Expression of fatty acid desaturases in corn

Abstract

EXPRESSION OF FATTY ACID DESATURASES IN CORN. The invention generally relates to the expression of desaturase enzymes in transgenic corn plants and compositions derived therefrom. In particular, the invention relates to the production of oils with improved omega-3 fatty acid profiles in corn plants and the seed oils produced in this way. Such oils may contain stearidonic acid that is not naturally found in corn plants and have been shown to have beneficial health effects.

Description

Descriptive Report of the Invention Patent for "EXPRESSION" "OF FATTY ACID DESATARASES IN CORN". Background of the Invention This application claims priority over U.S. Provisional Patent Application Serial Number 60 / 563,135, filed April 16, 2004, the entire description of which is specifically incorporated herein by reference. 1. Field of the Invention The invention generally relates to the expression of desaturase enzymes that modulate the number and location of double bonds in long-chain polyunsaturated fatty acids (LC-PUFs) in maize and compositions derived therefrom. 2. Description of the Related Technique The primary products of fatty acid biosynthesis in most organisms are composed of carbons 16 and 18. The relative ratio of chain lengths and degree of unsaturation of these fatty acids varies widely among species. Mammals, for example, produce primarily saturated and monounsaturated fatty acids, while most larger plants produce fatty acids with one, two, or three double bonds, the latter two comprising polyunsaturated fatty acids (PUFAs). Two major families of PUFAs are omega-3 fatty acids (also represented as "n-3" fatty acids), exemplified by eicosapentaenoic acid (EPA, 20:4, n-3), and omega-6 fatty acids (also represented as "n-6" acids), exemplified by arachidonic acid (ARA, 20:4, n-6). PUFAs are important components of the cell plasma membrane and adipose tissue, where they can be found in forms such as phospholipids and triglycerides, respectively. PUFAs are necessary for proper development in mammals, particularly in infant brain development, and for tissue formation and repair. Several disorders respond to treatment with fatty acids. Supplementation with PUFAs has been shown to reduce the rate of restenosis after Angioplasty. The health benefits of certain dietary omega-3 fatty acids for cardiovascular disease and rheumatoid arthritis have also been well documented (Simopoulos, 1997; James et al., 2000). Furthermore, PUFAs have been suggested for use in treatments for asthma and psoriasis. Evidence indicates that PUFAs may be involved in calcium metabolism, suggesting that PUFAs may be useful in the treatment or prevention of osteoporosis and kidney or urinary tract stones. Most of the evidence for health benefits applies to long-chain omega-3 fats, docosahexaenoic acid and EPA (DHA, 22:6), which are found in fish and fish oil.Based on this evidence, health authorities and nutritionists in Canada (Scientific Review Committee, 1990, Nutrition Recommendations, Minister of National Health and Welfare, Canada, Ottawa), Europe (de Deckerer et al., 1998), the United Kingdom (The British Nutrition Foundation, 1992, Unsaturated fatty acids - nutritional and physiological significance: The report of the British Nutrition Foundation's Task Force, Chapman and Hall, London), and the United States (Simopoulos et al., 1999) have recommended increased dietary intake of these PUFAs. PUFAs can also be used to treat diabetes (U.S. Patent No. 4,826,877; Horrobin et al., 1993). Altered fatty acid metabolism and composition have been demonstrated in diabetic animals. These alterations have been suggested to be involved in some of the long-term complications resulting from diabetes, including retinopathy, neuropathy, nephropathy, and damage to the reproductive system. Evening primrose oil, which contains gamma-linolenic acid (GLA, 18:3, A6, 9, 12), has been shown to prevent and reverse diabetic nerve damage. PUFAs, such as linoleic acid (LA, 18:2, A9, 12) and alpha-linolenic acid (ALA, 18:3, A9, 12, 15), are considered essential fatty acids in the diet because mammals lack the ability to synthesize these acids. However, when ingested, mammals can metabolize LA and ALA to form the n-6 and n-3 families of long-chain polyunsaturated fatty acids (LC-PUFAs). These LC-PUFAs are important cellular components that provide fluidity to membranes and function... Arachidonic acid (ADA) acts as a precursor to biologically active eicosanoids such as prostaglandins, prostacyclins, and leukotrienes, which regulate normal physiological functions. Arachidonic acid is the main precursor for the synthesis of eicosanoids, which include leukotrienes, prostaglandins, and thromboxanes, and which also play a role in the inflammatory process. Administration of an omega-3 fatty acid, such as DAS, has been shown to inhibit leukotriene biosynthesis (U.S. Patent No. 5,158,975). Consumption of SDA has been shown to induce a decrease in blood levels of the pro-inflammatory cytokines TNF-α and IL-13 (U.S. Publication No. 20040039058). In mammals, LC-PUFA formation is rate-limited by the A6 desaturation step, which converts LA to gamma-linolenic acid (GLA, 18:3, A6, 9, 12) and ALA to SDA (18:4, A6, 9, 12, 15). Many physiological and pathological conditions have been shown to depress this metabolic step, and consequently, LC-PUFA production. To overcome the rate-limiting step and increase tissue EPA levels, one might consume large amounts of ALA. However, consuming even moderate amounts of SDA provides an effective source of EPA, as SDA is about four times more efficient than ALA in raising tissue EPA levels in humans (U.S. Publication No. 20040039058). In the same studies, SDA administration was also able to increase tissue levels of docosapentaenoic acid (DPA), which is a product of EPA elongation.Alternatively, bypassing A6 desaturation through dietary supplementation with EPA or DHA can effectively alleviate many pathological conditions associated with low PUFA levels. However, as mentioned in greater detail below, currently available sources of PUFAs are undesirable for several reasons. The need for a safe and economical source of PUFAs has stimulated interest in alternative sources of PUFAs. The main important long-chain PUFAs include DHA and EPA, which are primarily found in different types of fish oil, and ARA, found in filamentous fungi such as Mortierella. Regarding DHA, there are several sources for commercial production, including a variety of marine organisms, oils obtained from cold-water marine fish, and egg yolk fractions. Commercial sources of SDA include the plant genera Trichodesma, Borago (borage), and Echium. However, there are several disadvantages associated with the commercial production of PUFAs from natural sources. Natural sources of PUFAs, such as animals and plants, tend to have highly heterogeneous oil compositions. Oils obtained from these sources may therefore require extensive purification to separate one or more desired PUFAs or to produce an oil that is enriched in one or more PUFAs. Natural sources of PUFAs are also subject to uncontrollable fluctuations in availability. Fish stocks can vary naturally or be depleted by overfishing. Furthermore, even with overwhelming evidence of their therapeutic benefits, dietary recommendations regarding omega-3 fatty acids are not considered. Fish oils have unpleasant tastes and odors, which may be economically impossible to separate from the desired product, and may make such products unacceptable as food supplements. Animal oils, and particularly fish oils, can accumulate environmental pollutants. Foods can be enriched with fish oils, but again, such enrichment is problematic because of the cost and decline in global fish stocks. This problem is also an impediment to the consumption and ingestion of whole fish.Nevertheless, if health messages to increase fish intake are followed by communities, there would likely be a problem in meeting the demand for fish. Furthermore, there are issues with the sustainability of this industry, which relies heavily on wild fish stocks for aquaculture feed (Naylor et al., 2000). Other natural limitations favor a new method for the production of omega-3 fatty acids. Weather conditions and diseases can cause fluctuations in the production of both fish and plant sources. Cropland available for the production of omega-3 fatty acid-producing crops. Alternating oil production is subject to competition from the constantly expanding human populations and the associated increased need for food production on the remaining arable land. Crops that produce PUFAs, such as borage, have not been adapted to commercial growth and may not perform well in monoculture. Growing such crops is therefore not economically competitive where more profitable and better-established crops can be developed. Large-scale fermentation of organisms such as Mortierella is also expensive. Natural animal tissues contain low amounts of ARA and are difficult to process. Microorganisms such as Porphyridium and Mortierella are difficult to cultivate on a commercial scale. Several enzymes are involved in the biosynthesis of PUFAs. LA (18:2, A9, 12) is produced from oleic acid (OA, 18:1, A9) by an A12 desaturase, while ALA (18:3, A9, 12, 15) is produced from LA by an A15 desaturase. SDA (18:4, A6, 9, 12, 15) and GLA (18:3, A6, 9, 12) are produced from LA and ALA by an A6 desaturase. However, as established above, mammals cannot desaturate beyond the A9 position and therefore cannot convert oleic acid to LA. Similarly, ALA cannot be synthesized by mammals. Other eukaryotes, including fungi and plants, have enzymes that desaturate at the carbon 12 and carbon 15 positions. Polyunsaturated fatty acids from animals, therefore, are derived from the diet through subsequent desaturation and elongation of dietary LA and ALA. Several genes encoding desaturases have been described. For example, U.S. Patent No. 5,952,544 describes nucleic acid fragments isolated and cloned from Brassica napus that encode fatty acid desaturase enzymes. Expression of the '544 patent nucleic acid fragments resulted in ALA accumulation. However, in transgenic plants expressing B. napus A15 desaturase, substantial LA remains unconverted by the desaturase. Certain fungal A15 desaturases have been shown to be capable of converting LA to ALA when expressed in plants. In particular, fungal A15 desaturases from Neuros- Pora crassa and Aspergillus (Emericella nidulans) have been effective (International Publication No. WO 03 / 099216, incorporated herein by reference). Increased ALA levels allow an A6 desaturase, when co-expressed with a nucleic acid encoding A15 desaturase, to act on ALA, thereby producing higher levels of SDA. Because of the multitude of beneficial uses of SDA, there is a need to create a substantial increase in SDA production. Nucleic acids from various sources have been sought for use in increasing SDA production. Genes encoding A6 desaturases have been isolated from the fungus Mortierella alpina (U.S. Patent No. 6,075,183) and the primrose plant (International Publication No. WO 05 / 021761, incorporated herein by reference). These have been shown to be capable of converting ALA to SDA in yeast and plants. Therefore, it would be advantageous to obtain genetic material involved in PUFA biosynthesis and express the isolated material in a plant system, in particular, a land-based terrestrial crop plant system, which can be manipulated to provide the production of commercial quantities of one or more PUFAs. There is also a need to increase omega-3 fat intake in humans and animals. Thus, there is a need to provide a wide range of foods and dietary supplements enriched with omega-3, so that individuals can choose foods, food ingredients, and food components that suit their usual dietary habits. Particularly advantageous would be seed oils and flour with increased SDA. Currently, only one omega-3 fatty acid, ALA, is available in vegetable oils. However, there is poor conversion of ingested ALA into long-chain omega-3 fatty acids such as EPA and DHA. It was demonstrated in the US co-pending publication 20040039058 for "Treatment and Prevention of Inflammatory Disorders" that increasing the average population intake of ALA from 1 g / day to 14 g / day through the use of flaxseed oil only reduced levels of the phospholipid EPA. Moderately increased plasma levels. A 14-fold increase in ALA intake resulted in a 2-fold increase in plasma phospholipid EPA (Manzioris et al., 1994). Thus, for that purpose, there is a need for efficient and commercially viable production of PU-FAs employing fatty acid desaturases, genes encoding them, and recombinant methods of producing them. There is also a need for oils containing higher relative proportions of specific PUFAs, and for food and feed compositions and supplements containing them. There is also a need for safe and economical methods of producing specific PU-FAs. Despite inefficiencies and low yields as described above, the production of omega-3 fatty acids through the terrestrial food chain is a beneficial initiative for public health and, in particular, the production of SDA. SDA is important because, as described above, there is low conversion of ALA to EPA. This is because the initial enzyme in the conversion, A6-desaturase, has low activity in humans and is rate-limiting. Evidence that A6-desaturase is rate-limiting is provided by studies demonstrating that the conversion of its substrate, ALA, is less efficient than the conversion of its product, SDA, to EPA in mice and rats (Yamazaki et al., 1992; Huang, 1991). Certain seed oils, such as corn, do not contain SDA or other important omega-3 fatty acids at all, and thus there is a great need in plant technology for seed oils with improved PUFA profiles. Such oils can be used to produce foods and food supplements enriched with omega-3 fatty acids, and consumption of such foods effectively increases tissue EPA levels. Foods and food ingredients, such as milk, margarine, and sausages, all made or prepared with omega-3 enriched oils, will result in health benefits. Animal feed stocks containing the extracted oil or meal or whole grain fat enriched with omega-3 fatty acids can also be used to effectively increase tissue EPA levels and provide There are health benefits for livestock farming as well as increased productivity. Therefore, there is a strong need for new plant-based desaturases to produce PUFA-enriched oils. Summary of the Invention In one aspect, the invention provides an endogenous corn seed oil containing stearidonic acid. In certain embodiments of the invention, the corn seed oil comprises from about 0.1% to about 33% stearidonic acid, and in other embodiments it may comprise from about 5% to about 15%; from about 5% to about 10%; from about 7.5% to about 12%; from about 10% to about 15%; about 12% to about 15%, about 10% to about 33%, about 15% to about 33%, about 15% to about 32%, about 20% to about 33%, about 20% to about 30%, about 25% to about 30%, and about 25% to about 33% of stearidonic acid, including all intermediate values, as well as those shown in the Tables below. An endogenous corn seed oil provided by the invention may also comprise gamma-linolenic acid. In certain embodiments of the invention, the gamma-linolenic acid content of the oil may be from about 0.01% to about 7.5% and from about 0.01% to about 7.5%.0.1% to about 5%, including less than about 5% and less than about 3%, and specifically including all intermediate values ​​and those shown in the Tables below. In