Synthesis of long-chain polyunsaturated fatty acids by recombinant cells

Abstract

SYNTHESIS OF POLYESATURATED LONG CHAIN ​​FATTY ACIDS BY RECOMBINANT STYLES. The present invention relates to the methods of synthesizing long-chain polyunsaturated fatty acids, especially eicosapentaenoic acid, docosapentaenoic acid and docosahexaenoic acid, in recombinant cells, such as yeast or plant cells. Recombinant cells or plants that produce long-chain polyunsaturated fatty acids are also provided. In addition, the present invention relates to a group of new enzymes that have desaturase or elongase activity that can be used in the long chain polyunsaturated fatty acid synthesis methods.

Description

SYNTHESIS OF LONG CHAIN ​​POLYUNSATURATED FATTY ACIDS BY RECOMBINANT CELLS FIELD OF THE INVENTION The present invention relates to methods of synthesizing long-chain polyunsaturated fatty acids, especially eicosapentaenoic acid, docosapentaenoic acid and docosahexaenoic acid, in recombinant cells, such as yeast or plant cells. Recombinant cells or plants that produce long-chain polyunsaturated fatty acids are also provided. Furthermore, the present invention relates to a group of new enzymes that have desaturase or elongase activity that can be used in methods of synthesizing long-chain polyunsaturated fatty acids. FUNDAMENTALS OF THE INVENTION Long-chain Omega-3 polyunsaturated fatty acid(s) (LC-PUFA) are now widely recognized as important compounds for human and animal health. These fatty acids can be obtained from dietary sources or by converting linoleic (LA, omega-6) or a-linoleic (ALA, omega-3) fatty acids, both considered essential fatty acids in the human diet. Although humans and many other vertebrate animals are capable of converting LA or ALA, obtained from plant sources, to LC-PUFA, they perform this conversion at a very low rate. Furthermore, most modern societies have unbalanced diets in which at least 90% of the polyunsaturated fatty acid(s) (PUFA) consists of omega-6 fatty acids, rather than the proportion of 4 :1 or less for omega-6 fatty acids:omega-3 which is considered optimal (Trautwein, 2001). The immediate dietary source of LC-PUFA, such as eicosapentaenoic acid (EPA, 20:5) and docosahexaenoic acid (DHA, 22:6), for humans is primarily fish or fish oil. Health professionals therefore recommend the regular inclusion of fish containing significant levels of LC-PUFA in the human diet. Progressively, fish-derived LC-PUFA oils are being incorporated into food products and baby formulas. However, in light of the decline in the global and national fishing industries, alternative sources of these health-boosting oils are needed. The inclusion of omega-3 LC-PUFAs, such as EPA and DHA, in the human diet has been linked to numerous health-related benefits. These include preventing or reducing coronary heart disease, hypertension, type 2 diabetes, kidney disease, rheumatoid arthritis, ulcerative colitis and chronic obstructive pulmonary disease, and aiding brain development and growth (Simopoulos, 2000). More recently, several studies have also indicated that omega-3 PUFA may be beneficial in infant nutrition and development and against various mental disorders such as schizophrenia, attention deficit hyperactive disorder and Alzheimer's disease. Higher plants, unlike animals, do not have the ability to synthesize polyunsaturated fatty acids with chain lengths greater than 18 carbons. In particular, crop and horticultural plants, along with other angiosperms, lack the necessary enzymes to synthesize the longer-chain omega-3 fatty acids, such as EPA, DPA and DHA, which are derived from ALA. an important goal at Plant biotechnology is therefore the design of crop plants, particularly oilseed crops, that produce substantial amounts of LC-PUFA, thereby providing an alternative source of these compounds. LC-P UFA synthesis pathways The biosynthesis of LC-PUFA from linoleic and a-linolenic fatty acids in organisms such as microalgae, mosses and fungi can occur by a series of alternating oxygen-dependent desaturation and elongation reactions, as shown schematically in Figure 1. In one pathway (Figure 1, II), the desaturation reactions are catalyzed by A6, A, and A4-desaturases, each of which adds an additional double bond to the fatty acid carbon chain, while each of an A6 and an A5 reaction -elongase adds a two-carbon unit to chain elongation. Conversion of ALA to DHA in these organisms therefore requires three desaturations and two elongations. Genes that encode the enzymes necessary for the production of DHA in this aerobic pathway have been cloned from various microorganisms and lower plants, including microalgae, mosses and fungi. Genes encoding some of the enzymes, including one that catalyzes the fifth step, A5-elongase, have been isolated from vertebrate animals, including mammals (reviewed in Sayanova and Napier, 2004). However, A5-elongase isolated from human cells is not specific for the reaction of EPA to DPA, having a broad specificity for substrates of fatty acid (Leonard et al., 2002). Alternative pathways for two sections of the pathway from ALA to DHA have been demonstrated in some groups of organisms. Conversion of ALA to ETA can be accomplished by a combination of an A9-elongase and an A8-desaturase (the so-called A8-desaturase pathway; see Figure 1, IV) in certain protists and from thraustochytrids, as evidenced by gene isolates that encode these enzymes (Wallis and Browse, 1999; Qi et al., 2002). In mammals, the so-called "Sprecher" pathway converts DPA to DHA by three reactions, independent of an A4-desaturase (Sprecher et al., 1995). In addition to these desaturase / elongase systems, EPA and DHA can also be synthesized through an anaerobic pathway in several organisms, such as Shewanella, Mortiella and Schizhochytrium (Abbadi et al., 2001). The operons encoding these polyketide synthase (PKS) enzyme complexes have been cloned from some bacteria (Morita et al., 2000; Metz et al., 2001; Tanaka et al., 1999; Yazawa, 1996; Yu et al. , 2000; WO 00 / 42195). The PKS EPA operon isolated from Shewanella spp. was expressed in Synechococcus, allowing it to synthesize EPA (Takeyama et al., 1997). The genes encoding these enzymes are arranged in relatively large operons, and their expression in transgenic plants has not been reported. Therefore, it remains to be seen whether the anaerobic PKS-like system is a possible alternative to the more classical aerobic desaturase / elongase for the transgenic synthesis of LC-PUFA. Desaturases All desaturase enzymes that have been shown to participate in LC-PUFA biosynthesis belong to the group of so-called "front-end" desaturases, which are characterized by the presence of a cytochrome b domain 5 at the N-terminus of each protein. The cytb domain 5 presumably acts as an acceptor of electrons needed for desaturation (Napier et al., 1999; Sperling and Heinz, 2001). The A5-desaturase enzyme catalyzes further desaturation of LC-PUFA C 20 , leading to arachidonic acid (ARA, 20:40)6) and EPA (20:5o)3). Genes encoding this enzyme have been isolated from several organisms, including algae (Thraustochytrium sp. Qiu et al., 2001), fungi (M. alpine, Pythium irregulars, Michaelson et al., 1998; Hong et al., 2002), Caenorhabditis elegans and mammals. A gene encoding a bifunctional A5- / A6-desaturase has also been identified from zebrafish (Hasting et al., 2001). The gene that encodes this enzyme perhaps represents an ancestral form of "front-end desaturase", which later duplicated and developed into distinct functions. The last step of desaturation for DHA production is catalyzed by an A4-desaturase and a gene encoding this enzyme has been isolated from the freshwater protist species Euglena gracilis and the marine species Thraustochytrium sp. (Qiu et al., 2001; Meyer et al., 2003). elongases Several genes encoding PUFA elongation enzymes have also been isolated (Sayanova and Napier, 2004). Members of this gene family were unrelated to elongase genes present in higher plants, such as FAE1 from Arabidopsis, which are involved in the extension of saturated and monounsaturated fatty acids. One example of the latter is erucic acid (22:1) in Brassicas. In some protist species, LC-PUFA are synthesized by elongating linoleic or a-linolenic acid with a C2 unit, prior to desaturation with A8-desaturase (Figure 1 part IV; "A8 desaturation" pathway). A6-desaturase and A6-elongase activities were not detected in these species. Rather, A9-elongase activity would be expected in such organisms and, in support of this, a C18 A9-elongase gene was recently isolated from Isochrysis galbana (Qi et al., 2002). LC-PUFA production engineering Transgenic oilseed crops that are engineered to produce major LC-PUFA by insertion of these genes have been suggested as a sustainable source of nutritionally important fatty acids. However, the requirement for coordinated expression and activity of five new enzymes encoded by genes from possibly diverse sources made this goal difficult to achieve and the proposal remains speculative to this day. The oxygen-dependent LC-PUFA biosynthetic pathway to form EPA (Figure 1) was successfully constituted in yeast by co-expression of an A6-elongase with A6 and A5 fatty acid desaturases, resulting in a small but significant accumulation of ARA and EPA from acids exogenously supplied linoleic acid and a-linolenic acid (Beaudoin et al., 2000; Zank et al. 2000) This demonstrated the ability of genes belonging to the LC-PUFA synthesis pathway to function in heterologous organisms. However, the efficiency of EPA production it was very low. For example, three genes obtained from C. elegans, Borago officinalis and Mortierella alpina, have been expressed in yeast (Beaudoin et al., 2000). When the transformed yeasts received 18:2(0-3 (LA) or 18:3(0-3 (ALA), there was a slight production of 20:4(0-6 or 2O:5co-3, in conversion efficiencies of 0.65% and 0.3%, respectively.Other researchers have similarly obtained very low EPA production efficiency using genes that express two desaturases and one elongase in yeast (Domergue et al., 2003a; Zank et al., 2002. There remains, therefore, the need to improve the efficiency of EPA production in organisms such as yeast, not to mention the production of PUFA C 2 2 which requires providing additional enzymatic steps. Some progress has been made in this quest for the introduction of the LC-PUFA aerobic biosynthetic pathway into higher plants, including oilseed crops (reviewed by Bayanova and Napier, 2004; Drexler et al., 2003; Abbadi et al., 2001). A gene encoding an A6-fatty acid desaturase isolated from borage (Borago officinalis) was expressed in transgenic tobacco and Arabidopsis, resulting in the production of GLA (18:3<o6) and SDA (18:4(03), the direct precursors for LC-PUFA in the transgenic plants (Sayanova et al., 1997; 1999) However, this only provides a single first step. Domergue et al. (2003a) used a combination of three genes, which encode A6 and A5-fatty acid desaturases and an A6-elongase, in both yeast and transgenic flax seed. The desaturase genes were obtained from the diatom Phaeodactylum tricornutum and the elongase gene from the moss Physcomitrella patens. the lows elongation yields were obtained for A6-fatty acids produced endogenously in yeast cells (i.e. by combining the first and second enzymatic steps), and the major PUFA C20 product formed was 20:2 â11 🇧🇷 14, representing an unwanted side reaction. Domergue et al. (2003a) also claim, without presenting data, that the combination of the three genes was expressed in the transgenic flax seed, which consequently produced ARA and EPA, but that the production was inefficient. They commented that the same problem that was observed in yeasts existed in the seeds of higher plants and that the "bottleneck" needed to be overcome for the production of LC-PUFA in oilseed crops. WO 2004 / 071467 (DuPont) reported expression of various desaturases and elongases in soybean cells, but did not show DHA synthesis in regenerated plants or in seeds. Abbadi et al. (2004) described attempts to express combinations of desaturases and elongases in transgenic flax seed, but only achieved low levels of EPA synthesis. Abbadi et al. (2004) indicated that their low levels of EPA production were also caused by an unknown "bottleneck". Qi et al. (2004) obtained the synthesis in leaves, but did not report the results in seeds. This is an important issue, as the nature of LC-PUFA synthesis can vary between leaves and seeds. In particular, oilseeds store lipid in seeds mainly as TAG, while leaves synthesize lipid mainly as phosphatidyl lipids. Furthermore, Qi et al. (2004) produced only AA and EPA. As a result, there are one need for methods additional production of long-chain polyunsaturated compounds, particularly EPA, DPA and DHA, in recombinant cells. SUMMARY OF THE INVENTION In a first aspect, the present invention provides a recombinant cell that is capable of synthesizing a long-chain polyunsaturated fatty acid(s) (LC-PUFA), comprising one or more polynucleotides encoding at least two enzymes, each of which is a bifunctional A5 / A6-desaturase, A5-desaturase, A6- desaturase, bifunctional A5 / A6 elongase, A5 elongase, A-6 elongase, A4 desaturase, A9 elongase or A8 desaturase, wherein one or more polynucleotides are operably linked to one or more promoters that are capable of directing expressing said polynucleotides in the cell, wherein said recombinant cell is derived from a cell which is not capable of synthesizing said LC-PUFA. In a second aspect, the present invention provides a recombinant cell with an increased ability to synthesize an LC-PUFA over a non-recombinant isogenic cell, which comprises one or more polynucleotides encoding at least two enzymes, each of which is an A5 bifunctional / A6-desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A5-elongase, A6-elongase, A4-desaturase, A9-elongase or A8-desaturase, wherein one or more polynucleotides are operatively linked to one or more promoters which are capable of expressing said polynucleotides in said recombinant cell. In one embodiment, at least one of the enzymes is a A5-elongase. The present inventors are the first to identify an enzyme that has greater A5-elongase activity than A6-elongase activity. As a result, this enzyme provides an efficient means of producing DPA in a recombinant cell, since the A5 elongation of EPA is favored over the A6 elongation of SDA. Thus, in one embodiment, the A5-elongase is relatively specific, i.e., when the A5-elongase also has A6-elongase activity, the elongase will be more efficient in synthesizing DPA from EPA than it is in synthesizing A6-elongase. ETA from SDA. In another embodiment, the A5-elongase comprises: i) an amino acid sequence as given in the ID. OF SEQ. No.: 2, ii) an amino acid sequence that is at least 50%, more preferably at least 80%, even more preferably at least 90%, identical to the ID. OF SEQ. No.: 2, or iii) a biologically active fragment of i) or ii). In another embodiment, the A5-elongase can be purified from algae. In another embodiment, at least one of the enzymes is an A9 elongase. The present inventors are the first to identify an enzyme that has both A9-elongase activity and A6-elongase activity. When expressed in a cell with an A6-desaturase and an A8-desaturase, this enzyme can use the two available pathways to produce ETA from ALA, DGLA from LA, or both (see Figure 1), thereby increasing the efficiency of ETA and / or DGLA production. Thus, in one embodiment, the A9-elongase also has A6-elongase activity. Preferably, A9-elongase is more efficient in synthesizing ETrA from ALA than it is in synthesizing ETA from SDA. Furthermore, in another embodiment, A9-elongase is capable of elongating SDA to ETA, GLA to GLA, or both, in a yeast cell. In a further embodiment, the A9-elongase comprises: i) an amino acid sequence as given in the ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 or ID. OF SEQ. No.: 86, ii) an amino acid sequence that is at least 50%, more preferably at least 80%, even more preferably at least 90%, identical to the ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 OR ID. OF SEQ. No.: 86, OR iii) a biologically active fragment of i) or ii). Preferably, the A9-elongase can be purified from algae or fungi. It is known in the art that the greater the number of transgenes in an organism, the greater the likelihood that at least one parameter of fitness of the organism, such as the expression level of at least one of the transgenes, growth rate, production of oil, reproductive capacity, etc., is compromised. Consequently, it is desirable to minimize the number of transgenes in a recombinant cell. To that end, the present inventors have devised numerous strategies for producing LC-PUFA's in a cell that avoid the need for a gene for each step in the relevant pathway. Thus, in another modality, at least one of the enzymes is a bifunctional A5 / A6 desaturase or a bifunctional A5 / A6 elongase. The bifunctional A5 / A6-desaturase can be naturally produced by a freshwater fish species. In one particular embodiment, the bifunctional A5 / A6 desaturase comprises: i) an amino acid sequence as given in the ID. OF SEQ. No.: 15, ii) an amino acid sequence that is at least 50%, more preferably at least 80%, even more preferably at least 90%, identical to the ID. OF SEQ. No.: 15, or iii) a biologically active fragment of i) or ii). Preferably, the bifunctional A5 / A6 desaturase is naturally produced by a freshwater fish species. Preferably, the bifunctional A5 / A6 elongase comprises: i) an amino acid sequence as given in the ID. OF SEQ. No.: 2 or ID. OF SEQ. No.: 14, ii) an amino acid sequence that is at least 50%, more preferably at least 80%, even more preferably at least 90%, identical to the ID. OF SEQ. No. : 2 OR ID. OF SEQ. No.: 14, or iii) a biologically active fragment of i) or ii). In another embodiment, at least one of the enzymes is an A5-desaturase. In a further embodiment, at least one of the enzymes is an A8-desaturase. In another embodiment, the LC-PUFA is docosahexaenoic acid (DHA). Preferably, you) polynucleotide(s) introduced encodes three or four enzymes, each of which is a bifunctional A5 / A6 desaturase, A5 desaturase, A6 desaturase, bifunctional A5 / A6 elongase, A5 elongase, A6 elongase or A4 desaturase. More preferably, the enzymes are as many as the following combinations: i) a bifunctional A5 / A6 desaturase, a bifunctional A5 / A6 elongase and an A4 desaturase, ii) a bifunctional A5 / A6 desaturase, an A5 elongase, an A6 elongase and an A4 desaturase, or iii) an A5-desaturase, an A6-desaturase, a bifunctional A5 / A6-elongase and an A4-desaturase. In another embodiment, the LC-PUFA is DHA and the introduced polynucleotide(s) encode five enzymes, wherein the enzymes are as many as the following combinations: i) an A4 desaturase, an A5 desaturase, an A6 desaturase, an A5 elongase and an A6 elongase, or ii) an A4 desaturase, an A5 desaturase, an A8 desaturase, an A5 elongase and an A9-elongase. In a further embodiment, the cell is of a organism suitable for fermentation, and the enzymes are at least one bifunctional A5 / A6 desaturase, one A5 elongase, an A6-elongase and an A4-desaturase. In another embodiment, the LC-PUFA is docosapentaenoic acid (DPA). Preferably, the introduced polynucleotide(s) encode two or three enzymes, each of which is a bifunctional A5 / A6 desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6 elongase, A5-? elongase, or A6-elongase. Most preferably, the enzymes are as many as the following combinations: i) a bifunctional A5 / A6 desaturase and a bifunctional A5 / A6 elongase, ii) a bifunctional A5 / A6 desaturase, an A5-elongase and an A6-elongase, or iii) an A5-desaturase, an A6-desaturase and a bifunctional A5 / A6-elongase. In a further embodiment, the LC-PUFA is DPA and the introduced polynucleotide(s) encode four enzymes, wherein the enzymes are as many as the following combinations: i) one A5-desaturase, one A6-desaturase, one A5- elongase and an A6-elongase, or ii) one A5-desaturase, one A8-desaturase, one A5- elongase and A9-elongase. In another embodiment, the cell is from an organism suitable for fermentation, and the enzymes are at least a bifunctional A5 / A6 desaturase, an A5-elongase and the A6-elongase. In a further embodiment, the LC-PUFA is eicosapentaenoic acid (EPA). Preferably, the polynucleotide(s) introduced(s) encode a bifunctional A5 / A6 desaturase and a bifunctional A5 / A6 elongase. In another embodiment, the polynucleotide(s) introduced encodes three enzymes, where the enzymes are as many as the following combinations: i) one A5-desaturase, one A6-desaturase and one A6-elongase, or i i) one A5-desaturase, one A8-desaturase and one A9- elongase. Evidence to date suggests that desaturases expressed in at least some recombinant cells, particularly yeast, have relatively low activity. However, the present inventors have identified that this may be a function of the ability of the desaturase to use acyl-CoA as a substrate in LC-PUFA synthesis. In this regard, it has also been determined that desaturases of vertebrate origin are particularly useful for the production of LC-PUFA in recombinant cells, for example plant, seed or yeast cells. Thus, in another preferred embodiment, the recombinant cell comprises: i) at least one A5-elongase that catalyzes the conversion of EPA to DPA in the cell, ii) at least one desaturase that is capable of acting on an acyl-CoA substrate, (iii) at least one desaturase from a vertebrate, or a desaturase variant thereof, or iv) any combination of i), ii) or iii). In a particular embodiment, the A5-elongase comprises: i) an amino acid sequence as given in the ID. OF SEQ. No.: 2, ii) an amino acid sequence that is at least 50% identical to the ID. OF SEQ. No.: 2, or iii) a biologically active fragment of i) or ii). The desaturase capable of acting on an acyl-CoA or vertebrate substrate may be an A5-desaturase, an A6-desaturase, or both. In a particular embodiment, the desaturase comprises: i) an amino acid sequence as given in the ID. OF SEQ. No.: 16, ID. OF SEQ. No.: 21 OR ID. OF SEQ. No.: 22, ii) an amino acid sequence that is at least 50% identical to the ID. OF SEQ. No.: 16, ID. OF SEQ. No.: 21 or ID. OF SEQ. No.: 22, or iii) a biologically active fragment of i) or ii). Preferably, at least one desaturase is naturally produced by a vertebrate. Alternatively, when the cell is a yeast cell, the LC-PUFA is DHA, and the enzymes are at least a bifunctional A5 / A6 desaturase, an A5-elongase, an A6-elongase and an A4-desaturase. In a further alternative, when the cell is a yeast cell, the LC-PUFA is DPA and the enzymes are at least a bifunctional A5 / A6 desaturase, an A5-elongase and the A6-elongase. While the cell may be any cell type, preferably, said cell is capable of producing said LC-PUFA from endogenously produced linoleic acid (LA), α-linolenic acid (ALA), or both. More preferably, the ratio of endogenously produced ALA to LA is at least 1:1 or at least 2:1. In one embodiment, the cell is a plant cell, a plant cell of an angiosperm, an oilseed plant cell, or a cell in a seed. Preferably, at least one promoter is a seed-specific promoter. In another embodiment, the cell is from a unicellular microorganism. Preferably, the unicellular microorganism is suitable for fermentation. Preferably, the microorganism is a yeast. In a further embodiment, the cell is a non-human animal cell or an in vitro human cell. In a further embodiment, the recombinant cell produces an LC-PUFA which is incorporated into triacylglycerols in said cell. More preferably, at least 50% of the LC-PUFA that is produced in said cell is incorporated in triacylglycerols. In another embodiment, at least the protein coding region of one, two or more of the polynucleotides is obtained from an algal gene. Preferably, the algal gene is from the genus Pavlova, for example from the species Pavlova salina. In another aspect, the present invention provides a recombinant cell capable of producing DHA from a fatty acid that is ALA, LA, GLA, ARA, SDA, ETA, EPA, or any combination or mixture thereof, wherein said recombinant cell it is derived from a cell that is not capable of synthesizing DHA. In a further aspect, the present invention provides a recombinant cell capable of producing DPA from a fatty acid that is ALA, LA, GLA, ARA, SDA, ETA, EPA, or any combination or mixture thereof, wherein said cell recombinant is derived from a cell that is not capable of synthesizing DPA. In yet a further aspect, the present invention provides a recombinant cell capable of producing EPA from a fatty acid that is ALA, LA, GLA, SDA, ETA or any combination or mixture thereof, wherein said recombinant cell is derived from a cell that is unable to synthesize EPA. In another aspect, the present invention provides a recombinant cell capable of producing both ETrA from ALA and ETA from SDA, and EPA from a fatty acid that is ALA, LA, GLA, SDA, ETA, or any combination or mixture thereof, wherein said recombinant cell is derived from a cell which is not capable of synthesizing ETrA, ETA, or both. In a further aspect, the present invention provides a recombinant cell of an organism useful in fermentation processes, wherein the cell is capable of producing DPA from LA, ALA, arachidonic acid (ARA), eicosatetraenoic acid (ETA), or any combination or mixture thereof, wherein said recombinant cell is derived from a cell which is not capable of synthesizing DPA. In another aspect, the present invention provides a recombinant plant cell capable of producing DPA from LA, ALA, EPA, or any combination or mixture thereof, wherein the plant cell is from an angiosperm. In one embodiment, the plant cell is also capable of producing DHA. In yet another aspect, the present invention provides a recombinant cell that is capable of synthesizing DGLA, comprising a polynucleotide(s) encoding one or both of: a) a polypeptide which is an A9 elongase, wherein the A9 elongase is selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in the ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 OR ID. OF SEQ. No.: 86, ii) a polypeptide comprising a sequence of amino acids that is at least 40% identical to ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 or ID. OF SEQ. No.: 86, and iii) a biologically active fragment of i) b) a polypeptide that is an A8-desaturase, or in which the A8-desaturase is selected from the group consisting of: a polypeptide that understands one sequence of amino acids as provided in ID. OF SEQ. 1, a polypeptide that understands one sequence of amino acids which is at least 40% identical to ID. OF SEQ. No.: 1, and iii) a biologically active fragment in in which the polynucleotide(s) it's on operationally to a direct expression or more promoters who are able to of said polynucleotide(s) in the cell, and wherein said recombinant cell is derived from a cell that is not capable of synthesizing DGLA. In one embodiment, the cell is capable of converting DGLA in ARA. In another embodiment, the cell further comprises a polynucleotide encoding an A5-desaturase, wherein the polynucleotide encoding the A5-desaturase is operably linked to one or more promoters that are capable of directing expression of said polynucleotide in the cell, and in that a cell is capable of producing ARA. In one particular embodiment, the cell is devoid of α>3-desaturase activity and is not capable of producing ALA. Such cells can be naturally occurring, or produced by reducing the co3-desaturase activity of the cell using methodologies well known in the art. Preferably, the cell is a plant cell or a cell from an organism suitable for fermentation. In a further embodiment, a recombinant cell of the invention also has the necessary enzyme to carry out the "Sprecher" pathway of converting EPA to DHA. These enzymes can be native to the cell or produced recombinantly. Such enzymes include at least one A7-elongase, A6-desaturase and enzymes necessary for the peroxisome O-oxidation of tetracosahexaenoic acid to produce DHA. The present inventors have also identified a group of new desaturases and elongases. As a result, additional aspects of the invention relate to these enzymes, as well as homologues / variants / derivatives thereof. The polypeptide can be a fusion protein that further comprises at least one other polypeptide sequence. The at least one other polypeptide can be a polypeptide that enhances the stability of a polypeptide of the present invention, or a polypeptide that aids in purification of the fusion protein. Also provided are isolated polynucleotides which, inter alia, encode polypeptides of the invention. In a further aspect, the present invention provides a vector comprising or encoding a polynucleotide according to the invention. Preferably, the polynucleotide is operably linked to a seed-specific promoter. In another aspect, the present invention provides a recombinant cell comprising a polynucleotide isolated according to the invention. In a further aspect, the present invention provides a method of producing a cell capable of synthesizing one or more LC-PUFAs, the method comprising introducing into the cell one or more polynucleotides encoding at least two enzymes, each of which is a bifunctional A5 / A6 desaturase, A5 desaturase, A6 desaturase, bifunctional A5 / A6 elongase, A5 elongase, A6 elongase, A4 desaturase, A9 elongase or A8 desaturase, and wherein one or more polynucleotides are operatively linked to one or more promoters which are capable of directing the expression of said polynucleotides in the cell. In another aspect, the present invention provides a method of producing a recombinant cell with an increased ability to synthesize one or more LC-PUFAs, the method comprising introducing into a first cell one or more polynucleotides encoding at least two enzymes, each being a bifunctional A5 / A6-desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A5-elongase, A6-elongase, A4-desaturase, A9-elongase or A8-desaturase, wherein one one or more polynucleotides are operably linked to one or more promoters which are capable of directing expression of said polynucleotides in the recombinant cell, and wherein said recombinant cell has an increased ability to synthesize said one or more LC-PUFAs relative to said first cell. Of course, it will be appreciated that each of the embodiments described herein in relation to the recombinant cells of the invention will equally apply to the methods for producing said cells. In a further aspect, the present invention provides a cell produced by a method of the invention. In another aspect, the present invention provides a transgenic plant comprising at least one recombinant cell according to the invention. Preferably, the plant is an angiosperm. More preferably, the plant is an oilseed plant. In a further embodiment, the transgenic plant, or part thereof, including a transgenic seed, does not comprise a transgene encoding an enzyme that preferentially converts a w6 LC-PUFA to a to3 LC-PUFA. In yet a further embodiment, the transgenic plant, or part thereof, including a transgenic seed, comprises a transgene encoding an A8 desaturase and / or an A9 elongase. In a further aspect, the present invention provides a method of producing an oilseed, the method comprising: i) growing a transgenic oilseed plant according to the invention under suitable conditions, and ii) harvesting the seed from the plant. In a further aspect, the invention provides a part of the transgenic plant of the invention, said part comprising an increased level of LC-PUFA in its fatty acid relative to the corresponding part of a non-transformed isogenic plant. Preferably, said plant part is selected without limitation from the group consisting of: a seed, leaf, stem, flower, pollen, root, or specialized storage organ (such as a tuber). Previously, it has not been shown that LC-PUFA can be produced in plant seeds, nor that such LC-PUFA can be incorporated into plant oils such as, for example, triacylglycerol. Accordingly, in another aspect, the present invention provides a transgenic seed comprising an LC-PUFA. Preferably, the LC-PUFA is selected from the group consisting of: i) EPA, ii) DPA, iii) DHA, iv) EPA and DPA, and v) EPA, DHA and DPA. More preferably, the LC-PUFA is selected from the group that consists of: i) DPA, ii) DHA, or iii) DHA and DPA. Even more preferably, the LC-PUFA is EPA, DHA and DPA. Preferably, the seed is derived from a seed isogenic non-transgenic that produces LA and / or ALA. Most preferably, the non-transgenic inbred seed comprises a higher concentration of ALA than LA in its fatty acids. Even more preferably, the non-transgenic isogenic seed comprises at least about 13% ALA or at least about 27% ALA or at least about 50% ALA in its fatty acid. Preferably, the total fatty acid in the seed oil comprises at least 9% of C fatty acids 2 O • Preferably, the seed is derived from an oilseed plant. More preferably, the oilseed plant is oilseed rapeseed (Brassica napus), maize (Zea mays), sunflower (Melianthus annuus), soybean (Glycine max), sorghum (Sorghum bicolor), flax (Linum usitatissimum), sugar ( Saccharum officinarum), beetroot (Beta vulgaris), cottonseed (Gossypium hirsutum), peanut (Arachis hypogaea), poppy (Papaver somniferum), cornflower (Sinapis alba), castor bean (Ricinus communis), sesame (Sesamum indicum) or saffron (Carthamus tinctorius) ). It is preferred that the seed have a germination rate that is substantially the same as that of the non-transgenic isogenic seed. It is further preferred that the timing of seed germination is substantially the same as that of non-transgenic isogenic seed. Preferably, at least 25% or at least 50% or at least 75% of the LC-PUFA in the seed forms part of triacylglycerols. Surprisingly, the present inventors have found that transgenic seeds produced using the methods of the invention have levels of ALA and LA that are substantially the same as those of a non-transgenic isogenic seed. As a result, it is preferred that the transgenic seed have levels of ALA and LA that are substantially the same as those of a non-transgenic isogenic seed. Furthermore, it was surprising note that levels of monounsaturated fatty acids were decreased in transgenic seeds produced using the methods of the invention. Hence, in an additional preferred embodiment, the transgenic seed has decreased levels of monounsaturated fatty acids when compared to a non-transgenic isogenic seed. In another aspect, the present invention provides a method of producing a transgenic seed according to the invention, the method comprising: i) the introduction into a progenitor cell of a seed of one or more polynucleotides encoding at least two enzymes, each of which is a bifunctional A5 / A6-desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A5-elongase, A6-elongase, A4-desaturase, A9-elongase or A8-desaturase, wherein one or more polynucleotides are operably linked to one or more promoters which are capable of directing the expression of said polynucleotides in the cell thereby producing , a recombinant progenitor cell, ii) growing said recombinant progenitor cell to produce a plant comprising said transgenic seed, and iii) recovering the seed of the plant so produced. In yet a further aspect, the present invention provides a method of producing a transgenic seed comprising growing a transgenic plant that produces the transgenic seed of the invention, and harvesting said transgenic seed from the plant. In a further aspect, the invention provides an extract of the transgenic plant of the invention, or a part of the plant of the invention, or a seed of the invention, wherein said extract comprises an increased level of LC-PUFA in its fatty acid relative to a corresponding extract of an isogenic non-transformed plant. Preferably, the extract is substantially purified oil comprising at least 50% triacylglycerols. In a further aspect, the present invention provides a non-human transgenic animal comprising at least one recombinant cell according to the invention. Also provided is a method of producing an LC-PUFA, the method comprising growing, under suitable conditions, a recombinant cell according to the invention. In one embodiment, the cell is from an organism suitable for fermentation and the method further comprises exposing the cell to at least one LC-PUFA precursor. Preferably, the LC-PUFA precursor is at least one of linoleic acid or oc-linolenic acid. In a particular embodiment, the LC-PUFA precursor is provided in a vegetable oil. In another embodiment, the cell is an algal cell and the method further comprises growing the algal cell under conditions suitable for the production of said LC-PUFA. In a further aspect, the present invention provides a method of producing one or more LC-PUFAs, the method comprising growing, under suitable conditions, a transgenic plant of the invention. In another aspect, the present invention provides a method of producing oil comprising at least one LC-PUFA, comprising obtaining the transgenic plant of the invention, or part of the plant of the invention, or the seed of the invention, and extracting oil from said plant, part or seed of the invention plant. Preferably, said oil is extracted from the seed by crushing said seed. In another aspect, the present invention provides a method of producing DPA from EPA, the method comprising exposing EPA to a polypeptide of the invention and a fatty acid precursor, under suitable conditions. In one embodiment, the method takes place in a cell utilizing the polyketide-lyceus system to produce EPA. In yet another aspect, the present invention provides a fermentation process comprising the steps of: i) providing a vial containing a liquid composition comprising a cell of the invention and constituents necessary for fermentation and fatty acid biosynthesis; and ii) providing conditions conducive to fermentation of the liquid composition contained in said vial. Preferably, a necessary constituent for fermentation and fatty acid biosynthesis is LA. Preferably, the cell is a yeast cell. In another aspect, the present invention provides a composition comprising a cell of the invention, or an extract or portion thereof, comprising LC-PUFA, and a suitable vehicle. In another aspect, the present invention provides a composition comprising the transgenic plant of the invention, or the plant part of the invention, or the seed of the invention, or an extract or a portion thereof, comprising LC-PUFA, and a suitable vehicle. In yet another aspect, the present invention provides a feed comprising a cell of the invention, a plant of the invention, the plant part of the invention, the seed of the invention, an extract of the invention, the product of the method of the invention, the product of the fermentation process of the invention, or a composition of the invention. Preferably, the feed comprises at least DPA, wherein at least one enzymatic reaction in the production of DPA has been carried out by a recombinant enzyme in a cell. Furthermore, it is preferred that the feed comprises at least DHA, wherein at least one enzymatic reaction in the DHA production has been carried out by a recombinant enzyme in a cell. In a further aspect, the present invention provides a method of preparing a feed, the method comprising mixing a cell of the invention, a plant of the invention, the plant part of the invention, the seed of the invention, an extract of the invention, the product of the method of the invention, the product of the fermentation process of the invention, or a composition of the invention, with a suitable vehicle. Preferably, the feed is for consumption by a mammal or a fish. In a further aspect, the present invention provides a method of increasing levels of an LC-PUFA in an organism, the method comprising administering to the organism a cell of the invention, a plant of the invention, the plant part of the invention, the seed of the invention, an extract of the invention, the product of the method of the invention, the product of the process fermentation of the invention, or a composition of the invention, or a feed of the invention. Preferably, the route of administration is oral. Preferably, the organism is a vertebrate. More preferably, the vertebrate is a human, fish, pet or farm animal. In a further aspect, the present invention provides a method of treating or preventing a condition that would benefit from an LC-PUFA, the method comprising administering to a subject a cell of the invention, a plant of the invention, part of plant of the invention, the seed of the invention, an extract of the invention, the product of the method of the invention, the product of the fermentation process of the invention or a composition of the invention, or a feed of the invention. Preferably the condition is an arrhythmia, angioplasty, inflammation, asthma, psoriasis, osteoporosis, kidney stones, AIDS, multiple sclerosis, rheumatoid arthritis, Crohn's disease, schizophrenia, cancer, fetal alcohol syndrome, attention deficit hyperactivity disorder, fibrosis cystic, phenylketonuria, unipolar depression, aggressive hostility, adrenoleukodystrophy, coronary heart disease, hypertension, diabetes, obesity, Alzheimer's disease, chronic obstructive pulmonary disease, ulcerative colitis, re- stenosis after angioplasty, eczema, high blood pressure, platelet aggregation, gastrointestinal bleeding, endometriosis, premenstrual syndrome, myalgic encephalomyelitis, chronic fatigue after viral infections or eye disease. While administering any amount of LC-PUFA to the subject is beneficial to the subject, it is preferred that an amount effective to treat the condition be administered. In another aspect, the present invention allows the use of a cell of the invention, a plant of the invention, a plant part of the invention, a seed of the invention, an extract of the invention, a product of the method of the invention, a product of the fermentation process of the invention or a composition of the invention, or a feed of the invention, for the manufacture of a medicament for treating or preventing a condition that would benefit from an LC-PUFA. A6-elongase from Caenorhabditis elegans has been previously expressed in yeast and has been shown to convert octadecatetraenoic acid to eicosatetraenoic acid. However, the present inventors have surprisingly found that this enzyme also has A5-elongase activity, being able to convert eicosapentaenoic acid into docosapentaenoic acid. In a further aspect, the present invention provides a method of producing an unbranched LC-PUFA comprising 22 carbon atoms, the method comprising incubating an unbranched LC-PUFA having 20 carbon atoms with a polypeptide selected from the group that consists of: i) a polypeptide comprising an amino acid sequence as provided in the ID. OF SEQ. No.: 2 or ID. OF SEQ. No.: 14, ii) a polypeptide comprising an amino acid sequence that is at least 50% identical to the ID. OF SEQ. No.: 2 or ID. OF SEQ. No: 14, and iü) a biologically active fragment of i) or ii), wherein the polypeptide also has A6-elongase activity. Preferably, the unbranched LC-PUFA comprising 22 carbon atoms is DPA, and the unbranched LC-PUFA having 20 carbon atoms is EPA, Preferably, the method is carried out within a recombinant cell that produces the polypeptide and EPA. In yet a further aspect, the present invention provides a substantially purified antibody, or fragment thereof, which specifically binds to a polypeptide of the invention. In another aspect, the present invention provides a method of identifying a recombinant cell, tissue or organism capable of synthesizing one or more LC-PUFAs, the method comprising detecting the presence in said cell, tissue or organism of one or more polynucleotides that encode at least two enzymes, each of which is a bifunctional A5 / A6-desaturase , or A8-desaturase, and wherein one or more polynucleotides are operably linked to one or more promoters which are capable of directing the expression of said polynucleotides in the cell, tissue or organism. Preferably, the method comprises a nucleic acid amplification step, a nucleic acid hybridization step, a step of detecting the presence of a transgene in the cell, tissue or organism, or a step of determining the fatty acid content or composition of the cell, tissue or organism. Preferably, the organism is an animal, plant, angiosperm plant or microorganism. In another aspect, the present invention provides a method of producing DPA from EPA, the method comprising exposing EPA to an A5-elongase of the invention and a fatty acid precursor, under suitable conditions. Preferably, the method takes place in a cell that uses the polyketide-like system to produce EPA. Naturally, recombinant (transgenic) cells, plants, non-human animals comprising a novel polynucleotide provided herein, may also produce other elongase and / or desaturases, such as those defined herein. As will be apparent, preferred features and characteristics of one aspect of the invention are applicable to many other aspects of the invention. Throughout this specification, the word "comprises", or variations such as "comprising" or "comprising", shall be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. The invention will hereinafter be described by way of the following non-limiting Examples and with reference to the accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS ATTACHED Figure 1. Possible synthesis pathways for LC-PUFA©3 and co6. Sectors labeled I, II, III and IV correspond to pathways 0)6 (A6), 0)3 (A6), 0)6 (A8) and 0)3 (A) , respectively. Compounds in sectors I and III are 0)6 compounds, while those in sectors II and IV are 0)3 compounds. "Des" refers to the desaturase steps in the pathway catalyzed by desaturases, as indicated, while "Elo" refers to the elongase steps catalyzed by elongases, as indicated. The thick arrow indicates the A5-elongase step. Dashed arrows indicate steps in the "Sprecher" pathway that operates in mammalian cells to produce DHA from DPA. Figure 2. Distribution of LC-PUFA in microalgae classes. Chlorophyceae and Prasinophyceae are described as "green algae", Eustigmatophyceae as "yellow-green algae", Rhodophyceae as "red algae", and Bacillariophyceae and Prymnesiophyceae as diatoms and golden brown algae. Figure 3. Genetic construct for expression of LC-PUFA biosynthetic genes in plant cells. Figure 4. PILEUP of desaturase enzymes. d8-atg - A8-desaturase from Pavlova salina-, euglena - AAD45877 (A8-desaturase, Euglena gracilis); rhizopus - AAP83964 (A6-desaturase, Rhizopus sp. NK030037); mucor - BAB69055 (A6-desaturase, Mucor circinelloid.es); mortierella - AAL73948 (A6-desaturase, Mortierella isabellina); malpina - BAA85588 (A6-desaturase, Mortierella alpina); physcomitrella CAA11032 (A6-acyl lipid desaturase, Physcomitrella patens); ceratadon - CAB94992 (A6-fatty acid acetylenase, Ceratodon purpureus). Figure 5. Southern blot of PCR products, hybridized to Elol or Elo2 probes. Figure 6. PILEUP of elongase enzymes. Figure 7. Transgene constructs used to express genes encoding LC-PUFA biosynthetic enzymes in Arabidopsis. The "EPA construct" pSSP-5 / 6D.6E (also called pZebdesatCeloPWvec8 in Example 5) (Figure 7A) contained the dual function zebrafish A5 / A6-desaturase (D5 / D6Des) and the nematode (D6Elo), both driven by the truncated napin (Fpl) promoter, and the hygromycin resistance selectable marker gene (hph) driven by the CaMV-35S (35SP) promoter. The pXZP355 "DHA construct" (Figure 7B) comprised the Pavlova salina A4-desaturase (D4Des) and A5-elongase (DSElo) genes, both driven by the truncated napin (Fpl) promoter, and the resistance selectable marker gene kanamycin (nptll) driven by the nopaline synthase (NosP) promoter. All genes were flanked at the 3rd end 1 by the nopaline synthase terminator (NosT). Figure 8. A. A gas chromatogram (GLC) showing the fatty acid profile for Arabidopsis thaliana line D011 that carries the EPA and DHA gene constructs. B. Mass spectra for EPA and DHA obtained from Arabidopsis thaliana line D011. Figure 9. Auto-radiograms of dot-blot hybridizations performed under low-control or highly-controlled conditions, as described in Example 12, for DNA from various microalgae species indicated at the top, using radiolabeled probes consisting of coding regions from the P. salina LC-PUFA gene, as indicated at right . Figure 10. Amino acid sequence