akt3 inhibition could reduce the threshold doses of drugs or radiation needed for effective chemotherapy or radiation, providing a mechanism to selectively target cells melanoma (Soengas et al., Oncogen 22: 3138-3151 (2003)). ThereforeTherapeutically targeting Akt3 activity alone or in combination with chemotherapeutic agents, it could be a potentially important therapy for patients with melanoma (Soengas et al., Oncogen 22: 3138-3151 (2003)). In summary, we identified Akt3 as a specific pro-survival kinase, whose increased activity in melanoma tumors corresponds to tumor progression and provides cells with a selective advantage to proliferate and survive environmental stresses.EXAMPLES FOR B ~ RafMATERIALS AND METHODSEXAMPLE 10: Cell Lines, Culture Conditions and B-Raf Mutational Status:The human melanoma cell lines UACC 903, 1205 Lu and C8161, as well as HEK293T cell weremaintained in DMEM (Invitrogen, Carlsbad, CA) supplemented with 10% FBS (Hyclone, Logan, UT). The presence or absence of the T1796A mutation of B-Raf in the UACC 903 and C1161 cell lines was produced in the manner previously described (Miller CJ et al. J. Invest. Dermatol. 123: 990-2 (2004)).In addition, the presence of this mutation in UACC 903 cells and1205 Lu has been reported previously (Miller CJ et al. J. Invest. Dermatol. 123: 990-2 (2004)., Tsao H et al. J. Invest. Dermatol. 122: 337-41 (2004)., Krasilnikov M et al. Oncogene. 22: 4092-101 (2003)). EXAMPLE 11: In Vitro siRNA Studies: siRNA (100 pmol) was introduced in 1 X 106UACC 903, 1205 Lu or C8161 cells by nucleofection with an Amaxa Nucleofector nucleofector (Koeln, Germany) using Solution R / program K-17 as described in the reference (Stahl JM et al. Cancer Res. 64: 7002-10 (2004)). The resulting transfection efficiency was>90%. After nucleofection, cells were plated again for 24-48 hours, when protein lysates were collected for Western blot analysis. To measure the duration of siRNA slaughter, cells were collected at 0, 2, 4, 6 and 8 days after nucleofection with siRNA at B-Raf or C-Raf and were subjected to Western blot analysis. Duplexed undetectable siRNA (Invitrogen, Carlsbad, CA) was used for these studies with the B-Raf sequencesmodified from references (Hingorani SR et al.Cancer Res .; 63: 5198-202 (2003)). The siRNA sequencesused were the following: WT B-RAF (COM4 or 4) -GGACAAAGAAUUGGAUCUGGAUCAU; MUT B-RAF (MuA or A) -GGUCUAGCUACAGAGAAAUCUCGAU; C-RAF-GGUCAAUGUGCGAAAUGGAAUGAGC; LAMIN A / C-GAGGAACUGGACUUCCAGAAGAACA; and VEGF-GCACATAGGAGAGATGAGCTTCCTA.EXAMPLE 12: Western Blot Analysis:ForWestern Blot analysis, lysatesincells werecollected in petri dishesby additioninlysis buffercontaining 50 mM HEPES (pH7.5), 150 mMinNaCI, 10 mMEDTA, 10% glycerol, 1%Triton- X-100mM sodium orthovanadate, 0.1 mM molybdatesodium,mM fluoridephenylmethylsulfonyl, 10pg / mL ofaprotinin, and 5pg / ml leupeptin. Lysatesof cellsintegrals werecentrifuged (> 10,000 X g)for 10minutes at 4 ° C to remove cellular debris. Proteinswere quantifiedusing the assayBCAfrom Pierce(Rockford, IL), and 30pg of lysate per trackwereloadedabout a NuPage Gelfrom Life TechnologiesInc.(Carlsbad,CA). After electrophoresis, samples were transferredfor difluoride membranepolyvinylidene (PaliCorporationPensacolaFL). Theblots were probed withantibodiesaccordingwithrecommendations from eachprovider:anti-pErkand anti-pMek from Cell SignalingTechnologies(Beverly, MA); antibodies to B-Raf, C-Raf, Erk2and cc-enolase from Santa Cruz Biotechnology (Santa Cruz, CA); andan antibody to Lamin A / C from Biomeda Corp (Foster City, CA).Secondary antibodies were conjugated with peroxidase fromstrong root and obtained from Santa Cruz Biotechnology. Immunoblots were developed using an enhanced chi-luminescence detection system (Amersham Pharmacia Biotech, Piscataway, NJ).EXAMPLE 13: In vivo siRNA studies:Animal experimentation was conducted according to protocols approved by the Institutional Animal Care and Use Committee at The Pennsylvania State University College of Medicine. The kinetic characteristics of the tumor were measured by subcutaneous injection of 1 x 106 UACC 903 or 1205 Lu cells nucleofected with siRNA in 0.2 mL of DMEM supplemented with 10% FBS above both the left and right rib cage of six nude mice aged 4-6 weeks (Harlan Sprague Dawley, Indianapolis, IN) . The dimensions of the developing tumors were taken using calipers every other day. For mechanistic studies 5 x 106 UACC 903 nucleofected siRNA cells were injected into mice and the tumors were collected 4 days after cell injection in order to measure changes in cell proliferation and apoptosis, as previously described (Stahl JM et al. Cancer Res. 64: 7002-10 92004)., Stahl JM et al. Cancer Res. 63: 2881-90 (2003). ).EXAMPLE 14: Studies of BAY 43-9006 in vitro and in vivoThe compound BAY 43-9006 used for these studies was synthesized in the manner described in the reference (Bankston D et al. Organic Process Res. Dev. 6: 777-81 (2002).). To assess the inhibitory effects of BAY 43-9006 on the typewild-type and mutant B-Raf, HEK 293T cells were transfected with wild-type B-Raf identified with HA, V599E mutant B-Raf or vector (pcDNA3), using Calcium Phosphate as previously described (Robertson GP et al. Proc. Natl. Acad. Sci. USA 95: 9418-23 (1998).). After transfection (72 hours) the medium was replaced with DMEM medium supplemented with 10% FBS and pM BAY 43-9006 or DMSO vehicle. Two hours later, protein lysates were collected for Western blot analysis. The levels of MEK and phosphorylated ERK were quantified from 3 independent blots and differences in multiples under different conditions were estimated after normalization against an Erk2 loading control.The effect of BAY 43-9006 on tumor development was measured by subcutaneous injection of 5 x 106 UACC 903 cells or 1 x 106 1205 Lu cells in nude mice. After 6 days when a small tumor had developed 950-100 mm3), the mice received an intraperitoneal injection every other day, consisting of 50 pL of vehicle (DMSO), or of the drug BAY 43-9006 at concentrations of 10, 50 or 100 mg / kg of body weight for UACC 903 and 50 mg cells / kg body weight for 1205 Lu cells. For studies involving pretreatment with BAY 43-9006, 50 mg / kg of body weight of the drug were injected intraperitoneally twice (-4 and -2 days) before subcutaneous injection of UACC 903 or 1205 Lu. The mechanism by which pharmacological inhibition of mutant developmentV599E B-Raf slows down tumor developmentidentified by comparing tumors of the same size that developed in parallel. This was achieved by subcutaneous injection of 5 x 106of UACC 903 cells followed on day 6 by intraperitoneal injection every 2 days with 50 mg / kg of BAY 43-9006. For a temporal and spatial pairing of tumors treated with DMSO control and treated with drugs, either 1 x 106, or 2.5 x 106 or 5 x 106 millions of UACC 903 cells subcutaneously and as of day 6, they were treated intraperitoneally with a DMSO vehicle every two days. Tumors treated with drugs or vehicles of the same size that developed in parallel were collected on days 9, 11, 13 and 15 for comparison. At each point in time, tumors from mice treated with a vehicle or drug were collected for analysis of cell proliferation, apoptosis and vascular development, as already described (Stahl JM et al. Cancer Res. 64: 7002-10 (2004) , Stahl JM et al. Cancer Res. 63: 2881-90 (2003)).EXAMPLE 15: Measurements of Apoptosis, Cell Proliferation and Vascular Density in TumorsApoptosis measurements in paraffin-encapsulated formalin-fixed tumor sections were taken using the Roche TUNEL TMR Red Apoptosis kit (Manheim, Germany), as already described (Stahl JM et al. Cancer Res. 64: 7002 -10 (2004)., Stahl JM et al. Cancer Res. 63: 2881-90 (2003).). Cell Proliferation rates in formalin-fixed tumor sections were measured using the RPN 20 cell proliferation kit (Amersham Biosciences, Piscataway, NJ) that uses BrdU incorporation andimmunocytochemistry. Two hours before sacrifice, 0.2 ml of BrdU was injected intraperitoneally into mice and the tumors were processed according to the instructions of the proliferation kit. The number of cells stained by BrdU was counted as a percentage of total tumor cells treated with BAY 43-9006 or vehicle (DMSO). Quantification of vascular density using a purified mouse anti-murine CD31 monoclonal antibody (PECAM-1) (Pharmingen, San Diego, CA) has been previously described (Stahl JM et al. Cancer Res. 64: 7002-10 ( 2004), Stahl JM et al. Cancer Res. 63: 2881-90 (2003)). The ratio of the tumor area occupied by vessels to the total area was calculated using the IP Lab imaging software program. For all tumor analyzes, a minimum of 6 different tumors were analyzed with 4-6 fields for the tumor and the results represented as the mean ± mean standard error.EXAMPLE 16: In vivo pErk measurements:To quantify changes in pErk levels in paraffin-encapsulated formalin-fixed tumor sections, antigen recovery was performed with 0.01 M citrate buffer at pH 6.0 for 20 minutes in a 95 ° water bath. Ç. The slides were cooled for 20 minutes, washed in PBS, then incubated in H2O2 3% for 10 minutes to extinguish endogenous peroxidase activity, then sections were blocked with 1% BSA for 30 minutes and incubated with anti-pERK antibody at a 1: 100 dilution (Cell Signaling Technologies, Beverly, BUT) overnight at 4 ° C.After rinsing in PBS, the sections were incubated with biotinylated anti-rabbit IgG for 1 hour, rinsed again in PBS, and incubated