Compositions useful in treatment of metachromatic leukodystrophy
The use of a replication-defective adeno-associated virus (rAAV) delivering hARSA directly to the CNS addresses the limitations of current MLD treatments by ensuring effective enzyme expression, thereby halting or preventing disease progression in Metachromatic Leukodystrophy.
Patent Information
- Authority / Receiving Office
- CA · CA
- Patent Type
- Patents
- Current Assignee / Owner
- THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
- Filing Date
- 2020-05-02
- Publication Date
- 2026-07-28
AI Technical Summary
Current treatments for Metachromatic Leukodystrophy (MLD), such as enzyme replacement therapy (ERT) and hematopoietic stem cell transplantation (HSCT), are inadequate for rapidly progressive forms of the disease, particularly early onset MLD, due to limitations in enzyme delivery across the blood-brain barrier and risks associated with transplantation, while gene therapies face challenges like insertional mutagenesis and insufficient metabolic correction.
A replication-defective adeno-associated virus (rAAV) carrying a functional human Arylsulfatase A (hARSA) gene is administered directly to the central nervous system via intra-cisterna magna injection, using an AAVhu68 capsid and engineered regulatory sequences to ensure effective enzyme expression in target cells.
The rAAV delivery system provides sustained ARSA enzyme activity in the CNS, potentially halting or preventing disease progression in MLD patients, offering a safer and more effective therapeutic option than existing methods.
Abstract
Description
COMPOSITIONS USEFUL IN TREATMENT OF METACHROMATIC LEUKODYSTROPHY BACKGROUND OF THE INVENTION Metachromatic Leukodystrophy (MLD) is a monogenic autosomal recessive sphingolipid storage disease caused by mutations in the gene encoding the lysosomal enzyme ARSA (Von Figura et al., 2001; Gieselmann and Krageloh-Mann, 2010). ARSA deficiency leads to accumulation of its natural substrates, which are sulfated galactosphingolipids (galactosylceramide-3-O-sulfate and galactosylsphingosine-3-O-sulfate), commonly referred to as sulfatides. Sulfatides accumulate within the lysosomes of oligodendrocytes, microglia, and certain types of neurons in the Central Nervous System (CNS), in addition to Schwann cells and macrophages in the Peripheral Nervous System (PNS) (Peng and Suzuki, 1987). While the PNS and CNS are mainly affected, sulfatide storage also occurs in visceral organs; most notably, the kidney, liver (Toda et al., 1990), and gallbladder (Rodriguez-Waitkus et al., 2011; McFadden and Ranganathan, 2015). MLD patients (i.e., those who carry a mutation on both alleles) typically have ARSA enzyme activity that is <semantics>0−10%<annotation encoding="application / x-tex">0-10\%< / annotation>< / semantics> of control values in synthetic substrate-based assays. ARSA mutation carriers, who have a single mutated ARSA allele and one normal allele, are clinically unaffected and usually have ARSA enzyme activity that is approximately 10% of control values, while asymptomatic individuals with pseudodeficiency (PD, another genetically distinct form of ARSA deficiency) alleles have ARSA enzyme activity that is approximately 10-20% of healthy controls (Gomez-Ospina, 2017). Clinically, three forms of MLD can be distinguished based on age of symptom onset that span a broad continuous spectrum of disease severity: a rapidly progressive severe late infantile form, a juvenile form, and a late onset slowly progressive adult form comprising 50-60%, 20-30%, and 15-20% of MLD diagnoses, respectively (Gomez-Ospina, 2017, Wang et al., 2011). Infantile MLD is considered an orphan disease. Late infantile MLD has an onset before 30 months of age and is the most severe form of the disease. The late infantile form has a uniform clinical presentation and a rapidly progressive, predictable disease course. Juvenile MLD is characterized by an age of onset between the age of 30 months and 16 years with a median age of onset of 6 years 2 months (Kehrer et al., 2011a) to 10 years (Mahmood et al., 2010), depending on the study. In order to better characterize the clinical phenotype, a subset of juvenile MLD patients has been described, referred to as early juvenile MLD, who have a clinical onset <semantics>≤6<annotation encoding="application / x-tex">\leq 6< / annotation>< / semantics> years of age and who have a similar, although less rapid, initial disease evolution compared to children with late infantile MLD (Biffi et al., 2008; Chen et al., 2016; Sessa et al., 2016). The early juvenile and late infantile phenotypes are collectively referred to as early onset MLD (Sessa et al., 2016). In late juvenile MLD patients (i.e., those with symptom onset between 7–16 years of age), behavioral issues, attention deficit, or cognitive decline usually develops first, sometimes in combination with gait disturbances. There is no approved curative or disease-modifying therapy for MLD. Since MLD is caused by defective ARSA, various investigational approaches aim to correct the biochemical defect by replacing functional ARSA in affected neural tissue of the