alignment of A6- and A8-desaturases from higher plants. The amino acid sequences of A6-desaturases from E. plantagineum (EplDGDes) (SEQ ID NO: 64), E. gentianoides (EgeD6Des, accession number AY055117) (SEQ ID NO: 65), AND. pitardii (EpiD6Des, AY055118) (SEQ ID. NO: 66), Borago Officinalis (BofD6Des, U79010) (SEQ ID. NO: 67) and A8-desaturases from B. officinalis (BofD8Des, AF133728) ( SEQ ID NO: 68), Helianthus annus (HanD8Des, 568358) (SEQ ID NO: 69), and Arabidopsis thaliana (AtD8DesA, AAC62885.1; and AtD8DesB, CAB71088.1) (ID. SEQ ID NO: 70 and SEQ ID NO: 71, respectively) were aligned by PILEUP (GCG, Wisconsin, USA). HBI, HBII and HBIII are three conserved histidine boxes. F1 and RI are the corresponding regions for the degenerate primers EpD6Des-Fl and EpD6Des-Rl used to amplify the cDNA. The N-terminal cytochrome domain b5 with conserved HPGG motif is also indicated. Figure 11. Isolated EplD6Des variant enzymes and representative enzyme activities. EplD6Des with cytochrome b5, histidine boxes I, II, and III are shown as b5, HBI, HBII, HBIII, respectively. Isolated variants are shown in panel A in the format: wild-type amino acid - position number -variant amino acid. Empty diamonds indicate mutants with significant reduction in enzymatic activity, while solid diamonds indicate variants with no significant effect on enzymatic activity. Panel B shows the comparison of GLA and SDA production in transgenic tobacco leaves of two variants with that of the wild-type enzyme. Figure 12. Alternative pathways for the synthesis of LC-PUFA (03 SDA (18:4), EPA (20:5) and DHA (22:6) from ALA (18:3). Desaturases, elongases and acyltransferases are shown as solid, open, and dashed arrows, respectively. Chain elongation occurs only on acyl-CoA substrates, while desaturation can occur on acyl-PC (A and B) or acyl-CoA [C] substrates. acyl-PC or acyl-CoA substrate of the final A4-desaturase step has yet to be determined. The pathways involving acyl-PC desaturases require acyltransferase-mediated shuffling of acyl groups between PC and CoA substrates. Panels A and B show the "A6 pathway" and "A8 pathway" variants of the acyl-PC desaturase pathway, respectively. Panel C shows the pathway expressed in the current study in which acyl-CoA A6- and A5-desaturase activities were encoded by the zebrafish A6 / A5 dual function desaturase Synthesis of co6 LC-PUFA such as ARA (20:4) occurs by the same c set of reactions, but starting with LA (18:2) as the starting substrate. Figure 13. Growth rates of Synechococcus 7002 at 22°C, 25°C, 30°C. Figure 14. Linoleic and linolenic acid levels of Synechococcus 7002 at various growth temperatures. IMPORTANT DATA FOR SEQUENCE LISTING ID. OF SEQ. No. : 1 - A8-desaturase from Pavlova salina ID. OF SEQ. No. : 2 - A5-elongase from Pavlova salina. ID. OF SEQ. No.: 3 - A9-elongase from Pavlova salina. ID. OF SEQ. No. : 4 - A4-desaturase from Pavlova salina ID. OF SEQ. No.: 5 - cDNA encoding the open reading frame of A8-desaturase from Pavlova salina. ID. OF SEQ. No.: 6 - full-length CDNA encoding saline Pavlovs A8-desaturase. ID. OF SEQ. No: 7 - CDNA encoding the open reading frame of A5-elongase from Pavlova salina. ID. OF SEQ. No.: 8 - full-length cDNA encoding A5-elongase from Pavlova salina. ID. OF SEQ. No: 9 - CDNA encoding the reading frame. of A9-elongase from Pavlova salina. ID. OF SEQ. No.: 10 - full-length cDNA that encodes A9-elongase from Pavlova salina. ID. OF SEQ. No: 11 - partial cDNA encoding portion of the N-terminus of A4-desaturase from Pavlova salina. ID. OF SEQ. No.: 12 - cDNA encoding the open reading frame of A4-desaturase from Pavlova salina. ID. OF SEQ. No.: 13 - full-length cDNA encoding Pavlova salina A4-desaturase. ID. OF SEQ. No. : 14 - Bifunctional A5 / A6 elongase from Caenorhabditis elegans. ID. OF SEQ. No. : 15 - Bifunctional A5 / A6-desaturase from Danio rerio (zebrafish). ID. OF SEQ. No: 16 - human α5-desaturase (Genbank Accession No.: AAF29378). irregulare (Genbank Accession No.: AAL13311). ID. OF SEQ. No.: 18 - A5-desaturase from Thraustochytriurn sp. (Genbank Accession No.: AAM09687). ID. OF SEQ. No.: 19 - Mortierella alpina α5-desaturase (Genbank Accession No.: 074212). ID. OF SEQ. No: 20 - A5-desaturase from Caenorhabd.itis elegans (Genbank Accession No.: T43319). ID. OF SEQ. No: 21 - human A6-desaturase (Genbank Accession No.: AAD20018). ID. OF SEQ. No: 22 - Mouse A6-desaturase (Genbank Accession No.: NP_062673). ID. OF SEQ. No: 23 A6-desaturase from Pythium irregulare (Genbank Accession No.: AAL13310). ID. OF SEQ. No. : 24 A6-desaturase from Borago officinalis (Genbank Accession No.: AAD01410) • ID. OF SEQ. No. : 25 Anemone A6-desaturase leveillei (Genbank Accession No.: AAQ10731). ID. OF SEQ. No.: 26 - Ceratodon A6-desaturase purpureus (Genbank Accession No.: CAB94993). ID. OF SEQ. No: 27 - A6-desaturase from Physcomitrella patens (Genbank Accession No.: CAA11033). ID. OF SEQ. No.: 28 - Mortierella A6-desaturase alpina (Genbank Accession No.: BAC82361). ID. OF SEQ. No: 29 - A6-desaturase from Caenorhabditis elegans (Genbank Accession No.: AAC15586). ID. OF SEQ. No: 30 - human α5-elongase (Genbank Accession No.: NP_068586). ID. OF SEQ. No: 31 - A6-elongase from Physcomitrella patens (Genbank Accession No.: AAL84174). ID. OF SEQ. No.: 32 - A6-elongase from Mortierella alpina (Genbank Accession No.: AAF70417). ID. OF SEQ. No.: 33 - A4-desaturase from Thraustochytrium sp. (Genbank Accession No.: AAM09688). ID. OF SEQ. No.: 34 - A4-desaturase from Euglena gracilis (Genbank Accession No.: AAQ19605). ID. OF SEQ. No.: 35 - A9-elongase from Isochrysis galbana (Genbank Accession No.: AAL37626). ID. OF SEQ. No.: 36 - Euglena gracilis α8-desaturase (Genbank Accession No.: AAD45877). ID. OF SEQ. No.: 37 - cDNA encoding bifunctional A5 / A6 elongase from Caenorhabditis elegans. ID. OF SEQ. No: 38 - cDNA encoding A5 / A6- Danio rerio (zebrafish) bifunctional desaturase. IDS. OF SEQ. No os : 39 to 42, 46, 47, 50, 51, 53, 54, 56, 57, 81, 82, 83, 84 and 87 - Oligonucleotide primers. IDS. OF SEQ. No OS :43 to 45, 48, 49 and 52 - Reasons conserved from various desaturases / elongases. ID. OF SEQ. N°: 55 - Partial CDNA encoding FAE-like elongase from Pavlova salina. ID. OF SEQ. No.: 58 - full-length cDNA encoding Pavlova salina A5-desaturase. ID. OF SEQ. No: 59 - CDNA that encodes the frame of open reading of A5-desaturase from Pavlova salina. ID. OF SEQ. No.: 60 - A5-desaturase from Pavlova salina. IDS. OF SEQ. Nos 61 and 62 - Fragments of A6-desaturase from Echium pitardii. ID. OF SEQ. No: 63 - cDNA encoding the open reading frame of A6-desaturase from Echium plantagineum. ID. OF SEQ. No. : 64 - Echium A6-desaturase plantaginum. ID. OF SEQ. No. : 65 - Echium A6-desaturase gentianoides (Genbank Accession No.: AY055117). ID. OF SEQ. No: 66 - Echium pitardii α6-desaturase (Genbank Accession No.: AY055118). ID. OF SEQ. No: 67 A6-desaturase from Borago officinalis (Genbank Accession No.: U79010). ID. OF SEQ. No: 68 Borago officinalis A8-desaturase (Genbank Accession No.: AF133728). ID. OF SEQ. No.: 69 - A8-desaturase from Helianthus annus (Genbank Accession No.: S68358). ID. OF SEQ. No: 70 - Arabidopsis thaliana A8-desaturase A (Genbank Accession No.: AAC62885.1). ID. OF SEQ. No: 71 - Arabidopsis thaliana A8-desaturase B (Genbank Accession No.: CAB71088.1). ID. OF SEQ. No.: 72 and 73 - Preserved motifs from A6- and A8-desaturases. ID. OF SEQ. No. : 74 - A6-elongase from Thraustochytriurn sp. (Genbank Accession No.: AX951565). ID. OF SEQ. No.: 75 - Danio rerio A9-elongase (Genbank Accession No.: NM_199532). ID. OF SEQ. No.: 76 - A9-elongase from Pavlova lutheri. ID. OF SEQ. No.: 77 - A5-elongase from Danio rerio (Genbank Accession No.: AF532782). ID. OF SEQ. No.: 78 - A5-elongase from Pavlova lutheri. ID. OF SEQ. No.: 7 9 - Partial gene sequence of Heterocapsa niei encoding an elongase. ID. OF SEQ. No.: 80 - Protein encoded by ID. OF SEQ. No.: 79; the presence of a stop codon suggests an intron in the ID. OF SEQ. No.: 79. ID. OF SEQ. No. : 85 - A9-elongase from Pavlova salina, encoded by a surrogate start codon at position 31 of the ID. OF SEQ. No.: 9. ID. OF SEQ. No: 86 - A9-elongase from Pavlova salina, encoded by a substitute start codon at position 85 of the ID. OF SEQ. No.: 9. ID. OF SEQ. No.: 88 - Sequence of amino acids from partial elongase from Melosira sp. ID. OF SEQ. No. : 89 - cDNA sequence encoding partial elongase from Melosira sp. DETAILED DESCRIPTION OF THE INVENTION General techniques and definitions Unless specifically defined otherwise, all technical and scientific terms used herein should be deemed to have the same meanings as are understood by those skilled in the art (e.g., cell culture, plant biology, molecular genetics, immunology , immunohistochemistry, protein chemistry, fatty acid synthesis and biochemistry). Unless otherwise indicated, the recombinant nucleic acid, recombinant protein, cell culture and immunological techniques used in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained in the literature in sources such as, J. Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons (1984), J. Sambrook et al., "Molecular Cloning: A Laboratory Manual", Cold spring harbor Laboratory Press (1989), T.A. Brown (editor), "Essential Molecular Biology: A Practical Approach", Volumes 1 and 2, IRL Press (1991), D. M. Glover and B.D. Hames (editors), "DNA Cloning: A Practical Approach", Volumes 1-4, IRL Press (1995 and 1996), and F. M. Ausubel et al, (editors), "Current Protocols in Molecular Biology", Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (editors) "Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory, (1988), and J.E. Coligan et al. (publishers) "Current Protocols in Immunology", John Wiley & Sons (including all updates to date), and are incorporated herein by reference. As used herein, the terms "long chain polyunsaturated fatty acid", "LC-PUFA" or "C polyunsaturated fatty acid" 2 o+" refer to a fatty acid comprising at least 20 carbon atoms in its carbon chain and at least three carbon-carbon double bonds. As used herein, the term "very long chain polyunsaturated fatty acid", "VLC- PUFA" or "C22+ polyunsaturated fatty acid" refers to a fatty acid that comprises at least 22 carbon atoms in its carbon chain and at least three carbon-carbon double bonds. Typically, the number of carbon atoms in the carbon chain of fatty acids refers to an unbranched carbon chain. If the carbon chain is branched, the number of carbon atoms will exclude those in side groups. In one embodiment, the long-chain polyunsaturated fatty acid is a co3 fatty acid, that is, having a desaturation (carbon-carbon double bond) at the third carbon-carbon bond from the methyl end of the fatty acid. In another embodiment, the long-chain polyunsaturated fatty acid is a ®6 fatty acid, or that is, having a desaturation (carbon-carbon double bond) at the sixth carbon-carbon bond from the methyl end of the fatty acid. In a further embodiment, the long chain polyunsaturated fatty acid is selected from the group consisting of: arachidonic acid (ARA, 20:4A5,8,11,14; co6), eicosatetraenoic acid (ETA, 20:4A8,11,14 ,17,co3) eicosapentaenoic acid (EPA, 20:5A5,8,11,14,17; co3), docosapentaenoic acid (DPA, 22:5A7,10,13,16,19, co3) or docosahexaenoic acid (DHA, 22:6A4,7,10,13,16,19,0)3). LC-PUFA can also be dihomo-γ-linoleic acid (DGLA) or eicosatrienoic acid (ETrA, 20:3A11,14,17,0)3). It is readily apparent that the LC-PUFA produced according to the invention can be a mixture of any or all of the above and can include other LC-PUFAs or derivatives of any such LC-PUFA. In a preferred embodiment, the O)3 fatty acid is EPA, DPA or DHA, or even more preferably DPA or DHA. Furthermore, as used herein, the terms "long chain polyunsaturated fatty acid" or "very long chain polyunsaturated fatty acid" refer to the fatty acid in a free (unesterified) state or in an esterified form, e.g. part of a triglyceride, diacylglyceride, monoacylglyceride, linked acyl-CoA or other linked form. The fatty acid can be esterified as a phospholipid, for example in the form of phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol. Thus, LC-PUFA can be present as a mixture of forms in the lipid of a cell or a purified oil or lipid extracted from a cell. cells, tissues or organisms. In preferred embodiments, the invention provides an oil comprising at least 75% or 85% triacylglycerols, with the remainder present as other lipid forms, such as those mentioned, with at least said triacylglycerols comprising the LC-PUFA. The oil can be further purified or treated, for example, by hydrolysis with a strong base to liberate the free fatty acid, or by fractionation, distillation, or the like. As used herein, the abbreviations "LC-PUFA" and "VLC-PUFA" may refer to a single type of fatty acid, or to multiple types of fatty acids. For example, a transgenic plant of the invention that produces LC-PUFA can produce EPA, DPA and DHA. The desaturase and elongase proteins and the genes encoding them that can be used in the invention are any of those known in the art, or homologues or derivatives thereof. Examples of such genes and the sizes of the encoded proteins are listed in Table 1. All desaturase enzymes known to participate in LC-PUFA biosynthesis belong to the group of so-called "front-end" desaturases, which are characterized by the presence of a domain from the cytochrome b 5 -like at the N-terminus of each protein. The cytochrome b domain 5 -like presumably acts as an electron acceptor necessary for desaturation (Napier et al., 1599; Sperling and Heinz, 2001). TABLE 1. Cloned genes involved in LC- biosynthesis PUFA. Enzyme Type of organism Species No. s de Accession Protein size (aa) References A4-desaturase Algae Euglena gracilis AY278558 541 Meyer et al., 2003 Pavlova lutherii AY332747 445 Tonon et al., 2003 Thraustochytrium sp. AF489589 519 Qiu et al., 2001 Thraustochytrium aureum AF391543-5 515 (NCBI) A5-desaturase Mammalian Homo sapiens AF199596 444 Cho et al., 1999b Leonard et al., 2000b Nematode Caenorhabditis Elegans AF11440, NM_0647 4693 Michaelson. 1998b; Watts and Browse, 1999b Fungi Mortierella alpina AF067654 446 Michaelson et al., 1998a; Knutzon et al., 1998 Pythium irregulare AF419297 456 Hong et al., 2002a Dictyostelium AB022097 467 Saito et al., Enzyme Type of organism Species No. Bde Accession Protein size (aa) References discoideum 2000 Saprolegnia 470 W002081668 diclin Diato- Phaeodactylum AY082392 469 Domergue et al., tricornutum cols., 2002 Algae Thraustochytrium AF489588 439 Qiu et al., sp. 2001 Thraustochytrium 439 W002081668 aureum Isochrysis 442 W002081668 galbana Musgo Marchantia AY583465 484 Kaj ikawa e polymorpha cols., 2004 A6- Mammals Homo sapiens NM—013402 444 Cho et al., desaturase 1999a; Leonard et al., 2000 Mus musculus NM_019699 444 Cho et al., 1999a Nematode Caenorhabditis Z70271 443 Napier et al., elegans 1998 Borago plants U79010 448 Sayanova et al. vialii AY234127 453 Sayanova et al., 2003 Enzyme Type of organism Species No. s de Accession Protein size (aa) References Anemone AF536525 446 Whitney e leveillei cols., 2003 Ceratodon mosses AJ250735 520 Sperling e purpureus cols., 2000 Marchantia AY583463 481 Kaj ikawa e polymorpha cols., 2004 Physcomitrei la Girke et al., patens 1998 Fungi Mortierella AF110510 457 Huang et al. , alpine AB020032 1999; Sakuradani et al., 1999 Pythium AF419296 459 Hong et al., irregulare 2002a Mucor AB052086 467 NCBI* circinelloides Rhizopus sp. AY320288 458 Zhang et al. , 2004 Saprolegnia 453 W002081668 DICLINA DIARO- PHAEODACTYL A AY082393 477 DOMERGUE AND MACEA TRICONUTUM COLS. Enzyme Type of organism Species No. s of Accession Protein size (aa) References Bifunctional desaturase cols., 2001 A8-desaturase C20 Algae Euglena gracilis AF139720 419 Wallis and Browse, 1999 Plants Borago officinales AF133728 A6- elongase Nematode Caenorhabditis elegans NM_069288 288 Musgos Beaudoin et al., 2000 Physcomitrella patens AF428243 290 Zank e cols., 2002 Marchant ia polymorpha AY583464 290 Kaj ikawa e cols., 2004 Fungos Mortierella alpina AF206662 318 Parker-Barnes e cols., 2000 Algas Pavlova lutheri** 501 WO 03078639 Thraustochytrium AX951565 271 WO 03093482 Thraustochytrium sp ** AX214454 271 WO 0159128 PUFA-elongase Mammals Homo sapiens AF231981 299 Leonard et al., 2000b; Leonard et al., 2002 1 Enzyme Type of organism Species No. s de Accession Protein size (aa) References Rattus AB071985 299 Inagaki e norvegicus cols., 2002 Rattus AB071986 267 Inagaki e norvegicus** cols., 2002 Mus musculus AF170907 279 Tvrdik et al. , 2000 Mus musculus AF170908 292 Tvrdik et al., 2000 Fish Danio rerio AF532782 291 Agaba et al., (282) 2004 Danio rerio** NM_199532 266 Lo et al. , 2003 Verme Ca enorhabditis Z68749 309 Abbott et al., elegans 1998 Beaudoin et al., 2000 Algae Thraustochytrium AX464802 272 WO 0208401-A2 aureum** Pavlova lutheri WO 03078639 •k ★ A9- Algae Isochrysis472 AF390i cols. , elongase galbana 2002 1 1 🇧🇷 http: / / www.ncbi.nlm.nih.gov / ** Function not proven / not demonstrated The activity of any of the elongases or desaturases for use in the invention can be tested by expressing a gene encoding the enzyme in a cell, such as a yeast cell or a plant cell, and determining whether the cell has an increased ability to produce LC-PUFA compared to a comparable cell in which the enzyme is not expressed. Unless otherwise stated, embodiments of the present invention which relate to cells, plants, seeds, etc., and methods for producing these, and which refer to at least "two enzymes" (or at least "three enzymes" etc) from the provided list, mean that the polynucleotides encode at least two "different" enzymes from the provided list, and not two identical open reading frames (or very similar, with only minor differences that do not substantially alter the activity of the encoded enzyme) that encode essentially the same enzyme. As used herein, unless otherwise stated, the term "substantially the same", or variations thereof, means that two samples being analyzed, for example, two seeds from different sources, are substantially the same if they vary only about + / -10% in the trait being investigated. As used herein, the term "an enzyme that preferentially converts a co6 LC-PUFA to a co3 LC-PUFA" means that the enzyme is more efficient in carrying out said conversion than in carrying out a desaturation reaction described in pathways II or III of Figure 1. Although certain enzymes are specifically described herein as "bifunctional", the absence of this term does not necessarily imply that a particular enzyme does not have another activity other than the one specifically defined. Desaturases As used herein, a "bifunctional A5 / A6 desaturase" or an "A5 / A6 desaturase" is capable of at least i) converting oc-linolenic acid to octadecatetraenoic acid, and ii) converting eicosatetraenoic acid to eicosapentaenoic acid. That is, a bifunctional A5 / A6-desaturase is both an A5-desaturase and an A6-desaturase, and bifunctional A5 / A6-desaturases can be considered a subclass of each of these. A gene encoding a bifunctional zebrafish A5- / A6-desaturase has been identified (Hasting et al., 2001). The gene encoding this enzyme perhaps represents an ancestral form of "front-end desaturase" that later duplicated and the copies developed into distinct functions of A5- and A6-desaturase. In one embodiment, the bifunctional A5 / A6 desaturase is naturally produced by a freshwater fish species. In one particular embodiment, the bifunctional A5 / A6 desaturase comprises: i) an amino acid sequence as given in the ID. OF SEQ. No.: 15, ii) an amino acid sequence that is at least 50% identical to the ID. OF SEQ. No.: 15, or iii) a biologically active fragment of i) or ii). As used herein, an "A5-desaturase" is at least capable of converting eicosatetraenoic acid to eicosapentaenoic acid. In one embodiment, the A5-desaturase enzyme catalyzes the desaturation of LC-PUFA C 2 o, converting DGLA into arachidonic acid (ARA, 20:4iO6) and ETA in EPA (20:5co3). The genes that encode this enzyme have been isolated from several organisms, including algae (Thraustochytrium sp. Qiu et al , 2001), fungi (M. alpine, Pythium irregulare, P. tricornutum, Dictyostelium), Caenorhabditis elegans and mammals (Table 1). In another embodiment, the A5-desaturase comprises: (i) an amino acid sequence as provided in the ID. OF SEQ. No.: 16, ID. OF SEQ. No.: 17, ID. OF SEQ. No.: 18, ID. OF SEQ. No.: 19, ID. OF SEQ. No.: 20 or ID. OF SEQ. No.: 60; (ii) an amino acid sequence that is at least 50% identical to any one of the ID. OF SEQ. No.: 16, ID. OF SEQ. No.: 17, ID. OF SEQ. No.: 18, ID. OF SEQ. No.: 19, ID. OF SEQ. No.: 20 or ID. OF SEQ. No.: 60, or (iii) a biologically active fragment of i) or ii). In a further embodiment, the A5-desaturase comprises: (i) an amino acid sequence as provided in the ID. OF SEQ. No.: 16, ID. OF SEQ. No.: 17, ID. OF SEQ. No.: 18, ID. OF SEQ. No.: 20 or ID. OF SEQ. No.: 60; (ii) an amino acid sequence that is at least 90% identical to any one of the ID. OF SEQ. No.: 16, ID. OF SEQ. No.: 17, ID. OF SEQ. No.: 18, ID. OF SEQ. No.: 20 or ID. OF SEQ. No.: 60, or (iii) a biologically active fragment of i) or ii) . In a further embodiment, the A5-desaturase is encoded by the protein coding region of one of the A5-desaturase genes listed in Table 1 or a gene substantially identical thereto. As used herein, an "A6-desaturase" is at least capable of converting a-linolenic acid to octadecatetraenoic acid. In one embodiment, the A6-desaturase enzyme catalyzes the desaturation of LC-PUFA C18, converting LA to GLA and ALA to SDA. In another modality, the A6-desaturase comprises: (i) an amino acid sequence as provided in the ID. OF SEQ. No.: 21, ID. OF SEQ. No.: 22, ID. OF SEQ. No.: 23, ID. OF SEQ. No.: 24, ID. OF SEQ. No.: 25, ID. OF SEQ. No.: 26, ID. OF SEQ. No.: 27, ID. OF SEQ. No.: 28, ID. OF SEQ. No.: 29, ID. OF SEQ. No.: 64 ID. OF SEQ. No.: 65, ID. OF SEQ. No. : 66 OR ID. OF SEQ. No.: 67; (ii) an amino acid sequence that is at least 50% identical to any one of the ID. OF SEQ. No.: 21, ID. OF SEQ. No.: 22, ID. OF SEQ. No.: 23, ID. OF SEQ. No.: 24, ID. OF SEQ. No.: 25, ID. OF SEQ. No.: 26, ID. OF SEQ. No.: 27, ID. OF SEQ. No.: 28, ID. OF SEQ. No.: 29, ID. OF SEQ. No.: 64 ID. OF SEQ. No.: 65, ID. OF SEQ. No.: 66 or ID. OF SEQ. No.: 67, or (iii) a biologically active fragment of i) or ii). In a further embodiment, the A6-desaturase comprises an amino acid sequence that is at least 90% identical to any one of the ID. OF SEQ. No.: 21, ID. OF SEQ. No.: 22, ID. OF SEQ. No.: 23, ID. OF SEQ. No.: 24, ID. OF SEQ. No.: 25, ID. OF SEQ. No.: 26, ID. OF SEQ. No.: 27, ID. OF SEQ. No.: 28, ID. OF SEQ. No.: 29, ID. OF SEQ. No.: 64 ID. OF SEQ. No.: 65, ID. OF SEQ. No.: 66 or ID. OF SEQ. No.: 67. In a further embodiment, the A6-desaturase is encoded by the protein coding region of one of the A6-desaturase genes listed in Table 1 or a gene substantially identical thereto. As used herein, an "A4-desaturase" is at least capable of converting docosapentaenoic acid to docosahexaenoic acid. The desaturation step to produce DHA from DPA is catalyzed by an A4-desaturase in organisms other than mammals, and a gene encoding this enzyme has been isolated from the water protist species sweet Euglena gracilis and the marine species Thraustochytrium sp. (Qiu et al., 2001; Meyer et al., 2003). In a In this embodiment, the A4-desaturase comprises: (i) an amino acid sequence as provided in the ID. OF SEQ. No.: 4, ID. OF SEQ. No.: 33 or ID. OF SEQ. No.: 34; (ii) an amino acid sequence that is at least 50% identical to the ID. OF SEQ. No.: 4, ID. OF SEQ. No.: 33 or ID. OF SEQ. No.: 34, or (iii) a biologically active fragment of i) or ii). In a further embodiment, the A4 desaturase is encoded by the protein coding region of one of the A4 desaturase genes listed in Table 1 or a gene substantially identical thereto. As used here, an "A8-desaturase" is capable of converting at least 20:3 A11,14,17 co3 into eicosatetraenoic acid. In one embodiment, the A8 desaturase is relatively specific for A8 substrates. That is, it has greater activity in desaturating A8 substrates than other substrates, in particular A6 desaturated substrates. In a preferred embodiment, the A8-desaturase has little or no A6-desaturase activity when expressed in yeast cells. In another embodiment, the A8-desaturase comprises: (i) an amino acid sequence as provided in the ID. OF SEQ. No.: 1, ID. OF SEQ. No.: 36, ID. OF SEQ. No.: 68, ID. OF SEQ. No.: 69, ID. OF SEQ. No.: 70 or ID. OF SEQ. No.: 71; (ii) a sequence of amino acids that is at least 50% identical to ID. DE SEQ NO: 1, ID. OF SEQ. No.: 36, ID. , OF SEQ. No.: 68, ID. DE SEQ NO: 69, ID. OF SEQ. No.: 70 or ID. OF SEQ. No.: 71, or (iii a biologically active fragment of i) or ii). In a further embodiment, the A8-desaturase comprises: (i) a amino acid sequence as given in ID. OF SEQ. No.: 1; (ii) an amino acid sequence that is at least 90% identical to the ID. OF SEQ. No.: 1, or (iii) a fragment biologically active of i) or ii) . As used herein, a "co3-desaturase" is at least capable of converting LA to ALA and / or GLA to SDA and / or ARA to EPA. Examples of co3-desaturase include those described by Pereira et al. (2004), Horiguchi et al. (1998), Berberich et al. (1998) and Spychalla et al. (1997). In one embodiment, a cell of the invention is a plant cell devoid of co3 -desaturase activity. Such cells can be produced using gene knockout technology well known in the art. These cells can be used to specifically produce large amounts of to6 LC-PUFA such as DGLA. elongases Biochemical evidence suggests that fatty acid elongation consists of 4 steps: condensation, reduction, dehydration and a second reduction. In the context of this invention, an "elongase" refers to the polypeptide that catalyzes the condensation step in the presence of the other members of the elongation complex, under appropriate physiological conditions. It has been shown that heterologous or homologous expression in a cell of only the condensing component ("ellongase") of the elongation protein complex is necessary for the elongation of the respective acyl chain. In this way, the introduced elongase is able to successfully recruit the reducing and dehydrating activities of the transgenic host to perform successful acyl elongations. It is believed that the specificity of the elongation reaction with respect to chain length and the degree of desaturation of fatty acid substrates resides in the condensation component. This component is also believed to be rate limiting in the elongation reaction. Two groups of condensing enzymes have been identified so far. The former is involved in the extension of saturated and monounsaturated fatty acids (C18-22) such as, for example, the Arabidopsis FAE1 gene. An example of a product formed is erucic acid (22:1) in Brassicas. In this group are FAE-like enzymes, and it seems that it has no participation in LC-PUFA biosynthesis. The other identified class of fatty acid elongases, called the ELO family of elongases, is named after the ELO genes, whose activities are required for the synthesis of the very long-chain fatty acids of sphingolipids in yeast. Apparent paralogs of ELO-type elongases isolated from organisms that synthesize LC-PUFA, such as algae, mosses, fungi and nematodes, have been shown to be involved in the elongation and synthesis of LC-PUFA. Several genes encoding such PUFA elongation enzymes were also isolated (Table 1). Such genes are unrelated in terms of nucleotide or amino acid sequence to the FAE-like elongase genes present in higher plants. As used herein, a "bifunctional A5 / A6 elongase" or "A5 / A6 elongase" is capable of at least: i) converting octadecatetraenoic acid to eicosatetraenoic acid, and ii) converting eicosapentaenoic acid to docosapentaenoic acid. That is, a bifunctional A5 / A6 elongase is both an A5-elongase and an A6-elongase, and bifunctional A5 / A6-elongases can be considered a subclass of each of these. In one embodiment, the bifunctional A5 / A6 elongase is capable of catalyzing the elongation of EPA to form DPA in a plant cell, such as, for example, a higher plant cell, when that cell is provided with a source of EPA. EPA can be supplied exogenously or, preferably, endogenously. A gene encoding such an elongase has been isolated from an invertebrate, C. elegans (Beaudoin et al., 2000), although it was not previously known that it catalyzes the A5-elongation step. In one embodiment, the bifunctional 05 / A6-elongase comprises: (i) an amino acid sequence as provided in the ID. OF SEQ. No.: 2 or ID. OF SEQ. No.: 14; (ii) an amino acid sequence that is at least 50% identical to the ID. OF SEQ. No.: 2 or ID. OF SEQ. No.: 14, or (iii) a biologically active fragment of i) or ii). As used herein, an "A5-elongase" is at least capable of converting eicosapentaenoic acid to docosapentaenoic acid. In one embodiment, the A5-elongase is from a non-vertebrate source such as, for example, an algal or fungal source. Such elongases may have advantages in terms of the specificity of the elongation reactions performed (for example, the A5-elongase provided as SEQ ID. NO: 2). In a preferred embodiment, the A5-elongase is relatively specific for C substrates 20 in relation to substrates C 2 2 • For example, it can have at least 10 times lower activity compared to C substrates 22 (elongated into C24 fatty acids) in relation to activity towards substrate C 20 corresponding, when expressed in yeast cells. It is preferred that the activity when using desaturated substrates C 2 the A5 is high, for example, providing an efficiency for the conversion of 20:5a>3 to 22:5co3 of at least 7%, when expressed in yeast cells. In another embodiment, the A5-elongase is relatively specific for A5 desaturated substrates relative to A6 desaturated substrates. For example, it can have at least 10 times lower activity towards C18 A6 desaturated substrates compared to C desaturated substrates 2o A5, when expressed in yeast cells. In a further embodiment, the A5-elongase comprises: (i) an amino acid sequence as provided in the ID. OF SEQ. No.: 2, ID. OF SEQ. No.: 30, ID. OF SEQ. No.: 77 or ID. OF SEQ. No.: 78; (ii) an amino acid sequence that is at least 50% identical to the ID. OF SEQ. No.: 2, ID. OF SEQ. No.: 30, ID. OF SEQ. No.: 77 or ID. OF SEQ. No.: 78, or (iii) a biologically active fragment of i) or ii). In another embodiment, the A5-elongase comprises: (i) an amino acid sequence as provided in the ID. OF SEQ. No.: 2; (ii) an amino acid sequence that is at least 90% identical to the ID. OF SEQ. No.: 2, or (iii) a biologically active fragment of i) or ii). In a further embodiment, the A5 elongase is encoded by the protein coding region of one of the A5 elongase genes listed in Table 1 or a gene substantially identical thereto. As used herein, an "A6-elongase" is at least capable of converting octadecatetraenoic acid to eicosatetraenoic acid. In one embodiment, the A6-elongase comprises: (i) a sequence of amino acids as provided in ID. OF I SEQ. No.: 2, ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 31, ID. OF SEQ. No.: 32, ID. OF SEQ. No.: 74, ID. OF SEQ. No.: 85, ID. OF SEQ. No. : 8 6 OR ID. OF SEQ. No.: 88; (Ü) an amino acid sequence that is skin ) less than 50% identical to the ID. OF SEQ. No.: 2, ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 31, ID. OF SEQ. No.: 32, ID. OF SEQ. No.: 74, ID. OF SEQ. 🇧🇷 No.: 85, ID. OF SEQ. No.: 86 or ID. OF SEQ. No 3 : 88, or (iii) one biologically active fragment of i) or ii). in another embodiment, the A6-elongase comprises: (i) a sequence of amino acids as provided in ID. OF SEQ. No.: 2, ID . OF SEQ. No.: 3 OR ID. OF SEQ. No. : : 32, ID. OF SEQ. No.: 85, ID. OF SEQ. No.: 86 or ID. OF SEQ. No.: 88; (ü) an amino acid sequence that is at least 90% identical. to ID. OF SEQ. No.: 2, ID. OF SEQ. No.: 3, ID. 🇧🇷 OF SEQ. No.: 32, ID. OF SEQ. No.: 85, ID. OF SEQ. No.: 86 OR ID. OF SEQ. No.: 88, or (iü) a biologically active fragment of i) or ii). In an additional embodiment, A6-• elongase is encoded by protein coding region from one of the A6-elongase genes listed in Table 1 or from a gene substantially identical thereto. In some protist species, LC-PUFA are synthesized by elongating linoleic or oc-linolenic acid with a C2 unit, prior to desaturation with A8-desaturase (Figure 1 part IV; "A8-desaturation" pathway). A6-desaturase and A6-elongase activities were not detected in these species. Rather, A9-elongase activity would be expected in such organisms and, in support of this, a C18 A9-elongase gene was recently isolated from Isochrysis galbana (Qi et al., 2002). As used herein, an "A9-elongase" is capable of at least converting α-linolenic acid to 20:3A 11,14 🇧🇷 17 co3. In one embodiment, the A9-elongase comprises: (i) an amino acid sequence as provided in the ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 35, ID. OF SEQ. No.: 75, ID. OF SEQ. No.: 76, ID. OF SEQ. No.: 85 or ID. OF SEQ. No.: 86; (ii) an amino acid sequence that is at least 50% identical to the ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 35, ID. OF SEQ. No.: 75, ID. OF SEQ. No.: 76, ID. OF SEQ. No.: 85 or ID. OF SEQ. No.: 86, or (iii) a biologically active fragment of i) or ii). In another embodiment, the A9-elongase comprises: (i) an amino acid sequence as provided in the ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 or ID. OF SEQ. No.: 86; (ii) an amino acid sequence that is at least 90% identical to the ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 or ID. OF SEQ. No.: 86, or (iii) a biologically active fragment of i) or ii). In a further embodiment, the A9 elongase is encoded by the protein coding region of the A9 elongase gene listed in Table 1 or a gene substantially identical thereto. In another embodiment, the A9-elongase also has A6-elongase activity. Elongase in this modality is capable of converting SDA into ETA and / or GLA into GLA (A6-elongase activity), in addition to converting ALA into ETrA (A9-elongase). In a preferred embodiment, such an elongase is from an algal or fungal source, for example, the genus Pavlova. As used herein, an "A4-elongase" is capable of at least converting docosahexaenoic acid to 24 : A6, 9 🇧🇷 12 🇧🇷 15,18,21 co3 . cells Suitable cells of the invention include any cell that can be transformed with a polynucleotide encoding a polypeptide / enzyme described herein, and which is therefore capable of being used for the production of LC-PUFA. Host cells into which the polynucleotide(s) are introduced can be transformed cells or cells that are already transformed with at least one nucleic acid molecule. This nucleic acid molecule may or may not be related to the synthesis of LC-PUFA. Host cells of the present invention can either be endogenously (i.e. naturally) capable of producing proteins of the present invention or they can be capable of producing such proteins only after being transformed with at least one nucleic acid molecule. As used herein, the term "cell with an increased ability to synthesize a long-chain polyunsaturated fatty acid" is a relative term in which the recombinant cell of the invention is compared to the native cell, with the recombinant cell producing more polyunsaturated fatty acids long chain or a higher concentration of LC-PUFA such as EPA, DPA or DHA (relative to other fatty acids) than the native cell. Cells can be prokaryotic or eukaryotic. The host cells of the present invention can be any cell capable of producing at least one protein described herein, and include bacterial, fungal (including yeast), parasitic, arthropod, animal and plant cells. Preferred host cells are yeast cells and plant cells. In a preferred embodiment, the plant cells are seed. In one embodiment, the cell is an animal cell or an algal cell. The animal cell may be from any type of animal, for example, a non-human animal cell, a non-human vertebrate cell, a non-human mammalian cell, or aquatic animal cells such as fish or crustaceans, invertebrates, insects, etc. . An example of a bacterial cell useful as the host cell of the present invention is Synechococcus spp. (also known as Synechocystis spp.), for example, Synechococcus elongatus. The cells may be from an organism suitable for fermentation. As used herein, the term "fermentation process" refers to any fermentation process or any process that comprises a fermentation step. A fermentation process includes, without limitation, fermentation processes used to produce alcohols (eg, ethanol, methanol, butanol); organic acids (eg citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (for example, H 2 and C0 2 🇧🇷 antibiotics (eg, penicillin and tetracycline); enzymes; vitamins (eg, riboflavin, beta-carotene); and hormones. Fermentation processes also include fermentation processes used in the consumable alcohol industry (e.g. beer and wine), the dairy industry (e.g. fermented dairy products), the leather industry and the tobacco industry. Preferred fermentation processes include alcohol fermentation processes, well known in the art. fermentation processes preferred are anaerobic fermentation processes, well known in the art. Suitable fermentation cells, typically microorganisms, are capable of fermenting, i.e. converting, sugars such as glucose or maltose, directly or indirectly, into the desired fermentation product. Examples of fermentation microorganisms include fungal organisms such as yeast. As used herein, "yeast" includes Saccharomyces spp., Saccharomyces cerevisiae, Saccharomyces carlbergensis, Candida spp., Kluveromyces spp., Pichia spp., Hansenula spp., Trichoderma spp., Lipomyces Starkey and Yarrowia lipolytica. Preferred yeasts include strains of Saccharomyces spp. and, in particular, Saccharomyces cerevisiae. Commercially available yeasts include, for example, "Red Star / Lesaffre Ethanol Red" (available from Red Star / Lesaffre, USA) FALI (available from Fleischmann's Yeast, a division of Burns Philp Food Inc. , USA), SUPERSTART (available from Alltech), GERT STRAND (available from Gert Strand AB, Sweden^ ) and FERMIOL (available from DSM Specialties). Evidence to date suggests that some heterologously expressed desaturases in yeast have relatively low activity in combination with some elongases. However, the present inventors have identified that this can be alleviated by providing a desaturase with the ability to use an acyl-CoA form of the fatty acid as a substrate in LC-PUFA synthesis, and this is believed to be advantageous in other ways as well. recombinant cells other than yeast. About Accordingly, it has also been determined that desaturases of vertebrate origin are particularly useful for the production of LC-PUFA. Thus, in embodiments of the invention, (i) at least one of the enzymes is an A5-elongase that catalyzes the conversion of EPA to DPA in the cell; (ii) at least one of the desaturases is capable of acting on an acyl-CoA substrate, (iii) at least one desaturase is from vertebrate or is a variant thereof, or (iv) a combination of ii) and iii). In a particularly preferred embodiment, the host cell is a plant cell, such as those described in more detail herein. As used herein, a "progenitor cell of a seed" is a cell that divides and / or differentiates into a cell of a transgenic seed of the invention, and / or a cell that divides and / or differentiates into a transgenic plant which produces a transgenic seed of the invention. Levels of LC-PUFA Produced The levels of LC-PUFA that are produced in the recombinant cell are important. Levels can be expressed as a composition (in percent) of the total fatty acid that is a particular LC-PUFA or related LC-PUFA group, for example, LC-PUFA o3 or LC-PUFA o6, or PUFA C22 + , or such as can be determined by methods known in the art. The level can also be expressed as an LC-PUFA content, for example the percentage of LC-PUFA in the dry weight of material comprising the recombinant cells, for example a percentage of the dry weight of seed that is LC-PUFA . It will be observed that the LC-PUFA which is produced in a seed oilseed can be considerably higher in terms of LC-PUFA content than a vegetable or a grain that is not grown for oil production, although both can have similar LC-PUFA compositions, and both can be used as sources of LC-PUFA for human or animal consumption. LC-PUFA levels can be determined by any of the methods known in the art. For example, total lipid can be extracted from cells, tissues or organisms and the fatty acid converted to methyl esters prior to analysis by gas chromatography (GC). Such techniques are described in Example 1. Peak position on the chromatogram can be be used to identify each particular fatty acid and the area under each integrated peak to determine the amount. As used herein, unless otherwise stated, a particular fatty acid percentage in a sample is determined as the area under the peak for that fatty acid as a percentage of the total area for fatty acids in the chromatogram. This is essentially a percentage of weight (w / w). Fatty acid identity can be confirmed by GC-MS as described in Example 1. In certain embodiments, when the recombinant cell is useful in a fermentation process such as, for example, a yeast cell, the level of EPA that is produced can be at least 0.21% of the total fatty acid in the cell, preferably at least 0.82% or at least 2% and even more preferably at least 5%. In other embodiments, the total fatty acid of the recombinant cell can comprise at least 1.5% EPA, preferably at least 2.1% EPA, and more preferably at least 2.5%, at least 3.1%, at least 4% or at least 5.1% EPA. In further embodiments, when the recombinant cell is useful in a fermentation process or is a plant cell and DPA is produced, the total fatty acid in the cell may comprise at least 0.1% DPA, preferably at least 0.13% or at least 0.15%, and more preferably at least 0.5% or at least 1% DPA. In further embodiments, the cell's total fatty acid may comprise at least 2% LC-PUFA C 20 , preferably at least 3% or at least 4% LC-PUFA C 2 o, more preferably at least 4.7% or at least 7.9% LC-PUFA C 20 and mainly at least 10.2% LC-PUFA C 20 🇧🇷 In further embodiments, the cell's total fatty acid may comprise at least 2.5% LC-PUFA C 20 co3, preferably at least 4.1% or more preferably at least 5% LC-PUFA C 20 to3 . In other embodiments, when both EPA and DPA are synthesized in a cell, the EPA level achieved will be at least 1.5%, at least 2.1%, or at least 2.5%, and the DPA level of at least least 0.13%, at least 0.5% or at least 1.0%. In each of these embodiments, the recombinant cell can be a cell from an organism that is suitable for fermentation, such as, for example, a unicellular microorganism, which can be a prokaryote or a eukaryote, such as, for example, yeast or a plant cell. In a preferred embodiment, the cell is a cell from an angiosperm (higher plant). In a preferred modality In addition, the cell is a cell in a seed, such as an oilseed or a grain or cereal. The level of LC-PUFA production in the recombinant cell can also be expressed as a conversion ratio, i.e., the amount of LC-PUFA formed as a percentage of one or more PUFA substrate or LC-PUFA. With respect to EPA, for example, this can be expressed as a ratio of the level of EPA (as a percentage in total fatty acid) to the level of a substrate fatty acid (ALA, SDA, ETA or ETrA). In a preferred embodiment, the conversion efficiency is for ALA to EPA. In particular embodiments, the conversion ratio for EPA production in a recombinant cell can be at least 0.5%, at least 1%, or at least 2%. In another -modality, the conversion efficiency for ALA to EPA is at least 14.6%. In further embodiments, the conversion ratio for producing DPA from EPA in a recombinant cell is at least 5%, at least 7%, or at least 10%. In other embodiments, the total to3 fatty acids produced that are products of A6-desaturation (i.e., below 18:3co3 (ALA), calculated as the sum of the percentages for 18:4co3 (SDA), 20:4co3 (ETA) , 20:5:03 (EPA) and 22:5:03 (DPA)) are at least 4.2%. In a particular embodiment, the efficiency of converting ALA to CO3 products via an A6-desaturation step and / or an A9-elongation step in a recombinant cell, preferably a plant cell, more preferably a seed cell, is at least 22% or at least 24%. Unless otherwise stated, in this modality, a proportion of products derived from ALA to ALA (products: ALA) in the cell is at least 1:3.6. The LC-PUFA content in the recombinant cell can be maximized if the parent cell used for gene introduction is chosen in such a way that the level of fatty acid substrate that is produced or supplied exogenously is optimal. In particular embodiments, the cell produces ALA endogenously at levels of at least 30%, at least 50% or at least 66% of the total fatty acid. The level of LC-PUFA can also be maximized by growing or incubating the cells under optimal conditions, for example at a temperature slightly lower than the standard temperature for that cell, which is believed to favor fatty acid accumulation polyunsaturated. There are advantages to maximizing the production of a desired LC-PUFA while minimizing the extent of side reactions. In one modality in particular, little or no ETrA is detected (less than 0.1%) while the EPA level is at least 2.1%. With respect to the transgenic plants of the invention, in one embodiment, at least one plant part synthesizes EPA, wherein the total fatty acid of the plant part comprises at least 1.5%, at least 2.1% or at least 2, 5% EPA. In another embodiment, at least one plant part synthesizes DPA, wherein the total fatty acid of the plant part comprises at least 0.1%, at least 0.13%, or at least 0.5% DPA. In a further embodiment, at least one plant part synthesizes DHA. In another embodiment, at least one plant part synthesizes DHA, wherein the total fatty acid of the plant part comprises at least 0.1%, at least 0.2%, or at least minus 0.5% DHA. In another embodiment, at least one plant part synthesizes at least one LC-PUFA C 2 the co3, where the total fatty acid of the plant part comprises at least 2.5% or at least 4.1% LC-PUFA C 20 o>3 . In yet another embodiment, at least one plant part synthesizes EPA, wherein the efficiency of converting ALA to EPA in the plant part is at least 2% or at least 14.6%. In a further embodiment, at least one part of the plant synthesizes CO3 polyunsaturated fatty acids that are the products of A6-ALA desaturation and / or the products of A9-ALA elongation, wherein the efficiency of conversion of ALA into said products in the plant part is at least 22% or at least 24%. In yet another embodiment, at least one plant part synthesizes DPA from EPA, wherein the conversion efficiency of EPA to DPA in the plant part is at least 5% or at least 7%. With respect to the transgenic seeds of the invention, in one embodiment, EPA is synthesized in the seed and the total fatty acid of the seed comprises at least 1.5%, at least 2.1% or at least 2.5% EPA. In another embodiment, DPA is synthesized in the seed and the total fatty acid of the seed comprises at least 0.1%, at least 0.13% or at least 0.5% DPA. In a further embodiment, DHA is synthesized in the seed. In another embodiment, DHA is synthesized in the seed and the total fatty acid of the seed comprises at least 0.1%, at least 0.2% or at least 0.5% DHA. In yet a further embodiment, at least one LC- PUFA C 2 CO3 is synthesized in the seed and the total fatty acid in the seed comprises at least 2.5% or at least 4.1% of LC-PUFA C20 co3 . In a further embodiment, EPA is synthesized in the seed and the efficiency of conversion of ALA to EPA in the seed is at least 2% or at least 14.6%. In another embodiment, co3 polyunsaturated fatty acids which are the products of A6-ALA desaturation and / or the products of A9-AL elongation are synthesized in the seed, and the efficiency of conversion of ALA into said products in the seed is at least 22% or at least 24%. In a further embodiment, DPA is synthesized from EPA in the seed and the conversion efficiency of EPA to DPA in the seed is at least 5% or at least 7%. With respect to the extracts of the invention, in one embodiment, the total fatty acid content of the extract comprises at least 1.5%, at least 2.1% or at least 2.5% EPA. In another embodiment, the total fatty acid content of the extract comprises at least 0.1%, at least 0.13% or at least 0.5% DPA. In a further embodiment, the extract comprises DHA. In another embodiment, the total fatty acid content of the extract comprises at least 0.1%, at least 0.2% or