with peroxidase-labeled streptavidin for 30 minutes. Visualization was performed using the AEC substrate kit (aminoethyl carbazole) for 5-10 minutes (Zymed Laboratories Inc., South San Francisco, CA) and the cores counter-stained with hemotoxylin before mounting the cap using an aqueous mounting solution. The mean percentage of cells ± mean standard error that were stained positive for pErk was counted from a minimum of 6 different tumors with 4-6 fields counted per tumor.EXAMPLE 17: In vitro Fold Times and Tumor Latency Periods in vivo.The in vitro folding time of UACC 903 cells nucleofected with siRNA was estimated with 5 x 103 cell / well in 200 pL of DMEM supplemented with 10% FBS in multiple wells in five 96 well plates. Growth was measured every 24 hours over a period of 5 days by conducting a colorimetric assay on each plate every day using the sulforodamine B (SRB) binding assay (Sigma Chemical Co., St. Louis, MO) and the calculated folding time, as previously described (Stahl JM et al. 63: 2881-90 (2003)). The in vivo tumor latency period was measured by estimating the number of days required for the average tumor size to reach 10 mmJ.EXAMPLE 18: Growth Inhibition by BAY 43-9006 / ICso deMelanoma Cells UACC 903To measure the growth-inhibitory or ICbü effects of BAY 43-9006 on UACC 903 cells, 5 x 103 cells / well in 96-well plates. After 24 hours, varying concentrations of BAY 43-9006 (0, 0.002, 0, 1, 0, 4, 1, 6, 6, 3, 25, or 10 pM) were added to the wells of 8 duplicate strips in the board. After 72 hours of culture at 37 ° C in a humidified C0 atmosphere2 at 5%, the medium was discarded and the cells were fixed in 10% trichloroacetic acid. Surviving cells at each drug concentration were calculated using the SRB binding assay (Stahl JM et al. Cancer Res. 63: 2881-90 (2003).). To demonstrate the effects of increasing concentrations of BAY 43-9006 (5, 10, 15 and 20 pM) on the phosphorylation levels of MEK 12 and ERK 12 in UACC 903 cells after 2 hours of exposure to the drug, Western blot.EXAMPLE 19: VEGF Expression AnalysisTo determine the amount of VEGF secreted by cells after killing siRNA-mediated B-Raf protein activity or after treatment with BAY 43-9006, the human VEGF Quantikine (DVE00) kit was used (R&D Systems Inc. , Minneapolis, MN). UACC 903 or 1205 Lu cells (5 x 105) nucleofected with several siRNAs were placed in 60 mm petri dishes and 24 hours later the medium was replaced with DMEM containing 2% FBS. After another 24 hours, the medium was replaced again and the mediumConditioned for ELISA analysis was collected 24 and 48 hours later. For the BAY 43-9006 studies, 3 x 105 UACC 903 or 1205 Lu cells in 60 mm petri dishes and 24 hours later the medium was exchanged for DMEM containing 2% FBS. After another 24 hours, the medium was replaced with DMEM supplemented with 2% FBS alone or in combination with BAY 43-9006 (5, 10, 15 pM) in DMSO vehicle. After 12 or 24 hours, the conditioned medium was collected for analysis by ELISA. The medium was removed by centrifugation at 14,000 rpm (4 ° C) for 5 minutes and stored at -80 ° C. VEGF analysis by ELISA was carried out in triplicate in duplicate experiments according to the manufacturer's instructions.EXAMPLE 20. • Statistics:For statistical analysis, Student's t test was used for two-to-two comparisons and the One-Way Analysis of Variance test (ANOVA) or the Kruskal-Wallis test was used for group to group comparisons, followed by the appropriate post hoc tests ( Dunnet, Tukey or Dunn). The results were considered significant at a P value of<0.05.EXPERIMENTAL RESULTSEXAMPLE 21: SiRNA-mediated targeting against mutant V599E B-Raf inhibits the development of the melanoma tumor.Table 2. Growth properties of UACC 903 cells treated with siRNA against B-Raf, C-Raf or mixed siRNATreatment with siRNA In vitro folding time in days (hours)% of proliferating cells on day 4 in tumors ± mean standard error Latency period for tumor formation (days)1 Mixed 11.25 (30) 10 ± 0.7 5 C-Raf 1.1 (26) 15 ± 0.6 5 B-Raf (4) 1.6 (38.4) 2 ± 0.6 14 B- Raf (A) 1.7 (40.8) 2 ± 0.4 161 Latency period for tumor formation was defined as the number of days required for an average tumor size to reach 10 mm3.The role ofV599E Mutant B-Raf in melanoma tumorigenesis is currently unknown. In order to face this problem, we consider that the inhibition of the expression or activity ofV599E Mutant B-Raf could be used to identify the role this protein plays in melanoma tumorigenesis. A siRNA-mediated approach was used to kill the expression of the mutant V599E B-Raf in UACC 903 and 1205 Lu cell lines containing the mutant protein or B-Raf in the C8161 cell line devoid of the T1796A mutation. MuA or A siRNA was designed to reduce expression of the native-type and mutant protein whereas Com4 or 4 siRNA only reduced the expression of the mutant protein as previously described (Hingorani SR et al. / Cancer Res. 63: 5198 -202 (2003)). siRNA for these studies was introduced into cell lines through nucleofection resulting in transfection efficiencies of>90% (data not shown) (Stahl JM et al. Cancer Res64: 7002-10 (2004)). The effectiveness of siRNA in reducingexpression of B-Raf and C-Raf protein in UACC 903 cells (Figure 12A), 1205 Lu (Figure 12B) and C8161 (Figure 12C) after nucleofection was measured by Western blot analysis. 24 or 48 hours after nucleofection, each siRNA reduced only the expression of the protein against which it was designed, demonstrating, therefore, the specificity and efficacy of the abatement of expression by siRNA in each of these cell lines. In UACC 903 and 1205 Lu cells, only B-Raf siRNA reduced the levels of phosphorylation (activity) of the targets downstream from MEK and ERK, whereas mixed siRNA or C-Raf siRNA had no effect on these proteins (Figure 12A and figure 12B). The maximum reduction in levels of phosphorylation (activity) of MEK and ERK in UACC 903 and 1205 Lu cells was observed 48 hours after nucleofection. On the other hand, reduced expression of B-Raf or C-Raf in C8161 cells had a negligible negligible effect on the phosphorylated MEK and ERK levels (Figure 12C). Thus, the inhibition of expression ofv599E b-Raf in melanoma strains containing mutant protein leads to reduced MEK and ERK activity, while reducing the expression of B-Raf protein in melanoma cells that do not have the T1796A mutation does not appear to affect the activity of targets at downstream.To measure the effect of reduced expression ofV599E B-Raf (activity) on tumor development, expression ofV599E B-Raf in UACC 903 cell lines and1205 Lu was inhibited using siRNA followed by an injectionsubcutaneous tissue in mice using a transient activity depletion approach that has been previously reported (Stahl JM et al. Cancer Res. 64: 7002-10 (2004)). The siRNA-mediated protein expression abatement continued for a minimum of 8 days in UACC 903 (Figure 13A) and 1205 Lu cells (Figure 13B). In addition, a corresponding reduction in pErk levels was also observed for the same period (Figure 13B). The size of the developing tumor was measured on alternate days until 17, 5 days after the nucleofection to determine the effect of the abatement of the expression of B-Raf on the melanoma tumorigenesis. A reduction in tumor development was seen in both UACC 903 cells (Figure 13C) and 1205 Lu cells (Figure 13D) in which the expression ofV599E Mutant B-Raf had been slaughtered. On the other hand, siRNA-mediated inhibition of C-raf controls, a mixed siRNA or buffer did not alter tumor development. The absence of an effect after c-Raf culling suggested that signaling throughV599E B-Raf was specifically needed for tumor development. Therefore, the siRNA-mediated reduction in expression (activity) ofv599e b-Raf in melanoma cells before injection in mice inhibited tumorigenesis.An analogous experiment was undertaken using a Raf kinase inhibitor, called BAY 43-9006, to inhibit the activity of B-Raf protein in UACC 903, 1205 Lu or C8161 cells. This compound, originally identified in a Raf kinase inhibitor test, has been shown to inhibitthe activity of the native type B-Raf protein (Lowinger ALSO et al., Curr Pharm. Des. 8: 2269-78(2002) -. j Lyons JF et al. Endocr. Report Cancer 8: 219-25 (2001)). Initially, we determined the concentration of BAY 43-9006 that reduced the survival of UACC 903 cells in half, also known as IC40, and found to be 5-6 pM (data not shown). Therefore, a concentration of 5 pM was chosen for subsequent in vitro studies. Next, we demonstrated that BAY 43-9006 inhibited the activity of both mutant and native-type B-Raf protein to the same point by expression or constructions identified with HA of B-Raf of the native type as ofV599E Mutant B-Raf in HEK 293T cells (Figure 14A). As already reported, we observed that the levels of ERK or MEK phosphorylated (active) in cells that expressedV599E B-Raf were 5-7 times higher than in cells transfected with the native type of B-Raf only (Davies H et al. Nature. 