A novel and efficient method for reprogramming blood to induced pluripotent stem cells

Abstract

Described herein are methods and compositions related to generation of induced pluripotent stem cells (iPSCs). Improved techniques for establishing highly efficient, reproducible reprogramming using non-integrating episomal plasmid vectors. Using the described reprogramming protocol, one is able to consistently reprogram non-T cells with close to 100% success from non-T cell or non-B cell sources. Further advantages include use of a defined reprogramming media E7 and using defined clinically compatible substrate recombinant human L-521. Generation of iPSCs from these blood cell sources allows for recapitulation of the entire genomic repertoire, preservation of genomic fidelity and enhanced genomic stability.

Description

<DP=1>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²A NOVEL AND EFFICIENT METHOD FOR REPROGRAMMING BLOOD TO²INDUCED PLURIPOTENT STEM CELLS²FIELD OF INVENTION²Described herein are methods and compositions related to regenerative medicine²including the derivation of induced pluripotent stem cells (iPSCs) from whole ²blood and ²peripheral blood, such methods and compositions that provide a renewable ²source of ²transplant material.² BACKGROUND²Pluripotent stem cells ("pSCs") present broad opportunities to generate ²therapeutic ²materials for use in regenerative medicine, as well as providing invaluable in ²vitro models for ²studying disease initiation and progression. One category of pSCs, induced ²pluripotent stem ²cells ("iPSCs"), possess the hallmark stem cell properties of self-renewal ²(i.e., immortal) and²differentiation capacity into cells derived from all three embryonic germ ²layers (i.e.,²pluripotency). These cells can be obtained through "reprogramming", which ²involves ²dedifferentiation of cells from non-embryonic sources, such as adult somatic ²cells. The ²reprogramming process obviates potential ethical concerns over embryonic ²source material ²for other types such pSCs, such as embryonic stem cells ("ESCs"), while ²providing a further²benefit of enabling potential patient-specific immunological incompatibility.²In addition to establishing robust reprogramming techniques, full realization ²of ²therapeutic goals for stem-cell regenerative medicine further requires ²consideration of the ²types of host cells that can serve as a resource for renewable regenerative ²material. Ideally, ²cells would possess not only the requisite plasticity for successful ²reprogramming and²stability in subsequent propagation, but also provide advantages in clinical ²aspects, such as²ease of isolation, storage, stability and maintenance. In this regard, blood ²cells represent an ²attractive choice for such uses, given their wide use medical diagnostics and ²as a highly ²accessible resource for cellular reprogramming. Whereas fibroblasts have been ²a widely used ²cellular source for many reprogramming experiments performed in the last ²decade, this²source material but may not be the best choice for directed reprogramming. ²Skin biopsy to²obtain fibroblasts is an invasive, non-sterile procedure requiring expansion ²of harvested cells ²before experimentation. Most importantly, skin cells harbor more mutations due ²to ²environmental insults such as UV irradiation than cells from inside the body ²such as blood.²1²<DP=2>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Given the eventual therapeutic goal of generating patient-specific, ²immunocompatible ²biological material, there is a great need in the art to establish a robust ²and reproducible ²means for reprogramming cells, along with identifying sources of therapeutic ²materials ²suitable for eventual clinical application. Such improved methods would need ²to possess²high efficiency of reprogramming, consistent reproduction, produce cells ²possessing genomic²stability and be readily extendible to a variety of cell types.²Described herein are improved techniques for establishing highly efficient, ²reproducible reprogramming using non-integrating episomal plasmid vectors, ²including ²generation of iPSCs from non-T cell, non-B cell component in blood samples. ²These²described approaches allow for use of blood as a readily accessible resource ²for cellular²reprogramming with superior properties in genomic and karyotype stability.²SUMMARY OF THE INVENTION²Described herein is a method of generating blood cell derived induced ²pluripotent²stem cells, comprising providing a quantity of blood cells, delivering a ²quantity of²reprogramming factors into the blood cells, and culturing the blood cells in a ²reprogramming ²media for at least 4 days, wherein delivering the reprogramming factors, and ²culturing in a ²reprogramming media generates blood cell derived induced pluripotent stem ²cells. In other ²embodiments, delivering a quantity of reprogramming factors comprises ²nucleofection. In²other embodiments, the reprogramming factors comprise one or more factors ²selected from²the group consisting of: Oct-4, Sox-2, Klf-4, c-Myc, Lin-28, 5V40 Large T ²Antigen ²("SV4OLT"), and short hairpin RNAs targeting p53 ("shRNA-p53"). In other ²embodiments, ²the reprogramming factors are encoded in one or more oriP / EBNA1 derived ²vectors. In other ²embodiments, the one or more oriP / EBNA1 derived vectors comprise pEP4 E025 ²ET2K,² pCXLE-hOCT3 / 4-shp53-F, pCXLE-hSK, pCXLE-hUL, and pCWB-EBNAl. In other ²embodiments, plating of the blood cells on a treated cell culture surface ²after delivering ²reprogramming factors into the blood cells, and culturing the blood cells in a ²reprogramming ²media on said treated cell culture surface. In other embodiments, the treated ²cell culture ²surface comprises plating of mouse embryonic feeders (MEFs). In other ²embodiments, the²treated cell culture surface comprises an extracellular matrix protein. In ²other embodiments,²the extracellular matrix protein comprises laminin. In other embodiments, ²laminin comprises ²L-521. In other embodiments, the reprogramming media comprises embryonic stem ²cell ²(ESC) media. In other embodiments, the ESC media comprises basic fibroblast ²growth factor²2²<DP=3>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²(bFGF). In other embodiments, the reprogramming media comprises E7 media. In ²other ²embodiments, the reprogramming media comprises E7 media comprising L-Ascorbic ²Acid, ²Transferrin, Sodium Bicarbonate, Insulin, Sodium Selenite and / or bFGF. In ²other ²embodiments, culturing the blood cells in a reprogramming media is for at ²least 4, 5, 6, 7, 8,²9, 10, 11, 12, 13, 14, 15, or 16 days. In other embodiments, culturing the ²blood cells in a²reprogramming media is for at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, ²27, 28, 29, 30 or 31 ²days. Further described herein is a cell line comprising blood cell derived ²induced ²pluripotent stem cells generated by the aforementioned method. In other ²embodiments, the ²blood cells are isolated from a subject possessing a disease mutation. In ²other embodiments,²the disease mutation is associated with a neurodegenerative disease, disorder ²and / or²condition. In other embodiments, the disease mutation is associated with an ²inflammatory ²bowel disease, disorder, and / or condition. In other embodiments, the blood ²cells are non T-²cell, non B-cell mononuclear cells. In other embodiments, the blood cells are ²a sample drawn ²from a human subject. In other embodiments, the sample is whole blood. In ²other²embodiments, the sample is peripheral blood. In other embodiments, the sample ²comprises an²isolated component of non T-cell, non B-cell mononuclear cells. Further ²described herein is ²a blood cell derived induced pluripotent stem cell line.²Further described herein is a method for generating induced pluripotent stem ²cells,²comprising providing a quantity of blood cells, delivering a quantity of ²reprogramming²factors into the blood cells, plating the blood cells on a treated cell ²culture surface and ²culturing the blood cells in a reprogramming media for at least 4 days, ²wherein delivering the ²reprogramming factors, and culturing in a reprogramming media generates blood ²cell derived ²induced pluripotent stem cells. In other embodiments, delivering a quantity of²reprogramming factors comprises nucleofection, the reprogramming factors ²comprise one or²more factors selected from the group consisting of: Oct-4, Sox-2, Klf-4, c-²Myc, Lin-28, 5V40 ²Large T Antigen ("SV4OLT"), and short hairpin RNAs targeting p53 ("shRNA-p53") ², ²encoded in one or more oriP / EBNA1 derived vectors. In other embodiments,the ²one or more ²oriP / EBNA1 derived vectors comprise pEP4 E025 ET2K, pCXLE-hOCT3 / 4-shp53-F,² pCXLE-hSK, pCXLE-hUL, and pCWB-EBNAl. In other embodiments,the treated cell ²culture surface comprises plating of mouse embryonic feeders (MEFs). In other ²embodiments,the treated cell culture surface comprises an extracellular matrix ²protein. In ²other embodiments,the extracellular matrix protein comprises laminin. In other ²embodiments,²3²<DP=4>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²laminin comprises L-521. In other embodiments, the reprogramming media ²comprises ²embryonic stem cell (ESC) media comprising basic fibroblast growth factor ²(bFGF). In other ²embodiments, the reprogramming media comprises E7 media comprising L-Ascorbic ²Acid, ²Transferrin, Sodium Bicarbonate, Insulin, Sodium Selenite and / or bFGF. In ²other²embodiments, culturing the blood cells in a reprogramming media is for at ²least 4, 5, 6, 7, 8,²9, 10, 11, 12, 13, 14, 15, or 16 days. In other embodiments, culturing the ²blood cells in a ²reprogramming media is for at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, ²27, 28, 29, 30 or 31 ²days. In other embodiments, the blood cells are a sample drawn from a human ²subject. In ²other embodiments, the sample is whole blood. In other embodiments, the sample ²is²peripheral blood. In other embodiments, the sample comprises an isolated ²component of non²T-cell, non B-cell mononuclear cells. Further described herein is a blood cell ²derived²induced pluripotent stem cell ²line.²BRIEF DESCRIPTION OF FIGURES² Figure 1(A) to Figure 1(B). Separation of Blood Components. Figure 1(A)²Schematic showing separated components. Figure 1(B) Picture of separated ²components. ²Figure 2(A) to Figure 2(E). Quality Control: iPS cells. Various measures of ²quality control for generated cells are shown including Figure 2(A) ²microscopy, and ²staining for pluripotent stem cell markers. Figure 2(B) Depiction of the ²pluripotency of stem²cells. Figure 2(C) Karyotype analysis. Figure 2(D) RT-PCR of pluripotent and ²lineage²specific markers for different cell lines. Figure 2(E) Pluripotent stem cells ²as capable of ²differentiating into all three embryonic lineages.²Figure 3. PBMC isolation and cryopreservation process. Process for obtaining ²blood cells utilized as a source for reprogramming and generation of iPSCs.²Figure 4. Peripheral blood mononuclear cells (PBMCs). Depiction of the various²components of blood, including populations of PBMCs and relative population ²abundance. ²Figure 5. T-cell Receptor Clonality Assay for iPSCs derived from Blood.²Figure 6(A) to Figure 6(B). Ideogram demonstrating the chromosomal changes ²observed in the iPSC lines are Cedars-Sinai iPSC Core. Each colored bar ²represents one²chromosome change occurrence in one cell line. The cytogenetic changes are ²color coded;²Mar000n, monosomy, loss of a whole chromosome. BC-iPSCs are superior at ²maintaining ²stable karyotypes than fibroblast-derived iPSCs. Individual chromosome level ²ideogram ²representation of abnormal karyotypes from fibroblast-(Figure 6(A)) and PBMC-²derived²4²<DP=5>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²iPSCs (Figure 6(B)) in the Inventors' laboratory. Abnormal iPSC karyotypes ²represented in ²the ideograms are; (Figure 6(A)) fib-iPSCs (n: 59) of total 258 fib-iPSC ²cultures karyotyped, ²and (Figure 6(B)) BC-iPSCs (n: 4) of total BC-iPSCss karyotyped (n: 106).²Figure 7(A) to 7(B). Karyotypes. Figure 7(A) Distribution of abnormal ²karyotypes²in relation to passage number. Figure 7(B) Distribution of abnormal karyotypes ²in relation to²age of tissue donor Mar000n, monosomy, loss of a whole chromosome;²Figure 8(A) to 8(F). Reliable epsiomal reprogramming of PBMCs into iPSCs. ²Figure 8(A): Schematic depicting the episomal reprogramming process and ²timeline of iPSC ²generation from PBMCs. Figure 8(B): Bright-field images of the reprogrammed ²iPSC²colonies from PBMCs obtained two healthy volunteers, one with a non-T cell ²(03iCTR-²NTn1) reprogramming method and another with a T-cell (80iCTR-Tn1) ²reprogramming ²method, show a high nuclear-to-cytoplasmic ratio, are alkaline phosphatase ²positive and ²immunopositive for the surface antigens, SSEA4, TRA-1-60, TRA-1-81; and ²nuclear ²pluripotency markers OCT3 / 4, 50X2 and NANOG. Scale bar, 75[tm. Figure 8(C):²Microarray Illumina gene-chip and bioinformatics based PluriTest confirms ²pluripotency²levels in the BC-iPSCs. (D): The PBMC- -iPSC lines maintained a normal G-band ²karyotype ²as shown from the two representative lines. Figure 8(E): non-T or T-cell ²clonality assay. ²Figure 8(F): Quantitative RT-PCR analyses of POU5F1 (OCT4), 50X2, LIN28, L-²MYC, ²and KLF4 expression in 49iCTR and 84iSMA LCL-iPSCs relative to H9 hESCs. (G) T ²cell²receptor gene rearrangement assay shows different sets of PCR primers were ²used to detect²TCRG gene rearrangements occurring in the BC-iPSCs derived from the T-cell ²method, ²while PCR products in the 145-255 bp range were not detectable in the non-T ²cell iPSC ²clones. A clonal positive control was included. Figure 8(F): TaqMan hPSC ²Scorecard table ²showing the tri-lineage potential of the representative BC-iPSCs rom selected ²genes in four²gene groups (self-renewal / pluripotency, ectoderm, endoderm, and mesoderm) ²comparing²spontaneous in vitro EB differentiation of EBs derived from the PBMC-iPSC ²lines. Figure ²8(G): Directed neuronal differentiation of representative fibroblast-derived ²(n: 26) and ²PBMC-derived iPSCs (n: 12) showing equivalent numbers of ectodermal ²(Nkx6.1+ / f33-²tubulin+ neuronal cells). Scale bar, 75[tm. ²Figure 8(11): High percent of iPSC²reprogramming success for cryopreserved PBMCs by the 5p method (n = 28 for T ²cells and n²= 13 for non-T cells) when compared to the published 4p method (n = 7 for both ²T and non-T ²cells). Percent reprogramming success is calculated as a proportion out of 10 ²the total number ²of attempts (successful or failed) at reprogramming the PBMCs. [{T cells, 5p ²versus 4p²5²<DP=6>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²(***): z-value = 3.74, two-tailed p-value = 0.00018, two-proportion z-test}; ²{non-T cells, 4p ²versus 5p (****): z-value = 7.18, two-tailed p-value < 0.0001, two-proportion ²z-test}]. ND: ²none detected.²It was further observed that there was greater reprogramming efficiency of the ²5p² method for both T and non-T cell populations when compared to the 4p method. ²Reprogramming efficiency is based on individual iPSC colonies identified and ²scored ²normalized to the total number of PBMCs nucleofected post-thaw. [{T cells, 4p ²versus 5p ²(***): two-tailed p-value = 0.0004, unpaired t-test with Welch's correction}, ²{non-T cells, 4p ²versus 5p (***): two-tailed p-value < 0.0001, unpaired t-test with Welch's ²correction}}. ND:²none detected. Figure 8(I) & Figure 8(J): Individual chromosome level ideogram ²²representation of abnormal karyotypes from fibroblast (top) and PBMC-derived ²iPSCs ²(bottom) in the Inventors' laboratory. Abnormal iPSC karyotypes represented in ²the ²ideograms are; (top) fib-iPSCs (n = 61) of total n = 260 fib-iPSC cultures ²karyotyped, and ²(bottom) PBMC-iPSCs (n = 4) of total n = 206 PBMC-iPSC lines karyotyped. ²Analysis²includes examination of chromosomes in a minimum of 20 cells per culture. Only ²²abnormalities that met the ISCN 2013 definition of clonality were included in ²this manuscript ²dataset. The letters above the translocation (navy blue bars) category are ²matched such that ²they correspond between the chromosomal locations to where each translocation ²abnormality ²occurred. The bar widths in each chromosomal ideogram were scaled in ²proportion to the²number of samples examined for fib-iPSCs and PBMC-iPSCs. Therefore, the bars ²displaying ²abnormalities found in PBMC-iPSC lines are 1.26 times (260 / 206) the width of ²bars ²depicting abnormalities found in fib-iPSC lines.²Figure 9(A) to Figure 9(D): Compared to fib-iPSC, the BC-iPSCs are more ²stable over extended culture. Figure 9(A) Percent abnormal G-band karyotypes ²observed in²the iPSC lines in correlation to donor age of fibroblasts and PBMCs. Figure ²9(B) Percent ²abnormal G-band karyotypes at the first karyotype post-reprogramming and in ²repeat ²karyotypes for iPSC lines evaluated in extended cell culture. The dotted lines ²represent the ²overall average karyotype abnormality rate for fib-iPSCs (orange) and BC-iPSCs ²(blue). ²Figure 9(C) Percent abnormal at the first G-band karyotypes evaluated for the ²fib- and²PBMC-iPSC clonal lines in relation to the passage number of the iPSCs. Figure ²9(D) Percent ²abnormal at the second ¨ fourth (repeat) G-band karyotypes evaluated for the ²fib- and ²PBMC-iPSC clonal lines in relation to the passage number of the iPSCs.²6²<DP=7>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Figure 10(A) to Figure 10(E): Comparative genomic hybridization confirms that ²the BC-iPSCs have relatively small and fewer submicroscopic cytogenetic ²aberrations ²compared to fib-iPSCs. (Figure10(A)-Figure10(B)) The average size of de novo ²acquired ²amplifications and deletions detected by aCGH in Mb of fib-iPSCs (n: 6) and ²PBMC- iPSCs²(n:7) when compared to each iPSC line's parental cells. The iPSC lines used in ²aCGH had²both abnormal and normal G-band karyotypes. Abnormal: fib-iPSC (n: 3) and PBMC-²iPSC ²(n: 2). Normal: fib-iPSC (n: 3) and PBMC-iPSC (n: 5). (FigurelO(C)-²Figure10(D)) The ²average number of de novo acquired amplifications and deletions detected by ²aCGH in Mb of ²fib-iPSCs (n: 6) and PBMC- iPSCs (n: 7) when compared to each iPSC line's ²parental cells.²Figure 10(E) A list of most recurrent submicroscopic amps / dels observed in the ²fib- or²PBMC-iPSC lines observed in the Inventors' laboratory. Figure 10(F): All data ²represented ²here is based on iPSC lines derived by the Inventors' laboratory at Cedars-²Sinai. The fib-²iPSCs were reprogrammed by the 3p method and the PBMC-iPSCs were reprogrammed ²by ²the 5p method. Percent abnormal G-band karyotypes observed in the iPSC lines ²in²correlation to donor age of fibroblasts and PBMCs. {{fib-iPSCs, donor age ²groups 21-40²versus 0-20 or 51-60 or 41-50 or 61-90: not significant (ns), two-proportion z-²test}]. fib-²iPSCs: n = 10 / 63 (0-20), n = 17 / 50 (21-40), n = 4 / 28 (41-50), n = 10 / 41 (51-²60), n = 7 / 29 (61-²90). {{fib-iPSCs versus PBMC-iPSCs ¨ age group 0-20: ns; age group 21-40 (**): ²z-value = ²2.9, two-tailed p-value = 0.003; age group 41-50 (*): z-value = 2.4, two-²tailed p-value =²0.015; age group 51-60 (***): z-value = 3.5, two-tailed p30 value = 0.0005; ²age group 61-90²(****): z-value = 4.02, two-tailed p-value < 0.0001; two-proportion z-testa ²PBMC-iPSCs: n²= 2 / 34 (0-20), n = 0 / 19 (21-40), n = 0 / 39 (41-50), n = 1 / 56 (51-60), n = 0 / 62 ²(61-90). ND:²none detected. Percent abnormal G-band karyotypes at the first karyotype ²post-²reprogramming and in repeat karyotypes for iPSC lines evaluated in extended ²cell culture.²The dotted lines represent the overall average karyotype abnormality rate for ²fib-iPSCs²(black) and PBMC-1 iPSCs (grey). {{1st karyotype, fib-iPSCs versus PBMC-iPSCs ²(****): ²z-value = 5.59, two-tailed p-value < 0.0001, two-proportion z-test}; {repeat ²(2nd-4th) ²karyotypes, fib-iPSCs versus PBMC-iPSCs (***): z-value = 3.72, two-tailed p-²value = ²0.0002, two-proportion z-test}; {fib-iPSCs and PBMC-iPSCs, 1st versus repeat ²karyotypes²tested as not significant by two-proportion z-test}]. fib-iPSCs: n = 46 / 205 ²(1st karyotype) and²n = 15 / 55 (repeat karyotype). PBMC-iPSCs: n = 2 / 143 (1st karyotype) and n = ²2 / 63 (repeat ²karyotype). Percent abnormal at the first G-band karyotypes evaluated for the ²fib- and ²PBMC-iPSC clonal lines in relation to the passage number of the iPSCs. {{fib-²iPSCs versus²7²<DP=8>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²PBMC-iPSCs ¨ passages 1-8 (****): z-value = 4.31, two-tailed p-value <0.0001; ²passages 9-²23 (***): z-value = 3.21, two tailed p-value = 0.001; two-proportion z-testa ²fib-iPSCs: n = ²20 / 102 (passages 1-8) and n =12 26 / 103 (passages 9-23). PBMC-iPSCs: n = 1 / 99 ²(passages ²1-8) and n = 1 / 42 (passages 9-23). Percent abnormal at the second ¨ fourth ²(repeat) G-band²karyotypes evaluated for the fib- and PBMC-iPSC clonal lines in relation to ²the passage²number of the iPSCs. [{fib-iPSCs versus²PBMC-iPSCs ¨ low passages 1-14: ns, z-value = 1.53, two-tailed p-value = 0.12; ²two-²proportion z-test}]. [{fib-iPSCs versus PBMC-iPSCs ¨ high passages > 15 (**): ²z-value = ²2.61, two-tailed p17 value = 0.009; two-proportion z-test}]. fib-iPSCs: n = ²7 / 12 (low²passages 1-14) and n = 8 / 43 (high passages > 15). PBMC-iPSCs: n = 0 / 2 (low ²passages 1-14)²and n = 2 / 61 (high passages > 15). ND: none detected. Figure 10(G): The ²average size of de ²novo acquired amplifications and deletions (amps / dels) detected by aCGH in Mb ²of fib-²iPSCs (n = 6) and PBMC- iPSCs (n = 8) when compared to each iPSC line's ²parental cells. ²[{fib-iPSC versus PBMC-iPSC (**): two-tailed p-value = 0.0015, unpaired t-²test}]. The iPSC².. lines used in aCGH amps / dels size analysis had both abnormal and normal G-²band²karyotypes. Abnormal: fib-iPSC (n = 3) and PBMC-iPSC (n = 2). Normal: fib-iPSC ²(n = 3) ²and PBMC-iPSC (n = 6). The average number of de novo acquired amplifications ²and ²deletions detected by aCGH in Mb of fib-iPSCs (n = 6) and PBMC- iPSCs (n = 8) ²when ²compared to each iPSC line's parental cells. [{fib-iPSC versus PBMC-iPSC (*): ²two-tailed p-²value = 0.0369, unpaired t-test}]. The iPSC lines used in number of de novo ²amps / dels²analysis with 1 abnormal karyotypes: fib2 iPSC (n = 3) and PBMC-iPSC (n = 2) ²as well as ²normal karyotypes: fib-iPSC (n = 3) and PBMC3 iPSC (n = 6). List of most ²recurrent ²submicroscopic amps / dels observed in iPSC lines observed in the Inventors' ²laboratory. ²Figure 10(11): Frequency of the different karyotype abnormalities in ²fibroblast-derived²iPSCs (fib-iPSCs) at individual chromosome level observed by G-band ²karyotyping. Rearr. ¨²Structural Rearrangements including translocations, inversions and ²derivatives. Cells shaded ²in gray depict chromosomes where karyotype abnormalities were never observed ²in fib-iPSC ²cultures. Cells shaded in orange depict the highest ranked (top 3) percent ²karyotype ²abnormality for each of the categories of total chromosomal abnormalities, ²which include² gain, loss or structural rearrangements of a chromosome.²Figure 11(A) to Figure 11(C): Transgene-free status of BC-iPSCs. Figure 11(A) ²Lack of plasmid-based EBNA gene expression using a assay in the genomic DNA of ²the BC-²iPSCs. Figure 11 (B): Relative normalized gene expression measured by ²quantitative RT-²8²<DP=9>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²PCR analyses using primers detecting endogenous POU5F1 (OCT4), SOX2, LIN28, L-²MYC, ²and KLF4 expression (coding DNA sequence, CDS). Figure 11 (C) as well as ²plasmid-²derived expression (Pla), which is undetectable in the iPSC lines.