at least 0.5% DHA. In another embodiment, the total fatty acid content of the extract comprises at least 2.5% or at least 4.1% LC-PUFA C 20 (D3. In yet a further embodiment, the extract comprises ARA, EPA, DPA, DHA, or any mixture thereof in triacylglycerols. With respect to methods of the invention for producing an LC-PUFA, in one embodiment, the cell comprises at least one LC-PUFA C 20 and the total fatty acid in the cell comprises at least 2%, at least 4.7% or at least 7.9% LC-PUFA C 20 🇧🇷 In another embodiment, the cell comprises at least one LC-PUFA C 20 a>3 and the total fatty acid in the cell comprises at least 2.5% or at least 4.1% LC-PUFA C 20 co3. In a further embodiment, the cell comprises ©3 polyunsaturated fatty acids which are the products of A6-ALA desaturation and / or the products of A9-ALA elongation, and the efficiency of converting ALA into said products in the cell is at least least 22% or at least 24%. In yet another embodiment, the cell comprises DPA and the total fatty acid of the cell comprises at least 0.1%, at least 0.13% or at least 0.5% DPA. In a further embodiment, the cell comprises DPA and the efficiency of converting EPA to DPA in the cell is at least 5% or at least 7%. In another embodiment, the cell comprises EPA, wherein the total fatty acid of the cell comprises at least 1.5%, at least 2.1% or at least 2.5% EPA. In a further embodiment, the cell comprises EPA and the efficiency of converting ALA to EPA in the cell is at least 2% or at least 14.6%. Polypeptides In one aspect, the present invention provides a substantially purified polypeptide selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in the ID. OF SEQ. No: 1, ii) a polypeptide comprising a sequence of amino acids that is at least 40% identical to ID. OF SEQ. No.: 1, and iii) a biologically active fragment of i) or ii), wherein the polypeptide has A8-desaturase activity. Preferably, the A8-desaturase does not also have A6-desaturase activity. In another aspect, the present invention provides a substantially purified polypeptide selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in the ID. OF SEQ. No.: 2, ii) a polypeptide comprising an amino acid sequence that is at least 60% identical to the ID. OF SEQ. No.: 2, and iii) a biologically active fragment of i) or ii), wherein the polypeptide has A5-elongase and / or A6-elongase activity. Preferably, the polypeptide has A5-elongase and A6-elongase activity whereby the polypeptide is more efficient in synthesizing DPA from EPA than it is in synthesizing ETA from SDA. More preferably, the polypeptide can be purified from algae. Furthermore, when expressed in yeast cells, it is more efficient in elongating LC-PUFA C 2 what of LC-PUFA C22 • In another aspect, the invention provides a substantially purified polypeptide selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in the ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 or ID. OF SEQ. No.: 86, ii) a polypeptide comprising an amino acid sequence that is at least 40% identical to the ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 or ID. OF SEQ. No.: 86, and iii) a biologically active fragment of i) or ii), wherein the polypeptide has A9-elongase and / or A6-elongase activity. Preferably, the polypeptide has both A9-elongase and A6-elongase activity. Preferably, the polypeptide is more efficient in synthesizing ETrA from ALA than it is in synthesizing ETA from SDA. Furthermore, it is preferred that the polypeptide can be purified from algae or fungi. In yet another aspect, the present invention provides a substantially purified polypeptide selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in the ID. OF SEQ. No: 4, ii) a polypeptide comprising a sequence of amino acids that is at least 70% identical to ID. OF SEQ. No.: 4, and iii) a biologically active fragment of i) or ii), wherein the polypeptide has A4-desaturase activity. In a further aspect, the present invention provides a substantially purified polypeptide selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in the ID. OF SEQ. No: 60, ii) a polypeptide comprising a sequence of amino acids that is at least 55% identical to ID. OF SEQ. No.: 60, and iii) a biologically active fragment of i) or ii), wherein the polypeptide has A5-desaturase activity. In yet another aspect, the present invention provides a substantially purified polypeptide selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in the ID. OF SEQ. No.: 64, ii) a polypeptide comprising an amino acid sequence that is at least 90% identical to the ID. OF SEQ. No.: 64, and iii) a biologically active fragment of i) or ii), wherein the polypeptide has A6-desaturase activity. In yet another aspect, the present invention provides a substantially purified polypeptide selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in the ID. OF SEQ. No.: 88, ii) a polypeptide comprising an amino acid sequence that is at least 76% identical to the ID. OF SEQ. No.: 88, and iii) a biologically active fragment of i) or ii), wherein the polypeptide has A6-elongase activity. Preferably, in relation to any of the aspects above, it is preferred that the polypeptide can be isolated from a species selected from the group consisting of Pavlova and Melosira. "Substantially purified polypeptide" means a polypeptide that has been at least partially separated from the lipids, nucleic acids, other polypeptides, and other contaminating molecules with which it is associated in its native state. Preferably, the substantially purified polypeptide is at least 60% free, preferably at least 75% free, and most importantly at least 90% free of other components with which they are naturally associated. Furthermore, the term "polypeptide" is used interchangeably herein with the term "protein". The % identity of a polypeptide is determined by GAP analysis (Needleman and Wunsch, 1970) (GCG program) with a gap creation penalty = 5, and a gap extension penalty = 0.3. Unless otherwise stated, the investigated sequence is at least 15 amino acids long, and GAP analysis aligns the two sequences over a region of at least 15 amino acids. More preferably, the investigated sequence is at least 50 amino acids long and the GAP analysis aligns the two sequences over a region of at least 50 amino acids. Even more preferably, the investigated sequence is at least 100 amino acids long and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. With respect to the defined polypeptides / enzymes, it will be appreciated that % identity numbers above those given above will encompass preferred embodiments. Of that Accordingly, where applicable, in light of minimum % identity numbers, it is preferred that the polypeptide comprise an amino acid sequence that is at least 60%, more preferably at least 65%, more preferably at least 70%, most preferably at least 70% at least 75%, more preferably at least 76%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, most preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, most preferably at least 99 .1%, more preferably at least 99.2%, most preferably at least 99.3%, most preferably at least 99.4%, most preferably at least 99.5%, most preferably at least 99.6%, plus pre preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the ID. OF SEQ. Determined relevant number. In a further embodiment, the present invention relates to polypeptides that are substantially identical to those specifically described herein. As used herein, with respect to a polypeptide, the term "substantially identical" means the deletion, insertion, and / or substitution of one or a few (e.g., 2, 3, or 4) amino acids while maintaining at least one activity of the protein native. As used herein, the term "biologically "active" refers to a portion of the defined polypeptide / enzyme that still retains desaturase or elongase activity (whichever is relevant). Such biologically active fragments can be readily determined by serial deletions of the full-length protein and with activity testing of the resulting fragment. Amino acid sequence mutants / variants of the polypeptides / enzymes defined herein can be prepared by introducing appropriate nucleotide changes into a nucleic acid encoding the polypeptide, or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletion, insertion, and substitution can be performed to arrive at the final construct, provided the final protein product has the desired characteristics. In the design of amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on the trait(s) to be modified. Mutation sites can be modified individually or serially, for example, (1) substituting first with conservative amino acid choices and then with more radical selections, depending on the results obtained, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site. Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues, and typically about 1 to 5 contiguous residues. Substitution mutants have at least one residue of amino acid in the polypeptide molecule removed and a different residue inserted in its place. Sites of greatest interest for substitution mutagenesis include sites identified as the active or binding site(s). Others of interest are those in which particular residues obtained from several strains or species are identical. These positions may be important for biological activity. These sites, especially those that are in a sequence of at least three other identically conserved sites, are preferably replaced in a relatively conservative manner. Such conservative substitutions are shown in Table 2. Furthermore, if desired, unnatural amino acids or chemical amino acid analogues can be introduced as a replacement or addition into the polypeptides of the present invention. Such amino acids include, without limitation, the D-isomers of the common amino acids, 2,4-diaminobutyric acid, cc-amino isobutyric acid, 4-aminobutyric acid, 2-aminobutyric acid, 6-amino hexanoic acid, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, 0-alanine, fluoro amino acids, amino acids designed as 0-methyl amino acids , Ccc-methyl amino acids, Na-methyl amino acids and amino acid analogues in general. Also included within the scope of the invention are polypeptides of the present invention that are differentially modified during or after synthesis, for example, by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivation by groups of known protection / blocking, proteolytic cleavage, binding to an antibody molecule or other cellular ligand, etc. Such modifications can serve to increase the stability and / or bioactivity of the polypeptide of the invention. TABLE 2. Exemplary substitutions. Original Residue Substitutions Exemplars Ala (A) vai; read; ile; gly Arg(R) Lys Asn(N) gin; his Asp (D) Glu Cys (C) Ser Gin (Q) asn; his Glu (E) Asp Gly (G) pro, ala His (H) asn; gin lie (I) leu; go; ala Leu(L)ile; go; met; Allah; phe Lys (K) Arg Met (M) leu; phe Phe (F) leu; go; ala Pro (P) Gly Ser (S) Thr Thr (T) Ser Trp (W) Tyr Tyr (Y) trp; phe Val(V)ile; read; met; phe, wing The polypeptides of the present invention can be produced in a variety of ways, including natural protein production and recovery, recombinant protein production and recovery, and chemical synthesis of the proteins. In one embodiment, an isolated polypeptide of the present invention is produced by culturing a cell capable of expressing the polypeptide under conditions effective to produce the polypeptide, and recovering the polypeptide. A preferred cell for culture is a recombinant cell of the present invention. Effective culture conditions include, without limitation, effective media, bioreactor, temperature, pH, and oxygen conditions that allow protein production. An effective medium refers to any medium in which a cell is cultured to produce a polypeptide of the present invention. This medium typically comprises an aqueous medium that has assimilable sources of carbon, nitrogen, and phosphate, and suitable salts, minerals, metals, and other nutrients, such as vitamins. The cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter plates and petri dishes. Cultivation can be carried out at a temperature, pH and oxygen content suitable for a recombinant cell. These culture conditions are part of the knowledge of those qualified in the technique. polynucleotides In one aspect, the present invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: i) a nucleotide sequence as given in the ID. OF SEQ. No.: 5 OR ID. OF SEQ. No.: 6; ii) the sequence encoding a polypeptide of the invention; iii) a nucleotide sequence that is at least 50% identical to the ID. OF SEQ. No.: 5 or ID. OF SEQ. No.: 6; and iv) a sequence that hybridizes to any one of i) to iii) under highly controlled conditions. In another aspect, the present invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: i) a nucleotide sequence as given in the ID. OF SEQ. No.: 7 or ID. OF SEQ. No.: 8; ii) a sequence encoding a polypeptide of the invention; iii) a nucleotide sequence that is at least 51% identical to the ID. OF SEQ. No.: 7 or ID. OF SEQ. No.: 8; and iv) a sequence that hybridizes to any one of i) to iii) under highly controlled conditions. In yet another aspect, the present invention provides an isolated polynucleotide comprising a sequence of nucleotides selected from the group consisting of: i) a nucleotide sequence as given in the ID. OF SEQ. No.: 9 or ID. OF SEQ. No.: 10; ii) a sequence encoding a polypeptide of the invention; iii) a nucleotide sequence that is at least 51% identical to the ID. OF SEQ. No.: 9 or ID. OF SEQ. No.: 10; and iv) a sequence that hybridizes to any one of i) to iii) under highly controlled conditions. In a preferred embodiment, the sequence encoding a polypeptide of the invention is formed by nucleotides 31 to 915 or ID. OF SEQ. No.: 9 or nucleotides 85 to 915 of ID. OF SEQ. No.: 9. In a further aspect, the present invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: i) a sequence of nucleotides as given in the ID. OF SEQ. No.: 11, ID. OF SEQ. No.: 12 OR ID. OF SEQ. No.: 13; ii) a sequence encoding a polypeptide of the invention; iii) a nucleotide sequence that is at least 70% identical to the ID. OF SEQ. No.: 11, ID. OF SEQ. No.: 12 or ID. OF SEQ. No.: 13; and iv) a sequence that hybridizes to any one of i) to iii) under highly controlled conditions. In another aspect, the present invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: i) a sequence of nucleotides as given in the ID. OF SEQ. No.: 58 or ID. OF SEQ. No.: 59; ii) a sequence encoding a polypeptide of the invention; iii) a nucleotide sequence that is at least 55% identical to the ID. OF SEQ. No.: 58 or ID. OF SEQ. No.: 59; and iv) a sequence that hybridizes to any one of i) to iii) under highly controlled conditions. In another aspect, the present invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: i) a nucleotide sequence as given in the ID. OF SEQ. No.: 63; ii) a sequence encoding a polypeptide of the invention; iii) a nucleotide sequence that is at least 90% identical to the ID. OF SEQ. No.: 63; and iv) a sequence that hybridizes to any one of i) to iii) under highly controlled conditions. In another aspect, the present invention provides an isolated polynucleotide comprising a sequence of nucleotides selected from the group consisting of: i) a nucleotide sequence as given in the ID. OF SEQ. No.: 89; ii) a sequence encoding a polypeptide of the invention; iii) a nucleotide sequence that is at least 76% identical to the ID. OF SEQ. No.: 89; and iv) a sequence that hybridizes to any one of i) to iii) under highly controlled conditions. The present inventors are also the first to isolate the polynucleotide encoding a fatty acid ketoacyl synthase-like elongase from a non-higher plant. Accordingly, in a further aspect, the present invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: i) a nucleotide sequence as given in the ID. OF SEQ. No.: 55; ii) a nucleotide sequence that is at least 40% identical to ID. OF SEQ. No.: 55; and iii) a sequence which hybridizes to i) or ii) under highly controlled conditions. An "isolated polynucleotide", including DNA, RNA or a combination thereof, single-stranded or double-stranded, in sense or antisense orientation, or a combination of both, dsRNA or otherwise, means a polynucleotide that is at least partially separated of the polynucleotide sequences with which it is associated or linked in its native state. Preferably, the isolated polynucleotide is at least 60% free, preferably at least 75% free, and most importantly at least 90% free of other components with which it is naturally associated. Furthermore, the term "polynucleotide" is used interchangeably herein with the term "nucleic acid molecule". The % identity of a polynucleotide is determined by GAP analysis (Needleman and Wunsch, 1970) (GCG program) with a gap creation penalty = 5 and a gap extension penalty = 0.3. Unless otherwise stated, the investigated sequence is at least 45 nucleotides in length, and GAP analysis aligns the two sequences over a region of at least 45 nucleotides. Preferably, the investigated sequence is at least 150 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 150 nucleotides. More preferably, the investigated sequence is at least 300 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 300 nucleotides. With regard to the defined polynucleotides, it will be observed that % identity numbers greater than those provided above will encompass preferred embodiments. Accordingly, where applicable, in light of minimum % identity numbers, it is preferred that the polynucleotide comprise a nucleotide sequence that is at least 60%, more preferably at least 65%, more preferably at least 70%, most preferably at least 75%, more preferably at least 76%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, most preferably at at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, most preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, most preferably at least 99.4%, most preferably at least 99.5%, most preferably at least 99.6% , more preferably at least 99.7%, more preferably at least 99.8% and even more preferably at least 99.9% identical to ID. OF SEQ. Determined relevant number. In a further embodiment, the present invention relates to polynucleotides that are substantially identical to those specifically described herein. As used herein, with reference to a polynucleotide, the term "substantially identical" means the substitution of one or a few (e.g., 2, 3, or 4) nucleotides while maintaining at least one activity of the native protein encoded by the polynucleotide. Furthermore, this term includes the addition or deletion of nucleotides that results in the increase or decrease in size of the native protein encoded by one or a few (e.g., 2, 3, or 4) amino acids while maintaining at least one activity of the native protein encoded by the polynucleotide. Oligonucleotides of the present invention can be RNA, DNA, or derivatives thereof. The minimum size of these oligonucleotides is the size required for the formation of a stable hybrid between an oligonucleotide and a complementary sequence in a nucleic acid molecule of the present invention. Preferably, oligonucleotides are at least 15 nucleotides in length, more preferably at least 18 nucleotides, more preferably at least 19 nucleotides, more preferably at least 20 nucleotides, even more preferably at least 25 nucleotides. The present invention includes oligonucleotides that can be used, for example, as probes for identifying nucleic acid molecules, or primers for producing nucleic acid molecules. The oligonucleotides of the present invention used as a probe are typically attached to a label such as, for example, a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule. Polynucleotides and oligonucleotides of the present invention include those that hybridize under highly controlled conditions to a sequence provided as an IDS. OF SEQ. No os : 5 to 13. As used herein, highly controlled conditions are those that: (1) employ low ionic strength and high temperature for washing, e.g. 0.015 M NaCl / 0.0015 M Sodium Citrate / NaDodS0 4 0.1% at 50°C; (2) employ during hybridization a denaturing agent such as formamide, for example, formamide 50% (vol / vol) with bovine serum albumin 0.1%, Ficoll 0.1%, polyvinylpyrrolidone 0.1%, 50 mM phosphate buffer sodium in pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt, Sonified salmon sperm DNA (50 g / ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1% SDS. The polynucleotides of the present invention can have, when compared to naturally occurring molecules, one or more mutations that are deletions, insertions, or substitutions of nucleotide residues. Mutants can be naturally occurring (ie, isolated from a natural source) or synthetic (eg, by performing site-directed mutagenesis on nucleic acid). Also provided are antisense and / or catalytic nucleic acids (such as ribozymes) that hybridize to a polynucleotide of the invention and thereby inhibit the production of an encoded protein. Furthermore, dsRNA molecules are provided, particularly small dsRNA molecules with a double-stranded region of approximately 21 nucleotides, which can be used in RNA interference to inhibit production of a polypeptide of the invention in a cell. Such inhibitory molecules can be used to alter the types of fatty acids produced by a cell, such as an animal, moss, or algae cell. The production of such antisense catalytic nucleic acids and dsRNA molecules is within the knowledge of those skilled in the art (see, for example, G. Hartmann and S. Endres, "Manual of Antisense Methodology", Kluwer (1999); Haseloff and Gerlach, 1988 ; Perriman et al., 1992; Shippy et al., 1999; Waterhouse et al. (1998); Smith et al. (2000); WO 99 / 32619, WO 99 / 53050, WO 99 / 49029 and WO 01 / 34815 ). Gene constructs and vectors One embodiment of the present invention includes a recombinant vector, which includes at least one isolated polynucleotide molecule encoding a polypeptide / enzyme defined herein, inserted into any vector capable of delivering the nucleic acid molecule into a host cell. Such a vector contains heterologous nucleic acid sequences, i.e., nucleic acid sequences which are not found naturally in nucleic acid molecules of the present invention and which, preferably, are derived from a species other than the species from which the molecule(s) is derived. ) of nucleic acid is derived. The vector can be RNA or DNA, prokaryotic or eukaryotic, and is typically a virus or a plasmid. One type of recombinant vector comprises a nucleic acid molecule of the present invention operably linked to an expression vector. As indicated above, the phrase "operably linked" refers to the insertion of a nucleic acid molecule into an expression vector such that the molecule is capable of being expressed when transformed into a host cell. As used herein, an expression vector is a DNA or RNA vector that is capable of transforming a host cell and effecting the expression of a specific nucleic acid molecule. Preferably, the expression vector is also capable of replicating within the host cell. Expression vectors can be prokaryotic or eukaryotic, and are typically viruses or plasmids. Expression vectors of the present invention include any vector that functions (i.e., directs gene expression) in recombinant cells of the present invention, including bacterial, fungal, endoparasite, arthropod, other animal and plant cells. Preferred expression vectors of the present invention can direct gene expression in yeast, animal, or plant cells. In particular, expression vectors of the present invention contain regulatory sequences, such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of acid molecules. core of the present invention. In particular, recombinant molecules of the present invention include transcription control sequences. Transcriptional control sequences are sequences that control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those that control the initiation of transcription, such as promoter, enhancer, operator, and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells herein. invention. Several such transcription control sequences are known to those skilled in the art. Another embodiment of the present invention includes a recombinant cell comprising a host cell transformed with one or more recombinant molecules of the present invention. The transformation of a nucleic acid molecule into a cell can be achieved by any method by which a nucleic acid molecule can be inserted into the cell. Transformation techniques include, without limitation, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell can remain unicellular or it can grow into a tissue, organ or a multicellular organism. Transformed nucleic acid molecules may remain extrachromosomal or may integrate at one or more sites within a chromosome of the transformed (i.e., recombinant) cell, such that their ability to be expressed is retained. Transgenic plants and parts thereof The term "plant", when used herein as a noun, refers to whole plants, but when used as an adjective, it refers to any substance that is present in, obtained from, derived from, or related to a plant, such as, for example, plant organs (eg, leaves, stems, roots, flowers), single cells (eg, pollen), seeds, plant cells, and the like. Plants provided or contemplated for use in practicing the present invention include both monocots and dicots. In preferred embodiments, the plants of the present invention are crop plants (e.g. cereals and kernels, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley or peas), or other legumes. Plants can be grown to produce edible roots, tubers, leaves, stems, flowers or fruits. The plants can be vegetables or ornamental plants. The plants of the invention may be: maize (Zea mays), canola (Brassica napus, Brassica rapa ssp.), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum {Sorghum bicolour, Sorghum vulgare), sunflower (Melianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), potato sweet (Lopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia senensis) , banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentals) , macadamia (Macadamia intergrifolia), almond (Prunus amygdalus), beetroot (Beta vulgaris), oats or barley. In one embodiment, the plant is an oilseed plant, preferably an oilseed crop plant. As used herein, an "oilseed plant" is a species of plant used for the commercial production of oils from the seeds of the plant. the plant of oilseed can be rapeseed oil (like, e.g. canola), maize, sunflower, soybean, sorghum, flax (flax seed) or sugar beet. Also, the oilseed plants can be other plants that produce Brassicas, cotton, peanuts, poppy, showed, castor, sesame, saffron or nuts. The plant can produce high levels of oil in its fruit such as olive, palm or coconut oil. Horticultural plants to which the present invention can be applied are lettuce, chicory or vegetable brassicas, including cabbage, broccoli or cauliflower. The present invention can be applied to tobacco, cucurbits, carrots, strawberries, tomatoes or peppers. When production of LC-PUFA 0)3 is desired, it is preferable that the plant species to be transformed have an endogenous ratio of ALA to LA that is at least 1:1, more preferably at least 2:1. Examples include most, if not all, oilseeds such as flaxseed. This maximizes the amount of ALA substrate available for the production of SDA, ETA, ETrA, EPA, DPA and DHA. Plants produced using the methods of the invention may already be transgenic and / or transformed with genes additional to those described in detail herein. In one embodiment, the transgenic plants of the invention also produce a recombinant co3-desaturase. The presence of a recombinant co3-desaturase increases the ratio of ALA to LA in plants, which, as described in the previous paragraph, maximizes the production of LC-PUFA such as, for example, SDA, ETA, ETrA, EPA, DPA and DHA . Grain plants that provide seeds of interest include oilseed plants and plants legumes. Seeds of interest include grain seeds such as maize, wheat, barley, rice, sorghum, rye, etc. Leguminous plants include broad beans and peas. Broad beans include guar, string beans, fenugreek, soybeans, kidney beans, black-eyed peas, manjuba, lima beans, fava beans, lentils, chickpeas, etc. The term "extract or portion thereof" refers to any part of the plant. "Portion" generally refers to a specific tissue or organ such as a seed or root, while an "extract" typically involves disrupting cell walls and possibly partially purifying the resulting material. Of course, the "extract or portion thereof" will comprise at least one LC-PUFA. The extracts can be prepared using standardized methodologies in the technique. Transgenic plants, as defined in the context of the present invention, include plants and their progeny that have been genetically modified using recombinant techniques. This would generally cause or enhance the production of at least one protein / enzyme defined herein in the desired plant or plant organ. Parts of transgenic plants include all parts and cells of said plants, eg cultured tissues, callus, protoplasts. Transformed plants contain genetic material that they did not contain prior to transformation. The genetic material is preferably stably integrated into the genome of the plant. The introduced genetic material may comprise sequences that occur naturally in the same species, but in a rearranged order. or in a different arrangement of elements, for example, an anti-sense sequence. Such plants are included herein under "transgenic plants". A "non-transgenic plant" is one that has not been genetically modified by introducing genetic material by recombinant DNA techniques. In a preferred embodiment, the transgenic plants are homozygous for each and every gene that has been introduced (transgenes), so that their offspring do not differ from the desired phenotype. There are several techniques for introducing foreign genetic material into a plant cell. Such techniques include the acceleration of genetic material coated onto microparticles directly into cells (see, for example, U.S. 4,945,050 and U.S. 5,141,131). Plants can be transformed using Agrobacterium technology (see, for example, U.S. 5,177,010, U.S. 5,104,310, U.S. 5,004,863, U.S. 5,159,135). Electroporation technology has also been used to transform plants (see, for example, WO 87 / 06614, U.S. 5,472,869, 5,384,253, WO 92 / 09696 and WO 93 / 21335). In addition to different technologies for transforming plants, the type of tissue that is placed in contact with foreign genes can also vary. Such tissue would include, without limitation, embryogenic tissue, type I and II callus tissue, hypocotyl, meristem, and the like. Almost all plant tissues can be transformed during development and / or differentiation using appropriate techniques described herein. Various vectors suitable for the stable transfection of plant cells or for establishing transgenic plants have been described in, for example, Pouwels et al., "Cloning Vectors: A Laboratory Manual", 1985, suppl. 1987; Weissbach and Weissbach, "Methods for Plant Molecular Biology", Academic Press, 1989; and Gelvin et al., "Plant Molecular Biology Manual", Kluwer Academic Publishers, 1990. Typically, plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5' and 3' regulatory sequences ' and a dominant selectable marker. Such plant expression vectors may also contain a regulatory promoter region (e.g., a regulatory region that controls inducible or constitutive, developmentally or environmentally regulated, or cell or tissue-specific expression), a transcription initiation site, a ribosome binding site, an RNA processing signal, a transcription termination site, and / or a polyadenylation signal. Examples of plant promoters include, without limitation, small subunit ribulose-1,6-bisphosphate carboxylase, beta-conglycinin promoter, phaseolin promoter, high molecular weight glutenin (HMW-GS) promoters, starch biosynthetic gene promoters , ADH promoter, heat shock promoters and tissue specific promoters. Promoters can also contain certain enhancer sequence elements that can improve the efficiency of transcription. Typical enhancers include, without limitation, Adh-intron 1 and Adh-intron 6. Constitutive promoters drive continuous gene expression in all cell types and at all times (eg, actin, ubiquitin, CaMV 35S). Tissue-specific promoters are responsible for gene expression in specific cell or tissue types, such as leaves or seeds (eg, zein, oleosin, napin, ACP, globulin, and the like) and these promoters can also be used. Promoters can also be active during a certain stage of plant development, as well as active in plant tissues and organs. Examples of such promoters include, without limitation, pollen specific, embryo specific, cotton silk specific, cotton fiber specific, root specific, seed endosperm specific, and the like. In a particularly preferred embodiment, the promoter directs expression in tissues and organs in which lipid and oil biosynthesis occurs, particularly in seed cells, such as endosperm cells and cells of the developing embryo. Suitable promoters are the rapeseed oilseed napin gene promoter (U.S. 5,608,152), the USP promoter from Vicia faba (Baumlein et al., 1991), the oleosin promoter from Arabidopsis (WO 98 / 45461), the Phaseolus vulgaris phaseolin promoter (U.S. 5,504,200), the Brassica Bce4 promoter (WO 91 / 13980), or the legumin B4 promoter (Baumlein et al., 1992), and promoters that lead to seed-specific expression in monocots such as corn, barley, wheat, rye, rice, and the like. Suitable notable promoters are the barley lpt2 or Iptl gene promoter (WO 95 / 15389 and WO 95 / 23230) or the promoters described in WO 99 / 16890 (promoters from the barley hordein gene, the rice glutelin gene, the rice oryzine gene, rice prolamine gene, rice wheat gliadin gene, wheat glutelin gene, maize zein gene, oat glutelin gene, sorghum casirin gene, rye secalin gene). Other promoters include those described by Broun et al. (1998) and U.S. 20030159173. Under certain circumstances, it may be desirable to use an inducible promoter. An inducible promoter is responsible for gene expression in response to a specific signal such as, for example: a physical stimulus (thermal shock genes); light (RUBP carboxylase); hormone (Em); metabolites; and stress. Other desirable transcription and translation elements that work in plants can be used. In addition to plant promoters, promoters from a variety of sources can be used efficiently in plant cells to express foreign genes. For example, promoters of bacterial origin, such as the octopine synthase promoter, the nopaline synthase promoter, the mannopine synthase promoter; promoters of viral origin such as cauliflower mosaic virus (35S and 19S), and the like, can be used. It will be clear that transgenic plants adapted for the production of LC-PUFA as described here, in particular DHA, can be eaten directly or used as a source for the extraction of essential fatty acids, of which DHA would be a constituent. As used herein, "germination" refers to emergence of the root tip through the seed coat after soaking. "Germination rate" refers to a percentage of seeds in a population that germinated over a period of time, for example, 7 or 10 days, after soaking. A seed population can be evaluated daily over several days to determine the percentage of germination over time. With respect to the seeds of the present invention, as used herein, the term "germination rate which is substantially the same" means that the germination rate of the transgenic seeds is at least 60%, more preferably at least 80%, and even more preferably at least 90% of that of non-transgenic isogenic seeds. Germination rates can be calculated using methodologies known in the art. With further reference to the seeds of the present invention, as used herein, the term "seed germination time is substantially the same" means that the germination time of the transgenic seeds is at least 60%, more preferably at least 80%, and furthermore more preferably at least 90% of that of non-transgenic isogenic seeds. The twinning moment can be calculated using methodologies known in the art. The present inventors have found that at least in some circumstances LC-PUFA production in recombinant plant cells is increased when the cells are homozygous for the transgene. As a result, it is preferred that the recombinant plant cell, preferably the transgenic plant, be homozygous for at least one desaturase and / or elongase gene. In one embodiment, the cells / plants are homozygous for the A6 / A5 desaturase of zebrafish and / or for elongase from C. elegans. Non-human transgenic animals Methodologies for producing transgenic animals are well known in the art. A useful general textbook on this subject is "Houdebine, Transgenic animals Generation and Use" (Harwood Academic, 1997). Heterologous DNA can be introduced, for example, into fertilized mammalian eggs. For example, totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate-mediated precipitation, liposome fusion, retroviral infection, or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal. . In a highly preferred method, developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals are produced from the infected embryo. In the most preferred method, however, the appropriate DNAs are co-injected into the pronucleus or cytoplasm of the embryos, preferably at the single-cell stage, and the embryos are allowed to develop into mature transgenic animals. Another method used to produce a transgenic animal involves microinjecting a nucleic acid into eggs at the pronuclear stage by standard methods. The injected eggs are then cultured before being transferred into the oviducts of pseudopregnant recipients. Transgenic animals can also be produced by nuclear transfer technology. Using this method, fibroblasts from donor animals are transfected in stable form with a plasmid incorporating the coding sequences for a binding domain or binding partner of interest, under the control of regulatory sequences. Stable transfectants are then fused to enucleated oocysts, cultured and transferred into recipient females. rations The present invention includes compositions that can be used as feeds. For purposes of the present invention, "feed" includes any food or preparation for human or animal consumption (including for enteral and / or parenteral consumption) which, when it enters the body: (a) serves to nourish or form tissues or provide energy ; and / or (b) maintain, restore or support adequate nutritional status or metabolic function. Feeds of the invention include nutritional compositions for infants and / or young children. Feeds of the invention comprise, for example, a cell of the invention, a plant of the invention, the plant part of the invention, the seed of the invention, an extract of the invention, the product of the method of the invention, the product of the fermentation process of the invention , or a composition together with a suitable vehicle(s). The term "vehicle" is used in its broadest sense to encompass any component that may or may not have nutritional value. As will be appreciated by those skilled in the art, the vehicle must be suitable for use (or used at a sufficiently low concentration) in a feed such that it has no deleterious effect on an organism consuming the feed. The feed of the present invention comprises an oil, fatty acid ester or fatty acid produced directly or indirectly by use of the methods, cells or plants disclosed herein. The composition can be in a solid or liquid form. Additionally, the composition can include edible macronutrients, vitamins, and / or minerals in amounts desired for a particular use. The amounts of these ingredients will vary depending on whether the composition is intended for use in normal individuals or for use in individuals who have specialized needs, such as individuals suffering from metabolic disorders and the like. Examples of suitable vehicles with nutritional value include, without limitation, macronutrients such as, for example, edible fats, carbohydrates and proteins. Examples of such edible fats include, without limitation, coconut oil, borage oil, fungal oil, blackcurrant oil, soybean oil, and mono- and diglycerides. Examples of these carbohydrates include (without limitation): glucose, edible lactose, and hydrolyzed starch. Additionally, examples of proteins that can be used in the nutritional composition of the invention include (without limitation) soy proteins, electrodialyzed whey, electrodialyzed skim milk, whey or the hydrolysates of these proteins. With regard to vitamins and minerals, the following may be added to the feed compositions of the present invention: calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine and Vitamins A, E, D, C and the B complex. Other of these vitamins and minerals can also be added. The components used in the feed compositions of present invention may be of semi-purified or purified origin. Semi-purified or purified means a material that has been prepared by purification from a natural material or by de novo synthesis. A feed composition of the present invention can also be added to the feed, even when there is no need for dietary supplementation. For example, the composition can be added to foods of any type, including (without limitation): margarine, modified butter, cheeses, milk, yogurt, chocolate, candies, snacks, salad oils, cooking oils, cooking fats, meats , fish and drinks. The genus Saccharomyces spp. It is used in fermentation in beer and wine making, and also as a baking agent for foods, particularly breads. Yeast is one of the main constituents of plant extracts. Yeast is also used as an additive in animal feed. It will be clear that genetically engineered yeast strains that are adapted to LC-PUFA synthesis as described herein can be provided. These yeast strains can then be used in food products and in wine and beer making to provide products that have an increased fatty acid content and, in particular, DHA content. Additionally, LC-PUFA produced in accordance with the present invention, or host cells transformed to contain and express the genes in question, can also be used as animal feed supplements to alter an animal's tissue or the fatty acid composition of milk to one that is more desirable for human or animal consumption. Examples of such animals include sheep, cattle, horses and the like. Furthermore, the feeds of the invention can be used in aquaculture to increase LC-PUFA levels in fish for human or animal consumption. In mammals, the so-called "Sprecher" pathway converts DPA to DHA by three independent reactions of an A7-elongase, A4-desaturase, and a beta-oxidation step (Sprecher et al., 1995) (Figure 1). Thus, in feeds for mammalian consumption, for example, in formulations for consumption by human babies, it may be necessary to supply only DPA produced using the methods of the invention, since the individual mammal must be able to fulfill its nutritional needs of DHA using the "Sprecher" pathway to convert DPA to DHA. As a result, in one embodiment of the present invention, a feed described herein for mammalian consumption comprises at least DPA, at least one enzymatic reaction having been carried out in the production of DPA by a recombinant enzyme in a cell. compositions The present invention also encompasses compositions, particularly pharmaceutical compositions, comprising one or more of the resulting fatty acids and / or oils produced using the methods of the invention. A pharmaceutical composition may comprise one or more LC-PUFA and / or oils, in combination with a known, non-toxic, pharmaceutically acceptable standardized carrier, adjuvant or vehicle such as, for example, phosphate buffered saline, water, ethanol, polyols, oils vegetables, a wetting agent or an emulsion such as a water / oil emulsion. THE composition may be in liquid or solid form. For example, the composition may be in the form of a tablet, capsule, ingestible liquid or powder, injectable, or topical ointment or cream. Proper fluidity can be maintained, for example, by maintaining the required particle size in the case of dispersions and by using surfactants. It may also be desirable to include isotonic agents, for example, sugars, sodium chloride, and the like. In addition to these inert diluents, the composition can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents and perfuming agents. Suspensions, in addition to the active compounds, may comprise suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances. Solid dosage forms, such as tablets and capsules, can be prepared using methodologies well known in the art. For example, LC-PUFA produced in accordance with the present invention can be compressed with conventional tablet bases such as lactose, sucrose, and corn starch, in combination with binders such as, for example, acacia, corn starch or gelatin, disintegrating agents, such as potato starch or alginic acid, and a lubricant, such as stearic acid or magnesium stearate. Capsules can be prepared by incorporating these excipients into a capsule of gelatin, together with antioxidants and the relevant LC-PUFA(s). For intravenous administration, the PUFA produced according to the present invention, or derivatives thereof, can be incorporated into commercial formulations. A typical dosage of a particular fatty acid is 0.1 mg to 20 g taken one to five times a day (up to 100 g daily), and is preferably in the range of about 10 mg to about 1.2 , 5 or 10 g daily (taken in one or multiple doses). As known in the art, a minimum of about 300 mg / day of LC-PUFA is desirable. However, it will be appreciated that any amount of LC-PUFA will be beneficial to the individual. Possible routes of administration of the pharmaceutical compositions of the present invention include, for example, the enteral route (eg, oral and rectal) and the parenteral route. For example, a liquid preparation can be administered orally or rectally. Additionally, a homogeneous mixture can be completely dispersed in water, mixed under sterile conditions with physiologically acceptable diluents, preservatives, buffers or propellants to form a spray or inhalant. The dosage of the composition to be administered to the patient can be determined by those skilled in the art and depends on various factors such as the patient's weight, the patient's age, the patient's general health, the patient's past history, the patient's immune status of the patient etc. Additionally, the compositions of the present invention can be used for cosmetic purposes. It can be added to pre-existing cosmetic compositions, so that a mixture is formed, or an LC-PUFA produced in accordance with the present invention can be used as the sole "active" ingredient in a cosmetic composition. Medical, veterinary, agricultural and aquaculture uses The present invention also includes the treatment of various disorders by use of the pharmaceutical and / or feed compositions described herein. In particular, the compositions of the present invention can be used to treat restenosis after angioplasty. Furthermore, the symptoms of inflammation, rheumatoid arthritis, asthma and psoriasis can also be treated with the compositions (including feeds) of the invention. Evidence also indicates that LC-PUFA may be involved in calcium metabolism; accordingly, the compositions of the present invention can be used in the treatment or prevention of osteoporosis and kidney or urinary tract stones. Additionally, the compositions of the present invention can also be used in the treatment of cancer. Malignant cells have been shown to have altered fatty acid compositions. The addition of fatty acids has been found to slow down cell growth, cause cell death and increase its susceptibility to chemotherapeutic agents. Furthermore, the compositions of the present invention may also be useful for treating cachexia associated with cancer. The compositions of the present invention can also be used to treat diabetes, since it has been shown that metabolism and fatty acid composition are altered in diabetic animals. Furthermore, the compositions of the present invention, which comprise LC-PUFA produced directly or indirectly through the use of the cells of the invention, they can also be used in the treatment of eczema and in the reduction of blood pressure. Additionally, the compositions