DNA methylation measurement for mammals based on conserved loci

Abstract

While methylation chips have 5 been widely used in human studies over the last ten years, methylation chips for non- human species have not, perhaps due to lack of sufficient demand and / or because species specific methylation chips may be suboptimal for cross-species comparisons. To address challenges in this technology, we developed an algorithm, Conserved Methylation Array Probe Selector (CMAPS), 10 which repurposes the degenerate base technology used to tolerate within-human variation to tolerate cross- species mutations. CMAPS performs a greedy search to obtain a maximal number of species that can be targeted using a probe for any CpG in the human genome, based on a multiple sequence alignment. CMAPS then ranks all the probes and chooses a final set so that arrays can be made that can query a large 15 number of mammalian species and varied genomic positions based on external annotations of exons, CpG islands and hyper versus hypo methylated regions.

Description

DNA METHYLATION MEASUREMENT FOR MAMMALS BASED ON CONSERVED LOCI STATEMENT OF GOVERNMENT INTEREST This invention was made with government support under Grant Number 1254200, awarded by the National Science Foundation. TECHNICAL FIELD The invention relates to methods and materials for examining methylation of genomic DNA in mammals. BACKGROUND OF THE INVENTION DNA methylation by the attachment of a methyl group to cytosines is one of the most widely studies epigenetic modifications, due to its implications in regulating gene expression across many biological processes (1,2). In humans, DNA methylation levels can be used to accurately predict an individual's age, as well as age across tissues and cell types (3). The two most widely used technologies for obtaining DNA methylation levels are bisulfite sequencing and microarray-based methylation chips. Whole genome bisulfite sequencing is an expensive assay, causing reduced representation bisulfite sequencing (RRBS) to become the prevalent sequencing approach. RRBS effectively queries only a small number of nucleotides on the genome but still provides a genome wide methylation profile. However, the sequencing depth required even for RRBS can still drive up costs. Due to this, for human samples, array chips containing an increasing number of polynucleotide probes have been the most reliable and widely used technology (4-6). The first human methylation chip (ILLUMINA INFINIUM 27K) was introduced over ten years ago. However, no analogous chip has been presented for other non human mammalian species, a delay which may reflect the fact that it is not economical to design conventional methylation chips for non-human mammals. For example, the development and use of conventional species-specific methylation chips / arrays could hinder cross species comparisons as the measurement platforms are different. In view of this, conventional species-specific methylation chips may be sub-optimal for cross-species comparisons. Consequently, there is a need for methods and materials useful for observing methylation and phenomena associated with methylation (e.g. aging) across a wide variety of mammalian species. SUMMARY OF THE INVENTION Valuable information can be obtained from the study of methylation patterns in mammalian species other than those that are the typical focus of scientific studies (e.g. humans and mice). A problem in such studies however is the fact that it is technically challenging and expensive to develop methods and materials designed for observing methylation profiles in species that are rarely studied (e.g. naked mole-rats and killer whales). In this context, a single measurement platform that is useful to study all mammalian species would provide a solution that makes such endeavors much more efficient and cost effective. The invention disclosed herein provides this platform in the form of methods and materials that can be used to observe methylation and phenomena associated with methylation in a wide variety of mammalian species. As discussed below, one advantageous aspect of the invention is the identification and utilization of highly conserved segments of CpG methylation site containing DNA in the human genome, i.e. segments of the human genome that facilitate cross-species comparisons. The invention disclosed herein has a number of embodiments. One embodiment of the invention is an algorithm termed "Conserved Methylation Array Probe Selector" (CMAPS). This algorithm is used to identify DNA sequences useful in embodiments of the invention such as DNA methylation arrays / chips by repurposing conventional degenerate base technologies that are used to tolerate within-human variation in a manner that allows polynucleotides to tolerate cross- species mutations. In embodiments of the invention, the CMAPS algorithm performs a comprehensive sequence search to obtain a maximal number of species that can be targeted using a single probe for a CpG in the human genome, based on a multiple sequence alignment. The CMAPS algorithm then ranks all the sequences / probes and chooses a final set so that such sequences can be used to query a large number of mammalian species at varied genomic positions based on external annotations of exons, CpG islands and hyper versus hypo methylated regions. The CMAPS algorithm can be used, for example, to facilitate the design of embodiments of the invention, including DNA methylation arrays (e.g. arrays of polynucleotides disposed on a matrix such as a bead or chip). One such embodiment of the invention is a DNA methylation array comprising a plurality of polynucleotides coupled to a matrix, wherein the plurality of polynucleotides are selected by: (a) performing a polynucleotide sequence alignment comparing a human genome with a plurality of non-human mammalian genomes to identify polynucleotide sequences in the human genome comprising CpG methylation sites that are homologous to polynucleotide sequences within genomes of non-human mammalian species comprising CpG methylation sites; (b) ranking the polynucleotide sequences in the human genome identified in (a), wherein the ranking criteria comprises sequence homology to polynucleotide sequences in genomes of non-human mammalian species and then (c) using the ranking in (b) to select a plurality of polynucleotides in the human genome that cross hybridize to a plurality of polynucleotide sequences in the genomes of non-human mammalian species. Other illustrative ranking criteria can comprise for example, identifying those CpG containing polynucleotide sequences that function in the greatest number of different mammalian species; and / or identifying those CpG containing polynucleotide sequences that have been characterized as being significant in other epigenetic biomarker studies (e.g. human aging studies). Typically in these embodiments of the invention, the plurality of human genomic polynucleotide sequences are selected to have not more than a 3 base pair mismatch with polynucleotide sequences in genomes of non-human mammalian species. Optionally, the ranking sequence alignment compares human genomic sequences with genomic sequences of at least 10, 20, 30, 40 or more non-human mammalian species, and / or comprises comparisons of human genomic polynucleotide sequences to genomic polynucleotide sequences in evolutionarily distant species such as non-placental mammalian species as well as placental mammalian species. In certain embodiments of the invention, the DNA methylation chip comprises at least 10,000, 20,000 or 30,000 unique polynucleotides coupled to the matrix. Typically, the polypeptides comprise about 60 nucleotides (e.g. 40-80 nucleotides) that are at least about 95% identical to a DNA segment of a nonhuman mammalian genome comprising a CpG methylation site (e.g. where 57 out of 60 nucleotides of a nonhuman mammalian genome are identical to a 60 nucleotide DNA segment of a human genome). In certain illustrative working embodiments of the invention disclosed herein, at least one polynucleotide within the plurality of polynucleotides is a polynucleotide having a sequence shown in Table 3. A related embodiment of