certain embodiments of the invention, the α-linolenic acid content may be less than about 5, 10, 15, or 20%. In other embodiments of the invention, a corn seed oil of the invention may comprise a ratio of stearidonic acid to gamma-linolenic acid of about 1:1 to about 10:1, about 2:1 to about 10:1, about 3:1 to about 5:1, or at least about 3:1. A corn seed oil provided by the invention may also comprise a ratio of omega-3 to omega-6 fatty acids of about 0.5%:1 to about 10:1, about 5:1 to about 10:1, and at least about 5:1. Another aspect of the invention provides a method for producing oil. of corn seed containing a modified PUFA profile comprising the steps of (a) obtaining seeds from a plant according to the invention; and (b) extracting the oil from said seeds. Preferred methods of transforming such plant cells into certain embodiments of the invention include the use of Agrobacterium Ti and Ri plasmids, electroporation, and high-velocity ballistic bombardment. In yet another aspect, the invention provides a method of producing a corn plant comprising seed oil containing altered levels of omega-3 fatty acids comprising introducing a recombinant vector of the invention into an oil-producing plant. In the method, introducing the recombinant vector may comprise genetic transformation. In one embodiment, the transformation comprises the steps of: (a) transforming a plant cell with a recombinant vector of the invention; and (b) regenerating the plant from the plant cell, wherein the plant has altered levels of omega-3 fatty acids relative to a corresponding plant of the same genotype that has not been transformed with the vector. The plant may also be defined as transformed with a nucleic acid sequence encoding a polypeptide that has desaturating activity that desaturates a fatty acid molecule at carbon 12 and / or 15. The plant may comprise enhanced SDA and GLA.The method may also involve introducing the recombinant vector into a plurality of maize plants and evaluating which plants or their progeny have inherited the recombinant vector for a plant having a desired omega-3 fatty acid profile. However, in yet another aspect, the invention provides a method of increasing the nutritional value of an edible product for human or animal consumption, comprising adding a corn seed oil provided by the invention to the edible product. In certain embodiments, the product is human and / or animal food. The edible product may also be animal feed and / or a dietary supplement. In the method, the oil can increase the SDA content of the edible product and / or increase the ratio of omega-3 to omega-6 fatty acids in the edible product. The edible product may not contain SDA before the oil is added. In yet another aspect, the invention provides a method of manufacturing food or feed, comprising adding a corn seed oil provided by the invention to the starting food or feed ingredients, to produce the food or feed. In certain embodiments, the method is also defined as a method of manufacturing food and / or feed. The invention also provides food or feed manufactured by the method. However, in another aspect, the invention comprises a method of providing SDA to a human or animal, comprising administering a seed oil of the invention to said human or animal. In the method, the seed oil can be administered in an edible composition, including food or feed. Examples of foods include beverages, infused foods, sauces, condiments, salad dressings, fruit juices, syrups, desserts, glazes and fillings, soft frozen products, confections or intermediate foods. The edible composition may be substantially a liquid or solid. The edible composition may also be a food supplement and / or nutraceutical. In the method, the seed oil can be administered to a human and / or animal. Examples of animals the oil can be administered to include livestock or poultry. In yet another aspect, a corn seed oil of the invention can be obtained from a plant transformed with isolated nucleic acids encoding a polypeptide capable of desaturating a fatty acid molecule at carbon 6 (A6-desaturase). In one embodiment, an isolated polynucleotide sequence, isolated from a Primula species having unique desaturase activity, can be employed. In certain embodiments, the isolated polynucleotides are isolated, for example, from Primula juliae. In certain other embodiments of the invention, the polynucleotides encode a polypeptide having at least 90% homology with the polypeptide sequence of SEQ ID NO: 3 and / or SEQ ID NO: 4, including at least about 92%, 95%, 98% and 99% homology with these sequences. Such sequences- These substances may have substrate specificity for α-linolenic acid with respect to linoleic acid. In certain embodiments, there is at least a 2:1 substrate specificity for α-linolenic acid with respect to linoleic acid, including from about 2:1 to about 2.9:1. In another aspect, a maize plant is transformed with an isolated polynucleotide encoding a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 6, comprising a sequence selected from the group consisting of: (a) a polynucleotide encoding the polypeptide of SEQ ID NO: 3 or SEQ ID NO: 4; (b) a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2; and (c) a polynucleotide hybridizing to SEQ ID NO: 1 or SEQ ID NO: 2, or a complement thereof, under conditions of 5X SSC, 50% formamide and 42°C. In yet another aspect, the invention provides an isolated polynucleotide selected from the group consisting of: (a) a polynucleotide comprising the nucleic acid sequence of SEQ ID NO:8; (b) a polynucleotide hybridizing to SEQ ID NO:8 under conditions of 5X SSC, 50% formamide and 42°C, wherein the polynucleotide encodes a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 6; and (c) a polynucleotide having at least 90% sequence identity to the nucleic acid sequence of SEQ ID NO:8, wherein the polynucleotide encodes a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 6; and (d) a sequence complement of (a), (b), or (c). In one embodiment, such a polynucleotide may comprise the nucleic acid sequence of SEQ ID NO:9.The invention also provides recombinant constructs and transgenic plants comprising such polynucleotides, as well as the seed oil produced by the plants. In yet another aspect, a plant is transformed with a recombinant vector comprising an isolated polynucleotide according to the invention. The term "recombinant vector" as used herein includes any recombinant DNA segment that one wishes to introduce into A recombinant vector is a host cell, tissue, and / or organism, and especially includes isolated expression cassettes from a starting polynucleotide. A recombinant vector can be linear or circular. In several respects, a recombinant vector may comprise at least one additional sequence chosen from the group consisting of: operatively coupled regulatory sequences; operatively coupled selection markers; operatively coupled marker sequences; an operatively coupled purification portion; and an operatively coupled targeting sequence. In yet another aspect, the invention provides maize cells transformed with polynucleotides described herein. In another embodiment, the cells are transformed with recombinant vectors containing constitutive and tissue-specific promoters in addition to the polynucleotides. In certain embodiments of the invention, such cells may also be defined as transformed with a nucleic acid sequence encoding a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 12 and / or 15. Brief Description of the Figures The following drawings form part of this specification and are included to also demonstrate certain aspects of the present invention. The invention can be better understood by reference to one or more of these drawings in combination with the detailed description of the specific embodiments presented herein. The invention can be more fully understood from the following description of the figures: FIGURE 1 shows a pMON82812 vector map. FIGURE 2 shows a pMON78175 vector map. FIGURE 3 shows a pMON78171 vector map. Detailed Description of the Invention The invention overcomes the limitations of the prior art by providing methods and compositions for creating plants with improved PUFA content and the seed oils produced in this way. In one embodiment Regarding the invention, the Applicants have provided transgenic corn plants (Zea mays) that produce an endogenous corn seed oil containing stearidonic acid (SDA) and may also comprise gamma-linolenic acid (GLA). This is significant because corn seed oil normally lacks these components, each of which has been shown to have important health benefits. The corn seed oil is endogenous in that it can be produced by a corn seed without the need for external addition of, for example, SDA. Such an endogenous oil can be an extracted oil composition that can be used as a food or food ingredient and thus benefit human or animal health. Modifying the fatty acid content of an organism such as a plant thus provides many benefits such as improved nutrition and health benefits.Fatty acid content modification can be employed according to the invention to obtain desired beneficial levels or profiles of PUFAs in plants such as corn, plant parts, and plant products, including plant seed oils. For example, when the desired PUFAs are produced in the seed tissue of a plant, the oil can be isolated from the seeds, typically resulting in an oil with a desired high PUFA content or an oil having a desired fatty acid content or profile, which can, in turn, be employed to provide beneficial characteristics in foodstuffs and other products. The invention in particular provides endogenous corn seed oil having SDA. Several aspects of the invention include methods and compositions for modifying the PUFA content of a cell, for example, modifying the PUFA content of a maize plant cell. Compositions related to the invention include novel isolated polynucleotide sequences and polynucleotide constructs introduced into plants and / or plant parts. An example of such an isolated polynucleotide is a Primula fatty acid desaturase such as Primula A6-desaturase. Maize cells prepared according to the invention may comprise other fatty acid desaturases, including known A6 desaturases such as... that of Mortierella alpina. The inventors have shown in particular that the expression of different A6 and A15 fatty acid desaturases produces corn seed oil containing SDA. Certain embodiments of the invention, therefore, provide plants and transformed corn cells with coding sequences of A6 and A15 fatty acid desaturases. In one embodiment of the invention, the A15-desaturase may be from a fungal source, including Neurospora crassa and Aspergillus nidulans. Several embodiments of the invention may employ combinations of desaturase polynucleotides and the encoded polypeptides that typically depend on the host cell, the availability of substrate(s), and the desired end product(s). "Desaturase" refers to a polypeptide that can desaturate or catalyze the formation of a double bond between consecutive carbons of one or more fatty acids to produce a mono- or polyunsaturated fatty acid or precursor thereof.Of particular interest are polypeptides that can catalyze the conversion of oleic acid to LA, LA to ALA, or ALA to SDA, which includes enzymes that desaturate at positions 12, 15, or 6. The term "polypeptide" refers to any amino acid chain, regardless of length or post-translational modification (e.g., glycosylation or phosphorylation). Considerations for choosing a specific polypeptide having desaturase activity include, but are not limited to, the ideal pH of the polypeptide, whether the polypeptide is a rate-limiting enzyme or a component thereof, whether the desaturase employed is essential for the synthesis of a desired PU-FA, and / or whether a cofactor is required by the polypeptide. The expressed polypeptide preferably has characteristics that are compatible with the biochemical environment of its location in the host cell. For example, the polypeptide may have to compete with the substrate(s). Km analysis and specific activity of a given polypeptide can be considered in determining the suitability of a particular polypeptide for modifying the production, level, or profile of PUFA(s) in a given host cell. The polypeptide employed in a particular situation is the one that typically functions under the present conditions in the intended host cell, but in a different way. It can be any desaturase polypeptide having a desired characteristic or being capable of modifying the relative production, level, or profile of a desired PUFA(s) or any other characteristics as described herein. The substrate(s) for the expressed enzyme may be produced by the host cell or may be exogenously supplied. To achieve expression, the polypeptide(s) of the present invention is / are encoded by the polynucleotides as described below. In another aspect of the invention, vectors containing a nucleic acid, or fragment thereof, can be employed containing a promoter, a desaturase coding sequence, and a termination region for transfer into an organism wherein the promoter and termination regions are functional. Consequently, maize plants producing recombinant A6-desaturase are provided by this invention. An example of such an A6-desaturase coding sequence provided by the invention that has been optimized for expression in maize is provided by SEQ ID NO: 8 and SEQ ID NO: 9. The invention therefore specifically provides nucleic acids comprising this sequence, as well as sequences having at least 90% sequence identity with these sequences, including at least 93%, 95%, 98%, and 99% identity.Polypeptide or polynucleotide comparisons can be performed and identity determined using sequence analysis software, for example, the GCG Wisconsin Package Sequence Analysis software (Accelrys, San Diego, CA), MEGAIgnition (DNAStar, Inc., 1228 S. Park St., Madison, Wis. 53715), and MacVector (Oxford Molecular Group, 2105 S. Bascom Avenue, Suite 200, Campbell, Calif. 95008). Such software compares similar sequences by degrees of similarity or identity designation. Nucleic acid constructs can be provided that integrate into the genome of a host cell or are autonomously replicated (e.g., episomally replicated) in the host cell. For the production of ALA and / or SDA, expression cassettes (i.e., a polynucleotide encoding a protein that is operatively linked to the se- The nucleic acid sequence(s) that control(s) the expression of the polynucleotide) commonly employed include an expression cassette that provides the expression of a polynucleotide encoding an A6- and / or A15-desaturase. In certain embodiments, a host cell may have wild-type oleic acid content. Methods and compositions for constructing expression vectors, when considered in light of the teachings provided herein, for the expression of desaturase enzymes will be evident to one skilled in the art. Expression vectors, as described herein, are DNA or RNA molecules constructed for the controlled expression of a desired polynucleotide, for example, the polynucleotide encoding desaturase. Examples of vectors include plasmids, bacteriophages, cosmids, or viruses. Bridge vectors, for example (Wolk et al., 1984; Bustos et al., 1991), are also contemplated according to the present invention. Reviews of vectors and methods of preparing and using them can be found in Sambrook et al. (2001); Goeddel (1990); and Perbal (1988). Sequence elements capable of carrying out the expression of a polynucleotide include promoters, enhancer elements, upstream activator sequences, transcription termination signals, and polyadenylation sites. Polynucleotides encoding desaturases can be placed under the transcriptional control of a strong promoter. In some cases, this leads to an increase in the amount of desaturase enzyme expressed and concomitantly an increase in the fatty acid produced as a result of the enzyme-catalyzed reaction. Examples of such promoters include the 35S CaMV (cauliflower mosaic virus), 34S FMV (scrophularia mosaic virus) (see, for example, U.S. Patent No. 5,378,619, the contents of which are incorporated herein in their entirety), and Lee (maize). There is a wide variety of plant promoter sequences that can be employed to target the tissue-specific expression of polynucleotides encoding desaturases in transgenic plants. Indeed, in particular embodiments of the invention, the promoter employed is a seed-specific promoter. Examples of promoters that can be employed In this respect, they include the 5' regulatory regions of genes such as napin, which are regulated during plant seed maturation (Kridl et al., Seed Sci. Res. 1:209:219, 1991), phaseolin (Bustos et al., Plant Cell, 1(9):839-853, 1989), soybean trypsin inhibitor (Riggs et al., Plant Cell 1(6):609-621, 1989), ACP (Baerson et al., Plant Mol. Biol., 22(2):255-267, 1993), stearoyl-ACP desaturase (Slocombe et al., Plant Physiol. 