of the present invention can be used to inhibit platelet aggregation, to induce vasodilation, to reduce cholesterol levels, to inhibit proliferation of vessel wall smooth muscle and fibrous tissue, to reduce or prevent gastrointestinal bleeding, and other side effects of nonsteroidal anti-inflammatory drugs (U.S. 4,666,701), to prevent or treat endometriosis and premenstrual syndrome (U.S. 4,758,592), and to treat myalgic encephalomyelitis and chronic fatigue after viral infections (U.S. 5,116,871). Additional uses of the compositions of the present invention include, without limitation, use in the treatment or prevention of cardiac arrhythmia, angioplasty, AIDS, multiple sclerosis, Crohn's disease, schizophrenia, fetal alcohol syndrome, attention deficit hyperactivity disorder, cystic fibrosis, phenylketonuria, unipolar depression, aggressive hostility, adrenoleukodystrophy, coronary heart disease, hypertension, obesity, Alzheimer's disease, chronic obstructive pulmonary disease, ulcerative colitis or an eye disease, in addition to maintaining general health. Furthermore, the nutritional and pharmaceutical compositions described above can be used in connection with animals (i.e., domestic or non-domestic animals, including mammals, birds, reptiles, lizards, etc.), in addition to humans, since animals have many of the same needs and conditions as the humans. For example, the oil or fatty acids of the present invention can be used in animal feed supplements, animal feed substitutes, animal vitamins or topical ointments for animals. Compositions such as the feeds of the invention can also be used in aquaculture to increase LC-PUFA levels in fish for human or animal consumption. Any amount of LC-PUFA will be beneficial to the individual. However, it is preferred that an "amount effective to treat" the condition of interest be administered to the individual. Such dosages for effectively treating a condition that would benefit from administration of an LC-PUFA are known to those skilled in the art. As an example, a dose of at least 300 mg / day of LC-PUFA for at least a few weeks, more preferably more, would be adequate in many circumstances. antibodies The invention also provides monoclonal and / or polyclonal antibodies that specifically bind to at least one polypeptide of the invention or a fragment thereof. Thus, the present invention also provides a process for producing monoclonal and / or polyclonal antibodies to the polypeptides of the invention. The term "specifically binds" refers to the ability of the antibody to bind at least one protein of the present invention, but not other proteins present in a recombinant cell, particularly one recombinant plant cell of the invention. As used herein, the term "epitope" refers to a region of a protein of the invention that is bound by the antibody. An epitope can be administered to an animal to generate antibodies against the epitope, however, antibodies of the present invention preferably specifically bind to the region of the epitope in the context of the entire protein. If polyclonal antibodies are desired, a selected mammal (eg, mouse, rabbit, goat, horse, etc.) is immunized with an immunogenic polypeptide. Serum from the immunized animal is collected and treated according to known procedures. If serum containing polyclonal antibodies contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Methodologies for producing and processing polyclonal antisera are known in the art. In order that such antibodies can be made, the invention also provides polypeptides of the invention or fragments thereof haptenized to another polypeptide for use as immunogens in animals or humans. Monoclonal antibodies directed against polypeptides of the invention can also be readily produced by those skilled in the art. The general methodology for the production of monoclonal antibodies by hybridomas is well known. Immortal antibody-producing cell lines can be created by cell fusion, and also by other techniques, such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. Panels of produced monoclonal antibodies can be screened for several properties; that is, for isotype and epitope affinity. An alternative technique involves screening phage display libraries in which, for example, the phage express scFv fragments on the surface of their coat with a wide variety of complementarity determining regions (CDRs). Such methodology is well known in the art. For purposes of this invention, the term "antibody", unless otherwise specified, includes fragments of whole antibodies that retain their binding activity for a target antigen. Such fragments include Fv, F(ab') and F(ab') fragments 2 , in addition to single-chain antibodies (scFv). Furthermore, the antibodies and fragments thereof can be humanized antibodies, for example as described in EP-A-239400. Antibodies of the invention may be bound to a solid support and / or packaged in kits in a suitable container together with suitable reagents, controls, instructions and the like. Preferably, the antibodies of the present invention are detectably labeled. Exemplary detectable labels that allow direct measurement of antibody binding include radioactive labels, fluorophores, dyes, magnetic beads, chemiluminescent substances, colloidal particles, and the like. Examples of labels that allow indirect measurement of binding include enzymes where the substrate can provide a colored or fluorescent product. Additional exemplary detectable labels include form-linked enzymes covalently capable of providing a detectable product signal upon addition of suitable substrate. Examples of enzymes suitable for use in conjugates include horseradish peroxidase, alkaline phosphatase, malate dehydrogenase and the like. When not commercially available, such antibody-enzyme conjugates are readily produced by methodologies known to those skilled in the art. Additional exemplary detectable labels include biotin, which binds with high affinity to avidin or streptavidin; fluorochromes (eg. phycobiliproteins, phycoerythrin and allophycocyanins; fluorescein and Texas red), which can be used with a fluorescence-activated cell sorter; haptens; and the like. Preferably, the detectable label allows for direct measurement in a plate luminometer, e.g., biotin. Such labeled antibodies can be used in methodologies known in the art to detect proteins of the invention. EXAMPLES Example 1. Materials and methods Pavlova saline cultivation Pavlova salina isolates including strain CS-49 from the CSIRO Living Microalgae Collection were grown under standard culture conditions 🇧🇷 http: / / www.marine.csiro.au / microalgae 🇧🇷 A stock culture from the Collection was subcultured and amplified at a 1 in 10 dilution over consecutive transfers into 1 liter Erlenmeyer flasks, and then into 10 liter polycarbonate carboys. The culture medium was f / 2, a modification of Guillard's f medium and Ryther (1962) containing medium potency nutrients, with a growth temperature of 20±1°C. Other culture conditions included a light intensity of 100 pimol. photons PAR.m' 2 .s'l, light period 12:12 hours light:dark and CO bubbling 2 1% to air at a rate of 200 ml.l* 1 .min'' Cultivation and nutrition of yeast with precursor fatty acids Plasmids were introduced into yeast by heat shock and transformants were selected on yeast minimal medium (YMM) plates containing 2% raffinose as the sole carbon source. Clonal inoculum cultures were established in liquid YMM with 2% raffinose as the sole carbon source. Experimental cultures were inoculated from these in YMM + 1% NP-40 up to an OD S initial oo of -0.3. Cultures were grown at 30°C with shaking (-60 rpm) until the OD 6 oo was approximately 1.0. At this point, galactose was added to a final concentration of 2% and the precursor fatty acids were added to a final concentration of 0.5 mM. Cultures were incubated at 20°C with shaking for an additional 48 hours before harvesting by centrifugation. Cell pellets were washed with 1% NP-40, 0.5% NP-40 and water to remove any unincorporated fatty acids from the cell surface. Gas chromatography (GC) analysis of fatty acids Fatty acid preparation Fatty acid methyl esters (FAME) were formed by transesterification of the centrifuged pellet of yeast or Arabidopsis seeds by heating with MeOH-CHCl 3 -HCl (10:1:1, v / v / v) at 90-100°C for 2 hours in a tube of test glass fitted with a Teflon-coated screw cap. FAME were extracted in hexane-dichloromethane (4:1, v / v) and analyzed by GC and GC-MS. Capillary Gas-Liquid Chromatography (GC) FAMEs were analyzed with a Hewlett Packard (IV) 5890 GC or an Agilent 6890 gas chromatograph fitted with HP 7673A or 6980 series autoinjectors, respectively, and a flame ionization detector (FID). The injector and detector temperatures were 290°C and 310°C, respectively. FAME samples were injected at 50°C into a non-polar criss-cross capillary column of fused silica methyl silicone (HP-5; 50 m x 0.32 mm i.d.; 0.17 µm film thickness). After 1 minute, the oven temperature was raised to 210°C at 30°C min’ 1 , and then to a final temperature of 280°C at 3°C ​​min’ 1 , where it was maintained for 5 minutes. Helium was the carrier gas with a column head pressure of 65 kPa and the vent opened 2 minutes after injection. Peak identification was based on comparison of relative retention time data with standard FAME with confirmation using mass spectrometry. For quantification, the computer program Empower (Waters) or Chemstation (Agilent) was used to integrate the peak areas. Gas chromatography-mass spectrometry (GC-MS) GC-MS was performed on a Finnigan GCQ Plus GC-MS ion harvester fitted with a column injection set at 4°C. Samples were injected using an AS2000 automatic sampler into a holding gap attached to an HP-5 Ultra 2 phase bound column (50 m x 0.32 mm i.d. x 0.17 µm film thickness). The initial temperature of 45°C was maintained for 1 minute, followed by programming the temperature at 30°C.min' 1 up to 140°C, then at 3°C.min’ 1 to 310°C, where it was held for 12 minutes. Helium was used as carrier gas. The operating conditions of the mass spectrometer were: electronic impact energy 70 eV; emission current 250 pamp, transfer line 310°C; source temperature 240°C; scan rate 0.8 sweeps. s' 1 and mass range 40-650 Daltons. Mass spectra were acquired and processed with the Xcalibur™ computer program. P. salina cDNA library construction mRNA, for construction of a cDNA library, was isolated from P. salina cells using the following method. Two grams (wet weight) of P. salina cells were ground to a powder using a pestle and mortar in liquid nitrogen, and slowly dropped into a beaker containing 22 ml of extraction buffer that was being stirred constantly. To this, 5% insoluble polyvinylpyrrolidone, 90 mM 2-mercaptoethanol and 10 mM dithiotheitol were added and the mixture stirred for a further 10 minutes before being transferred to a Corex™ tube. 18.4 ml of 3M ammonium acetate was added and mixed well. The sample was then centrifuged at 6000 xg for 20 minutes at 4°C. The supernatant was transferred to a new tube and the nucleic acid precipitated by adding 0.1 volume of 3M NaAc (pH 5.2) and 0.5 volume of ice-cold isopropanol. After a 1 hour incubation at -20°C, the sample was centrifuged at 6000 xg for 30 minutes in a swinging rotor. The pellet was resuspended in 1 ml of water and extracted with phenol / chloroform. the aqueous layer he was transferred to a new tube and the nucleic acids were precipitated once more by the addition of 0.1 volume of 3M NaAc (pH 5.2) and 2.5 volumes of super-cold ethanol. The pellet was resuspended in water, the nucleic acid concentration determined and then the mRNA isolated using the Oligotex mRNA system (Qiagen). First strand cDNA was synthesized using an oligo-dT primer supplied with the ZAP-cDNA synthesis kit (Stratagene - cat.# 200400) and Superscript!!! (Invitrogen). The double-stranded cDNA was ligated into the EcoRT / XhoT adapters and from there a library was constructed using the ZAP-cDNA synthesis kit as described in the accompanying instruction manual (Stratagene - cat # 200400). The primary library titre was 2.5 x 10 5 plaque forming units (pfu) / ml, and that of the amplified library was 2.5 x 10 9 pfu / ml. The average insert size of cDNA inserts in the library was 1.3 kilobases and the percentage of recombinants in the library was 74%. Example 2. Microalgae and their polyunsaturated fatty acid content The CSIRO Collection of Living Microalgae CSIRO has established and maintained a Living Microalgae Collection (LML) containing over 800 strains from 140 genera representing most classes of marine and some freshwater microalgae (list of strains downloadable at http: / / www.marine.csiro.au 🇧🇷 Selected microheterotrophic strains were also maintained. The collection is the largest and most diverse microalgae culture collection in Australia. CLM focuses on isolates from Australian waters - over 80% of strains have been isolated from diverse localities and climate zones, from the tropical north of Australia to the Antarctic Territory of Australia, from oceanic, littoral, estuary, intertidal and freshwater environments. Additionally, emphasis was placed on representing different populations of a single species, usually by more than one strain. All strains in the culture collection were unicellular algae and most were clonal. A subset of strains were axenic. Another collection is the NIES Collection ("National Institute for Environmental Studies", Environment Agency) held in Japan. Microalgae are known for their cosmopolitan character at the morphological species level, with very low endemicity being evident. However, this cosmopolitan morphological character can hide a plethora of diversity at the infraspecific level. There have been several studies of genetic diversity in different microalgae, using approaches such as interbreeding, isozymes, growth rates and a range of molecular techniques. The diversity identified by these studies ranges from large regional and global scales (Chinain et al., 1997) to between and within populations (Gallagher, 1980; Medlin et al., 1996; Bolch et al., 1999a,b). Variation at the intraspecific level, between morphologically indistinguishable microalgae, can usually only be identified using strains isolated from the environment and grown in the laboratory. It is essential to have identifiable and stable genotypes within collections of cultures. Although there are reported cases of alteration or loss of specific traits in long-term cultures (Coleman, 1977), in general, cultivation guarantees the genetic continuity and stability of a particular strain. Cryopreservation strategies could also be used to limit the potential for genetic bias. Microalgae and its use in aquaculture Due to their chemical / nutritional composition, which includes PUFAs, microalgae are used in aquaculture as live feed for various marine organisms. These microalgae need to be of adequate size for ingestion and digested quickly. They must have rapid growth rates, be amenable to mass culture, and also be stable in culture to fluctuations in temperature, light, and nutrients that can occur in rearing systems. Strains that fulfill these attributes and that are used widely in aquaculture include northern hemisphere strains such as Isochrysis sp. (T.ISO) CS-177, Pavlova, lutheri CS-182, Chaetoceros calcitrans CS-178, C. muelleri CS-176, Skeletonema costatum CS-181, Thalassiosira pseudonana CS-173, Tetraselmis suecica CS-187 and Nannochloropsis oculata CS -189. Australian strains used include Pavlova pinguis CS-375, Skeletonema sp. CS-252, Nannochloropsis sp. CS-246, Rhodomonas sauna CS-24 and Navicula jeffreyi CS-46. Biochemical evaluation of more than 50 strains of microalgae used (or potentially used) in aquaculture found that cells grown to the late logarithmic growth phase typically contained 30 to 40% protein, 10 to 20% lipid, and 5 to 15% carbohydrate (Brown et al., 1997). Lipid composition that includes PUFA content from microalgae There is considerable interest in microalgae containing a high content of the nutritionally important long-chain polyunsaturated fatty acids (LC-PUFA), in particular EPA (eicosapentaenoic acid, 20:5(oo3)) and DHA (docosahexaenoic acid, 22:6(< o3)), as these are essential for the health of humans and aquaculture animals. Although these PUFAs are available in fish oils, microalgae are the primary producers of EPA and DHA. A profile was created of the lipid composition of a wide range of microalgae (46 strains) and, in particular, of the proportion and content of important PUFAs in the lipid of the microalgae. The composition of PUFA Ci 8 -Ç2 2 of microalgal strains from different algal classes varied considerably across a wide range of phototrophic algal classes (Table 3, Figure 2; see also Dunstan et al., 1994, Volkman et al., 1989; Mansour et al. , 1999a). Diatoms and eustigmatophytes were rich in EPA and produced small amounts of the less common PUFA, ARA (arachidonic acid, 20:4(®6)), with negligible amounts of DHA. Furthermore, diatoms made unusual Cis PUFAs such as 16:4(ool) and 16:3(co4). In contrast, dinoflagellates had high concentrations of DHA and moderate to high proportions of EPA and PUFA Ci 8 precursor (18:5 (co3) and 18:4 (w3) SDA, stearidonic acid). Cocolithophorids also contained EPA and DHA, with EPA being the dominant PUFA. Cryptomonads were a rich source of PUFA C18 18:3 (003) (ALA a-linolenic acid) and SDA, in addition to EPA and DHA. Green algae (eg Chlorophytes such as Dunaliella spp. and Chlorella spp.) were relatively deficient in PUFA C 20 and C 22 , although some species had small amounts of EPA (up to 3%) and typically contained abundant ALA and 18:2(©6), and were also capable of making 16:4(©3). The biochemical or nutritional significance of PUFAs Ci 6 unusual (e.g. 16:4(©3), 16:4 (©1) , 16:3(o>4)) and Ci PUFAs 8 (eg 18:5 (©3) and STA) is uncertain. However, there is current interest in PUFA C 18 such as SDA, which are now increasingly recognized as precursors to the beneficial EPA and DHA, as opposed to ALA, which has only limited conversion to EPA and DHA. New strains of Australian thraustochytrids have been isolated. When examined, these thraustochytrids showed great morphological diversity from single cells to clusters of cells, complex reticulated shapes, and motile stages. Thraustochytrids are a group of single-celled organisms that produce high oil and LC-PUFA content. They were initially believed to be primitive fungi, although more recently they have been assigned to the subclass Thraustochytridae (Chromist, Heterocount), which places them more closely related to other heterocount algae (eg, diatoms and brown algae). Under culture, thraustochytrids can achieve considerably higher biomass yields (>20 g / l) than other microalgae. Furthermore, thraustochytrids can grow in fermenters with an organic source of carbon and therefore represent a highly attractive source, Renewable and contaminant-free omega-3 oils. TABLE 3. Distribution of selected PUFA and LC-PUFA in microalgae and other groups, and areas of application. Group Genus / Species PUFA Application Eustigmatophytes Nannochloropsis EPA Aquaculture Diatoms Chaetoceros Dinoflagellates Ctypthecodinium cohnii DHA Aquaculture, health Thraustochytrids Schizochytri um supplements, baby formula Red Algae Phorphyridium ARA Aquaculture, baby formula Thraustochytrids undescribed species Pharmaceutical industry Fungi Mortiella (precursor to prostaglandins) Algae Blue Green Spirulina GLA Health Supplements Abbreviations: γ-linolenic acid, GLA, 18:3(o6; 20:5a>3, eicosapentaenoic acid, EPA, 20:5co3; docosahexaenoic acid, DHA, 22:6co3; arachidonic acid, ARA, 20:4(06. Representative fatty acid profiles for Australian thraustochytrids are shown in Table 4. Strain 0 was particularly attractive as it contained very high levels of DHA (61%). Other PUFAs were present in less than 5% each. Higher Thraustochytrids containing DHA often also contained high ratios of 22:5co6, docosapentaenoic acid (DPA), as was observed for strains A, C, and H. DPA was only one minor component in strain 0 under the culture conditions employed, making this strain particularly interesting. Strain A contained both DHA (28%) and EPA (16%) as the main LC-PUFA. Strains C and H differed from the other strains, with ARA (10-13%) also being present as an important LC-PUFA. Several other LC-PUFAs were present in thraustochytrids, including DPA(3) and 22:4(06, and other components. TABLE 4. Fatty acid composition (% of total) of thraustochytrid strains. Fatty acid Percent Composition Strain A C H 0 16 : 0 18.0 16.4 13.5 22.1 20:4(06 ARA 4.0 10.5 13.4 0.7 20:50 EPA 15.8 7, 7 5.2 4.1 22:5(06 DPA ( 6) 16.6 9.3 12.7 3.4 22:6(03 DHA 28.2 21.6 19.2 61.0 The microalgae and thraustochytrids isolated at CLM that can be used for the isolation of genes involved in LC-PUFA synthesis are from the following genera or species: Class Bacillariophyceae (Diatoms) Attheya septentrionalis, Aulacoseira sp., Chaetoceros affinis, Chaetoceros calcitrans, Chaetoceros calcitrans f. pumilum, Chaetoceros cf. mitra, Chaetoceros cf. peruvianus, Chaetoceros cf. radians, Chaetoceros didymus, Chaetoceros Chaetoceros gracilis, Chaetoceros muelleri, Chaetoceros simplex, Chaetoceros socialis, Chaetoceros sp. , Chaetoceros cf. minus, Chaetoceros cf. tenuissimus, Coscinodiscus wailesii, other Coscinodiscus spp., Dactyliosolen fragilissimus, Detonula pumila, Ditylum brightwellii, Eucampia zodiacus, Extubocellulus spinifera, Lauderia annulata, Leptocylindrus danicus, Melosira moniliformis, Melosira sp. , Minidiscus trioculatus, Minutocellus polymorphus, Odontella aurita, Odontella mobiliensis, Odontella regia, Odontella rhombus, Odontella sp., Papiliocellulus simplex, Planktosphaerium sp., Proboscia alata, Rhizosolenia imbricata, Rhizosolenia setigera, Rhizosolenia sp., Skeletonema costatum, Skeletonema pseudocostatum, Skeletonema sp. , Skeletonema tropicum, other Skeletonema spp., Stephanopyxis turris, Streptotheca sp., Streptotheca tamesis, Streptotheca spp., Striatella sp., Thalassiosira delicatula, Thalassiosira eccentrics, Thalassiosira mediterranean, Thalassiosira oceanica, Thalassiosira oestrupii, Thalassiosira profundus, Thalassiosira pseudosirana , Thalassiosira stellaris, other Thalassiosira spp., Achnanthes cf. amoena, Amphiprora of. alata, Amphiprora hyalina, Amphora spp., Asterionella glacialis, Asterionellopsis glacialis, Biddulphia sp., Cocconeis sp., Cylindrotheca closterium, Cylindrotheca fusiformis, Delphineis sp., Diploneis sp., Entomoneis sp. , Fallacia carpentariae, Grammatophora oceanica, Haslea ostrearia, Licmophora sp., Manguinea sp. , Navicula cf. jeffreyi, Navicula jeffreyi, other Navicula spp., Nitzschia cf. bilobata, Nitzschia cf. constricta, Nitzschia cf. cylindrus, Nitzschia cf. frustulum, Nitzschia cf. paleacea, Nitzschia closterium, Nitzschia fraudulent, Nitzschia frustulum, Nitzschia sp., Phaeodactylum tricornutum, Pleurosigma delicatulum, other Pleurosigma spp., Pseudonitzschia australis, Pseudonitzschia delicatissima, Pseudonitzschia fraudulenta, Pseudonitzschia pseudodelicatissima, Pseudonitzschia pungens, Pseudonitzschia sp., Pseudostaurosira shiloi, Thalassionema nitzschioides, or Thalassiothrix heteromorpha. Class Chrysophyceae Chrysolepidomonas cf. marina, Hibberdia spp., Ochromonas danica, Pelagococcus subviridis, Phaeoplaca spp., Synura shagnicola or other Chrysophyte spp. Class Cryptophyceae Chroomonas placoidea, Chroomonas sp. , Geminigera cryophila, Hemiselmis simplex, Hemiselmis sp. , Rhodomonas baltica, Rhodomonas maculata, Rhodomonas salina, Rhodomonas sp. or other Cryptomonad spp. Class Dinophyceae (Dinophagellates) Alexandrium affine, Alexandrium catenella, Alexandrium margalefi, Alexandrium minutum, Alexandrium protogonyaulax, Alexandrium tamarense, Amphidinium carterae, Amphidinium cf britannicum, Amphidinium klebsii, Amphidinium sp., Amphidinium steinii, Amylax tricantha, Ciyptothecodinium cohnii, Ensiculifera sp., Fragilidium spp., Gambierdiscus toxicus, Gymnodinium catenatum, Gymnodinium galathaneum, Gymnodinium galatheanum, Gymnodinium nolleri, Gymnodinium sanguineum, or other Gymnodinium spp., Gyrodinium pulchellum, or other Gyrodinium spp., Heterocapsa niei, Heterocapsa rotundata, Katodinium cf, rotundatum, Kryptoperidinium foliaceum, Peridironcentrum, Peridironcentrum gracile, Prorocentrum mexicanum, Prorocentrum miccins, Protoceratium reticulatum, Pyrodinium bahamense, Scrippsiella cf, precaria, or other Scrippsiella spp., Symbiodinium microadriaticum or Woloszynskia sp. Class Euglenophyceae Euglena gracilis, Class Prasinophyceae Pycnococcus sp. Mantoniella squamata, Micromonas pusilla, Nephroselmis draft, Nephroselmis pyriformes, nephroselmis roundabout, Nephroselmis spp., or others Prasinophyte spp., Pseudoscourfieldia marina, Pycnococcus provasolii Pyramimonas cordata, Pyramimonas gelicola, Pyramimonas grossii, Pyramimonas oltmansii, Pyramimonas propulsion, other Pyramimonas spp., Tetraselmis Antarctica, Tetraselmis chuii, Tetraselmis Tetraselmis Swedish, or other Tetraselmis spp. Class Prymnesiophyceae Chrysochromulina acantha, Chrysochromulin apheles, Chrysochromulin brevifilum, Chrysochromulin camellia, Chrysochromulin stiff, Chrysochromulin kappa, Chrysochromulin minor Chrysochromulin pienaar, Chrysochromulin simplex Chrysochromulin sp. 🇧🇷 Chrysochromulin spinifera, Chrysochromulina strobilus, and other Chrysophyte spp., Chrysotila lamelosa, Cricosphaera carterae, Crystallolithus hyalinus, Diacronema vlkianum, Dicrateria inornata, Dicrateria sp. , Emiliania huxleyi, Gephyrocapsa oceanica, Imantonia rotunda, and other Isochrysis spp., Ochrosphaera neapolitana, Pavlova cf, pinguis, Pavlova gyrans, Pavlova lutheri, Pavlova pinguis, Pavlova salina, Pavlova sp., Phaeocystis cf. pouchetii, Phaeocystis globosa, Phaeocystis pouchetii, other Phaeocystis spp., Pleurochrysis cf. carterae, Prymnesium parvum, Prymnesium patelliferum, other Prymnesium spp. or Pseudoisochrysis paradoxa. Class Rapidophyceae Chattonella antiqua, other Chattonella spp., Fibrocapsa japonica, other Fibrocapsa spp., Heterosigma akashiwo, Heterosigma carterae, or other Heterosigma spp. Class Thraustochytridae Schizochytrium spp., Thraustochytrium aureum, Thraustochytrium roseum or other Thraustochytrium spp. Class Eustigmatophytae as a source of genes for EPA production: Eustigmatos vischeri, Monodus subterraneus, Nannochloropsis oculata, Nannochloropsis salina, Vischeria helvetica, Vischeria punctata, Chloridella neglecta, Chloridella simplex, Chlorobotrys regularis, Ellipsoidon parvum, Ellipsoidon solitare, Eustigmatos magnus, Eustigmatos polyphem, Goniochloris sculpta, Monodus subterraneus, Monodus unipapilla, Nannochloropsis gaditana, Nannochloropsis gaditana, Nannochloropsis gaditana , Pseudocharaciopsis ovalis, Pseudocharaciopsis texensis, Pseudostaurastrum limneticum or Vischeria stellata. Example 3. Isolation and functional characterization of zebrafish A5 / 6 desaturase in yeast Like microalgae, some other organisms have the ability to synthesize LC-PUFA from precursors such as, for example, a-linolenic acid (18:3, ALA) (see Figure 1), and some of the genes responsible for this synthesis have been isolated (see Sayanova and Napier, 2004). The genes involved in the biosynthesis of +PUFA C 20 Omega-3s have been cloned from various organisms including algae, fungi, mosses, plants, nematodes and mammals. Based on current knowledge about the genes involved in the synthesis from + PUFA C 2 omega-3, EPA synthesis in plants would require the transfer of genes encoding at least two desaturases and one PUFA elongase. The synthesis of DHA from EPA in plants would require the additional transfer of one more desaturase and one more elongase (Sayanova and Napier, 2004). These enzymes are: for the synthesis of EPA, the sequential activities of an A6-desaturase, A6-elongase and an A5-desaturase are required. Based on an alternative operative pathway in some algae, EPA can also be synthesized by the sequential activities of an A9-elongase, an A8-desaturase and an A5-desaturase (Wallis and Browse, 1999; Qi et al., 2002). For the further conversion of EPA to DHA in plants, an additional transfer of an A5-elongase and an A4-desaturase will be required (Sayanova and Napier, 2004). Hastings et al. (2001) isolated a gene encoding a bifunctional A5 / A6-desaturase from zebrafish (Danío rerio) and showed that, when expressed in yeast, the desaturase was able to catalyze the synthesis of A6 fatty acids (GLA and SDA) and A5 (20:4 and EPA). The desaturase was therefore able to act on co6 and ©3 substrates. Isolation of zebrafish A5 / A6-desaturase RNA was extracted using the RNAeasy system according to the manufacturer's instructions (Qiagen) from freshly dissected zebrafish livers. Based on published sequence (Hastings et al 2001), sense primers, 5'-CCCAAGCTTACTATGGGTGGGCGGAGGACAGC-3' (SEQ ID. NO: 39) and antisense 5'-CCGCTGGAGTTATTTGTTGAGATACGC-3' (SEQ ID. No.: 40) at the 5' and 3' ends of the zebrafish A5 / 6 ORF were designed and used in a reverse transcription- One-step PCR (RT-PCR, Promega) with the extracted RNA and using the manufacturer's recommended buffer conditions. A single amplicon with a size of 1,335 bp was obtained, ligated into pGEM-T easy (Promega) and the sequence confirmed as identical to that published. A fragment containing the entire coding region (SEQ ID NO: 38) was excised and ligated into the pYES2 yeast shuttle vector (Invitrogen). The pYES2 vector carried the URA3 gene, which allowed selection of yeast transformants based on uracil prototrophy. The inserted coding region was under control of the inducible GAL1 promoter and the pYES2 polyadenylation signal. The resulting plasmid was designated pYES2-zfA5 / 6, for introduction and expression in yeast (Saccharomyces cerevisiae). Expression of zebrafish A5 / A6-desaturase in yeast The pYES2-zfA5 / 6 gene construct was introduced into yeast strain S288. Yeast was a good host for analyzing the potential heterologous biosynthesis of LC-PUFA genes, including desaturases and elongases, for several reasons: it was easily transformed. It did not synthesize LC-PUFA itself and therefore any new PUFA made was easily detectable without any background problems. In addition, yeast cells rapidly incorporated fatty acids from the growth media into cellular lipids, thus allowing the presentation of appropriate precursors to transformed cells containing genes encoding new enzymes, allowing confirmation of their enzymatic activities. Biochemical analyzes Yeast cells transformed with pYES2-zfA5 / 6 were grown in YMM medium and induced by the addition of galactose. 18:3(»3 (ALA, 0.5 mM) or 20:4co3 (ETA, 0.5 mM) fatty acids were added to the medium as described above. After 48 hours of incubation, the cells were harvested and the Fatty acid analysis was performed by capillary gas-liquid chromatography (GC) as described in Example 1. The analysis showed that 18:4co3 (1.9% of the total fatty acid) was formed from 18:3co3 and 20: 5co3 (0.24% of fatty acids) from 20:4a>3, demonstrating A6 desaturase activity and A5-desaturase activity, respectively.These data are summarized in Table 5 and confirm the results of Hastings et al ( 2001). Example 4. Isolation and functional characterization of elongase from C. elegans in yeast Cloning of the C. elegans elongase gene Beaudoin and coworkers isolated a gene encoding an ELO-like fatty acid elongase from the nematode Caenorhabditis elegans (Beaudoin et al., 2000), and this gene was isolated as follows: oligonucleotide primers having the sequences 5'-GCGGGTACCATGGCTCAGCATCCGCTC-3 ' (SEQ ID. No.: 41) (sense orientation) and 5'-GCGGGATCCTTAGTTGTTCTTCTTCTT-3' (SEQ ID. NO: 42) (antisense orientation) were designed and synthesized, based on the 5' and 3' ends of the elongase coding region. These primers were used in a PCR reaction to amplify the 867 base pair coding region from a C. elegans N2 mixed stage gene library using an annealing temperature of 58°C and an extension time of 1 minute. THE PCR amplification was performed for 30 cycles. The amplification product was inserted into the pGEM™ T-easy vector (Promega) and the nucleotide sequence confirmed (SEQ ID NO: 37). An EcoRI / BamHI fragment including the entire coding region was removed and inserted into the EcoRI / BglIT sites of pSEC-TRP (Stratagene), generating pSEC-Ceelo, for introduction and expression in yeast. pSEC-TRP contains the TRP1 gene, which allowed the selection of transformants in yeast by tryptophan prototrophy, and the GAL1 promoter for inducible expression of the chimeric gene in the presence of galactose in the growth medium. TABLE 5. Enzymatic activities in yeast and Arabidopsis PUFA clone Synthesized PUFA precursor % (of total FA) Observed activity pYES2-zfA5 / 6 18 : 3 0)3 18 : 40)3 1,9 A6-desaturase pYES2-zfA5 / 6 20:40)3 20 : 50)3 0.24 A5-desaturase pYES2zfA5 / 6, pSEC-Ceelo 18 : 3 0)3 18 :40)3 0.82 A6-desaturase 20 : 30)3 0.20 A9-elongase 20 :40)3 0.02 A6 -elongase NO pYES2-psA8 18 : 3 0)3 18:4w3 A6-desaturase pYES2-psA8 20 :30)3 20 :40)3 0,12 A8-desaturase pYES2-psELOl 18 : 2 0)6 20 : 20) 6 pYES2-psELOl 18 : 3 0)3 pYES2-psELOl 20 : 30)3 22 : 30)3 pYES2-psELOl 20 :40)3 22 :40)3 pYES2-psELOl 20 : 50)3 22 : 50)3 0 .82 AS elongase pYES-psELO2 18 : 2(o6 20 : 2(o6 0,12 A9 elongase pYES-psELO2 18:3(03 20 : 3(03 0,20 A9 elongase pYES-psELO2 20 : 3(03 22 : 3( 03 pYES-psELO2 20 : 4(03 22 :4(03 pYES-psELO2 20 : 5(03 22 : 5(03 Arabidopsis + zfA5 / 6 & Ceelo (plant #1) - 18 : 3(06 0.32 A5 / 6-desaturase, A5 / 6 / 9- elongase - 18 :4(03 1.1 - 20:4(06 1.1 - 20 : 5(03 2.1 - 20 : 3(06 1.1 - 20: 4(03 0.40 - 20 : 2(06 3.2 - 20 : 3(03 TR - 22 :4(06 0.06 - 22 : 5(03 0.13 22 : 3(06 0.03 TR, traces, not precisely determined. Functional characterization of C. elegans elongase gene in yeast Yeast strain 5288 was transformed using the 5 method described in Example 1, with both pYES2-zfA5 / 6 and pSEC-Ceelo vectors simultaneously and the double transformants were selected in YMM medium devoid of tryptophan and uracil. Transformants grew well on both minimal and enriched media, in contrast to transformants of the S288 strain carrying only pSEC-Ceelo, in the absence of pYES2-zfA5 / 6, which grew very poorly. Double transformants were grown in YMM medium and induced by the addition of galactose. The fatty acid 18:3ct>3 (ALA, 0.5 mH) was added to the medium and, after incubation for 48 hours, the cells were harvested and the analysis of fatty acids was performed by capillary gas-liquid chromatography (GC), as described in Example 1. Analysis showed that 18:4to3 (0.82% of the total fatty acid) and 20:3co3 (0.20%) were formed from 18:3co3, and 2O:4co3 (0.02 % of fatty acids) from any of these, demonstrating the harmonic action of an elongase activity in addition to the A6-desaturase activity and the A5-desaturase activity of the zebrafish desaturase (Table 5). The harmonic action of a bifunctional A5 / 6-desaturase gene and an elongase gene has not been previously reported. In particular, the use of a bifunctional enzyme, if it shows the same activities in plant cells, would reduce the number of genes that would need to be introduced and expressed. This, too, had not been previously reported. Example 5. Coordinated expression of fatty acid desaturase and elongase in plants Genetic construct for co-expression of zebrafish A6 / A5 desaturase and C. elegans elongase in plant cells Beaudoin et al. (2000) showed that A6-de elongase from C. elegans, when expressed in yeast, could elongate C fatty acids 18 A6 desaturated GLA and DAS, that is, it would have A6-elongase activity in Cis substrates • They also showed that the protein does not had A5-elongase activity on a substrate C 20 in yeast. We therefore tested whether this elongase would be able to elongate the A6 desaturated fatty acids GLA and SDA in Arabidopsis seed. Arabidopsis thaliana seed has been shown to contain both omega-6 (18:2, LA) and omega-3 (18:3, ALA) fatty acids (Singh et al., 2001). The presence of 18:3 in particular makes Arabidopsis seed an excellent system for studying gene expression that could lead to the synthesis of +PLTFA C 20 omega-3s like EPA and DHA. Testing for elongase activity in Arabidopsis required the coordinated expression of an A6-desaturase in the seed to first form GLA or DAS. We chose to express the elongase gene in conjunction with the zebrafish desaturase gene described above. There were no previous reports of expression of the zebrafish A6 / A5-desaturase and C. elegans elongase genes in plant cells, either individually or together. Seed-specific co-expression of the zebrafish A6 / A5 desaturase and C. elegans elongase genes was achieved by placing the genes independently under control of a 309 fragment of the napin promoter, designated Fpl (Stalberg et al. , 1993). For plant transformation, the genes were inserted into the pWvec8 binary vector composed of a hygromycin-enhanced resistance gene as a selectable marker (Wang et al., 1997). To accomplish this, the C. elegans elongase coding region from Example 4 was inserted as a blunt-end fragment between the polyadenylation / terminator Fpl and Nos 3' in binary vector pWvecS, forming pCeloPWvec8. The zebrafish A5 / A6 desaturase coding region from Example 3 was initially inserted as a blunt-ended fragment between the Fpl and Nos 3' terminator sequences and this expression cassette assembled between the HindlII and Apal cloning sites of pBluescript cloning vector (Stratagene). Subsequently, the entire vector containing the desaturase expression cassette was inserted into the HindIII site of pCeloPWvec8, forming pZebdesatCeloPWvecS. The construct, shown schematically in Figure 3, was introduced into the AGLI strain of Agrobacterium (Valvekens et al., 1988) by electroporation, prior to transformation into Arabidopsis thaliana, ecotype Columbia. The construction was also designated the "DO" construction, and plans obtained by transformation with this construction were indicated by the "DO" prefix. Analysis and transformation of plants Plant transformation was performed using the floral immersion method (Clough and Bent, 1998). Seeds (Tl seeds) from treated plants (TO plants) were plated on hygromycin selective medium (20 mg / l) and transformed plants selected and transferred to soil to establish Tl plants. A hygromycin-resistant plant was recovered from a first sweep and established in soil. The transformation experiment was repeated and 24 later confirmed transgenic Tl plants were recovered and established in soil. Most of these Tl plants were expected to be heterozygous for the introduced transgenes. The T2 seed of the 25 transgenic plants was collected at maturity and analyzed for fatty acid composition. As summarized in Table 6, untransformed Arabidopsis seed (Columbia ecotype) contained significant amounts of the 3C fatty acid precursors i8 LA and ALA (06 and (o3, but did not contain any PUFA Ci 8 A6-desaturated (18:3(06 or 18:4a>3), C 2 o (o6-unsaturated or PUFA C 2 the ®3-desaturate. In contrast, fatty acids from the seed oil of the transformed plants comprising the zebrafish A5 / A6-desaturase and C. elegans elongase gene constructs contained 18:3w6, 18:4co3 and an entire series of PUFA C 20 co6- and co3. These resulted from the sequential action of desaturase and elongase enzymes on the respective precursors of C X8 • Most important and unexpected was that the transgenic seed contained both 20:5co3 (EPA), amounting to at least 2.3% of the total fatty acid in the seed oil, and 22:5co3 (DPA), amounting to at least 0.2 % of that omega-3 LC-PUFA in the seed oil fatty acid. 0 total fatty acids C 20produced in the transgenic seed oil reached at least 9.0%. The total 0)3 fatty acids produced that were a product of A6-desaturation (i.e. below 18:3103 (ALA), calculated as the sum of the percentages for 18:4(03 (SDA) , 20:4co3 (ETA) , 20:5co3 (EPA) and 22:5(03 (DPA)), reached at least 4.2%. These levels represent an efficiency of conversion of ALA, which is present in the seed oil of plants of the type wild-type Arabidopsis used for transformation at a level of about 13-15%, to products (o3 through an A6-desaturation step of at least 28%. Unless otherwise stated, the proportion of ALA products for ALA (products:ALA) in seed oil was at least minus 1:3.6. An important fact is that Arabidopsis has a relatively low amount of ALA in its seed oil compared to some commercial oilseed crops. TABLE 6. Composition of fatty acids in the transgenic seed (% of the total fatty acid in the seed oil) seed). Fatty acid Plant No. GLA 18:3(06 SDA 18:40)3 ARA 20:4(06 EPA 20:5ú)3 DGLA 20:3 0)6 ETA 20:40)3 EDA 20:20)6 EtrA 20:3(03 22:4(06 DPA 22:5(03 22:3(06 Wt- - - - - - - - - - - - D01 0.32 1.10 1.10 2.10 1.10 0.40 3.20 TR 0.06 0.13 0.03 D02 0.20 0.70 0.60 1.20 0.80 0.40 1.60 - 0.10 TR - DO 3 0.20 0 .50 0.40 0.80 0.60 0.30 1.90 - TR TR - D04 0.30 0.90 0.80 1.30 1.10 0.50 1.90 - - 0.10 - DO 5 0.10 0.50 0.20 0.40 0.40 - 0.30 - TR TR - D06 0.30 1.00 1.00 1.70 1.20 0.50 2.50 - 0.10 0.10 - D07 0.10 0.40 0.40 0.70 0.70 0.30 1.60 - TR TR - D08 0.30 1.20 1.10 2.10 1.40 0.60 2 .80 - 0.10 0.10 - OD 9 0.30 1.30 0.90 2.20 1.30 0.60 3.10 - 0.10 0.10 - DOIO 0.10 0.40 0, 30 0.70 0.50 0.30 0.10 - TR TR - D011 0.30 1.00 1.40 2.30 1.50 0.60 3.20 - 0.10 0.20 - DO12 0. 