CNS. Enzyme replacement therapy (ERT) and hematopoietic stem cell transplantation (HSCT) rely on providing normal enzyme to ARSA-deficient cells, while gene therapy approaches are based on the overexpression of wild-type ARSA in different cell types (Patil and Maegawa, 2013). The efficacy of Hematopoietic Stem Cell Transplantation (HSCT) using umbilical cord blood (UCB), allogeneic peripheral blood stem cells, or allogeneic bone marrow depends on the MLD phenotype and the timing of intervention relative to the disease state of the patient (Patil and Maegawa, 2013; van Rappard et al., 2015). Bone marrow transplant (BMT) requires availability of a human leukocyte antigen-matched sibling donor for the best outcome (Boucher et al., 2015) and carries risks of transplant- and conditioning-related complications, such as graft versus host disease (GvHD), infections, and death. Umbilical Cord Blood (UCB) transplantation provides an alternative to BMT with the advantage of quicker availability, lower risk of GvHD, lower mortality, higher rates of full-donor chimerism, and better correction of enzymatic defect (Batzios and Zafeiriou, 2012; Martin et al., 2013). However, BMT is not widely available in Europe. Brain engraftment is slow, often taking many months for cells to engraft, migrate to the CNS, differentiate, and restore enzyme levels. Moreover, physiological enzyme levels achieved with HSCT may not be sufficient to correct the deficit throughout the CNS. This may explain why transplant is not efficacious in rapidly progressive early onset MLD, and may not correct or stabilize all aspects of the disease even when performed pre-symptomatically (de Hosson et al., 2011; Martin et al., 2013; Boucher et al., 2015). Thus, there remains a substantial unmet need for fast-onset therapies that can halt or prevent disease progression in these patients. In addition to HSCT, various other cell-based approaches exist that (over)express ARSA and deliver enzyme to affected cells and treat the neurological manifestations of MLD, including microencapsulated recombinant cells, oligodendrocyte and neural progenitor cells, and embryonic stem cells. These cell therapies have shown considerable clearance of sulfatide storage in animal models (Patil and Maegawa, 2013), but are still untested in humans. Ex vivo lentiviral gene therapy has been attempted which combines hematopoietic stem cell transplant with gene therapy (HSC-GT) (Biffi et al., 2013) by transducing autologous CD34+ cells with a human ARSA-encoding lentiviral vector and re-administering the gene-corrected cells to the patient. While this therapy is promising for patients identified at a pre-symptomatic stage (after diagnosis in an older affected sibling), it has not been shown to be efficacious in patients who are already symptomatic. Unfortunately, most new MLD diagnoses are made after symptom onset because newborn screening is not yet available, making it an unlikely therapeutic option for many MLD patients. Additionally, there are risks inherent to the myeloablative conditioning regimen and risk of insertional mutagenesis associated with these integrating vectors. A pharmacological-toxicological study in NHPs demonstrated significant dose-limiting toxicity (Zerah et al., 2015) due to brain inflammation (encephalitis) localized around injection sites. A Phase 1 / 2 clinical study to assess safety and efficacy of AAVrh10-mediated ARSA gene transfer in the brain of children affected with early onset MLD is ongoing (NCT01801709) (Aubourg, 2016) likewise involved intra-cerebral vector administration at 12 sites in the white matter of the brain (Zerah et al., 2015). Results of the trial have not been published, except in abstract form, with preliminary reports suggesting lack of efficacy at preventing onset or stopping disease progression (Sevin et al., 2018). The reasons for the lack of efficacy have not been discussed by the sponsor of the trial. In addition to AAVrh10-mediated gene therapy, an intra- cerebrally delivered lentiviral gene therapy is also recruiting patients with any form of MLD (NCT03725670). Enzyme replacement therapy (ERT) is now the Standard of Care (SOC) for several Lysosomal Storage Diseases (LSDs) (Sands, 2014) and relies on the ability of cells to take up infused enzyme via mannose-6-phosphate receptors (Ghosh et al., 2003). In MLD, ERT reduces sulfatide storage in the kidneys, peripheral nerves, and CNS in Arsa- / - mice (Matzner et al., 2005). In an aggravated MLD mouse model with immune tolerance to human ARSA and supra-normal sulfatide synthesis, improvements in MLD symptoms and reduction in sulfatide storage was seen only in mice treated at early time points, suggesting that IV-administered ERT may not work in patients with advanced symptoms (Matthes et al., 2012). In the same model, continuous IT infusion of recombinant ARSA to bypass the BBB (Stroobants et al., 2011) resulted in complete reversal of sulfatide storage and correction of CNS dysfunction, while other non-clinical studies in mice result in reduced sulfatide storage and improved functional outcomes (Matzner et al., 2009; Piguet et al., 2012). However, in humans, the