104(4):167-176, 1994), and the alpha subunit of E-conglycinin (P-Gm7S, see for example, Chen et al., Proc. Natl. Acad. sci. alpha of / 3-conglycinin (7S alpha) soybean (United States Patent Application No. 10 / 235.618, incorporated by reference), barley seed peroxidin PER1 promoter (see, for example, Stacey et al., Plant Mol. Biol., 31:1205-1216, 1996), and Zea mays oleosin L3 promoter (P-Zm.L3, see, for example, Hong et al., Plant Mol. Biol., 34(3):549-555, 1997; see also U.S. Patent No. 6,433,252, the description of which is specifically incorporated by reference). Examples of promoters highly expressed in the endosperm include the promoters of genes encoding zeins, which are a group of storage proteins found in maize endosperm. Genomic clones for zein genes have been isolated (Pedersen et al., Cell 29:1015-1026 (1982), and Russell et al., Transgenic Res. 6(2):157-168) and the promoters of these clones, including the 15 kD, 16 kD, 19 kD, 22 kD, and 27 kD genes, can likewise be employed to provide endosperm expression according to the invention (see, for example, U.S. Patent No. 6,326,527, specifically incorporated herein by reference in its entirety).Other suitable promoters known to function in maize, and in other plants, include the promoters for the following genes: waxy (granule-linked starch synthase), Brittle and Shrunken 2 (ADP glucose pyrophosphorylase), Shrunken 1 (sucrose synthase), branching enzymes I and II, debranching enzymes, oleosins, glutelins, sucrose-. synthases (Yang et al., 1990), BetH (basal endosperm transfer layer) and globulin 1. Other promoters useful in the practice of the invention that are known to anyone skilled in the art are likewise considered by the invention. A technician with ordinary experience can determine vectors and regulatory elements (including operatively linked promoters and coding regions) suitable for expression in a particular host cell. "Operatively linked" in this context means that the terminator and promoter sequences effectively function to regulate transcription. As another example, a suitable vector for the expression of A6 and / or A15 desaturase in transgenic maize plants might comprise seed-specific promoter sequences operatively linked to the desaturase coding region and others operatively linked to a seed storage protein termination signal or to the nopalin synthase termination signal.As yet another example, a vector for use in the expression of desaturases in plants may comprise a constitutive promoter or a tissue-specific promoter operatively linked to the desaturase coding region and also operatively linked to a tissue-specific or constitutive termination or the nopalin synthase termination signal. Modifications of nucleotide sequences or regulatory elements described herein that maintain the functions considered herein are within the scope of this invention. Such modifications include insertions, substitutions, and deletions, and specifically substitutions that reflect the degeneracy of the genetic code. Standard techniques for constructing such recombinant vectors are well known to those with ordinary experience in the technique and can be found in references such as Sambrook et al. (2001), or any of the myriad laboratory manuals on recombinant DNA technology that are widely available. A variety of strategies are available for ligating DNA fragments, the choice of which depends on the nature of the DNA fragment ends. It Also considered according to the present invention is including in a nucleic acid vector other nucleotide sequence elements that facilitate cloning, expression or processing, for example, sequences encoding signal peptides, a sequence encoding KDEL which is required for protein retention in the endoplasmic reticulum or sequences encoding transit peptides that direct A6-desaturase to the chloroplast. Such sequences are known to one of ordinary experience in the art. An optimized transit peptide is described, for example, by Van den Broeck et al. (1985). Prokaryotic and eukaryotic signal sequences are described, for example, by Michaelis et al. (1982). Once the desired cDNA or genome has been isolated, it can be sequenced using known methods. It is recognized in the art that such methods are subject to errors, such that multiple sequencing of the same region is routine and is still expected to induce measurable error rates in the resulting deduced sequence, particularly in regions having repeated domains, extensive secondary structure, or unusual basic compositions, such as regions with GC basic content. When discrepancies arise, re-sequencing can be performed and may employ special methods.Special methods may include altered sequencing conditions employing: different temperatures; different enzymes; proteins that alter the ability of oligonucleotides to form higher-order structures; altered nucleotides such as methylated ITP or dGTP; different gel compositions, for example the addition of formamide; different primers or primers located at different distances from the problem region; or different patterns such as single-stranded DNAs. mRNA sequencing can similarly be employed. Some or all of the coding sequence for a polypeptide having desaturase activity may be from a natural source. In some situations, however, it is desirable to modify all or a portion of the codons, for example, to enhance expression, using preferred host codons. Preferred host codons can be determined from the highest frequency codons in the expressed proteins. The text discusses the importance of synthesizing desaturase sequences in larger quantities in a particular host species and / or tissue of interest. It explains that the coding sequence for a polypeptide with desaturase activity can be synthesized in whole or in part. Similarly, whole or portions of DNA can be synthesized to remove any destabilizing secondary structure regions or sequences that would be present in the transcribed mRNA. All or part of DNA can also be synthesized to alter the basic composition to one more preferable in the desired host cell. Methods for synthesizing sequences and assembling sequences together are well-established in the literature.Mutagenesis and in vitro selection, site-directed mutagenesis, or other means may be employed to obtain mutations of naturally occurring desaturase genes to produce a polypeptide having in vivo desaturase activity with more desirable physical and kinetic parameters to function in the host cell, such as a longer half-life or a higher rate of production of a desired polyunsaturated fatty acid. Once the polynucleotide encoding a desaturase polypeptide has been obtained, it is placed in a vector capable of replication in a host cell, or it is propagated in vitro using techniques such as PCR or long PCR. Replication vectors can include plasmids, phages, viruses, cosmids, and the like. Desirable vectors include those useful for mutagenesis of the gene of interest or for expression of the gene of interest in host cells. The long PCR technique has made in vitro propagation of large constructs possible, so that modifications to the gene of interest, such as mutagenesis or addition of expression signals and propagation of the resulting constructs, can occur completely in vitro without the use of a replication vector or a host cell. For the expression of a desaturase polypeptide, functional transcriptional and translational termination and initiation regions are operably linked to the polynucleotide encoding the desaturase polypeptide. Expression of the polypeptide coding region can occur in a host cell in vitro or in vivo. Transcriptional and translational termination and initiation regions are derived from a variety of sources. non-exclusive factors, including the polynucleotide to be expressed, genes known or suspected to be capable of expression in the desired system, expression vectors, chemical synthesis, or from an endogenous location in a host cell. Expression in a host cell can be achieved in a transient or stable manner. Transient expression can occur from introduced constructs that contain functional expression signals in the host cell, but whose constructs do not replicate and rarely integrate into the host cell, or where the host cell is not proliferating. Transient expression can also be achieved by inducing the activity of an operably regulated promoter linked to the gene of interest, although such inducible systems often exhibit a low baseline level of expression. Stable expression can be obtained by introducing a construct that can integrate into the host genome or that autonomously replicates in the host cell. Stable expression of the gene of interest can be selected through the use of a selectable marker located in or transfected with the expression construct, followed by selection for cells expressing the marker.When stable expression results from integration, the integration of constructs can occur randomly within the host genome or can be targeted through the use of constructs containing regions of homology with the host genome sufficient to target recombination with the host locus. Where constructs are targeted to an endogenous locus, all or some transcriptional and translational regulatory regions may be supplied by the endogenous locus. When increased expression of polypeptide desaturase in the source organism is desired, several methods can be employed. Additional genes encoding polypeptide desaturase can be introduced into the host organism. Expression of the native desaturase site can similarly be increased through homologous recombination, for example by inserting a stronger promoter into the host genome to cause increased expression, or by removing destabilizing sequences from the mRNA or encoded protein by deleting that information. of the host genome, or by adding stabilizing sequences to the mRNA (United States Patent No. 4,910,141). It is considered that more than one polynucleotide encoding a desaturase, or a polynucleotide encoding more than one desaturase, can be introduced and propagated in a host cell by the use of episomal or integrated expression vectors. Where two or more genes are expressed from separate replication vectors, it is desirable that each vector has a different means of replication. Each introduced construct, whether integrated or not, should have a different means of selection and should require homology to the other constructs to maintain stable expression and prevent re-classification of elements between constructs. Judicious choices of regulatory regions, means of selection, and method of propagation of the construct can be experimentally determined so that all introduced polynucleotides are expressed at the levels necessary to provide synthesis of the desired products. When necessary for transformation, a desaturase-encoding sequence can be inserted into a plant transformation vector, for example, the binary vector described by Bevan (1984). Plant transformation vectors can be derived by modifying the natural gene transfer system of Agrobacterium tumefaciens. The natural system comprises large Ti (tumor-inducing) plasmids containing a large segment, known as T-DNA, which is transferred to transformed plants. Another Ti plasmid segment, the vir region, is responsible for T-DNA transfer. The T-DNA region is bounded by terminal repeats. In the modified binary vectors, the tumor-inducing genes have been deleted, and the functions of the vir region are used to transfer foreign DNA bounded by the T-DNA boundary sequences.The T region similarly contains a selectable marker for antibiotic resistance, and a multiple cloning site for inserting sequences for transfer. Such constructed strains are known as "disarmed" A. tumefaciens strains, and allow for efficient transformation of T region-limited sequences into plant nuclear genomes. The invention has many applications. Probes based on the polynucleotides of the present invention can find use in methods for isolating related molecules or in methods for detecting organisms expressing desaturases. When employed as probes, the polynucleotides or oligonucleotides must be detectable. This is normally achieved by attaching a label to the internal site, for example, by incorporating a modified residue, or at the 5' or 3' ends. Such labels may be directly detectable, may bind to a detectably labeled secondary molecule, or may bind to an unlabeled secondary molecule and a detectably labeled tertiary molecule; this process can be extended as long as it is practical to obtain a satisfactorily detectable signal without unacceptable levels of antecedent signal.Secondary, tertiary, or bridging systems may involve the use of antibodies directed against any other molecule, including labels or other antibodies, or may involve any molecules that bind to each other, for example a biotin-streptavidin / avidin system. Detectable labels typically include radioactive isotopes, molecules that chemically or enzymatically produce or alter light, enzymes that produce detectable reaction products, magnetic molecules, fluorescent molecules, or molecules whose fluorescence or light emission characteristics change upon binding. Examples of labeling methods can be found in U.S. Patent No. 5,011,770.Alternatively, the binding of target molecules can be detected directly by measuring the change in the solution's heat upon binding of the probe to the target using isothermal titration calorimetry, or by coating the probe or target onto a surface and detecting the change in light scattering from the surface produced by binding of the target or probe, respectively, as can be done with the BIAcore system. Constructs comprising the gene of interest can be introduced into a host cell using standard techniques. For convenience, a host cell that has been manipulated by any method to accept a construct or DNA sequence will be referred to as a "transformed" cell. The term "recombinant" here refers to the host organism. The target organism will have at least one copy of the expression construct and may have two or more, for example, depending on whether the gene is integrated into the genome, amplified, or is present in an extrachromosomal element having multiple copy numbers. The transformed host cell can be identified by selection for a marker contained in the introduced construct. Alternatively, a separate marker construct can be