the invention is a DNA methylation array comprising a plurality of polynucleotide sequences coupled to a matrix, wherein the polynucleotides comprise a CpG motif (or its complement) at their terminal ends. These polynucleotides typically comprise sequences of about 60 nucleotides that exhibit an about 95% homology between a human genomic sequence and a genomic sequence of a non-human mammalian species (e.g. 57 out of 60 nucleotides). In certain embodiments of the invention, at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a marsupial mammalian species (e.g. a wallaby species) with less than a 3 base pair mismatch; and / or at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a monotreme mammalian species (e.g. a platypus) with less than a 3 base pair mismatch; and / or at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a laurasiatherian mammalian species (e.g. a bat species) with less than a 3 base pair mismatch; and / or at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a euarchontoglirian mammalian species (e.g. a rodent species) with less than a 3 base pair mismatch; and / or at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a xenarthran mammalian species (e.g. an armadillo species) with less than a 3 base pair mismatch; and / or at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a afrotherian mammalian species (e.g. a tenrec species) with less than a 3 base pair mismatch. Another embodiment of the invention is a method of making a DNA methylation array comprising coupling a plurality of polynucleotides to a matrix. Typically in such embodiments of the invention, the plurality of polynucleotides each comprise a CpG motif (or its complement) and are polynucleotide sequences of about 60 nucleotides that exhibit an about 95% homology between a human genomic sequence and a non-human mammalian species (e.g. 57 out of 60 nucleotides). In typical embodiments of the invention, the DNA methylation array is designed so that it comprises at least 2,000 unique polynucleotide sequences that hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of non-placental mammalian species as well as placental mammalian species with less than a 3 base pair mismatch. Typically, the plurality of polypeptides used to make the DNA methylation array are selected by: (i) performing a polynucleotide sequence alignment comparing a human genome with a plurality of non-human mammalian genomes to identify polynucleotide sequences in the human genome comprising CpG methylation sites that are homologous to polynucleotide sequences comprising CpG methylation sites within genomes of non-human mammalian species; (ii) ranking the polynucleotide sequences in the human genome identified in (a), wherein the ranking criteria comprises sequence homology to polynucleotide sequences in the genomes of non-human mammalian species; and then (iii) using the ranking in (b) to select a plurality of polynucleotides having CpG methylation sites that cross hybridize to a plurality of polynucleotide sequences having CpG methylation sites in the genomes of non-human mammalian species with not more than a 2, 3 or 4 base pair mismatch, so that the DNA methylation array is made. Yet another embodiment of the invention is a method of observing a methylation profile in a non-human mammal comprising obtaining genomic DNA from the non-human mammal; and then observing cytosine methylation of a plurality CG loci in the genomic DNA using a DNA methylation array disclosed herein; so that a methylation profile in the non-human mammal is observed. Optionally this method includes comparing the CG locus methylation profile observed with the CG locus methylation profiles observed in genomic DNA derived from individuals in the non- human mammal species having known ages; and then correlating the CG locus methylation observed with the known ages of the non-human mammal species, so that information useful to determine the age of the non-human mammal is obtained. In typical embodiments of the invention, the DNA methylation array is used to observe methylation profiles in a plurality of non-human mammalian species. Significantly, embodiments of the invention further allow artisans to evaluate whether an intervention (e.g. exposure to a test agent) that affects DNA methylation levels in one species (e.g. mouse) also affects the corresponding DNA methylation levels in another species (e.g. human). In addition, the conserved sequences further allow artisans to develop epigenetic age estimators for different mammalian species (epigenetic clocks) based on highly conserved CpGs. As discussed below, a working embodiment of the invention disclosed herein is termed the "HorvathMammalMethylChip40", and is a DNA methylation array disposed on a chip which contains roughly 38k unique human genomic polynucleotides coupled to a matrix as probes for complementary sequences. Among those, 36,000 polynucleotide probes query CpG sites in conserved regions of the mammalian genome, making this embodiment of the invention useful in studies across all mammalian species. In this embodiment of the invention, the remaining 2,000 probes were chosen due to their special interest in human epigenetic biomarker studies. As shown by the data presented in Table 2 below, the resulting DNA methylation chip is applicable to all mammals and hence drives down the cost per chip through economies of scale. Further, this chip embodiment is tailor-made for cross species comparisons. Other objects, features and advantages of the present invention will become apparent to those skilled in the art from the following detailed description. It is to be understood, however, that the detailed description and specific examples, while indicating some embodiments of the present invention, are given by way of illustration and not limitation. Many changes and modifications within the scope of the present invention may be made without departing from the spirit thereof, and the invention includes all such modifications. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Figure 1 provides graphed data showing CpG sites identified through the CMAPS algorithm target dense CpG islands due to the inclusion of Infinium I probes. The representation of the selected CpGs (blue) is similar to that of all CpGs in the human genome (red). Figure 2. Figure 2 provides graphed data showing CpG sites identified through the CMAPS algorithm target both hyper and hypo methylated CpG sites. The histogram of methylation of the selected probes (red) is similar to that of all sites (blue) in the human genome. Figure 3. Figure 3 provides graphed data showing epigenetic aging clock based on 404 highly conserved CpGs from human methylation data. Left panel: the weighted average of the 404 epigenetic clock CpGs versus chronological age in the training data sets. The rate of change of the red curve can be interpreted as tick rate. Points are colored and labeled by data set as described in Horvath, S. DNA methylation age of human tissues and cell types. Genome Biol. 14, R115 (2013) ("Horvath 2013"). Right panel: analogous results for the test data sets. Only the test data lend themselves for independent validation. DETAILED DESCRIPTION OF THE INVENTION In the description of embodiments, reference may be made to the accompanying figures which form a part hereof, and in which is shown by way of illustration a specific embodiment in which the invention may be practiced. It is to be understood that other embodiments may be utilized, and structural changes may be made without departing from the scope of the present invention. Many of the techniques and procedures described or referenced herein are well understood and commonly employed by those skilled in the art. Unless otherwise defined, all terms of art, notations and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. For example, U.S. Patent Publication 20150259742, U.S. Patent App. No. 15 / 025,185, titled "METHOD TO ESTIMATE THE AGE OF TISSUES AND CELL TYPES BASED ON EPIGENETIC MARKERS", filed by Stefan Horvath; U.S. Patent App. No. 14 / 119,145, titled "METHOD TO ESTIMATE AGE OF INDIVIDUAL BASED ON EPIGENETIC MARKERS IN BIOLOGICAL SAMPLE", filed by Eric Villain et