417: 949-54(2002)). HEK 293T cells that expressed either the native type B-Raf protein or the mutantV599E B-Rafs were then exposed to 5 µM BAY 43-9006 for 2 hours to examine the effect on signaling pathway activities. Exposure to BAY 43-9006 reduced the levels of MEK and ERK phosphorylated in cells that expressed or the native type B-Raf protein as the mutantV599E B-Raf 5-6 times and 3-4 times, respectively (Figure 14A). In this way, BAY 43-9006 inhibits the activity of both native and mutant B-Raf.To demonstrate that BAY 43-9006 inhibitedprotein signalingV599E Mutant B-Raf in UACC 903 cells, in vitro cultures were exposed for 2 hours to increasing concentrations of BAY 43-9006. BAY 43-9006 reduced the levels of NEK and phosphorylated ERK (active) in UACC 903 cells in a dose-response manner (Figure 14B). The inhibitory effects of BAY 43-9006 on MPA kinase signaling persisted for at least 2 to 3 days in UACC 903 and 1205 Lu cell lines (data not shown). Then we evaluated the effect of pretreating animals with BAY 43-9006 before subcutaneous injection of UACC 903 or 1205 Lu cells. For these experiments the mice were exposed to 50 mg / kg of BAY 43-9006 for 4 days before the subcutaneous injection of 5 x 106 cells that was followed by an intraperitoneal injection of the drug every two or three days until the 22nd. Both tumor development in UACC 903 (Figure 14C) and 1205 Lu (not shown) was significantly inhibited (Student's t test ; P<0.05), and comparison of ÜACC 903 tumors matched by size revealed reduced proliferation and reduced vascular development in tumors treated with BAY 43-9006 compared to vehicle-treated controls (not shown). In addition, the tumor size slowly increased until day 8, and then remained at the same level without any statistical difference between subsequent measurements of the tumors (ANOVA; P> 0.05). Thus, the pharmacological inhibition of the activity ofV599E Mutant B-Raf by pretreating the host animal with BAY 43-9006 significantly reduced the tumorigenic potential oftoilet: Q Qpmelanoma that expressed the mutant B-Raf.To identify the mechanism that leads to tumor inhibition in cells pretreated with siRNA toV599E B-Raf, tumor cell proliferation and apoptosis rates were measured in UACC 903 tumors 4 days after subcutaneous injection. No difference in apoptosis rate 91-2%) was detected using the TUNEL assay (data not shown). However, UACC 903 cells treated with B-Raf siRNA had a number of 5 to 6 times fewer proliferating cells compared to the nucleofected control cells with buffer alone, mixed siRNA or C-Raf siRNA (Figure 14D). Next, in vitro folding times, in vivo proliferation rates, and tumor latency periods in the UACC 903 cell line were compared to determine whether reduced growth could be responsible for delayed tumor development (Table 2). UACC 903 cells nucleofected with siRNA against C-Raf or with mixed siRNA doubled in number every 1.2 days (or ~ 29 hours), while cells nucleofected with siRNA against B-Raf doubled in number every 1.65 days (or ~ 40 hours) which is a delay of ~ 38%. On the other hand, the analysis of proliferating cells in tumors showed a significant difference between control tumors nucleofected with siRNA against C-Raf or mixed siRNA (ANOVA; p<0.05), which had 10-15% proliferating cells compared to nucleofected tumor cells withsiRNA against B-Raf who had 2-3%proliferating cells.The -82¾ reduction in the proliferative capacity of nucleofected cells with siRNA against B-Raf could be responsible for the delayed latency period of tumor development. Therefore, for tumors of the same size as controls on day 5, cells nucleofected with siRNA against B-Raf required an additional 10 days to form tumors of the same size (Table 2). As tumor development was delayed from> 200%, the reduced growth rate observed in vitro and in vivo could be responsible for the reduced tumorigenic potential of these cells. Therefore, the inhibition of expression (activity) ofV599E Mutant B-Raf in melanoma cells before tumor formation significantly reduced the growth potential of the cells in vivo, thus delaying tumorigenesis.EXAMPLE 22: Inhibition of melanoma tumor development by attacking theVb99E Mutant B-Raf in pre-existing tumors.It is currently unknown whether the fact of targetingV599E Mutant B-Raf in established pre-existing melanoma tumors could slow the development of the tumors, and if so, if the mechanism is the same as when it is aimed atV599L B-Raf in cells before tumor formation. Therefore, we then examined whether the targeted pharmacological attack of B-Raf in pre-existing melanoma tumors would inhibit tumor development by an analogous mechanism, five million UACC 903 cells, one million 1205 Lu cells or five million C8161 cells were injected subcutaneously into nude female mice from4 to 6 weeks old. On day 6, vehicle (DMSO) or compoundBAY 43-9006 dissolved in vehicle (10, 50 or 100 mg / kg) was administered to mice by intraperitoneal injection every 48 hours. A period of 48 hours between drug administrations was chosen because the inhibitory effects on the MAP kinase signaling pathway in UACC 903, 1205 Lu and C8161 cells persisted for at least that period (data not shown). The size of the tumors that developed was measured using calipers on alternate days and the results are shown for UACC 903 cells in figure 4A and for 1205 Lu in Figure 15B. Although all concentrations of compound BAY 43-9006 have delayed the development of the UACC 903 tumor, only concentrations> 50 mg / kg caused the tumor development to stop 7 days after the start of treatment (figure 4B). Tumor development in mice treated with BAY 43-9006 at 10 mg / kg was delayed by ~ 1 week, but the UACC 903 tumors constantly increased in size and the mice had to be sacrificed on day 27 when the tumors had reached sizes> 2.4 00 mm3. For UACC 903 cells, a small increase occurred in tumor size until day 13; however, after a week of treatment with the drug, tumor sizes stabilized and there was no statistically significant increase in tumor sizes from days 13 to 31 (Figure 15A) (ANOVA: P.O, 05). The treatment of 1205 Lu tumors with 50 mg / kg BAY 43-9006 also reduced developmenttumor in an analogous manner causing a stabilization in thetumor size from days 17-31 (Figure 15B) (ANOVA; P = 0.12). On the other hand, although BAY 43-9006 inhibited the levels of pMek and pErk in C8161 cells, no difference was observed in the kinetic characteristics of tumor formation (data not shown). Thus, the pharmacological inhibition ofV599R Mutant B-Raf slows down tumor growth in pre-existing melanoma tumors but does not produce tumor regression. On the other hand, inhibition of B-Raf in melanoma cells that do not have the T1796A mutation does not appear to alter the tumorigenic potential.To confirm that the compound BAY 43-9006 affected the activity of the signaling pathway ofV599E Mutant B-Raf in tumors, the percentage of cells expressing high levels of phosphorylated ERK was counted in tumors from mice 9 days after starting treatment with vehicle (DMSO) or with vehicle containing 50 mg / kg of BAY 43-9006 (Figure 15C). Quantification of the number of pErk positive cells showed that tumors treated with BAY 43-9006 had ~ 3 times fewer pErk positive cells than tumors treated with the control vehicle (Figure 15D). (Student's t test; P<0.05). The significantly higher number of ERK-positive cells phosphorylated in vehicle-treated tumors indicated that BAY 43-9006 was inhibiting the activity of theV599E Mutant B-Raf in vivo. Therefore, these results demonstrate that the pharmacological inhibition ofV599E Mutant B-Raf with BAY 43-9006 reduces signaling of the pathwayMPA kinase in tumors, thereby mediating tumor inhibition.EXAMPLE 23: Mechanically, BAY 43-9006 inhibits the vascular development of pre-existing melanoma tumors leading to an increase in apoptosis.The above experiments showed a consistent relationship between the inhibition ofV599E Mutant B-Raf and reduced tumor development; therefore, subsequent studies have focused on identifying the mechanism by which this occurred in existing melanoma tumors. For these studies UACC 903 tumors paired in time and space exposed or to vehicle or BAY 43-9006 were analyzed for vascular development as well as for apoptosis and proliferation rates in order to identify the critical event that slows the growth of existing tumors Paired tumors were collected every two days, starting on the 9th and until the 15th; the rates of apoptosis, growth and vascular development were compared at each point in time (Figure 16). A statistically significant difference in vascular development on day 9 was observed between tumors treated with vehicle and with BAY 43-9006 (Figure 5A) (Student's t test; P<0.05). On the other hand, no statistically significant difference was detected in the number of proliferating cells (Student's t-test; P = 0.61) or apoptotic areas (Student's t-test; p = 0.15) in tumor masses on day 9 between the control tumors and those treated with BAY 43-9006 (Figure 16B and Figure 16C). However, for all analyzes on the 11th inonwards, a statistically significant difference wasobserved between control tumors and those treated with the drug (Student's t test; P<0.05). Taken together, these data suggest that a significantly reduced vascular development seen on day 9 in tumors treated with BAY 4 3-9006 was an initiation event that led to delayed tumor growth. Apoptosis became evident in tumors treated with BAY 43-9006 on day 11 and occupied up to 25% of the tumor area on day 15 (Figure 16B). On day 20, ~ 50% of the tumor area was undergoing apoptosis (data not shown). BAY 43-9006 also affected the tumor cell proliferation of pre-existing tumors leading to a 32-57% reduction in the percentage of proliferating cells (Figure 16C). Taken together, these data lead to the conclusion that inhibition of vascular development is a key event leading to inhibition of the growth of pre-existing melanoma tumors.As vascular development in tumors occurs through angiogenesis, or the growth of new vessels from surrounding vascular beds, and is triggered by angiogenic factors secreted by tumor cells (Carmeliet P, Jain RK. Nature. 