introduced with the desired constructs, since many transformation techniques introduce many DNA molecules into host cells. Typically, transformed hosts are selected for their ability to grow in selective media. Selective media may incorporate an antibiotic or require a factor necessary for the growth of the untransformed host, such as a nutrient or growth factor. A marker gene introduced in this way may confer antibiotic resistance, or encode an essential growth factor or enzyme, and allow growth in selective media when expressed in the transformed host. Selection of a transformed host can similarly occur when the expressed marker protein can be detected, directly or indirectly.The marker protein can be expressed alone or as a fusion to another protein. The marker protein can be detected by its enzymatic activity; for example, beta-galactosidase can convert the substrate X-gal into a colored product, and luciferase can convert luciferin into a light-emitting product. The marker protein can be detected by its light-modifying or light-producing characteristics; for example, the green fluorescent protein of Aequorea victoria fluoresces when illuminated with blue light. Antibodies can be used to detect the marker protein or a molecular label on, for example, a protein of interest. Cells expressing the marker protein or label can be selected, for example, visually, or by techniques such as FACS or pa-niculation using antibodies.Ideally, resistance to kanamycin and the aminoglycoside G418 is of interest, as is the ability to grow in media requiring uracil, leucine, lysine, or tryptophan. Another aspect of the present invention provides transgenic plants or offspring containing the isolated DNA described herein. Plant cells can be transformed with one or more isolated DNA(s) encoding A6 and Al5-desaturase by any plant transformation method. The transformed plant cell, often in a callus or leaf disc culture, is regenerated into a complete transgenic plant by methods well known to one of ordinary skill in the art (e.g., Horsch et al., 1985). Since the offspring of transformed plants inherit the polynucleotide(s) encoding the desaturase, seeds or cuttings of transformed plants can be used to maintain the transgenic plant lineage. The present invention also provides a method for providing transgenic plants with an increased content of GLA and / or SDA. In certain embodiments of the invention, DNA encoding an A15- and / or A12-desaturase can be introduced into plant cells with an A6-desaturase. Such plants may or may not similarly comprise endogenous A12- and / or A15-desaturase activity. The present invention also provides a method for providing transgenic maize plants containing elevated levels of PUFAs, including GLA and / or DAS, which are lacking in native maize plants. Expression vectors comprising DNA encoding an A6-desaturase and / or an A12-desaturase and / or an A15-desaturase can be constructed by recombinant technology methods known to one of ordinary skill in the art (Sambrook et al., 2001). For dietary supplementation, purified PUFAs, processed plants or plant parts, or derivatives thereof, can be incorporated into the cooking of oils, fats, or margarines formulated in such a way that in normal use the container would receive the desired amount. PUFAs can similarly be incorporated into infant formulas, nutritional supplements, or other food products, and may find use as anti-inflammatory or cholesterol-lowering agents. When used here, "edible composition" is defined such as compositions that can be ingested by a mammal, such as foodstuffs, nutritional substances, and pharmaceutical compositions. When used herein, "foodstuffs" refers to substances that can be used or prepared for use as food for a mammal and includes substances that can be used in food preparation (such as frying oils) or food additives. For example, foodstuffs include animals used for human consumption or any product thereof, such as, for example, eggs.Foodstuffs include, but are not limited to, beverages (e.g., soft drinks, carbonated drinks, ready-to-mix drinks), infused foods (e.g., fruits and vegetables), sauces, condiments, salad dressings, fruit juices, syrups, desserts (e.g., puddings, gelatin, glazes and fillings, baked goods and frozen desserts such as ice cream and fruit sorbets), soft frozen products (e.g., soft frozen custards, soft frozen yogurts and ice creams, soft frozen toppings such as milk-based or milk-free whipped toppings), oils and emulsified products (e.g., shortening, margarine, mayonnaise, butter, cooking oil and salad dressings) and intermediate wet foods (e.g., rice and dog food). An example of a foodstuff provided by the invention is a food formulated for a companion animal. The term "companion animal" refers to a domesticated animal. The companion animal may be a particular mammal, and specifically includes, but is not limited to, dogs, cats, rabbits, rodents, and horses. As described, the companion animal can obtain health benefits by consuming such a foodstuff comprising seed oil according to the invention. The formulation of animal feed products is well known to those experienced in the art, including formulated food for companion animals. In the area of ​​cat and dog food, for example, wet pet food, semi-moist pet food, dry pet food, and pet treats and light meals are well known. Drinks for Pet food is similarly available as milk drinks for cats. An intermediate wet food, for example, generally has a moisture content above 20%, while a wet food has a moisture content of at least about 65%. Semi-moist food typically has a moisture content between about 20% and about 65% and may include humectants such as propylene glycol, potassium sorbate, and other ingredients to prevent microbial growth (i.e., bacteria and mold). Dry (crushed) pet food generally has a moisture content below about 20%, and its production may include extrusion, drying, and / or heat cooking.Light pet meals and treats are frequently semi-moist light meals or chewable treats; dry light meals or treats in any number of shapes or forms; chewable bones; baked, extruded or crushed treats; confectionary light treats / meals; or other types of treats, as is well known in the art. An intermediate wet pet food product may include ingredients such as cereal grains, meats, fats, vitamins, minerals, water, and functional ingredients that are mixed together, cooked, and packaged. However, any semi-moist pet food formulation known to one skilled in the art may be employed. For example, a pet food may be formed by adding, on a dry matter basis, about 5-40% by weight of protein; about 5-45% by weight of fat; about 0.1-12% by weight of a fiber; about 1-90% by weight of carbohydrate; and about 0.1-2% by weight of a functional ingredient. An oil composition of the invention may be added in any desired amount, for example, about 1-50% by weight, including about 1-30% and about 3-15%.Variations can be made based on the desired characteristics of the final product, as is well known to those experienced in the art. Furthermore, the edible compositions described herein can also be ingested as an additive or supplement contained in foods and beverages. These can be formulated together with a substance. Nutritional components such as various vitamins and minerals are incorporated into substantially liquid compositions such as nutrient drinks, soy milks, and soups; substantially solid compositions; and gelatins, or employed in powder form to be incorporated into various foods. The content of the effective ingredient in such a health or functional food may be similar to the dose contained in a typical pharmaceutical agent. Purified PUFAs, processed plants or plant parts can be incorporated into animal feed, particularly livestock feed. In this way, the animals themselves can benefit from a diet rich in PUFAs, while human consumers of food products produced from such livestock can also benefit. It is expected in certain embodiments that SDA will be converted into EPA in animals and thus such animals can benefit from an increase in EPA from consuming SDA. For pharmaceutical use (human or veterinary), the compositions can generally be administered orally; however, they can be administered by any route by which they can be successfully absorbed, for example, parenterally (i.e., subcutaneously, intramuscularly, or intravenously), rectally, vaginally, or topically, for example, as a skin lotion or ointment. PUFAs, transformed plants, or plant parts of the present invention can be administered alone or in combination with a pharmaceutically acceptable excipient or carrier. Where available, gelatin capsules are the preferred form of oral administration. Dietary supplementation as mentioned above can similarly provide an oral route of administration. Unsaturated acids of the present invention can be administered in conjugated forms, or as salts, esters, amides, or prodrugs of fatty acids.Any pharmaceutically acceptable salt is covered by the present invention; sodium, potassium, or lithium salts are especially preferred. Similarly covered are salts of N-alkylpolyhydroxylamine, such as N-methylglucamine, found in PCT publication WO 96 / 33155. Ethyl esters are preferred. As solid salts, PUFAs can... They can also be administered in tablet form. For intravenous administration, PUFAs or derivatives thereof can be incorporated into commercial formulations such as Intralipids. In certain embodiments of the invention, coding sequences or fragments thereof are provided operably linked to a heterologous promoter, in either sense or antisense orientation. Expression constructs are likewise provided comprising these sequences, as are plants and plant cells transformed with the sequences. The constructs that can be employed in conjunction with plant transformation techniques employing these or other sequences according to the invention will be known to those skilled in the art taking into account the present description (see, for example, Sambrook et al., 2001; Gelvin et al., 1990). The techniques of the present invention are thus not limited to any particular nucleic acid sequences. One use of the sequences provided by the invention will be in altering the composition of oil. The desaturase gene can be provided with other sequences. Where an expressible coding region that is not necessarily a marker coding region is employed in combination with a marker coding region, one can employ the separate coding regions in the same or different DNA segments for transformation. In the latter case, the different vectors are released simultaneously into recipient cells to maximize co-transformation. The choice of any additional elements employed along with the desaturase coding sequences will frequently depend on the purpose of the transformation. One of the main purposes of crop plant transformation is to add commercially desirable, agronomically important characteristics to the plant. As PUFAs are known to confer many beneficial health effects, concomitant increases in SDA production may be similarly beneficial and can be achieved by expression of Primula A6-desaturase. Such increases in SDA may, in certain embodiments of the invention, comprise expression of A12 and / or A15 desaturase. Vectors used for plant transformation may include, for example, plasmids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), or any other suitable cloning system, as well as DNA fragments thereof. Thus, when the term "vector" or "expression vector" is used, all the preceding types of vectors, as well as nucleic acid sequences isolated from them, are included. It is considered that the use of cloning systems with large insertion capabilities will allow the introduction of large DNA sequences comprising more than one selected gene. According to the invention, this can be used to introduce several desaturase-coding nucleic acids. The introduction of such sequences can be facilitated by the use of bacterial or yeast artificial chromosomes (BACs or YACs, respectively), or even plant artificial chromosomes.For example, the use of BACs for Agrobacterium-mediated transformation was described by Hamilton et al. (1996). Particularly useful for transformation are expression cassettes that have been isolated from such vectors. DNA segments employed to transform plant cells will, of course, generally comprise the cDNA, gene or genes that one wishes to introduce into and that are expressed in the host cells. These DNA segments may also include structures such as promoters, enhancers, polylinkers, or even regulatory genes as desired. The DNA segment or gene chosen for cellular introduction will frequently encode a protein that will be expressed in the resulting recombinant cells, resulting in a selectable or evaluable trait and / or giving an improved phenotype to the resulting transgenic plant. However, this may not always be the case, and the present invention likewise encompasses transgenic plants incorporating unexpressed transgenes. Preferred components likely to be included with vectors employed in the present invention are as follows. The DNA sequence between the transcription initiation site and the beginning of the coding sequence, that is, the non-transcriptional leader sequence... Linked gene expression can likewise influence gene expression. One may therefore wish to employ a particular leader sequence with a transformation construct of the invention. Preferred leader sequences are considered to include those comprising sequences predicted to direct optimal linked gene expression, i.e., including a preferred consensus leader sequence that can enhance or maintain mRNA stability and prevent improper translation initiation. The choice of such sequences will be known to those skilled in the art taking into account the present description. Sequences that are derived from genes that are highly expressed in plants will typically be preferred. Transformation constructs prepared according to the invention will typically include a 3' end DNA sequence that acts as a signal to terminate transcription and allow polyadenylation of the resulting mRNA encoding sequences operably linked to a desaturase gene (e.g., cDNA). In one embodiment of the invention, the native terminator of a desaturase gene is employed. Alternatively, a heterologous 3' end may enhance the expression of desaturase-coding regions. Examples of terminators deemed useful include those of the Agrobacterium tume-faciens nopalin synthase gene (3' end) (Bevan et al., 1983), the 3' end of potato or tomato protease inhibitor I or II genes, and the CaMV 35S terminator.Regulatory elements such as an Adh intron (Callis et al., 1987), a sucrose synthase intron (Vasil et al., 1989), or a TMV omega element (Gallie et al., 1989) may likewise be included where desired. Suitable methods for transforming plant or other cells for use with the present invention are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct DNA release, such as by PEG-mediated transformation of protoplasts (Omirulleh et al., 1993), by desiccation / inhibition-mediated DNA uptake (Potrykus et al., 1985), by electroporation (U.S. Patent No. 5,384,253, specifically incorporated). (each specifically incorporated herein by reference in its entirety), by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Patent No. 5,302,523, specifically incorporated herein by reference in its entirety; and U.S. Patent No. 5,464,765, specifically incorporated herein by reference in its entirety), by Agrobacterium-mediated transformation (U.S. Patent No. 5,591,616 and U.S. Patent No. 5,563,055; both specifically incorporated herein