²Figure 12(A) to Figure 12(B): Chromosomal ideograms of lymphoblastoid cell²line (LCL)-iPSCs and epithelial cell-derived iPSCs. Individual chromosome ²level²ideogram representation of abnormal karyotypes from LCL-derived Figure 12(A) ²and ²epithelial-derived iPSCs Figure 12(B) in the Inventors' laboratory. Abnormal ²iPSC ²karyotypes represented in the ideograms are; (Figure 12(A)) LCL-iPSCs (n: 15) ²of total 60 ²LCL-iPSC cultures karyotyped, and (Figure 12(B)) epithelial-iPSCs (n: 7) of ²total BC-iPSCs² karyotyped (n: 26).²Figure 13(A) to Figure 13(B). Tr-lineage potential of PBMC-derived iPSCs. ²TaqMan hPSC Scorecard table showing the tri-lineage potential of the ²representative PBMC-²derived iPSCs generated in the Inventors' laboratory. Figure 13(A): Expression ²of selected ²genes in four groups (self-renewal / pluripotency, ectoderm, endoderm, and ²mesoderm) is²compared for spontaneous in vitro differentiation of embryoid bodies (EBs) ²derived from²each Figure 13(B): PBMC-iPSC line between 14-18 days post-iPSC stage. Negative ²scores ²for self-renewal reflect the differentiating status of EBs, while positive ²scores for each of the ²3 germ layers shows relatively equal propensity of a PBMC-derived iPSC line to ²generate the ²ectoderm, mesoderm and endoderm without directed differentiation.² Figure 14(A) to Figure 14(C). PBMC-iPSCs reprogrammed with episomal²plasmids are transgene-free. Figure 14(A): Lack of plasmid-based EBNA1 gene ²presence ²in the genomic DNA of the PBMC-iPSCs. Figure 14(B) and Figure 14(C): Relative ²normalized gene expression measured by quantitative RT-PCR analyses using ²primers ²detecting endogenous POU5F1 (OCT4), 50X2, LIN28, L-MYC, and KLF4 expression²(coding DNA sequence, CDS), as well as plasmid-derived expression (Pla), which ²is²undetectable in the PBMC-iPSC lines.²Figure 15(A) to Figure 15(B). PBMC-iPSCs Reprogrammed with 5p Method are ²Free of SV4OLT Gene Integration and Expression. Figure 15(A), Lack of plasmid-²based ²EBNA1 and SV4OLT gene presence in the genomic and episomal DNA isolated from²PBMC-iPSCs, H9-hESCs, integrated iPSC control lines and a positive control ²(nucleofected²with 5p in PBMCS for 30 days). Figure 15(B): Gene expression measured by ²quantitative ²RT-PCR analyses in the same cell lines using primers detecting expression for ²EBNA1, ²SV4OLT and GAPDH. SV4OLT gene expression is undetectable in the reprogrammed²9²<DP=10>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²PBMC-iPSC lines, when compared to the nucleofected positive control. 32 PCR ²cycles were ²used for all primer sets.²Figure 16(A) to Figure 16(B). Chromosomal ideograms of lymphoblastoid cell ²line (LCL)-iPSCs and epithelial cell-derived iPSCs. Individual chromosome ²level²ideogram representation of abnormal karyotypes from Figure 16(A): LCL-derived ²(top) and²Figure 16(B): epithelial-derived iPSCs (bottom) in the Inventors' laboratory. ²Abnormal iPSC ²karyotypes represented in the ideograms are; (top) LCL-iPSCs (n =15) of total ²60 LCL-iPSC ²cultures karyotyped, and (bottom) epithelial-iPSCs (n = 7) of total PBMC-iPSCs ²karyotyped ²(n = 26).²Figure 17. p53 analysis. Somatic variants (those appearing in only iPSC clones ²are²identified using realigned and recalibrated sequence files (.bam) generated in ²the GATK ²toolkit and the MuTect package. The package accepts processed sequencing reads ²from ²paired normal (in this case blood derived DNA) and somatic (in this case iPSC ²Clone DNA) ²samples and removes reads with low quality sequence, then applies a Bayesian ²classifier to²identify variants that occur in only the somatic sample before additional ²quality control steps²identify variants as germline or somatic. Identified variants are then ²annotated with a large ²SNP database of common variation identified in the population (dbSNP).²Figure 18(A) to Figure 18(B). Additional characterization of reprogramming ²techniques in fibroblasts using 3P, 5P methods. Figure 18(A) Day 22 post ²nucleofection² Figure 18(B) Day 28 post nucleofection²Figure 19(A) to Figure 19(B). Additional characterization of reprogramming ²techniques in fibroblasts using 3P, 5P methods. Figure 19(A) AP Stain ¨ 3 ²Plasmid ²Condition Figure 19(B) AP Stain ¨ 5 Plasmid Condition.²Figure 20. Frequency of the different karyotype abnormalities in fibroblast-² derived iPSCs (fib-iPSCs) at individual chromosome level observed by G-band ²karyotyping. Structural Rearrangements including translocations, inversions ²and derivatives. ²Cells shaded in gray depict chromosomes where karyotype abnormalities were ²never ²observed in fib-iPSC cultures. Cells shaded in orange depict the highest ²ranked (top 3) ²percent karyotype abnormality for each of the categories of total chromosomal ²abnormalities,²which include gain, loss or structural rearrangements of a chromosome.²<DP=11>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²DETAILED DESCRIPTION²All references cited herein are incorporated by reference in their entirety as ²though ²fully set forth. Unless defined otherwise, technical and scientific terms used ²herein have the ²same meaning as commonly understood by one of ordinary skill in the art to ²which this²invention belongs. Allen et at., Remington: The Science and Practice of ²Pharmacy 22nd ed.,²Pharmaceutical Press (September 15, 2012); Hornyak et at., Introduction to ²Nanoscience and ²Nanotechnology, CRC Press (2008); Singleton and Sainsbury, Dictionary of ²Microbiology ²and Molecular Biology 3rd ed., revised ed., J. Wiley & Sons (New York, NY ²2006); Smith, ²March's Advanced Organic Chemistry Reactions, Mechanisms and Structure 7th ²ed., J. Wiley²& Sons (New York, NY 2013); Singleton, Dictionary of DNA and Genome Technology ²3m'²ed., Wiley-Blackwell (November 28, 2012); and Green and Sambrook, Molecular ²Cloning: A ²Laboratory Manual 4th ed., Cold Spring Harbor Laboratory Press (Cold Spring ²Harbor, NY ²2012), provide one skilled in the art with a general guide to many of the ²terms used in the ²present application. For references on how to prepare antibodies, see ²Greenfield, Antibodies²A Laboratory Manual 2nd ed., Cold Spring Harbor Press (Cold Spring Harbor NY, ²2013);²Kohler and Milstein, Derivation of specific antibody-producing tissue culture ²and tumor lines ²by cell fusion, Eur. J. Immunol. 1976 Jul, 6(7):511-9; Queen and Selick, ²Humanized ²immunoglobulins, U. S. Patent No. 5,585,089 (1996 Dec); and Riechmann et at., ²Reshaping ²human antibodies for therapy, Nature 1988 Mar 24, 332(6162):323-7.²One skilled in the art will recognize many methods and materials similar or ²equivalent²to those described herein, which could be used in the practice of the present ²invention. ²Indeed, the present invention is in no way limited to the methods and ²materials described. ²For purposes of the present invention, the following terms are defined below.²As used in the description herein and throughout the claims that follow, the ²meaning²of "a," "an," and "the" includes plural reference unless the context clearly ²dictates otherwise.²Also, as used in the description herein, the meaning of "in" includes "in" and ²"on" unless the ²context clearly dictates otherwise.²As described, patient-specific induced pluripotent stem cells ("iPSCs") hold ²great²promise for many applications, including disease modeling to elucidate ²mechanisms involved²in disease pathogenesis, drug screening, and ultimately regenerative medicine ²therapies. the ²utility of human iPSCs is contingent upon maintaining quality, genomic ²integrity and ²stability. Multiple laboratories have shown recurrent genomic aberrations in ²human iPSC²11²<DP=12>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²lines upon long-term culture, with ¨10-25% rate of karyotype abnormalities ²derived from ²various tissue sources.²Maintaining genomic integrity and stability of hiPSC lines is imperative for ²reliable ²disease modeling and safe clinical applications of stem cells as a ²regenerative therapy.²Aberrant cytogenetic errors that arise during reprogramming of somatic cells ²and / or during²maintenance, expansion and prolonged culture of hiPSCs will impact the ²accuracy of in vitro ²disease modelling or, more critically, the in vivo utility of iPSCs for ²regenerative medicine. It ²is important that iPSCs in clinical use are free from cancer-associated ²genomic aberrations, ²especially given that several studies have reported chromosomal aneuploidy, ²translocations,²duplications and deletions, and point mutations in iPSCs. The highly ²aneuploidy human²embryonal carcinoma (EC) stem cells, which are the malignant analogues of ²normal hESCs, ²typically contain amplified regions of the short arm of chromosome 12 and ²gains of ²chromosomes 1, 17 and X.²Increased sub-chromosomal copy number variations (CNVs) with differences in ²early,²intermediate or late passage numbers, deletions associated with tumor-²suppressor genes, and²duplications of oncogenes have all been reported in iPSCs In most of these ²studies, the ²genomic abnormalities in the iPSC lines have been generated from integrating ²reprogramming methods. To date, however, no systematic and well-controlled ²(similar ²reprogramming and stem cell culture methods) reports of recurrent sub-²chromosomal²abnormalities specific to large numbers of fibroblast- or blood-derived hiPSC ²lines have been²described. The Inventors have developed an iPSC core facility with extensive ²experience ²producing, characterizing and differentiating human iPSC lines. This bio-²repository currently ²has over 160 well-characterized individual donor human iPSC lines with ²multiple clones (2-²6) per cell line. The iPSC Core has systematically monitored the genomic ²stability of hiPSCs²derived in the Core from 450 independent iPSC cultures over multiple passages, ²which have²been derived from fibroblast, peripheral blood mononuclear cells, immortalized ²²lymphoblastoid cell lines and primary epithelial cells.²A frequently used starting source of cells for reprogramming has been dermal ²fibroblasts isolated from skin biopsies. However, as described, iPSCs derived ²from skin²punch biopsies are more invasive, require a prolonged 2-3 week period of ²expansion in²culture prior to reprogramming. Most importantly, there are greater numbers of ²mutations ²associated with epidermal exposure to UV light, raising concerns over the ²safety of the iPSCs ²cells derived from skin. Issues with the common fibroblast cell source would ²be²12²<DP=13>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²circumvented with peripheral blood, which can be utilized as an easily ²accessible source of ²patient tissue for reprogramming. Peripheral blood is the most accessible ²adult tissue and ²permits access to numerous frozen samples already stored at blood banks. ²Additionally, many ²repositories have stored peripheral or lymphoblast blood with specific ²genotypes.²Blood appears to an advantageous alternative for iPSC derivation as widely ²used in²clinical diagnostics, involving less invasive methods of collection that is ²standardized and ²less traumatic than skin biopsy. The major components of peripheral blood (PB) ²are red ²blood cells and platelets. White blood cells are the nucleated cells in PB at ²concentrations of ²3.6-11 x 106 / ml. Mature T cells and primary progenitor cells in PB can be ²readily expanded²using established methods and are among the most successfully-used sources for ²²reprogramming. T cells are the most abundant cells after granulocytes in PB ²(20-30%) and T ²cells can be readily expanded with IL-2 and anti-CD3 / CD28 microbeads. ²Reprogramming of ²T cells into pluripotency has been reported by many labs using different ²approaches for the ²sake of developing replacements to aged T cells for immunotherapy. However, ²mature T²cells harbor a single T cell receptor (TCR) after somatic recombination and ²have lost the²ability to regenerate the T cell repertoire with unlimited possibilities.²Here the Inventors have developed a reliable protocol to efficiently reprogram ²blood ²cells (BCs) including peripheral mononuclear blood cells (PBMCs) into iPSCs ²(BC-iPSCs) ²and show that these iPSC lines are superior in terms of cytogenetic stability ²in comparison to²their fibroblast-derived iPSC (Fib-iPSCs) lines obtained from public ²repositories or local²clinics. The Inventors describe methods and cytogenetic stability for ²derivation of BC-iPSCs ²from both a lymphoid T cell and a myeloid non-T cell population. The Inventors ²discovered ²that hiPSC lines generated from PBMCs using non-integrating methods have ²greatly lower ²incidences of genomic aberrations than those generated by integrating methods. ²Both fib-²iPSCs and BC-iPSCs derived from the same somatic cells contained comparable ²numbers of²de novo CNVs. The Inventors' results show that freshly isolated human PBMCs ²can be ²faithfully reprogrammed to pluripotency with greater cytogenetic stability ²using episomal ²plasmids. As such, PBMCs should be a preferred somatic cell source for iPSC ²reprogramming to minimize any effects of acquired genomic aberrations and, ²further, should² be considered as an ideal cell source for regenerative medicine.²In contrast to mature T or B cells, the alternative source of blood ²progenitors contain ²an intact genome. In addition, they can be expanded in culture conditions that ²favor the ²proliferation of myeloid cells or erythroid cells. Blood stem / progenitor cells ²express surface²13²<DP=14>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²marker CD34 and reside in the stem cell niche. However, only about 1% ²stem / progenitor ²cells enter circulation each day and as a result, only 0.01-0.1% cells in PB ²are CD34+ cells. ²This population can be enriched by magnetic-activated cell sorting (MACS) or ²culture of ²MNCs for several days can be relied upon to expand CD34+ cells to a 5-20% ²purity, which² can be used for reprogramming without further purification.²Other nucleated peripheral blood cells include granulocytes (mostly ²neutrophils), ²monocytes, T lymphocytes, B lymphocytes and a few progenitor cells. Focusing ²on these ²constitutes of blood can be achieved by depleting red blood cells and platelet ²using lysis ²buffer followed by multiple centrifugations. Ficoll gradient centrifugation ²can also be²utilized to deplete both red blood cells and granulocytes, leading to the ²enrichment of²mononuclear cells (MNCs). Against this backdrop, reprogramming with ²exogenously ²expressed factors is notoriously inefficient and requires multiple cell cycles ²to achieve ²pluripotency. As such, primary granulocytes, monocytes and B lymphocytes are ²among the ²most difficult cells to be reprogrammed due to the lack of reliable protocols ²to expand these²cells. Primary success in this area includes Epstein-Barr virus immortalized ²lymphoblastoid²B cells can be readily expanded in ex vivo culture and thus be reprogrammed to ²pluripotency. ²In view of the above, of great interest is reprogramming of the non-T cell ²component ²of blood. Existing techniques are largely unable to reprogram this population ²from isolated ²peripheral blood mononuclear cells (PBMCs). More specifically, PBMCs are any ²peripheral²blood cell having a round nucleus. This includes lymphocytes (T cells, B ²cells, NK cells),²monocytes, dendritic cells. Lymphocytes are Small (5-10[tm) and Medium (10-18 ²[tm) and ²constitute 70-90% of PBMCs. Of these cells, 70 - 85% CD3+ T cells (40 -70% of ²PBMCs), ²CD4 Helper T cells (25-60% of PBMCs), typically with CD4 to CD8 ratio of 2:1, ²CD8 ²"Cytotoxic" compartment T cells (5-30% of PBMCs). The remaining compartment ²includes²5 ¨ 20% B Cells (up to 15% of PBMCs) and 5 ¨ 20% NK Cells (up to 15% of ²PBMCs).²Monocytes are 16-25 [tm and 10-30% of PBMCs (macrophages). Dendritic cells: 1-²2% of ²PBMCs²Here, the Inventors describe a new and reliable nonintegrating episomal ²plasmid ²reprogramming method for fresh (non-expanded) peripheral blood mononuclear ²cell (PBMC)²into iPSCs (PBMC-iPSCs). The Inventors show that PBMC-iPSCs produced using ²this ²method have superior chromosome-level karyotype stability at only a 1.9% ²abnormality rate, ²and exhibit few sub-chromosomal de novo copy number variations. In contrast, ²episomally ²reprogrammed iPSC lines derived from pre-expanded dermal fibroblasts (fib-²iPSCs),²14²<DP=15>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²lymphoblastoid cell lines (LCL-iPSCs) or epithelial cells (epi-iPSCs), exhibit ²over 10-fold ²greater karyotype instability (23-27%). These findings show that iPSCs ²reprogrammed from ²non expanded PBMCs and maintained with the methods described here, have ²excellent ²cytogenetic stability and minimal genomic aberrations, suggesting that this ²could be a² preferred method for iPSCs in research and therapeutic clinical applications.²These described approaches allow for use of peripheral blood as a readily ²accessible ²resource for cellular reprogramming with superior properties in genomic and ²karyotype ²stability avoiding environmental insults for which mutations or other forms of ²structural ²alteration would otherwise be therapeutic materials derived therein.²As described, the Inventors have established improved techniques for highly ²efficient, ²reproducible reprogramming using non-integrating episomal plasmid vectors, ²including ²generation of iPSCs from blood cells, including whole blood and peripheral ²blood, the ²resulting reprogrammed pluripotent cells described herein as "BC-iPSCs".²Generally, different approaches for non-integrative reprogramming span at ²least²categories: 1) integration-defective viral delivery, 2) episomal delivery, 3) ²direct RNA ²delivery, 4) direct protein delivery and 5) chemical induction. As described ²further herein, ²the adoption of episomal vectors allows for generation of iPSCs substantially ²free of the ²vectors used in their production, as episomal or similar vectors do not encode ²sufficient viral²genome sufficient to give rise to infection or a replication-competent virus. ²At the same time,²these vectors do possess a limited degree of self-replication capacity in the ²beginning somatic²host cells. ² This self-replication capacity provides a degree of persistent expression²understood to be beneficial in allowing the dedifferentiation process to ²initiate take hold in a ²target host cell.²One example of a plasmid vector satisfying these criteria includes the Epstein ²Barr²oriP / Nuclear Antigen-1 ("EBNA1") combination, which is capable of limited self-²replication ²and known to function in mammalian cells. As containing two elements from ²Epstein-Barr ²virus, oriP and EBNA1, binding of the EBNA1 protein to the virus replicon ²region oriP ²maintains a relatively long-term episomal presence of plasmids in mammalian ²cells. This²particular feature of the oriP / EBNA1 vector makes it ideal for generation of ²integration-free²iPSCs.²More specifically, persistent expression of reprogramming factor encoded in an ²²oriP / EBNA1 vector occurs across multiple cell divisional cycles. Sufficiently ²high levels of²<DP=16>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²reprogramming factors across several cell divisions allows for successful ²reprogramming ²even after only one infection. While sustained expression of reprogramming ²factors is ²understood to be beneficial during initial programming stages, otherwise ²unlimited ²constitutive expression would hamper subsequent stages of the reprogramming ²process. For²example, unabated expression of reprogramming factors would interfere with ²subsequent²growth, development, and fate specification of the host cells.²At the same time, a further benefit is the eventual removal of the ²reprogramming ²factor transgenes, as a small portion of episomes is lost per cell cycle. This ²is due to the ²asymmetric replication capacity of the host cell genome and episomal self-²replication and it²is estimated that approximately 0.5% of vector is lost per generation. Gradual ²depletion of²plasmids during each cell division is inevitable following propagation leading ²to a population²of integration-free iPSCs. ² The persistent, yet eventual abrogation of reprogramming²factor expression on oriP / EBNA1 is highly coincident with the needs for ²different stages of ²the reprogramming process and eliminates the need for further manipulation ²steps for²excision of the reprogramming factors, as has been attempted through use of ²transposons and²excisable polycistronic lentiviral vector elements. Although oriP / EBNA1 has ²been applied ²by others in reprogramming studies, the reported efficiencies are extremely ²low (as few as 3 ²to 6 colonies per million cells nucleofected), which may be due, in-part, to ²reliance on large ²plasmids encoding multiple reprogramming factors (e.g., more than 12 kb), ²negatively² impacting transfection efficiency.²In addition to these choices in vector designs, the specific combinations of²reprogramming factors implemented in the literature have varied. ² As mentioned,²reprogramming factors that have been used include pluripotency-related genes ²Oct-4, Sox-2, ²Lin-28, Nanog, Sa114, Fbx-15 and Utf-1. These factors, traditionally are ²understood be²normally expressed early during development and are involved in the ²maintenance of the²pluripotent potential of a subset of cells that will constituting the inner ²cell mass of the pre-²implantation embryo and post-implantation embryo proper. Their ectopic ²expression of is ²believed to allow the establishment of an embryonic-like transcriptional ²cascade that initiates ²and propagates an otherwise dormant endogenous core pluripotency program ²within a host²cell. Certain other reprogramming determinants, such as Tert, Klf-4, c-Myc, ²SV40 Large T²Antigen ("SV4OLT") and short hairpin RNAs targeting p53 ("shRNA-p53") have ²been ²applied. There determinants may not be potency-determining factors in and of ²themselves, ²but have been reported to provide advantages in reprogramming. For example, ²TERT and²16²<DP=17>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²SV4OLT are understood to enhance cell proliferation to promote survival during ²²reprogramming, while others such as short hairpin targeting of p53 inhibit or ²eliminate ²reprogramming barriers, such as senescence and apoptosis mechanisms. In each ²case, an ²increase in both the speed and efficiency of reprogramming is observed. In ²addition,²microRNAs ("miRNAs") are also known to influence pluripotency and ²reprogramming, and²some miRNAs from the miR 0290 cluster have been applied in reprogramming ²studies. For ²example, the introduction of miR-291-3p, miR-294 or miR-295 into fibroblasts, ²along with ²pluripotency-related genes, has also been reported to increase reprogramming ²efficiency.