40 1.40 1.10 1.90 1.20 0.60 2.30 - 0.10 0.10 - OD13 0.20 0.60 0.60 0.90 0.80 0.40 0.40 - TR 0.10 - OD14 0.30 1.00 0.70 1.70 1.10 0.60 2.50 - TR TR - OD15 0.30 1.30 1.00 2.30 1.50 0.60 2.60 - 0.10 0.10 - OD17 0.20 0.40 0.40 0.70 0.70 0.30 1.80 - TR TR - DO18 0.20 0.60 0.50 0.90 0.80 0.40 1.70 - TR TR - DO19 0.20 0.40 0.40 0.80 0 .70 0.30 2.00 - TR 0.10 - OD2 0 0.30 1.00 0.50 0.90 0.70 0.30 1.60 - TR TR - OD21 0.30 1.20 0, 90 2.00 1.30 0.60 2.50 - - 0.10 - OD22 0.30 0.90 0.70 1.20 1.00 0.40 0.30 - TR TR - OD23 - - - - 0.10 0.10 1.80 - - - - OD24 0.30 1.10 0.70 1.50 1.10 0.50 2.90 - TR 0.10 - OD2 5 0.10 0.50 0 .30 0.70 0.50 0.20 1.60 - TR 0.10 - Wt = Untransformed Arabidopsis (Columbia). TR indicates less than 0.05%. Dash (-) indicates not detected. The T2 lines described above included lines that were homozygous for the transgenes in addition to heterozygotes. To distinguish homozygotes and heterozygotes for lines expressing the transgenes at the highest levels, T2 plants were established from the T2 seed to the 5 lines containing the highest levels of EPA, using selection on MS medium containing hygromycin (15 mg / l ) to determine the presence of the transgenes. For example, T2 seed was used from the TI plant designated D011, containing 2.3% EPA and showing a 3:1 segregation ratio of resistant to susceptible offspring on hygromycin medium, indicating that D011 contained the transgenes in a single genetic locus. Homozygous lines were identified. For example, the T2 offspring of the D011-5 plant were homozygous, as shown by their uniform resistance to hygromycin in their T3 offspring. Other T2 plants were heterozygous for the hygromycin marker. The fatty acid profiles of D011-5 T3 seed lots and other D011 T2 offspring were analyzed and the data are shown in Table 7. As expected, the EPA contents reflected the segregation of the DO construct. EPA levels in the fatty acid of seed oil obtained from the T3 lines were of three groups: negligible (null for the DO construct), in the range of 1.6-2.3% (heterozygous for the DO construct) and reaching at least minus 3.1% (homozygous for the DO construct). The levels obtained were higher in homozygotes than in heterozygotes, indicating a gene dosage effect. The T3 seed of the D011-5 plant synthesized a total of 9.6% new co3 and co6 PUFAs, including 3.2% EPA, 1.6% ARA, 0.1% DPA, 0.6% SDA and 1.8% GLA (Table 7) , this level of EPA synthesis in seed was four times higher than the level of 0.8¾ previously obtained in flax seed (Abbadi et al , 2004). considering also that the level of ALA precursor for 5EPA synthesis in Arabidopsis seed was less than a third of that present in flax seed, it appears that the LC-PUFA pathway described above, which included a desaturase that was able to use an acyl-CoA substrate, was operating with significantly greater efficiency than the desaturase pathway 10 dependent on acyl-PC expressed in flax seed. TABLE 7. Composition of fatty acids in transgenic seed (% of total fatty acid in seed oil) seed). Fatty Acid Wild Type. D011-5 D011-6 D011-7 DO11-8 DO11- 10 DO11- 11 D011- 12 0011- 13 0011- 16 D011- 18 DO11- 19 DO11- 20 DO11- 21 14: 0 0.3 0.0 0, 1 0.1 0.1 o, 1 0.0 0.1 0.1 0.1 0.1 0.1 0.1 0.1 15 : 0 0.0 0.0 0.2 02 0.2 0.1 0.0 0.1 0.1 0.1 0.1 0.1 0.2 0.1 16:1(07 0.5 0.4 0.6 0.7 0.6 0.5 0.4 0.6 0.5 0.6 0.4 0.4 0.7 0.5 16 : 0 8.1 7.1 7.9 7.8 7.6 7.0 7.1 7, 8 7.7 7.6 6.8 6.7 7.6 7.3 17 : l(08 0.0 0.0 0.0 0.1 0.1 0.1 0.0 0.1 0, 1 0.0 0.1 0.1 0.0 0.1 17 : 0 0.3 0.1 0.0 0.1 0.1 0.1 0.0 0.1 0.1 0.1 0 ,1 0.1 0.0 0.1 18 : 3(O6 GLA 0.0 0.6 0.0 0.0 0.0 0.3 03 0.0 0.4 0.0 02 0.3 0 ,0 0.4 18 : 4(03 SDA 0.0 1.8 0.0 0.0 0.0 1.0 1.1 0.0 1.3 0.0 0.7 1.1 0.0 1.2 18 : 2(06 LA 26.6 25.8 29.8 28.6 28.8 25.6 25.4 28.6 25.6 29.0 25.7 252 29.4 27.3 18 : 1(09 17.9 18.7 15.6 19.6 18.2 22.0 18.6 18.6 20.4 15.5 20.1 19.8 16.6 14.8 18 : 1( 07 / ALA 16.0 11.5 15.3 14.7 15.9 10.6 11.6 14.5 11.1 16.0 13.7 13.6 14.8 13.1 18 : 3(03 18 : 0 3.4 42 2.9 2.7 2.8 3.5 3.9 2.8 3.9 2.9 33 3.4 2.9 3.7 19 : 0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.1 0.0 0.1 0 ,1 0.0 0.1 20:4(06 ARA 0.0 1.6 0.0 0.0 0.0 0.9 0.9 0.0 1.3 0.0 0.4 0.8 0.0 1.3 20:5(03 EPA 0.0 3.2 0.0 0.1 0.0 1.6 2.1 0.0 2.1 0.0 1.1 1.8 0.0 2.3 20 : 3(o6 DG LA 0.0 1.9 0.0 0.0 0.0 1.2 1.5 0.0 1.4 0.0 0.7 1.0 0.0 1.5 20 : 4 (o3 ETA 0.0 0.4 0.0 0.0 0.0 0.4 0.6 0.0 0.2 0.0 0.3 0.4 0.0 0.5 2 0 : 2( 06 0.0 3.4 0.2 0.1 0.2 2.2 3.1 0.1 2.4 0.2 1.7 2.1 0.1 2.8 20 :1(09 / 17 ,4 10.9 17.8 18.1 17.3 14.8 12.5 18.2 132 18.0 15.4 14.0 18.6 12.4 (011 20 :1(07 1.9 2 .7 2.2 1.9 2.2 2.2 2.3 2.0 2.0 2.3 2.2 2.2 2.3 2.7 20 : 0 1.8 1.8 2.1 1.8 2.0 2.0 2.0 2.0 1.9 2.2 2.0 2.0 2.3 2.1 22 : 4(06 0.0 0.0 0.0 0.0 0.0 0.1 0.0 0.0 0.1 0.0 0.0 0.0 0.0 0.1 22:5(03 DPA 0.0 0.1 0.0 0.0 0, 0 0.1 0.1 0.0 0.1 0.0 0.1 0.1 0.0 0.2 22 : 1(011 / 0.0 0.0 0.0 0.0 0.0 0 ,0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 (03 22 : 1(09 1.3 0.8 1.9 1.7 1.7 1, 5 1.1 1.7 1.1 2.0 1.6 1.4 2.1 1.5 22 : 1(07 0.0 0.0 0.2 0.1 0.2 0.1 0, 0 0.1 0.0 0.2 0.1 0.1 0.2 0.2 22 : 0 02 03 03 0.3 0.3 0.3 0.4 0.3 0.3 0.4 0 ,3 0.3 0.4 0.4 24 : 1(09 0.6 0.4 0.2 0.2 0.3 0.2 0.2 0.2 0.2 0.3 0.2 0 ,2 0.2 0.3 24 : 1(07 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0 ,0 0.0 0.0 0.0 0.0 24 : 0 0.0 0.2 0.2 02 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0, 2 0.2 0.3 Wild-type refers to untransformed Arabidopsis thaliana, ecotype Columbia. The relative efficiencies of the individual enzyme steps encoded by the EPA construct can be assessed by examining the percent conversion of fatty acid substrate to fatty acid product (including subsequent derivatives) in D011-5. Zebrafish A5 / A6-desaturase exhibited strong A5-desaturase, with 89% of 20:4co3 being converted to EPA and DPA, and 45% of 20:3co6 being converted to ARA, consistent with the previously reported preference of this enzyme by 03 PUFA substrates in relation to 0)6 PUFA substrates (Hastings et al., 2001). In comparison, A6-desaturation occurred at significantly lower levels, with 32% of ALA and 14% of LA being converted to A6-desaturated PUFA. Considering that previous studies in yeast showed that this enzyme actually has greater A6-desaturase activity than A5-desaturase activity, the lower levels of A6-desaturase obtained in Arabidopsis seeds could be a reflection of a limited availability of substrates ALA and LA in the acyl-CoA pool (Singh et al., in print). A6-elongase operated highly efficiently, with 86% of GLA and 67% of SDA being elongated,' suggesting that this enzyme may have a slight preference for elongation of PUFA to6 substrate. The germination ability of T2 (segregation) and T3 (homozygous population) seeds was evaluated in MS medium and in soil. Seed from lines D011 and D011-5 EPA and containing DPA showed the same timing and frequency of germination as wild-type seed, and T2 and T3 plants had no apparent abnormal morphological characteristics. The growth rates of plants in in vitro or in the soil, and the amounts of seed obtained from the plants, were not affected either. Including the germination of the TI seed from which the D011 plant was obtained, normal germination of seeds from the D011 line was therefore observed over three generations. In addition, normal germination rates and timing were also observed for the other seed containing EPA and DPA. This trait was important and unpredictable, as higher plants do not naturally produce EPA or DPA and their seed therefore never previously contained this LC-PUFA. Germination requires the catabolism of stored seed oils and uses them for growth and as an energy supply. The normal germination rates observed showed that the plant's seeds were capable of effecting these processes using EPA and DPA, and that these compounds were not toxic. It has been reported that an A4-desaturase encoded by a gene isolated from Thraustochytrium spp. and expressed in Brassica juncea leaves was capable of converting exogenously supplied DPA into DHA (Qiu et al., 2001). The DPA produced in the plant seed described herein can serve as a precursor for the production of DHA. Such conversion of DPA to DHA can be achieved in plant cells by introducing an A4-desaturase gene into DPA-producing plant cells (Example 11). Discussion The presence of 22:5co3 in Arabidopsis seed oil implied that the C. elegans elongase gene not only had A6-elongase activity, but also A5-elongase activity in plant cells. That result was surprising, since it had been demonstrated that the gene is devoid of A5-elongase activity in yeast. Furthermore, it demonstrated that two genes could be used for the synthesis of DPA from ALA in plant cells. Synthesis of DPA in a higher plant has not been previously reported. Furthermore, the conversion efficiency of ALA in their seed co3 products, including EPA, DPA or both, of at least 28% was surprising. The synthesis of LC-PUFA, such as EPA and DHA, in cells such as plant cells via the A6- desaturation required the sequential action of PUFA desaturases and elongases. Desaturases required in one pathway had A6, A5, and A4-desaturation activity, in that order, and PUFA elongases required had elongation activity on A6 and A5 substrates. This conventional pathway operates on algae, mosses, fungi, diatoms, nematodes and some freshwater fish (Sayanova and Napier, 2004). PUFA desaturases from algae, fungi, mosses and worms are selective for the desaturation of fatty acids esterified at the sn-2 position of phosphatidylcholine (PC), while PUFA elongases act on fatty acids in the form of acyl-CoA substrates represented in the pool tissue acyl-CoA. In contrast, vertebrate A6-desaturases have been shown to be able to desaturate acyl-CoA substrates (Domergue et al., 2003a). Attempts to reconstitute LC-PUFA pathways in plant cells and in other cells must take into account the different sites of action and substrate requirements of the desaturase and elongase enzymes. For example, elongases of PUFA are membrane-bound proteins, and perhaps even integral membrane proteins, that use acyl-CoAs that are present as a distinct pool in the endoplasmic reticulum (ER). This acyl-CoA pool is physiologically separated from the PC component of the ER, and thus, for a PUFA fatty acid to be sequentially desaturated and elongated, it must be transformed between PC and acyl-CoA pools in the ER. Previous attempts to build LC-PUFA biosynthesis in yeast using desaturases and elongase from lower and higher plants, fungi and worms have been inefficient at best. In addition, the constituted pathways led to the synthesis of only PUFA C 20 , such as ARA and EPA. There is no previous report of the synthesis of PUFA C22 such as, for example, DPA and DHA, in yeast (Beaudoin et al., 2000, Domergue et al., 2003a). The strategy described above of using a vertebrate desaturase, in this example a zebrafish A5 / A6-desaturase, with a C. elegans PUFA A6-elongase has the advantage that both the desaturase and the elongase have activity on acyl-CoA substrates in the acyl-CoA pool. This may explain why this strategy was more efficient in LC-PUFA synthesis. Furthermore, the use of a bifunctional desaturase that exhibits dual A5 / A6-desaturase activities allowed the synthesis of EPA by the action of only 2 genes, instead of the 3 genes used by other researchers (Beaudoin et al., 2000, Domergue et al. cols., 2003a). The use of a bifunctional A5 / A6 elongase in plant cells also allowed the formation of DPA from ALA by inserting only three genes (one from elongase and two of desaturases) or, as exemplified, of only two genes (bifunctional elongase and bifunctional desaturase). Both of these aspects were surprising and unexpected. Biochemical evidence suggests that fatty acid elongation consists of 4 steps: condensation, reduction, dehydration and a second reduction. To date, two groups of condensation enzymes have been identified. The former is involved in the synthesis of saturated and monounsaturated fatty acids (C18-22). This group consists of FAE-like enzymes and does not seem to participate in LC-PUFA biosynthesis. The other identified class of elongases belongs to the ELO family of elongases named after the family of ELO genes whose activities are required for the synthesis of the very long chain fatty acids of sphingolipids in yeast. Apparent paralogs of ELO-type elongases isolated from organisms that synthesize LC-PUFA, such as algae, mosses, fungi, and nematodes, have been shown to be involved in the elongation and synthesis of LC-PUFA. It has been demonstrated that only the expression of the elongase condensation component is necessary for the elongation of the respective acyl chain. In this way, the introduced condensation component of elongase is able to successfully recruit the reducing and dehydrating activities of the transgenic host to perform successful acyl elongations. To date, successful elongation of PUFA C16 and C18 in yeast by heterologous expression of ELO-like elongases has been demonstrated. In this regard, elongase from C. elegans used as a described above was unable to stretch PUFA C 20 , when it expresses yeast (Beaudoin et al., 2000). Our demonstration that C. elegans elongase, when expressed in plants, was able to elongate the EPA C20:5 fatty acid, as evidenced by DPA production in Arabidopsis seeds, was an unprecedented and unexpected result. An explanation of why elongase from C. elegans was able to elongate PUFA C 2 o in plants, but not in yeast, perhaps resides in their ability to successfully interact with the other components of the plant elongation machinery to bind and act on substrates C 20 🇧🇷 This example showed that an ELO-type elongase from a non-vertebrate organism was able to elongate PUFA C 20 in plant cells. Leonard et al. (2002) reported that an ELO-like elongase gene isolated from humans, when expressed in yeast, was able to elongate EPA into DPA, but non-selectively. Example 6. Isolation of a P. salina A8-desaturase gene and functional characterization in yeast Microalgae are the only organisms reported to contain A8-desaturases, with the exception of sphingolipid A8-desaturases in higher plants that are not involved in LC-PUFA biosynthesis. A gene encoding an A8-desaturase has been isolated from Euglena gracilis (Wallis and Browse, 1999). The existence of an A8-desaturase in Isochrysis galbana can be presumed, as it contains an A9-elongase (Qi et al., 2002), whose product, 20:3n-3, is the precursor of an A8-desaturase (see Figure 1) . The fatty acid profiles of isolated microalgae in the however, it does not provide a sufficient basis for identifying which microalgae will contain A8-desaturase genes, since several pathways may operate to produce LC-PUFA. Isolation of an A8-desaturase gene fragment An alignment of A6-desaturase amino acid sequences with those of the following Genbank accession numbers, AF465283, AF007561, AAC15586 identified the consensus amino acid sequence blocks DHPGGS (SEQ ID NO: 43), WWKDKBN (SEQ ID NO: 43), WWKDKBN SEQ ID NO: 44) and QIEHBLF (SEQ ID NO: 45), which correspond to amino acid positions 204-210 and 394-400, respectively, of AF465283. DHPGSS corresponded to the "cytochrome b5 domain" block that was previously identified (Mitchell and Martin, 1995). WWKDKHN was a consensus building block that had not previously been identified or used for the design of degenerate primers for the isolation of desaturase genes. The QIEBTILF block, or variants thereof, corresponds to a required histidine-containing motif that was conserved in desaturases. It has been identified and used before as a "third His box" for the elaboration of degenerate oligonucleotides for desaturase gene isolation (Michaelson et al., 1998). This combination of blocks had not previously been used to isolate desaturase genes. Based on conserved second and third amino acid blocks, the degenerate primers 5'-TGGTGGAARCAYAARCAYAAY-3' (SEQ ID NO: 46) and 5 1 -GCGAGGGATCCAAGGRAANARRTGRTGYTC-3' (SEQ ID NO: 47) were synthesized. P. salina genomic DNA was isolated using DNAeasy system (Qiagen). Were realized PCR amplifications in 20 µl reaction volumes using 20 pmol of each primer, 200 ng of P. salina genomic DNA and Hotstar Tag DNA polymerase (Qiagen) with buffer and nucleotide components as specified. The cycling conditions were: 1 cycle of 95°C for 15 minutes; 5 cycles of 95°C for 1 minute; 38°C, 1 minute; 72°C, 1 minute; followed by 35 cycles of 95°C, 35 seconds; 52°C, 30 seconds; 72 °C, 1 minute; and ending with 1 cycle of 72°C, 10 minutes. A 515 base pair amplicon was generated, ligated into pGEM-T easy (Promega), sequenced, and used as a probe to screen a P. salina cDNA library. Isolation of a cDNA encoding a P. salina A8-desaturase A P. salina cDNA library on X-bacteriophage was constructed using the ZapcDNA Synthesis Kit (Stratagene) (see Example 1). The library was plated at a concentration of -50,000 plaques per plate and the scrapings removed with Hybond N+ membrane and treated using standard methods (Ausubel et al., 1988, supra), the 515 bp desaturase fragment generated by PCR was labeled with radioisotope with 32 P-dCTP and used to probe the scrapings under the following highly controlled conditions: overnight hybridization at 65°C in 6X SSC with shaking, a 5 minute wash with 2x SSC / 0.1% SDS, followed by 2 10 minute washes with 0.2x SSC / 0.1% SDS. Fifteen primary plaques from the library (150 mm) were screened by hybridization for the labeled 515 bp fragment. Forty strongly hybridizing plaques were identified and ten of these were screened. secondary. Plasmids from five secondary plaques hybridizing to the 515 bp probe were picked with ExAssist Helper phage according to the suppliers' protocol (Stratagene). Insert nucleotide sequences were obtained using the ABI Prism Big Dye Terminator kit (PE Applied Biosystems). The nucleotide sequences were identical where they overlapped, indicating that all five inserts were from the same gene. One of the five inserts was shown to contain the entire coding region, shown below to be from an A8-desaturase gene. This string is provided as an ID. OF SEQ. No.: 6. The full length amino acid sequence (SEQ ID NO: 1) revealed that the isolated cDNA encoded a putative A6 or A8 desaturase based on BLAST analysis. These two types of desaturases are very similar at the amino acid level and therefore it was not possible to predict by sequence alone which activity was encoded. The maximum degree of identity between P. salina desaturase and other desaturases (BLASTX) was 27-30%, while analysis using the GAP program, which allows the insertion of "gaps" in the alignment, showed that the maximum overall identity of amino acids over the entire desaturase coding regions of P. salina and AAD45877 of Euglena gracilis was 45%. A Pileup diagram of other similar desaturase sequences from Pavlova salina is provided in Figure 4. The entire coding region of this clone, contained within an EcoRI / Xhol fragment, was inserted into pYES2 (Invitrogen), generating pYES2-psA8, for introduction and functional characterization in yeast. The cells from the strain yeast S288 were transformed with pYES2-psA8, as described in Example 1, and transformants were selected on medium lacking uracil. Yeast cells containing pYES2-psA8 were grown in culture and then induced by galactose. After addition of 18:3co3 or 20:3to3 (0.5 mM) to the culture medium and 48 hours of additional culture at 30 °C, fatty acids in cellular lipids were analyzed as described in Example 1. When 18:3(03 (A9, 12, 15) was added to the medium, no 18:4©3 (A6, 9, 12, 15). However, when 20:3co3 (All,14,17) was added to the medium, the presence of 20:4co3 (A8,11,14,17) was detected in the cellular lipid of the yeast transformants (0.12%). It was concluded that the transgene encoded a polypeptide that had A8-desaturase but not A6-desaturase activity in yeast cells. The isolation of a gene encoding a fatty acid A8-desaturase that also lacks A6-desaturase activity has not been previously reported. The only previously reported gene encoding an A8-desaturase that was isolated (from Euglena gracilis) was capable of catalyzing 18:3a>3 and 2O:3co3 desaturation (Wallis and Browse, 1999). Furthermore, the expression of a gene encoding an A8-desaturase has not been previously reported in higher plants. As shown in Figure 1, expression of an A8-desaturase associated with an A9-elongase (e.g. the gene encoding ELO2 - see below) and an A5-desaturase (e.g. the goldfish A5 / A6 gene zebra or a gene equivalent of P. saline or from other microalgae) would produce EPA synthesis in plants. In addition to providing an alternative for the production of EPA in cells, the strategy of using an A9-elongase in combination with A8-desaturase may provide an advantage, since the elongation, which occurs in fatty acids coupled to CoA, precedes desaturation, which occurs in fatty acids coupled to PC, thus ensuring the availability of PUFA C 2 the newly elongated in the PC for subsequent desaturations by A8 and A5-desaturases, possibly leading to more efficient EPA synthesis. That is, the order of reactions - one elongation followed by two desaturations - will reduce the number of substrate binding changes that need to occur. The increased specificity provided by P. salina A8-desaturase is an additional advantage. Example 7. Isolation of fatty acid elongases ELO1 and ELO2 from P. salina ELO-type PUFA elongases from organisms such as nematodes, fungi and mosses have been identified based on EST or genome sequencing strategies. A gene encoding an A9-elongase with activity at 18:3<n3 (ALA) was isolated from Isochrysis galbana, using a PCR approach with degenerate primers, and was shown to have activity in yeast cells that were supplied with 18:2co6 ( LA) or exogenous 18:3co3 (ALA), forming fatty acids C 20 20:2co6 and 20:3co3, respectively. The coding region of the IgASE1 gene encoded a 263 amino acid protein with a predicted molecular weight of about 30 kDa and with limited homology (up to 27% identity) to other elongation proteins. Isolation of P. salina elongase gene fragments Based on multiple amino acid sequence alignments for fatty acid elongases, the amino acid consensus blocks FLHXYH (SEQ. ID NO: 48) and MYXYYF (SEQ ID NO: 49) were identified and the corresponding degenerate primers 5'- CAGGATCCTTYYTNCATNNNTAYCA-3' (SEQ ID. NO.: 50) (sense) and 5'- GATCTAGARAARTARTANNNRTACAT - 3' (SEQ. ID. NO.: 51) (antisense) were synthesized. Primers designed for the FLHXYH motif or their use in combination with the MYXYYF primer have not been previously described. These primers were used in PCR amplification reactions in 20 µl reaction volumes, with 20 pmol of each primer, 200 ng P. salina genomic DNA, and Hotstar Taq DNA polymerase (Qiagen) with buffer and buffer components. nucleotides in the manner specified by the supplier. The reactions were cycled as follows: 1 cycle of 95°C for 15 minutes, 5 cycles of 95°C, 1 minute, 38°C, 1 minute, 72°C, 1 minute, 35 cycles of 95°C, 35 seconds, 52°C, 30 seconds, 72°C, 1 minute, 1 cycle of 72°C, 10 minutes. Fragments of approximately 150 bp were generated and ligated into pGEM-Teasy for sequence analysis. Of the 35 clones isolated, two clones had nucleotide or amino acid sequences with similarities to known elongases. These were designated Elol and Elo2. Both gene fragments were radiolabeled with 32 P-dCTP and used to probe the P. salina cDNA library under the following highly controlled conditions: overnight hybridization at 65°C in 6X SSC with shaking, 5 minute wash with 2x SSC / 0.1% SDS, followed by 10 minute wash with 0.2x SSC / 0.1% SDS. Ten primary library plates (150 mm) were screened using the Elol or Elo2 probes. Elol hybridized strongly to several plaques on each plate, while Elo2 hybridized to only three plaques out of the ten plates screened. All plaques hybridizing to Elol were taken from a single plate and subjected to a secondary screen, while all three plaques hybridizing to Elo2 were subjected to a secondary screen. Each secondary plate was then used as a PCR template using the forward and reverse primers that flank the multiple cloning site in the pBluescript phagemid and the PCR products electrophoresed on a 1% TAE gel. After electrophoresis, the gel was spotted onto a Hybond N+ membrane and the membrane hybridized overnight with Elol and Elo2 probes labeled with 32 Q. Six of the amplified Elol secondary plaques and one of the amplified Elo2 secondary plaques hybridized to the Elol / 2 probe (Figure 5). Two classes of elongase-like sequences were identified in the P. salina cDNA library based on their hybridization to the Elol and Elo2 probes. Phagemids that hybridized strongly to one of the labeled fragments were picked with ExAssist Helper phage (Stratagene), and sequenced using the ABI Prism Big Dye Terminator kit (PE Applied Biosystems). All 5 inserts that hybridize to the Elol probe were shown to be from the same gene. Likewise, DNA sequencing of the 2 inserts that hybridize to the Elo2 probe demonstrated that they were of the same gene. The cDNA sequence of the Elol clone is given as ID. OF SEQ. No.: 8, and the protein encoded as ID. OF SEQ. No.: 2, while the cDNA sequence of clone Elo2 is given as ID. OF SEQ. No.: 10, and proteins encoded as ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 and ID. OF SEQ. No.: 86 (using three possible starting methionines). A comparison of elongases Elol and Elo2 and other known PUFA elongases from the database was performed using the PILEUP (NCBI) computer program, and is shown in Figure 6. The Elo 1 cDNA was 1,234 nucleotides long and had an open reading frame that encoded a protein of 302 amino acid residues. According to the PILEUP analysis, Elol clustered with other Elo-like sequences associated with PUFA elongation, including A6-unsaturated fatty acids (Figure 6). The Elol protein showed the highest degree of identity (33%) to a P. patens moss elongase (Accession No. AF428243) across the entire coding regions. The Elol protein also displayed conserved amino acid motifs found in all Elo-type elongases. The Elo2 cDNA was 1,246 nucleotides long and had an open reading frame that encoded a protein of 304 amino acid residues. According to PILEUP analysis, Elo2 clustered with other Elo-like sequences associated with PUFA elongation, including those with activity at PUFA A6 or A9 (Figure 6). Elo2 was in the same sub-branch as the A9-elongase isolated from Isochrysis galbana (AX571775). Elo2 exhibited 31% identity to the Isochrysis gene throughout the coding region. The Elo2 ORF also exhibited a conserved amino acid motif found in all Elo-like elongases. Example 8. Functional Characterization of A5-Fatty Acid Elongase in Yeast and Plant Cells Yeasts The entire coding region of the P. salina Elol gene was ligated into pYES2, generating pYES2-psEL01, for characterization in yeast. This genetic construct was introduced into yeast strains and tested for activity by growth in media containing exogenous fatty acids, as listed in Table 8. Yeast cells containing pYES2-psEL01 were able to convert 20:5co3 to 22:5(03, confirming the activity of A5 elongase in substrate C 2 o- The conversion ratio of 7% indicated high activity for this substrate. The same yeast cells converted 18:40)3 (A6, 9, 12, 15) to 20:4co3 and 18:3(06 (A6, 9, 12) to 20:3(06, demonstrating that elongase also had A6-elongase activity in yeast cells, but at approximately 10-fold lower conversion rates (Table 8). This indicated that the Elol gene encodes a specific or selective A5-elongase in yeast cells. This represents the first report of a specific A5-elongase, specifically an enzyme that has a higher A5-elongase activity compared to A6-elongase activity. This molecule is also the first A5-elongase isolated from an algal source. This enzyme is crucial in the conversion of EPA to DPA (Figure 1). Plants Lova 1 A5-elongase isolated from Pavlova is expressed in plants to confirm their ability to function in plants. First, a plant expression construct is made for constitutive expression of Elol. For this purpose, the Elol sequence is placed under the control of the 35S promoter in the plant binary vector pBI121 (Clontech). This construct is introduced into Arabidopsis using the floral immersion method described above. Leaf lipid analysis is used to determine the specificity of fatty acids elongated by the Elol sequence. In another approach, co-expression of the Elol construct with the zebrafish A5 / A6-desaturase / C. elegans elongase construct and the isolated Pavlova A4-desaturase results in the synthesis of DHA from ALA in pine seed. Arabidopsis, demonstrating the use of A5-elongase in the production of DHA in cells. In a further approach, the Elol gene can be co-expressed with A6-desaturase and A5-desaturase genes, or a bifunctional A6 / A5-desaturase gene, to produce DPA from ALA in cells, particularly plants. In an alternative approach, the A5-elongase and A4-elongase genes are used in combination with the Shewanella PKS genes that produce EPA (Takeyama et al., 1997) in plants for DHA synthesis. TABLE 8. Conversion of fatty acids in yeast cells transformed with genetic constructs expressing Elol or Elo2. Clone Fatty Acid Precursor / (% Total FA) Fatty Acid Formed / (% Total FA) Conversion Ratio (%) pYES2- 20:5n-3 / 3% 22:5n-3 / 0.21% 7% psELOl pYES2- psELOl 18:4n-3 / 16.9% 20:4n-3 / 0.15% 0.89% pYES2- psELOl 18:3n-6 / 19.8% 20:3n-6 / 0.14 % 0.71% pYES2- psELO2 20:5n-3 / 2.3% 22:5n-3 / tr - pYES2- psELO2 18:4n-3 / 32.5% 20:4n-3 / 0.38% 1 .2% pYES2- psELO2 18:3n-6 / 12.9% 20:3n-6 / 0.08% 0.62% pYES2- psELO2 18:2n-6 / 30.3% 20:2n-6 / 0 .12% 0.40% pYES2- psELO2 18:3n-3 / 42.9% 18:3n-3 / 0.20% 0.47% tr: residual amounts (<0.02%) detected. Example 9. Functional Characterization of A9-Fatty Acid Elongase in Yeast and Plant Cells Expression in yeast cells 5 The entire coding region of the P. saline encoding a 304 amino acid protein (SEQ ID NO: 3) was ligated into pYES2, generating pYES2-psELO2, for characterization in yeast. This genetic construct was introduced into yeast strains and tested for activity by growth in media containing exogenous fatty acids. Yeast cells containing pYES2-psELO2 were able to convert 18:2o>6 into 20:2<d6 (0.12% of total fatty acids) and 18:3co3 into 2O:3co3 (0.20%), confirming the activity of A9-elongase on Ci substrates 8 (Table 8) . 15 These cells were also able to convert 18:3co6 to 2O:3co6 and 18:4(03) in 20:4(03, confirming A6-elongase activity on Ci substrates 8 in yeast. However, since the 18:3co6 and 18:4co3 substrates also have a desaturation at the A9 position, it could be that the Elo2 enzyme is specific for A9-desaturated fatty acids, regardless of the fact that they also have an A6-desaturation. Cells were able to convert 20:5<o3 to the 22:5 DPA product. This is the first report of an A9-elongase that also has A6-elongase activity from a non-vertebrate source, in particular from a fungal or algal source. As the coding region contained three possible ATG start codons corresponding to the amino acids methionine (Met) at positions 1, 11 (SEQ ID NO: 85) and 29 (SEQ ID NO: 86) of ID. OF SEQ. No.: 3, the possibility was tested that polypeptides starting at amino acid positions 11 or 29 might also be active. Using 5' (sense) oligonucleotide primers that correspond to the nucleotide sequences of these regions, PCR amplification of the coding regions was performed, and the resulting products were digested with EcoRI. The fragments are cloned into pYES2 to form pYES2-psEL02-11 and pYES2-psELO2-29. Both plasmids have been shown to encode A9-elongase enzymes active in yeast. The three polypeptides can also be expressed in Synechococcus or in other cells, such as plant cells, to demonstrate activity. Expression in plant cells The A9-elongase gene, Elo2, isolated from Pavlova, was expressed in plants to confirm its ability to work in plants. First, a plant expression construct is made for constitutive expression of Elo2. For this purpose, the Elo2 coding sequence from amino acid position 1 of ID. OF SEQ. No: 3 was placed under the control of the 35S promoter in the plant binary vector pBI121 (Clontech). This construct is introduced into Arabidopsis using the floral immersion method described above. Analysis of leaf lipids indicates the specificity of fatty acids that are elongated by the Elo2 sequence. Co-expression of A9-elongase and A8-desaturase genes in transformed cells The P. salina A8-desaturase and A9-elongase were cloned into a single binary vector, each under the control of the constitutive 35S promoter and nos terminator. In this gene construct, pBI121 containing the A8-desaturase sequence was cut with HindlTI and Clal (blunt-ended) to release a fragment containing the 35S promoter and the A8-desaturase gene, which was then ligated into the pXZP143 / A9-elongase vector cut with HindIIT + Saci (blunt-ended) to yield intermediate pJRP013. This intermediate was then opened with HindIII and ligated into a pWvec8 / A9-elongase binary vector (also opened with HindIII) to result in construct pJRP014, which contains both genes between the left and right T-DNA borders, along with a gene hygromycin selectable marker suitable for plant transformation. This double gene construct was then used to transform tobacco using a standardized Agrobacterium-mediated transformation technique. After introducing the construction on Agrobacterium AGL1 strain, a single transformed colony was used to inoculate 20 ml of LB medium, and incubated with shaking for 48 hours at 28°C. The cells were pelleted (1,000 g for 10 minutes), the supernatant discarded, and the pellet resuspended in 20 ml of sterile MS medium. This step was then repeated, before 10 ml of this Agrobacterium solution was added to freshly cut tobacco leaves (1 cm squares) of the W38 cultivar. After gentle mixing, the tobacco leaf pieces and Agrobacterium solution were allowed to stand at room temperature for 10 minutes. Leaf pieces were transferred to MS plates, sealed and incubated (co-cultivation) for 2 days at 24°C. Transformed cells were selected on medium containing hygromycin, and sprouts regenerated. These shoots were then taken out and transferred to pots of MS rooting medium for root growth and finally transferred to soil. Leaf and seed lipids of these plants were analyzed for the presence of 20:2106, 20:326, 20:3co3 and 20:4(03), demonstrating the co-expression of the two genes. Discussion Biochemical evidence suggests that fatty acid elongation consists of 4 steps: condensation, reduction, dehydration and a second reduction, and the reaction is catalyzed by a complex of four proteins; the first catalyzes the condensation step and is commonly called elongase. There are 2 groups of condensing enzymes identified so far. The former is involved in the synthesis of saturated and monounsaturated fatty acids (C18-22). These enzymes are FAE-like enzymes and do not participate in LC-PUPA biosynthesis. The other identified class of elongases belongs to the ELO family of elongases named after the ELO gene family whose activities are required for the synthesis of very LC fatty acids from sphingolipids in yeast. Apparent paralogs of ELO-type elongases isolated from organisms that synthesize LC-PUFA, such as algae, mosses, fungi, and nematodes, have been shown to be involved in the elongation and synthesis of LC-PUFA. It has been shown that only the expression of the elongase condensation component is necessary for the elongation of the respective acyl chain. In this way, the introduced condensation component of elongase is able to successfully recruit the reduction and dehydration activities of the transgenic host to successfully perform acyl elongations. This is also true for A9-elongase from P. salina. Example 10. Isolation of a gene encoding an A4-desaturase from P. salina The final step in the aerobic pathway of DHA synthesis in organisms other than vertebrates, such as microorganisms, lower plants including algae, mosses, fungi, and possibly lower animals, is catalyzed by an A4-desaturase that introduces a double bond into the DHA chain. fatty acid carbon at the A4 position. The genes that encode such an enzyme have been isolated from Euglena and Pavlova algae and from Thraustochytrium using different approaches. For example, A4-desaturase genes from Pavlova lutheri and Euglena gracilis were isolated by random sequencing of cloned ESTs (EST approach, Meyer et al., 2003; Tonon et al., 2003), and an A4-desaturase gene from Thraustochytrium sp. ATCC21685 was isolated by RT-PCR using primers that correspond to an HPGG domain of cytochrome b5 and a histidine box III region (Qiu et al., 2001). The cloned A4-desaturase genes encoded front-end desaturases whose members are characterized by the presence of a cytochrome b5-like domain at the N-terminus (Napier et al., 1999; Sayanova and Napier, 2004). Isolation of a gene fragment of an A4-desaturase gene from P. salina Comparison of known A4-desaturases from moss and microalgae revealed several conserved motifs, including an HPGG motif (SEQ ID NO: 52) within a cytochrome b5-2ike domain and three histidine box motifs, which , presumably, are necessary for the activity. Unpublished degenerate PCR primers PavD4Des-F3 (5 1-AGCACGAGSSARCCACGGCG-3') (SEQ ID. N°: 53) and PavD4Des-R3 (5'-GTGGTGCAYCABCACGTGCT-3') (SEQ. ID. N°: 54), corresponding to the conserved amino acid sequence of box I of histidine and complementary to a sequence of nucleotides that encode the amino acid sequence of the box II histidine, respectively, were designed to amplify the corresponding region of P. salina desaturase genes, particularly an A4-desaturase gene. The use of degenerate PCR primers that correspond to the histidine box I and box II of histidine regions of A4-desaturase has not been previously reported. PCR amplification reactions using these primers were performed using first-class cDNA. filament of P. salina as a model with cycling of 95°C, 5 minutes for 1 cycle, 94°C, 30 seconds, 57°C, 30 seconds, 72°C, 30 seconds for 35 cycles, and 72°C , 5 minutes per 1 cycle. PCR products were cloned into pGEM-T-easy vectors (Promega), and nucleotide sequences were determined with an ABI3730 automated sequencer using a reverse primer from the pGEM-Teasy vector. Out of 14 sequenced clones, three clones showed homology to A4-desaturase genes. Two of these three clones are truncated at one end of the primer. The nucleotide sequence of the third cDNA insert, clone 1803, is given as an ID. OF SEQ. No.: 11. The amino acid sequence encoded by ID. OF SEQ. No.: 11 was used to search the NCBI protein sequence database using the BLASTX computer program. The results indicated that this sequence was homologous to known A4-desaturases. The amino acid sequence of the gene fragment from P. salina showed 65%, 49%, 46% and 46% identity to that of A4-desaturases from P. lutheri, Thraustochytrium sp. ATCC21685, Thraustochytrium aureum and Euglena gracilis respectively. Isolation of a full-length A4-desaturase gene The insert from clone 1803 was excised and used as a probe to isolate full-length cDNAs corresponding to the putative A4-desaturase gene fragment. About 750,000 pfu of the P. salina cDNA library were screened under highly stringent conditions. Hybridization was performed at 60°C overnight and washing was done with 2x SSC / 0.1% SDS for 30 minutes at 65°C, then 0.2x SSC / 0.1% SDS, 30 minutes at 65°C. Eighteen hybridizing clones were isolated and secondary screening was performed with six clones under the same hybridizing conditions. Single plaques from the secondary screen of these six clones were isolated. Plasmids from five single plaques were taken and the nucleotide sequences of the inserts were determined with an ABI3730 automated sequencer with reverse primers and forward vector. Sequencing results showed that each of four clones contained A4-desaturase cDNA approximately 1.7 kb in length, each with the same coding sequence and each apparently full-length. They differed slightly in length from the 5' and 3' RTUs 1 , although they contained identical protein-coding regions. The cDNA sequence of the longer P. salina A4-desaturase cDNA is given as ID. OF SEQ. No.: 13, and the protein encoded as ID. OF SEQ. No.: 4. The full-length cDNA was 1687 nucleotides long and had a coding region encoding 447 amino acids. A4-desaturase from Pavlova salina showed all conserved motifs typical of "frontend desaturases" including the N-terminal cytochrome b5-like domain and three conserved motifs rich in histidine. Comparison of the nucleotide and amino acid sequences with other A4-desaturase genes showed that the greatest extent of homology was to the P. lutheri A4-desaturase (Accession No. AY332747), which was 69.4% identical in terms of sequence of nucleotides to the coding region of protein, and 67.2% identical in terms of sequences of amino acids. Demonstration of enzymatic activity of A4-desaturase gene from Pavlova salina A DNA fragment including the A4-desaturase cDNA coding region from Pavlova salina was excised as an EcoRT-Sail cDNA fragment and inserted into the pYES2 yeast expression vector using the EcoRI and XhoI sites. The resulting plasmid was transformed into yeast cells. The transformants were grown in YMM medium and the gene was induced by the addition of galactose, in the presence of added ¢06 and a>3 fatty acids (exogenous), in order to demonstrate enzymatic activity and the range of substrates that could be activated by the gene express. The 22 fatty acids: 5co3 (DPA, 1.0 mM), 20:4n-3 (ETA, 1.0 mM), 22:4co6 (DTAG, 1.0 mM) and 20:4<b6 (ARA, 1 .0 mM) were each added separately to the medium. After incubation for 72 hours, the cells were harvested and fatty acid analysis by capillary gas-liquid chromatography (GC) was performed, as described in Example 1. The data obtained are shown in Table 9. TABLE 9. Yeast PUFA feed showing delta-4-desaturase gene activity. Exogenous fatty acid added to growth medium Fatty acid composition (% of total fatty acids) 22:4(06 22:5(03 14 : 0 0.63 0.35 15 : 0 0.06 0.06 16 : 1C07C 43.45 40.52 16 : 1G)5 0.20 0.13 16:0 18.06 15.42 17 :10)8 0.08 0.09 17 : 0 0.08 - 18 : 1CO9 26.73 30.07 18:10 )7 (major) and 1.43 1.61 18 : 3 0)3 18 : 1C05C 0.02 tr 18 : 0 7.25 8.87 20 : 50)3 0.40 0.62 20:10)9 / 0)11 0.03 tr 20 : 0 0.08 0.09 22 : 50)6 0.03 0.00 22 : 60)3 - 0.04 22 : 40)6 0.97 22 : 50)3 0.00 1.66 22 : 0 0.06 0.06 24 : 10)7 0.31 0.37 24 : 0 0.12 0.04 Sum 100.00% 100.00% This showed that the cloned gene encoded an A4-desaturase that was capable of desaturating both C22:4o)6 (3.0% conversion in 22:5o) and C22:5to3 (2.4% conversion in 22:6o3) in the A4 position. The enzyme showed no A5-desaturation activity when yeast transformants were fed C2O:3o)6 or C20:4co3. Example 11. Expression of P. salina A4-desaturase gene in plant cells and DHA production To demonstrate the activity of the A4-desaturase gene in plant cells, the coding region can be expressed both separately, to allow conversion of DPA to DHA, or in the context of other LC-PUFA gene synthesis such as, for example, an A5-elongase gene for the conversion of EPA to DHA. For expression as a separate gene, the A4-desaturase coding region can be taken out as a BamHI-Sail fragment and inserted between a seed-specific promoter and a polyadenylation / transcription termination sequence, for example, in pGNAP vector (Lee et al., 1998), in order to be expressed under the control of the seed-specific promoter. The expression cassette can then be inserted into a binary vector and introduced into plant cells. The plant material used for transformation can be from non-transformed plants or from transformed plants containing a construct expressing the zebrafish A5 / A6 double desaturase gene and the C. elegans elongase gene, each under the control of a seed-specific promoter (Example 5). transgenic Arabidopsis containing the latter, dual gene construct, successfully produced both EPA and DPA in seeds, and combination with the A4-desaturase gene would allow conversion of DPA to DHA in the 5 plant cells, as demonstrated below. To demonstrate co-expression of an A5-elongase gene with the A4-desaturase gene in recombinant cells, particularly plant cells, and to allow production of DHA, the A4-desaturase and A5-elongase genes from P. salina (Example 8) were combined into binary vector as follows. Both coding regions were placed under the control of promoters specific for seed (napin) and finalizers in the 3 ' , and the binary vector construct had a kanamycin resistance gene as a selectable marker for selection in plant cells. The coding region of the A5-elongase gene was taken from its cDNA clone as a PstI-SacTI fragment and inserted into an intermediate plasmid (pXZP143) between the promoter and the terminator, resulting in plasmid pXZP144. The coding region of the A4-desaturase gene was taken from its cDNA clone as a BamHI-SalI fragment and inserted into plasmid pXZP143 between the promoter and the 3' transcription terminator, resulting in plasmid pXZP150. These two expression cassettes were combined into a vector by inserting the HindIII-Apal fragment from pXZP144 (containing promoter-Elol-nos 3') between the StuT and Apal sites of pXZP150, resulting in plasmid pXZP191. The HindTII-StuT fragment of pXZP191 containing both expression cassettes was then cloned into the binary vector pXZP330, a derivative of pBI121, resulting in the plant expression vector pXZP355. This vector is shown schematically in Figure 7. plant transformation The A5-elongase and A4-desaturase genes in pXZP355 were introduced by the Agrobacterium-mediated floral immersion transformation method into Arabidopsis plants designated D011 (Example 5), which were already transgenic for the bifunctional A5 / A6-desaturase gene from zebrafish and the bifunctional A5 / A6 elongase gene from C. elegans. As these transgenes were linked to a hygromycin resistance gene as a selectable marker gene, secondary transformation with pXZP355 used a kanamycin resistance selection distinguishing, in this way, way, the two sets of transgenes. Five transgenic plants, designated "DW" plants, are obtained. As the D011 plants secreted both the zebrafish bifunctional A5 / A6 desaturase gene and the C. elegans bifunctional A5 / A6 elongase gene, some of the transformed plants were expected to be heterozygous for these genes while waiting for if others were homozygous. The seed (T2 seed) of the five transformed plants was analyzed and shown to contain up to at least 0.1% DPA and up to at least 0.5% DHA in seed oils. Data for two rows are shown in Table 10. Mass spectrometry (GC-MS) analysis of the fatty acids in the peaks identified as EPA and DHA from the GC analysis proved that they were, in fact, EPA and DHA (Figure 8). Fatty acid analysis of the T2 seed oil showed that a significant conversion of EPA to DHA had occurred in the DW2 and DW5 lines at 0.2% and 0.5% DHA, respectively. Examination of enzyme efficiencies in the DW5 plant containing the highest level of DHA showed that 17% of the EPA produced in its seed was elongated to DPA by P. salina A5-elongase and over 80% of that DPA was converted to DHA by A4- desaturase from P. salina. As the A5-elongase and A4-desaturase genes segregated in the T2 seed, the fatty acid composition data represented a measure of pooled null, heterozygous, and homozygous genotypes for these genes. It is expected that DHA levels in DW5 offspring lines will be higher in seeds that are uniformly homozygous for these genes. TABLE 10. Composition of fatty acids (% of fatty acids totals) of Arabidopsis thaliana seed oils (Columbia ecotype) and derivatives that carry EPA and DHA genetic constructs EPA, DPA and DHA synthesis in transgenic seeds. Fatty Acid Wild Type Construction D011 + DHA Columbia DW2 DW5 Common Fatty Acids Total Total TAG PL L6 : 0 7.2 6.7 6.1 5.5 12.5 18 : 0 2.9 3.8 4.4 4, 3 4.5 18:1A 9 20.0 20.6 16.6 18.9 13.7 18:2A 9 🇧🇷 12 (LA) 27.5 26.0 25.9 25.5 33.1 18:3A 9 🇧🇷 12 🇧🇷 15 (ALA) 15.1 13.2 15.0 13.6 15.1 20.0 2.2 2.1 1.8 1.9 0.6 20 : AI 11 19.8 14.8 10.5 10.5 3.2 2O:1A 13 2.2 3.0 4.2 4.8 1.4 20:2A 11,14 0.1 1.7 3.5 3.8 3.7 22 : 1A 13 1.5 1.4 1.0 0.3 0.4 Other Minors 1.5 2.9 2.7 2.4 3.8 Total 100.0 96.0 91.7 91.5 92.0 New 0 )6 -PUFA 18:3A 6 🇧🇷 9 🇧🇷 12 (GLA) 0 0.2 0.4 0.4 0.2 20:3a 8 🇧🇷 11 🇧🇷 14 0 0.8 1.5 1.5 1.7 20:4a 5 🇧🇷 8 🇧🇷 11 🇧🇷 14 (ARA) 0 0.4 1, o 1.1 1.2 22 :4A 7 🇧🇷 10 🇧🇷 13 🇧🇷 16 0 0 0 0 0.2 22 • 5 a4 🇧🇷7 / 10 🇧🇷 13 🇧🇷 16 0 0 0.1 0.1 0.1 Total 0 1.4 3.0 3.1 3.4 New 0)3-PUFA 18 :4A 6 🇧🇷 9 🇧🇷 12 🇧🇷 15 (SDA) 0 0.7 1.5 1.6 0.5 20:4a 8 🇧🇷 11 🇧🇷 14 🇧🇷 17 0 0.5 0.8 0.7 0.9 20:5a 5 🇧🇷 8 🇧🇷 11 🇧🇷 14 🇧🇷 17 (EPA) 0 1.1 2.4 2.5 2.3 22 : 5A 7 🇧🇷 10 🇧🇷 13 🇧🇷 16 🇧🇷 19 (DPA) 0 0.1 0.1 0.2 0.7 22 : 6A 4 🇧🇷 7 🇧🇷 10 🇧🇷 13 🇧🇷 16 🇧🇷 19 (DHA) 0 0.2 0.5 0.4 0.2 Total 0 2.6 5.3 5.4 4.6 Total fatty acids 100.0 100.0 100.0 100.0 100.0 MUFA a Total 41.3 36.8 28.1 29.7 17.3 C18-PUFA b Total 42.6 39.2 40.9 39.1 48.2 New PUFA C Total 0 4.0 8.3 8.5 8.0 a Total of 18:1A 9 and derived LC-MUFA (-18:1A 9 + 20:10 11 🇧🇷 22: 1A 13 🇧🇷 D 18:2 + 18:3 . c Total new co6 and C03-PUFA. 5 The germination of 50 T2 seeds each of DW2 and DW5 in medium containing hygromycin showed that the TI DW5 plant was homozygous (50 / 50) for the bifunctional A5 / A6 desaturase and bifunctional A5 / A6 elongase genes, while the DW2 seed, which secretes in a ratio of 3: 1 10 (resistant: susceptible) for these genes and DW2, it was therefore heterozygous. This was consistent with the higher levels of EPA seen in the DW5 seed compared to the DW2 seed and explained the increased level of DHA produced in the seed homozygous for these transgenes. This 15 also demonstrates the attractiveness of seeds that are homozygous for the trait. We also observed the consequences of LC-PUFA synthesis on the overall fatty acid profile of these seeds. Although we observed accumulation of new PUFA to 6 and co3 (i.e. A6-desaturation products) at levels above 8% in DW5 seeds, these seeds had levels of the precursor fatty acids LA and ALA that were nearly the same as in the wild type. Instead of depleting LA and ALA, C18:1A monounsaturated fatty acid levels 9 and their elongated derivatives (20:1a 11 and 22:1A 13 ) were significantly reduced. Thus, it seems that the conversion of Ci 8 -PUFA to LC-PUFA resulted in increased 18:1 conversion to LA and ALA, and a corresponding decrease in 18:1 available for elongation. The plant expression vector pXZP355 containing the A4-desaturase and A5-elongase genes was also used to introduce the genes into plants of the homozygous DO11-5 line, and 20 TI transgenic plants were obtained. DHA and DPA levels in T2 seeds of these plants were similar to those observed in DW5 seeds. Reductions in monounsaturated fatty acid levels were also observed in these seeds. Fractionation of the total lipids of DW5 seed seeds revealed that they were composed of 89% TAG and 11% polar lipids (made mostly of phospholipids). Furthermore, fatty acid analysis of the TAG fraction of DW5 seeds showed that newly synthesized EPA and DHA were being incorporated into the seed oil and that the proportion of EPA and DHA in the fatty acid composition of the total lipids of the seeds essentially reflected that of the seed oil. TAG fraction (Table 10). Example 12. Isolation of homologous genes from other sources Homologues of the desaturase and elongase genes, such as the P. salina genes described herein, can be readily detected in other microalgae or other sources by hybridization to labeled probes derived from the genes, particularly to parts or all of the coding regions, for example. for example, by Southern blot hybridization or dot-blot hybridization methods. Homologous genes can be isolated from genomic or cDNA libraries of such organisms, or by PCR amplification using primers that correspond to conserved regions. Similarly, homologues of vertebrate desaturases with high affinity for Acyl-CoA and / or bifunctional freshwater fish desaturases can be isolated by similar means using probes for the zebrafish A5 / A6-desaturase. dot-blot hybridizations Genomic DNA from six species of microalgae was isolated using a DNAeasy kit (Qiagen) following the suppliers' instructions, and used in dot-blot hybridization analysis to identify homologous genes involved in LC-PUFA synthesis in these species. This also allowed the evaluation of the sequence divergence of these genes, compared with those isolated from Pavlova salina. The microalgae species examined in this analysis were from the genera Melosira, Rhodomonas, Heterosigma, Nannochloropsis, Heterocapsa and Tetraselmis. They were identified according to Hasle, G.R. and Syvertsen, E.E. 1996 Dinoflagellates. In: Tomas, C.R. (ed.) Identifying Marine Phytoplankton. Academic Press, San Diego, CA. pages 531-532. These microalgae were included in the analysis based on in the presence of EPA, DHA, or both, when cultured in vitro (Example 2). Genomic DNA (approximately 100 µg) isolated from each microalgae was spotted onto Hybond N+ membrane strips (Amersham). After air-drying, each membrane strip was placed on a layer of 3 MM filter paper saturated with 0.4 M NaOH for 20 minutes to denature the DNA, and then quickly rinsed in 2x SSC solution. The membrane strips were air-dried and the DNA crosslinked to the membranes under UV light. Probes labeled with nucleotides 32 P e which consisted of the coding regions lacking the untranslated regions of several Pavlova-derived genes, including the A8, A5 and A4 desaturases and the A9 and A5 elongases, were prepared and hybridized to each membrane strip dot-blot / DNA. Membranes were hybridized with each probe overnight in a buffer containing 50 mM Tris-HCl, pH 7.5, 1 M NaCl, 50% formamide, 10x Denhardt's solution, 10% dextran sulfate, 1% SDS , 0.1% sodium pyrophosphate and 0.1 mg / ml herring sperm DNA at 42°C, then washed three times in a solution containing 2x SSC, 0.5% SDS at 50°C for 15 minutes each (wash under low stringency conditions in this experiment) or for a wash under highly stringent conditions. controlled in 0.2x SSC, 0.5% SDS at 65°C for 20 minutes each. It is known that the rigor of washing conditions employed in DNA blots / hybridizations can reveal useful information regarding the affinity of gene sequences. In this way, hybridizations maintained when subjected to a wash with high stringency indicate a high level of sequence affinity (e.g., 80% or greater nucleotide identity over at least 100-200 nucleotides), whereas hybridizations maintained only during low stringency washes indicate a relatively lesser degree of DNA conservation between genes (e.g. example, 60% or more nucleotide identity over at least 200 nucleotides). The hybridized dot-blots were exposed to BioMax x-ray film (Kodak), and the autoradiograms are shown in Figure 9. The autoradiograms reveal the presence of homologues to the P. salina genes from LC-PUFA in these species and, in addition, reveal a range of homologies based on the different levels of hybridization observed under the conditions of high and low stringency. It appears that some of the microalgae species examined have LC-PUFA genes that may differ substantially from the genes in P. salina, while others are more closely related in terms of sequence. For example, genes from Tetraselmis sp appear to be highly similar to A4- and A5-desaturases and A5-elongase from Pavlova salina based on the strength of hybridizations. In contrast, all LC-PUFA genes identified in Melosira sp seem to have lower degrees of similarity to P. salina genes. Isolation of an LC-PLTFA elongase gene from Heterocapsa sp. Heterocapsa spp. such as Heterocapsa niei in the CSIRO collection (Example 2), are dinoflagellates that have been identified as LC-PUFA producers, including EPA and DHA. To exemplify the isolation of LC-PUFA synthesis genes from these dinoflagellates, DNA was purified from