407: 249-57 ( 2000), we predict that BAY 43-9006 and siRNA-mediated inhibition ofV599E B-Raf were reducing the activity of a key angiogenic factor, thereby reducing vascular development (Kranenburg O et al. Biochim. Biophys. Acta. 1654: 23-37 (2004); Jain RK. Semin. Oncol. 29: 3- 9 (2002)). To examine thispossibility, an ELISA assay was used to determine whether VEGF secretion was reduced after inhibition ofV599E B-Raf. Initially UACC 903 and 1205 Lu cells in which the expression ofV599E B-Raf was inhibited with the use of siRNA were examined and revealed a significant reduction in VEGF secretion compared to controls (Figure 17A). Then the effects of inhibition ofV599E B-Raf mediated by BAY 43-9006 over UACC 903 and 1205 Lu and it was found that it reduced VEGF secretion in a dose-dependent manner (Figure 17B). To determine whether the siRNA-mediated reduction in VEGF resulted in tumor inhibition analogous to that seen after inhibition ofv599e b-Raf, siRNA against VEGF was nucleofected in UACC 903 or 1205 Lu cells. A reduced expression of VEGF was observed using VEGF-specific siRNA (Figure 17A), which reduced the tumorigenic potential of UACC 903 (Figure 17C) and 1205 Lu cells (Figure 17D) in a manner consistent with what occurred after the reduction the expression ofV599E B-Raf. Thus, a reduction in VEGF secretion mediated by a reduction in the activity ofV599E B-Raf led to inhibition of vascular development, which consequently affected the development of the melanoma tumor.EXPERIMENTAL DISCUSSION FOR B-RafThis study demonstrates that the use of siRNA or pharmacological inhibition of expression (V599E Mutant B-Raf effectively reduces the tumorigenic potential of melanoma cells by reducing the proliferative and / or angiogenic capacity of tumor cells. As such, melanoma cells that haveV599E Mutant B-Raf are better suitedfor proliferation in the tumor environment in vivo. We show thatthe targeted reduction of expression (activity) ofV599E B-Raf in melanoma cells before tumor development significantly reduced the growth potential of melanoma cells, thereby inhibiting tumor development. On the other hand, apoptosis did not play any significant role in this process. In addition, inhibition of tumor development has only been observed in cells where the expression ofV599E Mutant B-Raf had been killed and followed by the abatement of C-Raf activity or the abatement of B-Raf in melanoma cells that did not have the B-Raf T1796A mutation. Therefore, it is evident that signaling throughV599E B-Raf was specifically needed for the development of the melanoma tumor. These data are consistent with our previous study which shows that inhibition ofV599E SiRNA-mediated B-Raf in WM793 melanoma cells reduced the growth potential of these cells in vitro (Hingorani SR et al., Cancer Res .: 63: 5198-202 (2003)). Analogous in vitro studies using UACC 903 cells in this report reinforce these earlier observations. The abatement of the expression (activity) ofv599E Mutant b-Raf also specifically reduced ERK signaling leading to reduced growth, which did not occur after the cessation of C-Raf activity. Like this,V599E Mutant B-Raf promotes the growth of melanoma cells both in vitro and in vivo; in addition, targeted inhibition prior to tumor development inhibits mediated tumorigenesis by reducing cell growthtumoral.The attack aimed atV599E Mutant B-Raf in pre-existing established tumors halted growth; however, growth inhibition played only a partial role in this process. What was most significant is that the comparison of paired tumors by size and time revealed that inhibition of vascular development played an initiating role in delaying tumor growth. As with all solid tumors, vascular development occurs through angiogenesis in which the growth of new vessels from the surrounding vascular beds is triggered by angiogenic factors secreted by tumor cells (Carmeliet P, Jain RK. Nature. 407: 249 -57 (2000) .In this study, we found that inhibition ofV599E B-Raf reduced VEGF secretion by UACC 903 and 1205 Lu melanoma cells. B-Raf has been reported to have played an important role in embryonic vascular development, since B-RAF knockout mice had significant endothelial cell death leading to bleeding and embryonic lethality (Wojnowski L et al. Nat. Genet .; 16: 293-7 (1997)). However, we did not observe any deathssignificant endothelial cell growth in vessels in pre-existing tumors after inhibition ofV599E B-Raf using BAY 43-9006. On the contrary, the inhibition ofV599E B-Raf inhibited angiogenesis (Kranenburg O et al. Biochim Biophys Acta. 1654: 23-37 (2004)., Jain RK. Semin. Oncol. 29: 3-9 (2002))mediated through reduced secretion of VEGF by tumor cells. This observation is supported by published evidence that a reduction in VEGF secretion has led toreduction of angiogenesis, thereby inhibiting the tumorigenic potential of cancer cells (Heidenreich R et al. Int. J. Cancer. Ill: 348-57 (2004), Inai T et al. Am. J. Pathol. 165: 35- 52 (2004)). Thus, a reduction in VEGF secretion mediated by a reduction in signaling fromV599E Mutant B-Raf leads to inhibition of angiogenesis, stopping the growth of pre-existing melanoma tumors.Our study also showed that BAY 43-9006 inhibits' activity ofV599E B-Raf in vitro and in vivo, leading to reduced phosphorylation of MEK and ERK targets downstream, which delayed the development of the melanoma tumor. We observed that pretreatment of animals with BAY 43-9006 reduced the development of melanoma tumor in a manner analogous to siRNA-mediated inhibition. However, treatment with BAY 43-9006 only delayed the development of established tumors by destroying their vascular development. A complete regression of the tumors did not occur, on the contrary, the size of the tumor became relatively static after treatment. This observation is in line with preliminary data from clinical trials in which monotherapy with BAY 43-9006 was relatively ineffective for treating patients with advanced stage melanoma (Tuveson DA et al., Cancer Cell. 4: 95-8 (2003 )., Ahmad T et al., Proc. Am. Soc. Clin. Oncol. 23: 708 (2004)). However, in combination with traditional chemotherapy (paclitaxel and carboplatin), a 50% response rate has occurred in patients (Tuveson DA et al., Cancer Cell. 4: 95-8 (2003), Flaherty K et al. Proc Am Soc. Clin. Oncol. 23:708 (2004)). Therefore, although BAY 43-9006 delays thetumor development, it is likely that the drug will need to be combined with other synergistic therapeutic agents to cause regression of pre-existing established tumors (Tuveson DA et al., Cancer Cell. 4: 95-8 (2003) Bollag G. et al. Curr. Opin. Investig. Drugs 4: 1436-41 (2003), Lyons JF et al. Endocr. Cancer Report. 8: 219-25 (2001)). It is also possible that the route of administration of the drug could alter the effectiveness of BAY 43-9006 in patients with melanoma. Although the clinical test involved oral administration of the drug, our study administered the drug by intraperitoneal injection every 2 or 3 days. An alternative route of administration could be more effective by increasing the local bioavailability of the drug (Sparreboom A et al. Proc. Natl. Acad. Sci. USA 94: 2031-5 (1997),Bardelmeijer HA et al. Cancer Research, 62: 6158-64 (2002), Hale JT et al. Bioch. Pharm. 64: 1493-502 (2002), Kimura Y et al. Cancer Chemother. Pharm. 49: 322-8 (2002)). Therefore, aiming therapeutically the activity ofV599E B-Raf in combination with chemotherapeutic agents can offer an effective approach to shrink established melanoma tumors containing this mutant protein.In conclusion, we identified the mechanisms by which v599EB_Frogj mutant promotes the development of a melanoma tumor and we show how this mutation gives the melanoma cells selective and angiogenic growth advantages in the tumor environment.EXAMPLE 24: Akt3 Domain Exchange Experiments,Results and discussionThe permutation of domains between the Akt isoforms identified the Akt3 region that leads to preferential activation of Akt3 and not Aktl or Akt2 in melanoma. Activation is measured as phosphorylation levels of threonine 308 or serine 472 in Akt3; or by immunoprecipitation of Akt3 followed by an in vitro kinase assay in which Crosstide is phosphorylated by Akt3 to estimate activity. The Akt3 domains were exchanged with the Akt2 or Aktl domains and the constructs containing the chimeric genes were nucleofected in the melanoma cell lines WM35 or UACC 903. Akisto 3 and Akt2 myristoilated served as a positive control whereas Akt3 killed (T305a / S427A) and Akt2 dead (T309A / S474A) served as negative controls. The transfer of native-type Akt3 led to increased activity in contrast to native-type Akt2 that did not, which demonstrated the specificity for Akt3 activation in melanoma cells. The constructs in which the plecstrin homology domain from Akt3 (amino acids 1-110) was connected to the catalytic-regulatory domains of Akt2 did not lead to activation. On the other hand, constructs in which the plecstrin homology domain from Akt2 (amino acids 1-110) was connected to the catalytic-regulatory domains of Akt3 (amino acids 111-497) were activated. This maps the critical region that leads to preferential activation of Akt3 in melanomas of amino acids 111-497. This is theregion to which therapeutic agents can be directedto specifically prevent Akt3 activation in melanomas.Although the present invention has been described in conjunction with specific modalities presented above, many alternatives, modifications and variations of them will be evident to those skilled in the art. All such alternatives, modifications and variations are intended to affect the spirit and scope of the present invention. All documents (publications and patent applications, for example) cited in this document are incorporated into this document for reference to the same extent that each individual document would have been specifically and individually indicated to be incorporated for reference.REFERENCESAhmad T, Marais R, Pyle L, al. and. BAY 43-9006 in patients with advanced melanoma: The Royal Marsden experience. Proc Am Soc Clin Oncol 2004; 23: 708.Alessi DR, Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P, Hemmings BA. Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J. 15 (23): 6541-51 (1996).Andjelkovic M, Jones PF, Grossniklaus U, Cron P, Schier AF, Dick M, Bilbe G, Hemmings BA. Developmental regulation of expression and activity of multiple forms of the Drosophila RAC protein kinase. J Biol Chem. 270 (8): 4066-75 (1995).Atkins, J.H., and Gershell, L.J., Selective anticancer drugs, Nature Rev. Drug Dis 1: 491-492 (2002).Bailo, M.T., and Ang, K.K., Radiation therapy for malignant melanoma., Surgical Clinics North Am 83: 323-342 (2003).Bankston D, Dumas J, Natero R, Riedl B, Monahan M-K, Sibley R. A Scaleable Synthesis of BAY 43-9006: A Potent Raf Kinase Inhibitor for the Treatment of Cancer. Organic Process Res Dev 2002; 6: 777-81.Bardelmeijer HA, Ouwehand M, Buckle T, et al. Low systemic exposure of oral docetaxel in mice resulting from extensive first-pass metabolism is boosted by ritonavir. Cancer Research 2002; 62: 6158-64.Bastian, B.C., LeBoit, P.E., Hamm, H., Brocker,E.B., and Pinkel, D., Chromosomal gains and losses inprimary cutaneous melanomas detected by comparative genomic hybridization, Cancer Res 58: 2170-2175 (1998).Bellacosa, A., by Feo, D., Godwin, AK, Bell, DW, Cheng, JQ, Altomare, DA, Wan, M., Dubeau, L., Scambia, G., and Masciullo, V., Molecular alterations of the AKT2 oncogene in ovarian and breast carcinomas, Int J Cancer 64: 280-285 (1995).Bellacosa A, Testa IR, Moore R, Larue L. A portrait of AKT kinases: human cancer and animal models depict a family with strong individualities. Cancer Biol Ther. 3 (3): 268-75. Epub 2004 (2004).Bollag G, Freeman S, Lyons JF, Post LE. Raf pathway inhibitors in oncology. Curr Opin Investig Drugs 2003 / 4: 1436-41.Brazil DP, Hemmings BA. Ten years of protein kinase B signaling: a hard Akt to follow. Trends Biochem Sci. 26 (11): 657-64 (2001).Brazil, D.P., Park, J., and Hemmings, B.A., PKB binding proteins. Getting in on the Akt., Cell 111: 293-303 (2002).Brazil DP, Yang ZZ, Hemmings BA. Advances in protein kinase B signaling: AKTion on multiple fronts. Trends Biochem Sci. 29 (5): 233-42 (2004).Brodbeck D., Cron, P., and Hemmings, B.A., A human protein kinase Bgamma with regulatory phosphorylation sites in the activation loop and in the C-terminalhydrophobic domain, J Biol Chem 274: 9133-9136 (1999).Brodbeck D, Hill MM, Hemmings BA. Two splice variants of protein kinase B gamma have different regulatory capacity depending on the presence or absence of the regulatory phosphorylation site serine 472 in the carboxyl-terminal hydrophobic domain. J Biol Chem. 276 (31): 29550-8. Epub 2001 (2001).Brose MS, Volpe P, Feldrnan M, et al. BRAE and RAS mutations in human lung cancer and melanoma. Cancer Res 2002; 62: 6997-7000.Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Nature 2000; 407: 249-57.Chang F, Steelman LS, Shelton JG, et al. Regulation of cell cycle progression and apoptosis by the Ras / Raf / MEK / ERK pathway. Int J Oncol 2003; 22: 469-80.Chen, WS, Xu, PZ, Gottlob, K., Chen, ML, Sokol, K., Shiyanova, T., Roninson, L, Weng, W., Suzuki, R., Tobe, K., et al., Growth retardation and increased apoptosis in mice with homozygous disruption of the Aktl gene. Dev '15 genes: 2003-2208 (2001).Cheng, J.Q., Godwin, A.K .. Bellacosa. A., Taguchi, T., Franke, TF, Hamilton, TC, Tsichlis, PN, and Testa, JR, AKT2 a putative oncogene encoding a member of a subfamily of protein-serine / threonine kinase, is amplified in human ovarian carcinomas, Proc Nat Acad Sciences USA 09: 9261-9211 (1992).Cheng, J.Q., Ruggeri, B., Klein, W.M., Sonoda, G., Altomare, D.A., Watson, D.K., and Testa, J.R.,Amplification of AKT2 in human pancreatic cells andinhibition of AKT2 expression and tumorigenicity by antisense RNA, Proc Nat Acad Sciences USA 93: 3636-3641 (1996).Cho, H., Mu, J., Kim, JK, Thorvaldsen, JL, Chu, Q., Crenshaw, EB, 3rd, Kaestner, KH, Bartolomei, MS, Shulman, GI, and Birnbaum, MJ, Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta), Science 292: 1728-1731 (2001).Cho; H., Thorvaldsen, JL, Chu, Q., Fent, F., and Birnbaum, MJ, Aktl / PKBalpha is required for normal growth but dispensable for maintenance of glucose homeostasis in mice, J Biol Chem 276-38349-38352 (2001 ).Chong H, Vikis HG, Guan KL. Mechanisms of regulating the Raf kinase family. Cell Signal 2003; 15: 463-9.Datta SR, Brunet A, Greenberg ME. Cellular survival: a play in three Akts. Genes Dev. 13 (22): 2905-217 (1999).Davies H, Bignell GR, Cox C, et al. Mutations of the BRAF gene in human cancer. Nature 2002; 417: 949-54.Dhawan, P., Singh, A.B., Ellis, D.OL., and Richmond, A., Constitutive activation of Akt / protein kinase B in melanoma leads to up-regulation of nuclear factor-kappaB and tumor progression, Cancer Res 62: 7335-7342 (2002). Ferguson KM, Kavran JM, Sankaran VG, Fournier E, Isakoff SJ, Skolnik EY, Lemmon MA. Structural basis fordiscrimination of 3-phosphoinositides by pleckstrin homology domains. Mol Cell. 6 (2): 373-84 (2000).Flaherty K, Brose MS, Schuchter L, et al. Phase I / II trial of BAY 43-9006, carboplatin and paclitaxel demonstrates preliminary antitumor activity in the expansion cohort of patients with metastatic melanoma. Proc Am Soc Clin Oncol 2004; 23: 708.Gorden A, Osman I, Gai W, et al. Analysis of BRAF and N-RAS mutations in metastatic melanoma tissues. Cancer Res 2003; 63: 3955-7.Grossman, D., and Altieri, D.C., Drug resistance in melanoma: mechanisms, apoptosis, and new potential therapeutic targets, Cancer Metastasis Rev 20: 3-11 (2001).Hale JT, Bigelow JC, Mathews LA, McCormack JJ. Analytical and pharmacokinetic studies with 5-chloro-2'-deoxycytidine. Bioch Pharm 2002; 64: 1493-502.Heidenreich R, Machein M, Nicolaus A, et al. inhibition of solid tumor growth by gene transfer of VEGF receptor-1 mutants. Inu J Cancer 2004; 111: 348-57.Heimbach, H., Rossmanm, E., Kern, M.A., andSchadendorf, D., Drug resistance in human melanoma, Int J Cancer 93: 617-622 ^ OOl). Herlyn, M., Molecular and cellular biology of melanoma: Austin: R.G. Landes Co. (1993). Hersey, P., Adjuvant therapy for high-riskprimary and resected metastatic melanoma, Int Med J 33: 33-43 (2003).Hingorani SR, Jacobetz MA, Robertson GP, ​​HerlynMy Tuveson DA. Suppression of BRAF (V599E) in human melanomaabrogates transformation. Cancer Res 2003; 63: 5198-202.Hsu, M.-Y., Elder, D.E., and Herlyn, M., Melanoma: The Wistar (WM) Cell Lines. In Human Cell Culture. J.R.W.M.a.B. Palsson, editor. Great Britain: Kluwer Academic Publishers, 259-274 (1999).Inai T, Mancuso M, Hashizume H, et al. Inhibition of vascular endothelial growth factor (VEGF) signaling in cancer causes loss of endothelial fenestrations, regression of tumor vessels, and appearance of basement membrane ghosts. Am J Pathol 2004; 165: 35-52.Jain RK. Tumor angiogenesis and accessibility: role of vascular endothelial growth factor. Semin Oncol 2002; 29: 3-9.Jemal, A., Devesa, S.S., Hartge, P., and Tucker, M.A.y Recent trends in cutaneous melanoma incidence among whites in the United States., J Nat Cancer Inst 93: 678-3 (2001).Jemal, A., Thomas, A., Murray, T., and Thun, M., Cancer statistics., 2002. Ca: a Cancer Journal for Clinicians 52: 23-47 (2002).Johnstone, R.W., Ruelli, A.A., and Lowe, S.W., Apoptosis: a link between cancer genetics and chemotherapy, Cell 108: 153-164 (2002).Jones PF, Jakubowicz T, Hemmings BA. Molecular cloning of a second form of rac protein kinase. Cell Regul. 2 (12): 1001-9 (1991).Kimura Y, Aoki J, Kohno M, Ooka H, ​​Tsuruo T, Nakanishi 0. P-glycoprotein inhibition by the multidrug resistance-reversing agent MS-209 enhances bioavailability and antitumor efficacy of orally administered paclitaxel. Cancer Chemother Pharm 2002; 49: 322-8.Kranenburg 0, Gebbink MF, Voest EE. Stimulation of angiogenesis by Ras proteins. Biochim Biophys Acta 2004; 1654: 23-37.Krasilnikov, M., Adler, V., Fuchs, SY, Dong, Z., Haimovitz-Friedman, A., Herlyn, M., and Ronai, Z., Contribution of phosphatidylinositol 3-kinase to radiation resistance in human melanoma cells , Mol Carcinogenesis 24: 64-69 (1999).Kumar et al., BRAF Mutations in Metastatic Melanoma, Clinical Cancer Research, 9: 3362-3368, (2003).Laine, J., Kunstle, G., Obata, T., and Noguchi, M., Differential regulation of Akt kinase isoforms by the members of the TCL1 oncogene family, J Biol Chem 277: 3743-3751 (2002).Lang J, Boxer M, MacKie R. Absence of exon 15 BRAF germline mutations in familial melanoma. Hum Mutat 2003, -21: 327-30.Laud K, Kannengiesser C, Avril MF, et al. BRAF as a melanoma susceptibility candidate gene? Cancer Res 2003; 63: 3061-5.Lietzke SE, Bose S, Cronin T, Klarlund J, ChawlaA, Czech MP, Lambright DG. Structural basis of 3-phosphoinositide recognition by pleckstrin homology domains. Mol Cell. 6 (2): 385-94 (2000).Lowinger TB, Riedl B, Dumas J, Smith RA. Design and discovery of small molecules targeting raf-1 kinase. Curr Phann Des 2002; 8: 2269-78.Lu, Y., Li, Z., and Sun, M., Multiple gene alterations involved in the processor of human gastric carcinogenesis, Chung-Hua I Hsueh Tsa Chih [Chinese Medical Journal] 75: 679-682 (1995).Luo Y, Smith RA, Guan R, Liu X, Klinghofer V, Shen J, Hutchins C, Richardson P, Holzman T, Rosenberg SH, Giranda VL. Pseudosubstrate peptides inhibit Akt and induce cell growth inhibition. Biochemistry. 