²While various vectors and reprogramming factors in the art appear to present ²multiple²ingredients capable of establishing reprogramming in cells, a high degree of ²complexity²occurs when taking into account the stoichiometric expression levels necessary ²for successful ²reprogramming to take hold. For example, somatic cell reprogramming efficiency ²is ²reportedly fourfold higher when Oct-4 and Sox2 are encoded in a single ²transcript on a single ²vector in a 1:1 ratio, in contrast to delivering the two factors on separate ²vectors. The latter²case results in a less controlled uptake ratio of the two factors, providing a ²negative impact on²reprogramming efficiency. One approach towards addressing these obstacles is ²the use of ²polycistronic vectors, such as inclusion of an internal ribosome entry site ²("IRES"), provided ²upstream of transgene(s) that is distal from the transcriptional promoter. ²This organization ²allows one or more transgenes to be provided in a single reprogramming vector, ²and various²inducible or constitutive promoters can be combined together as an expression ²cassette to²impart a more granular level of transcriptional control for the plurality of ²transgenes. These ²more specific levels of control can benefit the reprogramming process ²considerably, and ²separate expression cassettes on a vector can be designed accordingly as under ²the control of ²separate promoters.²Although there are advantages to providing such factors via a single, or small ²number²of vectors, upper size limitations on eventual vector size do exist, which can ²stymie attempts ²to promote their delivery in a host target cell. For example, early reports on ²the use of ²polycistronic vectors were notable for extremely poor efficiency of ²reprogramming, ²sometimes occurring in less than 1% of cells, more typically less than 0.1%. ²These obstacles²are due, in-part, to certain target host cells possessing poor tolerance for ²large constructs²(e.g., fibroblasts), or inefficient processing of IRES sites by the host ²cells. Moreover, ²positioning of a factor in a vector expression cassette affects both its ²stoichiometric and ²temporal expression, providing an additional variable impacting reprogramming ²efficiency.²17²<DP=18>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Thus, some improved techniques can rely on multiple vectors each encoding one ²or more ²reprogramming factors in various expression cassettes. Under these designs, ²alteration of the ²amount of a particular vector for delivery provides a coarse, but relatively ²straightforward ²route for adjusting expression levels in a target cell.²A further advantage of the techniques described herein is the use of defined ²media²conditions for the reprogramming process, including the use of ESC media ²and / or E7 media. ²While certain additives may be present to spur the reprogramming process ²(e.g., L-Ascorbic ²Acid, Transferrin, Sodium Bicarbonate, Insulin, Sodium Selenite and / or bFGF), ²no serum or ²animal components are used. In some instances, there may be further benefits ²in altering the²chemical and / or atmospheric conditions under which reprogramming will take ²place. For²example, as the pre-implantation embryo is not vascularized and hypoxic ²(similar to bone ²marrow stem-cell niches) reprogramming under hypoxic conditions of 5% 02, ²instead of the ²atmospheric 21% 02, may further provide an opportunity to increase the ²reprogramming ²efficiency. Similarly, chemical induction techniques have been used in ²combination with²reprogramming, particularly histone deacetylase (HDAC) inhibitor molecule, ²valproic acid²(VPA), which has been found wide use in different reprogramming studies. At ²the same ²time, other small molecules such as MAPK kinase (MEK)¨ERK ("MEK") inhibitor ²PD0325901, transforming growth factor beta ("TGF-f3") type I receptor ALK4, ²ALK5 and ²ALK7 inhibitor SB431542 and the glycogen synthase kinase-3 ("GSK3") inhibitor²CHIR99021 have been applied for activation of differentiation-inducing ²pathways (e.g. BMP²signaling), coupled with the modulation of other pathways (e.g. inhibition of ²the MAPK ²kinase (MEK)¨ERK pathway) in order to sustain self-renewal. Other small ²molecules, such ²as Rho-associated coiled-coil-containing protein kinase ("ROCK") inhibitors, ²such as Y-²27632 and thiazovivin ("Tzv") have been applied in order to promote survival ²and reduce²vulnerability of pSCs to cell death, particularly upon single-cell ²dissociation.²In addition to the choice of delivery vectors, reprogramming factor ²combinations, and ²conditions for reprogramming, further variations must consider the nature of ²the host target ²cell for reprogramming. To date, a wide variety of cells have served as ²sources for ²reprogramming including fibroblasts, stomach and liver cell cultures, human ²keratinocytes,²adipose cells, and frozen human monocyte. Clearly, there is a wide and robust ²potential for²dedifferentiation across many tissues sources. Nevertheless, it is widely ²understood that ²depending on the donor cell type, reprogramming is achieved with different ²efficiencies and ²kinetics. For example, although fibroblasts remain the most popular donor cell ²type for²18²<DP=19>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²reprogramming studies, other types of cells such as human primary ²keratinocytes transduced ²with Oct-4, Sox-2, Klf-4 and c-Myc have been reported to reprogram 100 times ²more ²efficiently and two-fold faster. Additionally, some other cell types, such as ²cord blood cells, ²may only require a subset of reprogramming factors, such as Oct-4 and Sox-2 ²for²dedifferentiation to take hold, while neural progenitor cells may only require ²Oct-4. Without²being bound to any particular theory, it is believed that differences in ²reprogramming ²efficiency and / or reprogramming factor requirements of specific host cells ²result from high ²endogenous levels of certain reprogramming factors and / or intrinsic epigenetic ²states that are ²more amenable to reprogramming.²Although these many other sources have been used across studies for the ²generation²of iPSCs, mononuclear cells (MNCs) from peripheral blood (PB) are a highly ²attractive host ²cell candidate due to convenience and features as an almost unlimited resource ²for cell ²reprogramming. PB cells in particular are relatively easy to isolate (e.g., ²blood draw) ²compared to isolation from other sources such as fibroblasts (e.g., skin ²biopsy). These cells²do not require laborious culturing and propagation prior to reprogramming, ²thereby reducing²the overall time from which reprogramming iPSCs can be obtained.²Following successful reprogramming, clonal selection allows for generation of ²pluripotent stem cell lines. Ideally, such cells possess requisite morphology ²(i.e., compact ²colony, high nucleus to cytoplasm ratio and prominent nucleolus), self-renewal ²capacity for²unlimited propagation in culture (i.e., immortal), and with the capability to ²differentiate into²all three germ layers (e.g., endoderm, mesoderm and ectoderm). Further ²techniques to ²characterize the pluripotency of a given population of cells include injection ²into an ²immunocompromised animal, such as a severe combined immunodeficient ("SCID") ²mouse, ²for formation of teratomas containing cells or tissues characteristic of all ²three germ layers.² As an example of the above, approximately, 5 x 106 cells per nucleofection of²PBMCs were nucleofected with either plasmid mixture 4p or plasmid mixture 5p ²using ²program V-024 on the Amaxa Nucleofector 2D Device with the Amaxa Human T-cell ²Nucleofectorg Kit. Approximately 1 x 106 cells were then seeded into wells of ²a 6-well plate ²covered with mitomycin treated mouse embryonic feeder (MEF) layer or coated ²with 10²[tg / m1 Laminin-521 (L-521;BioLamina). Each episomal plasmid (Addgene) ²expressing 7²factors: OCT4, SOX2, KLF4, LMYC, LIN28, SV4OLT and p53 shRNA (pEP4 E02S ET2K, ²pCXLE-hOCT3 / 4-shp53-F, pCXLEhUL, pCXLE-hSK, and pCXLE-EBNA1). This method ²has a significant advantage over viral transduction, because exogenously ²introduced genes do²19²<DP=20>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²not integrate and are instead expressed episomally in a transient fashion. ²Cells were plated in ²2 mL of either af3 T-cell medium (X-vivol0 supplemented with 30U / m1 IL-2 and ²Sul / well ²Dynabeads Human T-activator CD3 / CD28) or non T-cell medium (aMEM supplemented ²with 10% FBS, lOng / m1 IL-3, lOng / m1 IL-6, lOng / m1 G-CSF and lOng / m1 GM-CSF). ²Two²days after nucleofection an equal amount of Primate ESC medium (ReproCell) ²containing 5²ng / ml bFGF (for MEF condition) or E7 medium (for L-521 condition) was added to ²the wells ²without aspirating the previous medium. Beginning on day four, the medium was ²gently ²aspirated from each well and 2m1 of the appropriate fresh reprogramming media ²was added to ²each well. Medium was replaced every other day. At approximately day 18 post²nucleofection, individual colonies were observed in all wells of each ²condition. At²approximately day 25 post nucleofection, individual colonies were isolated and ²sub-cloned ²into 1 well of 12-well plate containing the appropriate substrate and medium. ²These ²nucleofected cells were plated on feeder-independent BD MatrigelTM growth ²factor-reduced ²Matrix (Corning / BD Biosciences, #354230). All cultures were maintained at 20% ²02 during²the reprogramming process. Individual PBMC-iPSC colonies with ES / iPSC-like ²morphology²appeared between day 25-32 and those with best morphology were mechanically ²isolated, ²transferred onto 12-well plates with fresh MatrigelTM Matrix, and maintained ²in mTeSRgl ²medium. The iPSC clones were further expanded and scaled up for further ²analysis. All the ²fibroblasts were reprogrammed with the 3p reprogramming plasmid mixture as ²described.²Described herein is a composition of blood cell derived induced pluripotent ²stem cells ²("BC-iPSCs"). In certain embodiments, the composition of blood cell derived ²induced ²pluripotent stem cells includes cells generated by providing a quantity of ²blood cells, ²delivering a quantity of reprogramming factors into the blood cells, culturing ²the blood cells²in a reprogramming media for at least 4 days, wherein delivering the ²reprogramming factors,²and culturing generates the blood cells derived induced pluripotent stem ²cells. In certain ²embodiments, the blood cells are T-cells. In other embodiments, the blood ²cells are non-T-²cells. In other embodiments, the blood cells are mononuclear cells (MNCs), ²including for ²example peripheral blood mononuclear cells (PBMCs). In other embodiments, the ²cells are² primary granulocytes, monocytes and B lymphocytes.²In certain embodiments, the reprogramming factors are 0ct-4, Sox-2, Klf-4, c-²Myc, ²Lin-28, SV40 Large T Antigen ("SV4OLT"), and short hairpin RNAs targeting p53 ²("shRNA-p53"). In other embodiments, these reprogramming factors are encoded ²in a²<DP=21>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²combination of vectors including pEP4 E02S ET2K, pCXLE-hOCT3 / 4-shp53-F, pCXLE-²hSK, pCXLE-hUL and pCWB-EBNAl. This includes, for example, using about 0.5 ¨ ²1.0 ²ug pCXLE-hOCT3 / 4-shp53, 0.5 ¨ 1.0 ug pCXLE-hSK, 0.5 ¨ 1.0 ug pCXLE-UL, about ²0.25 ²¨ 0.75 ug pCWB-EBNA1 and 0.5 ¨ 1.0 ug pEP4 E02S ET2K. This includes, for ²example,² using 0.83ug pCXLE-hOCT3 / 4-shp53, 0.83ug pCXLE-hSK, 0.83ug pCXLE-UL, 0.5ug ²pCWB-EBNA1 and 0.83 ug pEP4 E02S ET2K, wherein the stoichiometric ratio of ²SV4OLT (encoded in pEP4 E02S ET2K) and EBNA-1 (encoded in pCWB-EBNA1) ²supports the reprogramming of non-T cell component of blood, including ²peripheral blood ²mononuclear cells. In certain other embodiments, the reprogramming media ²includes²PD0325901, CHIR99021, HA-100, and A-83-01. In other embodiments, the culturing ²the ²blood cells in a reprogramming media is for 4-30 days. In various embodiments, ²the blood ²cells are plated on a treated cell culture surface after delivering a quantity ²of reprogramming ²factors. In various embodiments, treatment includes plating of feeder cells, ²such as mouse ²embryonic fibroblasts. In other embodiments, treatment includes coating with ²extracellular²matrix proteins. In various embodiment, extracellular matrix proteins include ²laminin.²In various embodiments, the BC-iPSCs are capable of serial passaging as a cell ²line. ²In various embodiments, the BC-iPSCs possess genomic stability. Genomic ²stability can be ²ascertained by various techniques known in the art. For example, G-band ²karyotyping can ²identify abnormal cells lacking genomic stability, wherein abnormal cells ²possess about 10%²or more mosaicism, or one or more balanced translocations of greater than ²about 5, 6, 7, 8, 9, ²10 or more Mb. Alternatively, genomic stability can be measured using ²comparative ²genomic hybridization (aCGH) microarray, comparing for example, BC-iPSCs ²against iPSCs ²from a non-blood cell source such as fibroblasts. Genomic stability can ²include copy number²variants (CNVs), duplications / deletions, and unbalanced translocations. ²In various²embodiments, BC-iPSCs exhibit no more than about 3,4, 5, 6, 7, 8, 9, 10, 11, ²12, 13, 15, 16, ²17, 18, 19, or 20 Mb average size of amplification and deletion. In various ²embodiments, ²BC-iPSCs exhibit no more than about 20-30 Mb average size of amplification and ²deletion. ²In various embodiments, BC-iPSCs exhibit no more than about 30-40 Mb average ²size of ²amplification and deletion. In various embodiments, BC-iPSCs exhibit no more ²than about²40-50 Mb average size of amplification and deletion. In various embodiments, ²the average ²number of acquired de novo amplification and deletions in BC-iPSCs is less ²than about 5, 4, ²3, 2, or 1. For example, de novo amplification and deletions in fib-iPSCs are ²at least two-fold ²greater than in PBMC-iPSCs.²21²<DP=22>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²In different embodiments, reprogramming factors can also include one or more ²of ²following: Oct-4, Sox-2, Klf-4, c-Myc, Lin-28, SV4OLT, shRNA-p53, nanog, ²Sa114, Fbx-15, ²Utf-1, Tert, or a Mir-290 cluster microRNA such as miR0291 03p, miR0294 or ²miR0295. ²In different embodiments, the reprogramming factors are encoded by a vector. ²In different²embodiments, the vector can be, for example, a non-integrating episomal ²vector, minicircle²vector, plasmid, retrovirus (integrating and non-integrating) and / or other ²genetic elements ²known to one of ordinary skill. In different embodiments, the reprogramming ²factors are ²encoded by one or more oriP / EBNA1 derived vectors. In different embodiments, ²the vector ²encodes one or more reprogramming factors, and combinations of vectors can be ²used²together to deliver one or more of Oct-4, Sox-2, Klf-4, c-Myc, Lin-28, SV4OLT, ²shRNA-p53,²nanog, Sa114, Fbx-15, Utf-1, Tert, or a Mir-290 cluster microRNA such as ²miR0291 03p, ²miR0294 or miR0295. For example, oriP / EBNA1 is an episomal vector that can ²encode a ²vector combination of multiple reprogramming factors, such as pCXLE-hUL, pCXLE-²hSK, ²pCXLE-hOCT3 / 4-shp53-F, pEP4 E02S T2K and pCXWB-EBNAl.²In other embodiments, the reprogramming factors are delivered by techniques ²known²in the art, such as nuclefection, transfection, transduction, electrofusion, ²electroporation, ²microinjection, cell fusion, among others. In other embodiments, the ²reprogramming factors ²are provided as RNA, linear DNA, peptides or proteins, or a cellular extract ²of a pluripotent ²stem cell.² In various embodiments, the reprogramming media is embryonic stem cell (ESC)²media. In various embodiments, the reprogramming media includes bFGF. In ²various ²embodiments, the reprogramming media is E7 media. In various embodiments, the ²reprogramming E7 media includes L-Ascorbic Acid, Transferrin, Sodium ²Bicarbonate, ²Insulin, Sodium Selenite and / or bFGF In different embodiments, the ²reprogramming media²comprises at least one small chemical induction molecule. In different ²embodiments, the at²least one small chemical induction molecule comprises PD0325901, CHIR99021, HA-²100, ²A-83-01, valproic acid (VPA), 5B431542, Y-27632 or thiazovivin ("Tzv"). In ²different ²embodiments, culturing the BCs in a reprogramming media is for at least 4, 5, ²6, 7, 8, 9, 10, ²11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or ²30 days.² In certain embodiments, the BC-iPSCs are derived from blood cells previously²isolated from a subject, by for, example, drawing a blood sample from the ²subject. In other ²embodiments, the blood cells are isolated from a subject possessing a disease ²mutation. For ²example, subjects possessing any number of mutations, such as autosomal ²dominant,²22²<DP=23>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²recessive, sex-linked, can serve as a source of blood cells to generate BC-²iPSCs possessing²said mutation. In other embodiments, the disease mutation is associated ²with a ²neurodegenerative disease, disorder and / or condition. In other embodiments, ²the disease²mutation is associated with an inflammatory bowel disease, disorder, and / or ²condition. In²various embodiments, the BC-iPSCs possess features of pluripotent stem cells. ²Some²exemplary features of pluripotent stem cells including differentiation into ²cells of all three ²germ layers (ectoderm, endoderm, mesoderm), either in vitro or in vivo when ²injected into an ²immunodeficient animal, expression of pluripotency markers such as Oct-4, Sox-²2, nanog, ²TRA-1-60, TRA-1-81, SSEA4, high levels of alkaline phosphatase ("AP") ²expression,²indefinite propagation in culture, among other features recognized and ²appreciated by one of²ordinary skill.²Other embodiments include a pharmaceutical composition including a quantity of ²²blood cells derived induced pluripotent stem cells generated by the above ²described methods, ²and a pharmaceutically acceptable carrier.²Also described herein is an efficient method for generating induced ²pluripotent stem ²cells, including providing a quantity of cells, delivering a quantity of ²reprogramming factors ²into the cells, culturing the cells in a reprogramming media for at least 4 ²days, wherein ²delivering the reprogramming factors, and culturing generates induced ²pluripotent stem cells.²In certain embodiments, the cells are primary culture cells. In other ²embodiments, the cells²are blood cells (BCs). In certain embodiments, the blood cells are T-cells. In ²other ²embodiments, the blood cells are non-T-cells. In other embodiments, the cells ²are ²mononuclear cells (MNCs), including for example peripheral blood mononuclear ²cells ²(PBMCs). In other embodiments, the cells are primary granulocytes, monocytes ²and B² lymphocytes.²In certain embodiments, the reprogramming factors are Oct-4, Sox-2, Klf-4, c-²Myc, ²Lin-28, 5V40 Large T Antigen ("SV4OLT"), and short hairpin RNAs targeting p53 ²("shRNA-p53"). In other embodiments, these reprogramming factors are encoded ²in a ²combination of vectors including pEP4 E025 ET2K, pCXLE-hOCT3 / 4-shp53-F, pCXLE-²hSK, pCXLE-hUL and pCWB-EBNAl. This includes, for example, using about 0.5 ¨ ²1.0²ug pCXLE-hOCT3 / 4-shp53, 0.5 ¨ 1.0 ug pCXLE-hSK, 0.5 ¨ 1.0 ug pCXLE-UL, about ²0.25 ²¨ 0.75 ug pCWB-EBNA1 and 0.5 ¨ 1.0 ug pEP4 E025 ET2K. This includes, for ²example, ²using 0.83ug pCXLE-hOCT3 / 4-shp53, 0.83ug pCXLE-hSK, 0.83ug pCXLE-UL, 0.5ug²23²<DP=24>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²pCWB-EBNA1 and 0.83 ug pEP4 E02S ET2K, wherein the stoichiometric ratio of ²SV4OLT (encoded in pEP4 E02S ET2K) and EBNA-1 (encoded in pCWB-EBNA1) ²supports the reprogramming of non-T cell component of blood, including ²peripheral blood ²mononuclear cells. In various embodiments, the reprogramming media is ²embryonic stem²cell (ESC) media. In various embodiments, the reprogramming media includes ²bFGF. In²various embodiments, the reprogramming media is E7 media. In various ²embodiments, the ²reprogramming E7 media includes L-Ascorbic Acid, Transferrin, Sodium ²Bicarbonate, ²Insulin, Sodium Selenite and / or bFGF. In different embodiments, the ²reprogramming media ²comprises at least one small chemical induction molecule. In certain other ²embodiments, the²reprogramming media includes PD0325901, CHIR99021, HA-100, and A-83-01. In ²other ²embodiments, the culturing the blood cells in a reprogramming media is for 4-²30 days.²In various embodiments, the BC-iPSCs are capable of serial passaging as a cell ²line. ²In various embodiments, the BC-iPSCs possess genomic stability. Genomic ²stability can be ²ascertained by various techniques known in the art. For example, G-band ²karyotyping can²identify abnormal cells lacking genomic stability, wherein abnormal cells ²possess about 10%²or more mosaicism, or one or more balanced translocations of greater than ²about 5, 6, 7, 8, 9, ²10 or more Mb. Alternatively, genomic stability can be measured using ²comparative ²genomic hybridization (aCGH) microarray, comparing for example, BC-iPSCs ²against iPSCs ²from a non-blood cell source such as fibroblasts. Genomic stability can ²include copy number²variants (CNVs), duplications / deletions, and unbalanced translocations. ²In various²embodiments, BC-iPSCs exhibit no more than about 3,4, 5, 6, 7, 8, 9, 10, 11, ²12, 13, 15, 16, ²17, 18, 19, or 20 Mb average size of amplification and deletion. In various ²embodiments, ²BC-iPSCs exhibit no more than about 20-30 Mb average size of amplification and ²deletion. ²In various embodiments, BC-iPSCs exhibit no more than about 30-40 Mb average ²size of²amplification and deletion. In various embodiments, BC-iPSCs exhibit no more ²than about²40-50 Mb average size of amplification and deletion. In various embodiments, ²the average ²number of acquired de novo amplification and deletions in BC-iPSCs is less ²than about 5, 4, ²3, 2, or 1. For example, de novo amplification and deletions in fib-iPSCs are ²at least two-fold ²greater than in PBMC-iPSCs. In various embodiments, the methods produces iPSC ²cell lines²collectively exhibiting about 20%, 15%, 10%, 5% or less abnormal karyotypes ²over 4-8, 9-²13, 13-17, 17-21, 21-25, or 29 or more passages when serially passaged as a ²cell line.²In different embodiments, reprogramming factors can also include one or more ²of ²following: Oct-4, Sox-2, Klf-4, c-Myc, Lin-28, SV4OLT, shRNA-p53, nanog, ²5a114, Fbx-15,²24²<DP=25>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Utf-1, Tert, or a Mir-290 cluster microRNA such as miR0291 03p, miR0294 or ²miR0295. ²In different embodiments, the reprogramming factors are encoded by a vector. ²In different ²embodiments, the vector can be, for example, a non-integrating episomal ²vector, minicircle ²vector, plasmid, retrovirus (integrating and non-integrating) and / or other ²genetic elements²known to one of ordinary skill. In different embodiments, the reprogramming ²factors are²encoded by one or more oriP / EBNA1 derived vectors. In different embodiments, ²the vector ²encodes one or more reprogramming factors, and combinations of vectors can be ²used ²together to deliver one or more of 0ct-4, Sox-2, Klf-4, c-Myc, Lin-28, SV4OLT, ²shRNA-p53, ²nanog, Sa114, Fbx-15, Utf-1, Tert, or a Mir-290 cluster microRNA such as ²miR0291 03p,²miR0294 or miR0295. For example, oriP / EBNA1 is an episomal vector that can ²encode a²vector combination of multiple reprogramming factors, such as pCXLE-hUL, pCXLE-²hSK, ²pCXLE-h0CT3 / 4-shp53-F, pEP4 E02S T2K and pCXWB-EBNAl.