al.; and Hannum et al. "Genome-Wide Methylation Profiles Reveal Quantitative Views Of Human Aging Rates." Molecular Cell. 2013; 49(2):359-367 and patent US2015 / 0259742. As noted above, embodiments of the invention disclosed herein include an algorithm for identifying highly conserved methylation probes (CMAPS) that are useful to observe genomic methylation patterns across a wide variety of mammalian species. The polynucleotide probe sequence information including specific nucleotides within each probe sequence is designed to be tolerable to specified variation. The polynucleotide probes identified by the CMAPS algorithm allow one to measure cytosine methylation levels in short stretches of DNA that are highly conserved across mammals using polynucleotide arrays such as those sold by ILLUMINA. Embodiments of the invention disclosed herein include gene chips comprising a plurality of human genomic sequences identified using the CMAPS algorithm. As discussed below, an illustrative working embodiment of the invention that is disclosed herein is a gene chip comprising a set of 35,988 polynucleotide probes that allow one to assess cytosine DNA methylation levels in essentially all mammalian species. The CMAPS algorithm underlies the design of this custom ILLUMINA Infinium chip (HorvathMammalMethylChip40) which contains these roughly 38k polynucleotide probes. Among those, 36,000 probes query CpG sites in conserved regions of the human genome, making the chip applicable in all mammalian species. The remaining 2,000 probes were chosen due to their special interest in human epigenetic biomarker studies. This DNA methylation chip is useful for observing methylation profiles in all mammalian species and is therefore tailor-made for cross species comparisons. Embodiments of the invention include, for example, methods of making a DNA methylation array comprising a plurality of polynucleotides coupled to a matrix such as a bead or a chip. Typically in these methods, the plurality of polynucleotides are selected by a method comprising: performing a polynucleotide sequence alignment comprising comparing a human genome with a plurality of non-human mammalian genomes to identify polynucleotide sequences in the human genome comprising CpG methylation sites that are homologous to polynucleotide sequences within genomes of non-human mammalian species comprising CpG methylation sites; ranking the polynucleotide sequences in the human genome identified in the polynucleotide sequence alignment, wherein the ranking criteria comprises sequence homology to polynucleotide sequences in genomes of non-human mammalian species; and using this ranking in to select a plurality of polynucleotides in the human genome that cross hybridize to a plurality of polynucleotide sequences in the genomes of non-human mammalian species; and then coupling selected sequences from to a matrix so as to form a DNA methylation array. In typical embodiments of the invention, the DNA methylation array comprises at least 30,000 unique polynucleotides coupled to the matrix. In certain embodiments of the methods for making a DNA methylation array, the plurality of human genomic polynucleotide sequences are selected to have not more than a 3 base pair mismatch with polynucleotide sequences in genomes of non- human mammalian species. Typically, the plurality of polynucleotides are between 40-80 nucleotides in length. In some embodiments of the invention, the ranking of polynucleotide sequences comprises the step of homology comparisons to genomic polynucleotide sequences in non-placental mammalian species, and placental mammalian species in the Laurasiatheria, Euarchontoglires, Xenarthra and Afrotheria superordinal groups. Optionally, the sequence alignment compares human genomic sequences with genomic sequences of at least 10 non-human mammalian species. In another illustrative embodiment of a method of making a DNA methylation array comprising a plurality of polynucleotides coupled to a matrix, the plurality of polynucleotides comprise a CpG motif, and comprise at least 2,000 polynucleotide sequences that hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a marsupial mammalian species, a monotreme mammalian species, a Laurasiatheria mammalian species, a Euarchontoglires mammalian species, a Xenarthra mammalian species and an Afrotheria mammalian species with less than a 3 base pair mismatch. Typically, the polynucleotide sequences are selected by performing a polynucleotide sequence alignment comparing a human genome with a plurality of non-human mammalian genomes to identify polynucleotide sequences in the human genome comprising CpG methylation sites that are homologous to polynucleotide sequences comprising CpG methylation sites within genomes of non- human mammalian species; ranking the polynucleotide sequences in the human genome identified in (a), wherein the ranking criteria comprises a degree of sequence homology to polynucleotide sequences in the genomes of non-human mammalian species; using the rankings to select a plurality of polynucleotides having CpG methylation sites that cross hybridize to a plurality of polynucleotide sequences having CpG methylation sites in the genomes of non-human mammalian species with not more than a 3 base pair mismatch; and then coupling selected sequences from step (b) to a matrix so as to form a DNA methylation array so that the DNA methylation array is made. Embodiments of the invention include a DNA methylation array made by a method disclosed herein. In certain embodiments of the invention, at least 1, 10, 100 or more polynucleotides within the plurality of polynucleotides is a polynucleotide having a sequence shown in Table 3. For example, embodiments of the invention include a DNA methylation array comprising a plurality of polynucleotide sequences coupled to a matrix, wherein the polynucleotides comprise at least 60 nucleotides and a CpG motif at their terminal ends; the polynucleotides comprise polynucleotide sequences present in a human genome; and at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a marsupial mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a monotreme mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a Laurasiatheria mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a Euarchontoglires mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a Xenarthra mammalian species with less than a 3 base pair mismatch; and at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a Afrotheria mammalian species with less than a 3 base pair mismatch. In certain embodiments, the marsupial mammalian species is a Wallaby species; and / or the monotreme mammalian species is a Platypus species; and / or the Laurasiatheria mammalian species is a bat species; and / or the Euarchontoglires mammalian species is a rodent species; and / or the Xenarthra mammalian species is an armadillo species; and / or the Afrotheria mammalian species is a tenrec species. Another embodiment of the invention is a method of observing a methylation profile in a non-human mammal comprising obtaining genomic DNA from the non- human mammal; observing cytosine methylation of a plurality CG loci in the genomic DNA using a DNA methylation array disclosed herein; so that a methylation profile in the non-human mammal is observed. Optionally these methods also include comparing the CG locus methylation observed in the method to the CG locus methylation observed in genomic DNA derived from individuals in the non-human mammal species having known ages; and then correlating the CG locus methylation observed in (b) with the known ages of the non-human mammal species; so that information useful to determine the age of the non-human mammal is obtained. Typically in these embodiments, methylation is observed by a process comprising treatment of genomic DNA from the population of cells from the mammals with bisulfite to transform unmethylated cytosines of CpG dinucleotides in the genomic DNA to uracil; the DNA methylation array is used to observe methylation profiles in a plurality of non-human mammalian species; and / or genomic DNA is amplified by a polymerase chain reaction process. Yet another embodiment of the