cells from a strain of Heterocapsa niei originally isolated in Port Hacking, NSW, Australia, in 1977. DNA was isolated using a DNAeasy kit (Qiagen) following the suppliers' instructions. Based on several published amino acid sequence alignments for fatty acid elongases (Qi et al., 2002; Parker-Barnes et al., 2000), the FLHXYH amino acid consensus blocks (SEQ ID NO: 48 ) and MYXYYF (SEQ ID NO: 49) were identified and the corresponding degenerate primers encoding these sequences 5'-CAGGATCTTYYTNCATNNNTAYCA-3 1 (SEQ ID NO: 50) (sense) or complementary to these sequences 5'-GATCTAGARAARTARTANNNRTACAT-3' (SEQ ID NO: 51) (antisense) were synthesized. PCR amplification reactions were performed in 20 p.1 reaction volumes with 20 pmol of each primer, 200 ng of genomic DNA from Heterocapsa sp. and Hotstar Taq DNA polymerase (Qiagen) with buffer and nucleotide components as specified by the supplier. The reactions were cycled as follows: 1 cycle of 95°C for 15 minutes, 5 cycles of 95°C, 1 minute, 38°C, 1 minute, 72°C, 1 minute, 35 cycles of 95°C, 35 seconds, 52°C, 30 seconds, 72°C, 1 minute, 1 cycle of 72°C, 10 minutes. Fragments of approximately 350 bp were generated and ligated into pGEM-Teasy for sequence analysis. Of the eight clones isolated, two identical clones had nucleotide and encoded amino acid sequences with similarities to known elongase regions. These were designated Het350Elo, and the nucleotide and amino acid sequences are given as ID. IN SEQ. No.: 79 and ID. OF SEQ. No.: 80, respectively. BLAST analysis and the presence of an in-frame stop codon suggested the presence of an intron between approximate positions 33 and 211. The best matches for amino acid sequence were animal elongase sequences, see eg Meyer et al. (2004), indicating that the gene sequence isolated from Heterocapsa was probably involved in the elongation of Ci fatty acid substrates 8 and C20 • Full-length elongase clones can readily be isolated by screening a Heterocapsa cDNA library or by 5' and 3' RACE techniques known in the art. cDNA library construction and EST sequencing of Melosira sp. mRNA, for the construction of a cDNA library, was isolated from Melosira sp. using the following method. Two grams (wet weight) of Melosira sp. were dusted using a pestle and mortar in liquid nitrogen and slowly dropped into a beaker containing 22 ml of extraction buffer which was being constantly stirred. To this, 5% insoluble polyvinylpyrrolidone, 90 mM 2-mercaptoethanol and 10 mM dithiotheitol were added and the mixture was stirred for a further 10 minutes before being transferred to a Corex™ tube. 18.4 ml of 3M ammonium acetate was added and mixed well. The sample was then centrifuged at 6000 xg for 20 minutes at 4°C. The supernatant was transferred to a new tube and the nucleic acid precipitated by the addition of 0.1 volume of 3 M NaAc (pH 5.2) and 0.5 volume of ice-cold isopropanol. After a 1 hour incubation at -20°C, the sample was centrifuged at 6,000 xg for 30 minutes in a shaking rotor. The pellet was resuspended in 1 ml of water and extracted with phenol / chloroform. The aqueous layer was transferred to a new tube and the nucleic acids were precipitated once more by adding 0.1 volume of 3M NaAc (pH 5.2) and 2.5 volumes of super-cold ethanol. The pellet was resuspended in water, the nucleic acid concentration was determined, and then the mRNA was isolated using the Oligotex mRNA system (Qiagen). First strand cDNA was synthesized using an oligo(dT) linker-primer supplied with the ZAP-cDNA synthesis kit (Stratagene - cat # 200400) and the Superscript reverse transcriptase!!! (Invitrogen). The double-stranded cDNA was ligated to the EcoRI adapters and from there a library was constructed using the ZAP-cDNA synthesis kit as described in the accompanying instruction manual (Stratagene - cat # 200400). A primary library of 1.4 x 10 6plaque forming units (pfu). The average insert size of cDNA inserts in the library was 0.9 kilobase, based on 47 random plaques, and the percentage of recombinants in the library was 99%. Single-pass nucleotide sequencing of 8,684 expressed sequence tags (ESTs) was performed with SK primer (5'-CGCTCTAGAACTAGTGGATC-3') (SEQ ID NO: 87) using the ABI BigDye system. The sequences of 6750 ESTs were longer than 400 nucleotides, showing that the inserts were at least that long. are that show homology to several fatty acid desaturases and a PUFA elongase were identified by BlastX analysis. The (partial) amino acid sequence (SEQ ID NO: 88) encoded by the cDNA clone Mm301461 showed 75% identity to the fatty acid elongase 1 of Thalassiosira pseudonana (Accession No. AY591337). The nucleotide sequence of EST clone Mm301461 is provided as ID. OF SEQ. No: 89. The high degree of identity to a known elongase makes it highly likely that Mm301461 encodes a Melosira fatty acid elongase. RACE techniques can be easily used to isolate the full-length clone encoding the elongase. Example 13. Isolation of FAE-like elongase gene fragment from P. salina Random cDNA clones from the P. salina cDNA library were sequenced by an EST approach. In an initial round of sequencing, 73 clones were sequenced. One clone, designated 11.Bl, was identified as encoding a protein (partial sequence) having sequence similarity to known beta keto-acyl synthase-like fatty acid elongases based on BLASTX analysis. The nucleotide sequence of 11.Bl from the 3' end is given as (SEQ ID NO: 55). These plant elongases are different from the ELO elongase class in that they are known to be involved in the elongation of C16 to C18 fatty acids and also in the elongation of very long chain saturated and monounsaturated fatty acids. Clone 11.Bl represents the first non-higher plant gene isolated in this class. Example 14. Isolation of a gene encoding a P. salina A5-desaturase Isolation of a gene fragment from an A5-desaturase gene from P. salina In order to isolate an A5-desaturase gene from P. salina, oligonucleotides were designed for a conserved region of desaturases. The oligonucleotides designated d5A and d5B shown below were made by matching a short DNA sequence from an A5-desaturase gene from Pavlova lutheri. Oligo d5A: and oligo d5B: 5 ' -ATAGTGCAGCCCGTGCTTCTCGAAGAGCGCCTTGACGCGCGGCGCGATCGT CGGGTGGCGGAATTGCGGCATGGACGGGAACAGATGATGCTCGATCTGG- 3 ' (which corresponds to the complement of nucleotides 195-294 of WO03078639-A2, Figure 4a) (SEQ ID NO: 57). These oligonucleotides were annealed and extended in a PCR reaction. The PCR product was inserted into the pGEM-T Easy vector and the nucleotide sequence was confirmed. The cloned fragment was labeled and used as a hybridization probe for screening a Pavlova salina cDNA library under moderately controlled conditions, hybridizing at 55°C overnight with SSC hybridization solution and washing the blots at 60°C with 2x SSC / 0.1% SDS three times each for 10 minutes. From screening about 500,000 plaques, 60 plaques were isolated, which generated at least a weak hybridization signal. Of the 13 clones that were sequenced, one clone, designated p1918, contained a partial-length cDNA encoding an amino acid sequence with homology to known A5-desaturase genes. For example, the amino acid sequence was 53% identical to amino acid residues 210-430 of the C-terminal region of a Thraustochytrium A5-desaturase gene (Accession No. AF489588). Isolation of a full-length A5-desaturase gene The part-length sequence at p1918 was used to design a pair of sequence-specific primers, which were then used in PCR screening of the 60 isolated plaques mentioned above. Nineteen of the 60 were positive, having the same or similar cDNA sequence. One of the clones that showed a strong hybridization signal using the part-length sequence as a probe was used to determine the full-length sequence given as an ID. OF SEQ. No.: 58, and the amino acid sequence (425 amino acids in length) encoded by it is given as ID. OF SEQ. No.: 60. The amino acid sequence was used to search the NCBI protein sequence database using the BLASTX computer program. The results indicated that this sequence was homologous to known A5-desaturases. The amino acid sequence of the P. salina protein showed 81% identity to a P. lutheri sequence from activity not defined in WO03 / 078639-A2, and 50% identity to a Thraustochytrium A5-desaturase (Accession No. AF489588). A5-desaturase from Pavlova salina showed all conserved motifs typical of "front-end desaturases" including the N-terminal cytochrome b5-like domain and three conserved motifs rich in histidine. Co-expression of A9-elongase, A8-desaturase and A5-desaturase genes in transformed cells Co-expression of the A5-desaturase gene, together with the A9-elongase gene (Elo2, Example 7) and the A8-desaturase gene (Example 6) in cells was achieved as follows. The plant expression vector pXZP354 was constructed containing the three genes, from P. salina, and each expressed from the seed-specific napin promoter. The P. salina A8-desaturase coding region from the cDNA clone (above) was first inserted as a BamHI-NcoI fragment into pXZP143 between the seed-specific napin promoter and the Nos terminator, resulting in plasmid pXZP146. Likewise, the P. salina A9-elongase gene was inserted, as a PstI-Xhol fragment from its cDNA clone, into pXZP143 resulting in plasmid pXZP143-Elo2. The A5-desaturase gene from P. salina was also inserted, as a PstI / BssHII fragment from its cDNA clone, into pXZP143, resulting in plasmid pXZP147. Then, the HindIII-Apal fragment containing the A9-elongase expression cassette from pXZP143-Elo2 was inserted into pXZP146 below the A8-desaturase expression cassette, resulting in plasmid pXZP148. The HindIII-Apal fragment containing the pXZP147 A5-desaturase expression cassette was inserted into pXZP148 below the A8-desaturase and A9-elongase expression cassettes, resulting in plasmid pXZP149. Then, as a final step, the HindIIT-Apal fragment containing the three pXZP149 genes was inserted into a pART27 binary vector derivative containing a hygromycin resistance gene selection marker, resulting in a plant expression plasmid pXZP354 . Plasmid pXZP354 was introduced into Arabidopsis by the Agrobacterium-mediated floral immersion method, with the simultaneous presence or absence of the expression plasmid pXZP355 (Example 11) which contains the A5-elongase and A4-desaturase genes from P. salina. Co-transformation of the vectors could be achieved since they contained different selectable marker genes. In the latter case, the transgenic plants (designated "DR" plants) were selected using hygromycin as the selective agent, while in the first case, the plants ("DU" plants) were selected with both hygromycin and kanamycin. Twenty-one DR plants (T1 plants) were obtained. Fatty acid analysis of T2 seed oil from ten of these plants showed the presence of low levels of 20:2cd (EDA), 20:3co6 (DGLA) and 20:4©6 (ARA), including up to 0. 4% ARA. Fatty acid analysis of seed oil from T2 seeds of seven DU plants showed similar levels of these fatty acids. From the relative proportions of these fatty acids, it was concluded that the A5-desaturase and A8-desaturase genes were functioning efficiently in seeds transformed with pXZP354, but that the activity of the A9-elongase gene was suboptimal. It is likely that the shortening of the coding region at the end of the • N-terminus, to start translation at amino acid position 11 or 29 of the ID. OF SEQ. No. : 3 (Example 9) (see SEQ ID NO. os 85 and 86) will improve the activity level of the A9-elongase gene. Expression of one or two of the genes by seed-specific promoters other than the napin promoter, such that not all are expressed by the napin promoter, is also expected to improve the level of expression of the A9-elongase gene. Example 15. Isolation of a gene encoding an Echium plantagineum A6-desaturase Some plant species such as, for example, evening primrose (Oenothera biennis}, common borage (Borago officinalis), blackcurrant (Ribes nigrum), and some Echium species belonging to the Boragenacae family contain the Ci fatty acids. 8 co6- and ú)3-desaturates, y-linolenic acid (18:3to6, GLA) and stearidonic acid (18:4to3, SDA) in their leaf lipids and seed TAGs (Guil-Guerrero et al., 2000). GLA and SDA are recognized as beneficial fatty acids in human nutrition. The first step in LC-PUFA synthesis is an A6-desaturation. GLA is synthesized by an A6-desaturase that introduces a double bond at the A6 position of LA. The same enzyme is also capable of introducing a double bond at the A6 position of ALA, producing SDA. A6-desaturase genes have been cloned from members of the Boraginacae such as borage (Sayanova et al., 1997) and two species of Echium (Garcia-Maroto et al., 2002). Echium plantagineum is a winter annual plant native to Mediterranean Europe and North Africa. Its seed oil is unusual as it has a unique proportion of tt>3 and ú)6 fatty acids and contains high amounts of GLA (9.2%) and SDA (12.9%) (Guil-Guerrero et al., 2000), suggesting the presence of A6-desaturase activity involved in the fatty acid desaturation of both co3 and <n6 in seeds of this plant. Cloning of the EplD6Des gene from E. platangineum Degenerate primers with embedded Xbal or SacI restriction sites that correspond to the N- and C-terminal amino acid sequences MANAIKKY (SEQ ID NO: 61) and EALNTHG (SEQ ID NO: 62) of A6-desaturases known from Echium pitardii and Echium gentianoides (Garcia-Maroto et al., 2002) were used for RT PCR amplification of A6-desaturase sequences from E. platangineum using a revised Pfu Turbo® DNA polymerase (Stratagene). The 1.35kb PCR product from the amplification was inserted into pBluescript SK(+) at the XbaI and SacI sites to generate plasmid pXZP106. The nucleotide sequence of the insert was determined (SEQ ID NO: 63). It was composed of an open reading frame encoding a polypeptide of 438 amino acid residues (SEQ ID NO: 64), which had a high degree of homology with other A6- and A8-desaturases reported from E. gencianoides (SEQ ID NO: 65), E. pitardii (SEQ ID NO: 66), Borago officinalis (SEQ ID NO: 66) : 67 and 68), Melianthus annuus (SEQ ID NO: 69) and Arabidopsis thaliana (SEQ ID NO: 70 and SEQ ID NO: 71) (Figure 10). It had a cytochrome b domain 5 at the N-terminus, including the HPGG motif (SEQ ID NO: 72) in the heme-binding region, as reported for other A6- and A8- desaturases (Sayanova et al 1997; Napier et al 1999). In addition, the A6-desaturase from E. plantagineum contains three conserved histidine boxes, including the third histidine box containing the signature motif QXXHH (SEQ ID NO: 73) present in most "frontend" desaturases ( Figure 10) (Napier et al., 1999). Cluster analysis including representative members of A6- and A8-desaturases showed clear clustering of the cloned gene with other A6-desaturases, especially those from the Echium species. Heterologous expression of the E. plantagineum A6-desaturase gene in yeast Yeast expression experiments were performed to confirm that the cloned E. platangineum gene encoded an A6-desaturase enzyme. The gene fragment was inserted as an Xbal-SacI fragment into the Smal-SacI sites of the yeast expression vector pSOS (Stratagene) containing the constitutive ADH1 promoter, resulting in plasmid pXZP271. This was transformed into yeast strain S288Ca by a heat shock method and the transforming colonies selected by plating on plates with minimal media. For enzyme activity analysis, 2 ml of yeast clonal cultures were grown to an O.D. 600 of 1.0 in minimal yeast medium in the presence of 0.1% NP-40 at 30°C with stirring. Precursor free fatty acids, linoleic or linolenic acid as 25 mM stocks in ethanol, were added so that the final fatty acid concentration was 0.5 mM. Cultures were transferred to 20°C and grown for 2-3 days with shaking. Yeast cells were harvested by repeated centrifugation and washing, first with NP-40 0.1%, then with 0.05% NP-40, and finally with water. Fatty acids were extracted and analyzed. The identities of the fatty acid peaks were confirmed by GC-MS. Transgenic yeast cells expressing Echium EplD6Des were able to convert LA and ALA to GLA and SDA, respectively. Around 2.9% of LA was converted into GLA and 2.3% of ALA was converted into SDA, confirming the A6-desaturase activity encoded by the cloned gene. Functional expression of the E. platangineum A6-desaturase gene in transgenic tobacco In order to demonstrate that the EplDSDes gene could confer the synthesis of A6-unsaturated fatty acids in transgenic plants, the gene was expressed in tobacco plants. To do so, the gene fragment was excised from pXZP106 as an Xbal-SacI fragment and cloned into the plant expression vector pBI121 (Clonetech) at the XbaI and SacI sites under the control of a 35S constitutive CaMV promoter, to generate the plasmid of pXZP341 plant expression. This was introduced into Agrobacterium tumefaciens AGL1, and used for transformation of W38 tobacco plant tissue, by selection with kanamycin. Northern blot analysis of transformed plants was performed to detect expression of the introduced gene, and the total fatty acids present in the lipids of W38 tobacco leaf wild-type and transformed tobacco plants were analyzed as described above. Untransformed plants contained appreciable amounts of LA (21% of total fatty acids) and ALA (37% of total fatty acids) in leaf lipids. As As expected, neither GLA nor SDA, products of A6-desaturation, were detected in the untransformed leaf. Furthermore, transgenic tobacco plants transformed with the pBI121 vector had leaf fatty acid composition similar to that of non-transformed W38 plants. In contrast, leaves from transgenic tobacco plants expressing the EplD6Des gene showed the presence of additional peaks with retention times corresponding to GLA and SDA. The identity of the GLA and SDA peaks was confirmed by GC-MS. In particular, fatty acids from the leaves of plants expressing the EplD6Des gene consistently contained approximately twice as high a concentration of GLA as DAS, even when total A6-unsaturated fatty acids accounted for up to 30% of the total fatty acids in their lipids. of the sheet (Table 11). TABLE 11. Composition of fatty acids in lipids of transgenic tobacco leaves (%). Plant 16:0 18:0 18:1 18:2 GLA 18:3 SDA Prods. totals of A6- Desa. W3 8 21.78 5.50 2.44 21.21 - 37.62 - - ET27-1 20.33 1.98 1.25 10.23 10.22 41.10 6.35 16.57 ET27-2 18.03 1.79 1.58 14.42 1.47 53.85 0.48 1.95 ET27-4 19.87 1.90 1.35 7.60 20.68 29.38 9.38 30, 07 ET27-5 15.43 2.38 3.24 11.00 0.84 49.60 0.51 1.35 ET27-6 19.85 2.05 1.35 11.12 4.54 50.45 2 .19 6.73 ET27-8 19.87 2.86 2.55 11.71 17.02 27.76 7.76 24.78 ET27-11 17.78 3.40 2.24 12.62 1.11 51.56 0.21 1.32 ET27-12 16.84 2.16 1.75 13.49 2.71 50.80 1.15 3.86 Northern analysis of several independent lines of transgenic tobacco showed varying levels of the EplD6Des transcript, which generally correlated with the levels of A6-desaturated products synthesized in the plants. For example, the transgenic plant ET27-2, which contained low levels of the EplD6Des transcript, synthesized only 1.95% of its total leaf lipids as A6-dessaturated fatty acids. On the other hand, the ET27-4 transgenic plant contained significantly higher levels of the EplD6Des transcript and also had a much higher proportion (30%) of A6-unsaturated fatty acids in its leaf lipids. Analysis of individual tobacco plants showed that, without exception, GLA was present at a higher concentration than DAS, although a higher concentration of ALA than LA was present in non-transformed plants. In contrast, expression of EplD6Des in yeast resulted in approximately equivalent levels of conversion of LA to GLA and ALA to SDA. Echium plantagineum seeds, on the other hand, contain higher levels of SDA than GLA. EplD6Des probably performs its desaturation in vivo in Echium plantagineum seeds in LA and ALA esterified in phosphatidyl choline (PC) (Jones and Harwood 1980). In the tobacco leaf assay, the enzyme likely desaturates LA and esterified ALA in the chloroplast lipid monogalactosyldiacylglycerol (MGDG) (Browse and Slack, 1981). In the yeast assay, free precursors of LA and ALA fatty acids added to the medium likely enter the acyl-CoA pool and are available to act upon EplD6Des in this form. Functional expression of the A6-desaturase gene from E. platangineum in transgenic seeds To show seed-specific expression of the Echium A6-desaturase gene, the coding region was inserted into the seed-specific expression cassette as follows. An Ncol-SacI fragment that includes the A6-desaturase coding region was inserted into pXZP6, a pBluescriptSK derivative containing a Nos terminator, resulting in plasmid pXZP157. The Smal-Apal fragment containing the coding region and EplD6Des-NosT terminator was cloned into pWVec8-Fpl below the Fpl primer, resulting in plasmid pXZP345. Plasmid pXZP345 was used to transform wild-type, Columbia ecotype, Arabidopsis plants and transgenic plants selected by hygromycin B selection. Transgenic plants transformed with this gene were designated "DP" plants. Analysis of the fatty acid composition of the seed oil of T2 seeds from eleven IT plants transformed with the construct showed the presence of GLA and SDA in all lines, with levels of A6-desaturation products reaching at least 11% (Table 12 ) . This demonstrated the A6-efficient desaturation of LA and ALA in seed. TABLE 12. Composition of fatty acids in transgenic Arabidopsis seeds expressing A6- Echium desaturase. Plant Fatty acid (%) Total A6-desaturation products (%) 16:0 18:0 18 : 1A 9 18-.2A 9 🇧🇷 12 (LA) 18:3A 6 🇧🇷 9 🇧🇷 12 (GLA) 18:3A 9 🇧🇷 12 🇧🇷 15 (ALA) 18:4A 6 🇧🇷 9 🇧🇷 12 🇧🇷 15 (SDA) 20:0 20:1 Columbia DP-2 8.0 2.8 22.9 27.3 2.5 11.3 0.7 1.6 15.8 3.2 DP-3 7.8 2 .7 20.6 25.9 3.0 12.1 0.8 1.7 17.8 3.8 SD-4 7.8 2.8 20.4 28.5 1.2 13.7 0.4 1.7 16.1 1.5 SD-5 8.2 3.2 17.4 29.3 1.2 14.2 0.3 2.1 15.6 1.6 SD-7 8.2 2, 9 18.4 26.7 5.0 12.7 1.4 1.7 15.2 6.4 DP-11 9.0 3.5 17.8 28.4 3.0 13.4 0.9 2 .1 13.9 3.8 SD-12 8.6 3.0 18.9 27.8 3.3 12.6 1.0 1.8 15.4 4.3 SD-13 8.7 2.9 14.4 27.3 8.5 13.7 2.6 1.7 12.4 11.1 DP-14 9.3 2.9 14.2 32.3 2.1 15.4 0.7 1, 8 12.8 2.8 SD-15 8.2 2.9 17.8 30.1 0.3 15.3 0.2 1.9 15.5 0.5 SD-16 8.0 2.8 19 .5 29.2 2.7 13.1 0.8 1.7 14.2 3.5 Example 16. Mutagenesis of the EplD6Des gene from E. platangineum To determine whether variability could be introduced into the A6-desaturase gene and still retain desaturase activity, the A6-desaturase cDNA from E. platangineum was randomly mutated by PCR using Taq polymerase and primers EPD6DesFl and EPD6DesRl in the presence of dITP, as described by Zhou and Christie (1997). PCR products were cloned as Xbal-SacI fragments into pBluescript SK(+) at Xbal and SacI sites, and the sequences of randomly selected clones were determined. Random variants with changes in amino acid residues were chosen to clone Xbal-SacI fragments into pBI121 and the enzymatic activities of the proteins expressed by these variants were characterized in transgenic tobacco leaves, as described above for the wild-type gene. Figure 11A depicts the activity of EplDSDes sequence variants when expressed in tobacco plants. Variants could be divided into two broad classes in terms of their ability to perform A6-desaturation. Mutations represented as empty diamonds showed substantial reductions in A6-desaturase activity, while mutations represented as solid diamonds had little or no effect on encoded A6-desaturase enzyme activity. Figure 11B depicts the quantitative effect that a selection of mutations in the EplD6Des gene had on A6-desaturase activity. An L14P mutation in the cytochrome b domain 5 and an S301P mutation between histidine box II and histidine box III of EplD6Des caused substantial reductions in its A6-desaturase activities, resulting in a 3- to 5-fold reduction in total A6-desaturase fatty acids when compared to the wild-type enzyme in W38 plants. Surprisingly, significant activity was retained for each. In contrast, most of the variants examined, as exemplified by the S205N mutation, had no effect on the A6-desaturation activity of the EplD6Des gene. Example 17. Comparison of acyl-CoA and acyl-PC substrate-dependent desaturases for LC-PUFA production in cells As described above, the synthesis of LC-PUFAs, such as EPA and DHA, in cells by the conventional A6-desaturation pathway requires the sequential action of PUFA desaturases and elongases, shown schematically in Figure 12, part A. This The conventional route operates on algae, mosses, fungi, diatoms, nematodes and some freshwater fish (Sayanova and Napier, 2004). PUFA desaturases from algae, fungi, mosses and worms are selective for desaturation of esterified fatty acids up to the sn-2 position of phosphatidylcholine (PC), while PUFA elongases act on fatty acids in the form of acyl-CoA substrates represented in the pool of acyl-CoA in the endoplasmic reticulum (ER), which is physiologically separate from the PC component of the ER. Therefore, sequential desaturation and elongation reactions on a fatty acid substrate require the fatty acid to be transferred between the acyl-PC and acyl-CoA pools in the ER. This requires acyltransferases to be able to accommodate LC-PUFA substrates. This "substrate change" requirement can be responsible for the low efficiency observed in reported initial attempts to reconstitute LC-PUFA biosynthesis (Beaudoin et al., 2000, Domergue et al., 2003a). The alternative A8-desaturation pathway (Figure 12, part B) has the same drawback of requiring a "substrate change". As described in Example 5, the strategy of using a vertebrate desaturase that was capable of desaturating acyl-CoA substrates provided relatively efficient production of LC-PUFA in plant cells, including seeds. In Example 5, the combination of a zebrafish A5 / A6 desaturase with a C. elegans A6 elongase had the advantage that both enzymes, desaturase and elongase, had activity on acyl-CoA substrates in the acyl pool. -CoA. This may explain why this strategy was more efficient in LC-PUFA synthesis. To provide a direct comparison of the relative efficiencies of using an acyl-CoA substrate-dependent desaturase compared to an acyl-PC substrate-dependent desaturase, we performed the following experiment. He compared the use of Echium A6-desaturase (Example 15) and P. salina A5-desaturase (Example 14), both of which supposedly utilize acyl-PC substrates, with zebrafish A6 / A5-desaturase using an acyl-CoA substrate (Example 5). A construct containing two acyl-PC-dependent desaturases, specifically the Echium A6-desaturase and the P. salina A5-desaturase, in combination with the C. elegans A6-elongase was prepared. The Echium A6-desaturase gene in an NcoT-SacT fragment was inserted into pXZP143 (Example 15) resulting in pXZP192. The C. elegans A6-elongase gene (Fpl-CeElo-NosT expression cassette) in the HindTTT-Apal fragment of pCeloPWVec8 (Example 5) was inserted into the Stul-Apal sites of pXZP147 (Example 14) to generate pXZP193. The HindIII-Apal fragment from pXZP193 containing both genes (Fpl-PsD5Des-NosT and Fpl-CeElo-NosT) was inserted into the Apal-StuT sites of pXZP192, resulting in plasmid pXZP194 containing the three expression cassettes. The Xbal-Apal fragment from pXZP194 was inserted into a pWvec8 derivative, resulting in pXZP357. Plasmid pXZP357 was used to transform wild-type Arabidopsis plants, ecotype Columbia, by the Agrobacterium-mediated floral immersion method, and six transgenic plants were obtained after selection by hygromycin B (20 mg / l). TI transgenic plants were designated "DT" plants. Hygromycin-resistant transformed plants were transferred to soil and self-fertilized. T2 seeds were harvested and the fatty acid composition of the seed of two lines, DT1 and DT2, was analyzed. DT1 and DT2 seed fatty acids contained low levels of 18:3co6 and 18:4co4 (0.9 and 0.8% GLA, 0.3% and 0.1% SDA, respectively, Table 13). Furthermore, both DT1 and DT2 seeds also contained 0.3% and 0.1% of 20:4w6 (ARA). However, there was no apparent synthesis of the co3 fatty acid EPA in any of the seeds from the T2 lines, which probably reflected the greater desaturation ability of the Echium A6-desaturase on the LA to6 substrate compared to the ALA co3 substrate ( Example 15). TABLE 13. Seed oil fatty acid composition of T2 seeds of DTI and DT2. The fatty acid values are % of total fatty acids. Fatty acid Control DT1 DT2 16 : 0 7.2 6.5 6.5 18 : 0 2.9 3.6 3.3 18 : 1(09 20.0 23.2 22.3 18 : 2(06 27, 5 23.6 24.4 18 : 3C03 15.1 15.4 16.1 20 : 0 2.2 2.0 1.9 20 : 1(09 / (011 19.9 19.4 19.5 20 : 1(0 7 2.2 3.4 3.0 20 : 2(06 0.1 0.0 0.0 22 :1(07 0.0 0.0 0.0 Other minors 2.8 1.5 1 ,9 Total 100.0 98.6 98.9 New (06 - PUFA 18 : 3(06 0.0 0.9 0.8 20 : 3(06 0.0 0.0 0.0 20 :4(o6 0.0 0.3 0.1 Total 0.0 1.2 0.9 New (03 - PUFA 18 :4(03 0.0 0.3 0.2 20 : 4(03 0.0 0.0 0 ,0 20 : 5(03 0.0 0.0 0.0 Total 0.0 0.3 0.2 Total fatty acids 100.00 100.00 100.0 These data are in sharp contrast to those of the Example 5 above, where expression of fish-fish desaturase acyl-CoA-dependent zebra in combination with an A6-elongase resulted in the production of at least 1.1% ARA. and 2.3% EPA in fatty acids from T2 seeds. Thus, it appears that acyl-PC dependent desaturases were less effective than acyl-CoA dependent desaturases in driving LC-PUFA synthesis in plant cells. Example 18. Expression of LC-PUFA Genes in Synechococcus Synechococcus spp. (Bacteria; Cyanobacteria; Chroococcales; Synechococcus species, eg Synechococcus elongatus, also known as Synechocystis spp.) are unicellular, photosynthetic, marine or freshwater bacteria of the order Cyanobacteria, which use chlorophyll a in the light collection apparatus. The species includes important primary producers in the marine environment. A distinctive feature of Synechococcus is the presence of phycoerythrin, an orange fluorescent compound that can be detected at an excitation wavelength of 540 nm, and which can be used to identify Synechococcus. Members of the marine synechococcus group are closely related at the level of 16s rRNA. They are obligate marine and have high Na growth requirements. + , Cl', Mg 2+ and Ca 2+ , but can grow rapidly in natural and artificial seawater liquid media, as well as on plates (Waterbury et al. 1988). As they have a fast heterotrophic or autotrophic growth rate, contain fatty acid precursors such as LA and ALA, and are relatively simple to transform, they are suitable for functional studies involving the synthesis of genes from LC-PUFA, or for the production of LC-PUFA in fermenter-type production systems. Strains such as Synechococcus sp. strain WH8102, PCC7002 (7002, marine), or PCC7942 (freshwater) can grow easily and are amenable to biochemical and genetic manipulation (Carr, N.G., and N.H. Mann. 1994. "The oceanic cyanobacterial picoplankton", pages 27-48 EM: D.A. Bryant (ed.), "The Molecular biology of cyanobacteria". Kluwer Academic publishers, Boston). For example, Synechococcus has been used as a heterologous expression system for desaturases (Domergue 2003b). Fatty acid profile and growth rates of wild-type Synechococcus 7002 To show that the cyanobacterium Synechococcus 7002 was a suitable host for the transformation of fatty acid synthesis genes and that this expression system could be used to rapidly test the functions and specificities of fatty acid synthesis genes, we first analyzed the growth of wild type strain 7002 at 22°C, 25°C and 30°C and the resulting fatty acid profiles were analyzed by gas chromatography for growth at 22°C and 30°C (Table 14). TABLE 14. Fatty acid profiles of wild-type Synechococcus 7002 at 22°C and 30°C growth temperatures (% of total fatty acid). Temp. Myristic Palmitic Palmi-toleic Stearic Oleic 18: smooth Lino-leic GLA Lino-leic 22°C 0.79 42.5 10.6 0.92 8.4 1.5 7.5 0 .54 27.1 30°C 0.76 47.1 10.9 0.67 17.0 0.34 20.4 2.9 Growth at 30°C was much faster than at 22°C, with intermediate rates at 25°C (Figure 13). The cells were found to contain linoleic (LA, 18:2a>6) and linolenic (ALA, 18:3co3) acids, which could be used as precursors for LC-PUFA synthesis. While some of the preferred ALA precursors were produced at 30°C, higher levels were obtained at 22°C. Tests were also performed to determine whether the cells would grow at 30°C, followed by lowering the incubation temperature to 22°C, after sufficient biomass had been obtained to see whether this would result in a shift to greater linolenic acid production ( Figure 14) . In this experiment, the ALA levels obtained were greater than 5%. In additional experiments, a temperature of 25°C was used as the preferred temperature for the 7002 strain, providing adequate growth rates and a suitable precursor fatty acid profile. transformation strategy Replicative plasmid vectors and non-replicative homologous recombination vectors have previously been used to transform several species of cyanobacteria, including Synechococcus 7002 (Williams and Szalay, 1983; Ikeda et al., 2002; Akiyama et al., 1998a). Recombination vectors may be preferred in certain applications, and have been used to inactivate a gene rather than create an expression strain. A recombination vector was constructed that was suitable for introducing one or more fatty acid synthesis genes into the chromosome of Synechococcus strains, such as strain 7002. This vector contained the Synechococcus 7002 sul2 gene in a central structure of the plasmid pBluescript, which provided an ampicillin gene as a selectable marker, and allowed bacterial replication in species such as E. coli. The vector was designed to contain an E. coli plac promoter fused to a multiple cloning site below, with the two elements inserted approximately in the center of the sul2 gene. The sul2 gene in Synechococcus encodes a low-affinity sulfate that is not essential under normal growth conditions. Any gene other than sul2, preferably a non-essential gene, could have been chosen for incorporation into the recombination vector. The sul2 gene was amplified from the genomic DNA of Synechococcus 7002 using primers with gene specificity, based on the nearly identical sequence in the PCC6803 strain (Genbank Accession No. NC 000911, nucleotides 2902.831 to 290.4501) and inserted into the pGEM- T. The pBluescript plac promoter was amplified using primers 5 1 -gctacgcceggggatectcgaggctggcgcaacgcaattaatgtga-3 ' (SEQ ID NO: 81) (sense) and 5'- cacaggaaacagcf tgacatcgattaccggcaattgtacggeggccgctacggatatcc tcgctcgagctcgcccggggtagct-3' (SEQ ID NO: 82) (antisense), which also introduced several restriction sites at the ends of the promoter sequence. The amplified fragment was then digested with SmaI and ligated into the large PvuII fragment of pBluescript which includes the beta-lactamase gene. This intermediate vector was then digested with EcoRV and SacI and ligated to the Hpal to SacI fragment (designated sul2b) of the sul2 gene. The resulting plasmid was digested with BamHI, treated with DNA polymerase I (Klenow fragment) to fill in its ends, and ligated to the fragment Smal to Hpal (designated su!2a) of the sul2 gene. Excess restriction sites were then removed from this vector by digestion with SacT and SpeI, blunting their ends with T4 DNA polymerase, and religation. Finally, a multiple cloning site was introduced below the plac promoter by digesting the vector with ClaI and NotI, and ligating a ClaI fragment to NotI from pBluescript, generating the recombination vector that was designated pJRP3.2. Several genes related to LC-PUFA synthesis were adapted by PCR methods to include flanking restriction sites as well as ribosome binding site (RBS) sequences that were suitable for expression in the prokaryote, Synechococcus. For example, A6-desaturase from Echium plantagineum (Example 15) was amplified with primers 5'-AGCACATCGATGAAGGAGATATACCCatggctaatgcaatcaagaa-3' (SEQ ID. NO: 83) (sense) and 5'-ACGATGCGGCCGCTCAACCATGAGTATTAAGAGCTT-3' (ID DE SEQ NO: 84) (antisense). The amplified product was digested with ClaI and NotT and cloned into the ClaI to NotI sites of pJRP3.2. A selectable marker gene comprising a chloramphenicol acetyl transferase (CAT) coding region (catB3 gene, Accession No. AAC53634) below a pbsA promoter (psbA-CAT) was inserted into the XhoT site of pJRP3.2, producing the vector pJRP3.3. The selectable marker gene was inserted within the sulB gene to allow for easy selection of homologous recombination events after introduction of the recombination vector into Synechococcus. The transformation of Synechococcus 7002 was obtained by mixing vector DNA with cells during the exponential phase of growth, during which DNA uptake occurs, as follows. Approximately 1 pig of recombination vector DNA resuspended in 100 µl of 10 mM Tris-HCl was added to 900 µl of medium log phase cells growing in BG-11 broth. Cells were incubated for 90 minutes at 30°C and light intensity of 20 pimol photons.m' 2 🇧🇷 s' 1 🇧🇷 250 p.1 aliquots were then added to 2 ml of BG-11 broth, mixed with 2 ml of molten agar (1.5%) and poured onto BG-11 agar plates containing 50 pg / ml (Cm) chloramphenicol to selection of recombinant cells. Plates were incubated for 10-14 days under the same temperature / light conditions before Cm resistant colonies were clearly visible. These colonies were then streaked several times onto fresh BGll / Cm50 plates. After streaking for several rounds on selective plates, liquid medium was inoculated with individual colonies and the cultures were incubated at 25°C. Synechococcus 7002 cells containing the Echium A6-desaturase gene inserted into the sulB gene via the recombination vector and expressed by the plac promoter were found to produce GLA (18:3 A6,9,12) and SDA (18:4 , A6,9,12,15) from endogenous linoleic acid (LA) and linolenic acid (ALA), respectively, as substrates. Episomal vectors can also be used in Synechococcus instead of the integrative / recombination vectors described above. Species of Synechococcus have native plasmids that have been adapted for use in transformation, for example, pAQEXl, in which a fragment of the native plasmid pAQl (Accession No. NC_005025) was fused to an E. coli plasmid to form a shuttle vector with both E. coli and Synechococcus origins of replication (Ikeda et al., 2002; Akiyama et al., 1998b ). It will be appreciated by those skilled in the art that numerous variations and / or modifications can be made to the invention, as shown in the specific embodiments, without departing from the spirit or scope of the invention, as broadly described. The present arrangements, therefore, are to be considered in all respects as illustrative and not restrictive. All publications discussed above are hereby incorporated in their entirety. Any discussion of documents, acts, materials, devices, articles or the like which have been included in this specification is solely intended to provide context for the present invention. It should not be construed as an admission that any or all of these matters form part of established art or are common knowledge in the field relevant to the present invention, as if they existed prior to the priority date of each claim in this application. REFERENCES Abbadi, A. et al., (2001) Eur. J. Lipid. Know. Technol. 103:106-113. Abbadi, A., et al. (2004) Plant Cell 16:2734-2748. Abbott et al., (1998) Science 282:2012-2018. Agaba, M. et al., (2004) Marine Biotechnol. (NY) 6:251-261. Akiyama, H. et al. (1998a) DNA Res. 5:327-334. Akiyama, H. et al. (1998b) DNA Res. 5:127-129. Baumlein, H, et al., (1991) Mol. Gen. Genet. 225:459-467 . Baumlein, H. et al. , (1992) Plant J. 2:233-239. Beaudoin, F. et al. , (2000) Proc. Natl. academic Sci. USA 97:6421-6426. Berberich, T. et al., (1998) Plant Mol. Biol. 36:297- 306 . Bolch, C.J. et al. , (1999a) J. Phycology 35:339-355 Bolch, C.J. et al. , (1999b) J. Phycology 35:356-367 Broun, P. et al., (1998) Plant J. 13:201-210. Brown, M.R. and cols. , (1997) Aquaculture 151:315-331. Browse, J.A. and Slack, C.R. (1981) FEBS Letters 131:111-114. Chinain, M. et al., (1997) J. Phycology 33:36-43. Cho, H.P. et al., (1999a) J. Biol. chem. 274:471-477. Cho, H.P. et al., (1999b) J. Biol. chem. 274:37.335- 37,339. Clough, S.J. and Bent, A.F. (1998) Plant J. 16:735-43. Coleman, A.W. (1977) Am. J.Bot. 64:361-368. Domergue, F. et al., (2002) Eur. J. Biochem. 269 ​​:4,105-4,113. Domergue, F. et al., (2003a) J. Biol. chem. 278:35,115-35,126. Domergue, F. et al., (2003b) Plant Physiol. 131:1648-1660. Drexler, H. et al., (2003) J. Plant Physiol. 160:779- 802 . Dunstan, GA et al., (1994) Phytochemistry 35:155- 161. Gallagher, J. C. (1980) J. Phycology 16 - 464-474. Garcia-Maroto. F. et al., (2002) Lipids 37:417-426. Girke, T. et al., (1998) Plant J. 15:39-48. Guil-Guerrero, J.L. and cols. , (2000) Phytochemistry 53:451-456. Haseloff, J. and Gerlach, W.L. (1988) Nature 334:585-591. Hastings, N. et al., (2001) Proc. Natl. academic Sci. USA 98:14304-14309. Hong, H. et al., (2002) Lipids 37:863-868. Hong, H. et al., (2002a) Lipids 37:863-868. Horiguchi, G. et al., (1998) Plant Cell Physiol. 39:540-544. Huang, Y.S. et al., (1999) Lipids 34:649-659. Ikeda, K. et al. (2002) World J. Microbiol. Biotech. 18:55-56. Inagaki, K. et al., (2002) Biosci. Biotechnol. Biochem. 66:613-621. Jones, A. V. and Harwood, J. L (1980) Biochem. J. 190:851- 854 . Kajikawa, M. et al., (2004) Plant Mol. Biol. 54:335-52 . Knutzon, D.S. et al., (1998) J. Biol. chem. 273:29,360-6. Lee, M. et al., (1998) Science 280:915-918. Leonard, A.E. et al., (2000) Biochem. J. 347:719-724. Leonard, A.E. et al., (2000b) Biochem. J. 350:765- 770 . Leonard, A.E. et al., (2002) Lipids 37:733-740. Lo, J. et al., (2003) Genome Res. 13:455-466. Mansour, M. P. et al., (1999a) J. Phycol. 35:710-720. Medlin, L.K. et al., (1996) J. Marine Systems 9:13-31. Metz, J.G. et al., (2001) Science 293:290-293. Meyer, A. et al., (2003) Biochemistry 42:9779-9788. Meyer, A. et al., (2004) Lipid Res. 45:1899-1909. Michaelson, L. V. et al., (1998a) J. Biol. chem. 273:19055-19059. Michaelson, L.V. et al., (1998b) FEBS Lett. 439:215-218 . Mitchell, A.G. and Martin, C.E. (1995) J. Biol. chem. 270:29766-29772. Morita, N. et al., (2000) Biochem. Soc. Trans. 28: 872-879. Napier, J. A. et al., (1998) Biochem. J. 330:611-614. Napier, J.A et al., (1999) Trends in Plant Sci. 4:2- 4 . Napier, J. A. et al., (1999 ) Curr. Op. Plant Biol 2:123-127. Needleman, S.B. and Wunsch, C.D. (1970) J. Mol. Biol 48:443-453. Parker-Barnes, J. F, , et al. , (2000) Proc. Natl. Academy Sci. USA 97:8284-8289. Pereira, S. L. et al., (2004) Biochem. J. 378:665-671. Perriman, R. et al., (1992) Gene 113:157-163. Qi, B. et al., (2002) FEBS Lett. 510:159-165. Qiu, X. et al., (2001) J. Biol. chem. 276:31,561- 31,566. Reddy, A.S. et al., (1993) Plant Mol. Biol. 22:293- 300 . Saito, T. et al., (2000) Eur. J. Biochem. 267:1,813- 1818. Sakuradani, E. et al., (1999) Gene 238:445-453. Sayanova, O.V. et al., (1997) Proc. Natl. academic Sci. USA 94:4211-4216. Sayanova, O.V. and cols. , (1999) Plant Physiol. 121:641-646 . Sayanova, O.V. et al., I [2003) FEBS Lett. 542:100-104. Sayanova, O.V. and Napier, J.A. (2004) Phytochemistry 65:147-158. Shippy, R. et al., (1999) Mol. Biotech. 12:117-129. Simopoulos, AP. (2000) Poultry Science 79:961-970. Singh, S. et al., (2001) Planta 212:872-879. Smith, N.A. et al., (2000) Nature 407:319-320. Sperling, P. et al., (2000) Eur. J. Biochem. 267:3801-3811. Sperling, P. and Heinz, E. (2001) Eur. J. Lipid Sci. Technol. 103:158-180 Sprecher, H. et al., (1995) J. Lipid Res. 36:2,471- 2,477. Spychalla, P.J. et al., (1997) Proc. Natl. academic Sci. USA 94:1142-1147. Stalberg, K. et al., (1993) Plant. mol. Biol. 23:671-683 . Takeyama, H. et al., (1997) Microbiology 143:2725- 2,731. Tanaka, M. et al., (1999) Biotechnol. Left. 21:939- 945 . Tonon, T. et al., (2003) FEBS Lett. 553:440-444. Trautwein, EA. (2001) Euro. J. Lipid Sci. Technol. 103:45-55. Tvrdik, P. (2000) J. Cell. Biol. 143:707-718. Valvekens, D. et al., (1988) Proc. Natl. academic Sci. USA 85:5536-5540. Volkman, J.K. et al., (1989) J. Exp. Sea. Biol. Eco. 128:219-240. Wallis, J.G. and Browse, J. (1999) Arch. Biochem. Biophys. 365:307-316. Wang, M.B. et al., (1997) J. Gen. Breed. 51:325-334. Waterbury, J.B. et al. (1988) Methods Enzymol. 167:100-105. Waterhouse, P.M. et al., (1998) Proc. Natl. academic Sci. USA 95:13959-13964. Watts, J. L. and Browse, J. (1999b) Arch. Biochem. Biophys. 362:175-182. Williams, J.G. and Szalay, A.A. (1983) Gene 24:37-51. Whitney, H.M. et al., (2003). Blueprint 217:983-992. Yazawa, K. (1996) Lipids 31:S297-S300. Yu, R. et al., (2000) Lipids 35:1061-1064. Zank, T.K. et al., (2000) Plant J. 31:255-268. Zank, T.K. et al., (2002) Plant J. 31:255-268. Zhang, Q. et al., (2004) FEBS Lett. 556:81-85. Zhou, X.R. and Christie, P.J. (1997) J. Bacteriol. 179:5835-5842. SEQUENCE LISTING <110> Commonwealth Scientific and Industrial Research Organization <120> Synthesis of long-chain polyunsaturated fatty acids in recombinant cells <130> 503364 <160> 89 <170> Patentln version 3.3 <210> 1 <211> 427 <212> PRT <213> Pavlova saline <400> 1 Met Gly 1 Arg Gly Gly 5 Asp Ser Ser Gly Gin 10 Ala His Pro Ala Ala 15 Glu Leu Ala Vai Pro Ser Asp Arg Ala Glu Vai Ser Asn Ala Asp Ser Lys 20 25 30 Ala Leu His lie Vai Leu Tyr Gly Lys-Arg Vai Asp Vai Thr Lys Phe 35 40 45 Gin Arg Thr His Pro Gly Gly Ser Lys Vai Phe Arg Ile Phe Gin Asp 50 55 60 Arg Asp Ala Thr Glu Gin Phe Glu Ser Tyr His Ser Lys Arg Ala Ile 65 70 75 80 Lys Met Met Glu Gly Met Leu . Lys Lys Ser Glu Asp Ala Pro Ala Asp 85 90 95 Thr Pro Leu Pro Ser Gin Ser Pro Met Gly Lys Asp Phe Lys Ala Met 100 105 110 Ile Glu Arg His Vai Ala Ala Gly Tyr Tyr Asp Pro Cys Pro Leu Asp 115 120 125 Glu Leu Phe Lys Leu Ser Leu Vai Leu Leu Pro Thr Phe Ala Gly Met 130 135 140 Tyr Met Leu Lys Ala Gly Vai Gly Ser Pro Leu Cys Gly Ala Leu Met 145 150 155 160 Vai Ser Phe Gly Trp Tyr Leu Asp Gly Trp Leu Ala His Asp Tyr Leu 165 170 175 His His Ser Vai Phe Lys Gly Ser Vai Ala Arg Thr Vai Gly Trp Asn 180 185 190 Asn Ala Ala Gly Tyr Phe Leu Gly Phe Vai Gin Gly Tyr Ala Vai Glu 195 200 205 . Trp Trp Arg 210 Ala Arg His Asn Thr His His Vai Cys Thr ' Asn Glu Asp 215 220 Gly Ser Asp Pro Asp He Lys Thr Ala Pro Leu Leu He Tyr Val Arg 225 230 235 240 Asn Lys Pro Ser He Ala Lys Arg Leu Asn Ala Phe Gin Arg Tyr Gin 245 250 255 Gin Tyr Tyr Tyr Vai Pro Vai Met Ala He Leu Asp Leu Tyr Trp Arg 260 265 270 Leu Glu Ser lie Ala Tyr Vai Ala Met Arg Leu Pro Lys Met Leu Pro 275 280 285 Gin Ala Leu Ala Leu Vai Ala His Tyr Ala He Vai Ala Trp Val Phe 290 295 300 Ala Gly Asn Tyr His Leu Leu Pro Leu Vai Thr Vai Leu Arg Gly Phe 305 310 315 320 Gly Thr Gly He Thr Vai Phe Ala Thr His Tyr Gly Glu Asp lie Leu 325 330 335 Asp Ala Asp Gin Vai Arg His Met Thr Leu Vai Glu Gin Thr Ala Leu 340 345 350 Thr Ser Arg Asn He Ser Gly Gly Trp Leu Vai Asn val Leu Thr Gly 355 360 365 Phe He Ser Leu Gin Thr Glu His His Leu Phe Pro Met Met Pro Thr 370 375 380 Gly Asn Leu Met Thr lie Gin Pro Glu Vai Arg Ala Phe Phe Lys Lys 385 390 395 400 His Gly Leu Glu Tyr Arg Glu Gly Asn Leu He Glu Cys Val Arg Gin 405 410 415 Asn He Arg Ala Leu Ala Phe Glu His Leu Leu 420 425 <210> 2 <211> 302 <212> PRT <213> Pavlova saline <400> 2 Met 1 Lys Ala Ala Ala 5 Gly Lys Val Gin Gin 10 Glu Ala Glu Arg Leu 15 Thr Ala Gly Leu Trp Leu Pro Met Met Leu Ala Ala Gly Tyr Leu Leu Val 20 25 30 Leu Ser Ala Asn Arg Ala Ser Phe Tyr Glu Asn He Asn Asn Glu Lys 35 40 45 Gly Ala Tyr Ser Thr Ser Trp Phe Ser Leu Pro Cys Vai Met Thr Ala 50 55 60 Vai Tyr 65 Leu Gly Gly Vai 70 Phe Gly Leu Thr Lys 75 Tyr Phe Glu Gly Arg 80 Lys Pro Met Gin Gly Leu Lys Asp Tyr Met Phe Thr Tyr Asn Leu Tyr 85 90 95 Gin Vai lie lie Asn Vai Trp Cys He Ala Ala Phe Vai Vai Glu Vai 100 105 110 Arg Arg Ala Gly Met Ser Ala Vai Gly Asn Lys Vai Asp Leu Gly Pro 115 120 125 Asn Ser Phe Arg Leu Gly Phe Vai Thr Trp Vai His Tyr Asn Asn Lys 130 135 140 Tyr Vai Glu Leu Leu Asp Thr Leu Trp Met Vai Leu Arg Lys Lys Thr 145 150 155 160 Gin Gin Vai Ser Phe Leu His Vai Tyr His His Vai Leu Leu lie Trp 165 170 175 Ala Trp Phe Cys Vai Vai Lys Phe Cys Asn Gly Gly Asp Ala Tyr Phe 180 185 190 Gly Gly Met Leu Asn Ser He lie His Vai Met Met Tyr Ser Tyr Tyr 195 200 205 Thr Met Ala Leu Gly Trp Ser cys Pro Trp Lys Arg Tyr Leu Thr 210 215 220 Gin Ala Gin Leu Vai Gin Phe Cys He Cys Leu Ala His Ala Thr Trp 225 230 235 240 Ala Ala Ala Thr Gly Vai Tyr Pro Phe His He Cys Leu Vai Glu lie 245 250 255 Trp Vai Met Vai Ser Met Leu Tyr Leu Phe Thr Lys Phe Tyr Asn Ser 260 265 270 Tyr Lys Ward Gly Ala Ala Lys Gly Ala Ala Ala Ser Ser Asn Gly Ala 275 280 285 Ala Ala Pro Ser Gly Ala Lys Pro Lys Ser He Lys Ala Asn 290 295 300 <210> 3 <211> 304 <212> PRT <213> Pavlova saline <400> 3 Met 1 Gly Pro Leu Ser 5 Thr Leu Ala Trp 10 Met Pro Thr Trp Gly 15 Glu Phe Vai Ala Gly 20 Leu Thr Tyr Vai Glu 25 Ar...