²In other embodiments, the reprogramming factors are delivered by techniques ²known ²in the art, such as nuclefection, transfection, transduction, electrofusion, ²electroporation,².. microinjection, cell fusion, among others. In other embodiments, the ²reprogramming factors²are provided as RNA, linear DNA, peptides or proteins, or a cellular extract ²of a pluripotent ²stem cell. In certain embodiments, the cells are treated with sodium butyrate ²prior to delivery ²of the reprogramming factors. In other embodiments, the cells are incubated or ²1, 2, 3, 4, or ²more days on a tissue culture surface before further culturing. This can ²include, for example,²incubation on a Matrigel coated tissue culture surface. In other embodiments, ²the²reprogramming conditions include application of norm-oxygen conditions, such ²as 5% 02, ²which is less than atmospheric 21% 02.²In various embodiments, the reprogramming media is embryonic stem cell (ESC) ²media. In various embodiments, the reprogramming media includes bFGF. In ²various² embodiments, the reprogramming media is E7 media. In various embodiments, the²reprogramming E7 media includes L-Ascorbic Acid, Transferrin, Sodium ²Bicarbonate, ²Insulin, Sodium Selenite and / or bFGF. In different embodiments, the ²reprogramming media ²comprises at least one small chemical induction molecule. In different ²embodiments, the at ²least one small chemical induction molecule comprises PD0325901, CHIR99021, HA-²100,²A-83-01, valproic acid (VPA), 5B431542, Y-27632 or thiazovivin ("Tzv"). In ²different²embodiments, culturing the BCs in a reprogramming media is for at least 4, 5, ²6, 7, 8, 9, 10,²11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or ²30 days.²<DP=26>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Efficiency of reprogramming is readily ascertained by one of many techniques ²readily ²understood by one of ordinary skill. For example, efficiency can be described ²by the ratio ²between the number of donor cells receiving the full set of reprogramming ²factors and the ²number of reprogrammed colonies generated. Measuring the number donor cells ²receiving²reprogramming factors can be measured directly, when a reporter gene such as ²GFP is²included in a vector encoding a reprogramming factor. Alternatively, indirect ²measurement ²of delivery efficiency can be provided by transfecting a vector encoding a ²reporter gene as a ²proxy to gauge delivery efficiency in paired samples delivering reprogramming ²factor ²vectors. Further, the number of reprogrammed colonies generated can be ²measured by, for²example, observing the appearance of one or more embryonic stem cell-like ²pluripotency²characteristics such as alkaline phosphatase (AP)-positive clones, colonies ²with endogenous ²expression of transcription factors Oct or Nanog, or antibody staining of ²surface markers such ²as Tra-1-60. In another example, efficiency can be described by the kinetics ²of induced ²pluripotent stem cell generation. For example, efficiency can include ²producing cell lines of²normal karyotype, including the method producing iPSC cell lines collectively ²exhibiting²about 20%, 15%, 10%, 5% or less abnormal karyotypes over 4-8, 9-13, 13-17, 17-²21, 21-25, ²or 29 or more passages when serially passaged as a cell line.²Example / ² General iPSC Reprogramming Protocol for Blood²Generally, the reprogramming method involves the following steps. Frozen ²peripheral blood mononuclear cells (PBMCs), or freshly isolated PBMCs can be ²used. ²Treated cell culture surfaces can be used for plating thawed or freshly ²isolated PBMS. This ²includes, for example, cell culture surfaces treated with mouse embryonic ²feeders (MEF) or²extracellular matrix laminin L-521A. An expression plasmid mixture is ²provided, with the²plasmid mixture encoding a combination of pluripotency factors. Plasmids are ²introduced to ²PBMCs, by using for example, nucleofection, and thereafter placed on the ²treated cell culture ²surface. After 2 days of culturing, reprogramming media is introduced, and ²replenished until ²colonies are formed.² 26²<DP=27>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Example 2²Peripheral Blood Collection and Minimal Processing for Reprogramming²The Inventors have established processes to isolate lymphocytes from freshly²collected or commercial sources of human or mammalian peripheral blood (PB). ²The²preferred format for the collection and shipment of such samples is the CPT ²tubes. This²format allows the supplier to centrifuge the vacutainer(s) and separate the ²red blood cells ²from the plasma components prior to shipping. The protocol provides for the ²isolation of ²PBMCs from the plasma layer of the CPT tubes.²Optional tests: Prior to opening the Vacutainer, several disease state tests ²can be²performed, including testing for HIV, Hepatitis B and C, and syphilis. The ²latter test results²should be made available within 1-3 working days from the collection date. If ²there is a ²positive result, the sample(s) will be properly discarded, and all laboratory ²equipment that ²was used to process the samples will be decontaminated.² Example 3²Collection Procedure²(1) Red blood cells and platelets are depleted using containers. BD Vacutainer ² ²CPTTm Tube with Sodium Citrate should be at room temperature (18-25 C) and ²properly²labeled for patient identification. Spray the CPT Vacutainer lightly with ²70%² isopropanol / ethanol, wipe the alcohol off.²(2) Blood collection is into three (3) 8m1 CPT tubes per sample using the ²standard ²technique for BD Vacutainer Evacuated Blood Collection Tubes. After ²collection, tube is ²stored upright at room temperature until centrifugation. Blood samples should ²be centrifuged ²within two hours of blood collection for best results.²(3) Tube / blood sample is centrifuged at room temperature (18-25 C) in a ²horizontal²rotor (swing-out head) for a minimum of 20 minutes (up to 30 minutes) at 1500 ²to 1800 RCF ²(Relative Centrifugal Force).²(4) For blood shipped in CPT tubes and reprogramming is performed within 24 ²hours: ²After centrifugation, mononuclear cells and platelets will be in a whitish ²layer just under the²plasma layer (see Figure 1). An alternative procedure for recovering the ²separated²mononuclear cells is to resuspend the cells into the plasma by inverting the ²unopened BD ²Vacutainer CPTTm Tube gently 5 to 10 times. This is the preferred method for ²storing or ²transporting the separated sample for up to 24 hours after centrifugation.²27²<DP=28>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Example 4²Important Parameters²Temperature: Since the principle of separation depends on a density gradient, ²and the²density of the components varies with temperature, the temperature of the ²system should be²controlled between 18-25 C during separation.²Centrifugation: Since the principle of separation depends on the movement of ²formed ²elements in the blood through the separation media, the "RCF" should be ²controlled at 1500 ²RCF to 1800 RCF. The time of centrifugation should be a minimum of 20 minutes. ²(As noted²in the trouble shooting section, some specimens may require up to 30 minutes ²for optimal²separation.) Centrifugation of the BD Vacutainerg CPTTm Tube up to 30 minutes ²has the ²effect of reducing red blood cell contamination of the mononuclear cell ²fraction. ²Centrifugation beyond 30 minutes has little additional effect. The BD ²Vacutainerg CPTTm ²Tube may be re-centrifuged if the mononuclear "band" or layer is not ²disturbed.²Time: Blood samples should be centrifuged or separated within two hours of ²blood²drawing. Red blood cell contamination in the separated mononuclear cell ²fraction increases ²with longer delays in sample separation. Mononuclear cell recovery decreases ²with increased ²time delay before centrifugation, falling to approximately 40% mononuclear ²cell recovery at ²24 hours. Pour the contents (the plasma layer) off into an appropriately ²labeled 50 mL tube.² Example 5²Reprogramming Procedure Materials and Supplies²Described herein is the procedure for reprogramming separated whole blood ²samples ²(peripheral blood mononuclear cells ¨ PBMCs) for iPSC generation. Materials ²for use²include: Sterile 1.5m1 Eppendorf tubes; Sterile pipette tips (1000u1, 200u1, ²10u1); Amaxa²NucleofectorTM 2b Device (Lonza); Human T-Cell Nucleofector Kit (Lonza, Cat ²#VPA-²1002); Prepared MEF 6-well TC Plates or L-521 Coated Plates; 0.22um SteriFlip ²(optional); ²Primate ESC Medium or E7 Medium, described below in Tables 1-4.²Reprogramming Plasmids used include (1) pCXLE-hOCT3 / 4-shp53; (2) pCXLE-² hSK; (3) pCXLE-UL; (4) pCWB-EBNAl; (5) pEP4 E025 ET2K.²28²<DP=29>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Table 1 - al3 T-Cell Media ²ITEM CONCENTRATION ²X-vivol0²IL-2 30U / m1²Dynabeads Human T-activator Sul / well²CD3 / CD28 (to be added after²Nucleofection)²Table 2 - Non-T Cell Media ²ITEM CONCENTRATION ²aMEM²FB S 10%²IL-3 lOng / m1²IL-6 lOng / m1²G-CSF lOng / m1²GM-CSF lOng / m1² Table 3 - MEF Media (optional) ²ITEM CONCENTRATION ²DMEM²FBS 10%²NEAA 1%²GlutaMax 1%²Table 4 - Prepared Primate ESC Medium (Optional) ²ITEM CONCENTRATION ²Primate ESC Medium²bFGF 5 ng / ml²Table 5 - Prepared E7 Medium (Optional) ²ITEM CONCENTRATION ²DMEM / F12²29²<DP=30>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²L-Ascorbic Acid 64ug / m1²Transferrin 10. 7ug / m1²Sodium Bicarbonate 543ug / m1²Insulin 19.4ug / m1²Sodium Selenite 14ng / m1²bFGF 10Ong / m1²Example 6²Reprogramming Procedure²Day -1 - Preparation of plates²MEF Plates ¨ 1. Coat each well of 6-well plate with lml of 0.1% Gelatin. 2. ²Incubate plate at²37 C for a minimum of 1 hour. 3. Obtain a vial of frozen MEFs from the LN2 ²tank. 4. Thaw ²vial in a water bath by gently moving the frozen vial in a figure 8 motion in ²the water. 5. ²Collect thaw cells into a 15m1 conical. 6. Slowly add MEF media to bring the ²volume to ²10m1s. 7. Centrifuge tube / MEFs at room temperature (18-25 C) at 1000 to 1200 ²RPM²(Relative Centrifugal Force) for 5 minutes. 8. While the cells are spinning, ²aspirate the²gelatin from the 6-well plate and add lml of MEF media to each well. 9. After ²the ²centrifuged has stopped, remove the conical and aspirate the supernatant ²without disturbing ²the cell pellet. 10. Resuspend the cell pellet in enough MEF media to achieve ²approximately ²50,000ce11s / ml. 11. Add lml of cell / MEF media mixture to each well. 12. Swirl ²plate to²ensure even distribution of MEFs and place in incubator overnight. 13. Prepare ²lOug / m1 of L-²521 by thawing one lml vial of 10Oug / m1 L-521 and adding the contents to 9m1s ²of sterile ²PBS. 14. Filter the mixture through a 0.22um filter or SteriFlip. 15. Add lml ²of the lOug / m1 ²L-521 mixture to each well of a 6-well plate. 16. Wrap the plate with Parafilm ²and place in ²the 37oC incubator for 2 hours. 17. Remove plate from the incubator and place ²in 4oC² fridge.²Day 0 - Cell Preparation of Frozen PBMCs²18. Thaw 2 frozen vials of PBMCs containing 5e6 cells each in the water bath ²using a "figure²8" motion until a small ball of ice remains. 19. Collect the contents of each ²tube into two²separate sterile 15m1 conicals and label the tubes 1 and 2. 20. Add sterile ²PBS to each tube to²bring the volume to 10m1s. Mix cells by inverting tube 5 times. 21. Centrifuge ²for 15 ²minutes at 1000 RPM. 22. Proceed to step 25²<DP=31>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Cell Preparation of Freshly Isolated PBMCs²23. Place 3e6 freshly isolated PBMCs into 2 sterile 15m1 conicals each. 24. ²Perform steps 19²to 22.² Reprogramming²If using L-521 coated plates, one allows plates to equilibrate to room-²temperature for at²least 1 hr. 25. Prepare a 1.5m1 Eppendorf tubes of Lonza Nucleofection ²solution according²to protocol (82u1 of Nucleofection Solution + 18u1 of Supplement per ²reaction). Label the²tube NS.²NOTE: One will be performing each reaction twice; once for T-cell conditions ²and once²for non T-cell conditions. It is okay to prepare a master mix of NS for all ²reactions.²26. In an 1.5m1 Eppendorf tube, prepare 3.83ug of expression plasmid mixture ²for each²reaction as follows:²i. pCXLE-hOCT3 / 4-shp53: 0.83ug²pCXLE-hSK : 0.83ug²pCXLE-UL: 0.83ug²iv. pCWB-EBNAl: 0.5ug²v. pEP4 E025 ET2K: 0.83ug²27. Prepare a 15m1 conical with 6m1s T-cell media. 28. Prepare a 15m1 conical ²with 6m1s non ²T-cell media. 29. Aspirate the supernatant from one of the 15m1 conicals ²containing your ²cells. 30. Gently flick the tube to loosen up the cell pellet. 31. Add 100u1 ²of NS mixture to²your cell pellet and gently pipette up and down 3-4 times. 32. Transfer the ²total volume of ²NS / cell mixture to a 1.5m1 Eppendorf tube containing your plasmid mixture and ²mix by ²gently pipetting up and down 3-4 times. 33. Transfer the total volume of ²NS / cell / plasmid ²mixture to a glass cuvette provided with the Lonza T-cell kit. 34. Place the ²cuvette in the ²Amaxa nucleofector and run program V-024. 35. Using the plastic pipette tip ²provided with²the Lonza T-cell kit, transfer a small amount of T-cell media to the glass ²cuvette then transfer ²the entire contents of the cuvette to the 15m1 conical containing 6m1s of T-²cell media. 36 ²Repeat steps 29 ¨ 34 for your second 15m1 conical containing cells, proceed to ²step 37.²31²<DP=32>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²37. Using the plastic pipette tip provided with the Lonza T-cell kit, transfer ²a small amount of ²non T-cell media to the glass cuvette then transfer the entire contents of the ²cuvette to the ²15m1 conical containing 6m1s of non T-cell media.² Plate Down²MEF / Primate ESC condition²38. Remove the MEF media from each of the wells. 39. Rinse each well with lml ²of sterile ²PBS. 40. Transfer the entire contents of the 15m1 conical from step 35 to the ²top 3 wells by ²adding 2m1s to each well. 41. Add Sul of Dynabeads Human T-activator CD3 / CD28 ²to each².. well. 42. Transfer the entire contents of the 15m1 conical from step 37 to ²the bottom 3 wells²by adding 2m1s to each well. 43. Place the plate in a 37 C incubator.²L-521 / E7 Condition²44. Aspirate the L-521 from each well. 45. Transfer the entire contents of the ²15m1 conical²from step 5.35 to the top 3 wells by adding 2m1s to each well. 46. Add Sul of ²Dynabeads²Human T-activator CD3 / CD28 to each well. 47. Transfer the entire contents of ²the 15m1 ²conical from step 37 to the bottom 3 wells by adding 2m1s to each well. 48. ²Place the plate in ²a 37 C incubator.² Day 2²49. On day 2 post nucleofection, add 2m1s of the appropriate reprogramming ²media (Primate ²ESC + bFGF or E7) to each well. DO NOT ASPIRATE ANYTHING FROM THE ²WELLS.² Day 4-25+²50. Beginning on day 4, gently aspirate the media from each well and add 2m1s ²fresh ²reprogramming media to each well. This will be done every other day.²Day 25+²51. Using a pulled glass pipette, isolate individual colonies and transfer ²single colonies into 1²well of 12-well dish containing the appropriate substrate.²Example 7²32²<DP=33>²CA 03025678 2018-11-26²WO 2017 / 219000 PCT / US2017 / 038041²A variety of quality control assays can be performed to confirm proper ²generation of ²pluripotent stem cells. Examples of such tests exemplifying desirable ²characteristics of pSC ²generation are presented in Table 1.² Table 1. iPSC QC Assays ²Test Assay / Kit Result²Mycoplasma Testing MycoAlert - Lonza Negative²Alkaline Phosphatase (AP) Alkaline Positive²Staining Phosphatase²Staining Kit II -²Stemgent²Immunocytochemistry ICC Staining Positive²(ICC) for Pluripotency²Markers - Oct, SSEA4,²Nanog, Tra-1-60, Tra-1-81²Endogenous pluripotency qPCR Positive gene expression²genes turned on - OCT4,²50X2, LIN28, KLF4, L-²myc²Lack of exogenous gene qPCR Negative gene expression²presence²G-Band Karyotype N / A Normal Human Karyotype²Illumina gene-chip Pluritest Pluripotency score >20, Novelty ²score <1.6²expression and²bioinformatics assay²EB Formation and Tri- TaqMan_hPSC Positive for Endoderm, Ectoderm and²lineage gene expression Scorecard ¨ Life Mesoderm²Technologies²33²<DP=34>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Short tandem repeat (STR) Cell Check 9 - Genetic profile of the sample ²matches²profile and interspecies IDEXX identically to the parental ²genetic profile.²contamination testing Samples are confirmed to be of ²human origin²and no mammalian interspecies ²contamination is detected.²T-Cell Clonality Assay TCRB + TCRG T- ² Presence (T-cell) of lack of clonal TCR beta²(for whole blood derived Cell Clonality gene rearrangements (non T-cell)²iPSC lines) Assay TM Gel²Detection -²Invivoscribe²Example 8²Alkaline Phosphatase Staining²For characterization of BC-iPSCs, Alkaline Phosphatase staining can be ²performed²using the Alkaline Phosphatase Staining Kit II (Stemgent, Cat no. 00-0055) ²according to the ²manufacturer's instructions.²Example 9² Immunohisto / cytochemistry²For further characterization of BC-iPSCs, BC-iPSCs or differentiated cells can ²be ²plated on glass coverslips or optical-bottom 96-well plates (Thermo, # 165305) ²and ²subsequently fixed in 4% paraformaldehyde. Intestinal organoids can be fixed ²in 4% ²paraformaldehyde, transferred to 30% sucrose, embedded in HistoPrep (Thermo ²Fisher²Scientific) and cut into 20 p.m sections. All cells are blocked in 510% goat ²or donkey serum²with 0.1% Triton X-100 and incubated with primary antibodies either for either ²3hrs at room ²temperature or overnight at 4 C. Cells are then rinsed and incubated in ²species-specific ²AF488 or AF594-conjugated secondary antibodies followed by Hoechst 33258 (0.5 ²g / m1; ²Sigma) to counterstain nuclei.²Antibodies suitable for immunocytochemistry and immunoblotting include: (as ²listed²by antigen, dilution, catalog no., isotype, and manufacturer) SSEA4, 1:250, ² MAB4304,²mIgG3, Millipore; TRA-1-60, 1:250, 09-0010, IgM, Stemgent; TRA-1-81, 1:250,09-²0011,²34²<DP=35>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²mIgM, Stemgent; OCT4, 1:250, 09-0023, Rabbit IgG, Stemgent; NANOG, 1:250, 09-²0020, ²Rabbit IgG, Stemgent; SOX2,1:500, AB5603, Rabbit IgG, Millipore; Tull (133-²tubulin), ²1:1000, T8535, mIgG2b, Sigma; CDX2, 1:500, NBP1-40553, IgG, Novus; FABP2, ²1:500, ²AF3078, IgG, R & D systems; Collagen Type 1, 1:500, 600-401-103-0.1, Rabbit ²Rockland;² CD73, 1:500, 550257, mIgGl, BD Pharmingen; NKX6.1, 1:100 F55A10, mIgGl, DSHB²Iowa; HB9, 1:25, 81.5C10, mIgGl, DSHB Iowa; ISELT1, 1:250, AF1837, Goat IgG, R ²& ²D systems; 5MI32, 1:1000, SMI-32R, mIgGl, Covance; CHAT, 1:250, AB144P, Goat ²IgG, ²Millipore; SMN, 1:250, 610647, mIgGl, BD Biosciences; Cox-IV, 1:1000, 4850s, ²Rabbit ²Cell signaling; GAPDH, 1:1000, ab9484, mIgG2b, Abcam.² Example 10²Flow Cytome try²Additional characterization of can include flow cytometry. Specifically, BC-²iPSCs ²are dissociated into a single cell suspension using Accutase (Millipore, ²#SCR005). Surface² staining of IPSCs is carried out using SSEA4 (R&D Systems, FAB1435A).²Cells were then fixed, permeabilized and stained intracellularly for 0ct3 / 4 ²(BD ²Pharmingen, 560186). Recommended isotypes are used according to the antibodies ²²recommendation (R&D Systems, FABIC007 and BD Pharmingen, 562547). All samples ²re ²analyzed using a BD LSRFortessa flow cytometer using BD FACSDiva software. All ²images²are generated using FloJo software.²Example 11²Karyotype²Karyotyping can also be performed as follows. Human BC-iPSCs are incubated in²Colcemid (100 ng / mL; Life Technologies) for 30 minutes at 37 C and dissociated ²using²TrypLE for 10 minutes. They can be washed in phosphate buffered saline (PBS) ²and ²incubated at 37 C in 5mL hypotonic solution (1g KC1, lg Na Citrate in 400mL ²water) for 30 ²minutes. The cells can be centrifuged for 2.5 minutes at 1500 RPM and ²resuspended in ²fixative (methanol: acetic acid, 3:1) at room temperature for 5 minutes. This ²is repeated²twice, and finally cells were resuspended in 500 11.1 of fixative solution and ²submitted to the²Cedars-Sinai Clinical Cytogenetics Core for G-Band karyotyping.²Example 12²<DP=36>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²PluriTest²Pluritest provides a robust measurement of pluripotency. Total RNA can be ²isolated ²using the RNeasy Mini Kit (Qiagen) and subsequently run on a Human HT-12 v4 ²Expression ²BeadChip Kit (I1lumina). The raw data file (idat file) was subsequently ²uploaded onto the² Pluritest widget online (www.pluritest.org).²Example 13²Quantitative RT-PCR²Total RNA was isolated using the RNeasy Mini Kit (Qiagen), and 1 ug of RNA was²used to make cDNA using the transcription system (Promega). qRT-PCR was ²performed ²using specific primer sequences (Table 2) under standard conditions. "CDS" ²indicates that ²primers designed for the coding sequence measured expression of the total ²endogenous gene ²expression only, whereas "Pla" indicates that primers designed for the plasmid ²transgene ²expression only. Data are represented as mean SEM² Table 2. caT-PCR Primer Sequences ²Gene Name Forward Primer Reverse Primer²OCT3 / 4 CDS ccccagggccccattttggtacc acctcagtttgaatgcatgggagagc²(SEQ ID NO: 1) (SEQ ID NO: 2)²OCT3 / 4 Pla cattcaaactgaggtaaggg tagcgtaaaaggagcaacatag²(SEQ ID NO: 3) (SEQ ID NO: 4)²50X2 CDS ttcacatgtcccagcactaccaga tcacatgtgtgagaggggcagtgtgc²(SEQ ID NO: 5) (SEQ ID NO: 6)²50X2 Pla ttcacatgtcccagcactaccaga tttgtttgacaggagcgacaat²(SEQ ID NO: 7) (SEQ ID NO: 8)²KLF4 CDS acccatccttcctgcccgatcaga ttggtaatggageggegggacttg²(SEQ ID NO: 9) (SEQ ID NO: 10)²KLF4 Pla ccacctcgccttacacatgaaga tagcgtaaaaggagcaacatag²(SEQ ID NO: 11) (SEQ ID NO: 12)²LMYC CDS gcgaacccaagacccaggcctgctcc cagggggtctgctcgcaccgtgatg²(SEQ ID NO: 13) (SEQ ID NO: 14)²LMYC Pla ggctgagaagaggatggctac tttgtttgacaggagcgacaat²36²<DP=37>²LE² (917 :ON CR OHS) (St :ON CR oas)²ugglolgeounESSugnomoSSI aeuEEToEouoaalanuoEloEmE &Dv'²(tt :ON CR oas) (Et :omciii oas)²geoolonogeonowooESbEE EugeoEwEETE0000agegao IXSIN²(Zt :ON CR oas) (It :ON CR oas)²nomuuuomoou0000u0 wooguguolaBoomou00 ICENVH²(Ot :ON CR oas) (6E :ON CR OHS)² EwEElooSSIooElommo aeoloomoolooloomE I 'ANON²(S :ON CR oas) (LE :ON CR oas)²uognageElooEmege ElaeuES'ouSSoulonool HOCLE²(9 :ON CR OHS) (S :ON CR oas)²mslogngl000uomool aeowooEwoolgeouom HC1c1V9²(t :ON CR oas) (EE :ON CR oas)²oaeuElEuTESSuEouoon anougegenETESSEENdUO²(a :ON CR oas) (ii: :ON CET oas)²uuoluggisossuogual wu0uguss001u010010 I TIZEI²(0 :ON CR oas) (6Z :ON CR OHS)² EgeplEgalageogal ugeEnomEaeaeuEEIT I cITAII²(SZ :ON CR oas) (LZ :ON CR oas)²alounuuSSEuEonuESSulE ugeuElagegeugeugeugewo Z VNEEH²(9Z :ON CR OHS) (SZ :ON CR oas)²nEouS'EnanoEmooE augewougnooESSuolu IVNEEH²(tZ :ON CR oas) (Ez :ON CR oas)²gumoloou000010g10101 TEITEmEwoololEpEl 'NM²(ZZ :ON CR oas) (IZ :ON CR oas)² EmelETEloloaagan ugmEgegeugageS'Eloo VI1c111²(OZ :ON CR oas) (61 :ON CR OHS)² EuluanogageuumEogel oEoolEwoloogeTEETuluoogeId 8ZNI1²(SI :ON CR oas) (LI :ON CR oas)²EgelESSuogeESSoolooETEloweol oEoolEluoloogeTEETwooge SCD 8ZNI1²(91 :ON CR OHS) (SI :ON CR oas)²It080 / LIOZSI1IIDcl ²0006IZ / LIOZ OM²9Z-TT-810Z 8L9SZOE0 VD²<DP=38>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041² SMN PCR-RFLP ctatcatgctggctgcct ctacaacacccttctcacag²(SEQ ID NO: 47) (SEQ ID NO: 48)²Example 14²Cytogenetic stability of PBMC vs. fibroblast-derived iPSC lines² Table 3A. Cytogenetic Stability of PBMCs ²BC-iPSCs²Description Numbers % abnormal²Total iPSC lines 90 3.3%²Total abnormal 3²*Total with non-clonal aberration 3 3.3%²Table 3B. Cytogenetic Stability of PBMCs ²Fibroblast-iPSCs²Description Numbers % abnormal²Total iPSC lines 242 25.6%²Total abnormal 62²*Total with non-clonal aberration 17 7.0%² Example 15²Cytogenetic stability of PBMC vs. fibroblast-derived iPSC lines array CGH²Table 4A. Cytogenetic Stability of PBMCs ²BC-iPSCs²Description Numbers²Total iPSC lines 7²De Novo* amp / dels 4²Average De Novo amp / dels 0.6²38²<DP=39>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²De Novo amp / dels per passage 0.036²Table 4B. Cytogenetic Stability of PBMCs ²Fibroblast-iPSCs²Description Numbers²Total iPSC lines 6²De Novo amp / dels 19²Average De Novo amp / dels 3.2²De Novo* amp / dels per passage 0.136²* De Novo or deletions are those newly acquired amplifications or deletions ²during²reprogramming and / or expansion of the respective iPSC lines when compared to ²the parent² donor tissue aCGH profile²A variety of results demonstrating superior properties of BC-iPSCs are shown, ²including specific cell lines. High Success rate of peripheral blood ²mononuclear cell ²(PBMC)-based episomal reprogramming on MEFs is shown in Table 5. Frequency of²different types of karyotype abnormalities at individual; chromosomal level ²observed by G-²band karyotyping in fibroblast-derived iPSCs. Rearr. ¨ Rearrangement; Inv. ¨ ²Inversion; Der. ²¨ derivatives is shown in Table 6. Success rate of blood-based reprogramming ²on human ²recombinant laminin 521 in defined E7 reprogramming media is shown in Table 7. ²Lack of ²success of blood-based episomal reprogramming on Matrigel substrate and ²defined E7²reprogramming media is shown in Table 8.