by reference) and by acceleration of DNA-coated particles (U.S. Patent No. 5,550,318; U.S. Patent No. 5,538,877; and U.S. Patent No. 5,538,880; each specifically incorporated herein by reference in its entirety), etc. Through the application of techniques such as these, the cells of virtually any plant species can be stably transformed, and these cells develop into transgenic plants. After releasing exogenous DNA into recipient cells, the next steps generally involve identifying the transformed cells for cultivation and plant regeneration. In order to improve the ability to identify transformants, one may wish to employ an assessable or selectable marker gene with a transformation vector prepared according to the invention, as is well known in the art. In this case, one would then generally analyze the potentially transformed cell population by exposing the cells to a selective agent or agents, or one would assess the cells for the desired marker gene characteristic. In addition to the direct transformation of a particular plant genotype with a construct prepared according to the present invention, transgenic plants can be made by crossing a plant that has DNA selected from the invention with a second plant requiring the DNA. Plant breeding techniques can similarly be employed to introduce a multiple desaturase, for example, A6, A12 and / or A15-desaturase(s) into a single plant. In this way, the product of an A6-desaturase reaction can be effectively increased. Creating In plants homozygous for an A6-desaturase gene and / or other desaturase genes (e.g., A12- and / or A15-desaturase genes), beneficial metabolites may be increased. As mentioned above, a selected desaturase gene can be introduced into a particular plant variety by crossbreeding, without the need to always directly transform a plant of that specific variety. Therefore, the present invention encompasses not only a plant directly transformed or regenerated from cells that have been transformed according to the present invention, but likewise the offspring of such plants. When used herein, the term "offspring" denotes the offspring of any generation of a parent plant prepared according to the present invention, wherein the offspring comprises a selected DNA construct prepared according to the invention.The "Crossing" of a plant to provide a plant line that has one or more added transgenes or alleles relating to a starting plant line, as described herein, is defined as the techniques that result in a particular sequence being introduced into a plant line by crossing a starting line with a donor plant line comprising a transgene or allele of the invention. To achieve this, one could, for example, perform the following steps: (a) plant seeds from the first (starting line) and second (donor plant line comprising a desired transgene or allele) origin plants; (b) cultivate the seeds from the first and second origin plants into flowering plants; (c) pollinate a flower from the first origin plant with pollen from the second origin plant; and (d) harvest seeds produced on the origin plant producing the fertilized flower. Crossing is defined here as the process including the steps of: (a) crossing a plant of a first genotype containing a desired gene, DNA sequence or element with a plant of a second genotype requiring said desired gene, DNA sequence or element; (b) selecting one or more offspring plants containing the desired gene, DNA sequence or element; (c) crossing the offspring plants (a) ascending in a plant of the second genotype; and (b) repeating steps (b) and (c) in order to transfer a desired DNA sequence from a plant of a first genotype to a plant of a second genotype. The introgression of a DNA element into a plant genotype is defined as the result of the cross-conversion process. A plant genotype in which a DNA sequence has been introgressed may be referred to as a cross-converted, lineage, inbred, or hybrid genotype. Similarly, a plant genotype lacking the desired DNA sequence may be referred to as a non-converted, lineage, inbred, or hybrid genotype. Examples The following examples are included to illustrate embodiments of the invention. It should be appreciated by those skilled in the art that the techniques described in the following examples represent techniques discovered by the inventor to work well in the practice of the invention. However, those skilled in the art should, taking into account the present description, appreciate that many changes can be made to the specific embodiments that are described and still obtain an equal or similar result without departing from the concept, spirit, and scope of the invention. More specifically, it will be apparent that certain agents that are equally chemically and physiologically related can be substituted for the agents described herein while the same or similar results would be obtained.All such substitutes and similar modifications apparent to those skilled in the art are judged to be within the spirit, scope and concept of the invention as defined by the appended claims. Example 1. Vectors for Expressing A15- and A6-Desaturases in Corn A binary vector was constructed to express an Al5-desaturase and an A6-desaturase in maize embryo and aleurone tissue. This construct was prepared with a globulin promoter targeting the expression of a mutagenized Neurospora crassa A15-desaturase to increase expression in a monocotyledon such as maize (SEQ). (ID N0:5) and an A6 desaturase from Mortierella alpina (SEQ ID N0:6, bp 71-1444) (United States Patent No. 6,075,183). The M. alpina A6-desaturase was cloned into a transport vector containing the globulin promoter, pMON67624, resulting in pMON82809. The mutagenized N. crassa A15 desaturase was cloned into a transport vector containing the globulin promoter, pMON67624, resulting in pMON82810. The two globulin desaturase expression cassettes were cloned into the pMON30167 maize binary vector containing the CP4 marker gene for glyphosate resistance. The first expression cassette containing the A6 desaturase from M. alpina was cloned into pMON30167, resulting in pMON82811. The second expression cassette containing the mutagenized N. crassa A15 desaturase was then cloned into pMON82811, resulting in the maize transformation construct pMON82812 (FIG. 1). Transformed ex-plants are obtained through Agrobacterium tumefaciens-mediated transformation. Plants are regenerated from the transformed tissue. Oven-grown plants are then analyzed for oil composition. Another binary vector, pMON78175, was constructed to express an A15-desaturase and an A6-desaturase in maize embryo and aleurone tissue. To generate the binary vector, an expression cassette containing the N. crassa A15-desaturase (SEQ ID NO: 5) under globulin promoter control was PCR amplified using pMON82812 as a standard, cloned into a transport vector, and the cassette sequence verified. The expression cassette containing the P. juliae A6-desaturase (SEQ ID NO: 7) targeted by the globulin promoter was generated by PCR. As part of this process, the nucleotides immediately preceding the ATG start codon of the P. juliae A6-desaturase were changed to CAGCC to generate a translation initiation region optimized for gene expression in monocotyledonous plants such as maize. Employing standard ligation and restriction procedures that are well established in the art, the A6-desaturase from P. juliae and the A15-desaturase from N.crassa cells were subsequently cloned into a binary vector hosting a cas cell. Seven expressions of CP4 were used as selectable markers to generate the maize transformation vector, pMON78175 (FIG. 2). Transformed explants are obtained through Agrobacterium tumefaciens-mediated transformation. Plants are regenerated from the transformed tissue. Oven-grown plants are then analyzed for oil composition. Example 2 Vector for Expression of a Primula juliae A6-Desaturase Optimized by Monocotyledon Sequence in Maize This example describes the design and construction of a modified Primula juliae A6 desaturase polynucleotide molecule for expression in monocotyledonous plants. It is well known in the art that non-endogenous protein-coding sequences may not express well in plants (U.S. Patent No. 5,880,275, incorporated herein by reference). Therefore, employing a native PJD6D polypeptide sequence (SEQ ID NO: 3), an artificial PjDoD protein-coding polynucleotide sequence was designed and constructed by 1) employing a codon-use bias similar to that of highly expressed monocotyledonous proteins, and by 2) removing RNA destabilizing elements previously characterized and known to affect mRNA stability in plants (U.S. Patent No. 5,880,275).The resulting modified PJD6D polynucleotide sequence was designated PjD6Dnno (SEQ ID NO: 8) and encodes a polypeptide identical in sequence to the native PJD6D polypeptide (SEQ ID NO: 3). A binary vector, pMON78171, was constructed to express an A15-desaturase and a sequence-modified A6-desaturase from maize embryo and aleurone tissue. To generate the binary vector, an expression cassette containing N. crassa A15-desaturase (SEQ ID NO: 5) under globulin promoter control was PCR amplified using pMON82812 as a standard, cloned into a transport vector, and sequence-verified. The expression cassette containing P. juliae A6-desaturase (SEQ ID NO: 9) targeted by the globulin promoter was generated by PCR. As part of this process, the nucleotides that The ATG start codon immediately preceding the ATG of the P. juliae A6-desaturase was changed to CAGCC to generate a translation initiation region optimized for gene expression in monocotyledonous plants, such as maize. Employing standard ligation and restriction procedures that are well established in the technique, the P. juliae A6-desaturase and the N. crassa A15-desaturase were subsequently cloned into a binary vector hosting a CP4 expression cassette as a selectable marker to generate the maize transformation vector, pMON78171 (FIG. 3). Transformed explants are obtained via Agrobacterium tumefaciens-mediated transformation. Plants are regenerated from the transformed tissue. Oven-grown plants are then analyzed for oil composition. Example 3 Fatty acid analysis The fatty acid composition of mature seeds expressing pMON82812 was determined by grinding corn seeds and extracting the homogenate with heptane. The heptane extract was treated with toluene containing triheptadecanoin at 0.25 mg / ml and sodium methoxide in methanol (0.6 N). The reaction was stopped with aqueous sodium chloride (10% w / v). After splitting at room temperature, the organic phase was analyzed by GLC (Hewlett Packard model 6890 (120 volts) equipped with a split / unsplit capillary inlet (250°C) and a flame ionization detector (270°C). The column was a Supelco 24077 (0.25 mm od. x 15 m length) with a 0.25 µm bonded polyethylene glycol stationary phase. Fatty acid methyl esters are identified by comparison of retention time on commercial standards. Qualitative weight percent compositions are calculated as percents of the area of ​​identified peaks.The results of the analysis for seeds exhibiting SDA and GLA are shown in Table 1. Partially null seeds containing only GLA were not found. Specifically, more than two-thirds of the seeds analyzed contained both GLA and SDA. The analysis of a mature seed from the event ZM_103111: @ which was transformed with pMON82812. showed 9.68% SDA. Table 1: Fatty Acid Analysis of Single Mature Corn Seeds Expressing DAS and / or GLA. Pedigree Ger Oléico (18:1 LA (18:2) GLA (18:3) ALA (18:3) SDA (18:4) ZM S103111:©. RI 26.08 13.62 0.91 26.44 9.68 ZM S1.83@RI 14:2 30.17 8.56 ZM S103121:@ RI 27.39 16.2 1.14 27.61 5.8 ZM S103432:@ 21.44 14.11 0.68:2 0.61 30.56 5.19 ZM S103435ZLH244 Fl 22.3 16.98 0.99 33.28 4.81 ZM S103435 / LH244 Fl 23.85 19.21@0.12 ZM 49 ON 26.2 15.07 1.11 32.29 3.93 AM S103432:@. S103110:@. 34.81 3.67 ZM SI03427 RI 18.42 23.76 1.01 32.27 3.61 ZM S103435 / LH244 Fl 20.83 19.3 0.68 34.71 3.53 ZM 27 25.22 1.53 30.79 3.53 ZM S103110:@ RI 22.12 17.73 0.79 34.38 3.48 ZM S103099 / LH244 Fl S103432:@ 16.98 6.61 0.8 40.32 3.27 AM S108 0.35 30.79 3.23 ZM S103111:@. RI 21.29 19.93 0.71 33.77 3.23 ZM S103099 / LH244 Fl 21.11 23.29 0.79 30.95 3.21 ZM S103432:@. RI 18.2 18.81 0.61 38.94 3.19 ZM S103435 / LH244 Fl 21.27 19.75 0.7 34.33 3.13 ZM S103432:©. .. RI 20.8 2'1.47 0.76 33.59 3.12 ZM S103121:@. RI 23.71 18.96 0.75 31.97 3.1 ZM S103121:@. RI 23.81 17.28 0.98 33.75 3.07 ZM S103099 / LH244 Fl 19.64 21.46 0.7 34.49 2.99 ZM S103121:@. RI 23.83 16.72 1.01 34.5 2.93 ZM S103427:@. RI 16.68 26.92 1.03 30.59 2.87 ZM S103I68 / LH244 Fl 18.58 23.81 1.34 32.42 2.87 ZM S103432:@. RI 17.94 18.89 0.72 39.8 2.84 ZM S103110:@. RI 20.14 19.32 0.58 36.65 2.77 ZM S103111:@. RI 20.57 19.13 0.34 36.1 2.7 ZM S103168 / LH244 Fl 20.04 25.44 1.26 30.32 2.69 ZM S103110:@. RI 21.6 19.78 0.61 35.15 2.66 ZM S103099 / LH244 Fl 21.06 23.54 0.67 31.49 2.58 ZM S103435 / LH244 Fl 19.26 22.53 0.9 34.92 2.53 ZM S103433 / LH244 Fl 22.95 20.01 0.39 33.51 2.47 ZM S103168 / LH244 Fl 19.39 26.31 1.23 31.06 2.4 ZM S103110:@. RI 18.05 22.96 0.65 35.53 2.39 ZM S103110;@.RI 18.99 21.92 0.65 35.22 2.38 ZM S103111:@. RI 17.14 22.59 0.71 36.95 2.32 ZM S103433 / LH244 Fl 23.64 19.84 0.38 33.12 2.29 . ZM S1Õ3436 / LH244' FÍ1 20.71 26.64 1.07 28.11 2.26 ZM S103435 / LH244 F1 21.89 21.12 0.6 33.35 2.24 ZM S103110:@. RI 22.59 28.35 0.52 25.05 2.15 ZM S103168 / LH244 F1 19.41 27.76 1.19 28.96 2.14 ZM S103168 / LH244 F1 17.81 28.33 1.28 31.34 2.1 ZM S103097 / LH244 F1 18.61 25.34 1.19 31.88 2.09 ZM S103168 / LH244 F1 20.08 28.05 1.27 28.28 2.06 ZM S103433 / LH244 F1 20.11 19.18 0.38 38.29 2.04 ZM S103427:@. RI 18.38 30.32 1.19 26.79 1.98 ZM S103427:@. RI 20.06 29.56 1.13 27.23 1.95 ZM S103436 / LH244 F1 19.82 28.13 0.89 28.57 1.94 . ZM S103110:@. RI 18.74 22.83 0.72 35.29 1.91 ZM S103433 / LH244 F1 21.69 21.09 0.4 34.71 1.9 ZM S103430 / LH244 F1 23.25 25.64 0.92 27.64 1.89 ZM S103099 / LH244 F1 17.77 25.43 0.61 33.61 , 1.88 ZM S103111:@. RI 21.04 22.99 0.29 31.6 1.86 ZM S103168 / LH244 F1 18.19 27.7 1.18 31.55 1.86 ZM S103099 / LH244 F1 18.24 23.16 0.65 35.78 1.85 ZM S103435 / LH244 F1 21.02 27.67 0.88 28.27 1.83 ZM S103433ZLH244 F1 21.7 21.08 0.39 34.49. 1.8 ZM S103097 / LH244 F1 20.11 26.32 1.08 29.94 1.8 ZM S103427:@. RI 16.95 30.23 1.08 J 30.11 1.8 ZM S103437 / LH244 F1 23.93 26.23 1.12 25.86 1.78 ZM S103437 / LH244 F1 23.5 26.49 0.99 26.32 • 1.77 ZM S103168 / LH244 F1 19.4 27.81 1.06 30.29 1.74 ZM S103427:@. RI 17.94 30.11 1.17 29.42 1.74 ZM S103103 / LH244 F1 21.32 31.31 1.16 24.36 1.66 ZM S103433 / LH244 F1 20.48 21.06 0.41 35.4 1.64 ZMS103437 / LH244 F1 19.71 26.4 1.06 31.7 1.6 ZM S103433 / LH244 F1 18.98 21.89 0.36 37.18 1.59 ZM S103430 / LH244 F1 21.41 26.76 0.91 27.06 1.56 ZM S103437 / LH244 F1 18.67 28.15 1.07 30.71 1.56 ZM S103097 / LH244 F1 19.97 28.13. 1.18 28.16 1.55 ZM S103436 / LH244 F1 19.29 .31.27 0.79 25.74 1.53 ZM S103430 / LH244 F1 22.43 25.58 0.81 28.41 1.53 ZM S103430 / LH244 F1 18.48 27.25 1.05 31.73 1.53 ZM S103103 / LH244 F1 21.25 31.91 1.13 24.06 1.53 ZM S103435 / LH244 F1 20.92 27.87 0.82 27.48 1.51 ZM S103121:@. RI 20 24.11 0.99 33.48 1.5 ZM S103103 / LH244 F1 20.9 31.44 1.08 25.09 1.5 ZM S103103 / LH244 F1 20.06 32.22 1.04 25.4 1.4 ZM S103103 / LH244 F1 20.02 33.05 1.09 24.5 1.39 ZM S103097 / LH244 F1 18.78 28.78 1.03 29.82 1.31 ZM_S103111:@. RI 19.23 27.51 0.62 29.58 1.25 ZM S103436 / LH244 F1 18.53 30.87 0.66 27.55 1.22 LH244 / ZM S103431 F1 20.88 23.22 0.34 32.46 1.19 LH244 / ZM S103431 F1 20.07 25.05 0.35 33.01 1.19 ZM S103436 / LH244 F1 20.39 31.62 0.69 26.02 1.16 ZM S103111:@. RI 20.48 24.18 0.47 32.33 1.11 ZM S103435 / LH244 F1 20.4 26.7 0.52 31.26 1.09 . I. *M4W ** •* ™.