43 (5): 1254-63 (2004).Lyons JF, Wilhelm S, Hibner B, Bollag G.Discovery of a novel Raf kinase inhibitor. Endocr Relat Cancer 2001; 8: 219-25.Mercer KE, Pritchard CA. Raf proteins and Cancer: B-Raf is identified as a mutational target. Biochim Biophys Acta 2003; 1653: 25-40.Mertens, F., Johansson, B., Hbglund, M., and Mitelman, F., Chromosomal imbalance maps of malignant solid tumors: a cytogenetic survey of 3185 neoplasms, Cancer Res 57: 2765-2780 (1997).Meyer P, Klaes R, Schmitt C, Boettger MB, Garbe C. Exclusion of BRAFV599E as a melanoma susceptibility mutation. Int J Cancer 2003; 106: 78-80.Miller CJ, Cheung M, Shanna A, et al. Method ofMutation Analysis May Contribute to Discrepancies inReports of BRAF Mutation Frequencies in Melanocytic Neoplasms. J Invest Dermatol 2004; 123: 990-2.Mitsuuchi, Y., Johnson, S.W., Moonblatt, S., and Testa, J.R., Translocation and activation of AKT2 in response to stimulation by insulin, J Cellular Biochem 70: 433-441 (1998).Nicholson, KM, and Anderson, N.G., The protein kinase B / Akt signaling pathway in human malignancy, Cell Signal 14: 381-395 (2002).Niv MY, Rubin H. Cohen J, Tsirulnikov L, Licht T, Peretzman-Shemer A, Cna'an E, Tartakovsky A, Stein I, Albeck S, Weinstein I, Goldenberg-Furmanov M, Tobi D, Cohen E, Laster M , Ben-Sasson SA, Reuveni H. Sequence-based design of kinase inhibitors applicable for therapeutics and target identification. J Biol Chem. 279 (2): 1242-55. Epub 2003 (2004).Obata T, Yaffe MB, Leparc GG, Piro ET, Maegawa H, Kashiwagi A, Kikkawa R, Cantley LC. Peptide and protein library screening defines optimal substrate motifs for AKT / PKB. J Biol Chem. 275 (46): 36108-15 (2000).Parmiter, A.H., Balaban, G., Clark, W.H., Jr., and Nowell, P.C., Possible involvement of the chromosome region 10824 --- q26 in early stages of melanocyticneoplasm, cancer Genet Cytogenet 30: 313-317 (1988).Peng, XD, Xu, PZ, Chen, ML, Hahn-Windgassen, A., Skeen, J., Jacobs, J., Sundararajan, D., Chen, WS, Crawford, SE, Coleman, KG, et al., Dwarfism, impaired skin development, skeletal muscleatrophy, delayed bone development, and impeded adipogenesis in mice lacking Aktl and Akt2, Genes Dev. 17: 13521365 (2003).Pollock PM, Harper UL, Hansen KS, et al. High frequency of BRAF mutations in nevi. Nat Genet 2003; 33: 19-20.Powell, DJ, Hajduch, E., Kular, G., and Hundal, HS, Ceramide Disables 3-Phosphoinoside Binding to the Pleckstrin Homology Domain of Protein Kinase B (PKB) / Akt by a PKCzeta-Dependent Mechanism, Mol Cell Biol 23 : 7794-7808 (2003).Robertson, GP, Herbst, RA, Nagane, M., Huang, HJ, and Cavenee, WK, The chromosome 10 monosomy common in human melanomas results from loss of two separate tumor suppressor loci, Cancer Res 59: 3596-3601 (1999) .Robertson GP, ​​Furnari FB, Miele ME, et al. In vitro loss of heterozygosity targets the PTEN / MMAC1 gene in melanoma. Proc Natl Acad Sei USA 1998; 95: 9418-23.Sasaki Y, Niu C, Makino R, et al. BRAF Point Mutations in Primary Melanoma Show Different Prevalences by Subtype. J Invest Dermatol 2004; 123: 177-83.Satyamoorthy K, Li G, Gerrero MR, et al.Constitutive mitogen-activated protein kinase activation in melanoma is mediated by both BRAF mutations and autocrinegrowth factor stimulation. Cancer Res 2003; 63: 756-9. Scheid MP, Woodgett JR. PKB / AKT: functional insights from genetic models. Nat Rev Mol Cell Biol.2 (10): 760-8 (2001).Scheid MP, Woodgett JR. Unraveling the activation mechanisms of protein kinase B / Akt. FEBS Lett. 546 (1): 108-12 (2003).Schalick, W.0., Albino, AP, Reed, JA, Fountain, JW, Scott, GA, SuPont, G., Puri, N., Herlyn, M., Halern, AC, Gallager, RP, et al., Cutaneous Oncology. Malden, MA: Blackwell Science, Inc. 180-340 (1998).Serrone, L., and Herseym, P., The chemoresistance of human malignant melanoma: an update, Melanoma Res 9: 51-58 (1999).Serrone, L.z Zeuli, M., Sega, F.M., and Cognetti, F., Dacarbazine-based chemotherapy for metastatic melanoma: thirty-year experience overview, J Exp Clin Cancer Res 19: 21-34 (2000).Smalley KS. A pivotal role for ERK in the oncogenic behavior of malignant melanoma? Int J Cancer 2003; 104: 527-32.Soengas, M.S., and Lowe, S.W., Apoptosis and melanoma chemoresistance, Oncogene 22: 3138-3151 (2003).Staal, S.P., Molecular cloning of the akt oncogene and its human homologues AKT1 and AKT2: amplification of AKTI in a primary human gastricacenocarcinoma, Proc Nat Acad Sciences USA 84: 5034-5037 (1987). Stahl, J.M., Cheung, M., Sharma, A., Trivedi, N.R., Shanmugam, S., And Robertson, G.P., Loss of PTENPromotes Tumor Development in Malignant Melanoma, Cancer Res 63: 2891-2897 (2003).Sparreboom A, van Asperen J, Mayer U, et al.Limited oral bioavailability and active epithelial excretion of paclitaxel (Taxol) caused by P-glycoprotein in the intestine. Proceedings of the National Academy of Sciences of the United States of America 1997; 94: 2031-5.Stahl JM, Sharma A, Cheung M, et al. DeregulatedAkt3 activity promotes development of malignant melanoma. Cancer Res 2004; 64: 7002-10.Sumimoto H, Miyagishi M, Miyoshi H, et al. Inhibition of growth and invasive ability of melanoma by inactivation of mutated BRAF with lentivirus-mediated interfering RNA. Oncogene 2004.Sun, M., Wang, G., Paciga, JE, Feldman, RI, Yuan, ZQ, Ma, XL, Shelley, SA, Jove, R., Tsichlis, PN, Nicosia, SV, et al., AKTl / PKBalpha kinase is frequently elevated in human cancers and its constitutive activation is required for oncogenic transformation in NIH3T3 cells, Am J Path 159: 431-437 (2001).Testa SR, Bellacosa A. AKT plays a central role in tumorigenesis. Proc Natl Acad Sci USA. 98 (20): 10983-5 (2001).Tsao H, Goel V, Wu H, Yang G, Haluska FG. Genetic interaction between NRAS and BRAF mutations and PTEN / MMAC1 inactivation in melanoma. J Invest Dermatol 2004;] 22: 337-41.Tuveson DA, Weber BL. Herlyn M. BRAF as a potential therapeutic target in melanoma and other malignancies. Cancer Cell 2003; 4: 95-8.Thompson, F.H., Emerson, J., Olson, S., Weinstein, R., Leavitt, S.A., Leong, S.P., Emerson, S., Trent. J.M., Nelson, M.A., Salmon, S.E., et al., Cytogenetics of 158 patients with regional or disseminated melanoma. Subset analysis of near-diploid and simple karyotypes, Cancer Genet Cytogenet 83: 93-104 (1995).Uribe P, Wistuba, II, Gonzalez S. BRAF mutation: a frequent event in benign, atypical, and malignant melanocytic lesions of the skin. Am J Dermatopathol 2003; 25: 365-70.van Dekken, H., Geelen, E., Dinjens, WN, Wijnhoven, BP, Tilanus, HW, Tanke, HJ, and Rosenberg, C., Comparative genomic hybridization of cancer of the gastroesophageal junction: deletion of 14Q31-32.1 discriminates between esophageal (Barrett's) and gastric cardia adenocarcinomas, Cancer Res 59: 748-752 (1999).Waldmann, V., Wacher, J., and Deichmann, M., Absence of mutations in the pleckstrin homology (PH) domain of protein kinase B (PKB / Akt) in malignant melanoma, Melanoma Res 12: 45-50 (2002) .Waldmann, V., Wacker, J., and Diechmmann, M., Mutations of the activation-associated phosphorylation sites at codons 308 and 473 of protein kinase B are absentin human melanoma, Arch Dermatol Res 293: 368-312 (2001).Wojnówski L, Zimmer AM, Beck TW, et al.Endothelial apoptosis in Braf-deficient mice. Nat Genet 1997; 16: 293-7.Yazdi AS, Palmedo G, Flaig MJ, et al. Mutations5 of the BRAF gene in benign and malignant melanocytic lesions. J Invest Dermatol 2003; 121: 1160-2.SEQUENCE LISTING<110> Pennsylvania State Research Foundation<120>COMBINATORY METHODS AND COMPOSITIONS FOR THE TREATMENT OF MELANOMA<130> P0671OWO0<140> PCT / US 05 / 08950<141> 03 / 18 / 2005<150> US 60 / 554,509<151> 03 / 19 / 2004<160> 16<170> Patentln version 3.3<210> 1<211> 19<212> RNA<213> Homo Sapiens<400> 1cuaucuacaua uccggaaag<210><211><212><213>RNAHomoSapiens<400> twogaauuuacag cucagacua<210><211><212><213>RNAHomoSapiens<400> 3cagcucagac wauuacaau<210> 4<211> 25<212> RNA<213> HomoSapiens<400> 4cuuggacuau cuacauuccg gaaag<210> 5<211> 25<212> RNA<213> Homo Sapiens<400>-5cuuuccggaa uguagauagu ccaag 25<210> 6<211> 25<212> RNA<213> Homo Sapiens<400> 6gaugaagaau uuacagcuca gacua<210> 7<211> 25<212> RNA<213> Homo Sapiens<400> 7uagucugagc uguaaauucu ucauc 25<210> 8<211> 25<212> RNA<213> Homo Sapiens<400> 8aauuuacagc ucagacuauu acaau<210> 9<211> 25<212> RNA<213> Homo Sapiens<400> 9auuguaauag ucugagcugu aaauu 25<210> 10<211> 25<212> RNA<213> Homo Sapiens<400> 10ggucuagcua cagagaaauc ucgau<210> 11<211> 25<212> RNA<213> Homo Sapiens<400> 11ggacaaagaa uuggaucugg aucau<210> 12<211> 6<212> RNA<213> Homo Sapiens<400> 12cuugga 6<210> 13<211> 25<212> RNA<213> Homo Sapiens<400> 13aauuuacagc ucagacuauu acaau<210> 14<211> 25<212> RNA<213> Homo Sapiens<400> 14ggucaaugug cgaaauggaa ugagc 25<210> 15<211> 25<212> RNA<213> Homo Sapiens<400> 15gaggaacugg acuuccagaa gaaca<210> 16<211> 25<212> RNA<213> Homo Sapiens<400> 16gcacatagga gagatgagct tecta