²39²<DP=40>²Table 5: High Success rate of peripheral blood mononuclear cell (PBMC)-based ²episomal reprogramming on MEFs. ²NT - ² 0²Stmggecrell Plasmi T - ²EffiTienc Success 1.?1,,Ia-1 Pi5ke EffiVenc SurcaTgss t..)²Line Condition Fresh / Frozen d Total Piked ² ,-,²-4²MEFeRES ² t..)²,-,²02iCTR ² Fresh 3.00E+06 4P 22 22 7.33E-04 1 3 3 1.00E-²06 1 o²o²o²o²MEFeRES²03iCTR ² Fresh 3.00E+06 4P 9 9 3.00E-04 1 8 8 2.67E-06 ²1²MEFeRES reserve ² 0.00E+0²03iCTR ² 5.00E+06 4P 5 5 1.00E-04 1 0 0 0 0²14isALS-²MEFeRES Cryopideserve²5.00E+06 5P 21 21 4.20E-04 1 2 2 4.00E-07 1²MEFeRES reserve ² 0.00E+0²80iCTR- #2 5.00E+06 5P 10 10 ²2.00E-04 1 0 0 0 0 P². ²MEFeRES Cryopideserve ²-² N)51iALS- 5.00E+06 5P 12 8 2.40E-04 1 2 2 4.00E-07 1².6. ² ,²o .3²MEVES Cryoprdeserve ² N)0²89iALS- ²5.00E+06 5P 15 15 3.00E-04 1 14 14 2.80E-06 1 ,².3 ², ², ²,²MEFeRES Cryoph-eserve ² 0.00E+0 "I²138iALS- 5.00E+06 5P 5 5 1.00E-²04 1 0 0 0 0 .²MEFeRES reserve ² 0.00E+0²152iALS ² 5.00E+06 5P 7 7 1.40E-04 1 0 0 0 0²07iASD²MEFeRES Cryopideserve² 5.00E+06 5P 18 18 3.60E-04 1 12 12 2.40E-06 1²55dAS4v MEFeRES Cryopideserve²5.00E+06 5P 9 8 1.80E-04 1 15 13 ²3.00E-06 1 1-d²n²1-i²MEVES Cryoprdeserve²134iALS-C9 5.00E+06 5P 8 8 ²1.60E-04 1 12 12 2.40E-06 1²cp²t..)²o²MEFeRES Cryopideserve ² ,-,²-4²58iALS-C9 ² 5.00E+06 5P 4 4 8.00E-05 1 2 2 4.00E-07 1 ²o²(...)²cio²o².6.²,-,²<DP=41>² MEFe / PES Cryopid-eserve 0.00E+0²37iALS-C9 5.00E+06 5P 0 0 0 0 NP NP²0²MEFe / PES Cryopid-eserve 0.00E+0 ² t..)²o²79iCTR 5.00E+06 5P 0 0 0 ² 0 NP NP²-4²t..)²MEFe / PES Cryopyserve ² ,-,²,z²98iALS- 5.00E+06 5P 6 6 1.20E-04 1 3 3 ²6.00E-07 1²o²o²MEVES Cryoprdeserve²7001CTR- 5.00E+06 5P 12 12 2.40E-04 1 ² 9 9 1.80E-06 1²MEVES Cryopyserve²0121ASD 5.00E+06 5P 12 12 2.40E-04 1 1 1 2.00E-07 1²MEVES Cryopyserve²776iCLN6 5.00E+06 5P 12 12 2.40E-04 1 ² 5 5 1.00E-06 1²MEVES Cryopyserve²0131CTR 5.00E+06 5P NP NP ² 12 12 2.40E-06 1 p².².²MEVES Cryopyserve ² '².6. 7701CLN6 5.00E+06 5P 12 12 2.40E-04 1 ² 12 12 2.40E-06 1 .²,²,-, ² .3²"²MEVES Cryopyserve ² 0²,²0131CTR 5.00E+06 5P NP NP ² 12 12 2.40E-06 1 .3², ², ², ²,²MEVES Cryopyserve ² "²XH7iCTR 5.00E+06 5P NP NP ² 12 12 2.40E-06 1²MEVES Cryoprdeserve²WP3iCTR 5.00E+06 5P NP NP ² 12 12 2.40E-06 1²MEVES Cryopyserve²FP5iCTR 5.00E+06 5P NP NP ² 1 1 2.00E-07 1²7021GAN²MEVES Cryopyserve ² 1-d²5.00E+06 5P NP NP ² 12 12 2.40E-06 1 n²1-i²1161FNDI- MEVES Cryoprdeserve²nxx 5.00E+06 5P NP NP ² 12 12 2.40E-06 1 cp²t..)²o²,-,²3611GAN- MEVES Cryoprdeserve ² -4²nxx 5.00E+06 5P NP NP ² 6 6 1.20E-06 1²(...)²cio²o².6.²,-,²<DP=42>²012iGAN- MEFeRES Cryoprdeserve²nxx 5.00E+06 ²5P NP NP 6 6 1.20E-06 1²0²2EVPiALS- MEFeRES Cryopreserve ² t..)²o²nxx d ²5.00E+06 5P NP NP 6 6 1.20E-06 1²-4²7YXLiALS- ² t..)²,-,²nxx MEFs / PESC Cryopr,eserve ²5.00E+06 5P NP NP 4 4 8.00E-07 1 ,.tD²o ²9XXZiALS- ²o²nxx MEFs / PESC Cryopr,eserve ²5.00E+06 5P NP NP 2 2 4.00E-07 1²6MBUiALS-²nxx MEFs / PESC Cryopr,eserve ²5.00E+06 5P NP NP 6 6 1.20E-06 1²5XVDiALS-²nxx MEFs / PESC Cryopr,eserve ²5.00E+06 5P NP NP 6 6 1.20E-06 1²7MTEALS-²nxx MEFs / PESC Cryopr,eserve ²5.00E+06 5P NP NP 6 6 1.20E-06 1²OJGZiALS-²nxx MEFs / PESC Cryopr,eserve ²5.00E+06 5P NP NP 6 5 1.20E-06 1²9ZZ5iALS- MEFs / PESC Cryopr,eserve 5.00E+06 5P NP NP ² 6 6 1.20E-06 1 P²7AF6iALS- MEFs / PESC Cryopr,eserve 5.00E+06 5P NP NP ² 9 7 1.80E-06 1 2².6. 2UNGiALS- ² ,².3²t..)²nxx MEFs / PESC Cryopi;eserve ²5.00E+06 5P NP NP 6 6 1.20E-06 1 ,,².²1DGFiALS- ² ,².3²nxx MEFs / PESC Cryopr,eserve ²5.00E+06 5P NP NP 7 7 1.40E-06 1²,²9GXDiALS- ² r:,²nxx MEFs / PESC Cryopr,eserve ²5.00E+06 5P NP NP 6 6 1.20E-06 1 .²2FN3iALS-²nxx MEFs / PESC Cryopr,eserve ²5.00E+06 5P NP NP 6 6 1.20E-06 1²6PYDiALS-²nxx MEFs / PESC Cryopr,eserve ²5.00E+06 5P NP NP 6 6 1.20E-06 1²Average 2.20E-²04 90.00% 1.40E-04 90.24% 1-d²n²1-i²NP: Not performed²cp²T: T cell reprogramming method ² t..)²o²,-,²NT: non-T cell reprogramming method ² -4²o²4P / 5P: reprogramming factors on 4 or 5 plasmids ² c,.)²cio²o².6.²,-,²<DP=43>²Table 6 - Frequency of different types of karyotype abnormalitie ²0²% Abnormalities ² Rank t..)²o²,..,²Chromosome Total Gain Loss Rearr. Inv. Der. ² Total Gain Loss Rearr. -4²t..)²,..,²chrl 11.8% 15.8% 0.0% 13.9% 0.0% ²0.0% 2 2 8 1 o²o²o ²o²chr2 0.0% 0.0% 0.0% 0.0% 0.0% ²0.0% 21 13 8 16²chr3 4.9% 5.3% 7.7% 2.8% 0.0% ²0.0% 9 6 3 11²chr4 2.1% 0.0% 0.0% 8.3% 0.0% ²0.0% 12 13 8 4²chr5 0.0% 0.0% 0.0% 0.0% 0.0% ²0.0% 21 13 8 16²chr6 6.9% 10.5% 0.0% 5.6% 0.0% ²0.0% 6 4 8 7²chr7 0.0% 0.0% 0.0% 0.0% 0.0% ²0.0% 21 13 8 16 P²chr8 4.2% 5.3% 0.0% 5.6% 0.0% ²0.0% 10 6 8 7 " .6. ,²(...) ² .²chr9 2.1% 0.0% 0.0% 8.3% 0.0% ²0.0% 12 13 8 4 IV²0 ²F'²00²chrl 0 0.7% 0.0% 0.0% 2.8% 0.0% ²0.0% 19 13 8 11 ,A1²,²,²IV²chrl 1 6.9% 13.2% 0.0% 0.0% 0.0% ²0.0% 6 3 8 16 .²chr12 11.1% 21.1% 0.0% 0.0% 0.0% ²0.0% 3 1 8 16²chr13 13.2% 7.9% 7.7% 13.9% 100.0% ²100.0% 1 5 3 1²chr14 5.6% 5.3% 0.0% 11.1% 0.0% ²0.0% 8 6 8 3²chr15 3.5% 2.6% 7.7% 2.8% 0.0% ²0.0% 11 11 3 11 1-d²n²chr16 1.4% 2.6% 0.0% 0.0% 0.0% ²0.0% 15 11 8 16²chr17 1.4% 0.0% 7.7% 0.0% 0.0% ²0.0% 15 13 3 16 cp²t..)²o²,-,²chr18 1.4% 0.0% 7.7% 0.0% 0.0% ²0.0% 15 13 3 16 -4²o²(...) ²cio²chr19 1.4% 0.0% 0.0% 5.6% 0.0% ²0.0% 15 13 8 7 =².6.²,-,²Page 43 of 75²<DP=44>²lD²-²I I 1 9 17 %O. %O= 0 %8*Z ²%5=8 %E=c %17.0 I X-RI ²II 8 1 61 %0 0 %O= 0 %8= Z ²%00 %0 0 %L .0 ZZ-19²9 c %0 .0 %O= 0 %9=S %I ²*CC %CS % = 8 Z-HP²17 8 I Z I %0 0 %CYO %= 8 ²%0.0 %CYO %I =Z 0Z-140²<DP=45>²Table 7 - Success rate of blood-based reprogramming on human recombinant ²laminin 521 ²0 ²t..)²o²,-,²-4²MEFelPES ² 1.00E- ,-,²t..)²021CTR ² Fresh 3.00E+06 4P 22 22 7.33E-04 1 3 3 06 1 o²o²o²o²3.33E-² 021CTR L521 / E7 Fresh 3.00E+06 4P 3 3 1.00E-04 1 1 1 05 1² Cryopreserve 6.80E-²031CTR L521 / E7 d ²5.00E+06 5P 19 12 3.80E-04 1 34 12 04 1² Cryopreserve 0.00E+0²14isALS- L521 / E7 d 5.00E+06 4P 0 0 ²0.00E+00 0 0 0 0 0² Cryopreserve 0.00E+0²801CTR- L521 / E7 d ²5.00E+06 5P 4 4 8.00E-05 1 0 0 0 0 P².²80i R- Cryopreserve ² 0.00E+0 ².²L521 / E7 d 5.00E+06 5P NP NP NP ²0 0 0 0².6. ² ,²u, ² .3² Cryopreserve 0.00E+0²c,²89iALS- L521 / E7 d ²5.00E+06 5P 49 15 9.80E-04 1 0 0 0 0 ,².3 ², ², ²,²' Cryopreserve 0.00E+0 ² ,,²1381ALS- L521 / E7 d 5.00E+06 4P 0 0 ²0.00E+00 0 0 0 0 0 .² Cryopreserve 2.04E-²071CTR- L521 / E7 d ²5.00E+06 5P 49 16 9.80E-04 1 102 18 03 1² Cryopreserve 2.00E-²1791CTR- L521 / E7 d ²5.00E+06 5P NP NP NP 1 1 05 1² Cryopreserve 8.00E-²2011CTR- L521 / E7 d 5.00E+06 5P 6 6 ²1.20E-04 1 4 4 05 1 Iv²n ²1-i² Cryopreserve 8.00E-²2021CTR- L521 / E7 d 5.00E+06 5P 0 0 ²0.00E+00 0 4 4 05 1 cp²t..)²o²eserve r ² ,-,²-4²2061CTR L521 / E7 Cryop d 5.00E+06 5P 5 5 ² 1.00E-04 1 NP NP NP o²(...)²cio²166isALS L521 / E7 Cryopreserve 5.00E+06 5P 5 5 ² 1.00E-04 1 NP NP NP².6.²,-,²<DP=46>²ci ²_______________________________________________________________________________²________________________________ ²Cryopreserve ² 7.20E-²276iCTR L521 / E7d 5.00E+06 5P 12 12 2.40E-04 1 ² 36 12 04 1²6PYDiAL Cryopreserve ² 1.20E-²S-nxx L521 / E7 d. 5.00E+06 5P NP NP NP ² 6 6 04 1²2.90E-²Average 2.57E-²04 75.00% 04 61.54% ²NP: Not performed²T: T cell reprogramming method²NT: non-T cell reprogramming method²4P / 5P: reprogramming factors on 4 or 5 plasmids² 1-d²<DP=47>²Table 8 ¨ Relative lack of success of blood-based episomal reprogramming on ²Matrigel substrate ²0²CS02iCT My&CL ² 0.00E+0² Fresh 3.00E+06 4p 0 0 0.00E+00 0 0 0 0 0²CS03iCT ² 0.00E+0² MG / E7 Frozen 5.00E+06 4p 0 0 0.00E+00 0 0 0 0 0²6PYyiAL 2[MG] / E ² 0.00E+0²Frozen 5.00E+06 5p NP NP ² 0 0 0 0²Average 2.57E-04 ²75.00% 2.90E-²04 ² 61.54%²NP: Not performed²T: T cell reprogramming method² NT: non-T cell reprogramming method²4P / 5P: reprogramming factors on 4 or 5 plasmids²1-d²<DP=48>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Example 16²PBMCs isolatedfrom a blood draw are reliably reprogrammed to iPSCs²Dermal fibroblasts obtained from a skin biopsy have been the most common ²source of²iPSC reprogramming material, due largely to their inexpensive and relatively ²easy usage.²However, compared to a blood draw, a skin punch biopsy can be between the size ²of 3-4 mm²and is often a painful procedure that requires local anesthetics. Compared to ²skin biopsy-²derived fibroblasts, blood is a more accessible source of patient tissue ²during hospital visits ²and, therefore, a preferred choice of source tissue for iPSC reprogramming by ²both patients ²and clinicians. Various human blood reprogramming methods have been reported ²with mixed²efficiencies, including CD34+ cells mobilized from peripheral blood (ref). ²Unless isolated²from cord blood, CD34+ cells are usually isolated from the peripheral blood or ²bone marrow ²of patients undergoing G-CSF mobilization for several days. In order to ²generate sufficient ²cell numbers for reprogramming, isolated CD34+ progenitor cells need to be ²enriched and ²expanded in culture with complex and expensive protocols. The Inventors were ²successful in²reprogramming PBMCs that were freshly isolated from a peripheral blood draw ²without prior²cell expansion or CD34+ cell isolation using episomal reprogramming plasmids. ²Such an ²approach provides the fastest and most cost effective procedure for obtaining ²a patient's ²reprogrammed iPSCs from the time of collecting a patient bio-specimen to ²generating their ²rigorously characterized iPSCs.² Reprogramming large cohorts of PBMCs from multiple subjects simultaneously as²well as iPSC line generation at a much later date after a patient blood draw ²that allows for ²iPSC "future-proofing", requires a PBMC cryopreservation step to recover ²viable cells ²reliably. Additionally, this process is flexible because selective cohorts of ²well cryopreserved ²PBMCs from representative patients could be converted to iPSCs when greater ²patient²genotype-phenotype information is available. However, when cryopreserved PBMCs ²from ²multiple individuals were reprogrammed to iPSCs with episomal plasmids ²expressing ²POU5F1, SOX2, KLF4, LIN28, L-MYC, p53 shRNA, the Inventors observed ²significant ²variability in isolating identifiable iPSC clones even after 35-40 days, ²regardless of PBMC ²cell type, ECM substrata and media). The T reprogramming method was successful ²with only²33% of PBMC samples, while the non-T method on cryopreserved PBMCs did not ²result in²any clonal iPSC lines (data not shown).²Critically, the reliability of PBMC reprogramming in the Inventors' hands was ²improved significantly when the Inventors utilized, (a) two additional ²episomal plasmids²48²<DP=49>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²containing SV40 large T antigen (SV4OLT) and EBNA-1 in specific stoichiometry ²to ²minimize PBMC cell death and sustain reprogramming factor plasmid expression ²and (b) a ²defined reprogramming media to promote high surface attachment of the ²nucleofected ²PBMCs (Fig. 8A). This novel protocol resulted in successful and efficient ²generation of²multiple adherent PBMC-iPSC clones that could be mechanically isolated and ²scaled up for²expansion after 25-35 days post-nucleofection (Fig. 8A). Importantly, the ²success rate in ²reprogramming multiple individual cryopreserved PBMCs from unaffected controls ²or ²diseased patients' was 90% for the T cell method and 83% for the non-T cell ²method (Table ²5) on mouse embryonic fibroblast feeders (MEFs). Given the limitations imposed ²by T cell-²iPSCs and the low efficiencies for PBMC-derived non-T cell reprogramming, this ²method ²resulted in reliable reprogramming of non-T cell derived BC-iPSCs.²The Inventors next tested whether this new protocol was also amenable when ²using ²reprogramming methods that are more clinically compatible. Use of recombinant ²human ²laminin 521 substrate and chemically defined reprogramming media resulted in ²successful²PBMC-reprogramming, albeit at a slightly lower success rate at 75% and 58%, ²respectively.²The average reprogramming efficiency for T-cell and non-T cell method was 2.2 ²x 104 % and ²1.6 x 10-6 %, respectively (Table 5). All the PBMC-iPSC lines exhibited ²typical PSC ²characteristics, including tightly packed colonies, high cell nuclear-²cytoplasmic ratio, robust ²alkaline phosphatase activity, and expression of pluripotency antigens (Fig. ²8B). The BC-²iPSCs passed pluripotency quality control metrics determined by the PluriTest ²assay,²demonstrating that the PBMC-iPSC transcription profile was analogous to well ²established ²hESCs and fib-iPSCs, but not differentiated fibroblasts and neural progenitor ²cells (Fig. 8C). ²BC-iPSCs maintained a normal G-band karyotype (Fig. 8D) and were confirmed to ²be clonal ²derivatives of either T cells or non-T cells from the PBMCs using the T cell ²receptor (TCR)-(3²and ¨y, gene rearrangement / clonality assays (Fig. 8E). The trilineage ²potential of BC-iPSCs²was demonstrated by spontaneous embryoid body formation and by measuring germ-²layer ²specific gene expression profile by the TaqMan Scorecard assay (Fig. 8F). The ²"footprint-²free" status of BC-iPSCs was confirmed by demonstration of endogenous ²pluripotency gene ²expression and absence of exogenous reprogramming transgenes using RT-qPCR ²(Fig. 11A).²The EBNA plasmid-related latency element was eventually eliminated from the ²established²BC-iPSCs (Fig. 11B).²49²<DP=50>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Example 17²BC-iPSCs have equivalent neuronal differentiation compared to fib-iPSCs²It has been reported that iPSCs, regardless of the source tissue, ultimately ²lose most of their²gene expression and epigenetic profiles related to the original cell source. ²However, it²remains unclear whether blood-derived iPSCs can differentiate as efficiently ²as fibroblast-²derived iPSCs into other various cell types, possibly due to a stronger ²retention of epigenetic ²memory in blood-sourced iPSCs. The Inventors addressed this by directing blood ²or ²fibroblast-derived iPSCs, both of mesodermal origin, to a different germ layer ²such as ²ectoderm. Specifically, the Inventors performed neural ectoderm ²differentiation from large²numbers of fibroblast (n=26) and PBMC lines (n=8), from both healthy ²volunteers as well as²diseased patients. Based on immunocytochemistry for neural ectoderm markers of ²TUBB3 ²(f33-tubulin) and NKX6.1 and subsequent cell counts, neuronal differentiation ²was shown to ²occur at a similar efficiency between fibroblast and BC-iPSCs (Fig. 8G), ²further ²demonstrating the utility of BC-iPSCs.² Example 18²BC-iPSCs maintain a significantly more stable karyotype compared to fib-iPSCs²Recurrent chromosomal abnormalities have been described previously for an ²abundant²number of hESC lines. A few reports have chronicled common chromosomal ²aberrations for²hiPSC lines, however, these did not methodically account for variability in ²source tissues,²reprogramming methods and cell culture methods. To the Inventors' knowledge, ²there have ²been no systematic studies describing cytogenetic analysis comparing frequency ²between ²iPSCs derived from fibroblast and blood. Over the past six years the Inventors ²performed ²routine cytogenetic analysis on iPSC lines derived from 104 unique fibroblast ²or PBMC².. donors, which includes 339 independent clonal iPSC lines. All fibroblast ²and blood-derived²iPSCs assessed were reprogrammed using the similar non-integrating episomal ²reprogramming and standard feeder-free matrigel / mTeSR cell culture methods.²Although fib-iPSCs and BC-iPSCs derived in the iPSC Core resemble each other ²with ²regard to their reprogramming methods, pluripotency and differentiation, an ²early observation²of striking differences in cytogenetic stability between the two source cell ²types prompted the²need for large-scale comparative analyses. Many laboratories and stem cell ²repositories ²perform routine quality control assays of cytogenetic changes in PSCs using G-²band ²karyotyping by obtaining cell metaphases and Giemsa staining of the ²chromosomes. This²<DP=51>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²method can readily identify small subpopulations of abnormal cells where ²reliable ²identification of 5% abnormal cells is readily achieved, thus allowing ²detection of mosaicism ²(>10%) and balanced translocations at low resolution (>5-10 Mb).²The Inventors performed karyotype analysis on 364 human iPSC cultures where²source fibroblasts and PBMCs were collected from multiple laboratories or ²public²repositories. The Inventors' data reveal remarkable differences in the ²incidence of ²chromosomal aberrations in fib-iPSCs and BC-iPSCs. Abnormal karyotypes with ²clonal ²aberrations were observed in 59 of 258 (22.9%) cultures from clonally ²independent human ²fib-iPSC lines, derived from 78 unique donors (Fig. 6). In stark contrast, ²only 4 in 106²(3.8%) cultures of clonal human PBMC-iPSC lines derived from 32 unique donors ²displayed²low-frequency abnormalities. It is evident from the ideograms, schematic ²representation of ²the chromosomes, that recurrent aberrations are represented in much greater ²degree in in fib-²iPSCs compared to the BC-iPSCs (Fig. 6). Indeed, this remarkable cytogenetic ²stability is ²unique to PBMCs, as iPSCs reprogrammed from other cell origins, including ²lymphoblastoid²cell lines (25%) and primary epithelial cells (27%) have similar high rates of ²karyotypes²aberrations (Fig 12).²The most frequent karyotypic abnormalities in fib-iPSCs were observed in ²chromosomes 13 (13.2%), 1 (11.8%), 12 (11.1%), and X (10.4%) (Table 6). To a ²lesser ²extent karyotype changes were also observed in chromosomes 21, 11, and 6, in ²descending²order of frequency. Of the aneuploidies, chromosomal gains (trisomy or ²duplications) were²most commonly observed in 12 (21.1%), 1 (15.8%), 11 (13.2%), and 6 (10.5%) and ²²chromosomal losses were repeatedly observed in chromosomes X (38.5%) and 21 ²(23.1%). ²Translocation rearrangements in chromosomes 1 and 13 (13.9%) and 14(11.1%) in ²fib-iPSCs ²were also observed. BC-iPSCs had one line each display chromosome gains in 14 ²(trisomy)²or 18 (duplication). The other two PBMC-iPSC lines had exhibited uncommon ²abnormalities:²a translocation 46,XY,t(7;14)(q34;q11.2) and a mosaic deletion ²46,X,del(X)(q22q26) in 19% ²of cells (Table 6).²Example 19²Fib- and BC-iPSCs karyotype distribution relates not to the donor age but ²rather to passage²number²The skin, unlike the blood, is routinely exposed to external environmental ²elements ²like potential sun damage and the fibroblasts derived from the biopsies ²require a certain level²51²<DP=52>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²of expansion prior to reprogramming, which is akin to further aging in ²culture. Given this, the ²Inventors posited that the donor age might be a contributing factor that ²impacts the ²cytogenetic instability of fib-iPSCs. However, with respect to the frequency ²of cytogenetic ²abnormalities in fib-iPSCs, the Inventors did not observe a significant trend ²or correlation²with the age of the donor (Fig. 9A). Indeed, based on G band karyotype ²analysis, the highest²percent of karyotype abnormalities (31.9%) was observed in the 21-40 age group ²fibroblast-²iPSCs.²Pluripotent stem cells have a highly proliferative nature. As such, the ²Inventors next ²attempted to analyze how the fib- and BC-iPSCs fared over time in cell culture ²and whether²increasing passage number led to a greater propensity for accumulating ²cytogenetic²aberrations. About 21.6% of fibroblast-derived iPSCs were observed to have ²abnormal ²karyotypes (> 1 / 20 cells with clonal aberrations) in their first G-band ²karyotype evaluation ²post-iPSC generation, which was typically between passages 4-23. In stark ²contrast, only ²2.8% of BC-iPSCs had abnormal karyotypes in their first assessment. Any iPSC ²line that was²determined to have an abnormal karyotype was no longer cultured or evaluated. ²Therefore,²between 2nd and 4th repeat karyotypes were only evaluated on iPSC lines that ²were initially ²identified as cytogenetically normal in their first karyotype. This analysis ²allowed us to ²determine whether fib-iPSCs have an inherent level of cytogenetic instability ²over BC-iPSCs ²upon continued time in culture and passaging even after being established as ²normal post-²iPSC generation (at their first G-band karyotype evaluation). G-band ²karyotyping showed²that a greater proportion of fib-iPSCs (27.8%) acquired abnormal karyotypes in ²culture upon ²repeat karyotyping when compared to the proportion at first karyotypes (P < ²0.001, two way ²ANOVA with Bonferroni posttest), while the percent abnormal karyotypes in BC-²iPSCs did ²not show any significant difference between first and repeat karyotypes (Fig. ²9B). Upon²analyzing the origin of the cytogenetic instability in fib-iPSCs, it appeared ²that the highest²rate of abnormal karyotypes (first or repeat) occur during passages 10 ¨ 23 in ²the life of the ²iPSC line (Fig. 9C-D), which is typically when the largest amount of iPSC ²expansion occurs ²for any given cell line. The iPSC expansion increases at passages 10 ¨ 23 ²largely due to ²characterization and cell banking coinciding around these passage numbers. ²Nevertheless,²this is a similar process for both fib- or BC-iPSCs, and yet the PBMC-derived ²cells do not²display an increased disposition towards abnormal karyotypes upon extended ²culture or ²expansion.²52²<DP=53>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Example 20²BC-iPSCs acquire less submicroscopic amplifications and deletions²G-band karyotype has the advantage that it can detect balanced translocations,²inversions, <20% culture mosaicism, chromosomal position of genomic gains or ²losses as²commonly observed in the fib-iPSC cultures (Fig. 6 and Table 5). However, ²since G-band²karyotype is unable to detect submicroscopic genomic abnormalities (<5Mb), the ²Inventors ²decided to conduct comparative genomic hybridization (aCGH) microarray on a ²subset of fib-²iPSC and PBMC-iPSC lines. While aCGH is unable to detect balanced ²translocations, ²inversions and < 20% culture mosaicism, it is a good supportive method to ²detect smaller size²genomic gains and losses, copy number variants (CNVs), duplications / deletions, ²and²unbalanced translocations in the iPSC lines. The Inventors analyzed and ²recorded any de ²novo amplifications or deletions acquired in the iPSCs upon comparison with ²the parental ²fibroblast or PBMC source bio-specimen. In this analysis only those ²amplifications and ²deletions acquired de novo in iPSCs were considered, when they were not normal ²CNVs²upon cross referencing against the Database of Genomic Variants (DGV) that ²contains ²genomic variations observed in healthy individuals.