Claims

CLAIMS 1. A recombinant cell capable of synthesizing a long-chain polyunsaturated fatty acid (LC-PUFA), characterized by comprising one or more polynucleotides encoding at least two enzymes, each of which is a bifunctional A5 / A6-desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A5-elongase, A6-elongase, A4-desaturase, A9-elongase, or A8-desaturase, wherein one or more polynucleotides are operationally linked to one or more promoters capable of directing the expression of said polynucleotides in the cell, wherein said recombinant cell is derived from a cell that is not capable of synthesizing said LC-PUFA.

2. A recombinant cell with an increased capacity to synthesize a long-chain polyunsaturated fatty acid (LC-PUFA) relative to a non-recombinant isogenic cell, characterized by comprising one or more polynucleotides encoding at least two enzymes, each of which is a bifunctional A5 / A6-desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A5-elongase, A6-elongase, A4-desaturase, A9-elongase or A8-desaturase, wherein one or more polynucleotides are operationally linked to one or more promoters capable of expressing said polynucleotides in said recombinant cell.

3. A cell, according to either claim 1 or 2, characterized in that at least one of the enzymes is an A5-elongase.

4. Cell according to claim 3, characterized in that the A5-elongase also has A6-elongase activity and in which elongase is more efficient in synthesizing DPA from EPA than in synthesizing ETA from SDA.

5. Cell, according to any of the Claims 3 or 4, characterized in that A5-elongase comprises: i) an amino acid sequence as provided in ID. SEQ. NO: 2, ii) an amino acid sequence that is at least 50% identical to ID. DE SEQ. N°: 2, or iii) a biologically active fragment of i) or ii).

6. Cell according to claim 5, characterized by the fact that A5-elongase comprises: i) an amino acid sequence as provided in ID. DE SEQ. No.: 2, ii) an amino acid sequence that is at least 90% identical to ID. DE SEQ. No.: 2, or iii) a biologically active fragment of i) or ii) • 7. Cell, according to any one of claims 3, 4, 5 or 6, characterized in that A5-elongase can be purified from algae.

8. Cell, according to any one of claims 3, 4, 5 or 6, characterized in that the A5-elongase can be purified from algae. Claims 1 or 2, characterized in that at least one of the enzymes is an A9-elongase.

9. Cell according to claim 8, characterized in that the A9-elongase also has A6-elongase activity.

10. Cell according to claim 9, characterized in that A9-elongase is more efficient in synthesizing ETrA by ALA than in synthesizing Water treatment plant (WTP) from SDA.

11. A cell, according to any one of claims 9 or 10, characterized in that A9-elongase is capable of elongating SDA to ETA, GLA to GLA, or both, in a yeast cell.

12. Cell according to any one of claims 9, 10 or 11, characterized in that the A9-elongase comprises: i) an amino acid sequence as provided in ID. DE SEQ. N°: 3, ID. DE SEQ. N°: 85 or ID. DE SEQ. N°: 86, ii) an amino acid sequence that is at least 50% identical to ID. DE SEQ. N°: 3, 20 ID. DE SEQ. N°: 85 or ID. DE SEQ. N°: 86, or iii) a biologically active fragment of i) or ii).

13. Cell according to claim 12, characterized in that the A9-elongase comprises: i) an amino acid sequence as provided in ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 or ID. OF SEQ. No.: 86, ii) an amino acid sequence that is at least 90% identical to ID. DE SEQ. N°: 3, ID. DE SEQ. N°: 85 or ID. DE SEQ. N°: 86, or iii) a biologically active fragment of i) or ii).

14. Cell according to any one of claims 9, 10, 11, 12 or 13, characterized in that A9-elongase can be purified from algae or fungi.

15. A cell, according to either claim 1 or 2, characterized in that at least one of the enzymes is a bifunctional A5 / A6-desaturase or a bifunctional A5 / A6-elongase.

16. Cell according to claim 15, characterized in that the bifunctional A5 / A6-desaturase comprises: i) an amino acid sequence as provided in ID. DE SEQ. N°: 15, ii) an amino acid sequence that is at least 50% identical to ID. DE SEQ. N°: 15, or iii) a biologically active fragment of i) or ii).

17. Cell, according to any of the Claims 15 or 16, characterized in that the bifunctional A5 / A6-desaturase is naturally produced by a species of freshwater fish.

18. Cell according to claim 15, characterized in that the bifunctional A5 / A6-elongase comprises: i) an amino acid sequence as provided in ID. OF SEQ. No.: 2 or ID. OF SEQ. No.: 14, ii) an amino acid sequence that is at least 50% identical to sequence ID No. 2 or sequence ID No. 14, or iii) a biologically active fragment of i) or ii).

19. Cell according to any one of claims 1 or 2, characterized in that at least one of the enzymes is an A5-desaturase.

20. Cell according to any one of claims 1 or 2, characterized in that at least one of the enzymes is an A8-desaturase.

21. Cell according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, characterized by comprising at least one C20 LC-PUFA that is synthesized in the cell, in that the total fatty acid content of the cell comprises at least 2%, at least 4.7% or at least 7.9% of C20 LC-PUFA.

22. Cell according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21, characterized by to comprise at least one CO3 C20 LC-PUFA that is synthesized in the cell and in which the total fatty acid content of the cell comprises at least 2.5% or at least 4.1% of CO3 C20 LC-PUFA.

23. A cell, according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22, characterized by comprising polyunsaturated fatty acids ®3 that are the products of A6-desaturation of ALA and / or the products of A9-elongation of ALA, which products are synthesized in cell, and wherein the conversion efficiency of ALA into said products in the cell is at least 22% or at least 24%.

24. Cell, according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23, characterized by the fact that the LC-PUFA is docosahexaenoic acid (DHA).

25. Cell according to claim 24, characterized in that the introduced polynucleotide(s) encodes three or four enzymes selected from the group consisting of: bifunctional A5 / A6-desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A-elongase, A-6-elongase and A4-desaturase.

26. Cell according to claim 25, characterized in that the enzymes are as numerous as the following combinations: i) a bifunctional A5 / A6 desaturase, a bifunctional A5 / A6 elongase, and an A4 desaturase, ii) a bifunctional A5 / A6 desaturase, an A5 elongase, an A6 elongase and an A4 desaturase, or iii) an A5-desaturase, an A6-desaturase, a bifunctional A5 / A6-elongase, and an A4-desaturase.

27. Cell according to claim 24, characterized in that the introduced polynucleotide(s) encodes five enzymes, wherein the enzymes are as many as the following combinations: i) an A4-desaturase, an A5-desaturase, an A6-desaturase, an A5-elongase, and an A6-elongase, or ii) an A4-desaturase, an A5-desaturase, an A8-desaturase, an A5-elongase, and an A9-elongase.

28. Cell according to claim 24, characterized in that the cell is from an organism suitable for fermentation and the enzymes are at least one bifunctional A5 / A6-desaturase, one A5-elongase, one A6-elongase and one A4-desaturase.

29. Cell according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23, characterized in that the LC-PUFA is docosapentaenoic acid (DPA).

30. Cell according to claim 29, characterized in that the introduced polynucleotide(s) encodes two or three enzymes selected from the group consisting of: bifunctional A5 / A6-desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A5-elongase and A6-elongase.

31. Cell according to claim 30, characterized by the fact that the enzymes are as numerous as the following combinations: i) a bifunctional A5 / A6-desaturase and a bifunctional A5 / A6-elongase, ii) a bifunctional A5 / A6-desaturase, an A5-elongase and an A6-elongase, or iii) an A5-desaturase, an A6-desaturase, and a bifunctional A5 / A6-elongase.

32. A cell according to claim 29, characterized in that the introduced polynucleotide(s) encodes four enzymes, wherein the enzymes are as numerous as the following combinations: i) an A5-desaturase, an A6-desaturase, an A5-elongase and an A6-elongase, or ii) an A5-desaturase, an A8-desaturase, an A5-elongase, and an A9-elongase.

33. Cell according to claim 29, characterized in that the cell is from an organism suitable for fermentation, and the enzymes are at least one bifunctional A5 / A6-desaturase, one A5-elongase and one A6-elongase.

34. Cell, according to any of the claims 29, 30, 31, 32 or 33, characterized by To understand DPA that is synthesized in the cell and in which the total fatty acid content of the cell comprises at least 0.1%, at least 0.13%, or at least 0.5% of DPA.

35. A cell according to any one of claims 29, 30, 31, 32, 33 or 34, characterized by comprising DPA that is synthesized from EPA in the cell and in which the efficiency of converting EPA to DPA in the cell It is at least 5% or at least 7%.

36. Cell according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23, characterized in that the LC-PUFA is eicosapentaenoic acid (EPA).

37. Cell according to claim 36, characterized in that the introduced polynucleotide(s) encodes a bifunctional A5 / A6-desaturase and a bifunctional A5 / A6-elongase.