Claims

CLAIMS 1. Method for inducing apoptosis in one melanoma tumor cell, CHARACTERIZED due to what includes: a reduction of activity of Akt3.

2. Method. according with claim 1, CHARACTERIZED because the reduction is produced placing a tumor cell of melanoma in contact with an agent that reduces the activity of Akt3.

3. Method. according with the claim 2, CHARACTERIZED because the agent is selected of a group consisting of an siRNA molecule, a molecule anti-sense, an antagonist, a ribozyme, an inhibitor one A peptide is a small molecule.

4. Method, according to with the claim 3, CHARACTERIZED by the fact that the an agent is a molecule of siRNA comprising a polynucleotide selected from the group which has the sequence of 5' GGUCUAGCUACAGAGAAAUCUCGAU 3' , 5' CUAUCUACAUUCCGGAAAG 3', 5' GAAUUUACAGCUCAGACUA 3', 5'CAGCUCAGACUAUUACAAU 3', 5' CUUGGACUAUCUACAUUCCGGAAAG 3' , 5'CUUUCCGGAAUGUAGAUAGUCCAAG 3' , 5' GAUGAAGAAUUUACAGCUCAGACUA 3', 5'UAGUCUGAGCUGUAAAUUCUUCAUC 3', 5' AAUUUACAGCUCAGACUAUUACAAU 3, 5' AUUGUAAUAGUCUGAGCUGUAAAUU 3', and its complements.

5. Method, according with the claim CHARACTERIZED due to the fact that contact from the tumor cell melanoma includes Use of: a liposome one nanoliposome a nanoliposome containing ceramide one proteoliposome, a material in nanoparticles, a material in calcium phosphorus-silicate nanoparticles, a calcium phosphate nanoparticle material, a silicon dioxide nanoparticle material, a nanocrystalline particle material, a semiconductor nanoparticle material, poly(D-arginine), a nanodendrimer, a virus, calcium phosphate nucleotide-mediated nucleotide delivery, electroporation, and microinjection.

6. Method according to claim 3, Characterized by the fact that the agent is a peptide that It acts as a pseudosubstrate for Akt3.

7. Method according to claim 6, Characterized by the fact that the peptide acts as a pseudosubstrate for a catalytic domain or a regulatory domain of Akt3.

8. Method according to claim 3, characterized in that the agent is a peptide that acts as a competitive inhibitor for Akt3.

9. Method according to claim 8, characterized in that the peptide acts as a competitive inhibitor for a catalytic domain of Akt3.

10. Method according to claim 8, Characterized by the fact that the peptide acts as a competitive inhibitor for a homology domain a Akt3 plecstrina.

11. Method according to claim 8, Characterized by the fact that the peptide acts as a competitive inhibitor for a regulatory domain of Akt3.

12. Method according to claim 1, CHARACTERIZED by the fact that it further comprises the administration of a chemotherapeutic agent selected from the group consisting of alkylating agents, antimetabolites, antibiotics, natural products or plant derivatives, hormones or steroids, and platinum drugs.

13. Method according to claim 12, CHARACTERIZED in that the chemotherapeutic agent is decarbazine.

14. Method according to claim 1, CHARACTERIZED in that it further comprises the administration of irradiation.

15. A method for treating a melanoma tumor in a mammal, characterized by the fact that it comprises: administering to a melanoma tumor an effective amount of an agent to reduce angiogenesis and cell proliferation.

16. Method according to claim 15, CHARACTERIZED in that the apoptosis-inducing agent is an agent that reduces Akt3 activity.

17. Method according to claim 15, CHARACTERIZED in that the agent that reduces angiogenesis and cell proliferation is an agent that reduces the activity of V599E B-RAF, thus treating a melanoma tumor.

18. Method according to claim 17, characterized in that the reducing agent Akt3 activity is selected from the group that consists of a siRNA molecule, an antisense molecule, an antagonist, a ribozyme, an inhibitor, a peptide, and a small molecule.