invention is methods of observing the effects of a test agent (a compound having a molecular weight less than 3,000, 2,000, 1,000 or 500 g / mol, for example rapamycin) on genomic methylation associated epigenetic aging of mammalian cells (e.g. human primary keratinocytes). Typically these methods comprise combining the test agent with mammalian cells; observing methylation status of methylation markers in genomic DNA from the mammalian cells using a DNA methylation array of disclosed herein; and then comparing these observations with observations of the methylation status in genomic DNA from control mammalian cells not exposed to the test agent such that effects of the test agent on genomic methylation associated epigenetic aging in the mammalian cells is observed (e.g. whether or not the test agent decreases or increases genomic methylation patterns that are associated with epigenetic aging). Optionally in these methods, a plurality of test agents are combined with the mammalian cells. In certain embodiments of these methods, polynucleotides are coupled to a matrix, methylation is observed by a process comprising treatment of genomic DNA from the population of cells from the mammals with bisulfite to transform unmethylated cytosines of CpG dinucleotides in the genomic DNA to uracil; and / or genomic DNA is amplified by a polymerase chain reaction process. Further aspects and embodiments of the invention are discussed in the following sections. FURTHER ILLUSTRATIVE ASPECTS AND EMBODIMENTS OF THE INVENTION DNA methylation refers to chemical modifications of the DNA molecule. Technological platforms such as the ILLUMINA Infinium microarray or DNA sequencing-based methods have been found to lead to highly robust and reproducible measurements of the DNA methylation levels in humans. There are more than 28 million CpG loci in the human genome. Consequently, certain loci are given unique identifiers such as those cataloged in the ILLUMINA CpG loci database and used in Table 3 (see, e.g. Technical Note: Epigenetics, CpG Loci Identification ILLUMINA Inc. 2010). Certain illustrative CG locus designation identifiers and sequences are used herein. Such sequences can further be characterized using one or more of the genomic databases that are readily available to artisans in this technology such as the UCSC Genome Browser, an on-line, and downloadable, genome browser hosted by the University of California, Santa Cruz (UCSC). The term "epigenetic" as used herein means relating to, being, or involving a chemical modification of the DNA molecule. Epigenetic factors include the addition or removal of a methyl group which results in changes of the DNA methylation levels. The term "polynucleotide" as used herein may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively. The present invention contemplates any deoxyribonucleotide, ribonucleotide or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethylated or glucosylated forms of these bases, and the like. The polymers or oligomers may be heterogeneous or homogeneous in composition, and may be isolated from naturally-occurring sources or may be artificially or synthetically produced. In addition, the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states. The term "methylation marker" as used herein refers to a CpG position that is potentially methylated. Methylation typically occurs in a CpG containing nucleic acid. The CpG containing nucleic acid may be present in, e.g., in a CpG island, a CpG doublet, a promoter, an intron, or an exon of gene. For instance, in the genetic regions provided herein the potential methylation sites encompass the promoter / enhancer regions of the indicated genes. Thus, the regions can begin upstream of a gene promoter and extend downstream into the transcribed region. The phrase "selectively measuring" as used herein refers to methods wherein only a finite number of methylation marker or genes (comprising methylation markers) are measured rather than assaying essentially all potential methylation marker (or genes) in a genome. For example, in some aspects, "selectively measuring" methylation markers or genes comprising such markers can refer to measuring no less (or no more) than 100, 75, 50, 25, 10 or 5 different methylation markers or genes comprising methylation markers. DNA methylation of the methylation markers (or markers close to them) can be measured using various approaches, which range from commercial array platforms (e.g. from ILLUMINA) to sequencing approaches of individual genes. This includes standard lab techniques or array platforms. A variety of methods for detecting methylation status or patterns have been described in, for example U.S. Pat. Nos. 6,214,556, 5,786,146, 6,017,704, 6,265,171, 6,200,756, 6,251,594, 5,912,147, 6,331,393, 6,605,432, and 6,300,071 and US Patent Application Publication Nos. 20030148327, 20030148326, 20030143606, 20030082609 and 20050009059. Other array-based methods of methylation analysis are disclosed in U.S. patent application Ser. No. 11 / 058,566. For a review of some methylation detection methods, see, Oakeley, E. J., Pharmacology & Therapeutics 84:389-400 (1999). Available methods include but are not limited to: reverse-phase HPLC, thin-layer chromatography, SssI methyltransferases with incorporation of labeled methyl groups, the chloracetaldehyde reaction, differentially sensitive restriction enzymes, hydrazine or permanganate treatment (m5C is cleaved by permanganate treatment but not by hydrazine treatment), sodium bisulfite, combined bisulphate-restriction analysis, and methylation sensitive single nucleotide primer extension. The ILLUMINA method takes advantage of sequences flanking a CpG locus to generate a unique CpG locus cluster ID with a similar strategy as NCBI's refSNP IDs (rs#) in dbSNP (see, e.g. Technical Note: Epigenetics, CpG Loci Identification ILLUMINA Inc. 2010). The methylation levels of a subset of the DNA methylation markers disclosed herein are assayed (e.g. using an ILLUMINA DNA methylation array or using a PCR protocol involving relevant primers). To quantify the methylation level, one can follow the standard protocol described by ILLUMINA to calculate the beta value of methylation, which equals the fraction of methylated cytosines in that location. The invention can also be applied to any other approach for quantifying DNA methylation at locations near the genes as disclosed herein. DNA methylation can be quantified using many currently available assays. In certain embodiments of the invention, the genomic DNA is hybridized to a complimentary sequence (e.g. a synthetic polynucleotide sequence) that is coupled to a matrix (e.g. one disposed within a microarray). Optionally, the genomic DNA is transformed from its natural state via amplification by a polymerase chain reaction process. For example, prior to or concurrent with hybridization to an array, the sample may be amplified by a variety of mechanisms, some of which may employ PCR. See, for example, PCR Technology: Principles and Applications for DNA Amplification (Ed. H. A. Erlich, Freeman Press, NY, N.Y., 1992); PCR Protocols: A Guide to Methods and Applications (Eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res. 19, 4967 (1991); Eckert et al., PCR Methods and Applications 1, 17 (1991); PCR (Eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. Nos. 4,683,202, 4,683,195, 4,800,159, 4,965,188, and 5,333,675. The sample may be amplified on the array. See, for example, U.S. Pat. No. 6,300,070. Embodiments of the invention can include a variety of art accepted technical processes. For example, in certain embodiments of the invention, a bisulfite conversion process is performed so that cytosine residues in the genomic DNA are transformed to uracil, while 5-methylcytosine residues in the genomic DNA are not transformed to uracil. Kits for DNA bisulfite modification are commercially available from, for example, MethylEasyTM (Human Genetic SignaturesTM) and CpGenomeTM Modification Kit (ChemiconTM). See also, WO04096825A1, which describes bisulfite modification methods and Olek et al. Nuc. Acids Res. 24:5064-6 (1994), which discloses methods of performing bisulfite treatment and