— ZM S103436 / LH244 F1 19.35 31.69 0.71 27.3 1.08 LH244 / ZM S103431 F1 19.75 23.35 0.26 33.86 0.98 ZM S103436 / LH244 F1 20.11 32.54 0.71 26.25 0.96 ZM S103430 / LH244 F1 18.87 29.25 0.7 30.17 0.95 LH244 / ZM S103431 F1 21.18 25.86 0.2 29.33 0.87 LH244 / ZM SI03098 F1 21.77 24.64 0.15 32.57 0.81 LH244 / ZMS103105 F1 17.72 32.84 0.41 27.61 0.68 ZMJS103434 / LH244 F1 20.34 26.19 0.3 31.48 0.6 ZM S103434 / LH244 F1 21.59 26.44 0.28 29.99 0.58 ZMS103434 / LH244 F1 20.22 27.13 0.31 30.47 0.58 LH244 / ZM S 103098 F1 19.29 27.08 0.19 33.6 0.52 ZMS103434 / LH244 F1 19.24 28.24 0.26 31.45 0.51 LH244 / ZMJS103105 F1 17.73 34.46 0.44 27.24 0.5 LH244 / ZM S 103431 F1 19.12 31.08 0.24 27.77 . 0.47 ZMJS103434 / LH244 F1 17.63. 29.39 0.24 32.47 0.38 LH244 / ZM S103105 F1 18.37 36.34 0.36 24.68 0.33 LH244 / ZM S103105 . F1 18.62 38.05 0.34 22.84 0.27 ZM S103110:@. RI 18.35 57.16 0 2.25 0 LH244 / ZM S103098 F1 19.18 58.95 0 1.78 0 LH244 / ZM S103098 F1 19.35 58.56 0 1.79 0 LH244 / ZM S103098 F1 19.17 59.15 0 1.8 - 0 LH244 / ZM S103098 F1 16.76 62.23 0 1.81 0 LH244 / ZM S103098 F1 18.39 59.37 0 . 1.88 0 LH244 / ZM S103098 F1 18.26 59.91 0 1.96 0 LH244 / ZM S103098 F1 17.14 61.34 0 2.06 0 LH244 / ZM S103098 . F1 16.65 61.17 0 2.39 0 . . Fatty acid analysis of events generated by transformation with pMON78171 is shown in Table 2 below. Ten mature R1 or F1 seeds were analyzed for their co-occurring fatty acid composition. mo above, and average fatty acid composition was calculated from these numbers, while excluding nulls. The best event of the realization obtained with vector pMON78171 contained on average 28.6% SDA and 2.2% GLA. The best single maize seed of the realization contained 32.9% SDA and 3.5% GLA. TABLE 2: Fatty Acid Analysis of Mature Corn Seeds Pedigree Gen Oleico LA GLA ALA SDA ZM S1 ON 21.34 12.92 3.53 13.49 32.92 AM S126797:@. ON 22.11 12.12 3.3 14.12 32.58 EN S 126797 ON 21.91 12.87 3.5 13.1 32.28 ZM S127034:@. ON 23.26 9.86 1.22 17.05 31.2 EN S126797:@. EN 24.07 14.98 3.24 13.06 28.74 ZM S128026 / LH244 F1 21.96 16.99 3.24 12.69 28.5 ZM S127034:@. ON 24.15 11.3 1.2 18.06 28.19 EN S129919:@. AT 21.79 17.34 2.43 14.1 28.19 ZM..S127034:@. “27.39 9.56 128 16.03 28.04 ZM S127034:@.R1 29.01 9.8 1.19 15.19 27.41 ZM S128026 / LH244 Fl 22.35 17.95 3.58 12.5 26.93 ZM S129919:@ R1 20.77, 19.48 3.02 14.79 26.51 ZM S127034:@ 18.47 25.87 ZM S126797:@. R1 21.95 19.77 4.66 11.88 25.81 ZM S127034:@. R1 26.95 13.34 1.35 15.95 25.62 ZM S126797:@. R1 20.94 20.76 4.4 13.5 24.7 ZM S126790ZLH244 Fl 24.46 19.05 2.71 13.05 24.57 ZM S128026 / LH244 Fl 23.44 19.46 3.71 12.28 24.24 ZM S126797:@. R1 21.41 22.02 4.87 11.41 23.95 ZM S126808:@. R1 25.61 18.44 2.38 14.16 23.81 ZM S126797:@. R1 22.74 20.52 4.23 12.86 23.8 ZM S126797:@. R1 20.95 22.77 4.76 11.94 23.74 ZM S126808:@. R1 22 19.57 2.76 16.21 23.64 ZM S129919:@. R1 21.49 23.45 2.95 13.33 22.4 ZM S128026 / LH244 Fl.23.12 22.18 3.87 12.33 22.34 ZM S126797:@. R1 21.51 24.35 4.56 12 21.82 ZM S126790 / LH244 Fl 25.99 20.48 2.46 13.48 21.71 ZM S126995 / LH244 Fl . 24.4 22.45 2.12 14.26 20.03 ZM S126790 / LH244 Fl .24.33 23.6 2.87 13.24 19.76 ZM S126790 / LH244 Fl <24.24 24.08 2.88 12.74 19.44 ZM S126995 / LH244 Fl 29.51 20.1 1.96 12.44 19.17 ZM S126800 / LH244 Fl 26.18 24.62 3.01 11.52 18.9 ZMS126800 / LH244 Fl 24.35 26.28 3.26 10.89 18.56 ZM S129919:@. R1 21.87 27.84 2.77 12.76 18.28 ZM S126995 / LH244 Fl 26.78 24.15 2.09 11.97 18.26 ZM S129919:@. R1 21.22 28.87 3 12.33 18.18 ZM S126800ZLH244 Fl 23.23 27.22 3.54 11.35 17.98 ZM S126790 / LH244 Fl 22.01 28.63 3.36 12.63 17.78 ZMJS126995ZLH244 Fl 26.48 23.9 1.84 12.93 17.78 ZM S126800 / LH244 Fl 26.6 25.01 2.72 11.7 17.54 ZM S126995ZLH244 Fl 25.83 25.52 2.12 12.59 17.15 ZM S129919:@. RT 21.8 30 2.79 11.51 16.89 ZM S129919:@. R1 20.77 31.81 3.03 11.33 16.65 ZM S126808:®. R1 22.22 30.61 2.64 11.91 16.07 ZM S126808:®. . R1 22.6 30.58 2.5 11.72 15.54 ZM. S126800 / LH244 Fl 23.86 31.07 3.13 11.37 15.07 1.87 12.32 14.07 ZM S126808:@. R1 22.94 33.24 2.81 10.51 13.79 ZM S126808:@. R1 21.28 34.77 3.15 10.62 13.65 ZM S126808:@. R1 25.73 32.94 2.19 9.26 11.95 ZM S128026 / LH244 Fl 18.81 62.08 0.09 1.61 0.7 ZM S126790 / LH244 Fl 19.23 62.98 0 1.36 0.06 ZMS126790 / LH244 Fl 19.62 63.27 0 1.18 0 ZMS126790 / LH244 Fl 19.56 63.19 0 1.38 0 ZM S126790 / LH244 Fl 19.88 61.96 0 1-3 0 . ZM~SÍ26790 / LH244 — tf " 20.43 61.28 0 1.37 0 ZM S126800 / LH244 Fl 22.09 59.61 0 1.22 0 ZM S126800 / LH244 Fl 20.09 62.11 0 1.32 0 ZM S126800 / LH244 Fl 21.8 59.52 0 1.34 0 ZM S126800 / LH244 Fl 22.55 59.63 0 1.28 0 ZM S126808:@. RI 20.9 60.65 0 1.43 0 ZM S126808:@. RI 20.57 60.95 0 1.54 0 ZM S126808:@. RI 18.75 62.61 0 1.45 0 ZMS126995 / LH244 Fl. 20.03 63.35 0 1.22 0 ZMJS126995ZLH244 Fl 21.55 59.59 0 1.1 0 ZM S126995 / LH244 Fl 24.63 56.02 0 1.12 0 ZM S126995ZLH244 Fl 20.12 60.75 0 1.23 0 ZM S126998:@. RI 21.51 60 0 1.62 0 ZM S126998:@. RI 22.17 27.15 0 34.29 ' 0 ZM S126998:@. RI 19.77 62.76 o . 1.61 0 • ZM S126998:@. RI 20.73 28.41 0 33.75 0 ZM S126998:@. RI 20.59 33.96 0 29.47 0 ZM S126998:®. RI 20.8 33.48 0 28.9 0 ZM S126998:@. RI 22.15 33.67 0 27.92 0 ZM S126998:@. RI 19.86 30.92 0 32.91 0 ZM S126998:@. RI 21.47 30.99 0 31.39 0 ZM S126998:@. RI 21.37 31.16 0 30.85. 0 ZM S127034:@. RI 19.76 62.38 0 1.36 0 ZM S127034:@. RI 19.99 62.51 0 1.26 0 ZM S127034:@. RI 20.76 61.27 0 1.25 0 ZMS128026 / LH244 Fl 20.86 59.51 0 1.63 0 ZM S128026ZLH244 Fl 18.57 63.07 0 1.38 0 ZM S128026ZLH244 Fl 19.7 62.41 0 1.13 0 ZM S128026 / LH244 Fl 19.8 61.53 0 1.2 0 ZM S128026 / LH244 Fl 17.96 65.06 0 1.32 0 ZM S129919:@. RI 20.7 60.71 0 1.29 0 ZM S129919:@. RI 20.04 61.49 0 1.45 0 ZM S129919:@. RI 19.53 61.77 0 1.37 0 . Fatty acid analysis of events generated by transformation with pMON78175 is shown in Table 3 below. Ten mature F1 or R1 seeds were analyzed for their fatty acid composition as described above. The best single maize seed of the realization contained 12.4% SDA and 0% GLA. TABLE 3: Fatty Acid Analysis of Mature Corn Seeds Pedigree Gen Oleic Acid Linoleic Acid GLA ALA SDA ZM S130139:@. RI 26.57 8.39 0 34.39 12.36 ZM S130134:@. RI 30.59 9.04 0 30.31 11.86 ZM S130139:@. RI 26.39 9.41 0 34.91 11.12 ZM S130135:@. RI 25.09 12.98 0.12 34.81 9.93 ZM S130133:@. RI 30.62 10.85 0 30.93 9.63 ZM S130136:@. RI 30.55 11.99 0 32.28 7.63 ZM S130136:@. RI 28.27 13.53 0 33.41 7.45 ZM S130136:@. RI 29.14 10.61 0 34.59 7.44 ZM S130134:@. RI 25.43 14.32 0 35.68 7.3 ZM S130134:@. RI 23.94 16.92 0 35.7 6 ZM S130133:@. RI 22.93 17.14 0.02 37.21 5.88 ZM S130136:@. RI 28.28 11.89 0 35.63 5.86 ZM S130140:@. RI 23.47 15.34 0 37.85 5.68 ZM S130133:@. RI 21.75 17.83 0 37.43 5.59 ZM S130.072 / LH244 F1 23.17 25.78 0.2 28.61 5.39 ZM S130140:@. RI 22.75 ' ' 17.26 0 37.98 4.83 ZM S130161:@. RI 28.54 13.26 0 37.6 2.88 ZM S130140:@. RI 20.82 23.51 0 35.48 2.88 ZM. S130.155 / LH244 F1 20.87 59.43 1 0 2.2 0 All methods and / or compositions described and claimed herein can be made and performed without undue experimentation taking into account the present description. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be evident to those skilled in the art that variations can be applied to the compositions and / or methods and to the steps or sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be evident that certain agents that are both chemically and physiologically reported can be substituted for the agents described herein while the same or similar results would be obtained. All such modifications and similar substitutes evident to those skilled in the art are judged to be within the spirit, scope and concept of the invention as defined by the appended claims. REFERENCES The references listed below are incorporated herein by reference to the extent that they supplement, explain, provide a basis for, or teach the methodology, techniques, and / or compositions employed. here. United States Patent No. 4,826,877 United States Patent No. 4,910,141 United States Patent No. 5,011,770 United States Patent No. 5,158,975 United States Patent No. 5,302,523 United States Patent No. 5,378,619 United States Patent No. 5,384,253 United States Patent No. 5,464,765 United States Patent No. 5,538,877 United States Patent No. 5,538,880 United States Patent No. 5,550,318 United States Patent No. 5,563,055 United States Patent No. 5,591,616 United States Patent No. 5,952,544 United States Patent No. 6,603,061 Ausubel et al., In: Current Protocols in Molecular Biology, Green Publishing Assoc., New York, 1994. Baerson et al., Plant Mol. Biol, 22(2):255-267, 1993. Bevan et al., Nucleic Acids Res., 11(2):369-385, 1983. Bevan, Nucleic Acids Res., 12:8111, 1984. Bustos et al., J. Bacteriol, 174: 7525-7533, 1991. Bustos, et al., Plant Cell, 1(9):839-853, 1989. Callis et al., Genes Dev., 1: 1183-1200, 1987. Chen et al., Proc. Natl. Acad. Sci. USA, 83:8560-8564, 1986. Chou and Fasman, Adv. Enzymol, 47:45-148, 1978. de Deckerer, Eur. J. Clin. Nutr., 52:749, 1998. Garcia-Maroto and others, Lipids, 37 (4), 2002 Gelvin et al., In: Plant Molecular Biology Manual, 1990. Goeddel, In: Methods in Enzymology, Perbal (Ed.), Academic Press, John Wiley and Sones, 185, 1988. Hamilton et al., Proc. Natl. Acad. Sci USA, 93(18):9975-9979, 1996. Hong et al., Plant Mol. Biol, 34(3):549-555, 1997. Horrobin et al., Am J. Clin. Nutr., 57(Suppl):732S-737S, 1993. Horsch et al., Science, 227:1229, 1985. Huang, Biochem. Biophys. Acta, 1082:319, 1991. James et al., Semin. Arthritis Rheum., 28:85, 2000. Kaeppler et al., Plant Cell Reports, 9:415-418, 1990. Koncz and Schell, Mol Gen. Genet., 204:383-396, 1986. Kridl et al., Seed ScL Res., 1:209:219, 1991. Kyte and Doolittle, J. Mol Biol, 157:105-132, 1982. Manzioris et al., Am. J. Clin. Nutr., 59:1304, 1994. Michaelis et al., Ann. Rev. Microbiol, 36:425, 1982. Napier et al., Biochem. J., 328, 717-720, 1997. Napier et al., Prostaglandins Leukot. Essent. Fatty Acids, 68 (2), 135-143, 2003. Naylor et al., Nature, 405:1017, 2000. Omirulleh et al., Plant Mol. Biol, 21(3):415-28, 1993. PCT Order US03 / 16144 PCT Order WO 96 / 33155 PCT Request WO 03 / 06870 Pedersen et al., Cell, 29:1015-1026, 1982. Potrykus et al., Mol. Gen. Genet, 199(2):169-77, 1985. Potrykus et al., Mol Gen. Genet, 199:183-188, 1985. Radke et al., Plant Cell Reports, 11:499-505, 1992. Reed et al., Plant Physiol., 122:715-720, 2000. Riggs, et al., Plant Cell, 1(6):609-621, 1989. Russell et al., Transgenic Res., 6(2):157-168 Sambrook et al., In: Molecular cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001. Sayanova et al., FEBS Let, 542:100-104, 2003. Sayanova et al., Plant Physiol., 121, 641-646, 1999. Shanklin et al., Biochemistry 33, 12787-12794, 1994. Simopoulos et al., Am. Coll. Nutr., 18:487, 1999. Slocombe et al., Plant Physiol, 104(4): 167-176, 1994. Sperling and Heinz, Eur. J. Lipid Sd. Technolo., 103,158-180, 2001. Van den Broeck et al., Nature, 313:358, 1985. Vasil et al., Plant Physiol., 91:1575-1579, 1989. Yang et al. Proc. Natl. Academic. Sci USA, 87:4144-4148, 1990. Wolk et al., Proc. Natl. Acad. Sci USA, 1561-1565, 1984. Yamazaki et al., Biochem. Biophys. Acta, 1123:18, 19992. SEQUENCE LISTING <110> Ursin, Virginia Froman, Byron Nava, AJ Jennifer Gonzales <12O> FATTY ACID DESATIRASE EXPRESSION IN CORN <130> MONS:046WO <140> UNKNOWN <141> 2005-04-15 <150> 60 / 563.135 <151> 2004-04-16 <160> 22 <170> Patentin version 3.1 <210> 1 <211> 1953 <212> DNA <213> Juliae Primrose <400> 1 tatatatata tatatatata atcccaaca aacactgtca cttgcaaac aaactcaacc 60. cacgttactt atccctttc cccaaaatgg aaaaacacatt ttcaccacca cctactaaca 120 ccaattccaa ccccatgact aagaccattt acataccag ctcagaactt gaaaaacata 180 240 ctgcgcttca cccggggggc atcgctcccc tcatcgccct tgcaggacat gatgtgaccg 300 acgctttcct cgcttaccat ccccctycca cctcccgcct cctccctccc ttctccacca 360 acctacttct agaaaaacat tcagtgtccg agacctctc cgactcgc aaacttctag 420 acagctttca taagattgggc atgtttcgtg ccaggggcca cactgcctac gcgacctttg 480 tcattatgat acttatgttg gtttaatctg tgactggggt gctttgcagt gagaatccgt 540 gggtgcattt ggtttgtgga gcggcaatgg ggtttgcctg gatccagtgc ggatggatag 600 gtcatgattc cggacattac cggataatga ctgaaaggaa atggaaccgg ttcgctcaga 660 tcctgagctc aaactgcctc caagggatta gtatcgggtg gtggaagtgg aaccacaacg 720 cgcaccacat tgcctgcaat agtctggagt acgaccctga cctccagtac attcccttgt 780 tggttgtgtc cccgaagttc tttaactccc tcacttcg tttctacgac aagaagctga 840 acttcgacgg tgtgtcgagg tttttggttc aataccagca ctggtcgttt tatccggtca 900 tgtgtgttgc taggctgaac atgcttgcga agtcgtttat actgcttttt tcgaggaggg 960 aggtggcgaa cagggtgcag gagattcttg gactagcggt ttttggctt tggttccgc 1020 tcctgctttc ttgccttcct aattggggtg agagaataat gtttttgctc gcgagctact 1080 ccgttacggg gatacaacac gtgcagttca gcttgaacca tttctcatct gacgtttacg 1140 tgggcccacc cgtaggtaac gattggttta agaaacagac tgcagggaca ctcaacatat 1200 cgtgcccggc gtggatggat tggttccacg gtggattgca gtttcaggtc gagcaccact 1260 tgttcccgcg gatgcctagg ggtcagtttc ggaagatttc tccttttgtg agggatttgt 1320 gtaagaaaca caatttgact tacaatattg cgtcttttac taaagcaaat gtgttgacgc 1380 ttgagaccct gagaaacaca gccattgagg ctcgggacct ctctaatccg atcccaaaga 1440 atatggtgtg ggaggctgtt aaaaatgtcg ggtgaaattg actatgtgtt ttgctattgg 1500 agcttcaatt tagtgattgt cgtttaaggg ggtatacaca atcaccagat aatcaaacgt 1560 tttctgttgt atttcgttct tgttatttac atttgtagag tggctcatgt aactgacttg 1620 tgtcgaatcg ttaagcctaa atacaagtgt aacaatttag tttctgtcca atttgagaaa 1680 tagaaaagtt tggttgagcc tttfcttttct tctaatttct tcaacaggct tattgagtgc 1740 cttatttgcc acatacttaa gcgaaatgct ccaagtgcgc tagccgcaga tgtataaatt 1800 gtctttttcg gcttcaagtt ttaactgtat aacgtcattt cggcttatcg taatggttca 1860 aattagctgc ttttgttttg acaattgtcc taagcaggca ctgatcaaca ctatcagttg 1920 ttctttccct ggtaaaaaag aactgttgaa ttt 1953 <210> 2 <211* 1341 <212> DNA <213> Primrose of Julia <400> 2 atgactaaga ccatttacat aaccagctca gaacttgaaa aacataacaa gccaggtgac 60 ctatggatat caattcaagg tcaagtttac gacgtttctt cctgggctgc gcttcacccg 120 gggggcatag ctcccctcct cgcccttgca ggacatgatg tgaacgacgc tttcctcgct 180 taccatcccc cttccacctc ccgcctcctc cctcccttct ccaccaacct acttctagaa 240 aaacattccg tgtccgagac ctcttcggc tatcgcaaac ttctagacag ctttcataag 300 atgggcatgt ttcgtgccag gggccacact gcctacgcga cctttgtcat tatgatactt 360 atgttggttt cctctgtgac tggggtgctt tgcagtgaga atccgtgggt gcatttggtt 420 tgtggagcgg caatggggtt tgcctggatc cagtgcggat ggataggtca tgattccgga 480- cattaccgga taatgactga caggaaatgg aaccggttcg ctcagatcct gagctcaaac 540 tgcctccaag ggattagcat cgggtggtgg aagtggaacc acaacgcgca ccacattgcc 600 tgcaatagtc tggagtacga ccctgacccc cagtacattc ccttgttggt tgtgtccccg 660 aagttcttta actccctcac ttctcgtgattc agctcgtc tcgaggtttt tggttcaata ccagcactgg tcgttttatc cggtcatgtg tgttgctagg 780 ctgaacatgc ttgcgcagtc gtttatactg cttttttcga ggagggaggt ggcgaacagg 840 gtgcaggaga ttcttggact agcggttttgtt tccctgctgt g 900 cttcctaatt' ggggtgagag aataatgttt ttgctcgcga gctactccgt tacggggata 960 caacacgtgc agttcagctt gaaccatttc tcatctgacg tttaagtggg cccacccgta 1020 ggtaacgatt ggtttaagaa acagct acaggcagc 1080 atggattggt tccatggcgg gttgcagttt caggtcgagc accacttgtt cccgcggatg 1140 cctaggggtc agtttcggaa gatttctcct tttgtgaggg atttgtgtaa gaaacacaat 1200 ttgacttaca atattgcttacttagtc tcttaggtc gaccctgaga 1260 aacacagcca ttgaggctcg ggacctctct aatccgatcc caaagaatat ggtgtgggag 1320 gctgttaaaa atgtcgggtg a 1341 <210> 3 <211> 1389 <212> DNA <213 > Primula juliae <400> 3 atggaaaaca cattttcacc accacctact aacaccaatt ccaaccccat gactaagacc 60 atttacataa ccagctcaga acttgaaaaa cataacaagc caggtgacct atggatatca 120 attcacggtc aagtttacga cgtttcttc tgggctgcgc ttcacccggg gggcatcgct 180 cccctcctg cccttgcagg acatgatgtg accgacgctt tcatcgctta ccatccccct 240 tccacctccc gcctcctccc tccctctc accaacctac ttctagaaaa acattccgtg 300 tccgagacct cttccgacta tcgcaaactt ctagacagct ttcataagat gggcatgttt 360 cgtgccagag gccacactgc ctacgcgacc tttgtcatta tgatacttat gttggttttcc 420 tctgtgactg