²Including iPSC lines with abnormal and normal G-band karyotypes, the average ²size of the ²amplification and deletions detected by aCGH were significantly greater in fib-²iPSC lines at ²44 Mb compared to 2.1 Mb in PBMC-iPSC lines (Fig. 10A), the preponderance of ²which was²due to fib-iPSC lines with an abnormal karyotype (Fig. 10B). Upon segregating ²the size²analysis comparison between iPSC lines with normal karyotypes, the de novo ²amps / dels were ²on average 2.31 Mb in fib-iPSCs and 2 Mb in PBMC-iPSC lines. Supporting this ²data, the ²average number of acquired de novo total amps / dels in fib-iPSCs (3.7) were at ²least two-fold ²greater than in BC-iPSCs (1.8). Even in iPSC lines that were determined to ²have normal G-²band karyotypes, the number of new amps / dels were greater in fib-iPSCs at 3.3 ²vs. BC-iPSCs²at 1.8. The most commonly acquired submicroscopic (0.8-1.5 Mb) de novo ²amplifications or ²deletions in fib- or PBMC-iPSC lines detected by aCGH was amplification of ²chromosome ²7q31.32 or deletion of chromosomes 10q15.2-q25.1, 16p11.2, 21p11.2-p11.1 (Fig. ²10E).²Here the Inventors report a new and more reliable method for reprogramming of ²the²non-T cell component of blood using episomal plasmids expressing pluripotency ²factors.²Using the described reprogramming protocol, one is able to consistently ²reprogram non-T ²cells with close to 100% success from non-T cell or non-B cell sources. ²Further advantages ²include use of a defined reprogramming media E7 and using defined clinically ²compatible²53²<DP=54>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²substrate recombinant human L-521. Blood cell-derived iPSCs ("BC-iPSCs") ²exhibited ²identical characteristics to fibroblastderived iPSCs ("fib-iPSCs"), retain ²genotype, exhibit a ²normal pluripotency profile, and readily differentiate into all three germ-²layer cell types. This ²method for reliably deriving iPSCs from patient blood samples paves the way ²for rapidly²generate new human iPSC lines, including patient-specific lines, thus ²providing an enormous²bioresource for disease modeling, drug discovery, and regenerative medicine ²applications.²Example 21²Additional Characterization Studies² G-Band Karyotype. Human iPSCs were incubated in Colcemid (100 ng / mL; Life²Technologies) for 30 minutes at 37 C and then dissociated using TrypLE for 10 ²minutes. ²They were then washed in phosphate buffered saline (PBS) and incubated at 37 C ²in 5mL ²hypotonic solution (1g KC1, lg Na Citrate in 400mL water) for 30 minutes. The ²cells were ²centrifuged for 2.5 minutes at 1500 RPM and resuspended in fixative (methanol: ²acetic acid,²3:1) at room temperature for 5 minutes. This was repeated twice, and finally ²cells were²resuspended in 500 pi of fixative solution and submitted to the Cedars-Sinai ²Clinical ²Cytogenetics Core for G-Band karyotyping. Analysis includes examination of ²chromosomes ²in a minimum of 20 cells per culture. Only abnormalities that met the ISCN ²2013 definition ²of clonality were included in this manuscript dataset4. All normal and ²abnormal karyotypes²were transcribed into a table format. The chromosomal ideograms were then ²generated by ²importing the table into R Bioconductor (programming language) using the ²IdeoViz package ²that plots data associated with arbitrary genomic intervals along chromosomal ²ideogram. This ²Package is available on the open source Bioconductor website. To accurately ²reflect the ²frequency of chromosomal rearrangement, the bar widths for each ideogram were ²scaled in²proportion to the number of samples examined. As such, the bars displaying ²abnormalities²found in PBMC-iPSC lines are 2.16 times the width of bars depicting ²abnormalities found in ²fib-iPSC lines to account for the fibroblast ideogram portraying the number of ²abnormalities ²found in a sample set that was 2.16 times larger than the PBMC set. The ²letters above the ²chromosomal translocation (navy blue bars) category are matched such that they ²correspond²between the chromosomal locations to where the translocation abnormality ²occurred.²Copy Number Variations with Array Comparative Genomic Hybridization (aCGH).²Array CGH is a high-resolution karyotype analysis solution for the detection ²of unbalanced²54²<DP=55>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²structural and numerical chromosomal alterations with high-throughput ²capabilities. High ²quality genomic DNA was isolated from primary dermal fibroblasts or isolated ²PBMCs and ²their reprogrammed iPSCs. Quality of genomic DNA as determined by UV spec. ²(NanoVue), ²fluorometer (Qubit) and Agarose Gel analysis. The samples were analyzed for ²CNVs using²the Agilent 60K Standard aCGH platform suitable for human stem cell and cancer ²cell lines²by Cell Line Genetics (Madison, WI). Comparison of iPSC lines to their ²parental donor cell ²of origin yielded de novo copy-number variation (gains / amplifications or ²losses / deletions) for ²the indicated loci.²TCRG chain rearrangement assay. Genomic DNA (350ng) was harvested from all ²cell²lines using the MasterPure DNA Purification Kit (Epicenter Biotechnologies). ²An embryonic ²stem cell line (H9) was used as a negative control. Primer sets that recognize ²the three ²framework regions in the heavy chain locus of the IgH gene were obtained from ²InVivoScribe Technologies (Cat no.11010010, San Diego, CA) and the PCR was ²carried out²as per the manufacturer's protocol. Episomal plasmid related gene analysis ²Genomic DNA²(400ng) was harvested from all cell lines and an embryonic stem cell line (H9) ²was used a ²negative control. Primers that recognize EBNA-1, along with GAPDH, which was ²used as a ²housekeeping gene, were included in this study. PCR was run for 35 cycles at ²95 C for 30 ²sec, 60 C for 30 s, and 72 C for 30 s.²Neuronal differentiation from iPSCs. The human fibroblast- and PBMC-iPSCs were²seeded in 6-well Matrigel-coated plates. The iPSCs were grown to near ²confluence under ²normal maintenance conditions before the start of the differentiation. The ²next day neuronal ²differentiation was initiated by neuroectoderm differentiation by dual SMAD ²and GSK-3beta ²inhibition using LDN193189 (0.2 [NI, Cayman), SB431542 (10 [NI, Cayman) and²CHIR99021 (3 11M, Cayman) this treatment is carried on for 6 days in Iscove's ²modified²Dulbecco's medium (IMDM) / F12 (1:1) media containing nonessential amino acids ²(NEAA; ²1%), B27 (2%), and N2 (1%). After 6 days differentiating cells were then ²gently lifted by ²accutase treatment for 5 min at 37 C. Cells at a density of 7.5 X 10 were ²subsequently placed ²in a 6-well plate or 1 X 104 cells were seeded in a 96-well plate in above ²neural²differentiation medium with the addition of 0.1 [NI all-trans retinoic acid ²and 1 [NI sonic²hedgehog agonist (SAG). Fresh media was changed every other day. At day 12 of ²differentiation media was changed to terminal differentiation (IMDM) / F12 ²(1:1) media ²supplemented with NEAA (1%), B27 (2%), N2 (1%), compound E (0.1 [NI; ²Calbiochem),²<DP=56>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²DAPT (2.5 11M; Cayman), retinoic acid (0.5 [NI) all-trans, SAG (0.1 11M), ²ascorbic acid (200 ²ng / ml), dibutyryl cyclic adenosine monophosphate (111M), brain-derived ²neurotrophic factor ²(10 ng / ml), and glial cell line¨derived neurotrophic factor (10 ng / ml). ²Differentiating neurons ²were fixed at day 18 of differentiation and analyzed.² Example 22²Cry opreserved PBMCs Isolated from Blood are Reliably Reprogrammed to iPSCs²Human iPSCs can be generated from freshly isolated non-expanded PBMCs with²episomal plasmids. However, there are no descriptions for reprogramming ²cryopreserved²PBMCs to iPSCs. When the Inventors reprogrammed cryopreserved PBMCs to iPSCs ²from ²multiple individuals with episomal plasmids expressing POU5F1, 50X2, KLF4, ²LIN28, L-²MYC, and TP53 shRNA (termed 4p method), the Inventors were either unsuccessful ²or ²observed significant variability in isolating identifiable iPSC clones even ²after 35-40 days. ²Other attempts to generate iPSCs from whole blood have shown that in order to ²generate²sufficient cell numbers for reprogramming, isolated CD34+ progenitor cells ²need to be ²enriched and expanded in culture with complex and expensive protocols. This ²highlighted the ²need to simplify this process and avoid expansion of somatic cells prior to ²reprogramming. ²The Inventors instead isolated and cryopreserved non-expanded PBMCs for ²reprogramming ²to iPSCs because this somatic cell source provides the fastest and most cost-²effective²procedure from multiple subject cohorts. Using the 4p method, the T ²reprogramming protocol ²was successful with only 14.3% of PBMC samples, while the non-T protocol on ²cryopreserved PBMCs did not result in any clonal iPSC lines.²To increase the efficiency of PBMC reprogramming the Inventors utilized, (a) ²an ²additional episomal plasmid containing 5V40 large T antigen (SV4OLT) in ²specific²stoichiometry to minimize PBMC cell death, termed 5p method, and (b) a defined ²E7 ²reprogramming media to promote high surface attachment of the nucleofected ²PBMC. This ²novel protocol resulted in successful and efficient generation of multiple ²adherent PBMC-²iPSC clones that could be mechanically isolated and scaled up for expansion ²within 25-35 ²days post-nucleofection. Importantly, the success rate and the efficiencies in ²reprogramming²multiple subject cryopreserved PBMCs from unaffected controls or diseased ²patients was ²significantly greater at 85% for T cell and 92% for non-T cell types using the ²5p method, in ²contrast to between 0 and 15% for the 4p method. Reprogramming PBMCs on mouse ²embryonic fibroblast feeders (EFs) in a commercial media (primate ESC media; ²PESC)²56²<DP=57>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²resulted close to 89-95% success for both T and non-T cell types with good ²reprogramming ²efficiencies. The Inventors next tested whether this 5p reprogramming protocol ²was also ²amenable with xenobiotic-free components, as this may be required for ²clinically compatible ²iPSC-based cell therapies. Use of recombinant human laminin 521 substrate and ²chemically²defined reprogramming 1 media (E7)21 also resulted in successful T- and non-T ²cell²reprogramming, at 80% and 64%, respectively. Collectively, these results show ²that the 5p ²method, when compared to 4p method, significantly enhanced reprogramming ²success and ²efficiency of PBMCs (both T and non-T cells) and provides a valuable protocol ²for reliable ²reprogramming of cryopreserved PBMCs. Each PBMC-iPSC line exhibited typical ²PSC²characteristics, including tightly packed colonies, high cell nuclear-²cytoplasmic ratio, robust²alkaline phosphatase activity, and expression of multiple pluripotency ²antigens, which are all ²clear in representative reprogrammed iPSC colonies from PBMCs of two healthy ²volunteers ²(non-T cell source 03iCTR10 NTn1 and T-cell source 80iCTR-Tn1). The PBMC-iPSCs ²²passed pluripotency quality control metrics determined by the PluriTest assay, ²demonstrating²that the PBMC-iPSC transcription profile was analogous to well established ²hESCs and fib-²iPSCs, but not differentiated fibroblasts and neural progenitor cells. PBMC-²iPSCs maintained ²a normal G-band karyotype and were confirmed to be clonal derivatives of ²either T cells or ²non-T cells from the PBMCs using the T cell receptor (TCR)-(3 and ¨y, gene ²rearrangement / clonality assays. The tri-lineage potential of PBMC-iPSCs was ²demonstrated²by spontaneous embryoid body formation and by measuring germ-layer specific ²gene ²expression profile by the TaqMan Scorecard assay. The genomic transgene-free ²status of ²PBMC iPSCs was confirmed by, (1) demonstration that the EBNA plasmid-related ²latency ²element was eventually eliminated from the established PBMC-iPSCs and not ²detected in the ²genomic DNA; and (2) the expression of endogenous pluripotency genes and ²absence of any².. exogenous reprogramming transgenes using RT-qPCR. Further, the SV4OLT ²factor that is a²component of the 5p reprogramming cocktail was undetectable at the genomic DNA ²level ²and not expressed by the reprogrammed PBMC-iPSC lines.²Example 23² PBMC-iPSCs have Equivalent Neuronal Differentiation as Fib-iPSCs²While many early reports suggested that newly reprogrammed iPSCs retain some ²epigenetic memory of their parental donor cell type, recent reports suggest ²that hiPSCs, ²regardless of the source tissue, ultimately lose most of their gene expression ²and epigenetic²57²<DP=58>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²profiles related to the original cell source following expansion. However, it ²still remains ²unclear whether blood derived iPSCs can differentiate as efficiently as ²fibroblast-derived ²iPSCs into various cell types, possibly due to a stronger retention of ²epigenetic memory in ²blood-sourced iPSCs compared to other donor cells. The Inventors addressed ²this by²directing blood or fibroblast-derived iPSCs, both of mesodermal origin, ²towards a different²germ layer, i.e. neuroectoderm. Specifically, the Inventors performed neural ²ectoderm ²differentiation from large numbers of iPSC lines derived from fibroblast (n = ²26) and PBMC ²lines (n = 20), of both healthy subjects as well as diseased patients. ²Immunocytochemistry for ²neural ectoderm markers of TUBB3 (133-tubulin) and NKX6.1 and subsequent ²quantification²demonstrated that neuronal differentiation occurred at a similar efficiency ²between fib-iPSC²and PBMC-iPSCs, further demonstrating the utility of PBMC iPSCs. PBMC-iPSCs ²Reprogrammed with 5p Maintain a Significantly More Stable Karyotype Recurrent ²chromosomal abnormalities have been described previously for hESC lines. Some ²reports ²have also chronicled common chromosomal aberrations for hiPSC lines, however, ²these did²not methodically account for variability in source tissues, reprogramming ²methods and cell²culture methods. To the Inventors' knowledge, there have been no systematic ²studies ²describing cytogenetic analysis comparing frequency between iPSCs derived from ²fibroblast ²and blood. The Inventors performed in-depth cytogenetic analysis on iPSC lines ²derived from ²171 unique donors of 16 fibroblasts (77) or PBMCs (94). With multiple clonal ²lines per²donor, this included karyotypes from 348 independent clonal fibroblast (205) ²or PBMC (143)²iPSC lines. All the fibroblast, lymphoblastoid cell lines, epithelial and ²blood-derived iPSCs ²assessed were reprogrammed using similar non-integrating episomal ²reprogramming ²methods. The major difference between fibroblast and PBMC-reprogramming ²reported here ²was the number of reprogramming factor plasmids used; 3p31 fibroblasts and 4p ²or 5p for²PBMCs. After successful reprograming, all the iPSC lines analyzed and reported ²here were²maintained using feeder-free Matrigelg / mTeSR1Tm cell culture methods and ²passaged using ²mechanical StemProg EZPassageTM tool. To establish the genetic stability of ²these lines, the ²Inventors first performed G-band karyotype analysis on 552 human iPSC cultures ²derived ²from source fibroblasts (260), PBMCs (206), epithelial cells (26) and ²lymphoblastoid cell²lines (60) that were collected from multiple laboratories or public ²repositories. The Inventors'²data reveal remarkably lower incidence of chromosomal aberrations in PBMC ²iPSCs. ²Abnormal karyotypes with clonal aberrations were observed in 61 of 260 (23.5%) ²cultures ²from clonally independent human fib-iPSC lines, derived from 77 unique donors. ²Typically,²58²<DP=59>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²the fibroblasts had been expanded for 9-10 passages prior to reprogramming. In ²stark ²contrast, only 4 in 206 (1.9%) cultures of clonal human PBMC-iPSC lines ²derived from 94 ²unique donors displayed any karyotype abnormalities. The 4 abnormalities ²observed were ²also low-frequency. It is evident from the chromosomal ideogram schematics ²that recurrent²aberrations are represented in a significantly greater degree 1 in fib-iPSCs ²compared to the²PBMC-iPSCs. Indeed, this remarkable cytogenetic stability is unique to PBMCs ²reprogrammed with the new 5p method, as iPSCs reprogrammed from other cell ²origins, ²including lymphoblastoid cell lines (25%; 15 abnormal from 60) and primary ²epithelial cells ²(27%; 5 abnormal from 26) have similar high rates of karyotypes aberrations as ²those seen in²fibroblasts. The most frequent karyotype abnormalities in fib-iPSCs were ²observed in²chromosomes 13 (14.9%), 1(11.7%), 12 (9.6%), and X (8.5%). To a lesser extent ²karyotype ²changes were also observed in chromosomes 21, 11, and 6. Interestingly, ²karyotype ²aberrations were never detected on chromosomes 2, 5 and 7 in fib-iPSCs. Of the ²²aneuploidies, chromosomal gains (trisomy or duplications) were most commonly ²observed in²12 (20.0%), 1 (15.0%), and 13 (12.5%), and chromosomal losses were repeatedly ²observed in²chromosomes X (38.5%) and 21 (23.1%). Structural rearrangements, including ²translocations, inversions and derivative chromosomes, were recurrent in ²chromosomes 13 ²(22.0%), 1 (12.2%) and 14 (9.8%) in fib-iPSCs. In stark contrast, only two ²PBMC-iPSC ²lines from 178 iPSC cultures analyzed showed chromosome gains in 14 (trisomy) ²or 18²(duplication). The other two PBMC-iPSC lines exhibited uncommon abnormalities: ²a²translocation 46,XY,t(7;14)(q34;q11.2) and a mosaic deletion ²46,X,del(X)(q22q26) in 19% ²of cells.²Example 24²Enhanced Karyotype Stability of PBMC-iPSCs is Independent of Donor Age and ²Passage²Number²The skin, unlike the blood, is routinely exposed to external environmental ²elements ²like potential sun damage and the fibroblasts derived from the biopsies ²require a certain level ²of expansion prior to reprogramming, which is akin to further aging in ²culture. Given this, the²Inventors posited that the donor age might be a contributing factor that ²impacts the²cytogenetic instability of fib-iPSCs. G27 band karyotype analysis was used to ²assess this ²possibility. There was no clear trend and correlation between the increasing ²age of the donor ²and the frequency of cytogenetic abnormalities in fib-iPSCs. However, results ²confirmed that²59²<DP=60>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²PBMC-iPSCs had much greater karyotype stability over fib-iPSCs in every donor ²age group. ²Apart from donor group between ages 0-20, PBMC-iPSCs were significantly more ²stable ²than fib-iPSCs for all donor groups between ages 21-90. To establish how ²proliferation of ²the iPSCs in culture may affect genetic stability, 1 the Inventors next ²analyzed fib- and²PBMC-iPSCs over time. About 22.4% of fibroblast-derived iPSCs were observed to ²have²abnormal karyotypes (> 1 / 20 cells with clonal aberrations) in their first G-²band karyotype ²evaluation post-iPSC generation, which was typically between passages 1-23. In ²stark ²contrast, only 1.4% of PBMC-derived iPSCs had abnormal karyotypes in their ²first ²assessment (p < 0.0001). Any iPSC line that was determined to have an abnormal ²karyotype²in the first karyotype was no longer cultured or evaluated. As such, between ²2nd and 4th²repeat karyotypes of an iPSC line were only evaluated on lines that were ²initially identified as ²cytogenetically normal in their first karyotype. There was a trend towards ²greater proportion ²of fib-iPSCs (27.3%) acquiring abnormal karyotypes in culture upon repeat ²karyotyping ²when compared to the proportion at first karyotypes, and significantly greater ²than PBMC-²iPSCs (p < 0.001). Strikingly, the percent abnormal karyotypes in PBMC-iPSCs ²did not show²any significant differences between first and repeat karyotypes. Upon ²analyzing the origin of ²the cytogenetic instability in fib-iPSCs, it appeared that the highest rate of ²abnormal ²karyotypes (first or repeat) occurred during passages 1-23 in the life of the ²iPSC line. This ²passage range is typically when the greatest amount of iPSC expansion occurs ²for any given²cell line largely due to characterization and cell banking coinciding around ²these passage²numbers. Nevertheless, this is a similar process for both fib- or PBMC-iPSCs, ²and yet, ²critically, the PBMC-derived cells reprogrammed by the Inventors' new method ²do not ²display an increased disposition towards abnormal karyotypes upon extended ²culture or ²expansion. PBMC-iPSCs Acquire Less Submicroscopic Amplifications and Deletions ²Since²G-band karyotype is unable to detect submicroscopic genomic abnormalities ²(<5Mb), next²array comparative genomic hybridization (aCGH) microarrays were next conducted ²on a ²subset of fib-iPSC and PBMC-iPSC lines. While aCGH is unable to detect ²balanced ²translocations, inversions and < 20% culture mosaicism, it is a good ²supportive method to ²detect smaller size genomic gains and losses, copy number variants (CNVs),²duplications / deletions, and unbalanced translocations in the iPSC ²lines11,30,32,33. The²Inventors analyzed and recorded any de novo amplifications or deletions ²acquired in the ²iPSCs upon comparison with the parental fibroblast or PBMC source bio-²specimen. In this ²analysis, only those amplifications and deletions acquired de novo in iPSCs ²were considered,²<DP=61>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²when they were not normal CNVs upon cross referencing against the Database of ²Genomic ²Variants that contains genomic variations observed in healthy individuals.²Including iPSC lines with abnormal and normal G-band karyotypes, 1 the average ²²size of the amplification and deletions (amps / dels) detected by aCGH were ²significantly² greater in fib-iPSC lines at 44 Mb compared to 2.1 Mb in PBMC-iPSC lines, the²preponderance of which was due to fib-iPSC lines with an abnormal karyotype. ²Upon ²segregating the size analysis comparison between iPSC lines with normal ²karyotypes, the de ²novo amps / dels were on average 2.31 Mb in fib-iPSCs and 2 Mb in PBMC-iPSC ²lines. ²Supporting this data, the average number of acquired de novo total amps / dels ²in fib-iPSCs²(3.7) were significantly greater (two-fold) than in PBMC-iPSCs (1.8). Even in ²iPSC lines that²were determined to have normal G-band karyotypes, the number of new amps / dels ²was ²greater in fib-iPSCs at 3.3 vs. PBMC-iPSCs at 1.8. The most commonly acquired ²submicroscopic (0.8-1.5 Mb) de novo amplifications or deletions detected by ²aCGH were ²amplification of chromosome 7q31.32 or deletion of chromosomes 10q15.2-q25.1, ²16p11.2,²and 21p11.2-p11.1. Collectively, this data demonstrates that this new method ²to reprogram²PBMCs results in more stable human iPSCs with regards to acquisition of ²chromosomal ²aberrations, compared to any other published method.