38. A cell according to claim 36, characterized in that the introduced polynucleotide(s) encodes three enzymes, wherein the enzymes are as many as the following combinations: i) an A5-desaturase, an A6-desaturase and an A6-elongase, or ü) an A5-desaturase, an A8-desaturase and an A9-elongase • 39. Cell, according to any of the Claims 36, 37 or 38, characterized by comprising EPA that is synthesized in the cell and wherein the total fatty acid of the cell comprises at least 1.5%, at least 2.1% or at least 2.5% of EPA.

40. A cell according to any one of claims 36, 37, 38 or 39, characterized by comprising EPA that is synthesized in the cell and wherein the efficiency of conversion of ALA to EPA in the cell is at least 2% or at least 14.6%.

41. Cell according to any of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40, characterized by the fact that: i) at least one A5-elongase catalyzes the conversion of EPA to DPA in the cell, ii) at least one desaturase capable of acting on an acyl-CoA substrate, iii) at least one vertebrate desaturase or a variant desaturase thereof, or iv) any combination of i), ii), or iii).

42. Cell according to claim 41, characterized in that the A5-elongase comprises: i) an amino acid sequence as provided in ID. SEQ. NO: 2, ii) an amino acid sequence that is at least 50% identical to sequence ID No. 2, or iii) a biologically active fragment of i) or ii).

43. Cell, according to either of the Claims 41 or 42, characterized in that at least one desaturase comprises: i) an amino acid sequence as provided in ID. OF SEQ. No.: 16, ID. OF SEQ. No.: 21 OR ID. OF SEQ. No. : 22, ii) an amino acid sequence that is at least 50% identical to ID. DE SEQ. N° : 16, ID. DE SEQ. N° : 21 or ID. SEQ. NO: 22, or iii) a biologically active fragment of i) or ii).

44. Cell according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 or 43, characterized in that said cell is capable of producing the aforementioned LC-PUFA from endogenously produced linoleic acid (LA), alpha-linolenic acid (ALA), or both.

45. Cell according to claim 44, characterized in that the ratio of endogenously produced ALA to LA is at least 1:1 or at least 2:

1.

46. ​​Cell according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45, characterized in that the cell is a plant cell, a plant cell of an angiosperm, a plant cell of an oilseed, or a cell in a seed.

47. Cell according to claim 46, characterized in that at least one promoter is a seed-specific promoter.

48. Cell according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45, characterized in that the cell is of a single-celled microorganism.

49. Cell according to claim 48, characterized in that the unicellular microorganism is suitable for fermentation.

50. Cell according to claim 49, characterized in that the microorganism is a yeast.

51. A cell according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45, characterized in that the cell is either a non-human animal cell or a human cell in vitro.

52. A cell according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or 51, characterized by producing an LC-PUFA that is incorporated into triacylglycerols in said cell.

53. Cell according to claim 52, characterized in that at least 50% of the LC-PUFA The substances produced in that cell are incorporated into triacylglycerols.

54. Cell, according to any of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 / 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52 or 53, characterized by the fact that at least the protein-coding region of one, two or more of the polynucleotides is obtained from an algal gene.

55. A cell according to claim 54, characterized in that the algal gene is of the genus Pavlova, for example, of the species Pavlova salina.

56. Recombinant cell capable of producing DHA from a fatty acid that is ALA, LA, GLA, ARA, SDA, ETA, EPA, or any combination or mixture thereof, characterized in that said recombinant cell is derived from a cell that is not capable of synthesizing DHA.

57. A recombinant cell capable of producing DPA from a fatty acid that is ALA, LA, GLA, ARA, SDA, ETA, EPA, or any combination or mixture thereof, characterized in that said recombinant cell is derived from a cell that is not capable of synthesizing DPA.

58. A recombinant cell capable of producing EPA from a fatty acid that is ALA, LA, GLA, SDA, ETA, or any combination or mixture thereof, characterized in that said recombinant cell is derived from a cell that is not capable of synthesizing EPA.

59. A recombinant cell capable of producing both ETrA from ALA and ETA from SDA, and which produces EPA from a fatty acid that is ALA, LA, GLA, SDA, ETA, or any combination or mixture thereof, characterized in that said recombinant cell is derived from a cell that is not capable of synthesizing ETrA, ETA, or both.

60. A recombinant cell of an organism useful in fermentation processes, characterized in that the cell is capable of producing DPA from LA, ALA, arachidonic acid (ARA), eicosatetraenoic acid (ETA), or any combination or mixture thereof, wherein said recombinant cell is derived from a cell that is not capable of synthesizing DPA.

61. Recombinant plant cell capable of producing DPA from LA, ALA, EPA, or any combination or mixture thereof, characterized in that the cell of The plant is an angiosperm.

62. Plant cell according to claim 61, characterized by also being able to produce DHA.

63. Recombinant cell capable of synthesizing DGLA, characterized by comprising a polynucleotide(s) encoding one or both of: a) a polypeptide that is an A9-elongase, wherein the A9-elongase is selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in ID. DE SEQ. N°: 3, ID. DE SEQ. No.: 85 OR ID. OF SEQ. No.: 86, ii) a polypeptide comprising an amino acid sequence that is at least 40% identical to SEQ. ID No. 3, SEQ. ID No. 85 or SEQ. ID No. 86, and iii) a biologically active fragment of i) or ii), and / or b) a polypeptide that is an A8-desaturase, in which the A8-desaturase is selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in SEQ. ID No. 1, ii) a polypeptide comprising a sequence of amino acids that are at least 40% identical to ID. DE SEQ. N°: 1, and iii) a biologically active fragment of i) or ii), wherein the polynucleotide(s) is / are operationally linked to one or more promoters that are capable of directing the expression of said polynucleotide(s) in the cell, and wherein said recombinant cell is derived from a cell that is not capable of synthesizing DGLA.

64. Cell according to claim 63, characterized by the fact that the cell is able to convert DGLA into ARA.

65. A cell according to claim 64, characterized in that the cell further comprises a polynucleotide encoding an A5-desaturase, wherein the polynucleotide encoding the A5-desaturase is operationally linked to one or more promoters that are capable of directing the expression of said polynucleotide in the cell, and wherein the cell is capable of producing ARA.

66. A cell according to any one of claims 63, 64 or 65, characterized in that the cell is devoid of to 3 desaturase activity and is incapable of producing ALA.

67. Cell according to any one of claims 63, 64, 65 or 66, characterized in that the cell is a plant cell or a cell of an organism suitable for fermentation.

68. Substantially purified polypeptide, characterized by being selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in SEQ. ID No. 1, ii) a polypeptide comprising an amino acid sequence that is at least 40% identical to sequence ID No. 1, and iii) a biologically active fragment of i) or ii), in which the polypeptide has A8-desaturase activity.

69. Substantially purified polypeptide, characterized by being selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in ID. DE SEQ. N°: 2, ii) a polypeptide comprising a sequence of amino acids that are at least 60% identical to ID. DE SEQ. N°: 2, and iii) a biologically active fragment of i) or ii), in which the polypeptide has A5-elongase and / or A6-elongase activity.

70. Polypeptide, according to claim 69, characterized in that the polypeptide has A5-elongase and A6-elongase activity, and in that the polypeptide is more efficient in the synthesis of DPA from EPA than it is in the synthesis of ETA from SDA.

71. Polypeptide, according to any one of claims 69 or 70, characterized in that the polypeptide can be purified from algae.

72. Polypeptide, according to any one of claims 69, 70 or 71, characterized in that, when expressed in yeast cells, it is more efficient in elongating C20 LC-PUFA than C22 LC-PUFA.

73. Substantially purified polypeptide, characterized by being selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in SEQ. ID No. 3, SEQ. ID No. 85 or SEQ. ID No. 86, ii) a polypeptide comprising an amino acid sequence that is at least 40% identical to SEQ. ID No. 3, SEQ. ID No. 85 or SEQ. ID No. 86, and iii) a biologically active fragment of i) or ii), in which the polypeptide has A9-elongase activity. and / or A6-elongase.

74. Polypeptide, according to claim 73, characterized in that the polypeptide has A9-elongase and A6-elongase activity.

75. Polypeptide, according to claim 74, characterized in that the polypeptide is more efficient in the synthesis of ETrA from ALA than it is in the synthesis of ETA from SDA.

76. Polypeptide, according to any one of claims 73, 74 or 75, characterized in that the polypeptide can be purified from algae or fungi.

77. Substantially purified polypeptide, characterized by being selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in SEQ. ID No. 4, ii) a polypeptide comprising an amino acid sequence that is at least 70% identical to sequence ID No. 4, and iii) a biologically active fragment of i) or ii), in which the polypeptide has A4-desaturase activity.

78. Substantially purified polypeptide, characterized by being selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in SEQ. ID No. 60, ii) a polypeptide comprising an amino acid sequence that is at least 55% identical to ID. DE SEQ. N°: 60, and iii) a biologically active fragment of i) or ii), in which the polypeptide has A5-desaturase activity.

79. Substantially purified polypeptide, characterized by being selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in ID. DE SEQ. N°: 64, ii) a polypeptide comprising a sequence of amino acids that are at least 90% identical to ID. DE SEQ. N°: 64, and iii) a biologically active fragment of i) or ii), in which the polypeptide has A6-desaturase activity.

80. Polypeptide, according to any one of claims 68, 69, 70, 71, 72, 73, 74, 75, 76, 77 or 78, characterized in that it can be isolated from a species of Pavlova.

81. Polypeptide, according to any one of claims 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or 80, characterized in that it is a fusion protein that further comprises at least one other polypeptide sequence.

82. Isolated polynucleotide, characterized by comprising a sequence of nucleotides selected from the group consisting of: i) a nucleotide sequence as provided in SEQ. ID No.: 5 OR SEQ. ID No.: 6; ii) a sequence encoding a polypeptide according to claim 68 or claim 81; iii) a nucleotide sequence that is at least 50% identical to sequence ID No. 5 or sequence ID No. 6; and iv) a sequence that hybridizes to any of i) and iii) under highly controlled conditions.

83. Isolated polynucleotide, characterized by to understand a selected nucleotide sequence from the group consisting of: i) a nucleotide sequence as provided in the ID. OF SEQ. No.: 7 or ID. OF SEQ. No.: 8; ii) a sequence encoding a polypeptide according to any one of claims 69 to 72 or 81; iii) a nucleotide sequence that is at least 51% identical to ID. DE SEQ. N°: 7 or ID. DE SEQ. N°: 8; and iv) a sequence that hybridizes to any of i) and iii) under highly controlled conditions.

84. Isolated polynucleotide, characterized by comprising a sequence of nucleotides selected from the group consisting of: i) a nucleotide sequence as provided in the ID. OF SEQ. No.: 9 or ID. OF SEQ. No.: 10; ii) a sequence encoding a polypeptide according to any one of claims 73 to 76 or 81; iii) a nucleotide sequence that is at least 51% identical to Sequence ID No. 9 or Sequence ID No. 10; and iv) a sequence that hybridizes to any of i) and iii) under highly controlled conditions.

85. Isolated polynucleotide, characterized by comprising a sequence of nucleotides selected from the group consisting of: i) a nucleotide sequence as provided in the ID. OF SEQ. No.: 11, ID. OF SEQ. No.: 12 OR ID. OF SEQ. No.: 13; ii) a sequence encoding a polypeptide according to claim 77 or claim 81; iii) a nucleotide sequence that is at least 70% identical to ID. SEQ. N°: 11, ID. SEQ. N°: 12 or Sequence ID No.: 13; and iv) a sequence that hybridizes to any of i) and iii) under highly controlled conditions.

86. Isolated polynucleotide, characterized by comprising a sequence of nucleotides selected from the group consisting of: i) a nucleotide sequence as provided in SEQ. ID No.: 58 OR SEQ. ID No.: 59; ii) a sequence encoding a polypeptide according to claim 78 or claim 81; iii) a nucleotide sequence that is at least 55% identical to Sequence ID No. 58 or Sequence ID No. 59; and iv) a sequence that hybridizes to any of i) through iii) under highly controlled conditions.

87. Isolated polynucleotide, characterized by comprising a sequence of nucleotides selected from the group consisting of: i) a nucleotide sequence as provided in SEQ. ID No.: 63; ii) a sequence encoding a polypeptide according to claim 79 or claim 81; iii) a nucleotide sequence that is at least 90% identical to ID. DE SEQ. N° : 63; and iv) a sequence that hybridizes to any of i) through iii) under highly controlled conditions.

88. Vector characterized by comprising or encoding a polynucleotide according to any of the Claims 82, 83, 84, 85, 86 or 87.

89. Vector, according to claim 88, characterized in that the polynucleotide is operationally linked to a specific seed promoter.

90. Recombinant cell, characterized by comprising an isolated polynucleotide according to any one of claims 82, 83, 84, 85, 86 or 87.

91. A method for producing a cell capable of synthesizing one or more LC-PUFAs, characterized by comprising the introduction into the cell of one or more polynucleotides encoding at least two enzymes, each of which is a bifunctional A5 / A6-desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A5-elongase, A6-elongase, A4-desaturase, A9-elongase or A8-desaturase, wherein one or more polynucleotides is operationally linked to one or more promoters capable of directing the expression of said polynucleotides in the cell.

92. A method for producing a recombinant cell with an increased capacity to synthesize one or more LC-PUFAs, characterized by comprising the introduction into a first cell of one or more polynucleotides encoding at least two enzymes, each of which is a bifunctional A5 / A6-desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A5-elongase, A6-elongase, A4-desaturase, A9-elongase or A8-desaturase, wherein one or more polynucleotides are operationally linked to one or more promoters capable of directing the expression of said polynucleotides in the recombinant cell, and wherein said recombinant cell has an increased capacity to synthesize said one or more LC-PUFAs relative to said first cell.

93. Method, according to any one of claims 91 or 92, characterized in that at least one of the enzymes is an A5-elongase.

94. Method according to claim 93, characterized in that the A5-elongase also has A6-elongase activity and in that the elongase is more efficient in synthesizing DPA from EPA than it is in synthesizing ETA from SDA.

95. Method according to any one of claims 93 or 94, characterized in that the A5-elongase comprises: i) an amino acid sequence as provided in ID. DE SEQ. N°: 2, ii) an amino acid sequence that is at least 50% identical to ID. DE SEQ. N°: 2, or iii) a biologically active fragment of i) or ii).

96. Method according to claim 95, characterized in that the A5-elongase comprises: i) an amino acid sequence as provided in ID. DE SEQ. N°: 2, ii) an amino acid sequence that is at least 90% identical to ID. DE SEQ. N°: 2, or iii) a biologically active fragment of i) or ii).

97. Method, according to any of the Claims 93, 94, 95 or 96, characterized in that A5-elongase can be purified from algae.

98. Method, according to any one of claims 91 or 92, characterized in that at least one of the enzymes is an A9-elongase.

99. Method according to claim 98, characterized by the fact that A9-elongase also has A6-elongase activity.

100. Method according to claim 99, characterized in that A9-elongase is more efficient in synthesizing ETrA from ALA than it is in synthesizing ETA from SDA.

101. Method, according to any one of claims 99 or 100, characterized in that the A9-elongase is capable of elongating SDA to ETA, GLA to GLA, or both, in a yeast cell. • 102. Method, according to any one of claims 99, 100 or 101, characterized in that that A9-elongase comprises: i) an amino acid sequence as provided in ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 or ID. OF SEQ. No. : 86, ii) an amino acid sequence that is at least 50% identical to ID. DE SEQ. N°: 3, ID. DE SEQ. N°: 85 or ID. DE SEQ. N°: 86, or iii) a biologically active fragment of i) or ii).

103. Method according to claim 102, characterized in that the A9-elongase comprises: i) an amino acid sequence as provided in ID. OF SEQ. No.: 3, ID. OF SEQ. No.: 85 or ID. OF SEQ. No. : 86, ii) an amino acid sequence that is at least 90% identical to ID. DE SEQ. N°: 3, 35 ID. DE SEQ. N°: 85 or ID. DE SEQ. N°: 86, or iii) a biologically active fragment of i) or ii).

104. Method according to any one of claims 99, 100, 101, 102 or 103, characterized in that A9-elongase can be purified from algae or fungi.

105. Method, according to any one of claims 91 or 92, characterized in that at least one of the enzymes is a bifunctional A5 / A6-desaturase or a bifunctional A5 / A6-elongase.

106. Method according to claim 105, characterized in that the bifunctional A5 / A6-desaturase comprises: i) an amino acid sequence as provided in ID. DE SEQ. N°: 15, ii) an amino acid sequence that is at least 50% identical to ID. DE SEQ. N°: 15, or iii) a biologically active fragment of i) or ii).

107. A method according to any one of claims 105 or 106, characterized in that the bifunctional A5 / A6-desaturase is naturally produced by a species of freshwater fish.

108. Method according to claim 105, characterized in that the bifunctional A5 / A6-elongase comprises: i) an amino acid sequence as provided in ID. DE SEQ. N°: 2 or ID. DE SEQ. N°: 14, ii) an amino acid sequence that is at least 50% identical to sequence ID No. 2 or sequence ID No. 14, or iii) a biologically active fragment of i) or ii).

109. Method, according to any of the Claims 91 or 92, characterized in that at least one of the enzymes is an A5-desaturase.

110. Method, according to any one of claims 91 or 92, characterized in that at least one of the enzymes is an A8-desaturase.

111. Method according to any one of claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109 or 110, characterized in that the LC-PUFA is docosahexaenoic acid (DHA).

112. Method according to claim 111, characterized in that the polynucleotide(s) The introduced enzyme encodes three or four enzymes selected from the group consisting of: bifunctional A5 / A6-desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A-elongase, A-6-elongase, and A4-desaturase.

113. Method according to claim 112, characterized in that the enzymes are as numerous as the following combinations: i) a bifunctional A5 / A6 desaturase, a bifunctional A5 / A6 elongase and an A4 desaturase, a bifunctional A5 / A6 desaturase, an A5 elongase, an A6 elongase and an A4 desaturase, or iii) an A5-desaturase, an A6-desaturase, a bifunctional A5 / A6-elongase, and an A4-desaturase.

114. Method according to claim 111, characterized in that the introduced polynucleotide(s) encodes five enzymes wherein the enzymes are as numerous as the following combinations: i) an A4-desaturase, an A5-desaturase, an A6-desaturase, an A5-elongase, and an A6-elongase, or ii) an A4-desaturase, an A5-desaturase, an A8-desaturase, an A5-elongase, and an A9-elongase.

115. Method according to claim 111, characterized by the fact that the cell is from an organism suitable for fermentation and the enzymes are at least one bifunctional A5 / A6-desaturase, an A5-elongase, an A6-elongase and an A4-desaturase.

116. Method, according to any one of claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109 or 110, characterized in that the LC-PUFA is docosapentaenoic acid (DPA).

117. Method, according to claim 116, characterized in that the polynucleotide(s) The introduced enzyme encodes two or three enzymes selected from the group consisting of: bifunctional A5 / A6-desaturase, A5-desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A5-elongase, and A6-elongase.

118. Method according to claim 117, characterized in that the enzymes are any of the following combinations: i) a bifunctional A5 / A6-desaturase and a bifunctional A5 / A6-elongase, ii) a bifunctional A5 / A6-desaturase, an A5-elongase and an A6-elongase, or iii) an A5-desaturase, an A6-desaturase, and a bifunctional A5 / A6-elongase.

119. Method according to claim 116, characterized in that the introduced polynucleotide(s) encodes four enzymes, wherein there are as many enzymes as the following combinations: i) an A5-desaturase, an A6-desaturase, an A5- elongase and an A6-elongase, or ii) an A5-desaturase, an A8-desaturase, an A5-elongase, and an A9-elongase.

120. Method according to claim 116, characterized in that the cell is from an organism suitable for fermentation, and the enzymes are at least one bifunctional A5 / A6-desaturase, one A5-elongase and one A6-elongase.

121. Method according to any one of claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109 or 110, characterized in that the LC-PUFA is eicosapentaenoic acid (EPA).

122. Method according to claim 121, characterized in that polynucleotide(s) The introduced codenides for a bifunctional A5 / A6-desaturase and a bifunctional A5 / A6-elongase.

123. Method according to claim 121, characterized in that the introduced polynucleotide(s) encodes three enzymes, wherein the enzymes are as many as the following combinations: i) an A5-desaturase, an A6-desaturase and an A6-elongase, or ii) an A5-desaturase, an A8-desaturase, and an A9-elongase.

124. Method according to any one of claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122 or 123, characterized in that: i) at least one of the enzymes is an A5-elongase that It catalyzes the conversion of EPA to DPA in the cell. ii) at least one of the desaturases is capable of acting on an acyl-CoA substrate, iii) at least one desaturase is from a vertebrate or is a variant thereof, or iv) any combination of i), ii) or iii).

125. Method according to claim 124, characterized in that the A5-elongase comprises: i) an amino acid sequence as provided in ID. DE SEQ. N°: 2, ii) an amino acid sequence that is at least 50% identical to ID. DE SEQ. N°: 2, or iii) a biologically active fragment of i) or ii).

126. Method, according to any of the Claims 124 or 125, characterized in that at least one desaturase comprises: i) an amino acid sequence as provided in ID. DE SEQ. N°: 16, ID. DE SEQ. N°: 21 or ID. DE SEQ. N°: 22, ii) an amino acid sequence that is at least 50% identical to ID. DE SEQ. N°: 16, ID. DE SEQ. N°: 21 or ID. DE SEQ. N°: 22, OR iii) a biologically active fragment of i) or ii).

127. Method, according to any of the claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125 or 126, characterized by the fact that the aforementioned The cell is capable of producing the aforementioned LC-PUFA from endogenously produced linoleic acid (LA), alpha-linolenic acid (ALA), or both.

128. Method according to claim 127, characterized in that the ratio of endogenously produced ALA to LA is at least 1:1 or at least 2:1 • 129. Method, according to any one of claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127 or 128, characterized in that the A cell is a plant cell, a plant cell of an angiosperm, a plant cell of an oilseed, or a cell within a seed.

130. Method according to claim 129, characterized in that at least one promoter is a seed-specific promoter.

131. Method according to any one of claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127 or 128, characterized in that the A cell belongs to a single-celled microorganism.

132. Method according to claim 131, characterized in that the single-celled microorganism is suitable for fermentation.

133. Method according to claim 132, characterized in that the microorganism is a yeast.

134. Method according to any one of claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127 or 128, characterized by the fact that the cell is a non-human animal cell or a human cell in vitro.

135. Method according to any one of claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133 or 134, characterized in that the cell produces an LO-PUFA which is incorporated into triacylglycerols in the aforementioned cell.

136. Method according to claim 135, characterized in that at least 50% of the LC-PUFA produced in said cell is incorporated into triacylglycerols.

137. Method according to any one of claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135 or 136, characterized by the fact that at least the protein-coding region of one, two, or more of the polynucleotides is derived from an algal gene.

138. Method according to claim 137, characterized in that the algal gene is of the genus Pavlova, such as, for example, the species Pavlova salina.

139. Method for producing a cell capable of synthesizing DGLA, the method characterized by comprising the introduction into the cell of a polynucleotide(s) that encodes one or both of: a) a polypeptide that is an A9-elongase, wherein the A9-elongase is selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in SEQ. ID No. 3, SEQ. ID No. 85 or SEQ. ID No. 86, ii) a polypeptide comprising an amino acid sequence that is at least 40% identical to SEQ. ID No. 3, SEQ. ID No. 85 or SEQ. ID No. 86, and iii) a biologically active fragment of i) or ii), and / or b) a polypeptide that is an A8-desaturase, in which the A8-desaturase is selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in SEQ. ID No. 1, ii) a polypeptide comprising a sequence of amino acids that are at least 40% identical to ID. DE SEQ. N°: 1, and iii) a biologically active fragment of i) or ii), wherein the polynucleotide(s) is / are operationally linked to one or more promoters that are capable of directing the expression of said polynucleotides in the cell, and wherein said recombinant cell is derived from a cell that is not capable of synthesizing DGLA.

140. Method according to claim 139, characterized in that the cell is capable of converting DGLA into ARA.

141. Method according to claim 140, characterized in that a cell further comprises a polynucleotide encoding an A5-desaturase, wherein the polynucleotide encoding the A5-desaturase is linked Operationally, it refers to one or more promoters that are capable of directing the expression of said polynucleotide in the cell, and in which the cell is capable of producing ARA.

142. A method according to any one of claims 139, 140 or 141, characterized in that a cell is devoid of to3 desaturase activity and is unable to produce ALA.

143. A method according to any one of claims 139, 140, 141 or 142, characterized in that the cell is a plant cell or a cell of an organism suitable for fermentation.

144. Method according to any one of claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135 or 136, 137, 138, 139, 140, 141, 142 or 143, characterized by still including the step of determining the fatty acid content or composition of the cell after the introduction of said one or more polynucleotides.

145. Method according to any one of claims 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135 or 136, 137, 138, 139, 140, 141, 142, 143 or 144, characterized by still including the step of identifying or selecting a cell that has a modified fatty acid content or composition compared to an untransformed isogenic cell.

146. Recombinant cell, characterized by being produced by a method according to any one of claims 91 to 145.

147. Transgenic plant, characterized by comprising at least one cell according to any one of claims 1 to 47, 52 to 59, 61 to 67, 90 or 146.

148. Plant according to claim 147, characterized in that the plant is an angiosperm. 14 9. Plant, according to any one of claims 147 or 148, characterized by comprising at least a plant part that synthesizes EPA, and wherein the total fatty acid of the plant part comprises at least 1.5%, at least 2.1% or at least 2.5% of EPA.

150. Plant, according to any one of claims 147, 148 or 149, characterized by comprising at least one plant part that synthesizes DPA, wherein the total fatty acid content of the plant part comprises at least 0.1%, at least 0.13% or at least 0.5% of DPA.

151. Plant, according to any one of claims 147, 148, 149 or 150, characterized by comprising at least one plant part that synthesizes DHA.

152. Plant, according to any one of claims 147, 148, 149, 150 or 151, characterized by comprising at least one plant part that synthesizes at least one O)3 C20 LC-PUFA, and wherein the total fatty acid content of the plant part comprises at least 2.5% or at least 4.1% of O)3 C20 LC-PUFA.

153. Plant, according to any of the claims 147, 148, 149, 150, 151 or 152, characterized by comprising at least one plant part that synthesizes EPA, and wherein the efficiency of conversion of ALA to EPA in the plant part is at least 2% or at least 14.6%.

154. Plant, according to any one of claims 147, 148, 149, 150, 151, 152 or 153, characterized by comprising at least one plant part that synthesizes polyunsaturated fatty acids. <x>3 which are the products of A6-ALA desaturation and / or the products of A9-ALA elongation, wherein the efficiency of ALA conversion into said products in the plant part is at least 22% or at least 24%.

155. Plant, according to any one of claims 147, 148, 149, 150, 151, 152, 153 or 154, characterized by comprising at least one plant part that synthesizes DPA from EPA, and wherein the conversion efficiency of EPA to DPA in the plant part is at least 5% or at least 7%.

156. Plant according to any one of claims 147, 148, 149, 150, 151, 152, 153, 154 or 155, characterized in that the plant is an oilseed plant.

157. Method of producing an oilseed, the method characterized by comprising: i) growth of a transgenic oilseed plant according to claim 156 under suitable conditions, and ii) harvesting the plant's seed.

158. Part of the transgenic plant according to any of claims 147, 148, 149, 150, 151, 152, 153, 154, 155 or 156, characterized in that said part comprises an increased level of LC-PUFA in its fatty acid relative to the corresponding part of an unprocessed isogenic plant.

159. Plant part, according to claim 158, characterized by being a seed, leaf, stem, flower, pollen, root, or specialized storage organ.

160. Transgenic seed, characterized by comprising an LC-PUFA.

161. Seed, according to claim 160, characterized by the fact that LC-PUFA is selected from the group consisting of: i) EPA, ii) DPA, iii) DHA, iv) EPA and DPA, and (v) EPA, DHA, and DPA.

162. Seed, according to any of claims 160 or 161, characterized in that it is derived from a non-transgenic isogenic seed that produces LA and / or ALA.

163. Seed, according to claim 162, characterized in that the non-transgenic isogenic seed comprises a higher concentration of ALA than of LA in its fatty acids.

164. Seed, according to any of claims 162 or 163, characterized in that the non-transgenic isogenic seed comprises at least about 13% ALA or at least about 27% ALA or by less about 50% ALA in its total fatty acids.

165. Seed, according to any one of claims 160, 161, 162, 163 or 164, characterized in that the total fatty acid in the seed oil comprises at least 9% C20 fatty acids.

166. Seed, according to any one of claims 160, 161, 162, 163, 164 or 165, characterized in that the seed is derived from an oilseed plant.

167. Seed, according to claim 166, characterized in that the oilseed plant is an oilseed of rapeseed, maize, sunflower, soybean, sorghum, flax, beet, cotton, peanut, poppy, mustard, castor bean, sesame or saffron.

168. Seed, according to any one of claims 160, 161, 162, 163, 164, 165, 166 or 167, characterized in that the seed has a germination rate that is substantially the same as that of non-transgenic isogenic seed.

169. Seed, according to any one of claims 160, 161, 162, 163, 164, 165, 166, 167 or 168, characterized in that it comprises EPA which is synthesized in the seed and in that the total fatty acid content of the seed comprises at least 1.5%, at least 2.1% or at least 2.5% of EPA.

170. Seed, according to any one of claims 160, 161, 162, 163, 164, 165, 166, 167, 168 or 169, characterized by comprising DPA that is synthesized in the seed and wherein the total fatty acid content of the seed comprises at least 0.1%, at least 0.13% or at least 0.5% DPA.

171. Seed, according to any one of claims 160, 161, 162, 163, 164, 165, 166, 167, 168, 169 or 170, characterized by comprising DHA that is synthesized in the seed.

172. Seed, according to any one of claims 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170 or 171, characterized by comprising at least one ω3 C20 LC-PUFA that is synthesized in the seed and wherein the total fatty acid of the seed comprises at least 2.5% or at least 4.1% of ω3 C20 LC-PUFA.

173. Seed, according to any one of claims 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171 or 172, characterized by comprising EPA that is synthesized in the seed and wherein the efficiency of conversion of ALA to EPA in the seed is at least 2% or at least 14.6%.

174. Seed, according to any one of claims 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172 or 173, characterized by comprising omega-3 polyunsaturated fatty acids that are the products of A6-desaturation of ALA and / or the products of A9-elongation of ALA, which products are synthesized in the seed, and wherein the efficiency of conversion of ALA into said products in the seed is at least 22% or at least 24%.

175. Seed, according to any one of claims 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173 or 174, characterized by comprising DPA that is synthesized from EPA in the seed and wherein the conversion efficiency of EPA to DPA in the seed is at least 5% or at least 7%.

176. Seed, according to any one of claims 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174 or 175, characterized by The fact that at least 25%, or at least 50%, or at least 75% of the LC-PUFA in the seed forms part of triacylglycerols.

177. Extract of the transgenic plant according to any one of claims 147, 148, 149, 150, 151, 152, 153, 154, 155 or 156, or a part according to claim 158 or 159, or a seed according to any one of claims 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175 or 176, characterized in that said extract comprises an increased level of LC-PUFA in its fatty acid relative to a corresponding extract of an untransformed isogenic plant.

178. Extract, according to claim 177, characterized in that it is substantially purified oil comprising at least 50% triacylglycerols. 17 9. Extract, according to any one of claims 177 or 178, characterized in that the total fatty acid content comprises at least 1.5%, at least 2.1%, or at least 2.5% of EPA.

180. Extract, according to any one of claims 177, 178 or 179, characterized in that the total fatty acid content comprises at least 0.1%, at least 0.13%, or at least 0.5% of DPA.

181. Extract according to any one of claims 177, 178, 179, or 180, characterized by The fact that the total fatty acid content comprises DHA.

182. Extract, in accordance with any one of Claims 177, 178, 179, 180 or 181, characterized in that the total fatty acid content comprises at least 2.5% or at least 4.1% of ©3 C20 LC-PUFA.

183. Extract, according to any one of claims 177, 178, 179, 180, 181 or 182, characterized by comprising ARA, EPA, DPA, DHA, or any mixture of these in triacylglycerols.

184. Non-human transgenic animal, characterized by comprising at least one recombinant cell according to any one of claims 45, 51 to 59, 63 to 66, 90 or 146.

185. Method for producing an LC-PUFA, the method characterized by comprising cultivating, under suitable conditions, a recombinant cell according to any one of claims 1 to 67, 90 or 146.

186. Method according to claim 185, characterized in that the cell is from an organism suitable for fermentation and the method further comprises exposing the cell to at least one LC-PUFA precursor.

187. Method according to claim 186, characterized in that the LC-PUFA precursor is at least one of linoleic acid or α-linolenic acid.

188. Method according to claim 186 or 187, characterized in that the LC-PUFA precursor is provided in a vegetable oil.

189. Method according to claim 185, characterized in that the cell is an algal cell and the method further comprises growing the algal cell under conditions suitable for the production of said method. LC-PUFA.

190. Method according to any one of claims 185, 186, 187, 188 or 189, characterized in that the cell comprises at least one C20 LC-PUFA, and in that the total fatty acid of the cell comprises at least 2%, at least 4.7% or at least 7.9% of C20 LC-PUFA.

191. Method, according to any one of claims 185, 186, 187, 188, 189 or 190, characterized in that the cell comprises at least one C20 LC-PUFA, and in that the total fatty acid of the cell comprises at least 2.5% or at least 4.1% of C20 LC-PUFA.

192. Method according to any one of claims 185, 186, 187, 188, 189, 190 or 191, characterized in that the cell comprises 3 polyunsaturated fatty acids (CO3) that are the products of A6-desaturation of ALA and / or the products of A9-elongation of ALA, and wherein the efficiency of conversion of ALA into said products in the cell is at least 22% or at least 24%.

193. Method according to any one of claims 185, 186, 187, 188, 189, 190, 191 or 192, characterized in that the cell comprises DPA, and in that the total fatty acid of the cell comprises at least 0.1%, at least 0.13% or at least 0.5% of DPA.

194. Method according to any one of claims 185, 186, 187, 188, 189, 190, 191, 192 or 193, characterized in that the cell comprises DPA, and what is the efficiency of converting EPA to DPA in the cell? It is at least 5% or at least 7%.

195. A method according to any one of claims 185, 186, 187, 188, 189, 190, 191, 192, 193 or 194, characterized in that the cell comprises EPA, and in that the total fatty acid of the cell comprises at least 1.5%, at least 2.1% or at least 2.5% of EPA.

196. Method according to any one of claims 185, 186, 187, 188, 189, 190, 191, 192, 193, 194 or 195, characterized in that the cell comprises EPA, and in that the efficiency of conversion of ALA to EPA in the cell is at least 2% or at least 14.6%.

197. Method for producing one or more LC-PUFAs, the method characterized by comprising the cultivation, under suitable conditions, of a transgenic plant according to any one of claims 147 to 156.

198. Oil production method, the method characterized by comprising at least one LC-PUFA, comprising obtaining the transgenic plant according to any of claims 147 to 156, or a plant part of claims 158 or 159, or the seed according to any of claims 160 to 176, and extracting oil from said plant, plant part or seed.

199. Method according to claim 198, characterized in that said oil is extracted from the seed by crushing said seed.

200. Method for producing DPA from EPA, characterized by comprising exposing EPA to a polypeptide according to any one of claims 68 to 81 and a precursor fatty acid, under conditions suitable.

201. Method according to claim 200, characterized in that the method takes place in a cell that uses the polyketide-like system to produce EPA.

202. Fermentation process, characterized by comprising the following steps: i) supply of a flask containing a liquid composition comprising a cell according to any one of claims 1 to 44, 49 to 60, 63 to 76, 90 or 146 and constituents necessary for fermentation and fatty acid biosynthesis; and ii) providing conditions that lead to the fermentation of the liquid composition contained in said bottle.

203. Fermentation process according to claim 202, characterized in that a constituent necessary for fermentation and fatty acid biosynthesis is LA.

204. Composition, characterized by comprising a cell according to any one of claims 1 to 67, 90 or 146, or an extract or a portion thereof, comprising LC-PUFA, and a suitable carrier.

205. Composition characterized by comprising the transgenic plant according to any one of claims 147 to 156, or a part of the plant of claims 158 or 159, or a seed according to any one of claims 160 to 176, or an extract or a portion thereof comprising LC-PUFA, and a suitable carrier.

206. Ration, characterized by comprising a cell according to any one of claims 1 to 67, 90 or 146, a plant according to any one of claims 147 to 156, a plant part of claim 158 or claim 159, a seed according to any one of claims 160 to 176, an extract according to any one of claims 177 to 183, the product of the method according to any one of claims 185 to 201, the product of the fermentation process of claim 202 or claim 203, or a composition of claim 204 or claim 205.

207. Feed, according to claim 206, characterized in that it comprises at least DPA, wherein at least one enzymatic reaction has been carried out in the production of DPA by a recombinant enzyme in a cell.

208. Method of preparing a feed, characterized by comprising mixing a cell according to any one of claims 1 to 67, 90 or 146, a plant according to any one of claims 147 to 156, a plant part of claim 158 or claim 159, a seed according to any one of claims 160 to 176, an extract according to any one of claims 177 to 183, the product of the method according to any one of claims 185 to 201, the product of the fermentation process of claim 202 or claim 203 or a composition of claim 204 or claim 205, with a suitable carrier.

209. Method of increasing the levels of an LC-PUFA in an organism, characterized by comprising administering to the organism a cell according to any one of claims 1 to 67, 90 or 146, a plant according to any of claims 147 to 156, a plant part of claim 158 or claim 159, a seed according to any of claims 160 to 176; an extract according to any of claims 177 to 183, the product of the method according to any of claims 185 to 201, the product of the fermentation process of claim 202 or claim 203, or a composition of claim 204 or claim 205, or a ration of claim 206 or claim 207.

210. Method according to claim 209, characterized in that the route of administration is oral.

211. Method according to claim 209 or 210, characterized in that the organism is a vertebrate.

212. A method of treating or preventing a condition that would benefit from an LC-PUFA, characterized by comprising the administration to an individual of a cell of according to any one of claims 1 to 67, 90 or 146, a plant according to any one of claims 147 to 156, a plant part of claim 158 or claim 159, a seed according to any one of claims 160 to 176, an extract according to any one of claims 177 to 183, the product of the method according to any one of claims 185 to 201, the product of the fermentation process of claim 202 or claim 203, or a composition of claim 204 or claim 205, or a ration of claim 206 or claim 207.

213. Method according to claim 212, characterized by the fact that the condition is cardiac arrhythmia, angioplasty, inflammation, asthma, psoriasis, osteoporosis, kidney stones, AIDS, multiple sclerosis, rheumatoid arthritis, Crohn's disease, schizophrenia, cancer, fetal alcohol syndrome, attention deficit hyperactivity disorder, cystic fibrosis, phenylketonuria, unipolar depression, aggressive hostility, adrenoleukodystrophy, coronary heart disease, hypertension, diabetes, obesity, Alzheimer's disease, chronic obstructive pulmonary disease, ulcerative colitis, restenosis after angioplasty, eczema, arterial hypertension, platelet aggregation, gastrointestinal bleeding, endometriosis, premenstrual syndrome, myalgic encephalomyelitis, chronic fatigue after viral infections, or an eye disease.

214. Use of a cell according to any one of claims 1 to 67, 90 or 146, a plant according to any one of claims 147 to 156, a plant part of claim 158 or claim 159, a seed according to any one of claims 160 to 176, an extract according to any one of claims 177 to 183, the product of the method according to any one of claims 185 to 201, the product of the fermentation process of claim 202 or claim 203, or a composition of claim 204 or claim 205, or a ration of claim 206 or claim 207, characterized in that it is for the manufacture of a medicament for the treatment or prevention of a condition that would benefit from an LC-PUFA.

215. Method for producing an unbranched LC-PUFA comprising 22 carbon atoms, characterized by comprising the incubation of an unbranched LC-PUFA with 20 carbon atoms with a polypeptide selected from the group consisting of: i) a polypeptide comprising an amino acid sequence as provided in SEQ. ID No. 2 or SEQ. ID No. 14, ii) a polypeptide comprising an amino acid sequence that is at least 50% identical to sequence ID No. 2 or sequence ID No. 14, and iii) a biologically active fragment of i) or ii), in which the polypeptide also has A6-elongase activity.

216. Method according to claim 215, characterized in that the unbranched LC-PUFA comprising 22 carbon atoms is DPA, and the unbranched LC-PUFA with 20 carbon atoms is EPA.

217. Method according to claim 215 or 216, characterized in that the method is carried out within a recombinant cell that produces the polypeptide and EPA.

218. Substantially purified antibody, or fragment thereof, characterized by specifically binding to a polypeptide according to any one of claims 68 to 81.

219. Method for identifying a recombinant cell, tissue or organism capable of synthesizing one or more LC-PUFAs, characterized by comprising detecting the presence in said cell, tissue or organism of one or more polynucleotides encoding at least two enzymes, each of which is a bifunctional A5 / A6 desaturase, A5- desaturase, A6-desaturase, bifunctional A5 / A6-elongase, A5-elongase, A6-elongase, A4-desaturase, A9-elongase or A8-desaturase, in which one or more polynucleotides are operationally linked to one or more promoters that are capable of directing the expression of said polynucleotides in the cell, tissue or organism.

220. A method according to claim 219, characterized by comprising a nucleic acid amplification step, a nucleic acid hybridization step, a step for detecting the presence of a transgene in the cell, tissue or organism, or a step for determining the fatty acid content or composition of the cell, tissue or organism.

221. Method according to claim 219 or 220, characterized in that the organism is an animal, plant, plant angiosperm or microorganism.< / x>