gggtgctttg cagtgagaat ccgtgggtgc atttggtttg tggagcggca 480 atggggttg cctggatcca gtgcggatgg ataggtcatg attccggaca ttaccggata 540 atgactgaca ggaaatggaa ccggttcgct cagatcctga gctcaaactg cctccaaggg 600 attagcatcg ggtggtggaa gtggaaccac aacgcgcaca acattgcctg caatagtctg 660 gagtacgacc atgacctcca gtacattccc ttgttggttg tgtccccgaa gttctttaac 720 tccctcactt ctcgtttcta cgacaagaag gttcaatacc agcactggtc gttttatccg gcgcagtcgt ttatactgct tttttcgagg cttggactag cggttttttg gctttggttt ggtgagagaa taatgttttt gctcgcgagc ttcagcttga accatttctc atctgacgtt tttaagaaac agactgcagg gacactcaac catggcgggt tgcagtttca ggtcgagcac tttcggaaga tttctccttt tgtgagggat attgcgtctt ttactaaagc aaatgtgttg gaggctcggg acctctctaa tccgatccca gtcgggtga <210> 4 <211> 445 <212> PRT <213> Primrose of Julia <400> 4 ctgaacttcg acggtgtgtc ttgctaggct gaacatgctt agggaggtgg cgaacagggt gcaggagatt ccgctcctgc tttcttgcct tcctaattgg tactccgtta cggggataca acacgtgcag tacgtgggcc cacccctcgttac cggcgtggat ggattggttc cacttgttcc cgcggatgcc taggggtcag ttgtgtaaga aacacaattt gacttacaat acgcttgaga ccctgagaaa cacagccatt aagaatatgg tgtgggaggc tgttaaaaat 1389 Met Thr Lys Thr He lies Thr Dear Dear Glu Leu Glu Lys His Asn Lys Pro Gly Asp Leu Trp lie Dear He His Gly They In order to Tyr Asp In order to Dear Dear Trp No No Leu His Pro Gly Gly Hey That Pro Lion Lion That Lion That Gly His Asp Alas Thr Asp Ala Phe Lion That Tyr His Pro Pro Serum Thr Serum Silver Lion Lion Pro Pro Ph Serum Thr Asn Lion Lion Lion Glu Lys His Serum Alas Serum Glu Thr Serum Serum Asp Tyr Silver Lys Lion Lion Asp Serum Ph His Lys meth Gly meth Phe Arg Ala Arg Gly His Thr Ala Ala Thr Phe Vai He Met lie Leu Met Leu Vai Ser Ser Vai Thr Gly Vai Leu Cys Ser-Glu Asn Pro Trp Vai His Leu Vai Cys Gly Ala Ala Met Gly Phe Ala Trp He Gin Cys Gly Trp He Gly His Asp Ser Gly HisTyrArgHeMet Thr Asp Arg Lys Trp Asn Arg Phe Ala Gin lie 170- 175 Leu Ser Ser Asn Cys Leu Gin Gly He Ser lie Gly Trp Trp Lys Trp Asn His Asn His His lie Allah Cys Asn To be He read Glu Tyr Asp Pro Asp He read Gin lie Pro He read He read Go Go To be Pro Lys Phe Phe Asn To be He read Thr To be Arg Phe Tyr Asp Lys Lys He read Asn Phe Asp Gly Go To be Arg Phe He read Go Gin Tyr Gin His Trp Serum Ph Tyr Pro Alas meth Cys Vai Ala Arg Leu Asn Met Leu Ala Gin Ser Phe 260 265 lie Leo Leo Phe Serum Silver Silver Glu Alas That Asn Silver Alas Gin Glu Hey Lion Gly Lion That Alas Ph Trp Lion Trp Ph Pro Lion Lion Lion Serum Cys Lion Pro Asn Trp Gly Glu Arg lie Met Ph Lion Lion Winged Ser Tyr Ser Vai Thr Gly lie Gin His Alas Gin Ph Serum Lion Asn His Phe Ser Ser Asp Vai Vai Gly Pro Pro Vai Gly Asn Asp Trp Phe Lys Lys Gin Thr Ala Gly Thr Leu Asn lie Ser Cys Pro Ala Trp Met Asp Trp Phe His Gly Gly Leu 355 360 365 Gin Phe Gin Vai Glu His His Leu Phe Pro Arg Met Pro Arg Gly Gin Phe Arg Lys He Ser Pro Phe Vai Arg Asp Leu Cys Lys Lys His Asn Leu Thr Tyre Asn Hey Wing Ser Phew Thr Lily Wing Asn Alas! Leu Thr Leu Glue Thr Leo Arg Asn Thr Wing lie Glue Wing Arg Asp Leo Ser Asn For lie Pro Lys Asn Met Vai Trp Glu Ala Vai 435 440 Lys Asn Vai Gly <210> 5 <211> 462 <212> PRT <213> Primrose of Julia <400> 5 Met Glu Asn Thr Phe Ser Pro Pro Pro Thr Asn Thr Asn Ser Asn Pro 1 5 10 15 Met Thr Lys Thr He Tyr He Thr Ser Ser Glu Leu Glu Lys His Asn 20 25 30 Lys Pro Gly Asp Leu Trp He Ser He His Gly Gin Vai Tyr Asp Vai 35 40 45 Ser Ser Trp Ala Ala Leu His Pro Gly Gly He Ala Pro Leu Leu Ala 50 55 60 Leu Ala His Asp Vai Thr Asp Ala Phe Leu Ala Tyr His Pro Pro 65 70 75 80 Ser Thr Ser Arg Leu Leu Pro Pro Phe Ser Thr Asn Leu Leu Leu Glu 85 90 95 Lys His Ser Vai Ser Glu Thr Ser Ser Ser Asp Tyr Arg Lys Leu Leu Asp 100 105 110 Ser Phe His Lys Met Gly Met Phe Arg Ala Arg Gly His Thr Ala Ala Thr Phe Vai He Met He Leu Met Leu Vai Ser Ser Vai Thr Gly Vai Leu Cys Ser Glu Asn Pro Trp Vai Leu Vai Cys Gly Ala Ala Met Gly Phe Ala Trp lie Gin Cys Gly Trp He Gly His Asp Ser Gly His Arg lie Met Thr Asp Arg Lys Trp Asn Arg Phe Ala Gin He Leu Ser Ser Asn Cys Leu Gin Gly He Ser He Gly Trp Trp Lys Trp Asn His Asn No His His lie No Cys Asn Dear Leu Glu Tyr Asp Pro Asp Leu They Tyr Its Pro Leu Leu Go Go Dear Pro Lys Phe Phe Asn Dear Leu Thr Dear Arg Phe Tyr Asp Lys Lys Leu Asn Phe Asp Gly Go Dear Arg Phe Leu Go They Tyr They His Trp Dear Phe Tyr Pro Go But Cys Alas That Silver Lion Asn meth Lion That Gin Serum Ph Hey Lion Lion Ph Serum Silver Silver Glu Alas That Asn Silver Alas Gin Glu Hey Lion Gly Lion Alas Ph Trp Lion Trp Ph Pro Lion Lion Lion Serum Cys Lion Pro Asn Trp Gly Glu Silver Hey meth Ph Lion Lion That Serum Tyr Serum Alas Thr Gly He Gin His Vai Gin Phe Ser Leu Asn His Phe Ser Ser Asp Vai Tyr Vai His Asn 405 410 415 Leu Thr Asn He Ala Ser Phe Thr Lys Asn Vai Leu Thr Leu Glu Thr Leu Arg Asn Thr Ala He Glu Ala Arg Asp Leu 445 Ser Asn Pro He Pro Lys Asn Met Vai Trp Glu Allah Go Lys Asn Go Gly <210> 6 <211> 24 <212> DMA <213> Artificial <220> <223> Primer <400> 6 atmagyatyg gttggtggaa rtgg <210> 7 <211> 23 <212> DNA <213> Artificial <220> <223> Primer <400> 7 aàtccaccrt graaccartc gato <210> 8 <211> 27 <212> DMA <213> Artificial <220> <223> Primer <400> 8 cacacatgac cggataaaac gaccagt <210> 9 <211> 27 <212> DNA <213> Artificial <220> <223 > Primer <400> 9 gggaatgtac tggaggtcag ggtcgta 27 <210> 10 <211> 27 <212> DNA <213> Artificial <220> <223> Primer <400> 10 cgtgcagttc agcttgaacc atttctc <210> 11 <211> 27 <212> DNA <213> Artificial <220> <223 > Primer <400> 11 tgcagggaca ctcaacatat cgtgccc 27 <210> 12 <211> 27 <212> DMA <213> Artificial <220> <223> Primer <400> 12 gtaggttggt ggagaaggga gggagga <210> <211> <212> 27 DNA <213> Artificial <220> <223> Primer <400> 13 ggaaggggga tggtaagega ggaaagc 27 <210> 14 <211> 33 <212> DNA <213> Artificial <220> <223> Primer <400> 14 gtcgacatgg aaaacacatt ttcaccacca cct 33 <210> <211> <212> <213> DNA Artificial <220> <223> Primer <400> 15 gtcgacatga ctaagaccat ttacataacc age <210> <211> <212> <213> DNA Artificial <220> <223> Primer <400> 16 cctgcaggtc acccgacatt tttaacagcc tccc <210> 17 <211> 1290 <212> DNA <213> Neurospora crassa <400> 17 atggctgtca ctactaggtc acacaaagcc gccgctgcca ccgaacctga agttgtgtct 60 acaggagtgg atgeagteag cgctgccgca ccaagcagta gtagctcctc atcctcccaa 120 aagtcagctg agcctatcga atatccagac atcaagacaa ttegtgaege tataccagac 180 cactgcttta gacctcgcgt ttggatatcc atggcgtact ttattegega ttttgcaatg 240 gctttcggcc tcggatactt ggcatggcaa tacatccctt tgattgcaag taccccattg 300 agatacggag cttgggcttt gtacggttac ctccagggac tcgtctgtac tggaatttgg 360 atcttggctc acgaatgcgg tcacggagcc ttttctagac acacctggtt caacaacgtt 420 atgggttgga ttggtcactc tttcctacta- gtcccatatt ttagctggaa attttcccat 480 caccgtcatc ataggttcac cggacatatg gaaaaagata tggcgttcgt tccagccacg 540 gaggcggaca gaaatcagag aaaactagct aatctctata tggacaaaga gactgcggag 600 atgttcgagg atgttcctat tgtgcagttg gttaaactaa ttgctcacca actcgccggt 660 tggcagatgt atctcttgtt caacgttagt gccggaaaag gctccaaaca gtgggaaacc 720 ggcaaaggtg gaatgggatg gctccgcgtg agccatttcg aaccaagttc agccgttttc 780 agaaacagcg aagcaattta catagctcta agcgatctcg gacttatgat tatgggatac 840 attctctacc aggcagccca agttgttgga tggcaaatgg ttggtctctt gtattttcaa 900 cagtacttct gggttcacca ttggctcgtt gccatcactt accttcatca cacacacgaa 960 gaagttcacc actttgatgc agattcttgg acatttgtta agggtgccct cgctaccgtg 1020 gacagagact tcggtttcat cggcaagcac ctcttccata acatcattga ccatcatgtt 1080 gttcatcacctcttcccaag aatccctttc tactacgctg agaagctac caatcaata 1140 agacctatgc tcggacctct ttaccacaga gatgaccgtt cttcatggg gcaactctgg 1200 tacaacttca cacactgcaa atggtgtc cctgat6cccatgc tgtcatc aagtc tggctcaca ccgttcagag tactcagtaa 1290 <210> 18 <211> 1209 <212> DNA <213> Aspergillus nidulans <400> 18 atggccgcaa ccgcgaccac tctcgctgaa atagaaaga agaagga gattacacta 60 cagacaatca agaatgccat accaagcac tgttttaacc gtagtttgct tatttcaagt 120 gcctacgtcg tcagacct ccttacgca tcagttttgt tctattttga acttcatatt 180 gatacgctct tctcatcca gctccttagg atcttgcat ggacagctta cggttcatg 240 caagctgcg tgggaacgggg tatatggata ttggcacatg atgcggaca cggagctttt 300 agcccttacc aaacctggaa cgacgttgtt gggtggaccc ttcattct tctcatggtc 360 ccttacttct cttggaaaat aacccacgca aggcaccaca gatatacgaa caataccgag 420 agggacacag ccttcgttcc ctggaccgag aaggaatacg acaccagacc tcgttactc 480 cctgcatggt tcgagatgtt tgagacaca ccagtgtata acttgatttc attgctcgcc 540 catcagatcg ccggctggca aatgtacctc tgcttacg tctcagccgg agccaaagt 600 aagcctgttc cacaaggcaa gcagtccgga tggttttggag gtcacaatc tgcatcacac 660 tttgacccag gaagctctct atggaccgaa aaccagcgcc atctaatcgc aatctccgac 720 cttggactcc ttctcgtggc cgccgcgaat tggtacttgg ctcacaagt tggtgttcta 780 agaatggtgc tcatttacgt cgtcccctac ttttggtcc accactggct agtcgccatc 840 acgtacctcc accacactca cccatccata ccacactaca ccgacttac ctggacattc 900 actaaaggag cactctcaac agtggatcgt gacttcggat ttataggaag gcactcttt 960 caccacatca ttgatcacca cgtcgttcat cacttgttca ataggatacc attctatcac 1020 gcagaggaag ctactaacgc ataatacca gttctcggtg atagtacca tagagagaa 1080 accggattcc tctggagtct tatggaaact tataaaaact gtcgctttgt tggcgtggag 1140 aacgatgtgg gtaaggaggg agttctccat tgggttttcg aagaaaagaa aggcgctaaa 1200 gctgaatag 1209 <210> 19 <211> 1290 <212> DNA <213> Neurospora crassa <400> 19 atgacggtca ccacccgcag ccacaaggcc gcggccgcca ccgagcccga ggttgtcagc 60 accggcgttg acgccgtctc tgctgctgct ccctcctcct cctcctcctc ttccagccaa 120 aagtcggccg agcccatcga ataccccgac atcaagacca tccgcgacgc catccccgac 180 cactgcttcc gcccgcgcgt ctggatctcc atggcctact tcatccgcga cttcgccatg 240 gcctttggcc tcggctacct cgcctggcag tacatccccc tgatcgcctc caccccgctc 300 cgctacggcg cctgggctct gtacggctac ctccagggtc tcgtctgcac gggcatctgg 360 attctggcgc acgagtgcgg ccacggcgcc ttctcgaggc acacgtggtt caacaacgtc 420 atggggtgga ttggccactc cttcctcttg gtcccttact tcagctggaa gttcagccac 480 • catcgccacc atcgcttcac cggccacatg gagaaggaca tggcgtttgt gcctgccacc 540 gaggctgatc gcaaccagag gaagctggcc aacttgtaca tggacaagga gacggccgag 600 atgtttgagg atgtgcccat tgtccagctc gtcaagctca tcgcccacca gctggccggc 660 tggcagatgt acctcctctt caacgtctcc gccggtaagg gcagcaagca gtgggagact 720 ggcaagggcg gcatgggctg gttgagggtt agccactttg agccttcctc tgctgtgttc 780 cgcaactccg aggccatcta cattgccctg tccgatcttg gtctcatgat catgggctat 840 atcctctacc aggccgcgca ggttgttggc tggcagatgg. taggtctgct gtacttccag 900 cagtacttct gggttcacca ttggttggtc gccatcactt acctccacca cacccacgag 960 gaagtccacc actttgacgc cgactcgtgg accttcgtca agggcgctct cgccaccgtc 1020 gaccgcgatt ttggcttcat tggcaagcac ctcttccaca acattatcga ccaccacgtc 1080 gtccaccact tgttccctg catccccttc tactacgccg aagaagccac caactcgatc 1140 cgccccatgc tcggccccct ctaccaccgc gacgaccgct ccttcatggg ccagctgtgg 1200 tacaacttca cccactgcaa gtgggtcgtt ccggaccccc aggtccccgg cgcgcttatt 1260 tgggcgcaca ccgttcagag cacccagtaa 1290 <210> 20 <211> 1290 <212> DNA <213> Neurospora crassa <400> 20 atggcggtca ccacccgcag ccacaaggcc gcggccgcca ccgagcccga ggttgtcagc • 60 accggcgttg acgccgtctc tgctgctgct ccctcctcct cctcctcctc ttccagccaa 120 aagtcggccg agcccatcga ataccccgac atcaagacca tccgcgacgc catcccgac 180 cactgcttcc gcccgcgct ctggatctcc atggcctact tcatccgcga cttcgccatg 240 : gccttggcc tcggctacct cgcctggcag tacatccccc tgatcgcctc cacccgctc 300 cgctacggcg cctgggctct gtacggctac ctccagggtc tcgtctgcac gggcatctgg 360 attctggcgc acgagtgcgg ccacggcgcc ttctcgaggc acacgtggtt caacaacgtc 420 atggggtgga ttggccactc cttcctcttg gtcccttact tcagctggaa gttcagccac 480 catcgccacc atcgcttcac cggccacatg gagaaggaca tggcgtttgt gcctgccacc 540 gaggctgatc gcaaccagag gaagctggcc aacttgtaca tggacaagga gacggccgag 600 atgtttgagg atgtgcccat tgtccagctc gtcaagctca tcgcccacca gctggccggc 660 tggcagatgt acctcctctt caacgtctcc gccggtaagg gcagcaagca gtgggagact 720 ggcaagggcg gcatgggctg gttgagggtt agccactttg agccttcctc tgctgtgttc 780 cgcaactccg aggccatcta cattgccctg tccgatcttg gtctcatgat catgggctac 840 atcctctacc aggccgcgca ggttgttggc tggcagatgg tgggtctgct gtacttccag 900 cagtacttct gggttcacca ttggttggtc gccatcactt acctccacca cacccacgag 960 gaagtccacc actttgacgc cgactcgtgg accttcgtca agggcgctct cgccaccgtc 1020 gaccgcgatt ttggcttcat tggcaagcac ctcttccaca acattatcga ccaccacgtc 10E gtccaccact tgttccctg catccccttc cgccccatgc tggccccct ctaccaccgc tacaacttca cccactgcaa gtgggtcgtt tgggcgcaca ccgttcagag cacccagtaa <210> 21 <211> 2391 <212> DNA <213> Mortierella alpina <400> 21 caggatcggc ggcagcggtg gcaggagcca cggggacccg ggagtgccg caccctgagc cggaactctc cttcaggacc tgacaaacaa gtcagcctgc aaggaggaca tccccagtga ctggtttagc ttcctggaga gccacaacaa gcacatcttt aagatctctg aggaggagga tgccaagaag tacaaagaca ttatccggca tcccccacca aagaaggcct gaacaagggg agaccactcc cttccccatc ctcaatggga •atttactaac ttggtcctaa cccttactat gctgtctgtc tgtctagctc atctagttcc a999Sgagct taattccccc cactataggg aattggcaca ttcctcctcc ttctcccctt agcagaaagg acctgcattt tcctacactg agatggttgt atctaaagaa aaccagtggg acctggtaag ggacaaagaa aagccaggac tagaagccag cttcccgctg ttcccttagg tatgcccttg ttatgggcct gggatgcgga cgatcctttc ctggtccccaa agatcaaacc caaccttctg ctctggagag acgatgccgg tactacgccg aagaagccac caactcgatc 114 gacgaccgct ccttcatggg ccagctgtgg 12C ccggaccccc aggtccccgg cgcgcttatt 126 aggagcaggc tccagacgct gcttaggaac 60 tctcagctcc ggaggcgtca tggcagagta 120 catcaccctt gaagatctgg aacagctcaa 180 gaagagtgag gagatcacca caggcagcgc 240 gctggacaaa gacaacctct cctacataga 300 cctcctcact atggtggttg actacagaac 360 gctggacacc aagctaaccc gtattcccag 420 gccctctgaa gaagaaatca tcaaattggc 480 gaggaagagg aggaaggttg gatcttcatc 540 ggggctaggg caaccccctg ctccgtaccc 600 gcgcgtgtgt gtcggtgtgc gcacgctctg 660 tcctcctcat gaggggattg gaggcaaggg 720 ggaggtggac gctttttcta tgtaaacaga 780 tcctccaatc ttcccccaca tctttatgga 840 aggagctatg gtgaagatga ggtatgggag 900 gaaggaaggt aaagaggcca ctcaacctcc 960 tcagtgtttg tatctctatg ctggactggt 1020 ctgaggtcct gagtgccaat gggccctcct 1080 tgagccagaa atcttaatga gaagaccact 1140 ccaatggaga agccagcatt tactgtcccc 1200 gaccatgcac tactgagcct gagctaggga 1260 cgcaggcaga gacaggccca cttcctgctc ctcagtttct aaatacagac tgttggataa 1320 actgacctgg agcctaggga gattggggga tgagatcctt aggttttaac cccaacctgc 1380 ccacaaccta cagagtattg taggcaacct ttccactctc cagtttagaa ttctccaagc 1440 aagtagttaa ttacagtgtt tcctttgcac tgaccaccac cctgattcaa tccaggaagg 1500 gactggtaac ctttctcatt tgggtttgtg gatgccacac agccaagtca ctagagtgca 1560 gtgagtgaac ccagcctcct ccctgtccca agatgccctt ccccatcttg accgtgctaa 1620 ctgtgtgtac atatatattc tacatatatg tatattaaac ccgcactgcc atgtctgccc 1680 ttttttgtgg tttttagcat taacttattg tctaggccag agcgggagtg ggaggggatg 1740 ccacagaaag gaagtggcag agccaaattg ttacagagtc caaacagaaa acacatttca 1800 actaaccaca acaaatgtta catttacatg tgagctaaga gacaatttag agaaagatga 1860 aggtaggtgc ttttaggatg tgggagcaaa acttcacagg gaggggagga atggctgtca 1920 gaagagggtt cttgaagcca gactgactag agcaccctca gttcctagct gagcccagat 1980 tgcccatctc ctctggccac tgctgcagac acctgcctta actctcacac ctcgaagact 2040 ccagttttgc cttaaaggtc cttcctaaat ctccctagtc ttgcctggca tctcctttaa 2100 gacaagaaat ccttgtacaa ctgggtggga gaaaggaact ctgggtaaca tccttccttc 2160 tggggtgttc catgggagca ggagtgagac ggcgcttccc ttatggaaga gggaggagac agggtgcttc tcagaagctt ctctgtaagg caaaaaccaa actttaaaca gactaacctg 2280 ccctaatata ctcaccccct cgtgctgctg tgaggttgct cctagcctgt gctcctctgt 2340 ctgcagcgtg caaagccttg ttctaaccct ggaataaagg tgactgactc t 2391 <210> 22 <211> 522 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (200) . . . (511) <223> N = A, C, G, or T <220> <223> Description of Artificial Sequence: Synthetic Primer <400> 22 ttacagtaca gtcaatcacc tttattccag ggttagaaca aggccgtgca cactgcagac 60 aggagcacag gatggggaca atctcacagc ttaggttatt tttgcattac agagagattt cttctcccat ctcccccctc ctctcctcan. cctctcgctc tcgctcgctc tcacgcacat cagtcgtgct cagctccccc ctcccaattc gcagacaggg ctggggcatc tcggggaggt gtgtccgtgt taaggcaggt gtccccanca gctgggcgtg caaggttgtt ccnggcccgn cgtacagggt gggagggcag gttagtcttt 120 ctagactctg ctggaaatga ccctgtctcc 180 agaaggctcc tattccttcc tcctcttccc 240 tctcacatca cgtaatcctg accggaagga 300 tacaagtgcc tctcggtcct ggagggagaa 360 cctttaaggc aaaactgngg agtactccag 420 ntggccaaaa gggacggctg ggctgggctg 4.80 nggtttcttc tt 522