²Example 25² Additional Characterization of 5p method²Table 9 - Greater n for PBMCs reprogrammed to iPSCs ²Fibroblast-derived iPSCs Numbers % abnormal²Total number of cultures / karyotypes 261²23.37%²Total number of abnormal 61²PBMC-derived iPSCs Numbers % abnormal²Total number of cell lines 409²3.42%²Total number abnormal 14²The Inventors performed further analysis to confirm whether p53 (TP 53) in ²PBMC-iPSC²lines reprogrammed using the Inventors' method. These lines were reprogrammed ²on L521 ²substrate in defined E7 media.²61²<DP=62>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²The Inventors have performed extensive analyses of multiple iPSC lines. Upon ²whole ²genome sequencing (subject of another manuscript in preparation), the ²Inventors did not ²identify any variants (SNPs or In-dels) in the iPSC lines in the exon (coding ²region) of the ²TP53 gene at the genome level.² Whole genome sequencing was performed using 750ng of genomic DNA with the²Illumina TruSeq PCR free library preparation kit according to manufacturer's ²instructions ²(Illumina, San Diego, CA). Library quality was confirmed with the BioAnalyzer ²(Agilent ²Technologies, Santa Clara, CA) and libraries were sequenced to at least 40x ²read depth on an ²Illumina Hi-Seq10X at Fulgent Therapeutics, Temple City, CA. An average of ²>460Million²reads per sample were generated. Fastq files were aligned to the reference ²genome in build²hg38 using the BWA-mem algorithm in the Burroughs-Wheeler aligner, with more ²than ²400Million reads successfully aligned for each sample providing an average of ²43x read ²depth across the genome.²Using this pipeline, the Inventors did not identify any variants (SNPs or In-²dels) that arise²in only the iPSC line or their clones in the coding region (exons) of TP53. Of ²the multiple²iPSC lines analyzed and their clonal derivatives, a single intronic de novo ²SNP was detected ²in two of the three iPSC clones derived from only one donor iPSC line; ²rs12940247 (hg38 ²chr17:7,664,385 G / A), which is in Intron 1 of a single (and rare) isoform of ²TP53. This ²common SNP is found in at least 36% of all populations assayed, with a minor ²allele (G)²frequency of 0.403 in a reference population of Caucasian samples (the donor ²line iPSC line²was from a Caucasian donor). This common variant is not implicated with any ²function, or ²annotated in typical clinical annotation databases used to assign potential ²impact of variants ²in cancer (CiVIC, ClinVar, COSMIC Cancer Consensus). There is also no evidence ²for this ²variant to act as a regulator of TP53 expression level in any healthy tissue ²in the Gene Tissue²Expression (GTEx) dataset. The variant rs12940247 does not intersect with any ²regulatory²features in the Tier 1 cell lines (including a lymphoblastoid cell line ²GM12878, which has ²been derived from PBMC). The Inventors have also used the Illumina 0mni2.5M ²genotyping ²array to characterize these samples. In keeping with the results from whole ²genome ²sequencing there were no variants detected in the iPSC clones that were ²discordant from the²genotype of the germline (blood) sample, and there were no copy number ²variants identified²spanning this locus.²62²<DP=63>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Table 10 ¨ Non-coding common variant rs12940247 is observed as a de novo event ²in ²two clones from donor CS-002. ²Sample Fraction Fraction ²Called²reads reads Genotype²carrying A carrying G²Allele (%) Allele (%)²Blood CS-002 (Blood) 57 / 57 (100) 0 / 57 (0) AA²iPSC-Clone 1 C SO2iCTR-NTn3 29 / 46 (63) 16 / 46 (35) ²AG²iPSC-Clone 2 CS02iCTR-NTn4 49 / 51 (96) 2 / 51 (4) AA²iPSC-Clone 3 CS02iCTR-Tn11 39 / 51 (76) 12 / 51 (24) ²AG²The location of the SNP in intron 6 of one isoform of TP53 is marked with a ²grey²line. Isoforms of TP53 are shown from GENCODE v24 Comprehensive in black ²(features²with corresponding entry in the Protein Data bank) or dark blue (reviewed or ²validated ²transcript from either RefSeq or SwissProt). Below gene annotation are four ²tracks showing ²transcription, active promoters (none of which are observed in the genomic ²interval plotted) ²and active enhancers (tracks 3 and 4, again, none of which are observed in the ²genomic²interval plotted). Some poised regulatory elements are observed (represented ²as blue peaks²showing enrichment of signal from ChIP-Seq of H3K4me1) in the gene body of ²TP53 in ²HUVEC cells. There is no evidence for the observed non-coding variant ²occurring de novo in ²two clones from donor iPSC has any regulatory function of TP53.²Brief methodology: Germline variant calling was performed with the Genome²Analysis Toolkit (GATK) using Best Practices for germline variant calling. ²Briefly, aligned²sequence is pre-processing with Picard to identify duplicate reads (those ²originating from a ²single fragment of DNA, which can be generated during sample preparation or ²using cluster ²amplification during the sequencing process) by the sequence at the 5' end of ²the read. Base ²quality scores are recalibrated after local genome realignment around In-dels ²to improve²genotype calling accuracy (a process which relies heavily on base quality ²scores) before²variants are identified. Called single nucleotide polymorphisms (SNPs) and In-²dels are then ²used to recalibrate variant calls in a joint genotyping module to generate ²variant calls with ²high confidence.²63²<DP=64>²CA 03025678 2018-11-26²WO 2017 / 219000 PCT / US2017 / 038041²In conclusion, based on the highly detailed and extensive analysis of multiple ²iPSC lines ²and clones at the SNP and WGS level, the Inventors do not detect any coding ²mutations in ²the TP53 gene that would disable its normal regulation.²64²<DP=65>²Table 11 ¨ Non-coding common variant rs12940247 is observed as a de novo event ²in two clones from donor CS-002. ²0²t..)²o²,..,²-4²t..)²,..,²o²o²o²Starting²Cell 3P Reprogramming ² 5P Reprogramming²Cell ² Efficiency ¨ 5P²line Condition Efficiency ¨ 3P ² Condition²Count²100,000 ¨140 ² ¨528 0.176 P²1WP3 0.047²cells / well Colonies ² Colonies 0²0 ²N)²o ,²u, ² .3²N) ²0 ², ².3 ², ², ²,²100,000 ¨92 ² ¨269 0.090 ,õ'²8PF5 0.031²cells / well Colonies ² Colonies²100,000 ¨106 ² ¨356 0.119²9XI-17 0.035²cells / well Colonies ² Colonies 1-d²n²1-i²cp ²t..)²o²,-,² -4²o²(...)²cio²o².6.²,-,²<DP=66>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Example 26²Discussion²In this study, the Inventors show that human iPSCs derived by a new method ²from²non-expanded and cryopreserved PBMCs (PBMC-iPSCs) are remarkably ²cytogenetically²stable compared to iPSCs generated from other somatic cells that require cell ²expansion prior²to reprogramming, including skin fibroblast cultures, LCLs, epithelial cells, ²and adipose cells. ²These PBMC-iPSCs reprogrammed with the 5p method also have enhanced stability ²rates ²compared to those historically reported for other pluripotent stem cell lines ²such as hESCs ²and iPSCs derived in other laboratories. This entire study entailing episomal ²plasmid²reprogramming of various cell types from over 200 unique donors, identical ²stem cell²maintenance procedures, pluripotency characterization, and karyotype analysis ²were ²performed in the Inventors' laboratories and the cytogenetics core. The ²Inventors ²systematically analyzed over 200 individual clonal PBMC-iPSC lines generated ²in the ²Inventors' laboratory, with both lymphoid T cell and myeloid non-T cell ²populations being²reliably reprogrammed, irrespective of substrate and media. Further, the ²Inventors²demonstrated creation of stable PBMC-iPSCs on a xeno-free recombinant human ²L521 ²substrate and defined reprogramming media. Most importantly, the PBMC-iPSCs ²reprogrammed with the 5p method maintain karyotype stability upon long-term ²culture. ²Collectively, the combination of this improved technology and a non-expanded ²cell source²such as PBMCs offer 1 both clinically compatible reprogramming methods and ²facile access²to large numbers of patient samples.²Aneuploidy and rearrangements in chromosomes 1, 12, 13 and X were the most ²frequent abnormalities observed in fib-iPSCs generated by episomal ²reprogramming in the ²Inventors' laboratory. In contrast these aberrations were never detected in ²any of the PBMC-²iPSCs the Inventors generated and analyzed. Some of these changes observed in ²fib-iPSCs²are similar to recurrent abnormalities found in human ESCs where there are ²short arm of ²chromosome 12 and gains or losses of chromosomes 1, 17 and X, similar to their ²malignant ²human embryonal carcinoma (EC) stem cell counterparts. Using aCGH microarray, ²the ²PBMC-iPSCs showed half the number of de novo CNVs compared to the fib-iPSCs. ²These²de novo CNVs were not shared between hiPSCs and their respective parental ²fibroblasts or²PBMCs and were likely acquired during reprogramming or iPSC expansion. The ²average ²base pair size of chromosomal change in the CNVs in fib-iPSCs was also far ²greater when²66²<DP=67>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²compared to PBMC-iPSC lines, further supporting the stability of this new ²reprogramming ²method.²Increased karyotype abnormalities, coding mutations, and small genomic ²alterations ²have previously been reported in iPSCs, likely reflecting the mutagenic ²consequences due to ²the reprogramming procedure itself However, the bulk of these reported genomic ²²abnormalities have been examined in iPSC lines generated from skin fibroblasts ²using ²integrating retroviral and lentiviral reprogramming methods. Aneuploidy rates ²and CNVs ²comparing different nonintegrating and lentiviral reprogramming methods for ²low-passage ²iPSCs have been described. They reported an aneuploidy rate around 12-13% in ²low-passage ²iPSCs using episomal and integrating reprogramming methods, although this data ²²predominantly includes aberration rates for iPSCs derived from expanded ²fibroblast cultures ²that were not segregated by the origin of donor cells or obtained from non-²expanded cells, ²like PBMCs. Various factors can affect genetic stability during long-term ²culture and ²expansion of PSCs including, oxygen tension, growth supplements, growth ²factors, passage²technique, cryopreservation and the extracellular substrate on which cells are ²gr0wn36. There ²is often substantial laboratory variation in PSC culture techniques given ²these afore-²mentioned factors; however, these factors were all tightly controlled for in ²the Inventors' ²study. The Progenitor Cell Biology Consortium (www.synapse.org) identified ²correlations in ²gene expression and CNVs among key developmental and oncogenic regulators as a ²result of²donor line stability, reprogramming technology, and cell of origin. However, ²karyotype ²abnormalities and line stability were not distinguished by cell of origin and ²their previous cell ²expansion history in this study, and only small numbers of abnormal 1 fib-²iPSCs were ²analyzed.²Although methylation and transcription profiles of iPSCs segregated somewhat ²based²on blood and fibroblast cell of origin, they could not be directly attributed ²to somatic cell ²epigenetic memory profiles. This group also observed a trend towards higher ²level of CNVs ²in lines generated using integrating reprogramming methods. Recently, another ²group ²revealed that blood cells and derived iPSCs were much closer to bona fide ²hiPSCs and ESCs ²in their methylation profiles (more hyper-methylated state) compared to any ²other parental²tissue or their iPSCs that had more aberrant DNA methylation, supporting the ²Inventors' ²argument that a cell population that has not been previously expanded in ²tissue-culture, such ²as adult PBMCs or cord blood, could be a preferred choice for reprogramming ²and ²maintenance of cytogenetic stability at the iPSC stage.²67²<DP=68>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²The mechanisms underlying the genetic stability of iPSCs derived from non-²expanded ²PBMCs compared to iPSCs generated from expanded somatic cell types such as ²skin ²fibroblasts, LCLs, epithelial and adipose stem cells are likely to be multi-²factorial. First, the ²bone marrow niche allows for turnover of blood more frequently (1-5 days for ²most cells of²the PBMC lineage) than almost any other cell type of the body (BNID 101940). ²Therefore, a²host blood may be considered far less "aged" than a resident dermal ²fibroblast, epithelial or ²adipose cell, which only renews over a period of months to years. Notably, the ²²reprogramming of donor-derived skin fibroblasts, LCLs, epithelial and adipose ²cells, requires ²a significant period of ex vivo somatic cell expansion in tissue-culture. ²These factors may²lead to a starting pool of cells with increased tissue culture-associated cell ²stress and²senescence, thus making susceptible to decreased DNA repair capacities. It is ²also likely, ²therefore, that a culture of previously expanded somatic cells may start with ²some overall ²heterogeneity and inherent genotype instability, and low-level mosaicism could ²remain ²undetected by traditional G-band karyotype in a bulk heterogeneous cell ²culture prior to²reprogramming. Subsequently, fib-iPSC, LCL-iPSC or epithelial-iPSC line may be ²isolated²in which low-level karyotype abnormalities become magnified upon significant ²clonal ²proliferation and expansion. This risk is avoided in the Inventors' method, as ²isolated PBMCs ²were initiated for reprogramming immediately post-isolation without any period ²of prior cell ²expansion. Lastly, the PBMC 5p reprogramming protocol contains an additional ²episomal²plasmid where one of the reprogramming factors SV4OLT minimizes PBMC cell ²death and²promote surface attachment, which may also enhance the stability of the PBMCs ²during the ²stressful reprogramming phase for a cell. It has also been previously shown ²that the use ²SV4OLT as a component of the reprogramming factor cocktail is non-transforming ²since the ²transgene does not integrate into the genome of the iPSC lines derived by ²episomal plasmid²reprogramming, which is also supported by the Inventors' data. While it is ²possible that pre-²expanded somatic cell types like fibroblasts may obtain greater genetic ²stability if ²reprogrammed with the 5p protocol, the Inventors feel that this single ²difference in ²reprogramming between the pre-expanded cells and the nonexpanded PMBCs does ²not ²completely account for the vast differences in karyotype stability. ²Importantly, apart from².. the additional factor, all the pre-expanded cell types and non-expanded ²blood-derived iPSCs²were reprogrammed using similar non-integrating episomal reprogramming methods ²and ²maintained with identical feeder-free Matrigelg / mTeSR1Tm cell culture and the ²manual ²StemPro EZPassageTM tool. Nonetheless, it would be a great advancement to the ²field if the²68²<DP=69>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²Inventors' novel 5p protocol facilitated reprogramming of additional cell ²types beyond non-²expanded PBMCs and ongoing studies are assessing fibroblast reprogramming ²using the ²optimized protocol. The first autologous human iPSC clinical trial for ²treating age-related ²macular degeneration patients sponsored by RIKEN institute was suspended ²because single²nucleotide variations (SNVs) and CNVs were detected in a patient iPSC line, ²which were not²detectable in the patient's original fibroblasts. While the CNVs were all ²single-gene ²deletions, one of the SNVs was previously identified in a cancer-related ²somatic mutations ²database6,16. This emphasizes that a stable karyotype is paramount for the ²success of clinical ²applications of human iPSCs. In addition, scale-up of iPSCs and derivatives ²for predictive²toxicology and high-throughput drug screening for therapeutic discoveries ²requires a source²of iPSCs with substantial cell stability. This optimum reprogramming method in ²non-²expanded PBMCs will minimize effects of acquired genomic aberrations. ²Together, these ²results highlight that optimizing techniques of reprogramming as well as the ²quality and the ²period of pre-culture prior to reprogramming are crucial for long-term iPSC ²line stability.²This data will assist in refining the safety of iPSC-derived cell products for ²clinical and²research discovery applications, as well as aid in greater reproducibility in ²iPSC disease ²modeling studies.²The various methods and techniques described above provide a number of ways to²carry out the invention. Of course, it is to be understood that not ²necessarily all objectives or²advantages described may be achieved in accordance with any particular ²embodiment ²described herein. Thus, for example, those skilled in the art will recognize ²that the methods ²can be performed in a manner that achieves or optimizes one advantage or group ²of ²advantages as taught herein without necessarily achieving other objectives or ²advantages as²may be taught or suggested herein. A variety of advantageous and ²disadvantageous²alternatives are mentioned herein. It is to be understood that some preferred ²embodiments ²specifically include one, another, or several advantageous features, while ²others specifically ²exclude one, another, or several disadvantageous features, while still others ²specifically ²mitigate a present disadvantageous feature by inclusion of one, another, or ²several² advantageous features.²Furthermore, the skilled artisan will recognize the applicability of various ²features ²from different embodiments. Similarly, the various elements, features and ²steps discussed ²above, as well as other known equivalents for each such element, feature or ²step, can be²69²<DP=70>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²mixed and matched by one of ordinary skill in this art to perform methods in ²accordance with ²principles described herein. Among the various elements, features, and steps ²some will be ²specifically included and others specifically excluded in diverse embodiments.²Although the invention has been disclosed in the context of certain ²embodiments and²examples, it will be understood by those skilled in the art that the ²embodiments of the²invention extend beyond the specifically disclosed embodiments to other ²alternative ²embodiments and / or uses and modifications and equivalents thereof²Many variations and alternative elements have been disclosed in embodiments of ²the ²present invention. Still further variations and alternate elements will be ²apparent to one of²skill in the art. Among these variations, without limitation, are sources of ²blood cells,²cellular components of blood, pluripotent stem cells derived from therein, ²techniques and ²composition related to deriving pluripotent stem cells from blood cells cells, ²differentiating ²techniques and compositions, biomarkers associated with such cells, and the ²particular use of ²the products created through the teachings of the invention. Various ²embodiments of the²invention can specifically include or exclude any of these variations or ²elements.²In some embodiments, the numbers expressing quantities of ingredients, ²properties ²such as concentration, reaction conditions, and so forth, used to describe and ²claim certain ²embodiments of the invention are to be understood as being modified in some ²instances by ²the term "about." Accordingly, in some embodiments, the numerical parameters ²set forth in²the written description and attached claims are approximations that can vary ²depending upon²the desired properties sought to be obtained by a particular embodiment. In ²some ²embodiments, the numerical parameters should be construed in light of the ²number of ²reported significant digits and by applying ordinary rounding techniques. ²Notwithstanding ²that the numerical ranges and parameters setting forth the broad scope of some ²embodiments²of the invention are approximations, the numerical values set forth in the ²specific examples²are reported as precisely as practicable. ² The numerical values presented in some²embodiments of the invention may contain certain errors necessarily resulting ²from the ²standard deviation found in their respective testing measurements.²In some embodiments, the terms "a" and "an" and "the" and similar references ²used²in the context of describing a particular embodiment of the invention ²(especially in the²context of certain of the following claims) can be construed to cover both the ²singular and the ²plural. The recitation of ranges of values herein is merely intended to serve ²as a shorthand ²method of referring individually to each separate value falling within the ²range. Unless²<DP=71>²CA 03025678 2018-11-26²WO 2017 / 219000 ²PCT / US2017 / 038041²otherwise indicated herein, each individual value is incorporated into the ²specification as if it ²were individually recited herein. All methods described herein can be ²performed in any ²suitable order unless otherwise indicated herein or otherwise clearly ²contradicted by context. ²The use of any and all examples, or exemplary language (e.g. "such as") ²provided with²respect to certain embodiments herein is intended merely to better illuminate ²the invention²and does not pose a limitation on the scope of the invention otherwise ²claimed. No language ²in the specification should be construed as indicating any non-claimed element ²essential to ²the practice of the invention.²Groupings of alternative elements or embodiments of the invention disclosed ²herein².. are not to be construed as limitations. Each group member can be referred ²to and claimed²individually or in any combination with other members of the group or other ²elements found ²herein. One or more members of a group can be included in, or deleted from, a ²group for ²reasons of convenience and / or patentability. When any such inclusion or ²deletion occurs, the ²specification is herein deemed to contain the group as modified thus ²fulfilling the written² .. description of all Markush groups used in the appended claims.²Preferred embodiments of this invention are described herein, including the ²best mode ²known to the inventors for carrying out the invention. Variations on those ²preferred ²embodiments will become apparent to those of ordinary skill in the art upon ²reading the ²foregoing description. It is contemplated that skilled artisans can employ ²such variations as²appropriate, and the invention can be practiced otherwise than specifically ²described herein.²Accordingly, many embodiments of this invention include all modifications and ²equivalents ²of the subject matter recited in the claims appended hereto as permitted by ²applicable law. ²Moreover, any combination of the above-described elements in all possible ²variations thereof ²is encompassed by the invention unless otherwise indicated herein or otherwise ²clearly²contradicted by context.²Furthermore, numerous references have been made to patents and printed ²publications²throughout this specification. Each of the above cited references and printed ²publications are²herein individually incorporated by reference in their entirety.²In closing, it is to be understood that the embodiments of the invention ²disclosed²herein are illustrative of the principles of the present invention. Other ²modifications that can²be employed can be within the scope of the invention. Thus, by way of example, ²but not of ²limitation, alternative configurations of the present invention can be ²utilized in accordance²71²<DP=72>²CA 03025678 2018-11-26²WO 2017 / 219000 PCT / US2017 / 038041²with the teachings herein. Accordingly, embodiments of the present invention ²are not limited ²to that precisely as shown and described.²72²