19. Method according to claim 18, CHARACTERIZED by the fact that the agent that reduces Akt3 activity is an siRNA molecule comprising a polynucleotide selected from the group having the sequence 5' GGUCUAGCUACAGAGAAAUCUCGAU 3', 5' CUAUCUACAUUCCGGAAAG 3', 5' GAAUUUACAGCUCAGACUA 3', 5' CAGCUCAGACUAUUACAAU 3', 5' CUUGGACUAUCUACAUUCCGGAAAG 3' , 5' CUUUCCGGAAUGUAGAUAGUCCAAG 3', 5' GAUGAAGAAUUUACAGCUCAGACUA 3', 5' UAGUCUGAGCUGUAAAUUCUUCAUC 3', 5' AAUUUACAGCUCAGACUAUUACAAU 3', 5' AUUGUAAUAGUCUGAGCUGUAAAUU3', and their complements.

20. Method according to claim 16, CHARACTERIZED in that the agent that reduces Akt3 activity is introduced into the melanoma tumor by use of: a liposome, a nanoliposome, a ceramide-containing nanoliposome, a proteoliposome, a nanoparticle material, a calcium phosphorus-silicate nanoparticle material, a calcium phosphate nanoparticle material, a silicon dioxide nanoparticle material, a nanocrystalline particle material, a semiconductor nanoparticle material, poly(D-arginine), a nanodendrimer, a virus, calcium phosphate nucleotide-mediated delivery, electroporation, and microinjection.

21. Method according to claim 18, CHARACTERIZED in that the agent is a peptide that acts as a pseudosubstrate for Akt3.

22. Method according to claim 21, CHARACTERIZED in that the peptide acts as a pseudosubstrate for a catalytic domain or a regulatory domain of Akt3.

23. Method according to claim 18, CHARACTERIZED in that the agent is a peptide that acts as a competitive inhibitor for Akt3.

24. Method according to claim 23, characterized in that the peptide acts as a competitive inhibitor for a catalytic domain of Akt3.

25. Method according to claim 23, CHARACTERIZED in that the peptide acts as a competitive inhibitor for a plecstrin homology domain of Akt3.

26. Method according to claim 23, characterized in that the peptide acts as a competitive inhibitor for a regulatory domain of Akt3.

27. Method according to claim 15, CHARACTERIZED in that it further comprises the administration of a chemotherapeutic agent selected from the group consisting of alkylating agents, antimetabolites, antibiotics, natural or plant-derived products, hormones or steroids, and platinum drugs.

28. Method according to claim 15, CHARACTERIZED in that it further comprises the administration of irradiation.

29. Method according to claim 17, CHARACTERIZED in that the agent that reduces the activity of V599E B-Raf is selected from the group consisting of an siRNA molecule, an antisense molecule, an antagonist, a ribozyme, an inhibitor, a peptide and a small molecule.

30. Method according to claim 17, CHARACTERIZED in that the agent that reduces the activity of V599E B-Raf is introduced into said melanoma tumor by use of: a liposome, a nanoliposome, a ceramide-containing nanoliposome, a proteoliposome, a nanoparticle material, a calcium phosphorus-silicate nanoparticle material, a calcium phosphate nanoparticle material, a silicon dioxide nanoparticle material, a nanocrystalline particle material, a semiconductor nanoparticle material, poly(D-arginine), a nanodendrimer, a virus, calcium phosphate nucleotide-mediated nucleotide delivery, electroporation, and microinjection.

31. Method according to claim 29, CHARACTERIZED in that the siRNA molecule that reduces the activity of V599E B-Raf comprises: a polynucleotide having a 5' GGUCUAGCUACAGAGAAAUCUCGAU 3' sequence.

32. Method according to claim 29, Characterized by the fact that the siRNA molecule reduces B-Raf activity comprises: a polynucleotide that has the 5' sequence GGACAAAGAAUUGGAUCUGGAUCAU 3'.

33. Method according to claim 29, CHARACTERIZED in that the agent that reduces the activity of V599E B-Raf is a B-Raf inhibitor.

34. Method according to claim 33, CHARACTERIZED in that the B-Raf inhibitor is BAY 43-9006.

35. Method according to claim 15, CHARACTERIZED in that the treatment comprises: the administration, concomitantly or sequentially, of an effective amount of an agent that reduces Akt3 activity and an agent that reduces V599E B-Raf activity.

36. Pharmaceutical composition for the treatment of a melanoma tumor, CHARACTERIZED in that it comprises: an agent that reduces the activity of Akt3; and a vehicle.

37. Pharmaceutical composition, according to claim 36, CHARACTERIZED in that the vehicle is selected from the group consisting of: a liposome, a nanoliposome, a ceramide-containing nanoliposome, a proteoliposome, a nanoparticle material, a calcium phosphorus-silicate nanoparticle material, a silicon dioxide nanoparticle material, a nanocrystalline particle material, a semiconductor nanoparticle material, poly(D-arginine), a nanodendrimer, a virus, nucleotide-mediated delivery of calcium phosphate.

38. Pharmaceutical composition, according to claim 36, CHARACTERIZED in that the agent is selected from the group consisting of: an siRNA molecule, an antisense molecule, an antagonist, a ribozyme, an inhibitor, a peptide and a small molecule.

39. Pharmaceutical composition, according to claim 38, CHARACTERIZED in that the small interfering RNA (siRNA) molecule comprises: a 5' GGUCUAGCUACAGAGAAAUCUCGAU polynucleotide or its complement.

40. Pharmaceutical composition, according to claim 38, CHARACTERIZED in that the small interfering RNA (siRNA) molecule comprises: a 5' CUAUCUACAUUCCGGAAAG 3' polynucleotide, or its complement.

41. Pharmaceutical composition, according to claim 38, CHARACTERIZED in that the small interfering RNA (siRNA) molecule comprises: a 5' GAAUUUACAGCUCAGACUA 3' polynucleotide, or its complement.

42. Pharmaceutical composition, according to claim 38, CHARACTERIZED in that the small interfering RNA (siRNA) molecule comprises: the 5' CAGCUCAGACUAUUACAAU 3' polynucleotide, or its complement.

43. Pharmaceutical composition, according to claim 38, CHARACTERIZED in that the small interfering RNA (siRNA) molecule comprises: a 5' CUUGGACUAUCUACAUUCCGGAAAG 3' polynucleotide, or its supplement.

44. Pharmaceutical composition, according to claim 38, CHARACTERIZED in that the small interfering RNA (siRNA) molecule comprises: a 5' CUUUCCGGAAUGUAGAUAGUCCAAG 3' polynucleotide, or its complement.

45. Pharmaceutical composition, according to claim 38, CHARACTERIZED in that the small interfering RNA (siRNA) molecule comprises: a 5' GAUGAAGAAUUUACAGCUCAGACUA 3' polynucleotide, or its complement.

46. ​​Pharmaceutical composition, according to claim 38, CHARACTERIZED in that the small interfering RNA (siRNA) molecule comprises: a polynu- 47. Pharmaceutical composition according to claim 38, characterized in that the small interfering RNA (siRNA) molecule comprises: a 5' polynucleotide AAUUUACAGCUCAGACUAUUACAAU or its complement.

48. Pharmaceutical composition according to claim 38, characterized in that the small interfering RNA (siRNA) molecule comprises: a 5' polynucleotide AAUUGUAAUAGUCUGAGCUGUAAAUU or its complement.

49. Pharmaceutical composition according to claim 38, characterized in that the molecule small interfering RNA (siRNA) molecule comprises: a polynu- cleotideo 5' AUUGUAAUAGUCUGAGCUGUAAAUU 3' , or its complement.

53. Pharmaceutical composition, according to claim 38, CHARACTERIZED in that the agent is a peptide that acts as a substrate for Akt3.

54. Pharmaceutical composition, according to claim 53, CHARACTERIZED in that the peptide acts as a pseudosubstrate for a catalytic domain or a regulatory domain of Akt3.

55. Pharmaceutical composition, according to claim 38, CHARACTERIZED in that the agent is a peptide that acts as a competitive inhibitor for Akt3.

56. Pharmaceutical composition according to claim 55, CHARACTERIZED in that the peptide acts as a competitive inhibitor for a catalytic domain of Akt3.

57. Pharmaceutical composition, according to claim 55, CHARACTERIZED in that the peptide acts as a competitive inhibitor for a plecstrin homology domain of Akt3.

58. Pharmaceutical composition, according to claim 55, CHARACTERIZED in that the peptide acts as a competitive inhibitor for a regulatory domain of Akt3.

59. Pharmaceutical composition, according to claim 36, CHARACTERIZED in that it comprises yet another agent that reduces B-Raf activity.

60. Pharmaceutical composition, according to claim 60, CHARACTERIZED in that the agent is selected from the group consisting of: an siRNA molecule, an antisense molecule, an antagonist, a ribozyme, an inhibitor, a peptide and a small molecule.

61. Pharmaceutical composition, according to claim 60, CHARACTERIZED in that the small interfering RNA (siRNA) molecule comprises: a 5' GGUCUAGCUACAGAGAAAUCUCGAU 3' polynucleotide, or its complement.

62. Pharmaceutical composition, according to claim 60, CHARACTERIZED in that the small interfering RNA (siRNA) molecule comprises: a 5' GGACAAAGAAUUGGAUCUGGAUCAU 3' polynucleotide, or its complement.