subsequent amplification. Bisulfite treatment allows the methylation status of cytosines to be detected by a variety of methods. For example, any method that may be used to detect a SNP may be used, for examples, see Syvanen, Nature Rev. Gen. 2:930-942 (2001). Methods such as single base extension (SBE) may be used or hybridization of sequence specific probes similar to allele specific hybridization methods. In another aspect the Molecular Inversion Probe (MIP) assay may be used. Many techniques exist for measuring DNA methylation levels in a single species. For measuring methylation in human DNA, one can use the human ILLUMINA Infinium arrays to measure DNA methylation levels in human DNA samples. A recent paper (Needhamsen et al., BMC Bioinformatics, BMC series – 2017, 18:486) has shown that it is possible to use the EPIC chip for methylation measurements in mouse, but only ~19K out of the 850K probes on the EPIC chip are useful in mouse. Species that are more distant from human are likely to have even fewer useful probes on the EPIC chip, pointing to the need for a platform that can be used in non-human mammals. An alternative to chips / arrays for measuring DNA methylation is bisulfite sequencing (see, e.g. Meissner et al., Nucleic Acids Research, Volume 33, Issue 18, 1 January 2005, Pages 5868–5877), which applies to all mammalian species, but is not established to be as quantitatively reliable. Array technology is particularly valuable for developing highly robust epigenetic biomarkers of aging and development. The current invention provides an algorithm for selecting probes and the results of this algorithm for identifying (non-natural) nucleotide sequences which can be used on methylation arrays / chips that apply to all mammals. We have demonstrated that highly conserved sequences lend themselves for building highly accurate epigenetic aging clocks (see, e.g. U.S. Patent App. No. 15 / 025,185, titled "METHOD TO ESTIMATE THE AGE OF TISSUES AND CELL TYPES BASED ON EPIGENETIC MARKERS"). The first human methylation chip (ILLUMINA Infinium 27K) was introduced over ten years ago but no analogous chip has been presented for other species. This delay may reflect the fact that it is not economical to design a methylation chip for non-human species. Even if costs were no impediment, the development of species- specific arrays could hinder cross species comparisons as the measurement platforms would be different. As noted above, to address these challenges, we developed an algorithm, Conserved Methylation Array Probe Selector (CMAPS), which repurposes the degenerate base technology used to tolerate within-human variation to tolerate cross-species mutations. CMAPS performs a greedy search to obtain a maximal number of species that can be targeted using a probe for any CpG in the human genome, based on a multiple sequence alignment. CMAPS was used to design almost 36,000 probes querying CpG sites in conserved regions of the human genome, making the chip directly applicable to mammalian species and thus facilitating cross species comparisons. To obtain such a large number of probes for a large number of species, CMAPS ranks all the probes and chooses a final set such that each Infinium array can query a large number of mammalian species and varied genomic positions based on external annotations of exons, CpG islands and hyper versus hypo methylated regions. To enhance the utility of the chip in human studies, we also added about 2,000 probes that are of particular interest in human biomarker studies. In the following, we describe the CMAPS algorithm and the properties of the resulting chip (HorvathMammalMethylChip40) ILLUMINA Infinium probes Currently, methylation arrays produced by ILLUMINA can contain two types of probes: Infinium 1 and Infinium 2, with the latter being newer technology requiring only one bead to query a CG, while the former requires two beads. For the design and development of the MammalMethyl40 chip, we leveraged a list of all the human CG sites, which can be interrogated using one or both of these probes. There are two variants of each of the two probes, depending on whether the probe is designed on the forward versus reverse genomic strand. The probes allow for up to 3 degenerate bases, which can tolerate variation in the sequence being interrogated. The number of degenerate bases tolerated is a function of the design score of the probe computed by ILLUMINA, and the number of underlying CpGs in the case of Infinium 2 probes (Table 1). In order to be able to query a certain CpG site, an oligonucleotide probe has to be synthesized on the array containing the 60 base pairs either upstream or downstream of the CpG site. Degenerate base technology allows for a CpG site to be interrogated by a probe even if an individual happens to have variants in the neighboring region that cause mismatches with the synthesized probe (Methods). We developed the CMAPS algorithm, which repurposes this technology to design degenerate bases for each human probe, so that the probe can now tolerate mutations and hybridize to DNA from other species as well. The CMAPS algorithm was applied to a 100-way alignment of 99 other species to the human genome and provides the ability to pick mutations within the rules specified by the underlying array technology, which is the Infinium technology in this particular case. However, the algorithm can take as input any multiple sequence alignment with any reference genome, along with a set of design considerations and provide conserved probes and degenerate base selections within those rules. Determining an initial set of 60,000 probes For each CG site in the human genome we selected the Infinium 1 probe out of the options that covered the most species based on the algorithm described above, and analogously for Infinium 2. We first included all Infinium 2 probes that were targeting the mm10 mouse genome, such that the chip is guaranteed to be useful for one of the most widely used model organisms. We then sorted the CpG sites in descending order of the number of species covered with the Infinium 2 probe, and added all the probes that weren't already selected due to targeting mm10, for a total of up to 53,000 probes. We then ranked the probes on the ILLUMINA EPIC array in descending order of the number of species they can target using the degenerate bases picked by the CMAPS algorithm, and selected an additional 3,000 probes that had not already been picked based on the earlier criteria. Lastly, we sorted the CpG sites in descending order of number of species they can target and picked the top 4,000 Infinium 1 probes that targeted CpG sites that had not already been included. The Infinium 1 probes were selected to allow us to query more CG dense regions, as the underlying CpG count of an Infinium 1 probe does not count against the number of SNVs permitted. This gave us a total of 60,000 probes. Filtering probes based on mappability Since probes on the array are only 60 base pairs long, they run the risk of mapping to multiple locations in the genome, which results in a confounded signal coming from multiple CpG sites. This issue can be compounded by the fact that each of our probes can have up to <semantics>2(#)<annotation encoding="application / x-tex">2^{(\#)}< / annotation>< / semantics> of degenerate bases) variants. For 16 quality genomes we computed for each probe how many of its variants map uniquely in that genome. We then filtered probes down by asking that all variants of a probe have to map uniquely in at least 80% of the species they were designed to target, or the probe has to target at least 40 species. This reduced the set of working probes to the final set of 35,988 probes. Properties of the custom chip The HorvathMammalMethylChip40 profiles fewer than 40k probes (hence the ending "40"). Two thousand out of 38k probes were selected based on their utility for human biomarker studies. These CpGs, which were previously implemented in human ILLUMINA Infinium arrays (EPIC, 450K, 27K) were selected due to their relevance for estimating age, blood cell counts, or the proportion of neurons in brain tissue. The remaining 35,988 probes were chosen to