Claims

CLAIMS 1. Endogenous corn seed oil that has a stearidonic acid (18:4 n-3) content of about 0.1% to about 33%.

2. Corn seed oil according to claim 1, wherein the stearidonic acid content is selected from the group consisting of about 12% to about 15%, about 10% to about 33%, about 15% to about 32%, about 20% to about 30%, and about 25% to about 30%.

3. Corn seed oil according to claim 1, wherein corn seed oil is defined as comprising gamma-linolenic acid in a content selected from the group consisting of: less than about 7.5%, less than about 5% and less than about 3%.

4. Corn seed oil according to claim 1, wherein the ratio of stearidonic acid to gamma-linolenic acid is selected from the group consisting of: from about 1:1 to about 10:1, from about 2:1 to about 10:1, from about 3:1 to about 5:1 and at least about 3:

1.

5. Corn seed oil according to claim 1, wherein the ratio of omega-3 to omega-6 fatty acids in the oil is selected from the group consisting of between about 0.5%:1 to about 10:1, from about 5:1 to about 10:1, and at least about 5:

1.

6. Corn seed comprising seed oil according to claim 1.

7. Corn seed according to claim 6, defined as a congenital seed.

8. Corn seed according to claim 6, defined as a hybrid seed.

9. Corn plant producing a seed oil according to claim 1.

10. Corn plant according to claim 6, defined as a congenital plant.

11. Corn plant according to claim 6, defined as a hybrid plant.

12. Isolated polynucleotide selected from the group consisting of: (a) a polynucleotide comprising the nucleic acid sequence SEQ ID NO:8; (b) a polynucleotide hybridizing to SEQ ID NO:8 under conditions of 5X SSC, 50% formamide and 42°C, wherein the polynucleotide encodes a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 6; and (c) a polynucleotide having at least 90% sequence identity to the nucleic acid sequence of SEQ ID NO: 8, wherein the polynucleotide encodes a polypeptide having desaturase activity that desaturates a fatty acid molecule at carbon 6; and (d) a complement to the sequence in (a), (b), or (c).

13. Polynucleotide according to claim 12, also defined as comprising the nucleic acid sequence of SEQ ID NO:

9.

14. Recombinant construct comprising the isolated polynucleotide according to claim 12.

15. Transgenic plant transformed with the recombinant construct according to claim 14.

16. Method of producing seed oil, comprising cultivating the plant according to claim 9 under plant cultivation conditions until the plant produces said seed oil.

17. Method of increasing the nutritional value of an edible product for human or non-human animal consumption, comprising adding corn seed oil according to claim 1 to the edible product.

18. Method according to claim 17, wherein the edible product is selected from the group consisting of human food, animal food and a food supplement.

19. Method according to claim 17, wherein corn seed oil increases the stearidonic acid content of the edible product.

20. Method according to claim 17, wherein corn seed oil increases the ratio of omega-3 to omega-6 fatty acids in the edible product.

21. Method according to claim 17, wherein the edible product requires stearidonic acid before adding corn seed oil.

22. Method of manufacturing food and / or feed, comprising adding corn seed oil according to claim 1 in starting ingredients to produce the food and / or feed.

23. Food or feed made by the method according to claim 22.

24. Method of delivering stearidonic acid to a human or non-human animal, comprising administering corn seed oil according to claim 1 to said human or non-human animal.

25. Method according to claim 24, wherein the oil of Corn seed is administered in an edible composition.

26. Method according to claim 25, wherein the edible composition is food or feed.

27. A method according to claim 26, wherein the food comprises beverages, infused foods, sauces, condiments, salad dressings, fruit juices, syrups, desserts, glazes and fillings, soft frozen products, confections or intermediate moist food.

28. Method according to claim 26, wherein the edible composition is food or feed for a companion animal.

29. Method according to claim 25, wherein the edible composition is substantially a liquid or a solid.

30. Method according to claim 25, wherein the edible composition is a dietary supplement and / or a nutraceutical.

31. Method according to claim 24, wherein the oil of A corn seed is administered to a human.

32. Method according to claim 24, wherein corn seed oil is administered to a non-human animal.

33. Method according to claim 32, wherein corn seed oil is administered to cattle or poultry.