Claims

1. A method of generating peripheral blood mononuclear cell (PBMC) derived induced pluripotent stem cells, comprising: providing a quantity of PBMCs; delivering a quantity of EBNA1 and reprogramming factors comprising Oct-4, Sox-2, Klf-4, l-Myc, Lin-28, SV40 Large T Antigen ("SV40LT"), and short hairpin RNAs targeting p53 ("shRNA-p53") into the PBMCs; and culturing the PBMCs in a serum free reprogramming media for at least 4 days, wherein delivering the EBNA and reprogramming factors, and culturing in the reprogramming media generates PBMC derived induced pluripotent stem cells, wherein the reprogramming media comprises embryonic stem cell (ESC) media or E7 media, wherein the reprogramming factors are encoded in plasmid vectors comprising: a first vector encoding Oct4, Sox2, SV40LT and Klf4; a second vector encoding Oct4 and shRNA-p53; a third vector encoding Sox2 and Klf4; and a fourth vector encoding 1-Myc and Lin-28, and wherein a fifth vector encodes EBNA1.

2. The method of claim 1, wherein delivering a quantity of reprogramming factors comprises nucleofection.

3. The method of any one of claims 1 or 2, wherein the stoichiometric ratio of SV40LT and EBNA1 supports the reprogramming of non-T cell component of blood, including PBMCs.

4. The method of claim 3, wherein the first vector comprises pEP4 E02S ET2K, the second vector comprises pCXLE-hOCT3 / 4-shp53-F, the third vector comprises pCXLE-hSK, the fourth vector comprises pCXLE-hUL, and the fifth vector comprises pCXWB-EBNA1.

5. The method of any one of claims 1-4, further comprising plating of the PBMCs on a treated cell culture surface after delivering the reprogramming factors into the PBMCs, and culturing the PBMCs in the reprogramming media on said treated cell culture surface.

6. The method of claim 5, wherein the treated cell culture surface comprises plating of mouse embryonic feeders (MEFs).

7. The method of either claim 5 or 6, wherein the treated cell culture surface comprises an extracellular matrix protein.

8. The method of claim 7, wherein the extracellular matrix protein comprises laminin.

9. The method of claim 8, wherein laminin comprises L-521.

10. The method of any one of claims 1-9, wherein the ESC media comprises basic fibroblast growth factor (bFGF).

11. The method of any one of claims 1-9, wherein the reprogramming media comprises E7 media comprising L-Ascorbic Acid, Transferrin, Sodium Bicarbonate, Insulin, Sodium Selenite and / or bFGF.

12. The method of any one of claims 1-11, wherein the PBMCs are cultured in the reprogramming media for at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 days.

13. The method of any one of claims 1-11, wherein the PBMCs are cultured in the reprogramming media for at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 31 days.

14. A cell line comprising the PBMC derived induced pluripotent stem cells generated by the method of any one of claims 1-13, wherein the cell line is derived from non-expanded PBMCs, and wherein the cell line has 5% or less abnormal karyotype over 4-8 passages, or wherein the cell line does not show statistically significant differences between a first and a repeat G- band karyotype analysis, wherein the first or the repeat G-band karyotype analysis occurs during passages 10-23.

15. The method of any one of claims 1-13, wherein the PBMCs are isolated from a subject possessing a disease mutation and / or the PBMCs are a sample drawn from a human subject.

16. The method of claim 15, wherein the disease mutation is associated with a neurodegenerative or inflammatory bowel disease, disorder and / or condition.

17. The method of any one of claims 1-13, 15, and 16, wherein the PBMCs are non T-cell, non B-cell mononuclear cells and / or isolated non-expanded PBMCs.

18. The method of claim 15, wherein the sample is whole blood, peripheral blood, or an isolated component of non T-cell, non B-cell mononuclear cells.

19. A PBMC derived induced pluripotent stem cell line generated by the method of any one of claims 1-13 and 15-18, wherein the PBMC derived induced pluripotent stem cell line is derived from non- expanded PBMCs, and wherein the PBMC derived induced pluripotent stem cell line has 5% or less abnormal karyotype over 4-8 passages, or wherein the PBMC derived induced pluripotent stem cell line does not show statistically significant differences between a first and a repeat G-band karyotype analysis, wherein the first or the repeat G-band karyotype analysis occurs during passages 10-23.