assess cytosine DNA methylation levels in a wide variety of evolutionarily distinct mammalian species. Toward this end, the CMAPS algorithm was employed to identify highly conserved CpGs across 50 mammalian species: 33,493 Infinium II probes and 2,496 Infinium I probes. Not all probes on the array are expected to work for all species, but rather each probe is designed to cover a certain subset of species, such that overall all species have a high number of probes. The particular subset of species for each probe is provided in the chip manifest file. Out of the 50 mammalian species observed, 46 of them have more than 10,000 probes on the array, and 36 have more than 20,000 probes (Table 2). Chromosomal context The CpG sites targeted by these probes represent diverse regions of the genome. Within human, 40% of the CpG sites fall within exonic regions, as expected by the known strong conservation signal in exons. The selected set of CpG sites target dense CpG islands due to our choice to include Infinium I probes (Figure 1), and can target both hyper and hypo methylated CpG sites (Figure 2). Epigenetic clocks based on highly conserved CpGs in humans Using 404 highly conserved CpGs on the ILLUMINA 27K array, we developed a novel epigenetic clock using the same data that were previously used for developing the pan-tissue epigenetic clock disclosed in Horvath, S. DNA methylation age of human tissues and cell types, Genome Biol. 14, R115 (2013). To ensure an unbiased validation in the test data, we only used the training data to define the age predictor. As detailed in Horvath 2013, a transformed version of chronological age was regressed on the CpGs using a penalized regression model (elastic net). The elastic net regression model automatically selected the covariates CpGs. These highly conserved CpGs will be referred to as (epigenetic) clock CpGs since their weighted average (formed by the regression coefficients) amounts to an epigenetic clock. Although the clock was only based on 404 CpGs, the resulting epigenetic age estimator performs remarkably well across a wide spectrum of tissues and cell types (Figure 3). The linear combination of the 404 highly conserved epigenetic clock CpGs (resulting from the regression coefficients) varies greatly across the entire life course (from cradle to grave) as can be seen from Figure 3. The red calibration curve reveals a logarithmic dependence until adulthood that slows to a linear dependence later in life. The rate of change (of this red curve) can be interpreted as the ticking rate of the epigenetic clock. Similar to the original pan tissue clock from Horvath 2013, we find that organismal growth leads to a high ticking rate that slows down to a constant ticking rate (linear dependence) after adulthood. Discussion The CMAPS algorithm facilitated the design of a novel mammalian methylation array that applies to all mammals. The mammalian array is tailor made for cross species comparisons across mammals and for developing biomarkers that apply to multiple species. Our study demonstrates that relatively few highly conserved CpGs (roughly 400) resulting from CMAPS algorithm already lend themselves for building highly accurate epigenetic age estimators (conserved epigenetic clocks). Overall, we expect that the mammalian chip is particularly well suited for DNA methylation-based biomarker studies in mammals. For example, the invention allows one to evaluate whether a specific intervention (e.g. a therapeutic agent and / or regimen) that affects DNA methylation levels in one species (e.g. mouse) also affects the corresponding DNA methylation levels in another species (e.g. a human). METHODS Conserved Methylation Array Probe Selector (CMAPS) The CMAPS algorithm was applied to the Multiz alignment of 99 vertebrates with the hg19 human genome downloaded from the UCSC Genome Browser (7). For the purpose of this chip, only the mammalian species in this alignment were considered. The design scores for each CpG in the human genome and each possible type of probe at each location were provided by ILLUMINA and taken as input by CMAPS. For each CG site in the human genome, we computed the maximum number of species that could be targeted by each of the 4 different possible probe designs in human, considering each possible placing of the maximum number of tolerated mutations. For each probe option we tried all possibilities for placing the maximum number of potential variants, and greedily picked the variant that covers the most species at a particular position. More specifically, the algorithm for selecting the number of species covered by a probe is explain in pseudocode below: The function get max species makes a greedy choice for the nucleotide at a certain SNV by picking whichever nucleotide is contained by the majority of species in the alignment at that position. Function get max species(SNV pos, num SNV, multiple sequence alignment): max species = <semantics>∏<annotation encoding="application / x-tex">\prod< / annotation>< / semantics> for <semantics>X<annotation encoding="application / x-tex">X< / annotation>< / semantics> in <semantics>{A,C,T,G}<annotation encoding="application / x-tex">\{A, C, T, G\}< / annotation>< / semantics> count species = number of species with X at SNV pos in the multiple sequence alignment max species.append(count species, x)) sort(max species, descending = True) # sorts in descending order of number of species covered return max_species[:num_SNV][,1] # return the top num_SNV nucleotides in order of how many species they target In the pseudocode below, SNV set iterates over all possible positions of SNVs in a particular probe, given the design score and probe type constraints. Cur max species = <semantics>1<annotation encoding="application / x-tex">1< / annotation>< / semantics> for SNV_set in all positions in probe: alt nucleotide list = <semantics>∏<annotation encoding="application / x-tex">\prod< / annotation>< / semantics> for SNV_pos in SNV_set: alt_nucleotide_list.append(get_max_species(SNV_pos, multiple_sequence_alignment, count(SNV_pos, SNV_set))) num species = number of species fully matching human given SNV set and alt_nucleotide_list if num_species > cur_max_species: cur_max_species = num_species final <semantics>SNV<annotation encoding="application / x-tex">SNV< / annotation>< / semantics> set <semantics>=SNV<annotation encoding="application / x-tex">= SNV< / annotation>< / semantics> set Since the get_max_species function makes greedy choices this may not be the true maximal subset of species for a probe, but this method is relatively computationally inexpensive and produced satisfactory species coverage for our purposes. Supplementary Data: SupplementMammalianChip36Kprobes The following explanation describes the variables. Forward Sequence: Sequence on forward strand Genome Build: Human Genome build Chromosome: Human Chromosome CG site is located on Coordinate: Human Genomic coordinate (1-based) of "C" in the CG site TB_Strand_OrigP: TOP / BOTTOM strand Top_Sequence: Sequence on TOP strand Methyl Probe Sequence: Methylated probe sequence off by one from sequence selected for Infinium 2 Allele Fr Strand: Forward / Reverse strand Allele TB Strand: TOP / BOT strand Allele CO Strand: Converted / Opposite strand Underlying CpG Count: Underlying CpG count for each site UnMethyl Probe Sequence: Unmethylated probe sequence off by one from sequence selected for Infinium 2 Num Species: Number of mammalian species probe is expected to work in Species: Comma separated genome assembly names of the species the probe is expected to work in Probe Start Coord: Probe start coordinate in 1-based hg19 forward strand Probe End Coord: Probe end coordinate in 1-based hg19 forward strand Reference Probe Sequence: Probe forward strand reference sequence in 1-based hg19 SNV location: hg19 1-based comma separated coordinate of bases where an SNV is designed for SNV original: hg19 comma separated reference nucleotide for each SNV; 1-1 correspondence with the ordering of coordinates in SNV location SNV change: comma separated alternate designed nucleotide for each SNV; 1-1 correspondence with the ordering of coordinates in SNV location and reference nucleotides in SNV original Infinium Type: Infl / Inf2 Infinium probe type Is EPIC site: 0 / 1 binary variable indicating whether CG site is also queried by a probe on the EPIC Array Is_EPIC_design: 0 / 1 binary variable indicating whether the probe querying this site on the EPIC Array is the same Infinium type(1 / 2) and same strands(both forward / reverse and converted / opposite); Is always 0 if Is_EPIC_site is 0 Nvariants: Number of variations of the probe based on SNVs effectively 2^(# SNVs) used in mappability analysis TABLES Table 1: Number of underlying CpGs and / or SNVs tolerated by a probe as a function of type and design score. Table provided by ILLUMINA Inc. [Image disponible dans le document PDF, Image available in the PDF document] Table 2. Illustrative Genome / species and the number of applicable probes out of 15 35,988 probes found by the CMAPS algorithm. [Image disponible dans le document PDF, Image available in the PDF document] [Image disponible dans le document PDF, Image available in the PDF document] [Image disponible dans le document PDF, Image available in the PDF document] Table 3: lists illustrative polynucleotide sequences of probes used for querying highly conserved CpGs. PROBE ID PROBE SEQUENCE SEQ ID NO: = [Image disponible dans le document PDF, Image available in the PDF document] 1 1. cg01107215 GGAAAATCAATACCTTTTAAATGCTGTTTATGTGTGATTAACGGTTAATA 11 cg02551294 GAAGTTATAATTGATATCGGGGCCCATCACCATAATGGGTTCATCATAGC 12 cg09531328 TCAGTCAATACATTTAATAACAACTTACAGGCTATTTTCAATAAAGTGGC 13 cg19635296 TGATACAGCAAACACCCAGAGAGATATGATGACAAATGGGTCCAGATCCC 14 5 cg13684852 GAAATTTCATTCAGTTTGTTGCTAGCAGAGATGAAGTAATCTAAATTGTG 15 cg24978178 GCAACATTTCTCTCTGAGCTAATTAAATCTGGAAATGAATTAGCAACAC 16 cg04108195 GTTAGTCAATTTAATTTATAATTGAATTGGATGGATGTAACTCTGTGTAA 17 cg02883001 TTCATGCGGTAATGACCCTTTTCAGAGACAATGGTCATCATGGATTATGC 18 cg06637343 GGTAATGACCCTTTTCAGAGACAATGGTCATCATGGATTATGCGTTTCCA 19 10 cg22763089 GAGGCCTGATCATGTCTGATGGATTGATTTGCAAATGTAATCAAA 20 cg22620222 TCAGAAATTGAAATGGCCCAGATTAATGTATTATATCTTACACACTGTCC 21 cg18713298 GAATGTCAACAAAATAAATGAAGTTGCGAGTTGAAGTGAAATTTTTATCA 22 cg16884658 GTGAGATTGCTACAGTTCTTGAAGACTTTCCCACAGTACTCACAAGTGTC 23 cg18295902 GTTCACAAACTCTTATAGAGTTTTGGAAGTGTGAATCTTTGAAGCCTGAA 24 15 cg09680988 AATTTGCCACTGTTCCACATGATTAAGCCAGATAATTGTGTGTTGATAGC 25 cg03183633 GCCTTGGGGTAATGACTAATGTCAATGGCAAATTTCACAGTTGTCTAGAG 26 cg26441853 TCCCTGTCTCTGTCATATTTGTCTACTTGAATGGTCCTAAATACCACAGC 27 cg08271353 GATTTAGTGGAATGCAATTAGGAAGCCTAAATTAAGTGGTAATGGAGAAC 28 cg26717373 ATAAACCTGGCCTCTCTAATCGCCTCCTTATGTGCCTGGAACATCTTGAC 29 20 cg02030045 GCTAAATGTATAGAATCAGCTTCTTGCTAAAAACTACAATTACAGGTGAT 30 cg07276805 AACTACAATTACAGGTGATATACAGATTGAAATCACAGGGCTGGTTTGTC 31 cg03231157 GGTTGCTGGCCTGAAACAGTATTATTTATATAGAACATTTACGTTTGTTA 32 cg08816243 ATTAGTGTCTTGTAATTGTTTCATTAAAACCAGTTGTTCCATTTCTCCTC 33 cg02231368 GGCAGAATAATTAATGAATGGTGTCCTTTGTGCTGGTAATAAAGACAAGA 34 25 cg25905100 GAACTTCTTGGAGTTGTTTGCTTTTATAATCAAGGCACAGAAGCAGAACC 35 cg20217707 GCTTAGCAGACACTGAAACAAAATGGACTGTAAAGTTCGTTAGATGAAAA 36 cg20583510 GTTAGATGAAAATATTAAAAAAGAATTAAGCTAATGGAGATAAAATTAAA 37 cq04065686 CACATCACACCAAAAATGGCATTGCAGTGACAGCTAAGATTCCTAATGAC 38 cg04518473 TGTCAGCTTCTACCTTGTATGTCCCCAGGCATCAGTAAAATTGACTGCAC 39 30 cg23885558 TAAAGTGCAAATAAAATTTCTAAAATTAGAAATTAACACACTCATTCGATC 40 cg07744194 ACTCAATTGAAGGTGGCTGTTTCTGAATTAGTCAGCCCTCACAGGCTCTC 41 cg09684189 ACTTTTAAATTCTGTACCACCTGTTTTGGGCAAGACATCTTAGGCAGCGC 42 cg01814663 TTAAATTCTGTACCACCTGTTTTGGGCAAGACATCTTAGGCAGCGCGACC 43 cg03273505 GCCCTGTAGATGTGAAAAAGAAGCAATTATAATGTAGATGAATGA 44 35 cg13448855 CTTACGCTTCTAATTTGTGGCCTTAAATTGCAAACAGAATTTCAGGAGTC 45 cg25709820 GTTAAGTACCAGATATTATATTCTGTAATATGCTTAAGTGATATTAGAGG 46 cg18377384 GCATAGACCAAAGGTGCTATTAAAGACTGAGTGTATGAAATAGGCAGCAT 47 cg00010977 GCCAGTCACAGATATTAAAATGAATTATATCTAATCTGAATTTTAGTCAC 48 cg04951768 GCTTGAGAGATAAAACTTTAAGTGTTGCTCCCAATTAGCACAACAGTGAC 49 40 cg24868933 TCAGCATCTGCTTGCATTCAACACAAAATCACTTTGAATTAAAAATTAAC 50 References Describing methods and materials useful in aspects of the invention For example, U.S. Patent Publication 20150259742, U.S. Patent App. No. 15 / 025,185, titled "METHOD TO ESTIMATE THE AGE OF TISSUES AND CELL TYPES BASED ON EPIGENETIC MARKERS", filed by Stefan Horvath; U.S. Patent App. No. 14 / 119,145, titled "METHOD TO ESTIMATE AGE OF INDIVIDUAL BASED ON EPIGENETIC MARKERS IN BIOLOGICAL SAMPLE", filed by Eric Villain et al.; and Hannum et al. "Genome-Wide Methylation Profiles Reveal Quantitative Views Of Human Aging Rates." Molecular Cell. 2013; 49(2):359-367 and patent US2015 / 0259742. CITED REFERENCES Bernstein, B. E., Meissner, A. & Lander, E. S. The Mammalian Epigenome. Cell 128, 669–681 (2007). Smith, Z. D. & Meissner, A. DNA methylation: roles in mammalian development. Nature Reviews Genetics 14, 204–220 (2013). 3. Horvath, S. DNA methylation age of human tissues and cell types. Genome 15 Biol. 14, R115 (2013). 4. Genome-wide DNA methylation profiling using Infinium® assay | Epigenomics. Available at: https: / / www.futuremedicine.com / doi / abs / 10.2217 / epi.09.14. (Accessed: 28th August 2018) 20 Evaluation of the Infinium Methylation 450K technology. - PubMed - NCBI. Available at: https: / / www.ncbi.nlm.nih.gov / pubmed / 22126295. (Accessed: 28th August 2018) 6. Pidsley, R. et al. Critical evaluation of the ILLUMINA MethylationEPIC BeadChip microarray for whole-genome DNA methylation profiling. Genome Biology 17, 208 (2016). 7. Rosenbloom, K. R. et al. The UCSC Genome Browser database: 2015 update. Nucleic Acids Res. 43, D670-681 (2015). ADDITIONAL PUBLICATIONS DESCRIBING METHODS AND MATERIALS USEFUL IN ASPECTS OF THE INVENTION 1, Horvath S: DNA methylation age of human tissues and cell types. Genome Biol 2013, 14:R115. 2. Hannum G, Guinney J, Zhao L, Zhang L, Hughes G, Sadda S, Klotzle B, Bibikova M, Fan JB, Gao Y, et al: Genome-wide methylation profiles reveal quantitative views of human aging rates. Mol Cell 2013, 49:359-367. 3. Bocklandt S, Lin W, Sehl ME, Sanchez FJ, Sinsheimer JS, Horvath S, Vilain E: Epigenetic predictor of age. PLoS One 2011, 6:e14821. 4. Levine ME, Lu AT, Quach A, Chen BH, Assimes TL, Bandinelli S, Hou L, Baccarelli AA, Stewart JD, Li Y, et al: An epigenetic biomarker of aging for lifespan and healthspan. Aging (Albany NY) 2018. 5. Zhang Y, Wilson R, Heiss J, Breitling LP, Saum KU, Schottker B, Holleczek B, Waldenberger M, Peters A, Brenner H: DNA methylation signatures in peripheral blood strongly predict all-cause mortality. Nat Commun 2017, 8:14617. 6. Bocklandt S, Lin W, Sehl ME, Sanchez FJ, Sinsheimer JS, Horvath S, Vilain E: Epigenetic predictor of age. PLoS One 2011, 6. 7. Weidner CI: Aging of blood can be tracked by DNA methylation changes at just three CpG sites. Genome Biol 2014, 15. 8. Hannum G: Genome-wide methylation profiles reveal quantitative views of human aging rates. Mol Cell 2013, 49. 9. Lin Q, Weidner CI, Costa IG, Marioni RE, Ferreira MRP, Deary IJ: DNA methylation levels at individual age-associated CpG sites can be indicative for life expectancy. Aging 2016, 8:394-401. 10. Marioni R, Shah S, McRae A, Chen B, Colicino E, Harris S, Gibson J, Henders A, Redmond P, Cox S, et al: DNA methylation age of blood predicts all-cause mortality in later life. Genome Biol 2015, 16:25. 11. Christiansen L, Lenart A, Tan Q, Vaupel JW, Aviv A, McGue M, Christensen K: DNA methylation age is associated with mortality in a longitudinal Danish twin study. Aging Cell 2015. 12. Perna L, Zhang Y, Mons U, Holleczek B, Saum K-U, Brenner H: Epigenetic age acceleration predicts cancer, cardiovascular, and all-cause mortality in a German case cohort. Clinical Epigenetics 2016, 8:1-7. 13. Horvath S, Pirazzini C, Bacalini MG, Gentilini D, Blasio AM, Delledonne M, Mari D, Arosio B, Monti D, Passarino G: Decreased epigenetic age of PBMCs from Italian semi-supercentenarians and their offspring. Aging (Albany NY) 2015, 7. CONCLUSION This concludes the description of the preferred embodiment of the present invention. The foregoing description of one or more embodiments of the invention has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the invention to the precise form disclosed. Many modifications and variations are possible in light of the above teaching.

Claims

<pat:Claims com:id="claims"> <pat:Claim com:id="CLM-00001"> <pat:ClaimNumber>1< / pat:ClaimNumber> <pat:ClaimText>1. A method of making a DNA methylation array comprising: (a) selecting a plurality of polynucleotides by: performing a polynucleotide sequence alignment comprising comparing a human genome with a plurality of non-human mammalian genomes to identify polynucleotide sequences in the human genome comprising CpG methylation sites that are homologous to polynucleotide sequences within genomes of non-human mammalian species comprising CpG methylation sites, wherein the polynucleotide sequence alignment compares human genomic sequences with genomic sequences of at least 5 non-human mammalian species including at least one non-placental mammalian species; (b) ranking the polynucleotide sequences in the human genome identified in (a), wherein: the ranking criteria comprises sequence identity to polynucleotide sequences in genomes of non-human mammalian species; and the plurality of human genomic polynucleotide sequences are selected to have not more than a 3 base pair mismatch with polynucleotide sequences in genomic sequences of the at least 5 non-human mammalian species; and (c) using the ranking in (b) to select a plurality of polynucleotides in the human genome that cross hybridize to a plurality of polynucleotide sequences in the genomes of the at least 5 non-human mammalian species; and (d) coupling selected sequences from step (c) to a matrix so as to form a DNA methylation array. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00002"> <pat:ClaimNumber>2< / pat:ClaimNumber> <pat:ClaimText>2. The method of claim 1, wherein the ranking comprises identity comparisons to genomic polynucleotide sequences in non-placental mammalian species, and placental mammalian species in the Laurasiatheria, Euarchontoglires, Xenarthra and Afrotheria superordinal groups. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00003"> <pat:ClaimNumber>3< / pat:ClaimNumber> <pat:ClaimText>3. The method of claim 1, wherein the DNA methylation array comprises at least 30,000 unique polynucleotides coupled to the matrix. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00004"> <pat:ClaimNumber>4< / pat:ClaimNumber> <pat:ClaimText>4. The method of claim 3, wherein the plurality of unique polynucleotides are between 40-80 nucleotides in length. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00005"> <pat:ClaimNumber>5< / pat:ClaimNumber> <pat:ClaimText>5. The method of claim 1, wherein the matrix is a bead or a chip. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00006"> <pat:ClaimNumber>6< / pat:ClaimNumber> <pat:ClaimText>6. A method of making a DNA methylation array comprising a plurality of polynucleotides coupled to a matrix, wherein the plurality of polynucleotides: (a) comprise: a CpG motif; at least 2,000 unique polynucleotide sequences that hybridize to a 60 nucleotide segment in genomic polynucleotide sequences of a marsupial mammalian species, a monotreme mammalian species, a Laurasiatheria mammalian species, a Euarchontoglires mammalian species, a Xenarthra mammalian species and an Afrotheria mammalian species with less than a 3 base pair mismatch; and (b) are selected by: (i) performing a polynucleotide sequence alignment comparing a human genome with a plurality of non-human mammalian genomes to identify polynucleotide sequences in the human genome comprising CpG methylation sites that are homologous to polynucleotide sequences comprising CpG methylation sites within genomes of non-human mammalian species; (ii) ranking the polynucleotide sequences in the human genome identified in (a), wherein the ranking criteria comprises a degree of sequence identity to polynucleotide sequences in the genomes of non-human mammalian species; and (iii) using the ranking in (ii) to select a plurality of polynucleotides having CpG methylation sites that cross hybridize to a plurality of polynucleotide sequences having CpG methylation sites in the genomes of non-human mammalian species with not more than a 3 base pair mismatch; and (c) coupling selected sequences from step (b) to a matrix so as to form a DNA methylation array; so that the DNA methylation array is made. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00007"> <pat:ClaimNumber>7< / pat:ClaimNumber> <pat:ClaimText>7. A DNA methylation array made by the method of any one of claims 1-6. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00008"> <pat:ClaimNumber>8< / pat:ClaimNumber> <pat:ClaimText>8. A DNA methylation array comprising a plurality of polynucleotide sequences coupled to a matrix, wherein: the polynucleotides comprise at least 40 nucleotides and a CpG motif at their terminal ends; the polynucleotides comprise polynucleotide sequences present in a human genome; and: at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a marsupial mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a monotreme mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Laurasiatheria mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Euarchontoglires mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Xenarthra mammalian species with less than a 3 base pair mismatch; and at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Afrotheria mammalian species with less than a 3 base pair mismatch. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00009"> <pat:ClaimNumber>9< / pat:ClaimNumber> <pat:ClaimText>9. The DNA methylation array of claim 8, wherein: the marsupial mammalian species is a Wallaby species; the monotreme mammalian species is a Platypus species; the Laurasiatheria mammalian species is a bat species; the Euarchontoglires mammalian species is a rodent species; the Xenarthra mammalian species is an armadillo species; and the Afrotheria mammalian species is a tenrec species. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00010"> <pat:ClaimNumber>10< / pat:ClaimNumber> <pat:ClaimText>10. The DNA methylation array of any one of claims 7-9, wherein at least one polynucleotide within the plurality of polynucleotides is a polynucleotide selected from any one of SEQ ID NO: 1 to SEQ ID NO:

50. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00011"> <pat:ClaimNumber>11< / pat:ClaimNumber> <pat:ClaimText>11. A method of observing a methylation profile in a non-human mammal comprising: (a) obtaining genomic DNA from the non-human mammal; (b) observing cytosine methylation of a plurality of CG loci in the genomic DNA using a DNA methylation array comprising a plurality of polynucleotide sequences coupled to a matrix, wherein: the polynucleotides comprise at least 40 nucleotides and a CpG motif at their terminal ends; the polynucleotides comprise polynucleotide sequences present in a human genome; and: at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a marsupial mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a monotreme mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Laurasiatheria mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Euarchontoglires mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Xenarthra mammalian species with less than a 3 base pair mismatch; and at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Afrotheria mammalian species with less than a 3 base pair mismatch; so that a methylation profile in the non-human mammal is observed. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00012"> <pat:ClaimNumber>12< / pat:ClaimNumber> <pat:ClaimText>12. The method of claim 11, further comprising: (c) comparing the CG loci methylation observed in (b) to the CG loci methylation observed in genomic DNA derived from individuals in the non-human mammal species having known ages; and (d) correlating the CG loci methylation observed in (b) with the known ages of the non-human mammal species. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00013"> <pat:ClaimNumber>13< / pat:ClaimNumber> <pat:ClaimText>13. The method of claim 11, wherein: methylation is observed by a process comprising treatment of genomic DNA from a population of cells from a mammal with bisulfite to transform unmethylated cytosines of CpG dinucleotides in the genomic DNA to uracil; the DNA methylation array is used to observe methylation profiles in a plurality of non-human mammalian species; and / or genomic DNA is amplified by a polymerase chain reaction process. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00014"> <pat:ClaimNumber>14< / pat:ClaimNumber> <pat:ClaimText>14. A method of observing the effects of a test agent on genomic methylation associated epigenetic aging of mammalian cells, the method comprising: (a) combining the test agent with mammalian cells; (b) observing methylation status of methylation markers in genomic DNA from the mammalian cells using a DNA methylation array comprising a plurality of polynucleotide sequences coupled to a matrix, wherein: the polynucleotides comprise at least 40 nucleotides and a CpG motif at their terminal ends; the polynucleotides comprise polynucleotide sequences present in a human genome; and: at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a marsupial mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a monotreme mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Laurasiatheria mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Euarchontoglires mammalian species with less than a 3 base pair mismatch; at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Xenarthra mammalian species with less than a 3 base pair mismatch; and at least 2,000 polynucleotides within the plurality of polynucleotide sequences can hybridize to a 40 nucleotide segment in genomic polynucleotide sequences of a Afrotheria mammalian species with less than a 3 base pair mismatch; (c) comparing the observations from (b) with observations of the methylation status in genomic DNA from control mammalian cells not exposed to the test agent such that effects of the test agent on genomic methylation associated epigenetic aging in the mammalian cells is observed. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00015"> <pat:ClaimNumber>15< / pat:ClaimNumber> <pat:ClaimText>15. The method of claim 14, wherein a plurality of test agents are combined with the mammalian cells. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00016"> <pat:ClaimNumber>16< / pat:ClaimNumber> <pat:ClaimText>16. The method of claim 14, wherein the cells are human primary keratinocytes. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00017"> <pat:ClaimNumber>17< / pat:ClaimNumber> <pat:ClaimText>17. The method of claim 14, wherein the test agent is a compound having a molecular weight less than 3,000 g / mol, 2,000 g / mol, 1,000 g / mol or 500 g / mol. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00018"> <pat:ClaimNumber>18< / pat:ClaimNumber> <pat:ClaimText>18. The method of claim 14, wherein: methylation is observed by a process comprising treatment of genomic DNA from the population of the mammalian cells with bisulfite to transform unmethylated cytosines of CpG dinucleotides in the genomic DNA to uracil; and / or genomic DNA is amplified by a polymerase chain reaction process. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00019"> <pat:ClaimNumber>19< / pat:ClaimNumber> <pat:ClaimText>19. The method of claim 1, 11 or 14, wherein at least one polynucleotide within the plurality of polynucleotides is a polynucleotide selected from any one of SEQ ID NO: 1 to SEQ ID NO:

50. < / pat:ClaimText> < / pat:Claim> < / pat:Claims>