extent of metabolic correction with ERT will unlikely be sufficient and timely to arrest the rapid cerebral demyelination that occurs in early onset MLD (Rosenberg et al., 2016). Since the BBB restricts access to the CNS of most large proteins, it is believed that ERT will likely only work when delivered directly to the CNS (Abbott, 2013), and the short half-life will require frequent administration. This hypothesis is bearing out in ERT clinical trials that attempted to overcome these limitation through frequent high dose IV administration (NCT00681811) or IT injection (Giugliani et al., 2018). However, results in late infantile MLD patients with IV-administered ERT have been disappointing (NCT00418561), along with IT-administered ERT in early onset and late juvenile MLD (NCT01510028). Small molecule-based treatments can potentially overcome limitations of current therapies for MLD (e.g., by crossing the BBB) and may also address different pathogenic mechanisms of the disease. Warfarin (Coumadin) is an anti-coagulant that has been tested as a substrate-reducing agent in a small cohort of late infantile MLD patients. There was no beneficial effect on urinary sulfatide levels or levels of the brain biomarkers N-acetylaspartate and myo- inositol (Patil and Maegawa, 2013). The limited benefit, restricted population, short therapeutic window, and associated risks of HSCT and HSC-GT combined with the overall disappointing non-clinical results obtained with other investigational approaches represent a significant unmet clinical need for other viable treatment options, especially for early onset MLD patients. What is desirable are alternative therapeutics for treatment of conditions associated with abnormal ARSA gene and / or Metachromatic Leukodystrophy. SUMMARY OF THE INVENTION Provided herein is a therapeutic, recombinant, and replication-defective adeno-associated virus (rAAV) which is useful for treating a disease associated with an Arylsulfatase A gene (ARSA) mutation (for example, Metachromatic Leukodystrophy, i.e., MLD, or ARSA pseudodeficiency) in a subject in need thereof. The rAAV is desirably replication-defective and carries a vector genome comprising inverted terminal repeats (ITR) and a nucleic acid sequence encoding a functional human Arylsulfatase A (hARSA) under the control of regulatory sequences which direct the hARSA expression in a target cell. In certain embodiment, the rAAV further comprises an AAVhu68 capsid in which the vector genome is packaged. In certain embodiments, the vector genome is entirely exogenous to the AAVhu68 capsid, as it contains no AAVhu68 genomic sequences. In certain embodiments, the functional hARSA has a signal peptide and a sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2. In certain embodiments, the native hARSA signal peptide is used, e.g., as 1 to as 18 of SEQ ID NO: 2. In certain embodiment, the signal peptide is aa 1 to aa 20 of SEQ ID NO: 4. In certain embodiment, the functional hARSA has an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4. In certain embodiments, the hARSA coding sequence is about 95% to 100% identical to nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1. In certain embodiments, the hARSA-coding sequence is SEQ ID NO: 1 or SEQ ID NO: 3. In a further embodiment, the hARSA coding sequence encodes a sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2. In yet a further embodiment, the hARSA coding sequence encodes a sequence of SEQ ID NO: 2 or SEQ ID NO: 4. In certain embodiments, the regulatory sequences comprise one or more of the following: a regulatory element derived from the chicken β-actin (BA) promoter and human cytomegalovirus immediate-early enhancer (CMV IE) (for example, CB7 promoter, nt 198 to nt 862 of SEQ ID NO: 5), a chimeric intron consisting of a chicken BA splice donor and a rabbit β- globin (rBG) splice acceptor element(for example, CI, nt 956 to nt 1928 of SEQ ID NO: 5), and polyadenylation (PolyA) signal derived from the rBG gene (for example, rBG, nt 3539 to nt 3665) of SEQ ID NO: 5). In certain embodiments, the vector genome has a sequence of nucleotide (nt) 1 to nt 3883 of SEQ ID NO: 5. In certain embodiments, the rAAV or a composition comprising the rAAV is administrable to a subject in need thereof to ameliorate symptoms of a disease associated with an ARSA mutation (for example, MLD) and / or to delay progression of a disease associated with an ARSA mutation (for example, MLD). In another aspect, a production system useful for producing the rAAV is provided. In this system, cells which comprise a nucleic acid sequence encoding an AAVhu68 capsid protein are cultured, a vector genome as described herein and sufficient AAV rep functions and helper functions to permit packaging of the vector genome into the AAV capsid. In one aspect, provided herein is a vector which is useful for treating a disease associated with an ARSA mutation (for example, MLD) in a subject in need thereof. The vector carries a nucleic acid sequence encoding a functional human Arylsulfatase A (hARSA) under the control of regulatory sequences which direct the hARSA expression in a target cell. In certain embodiments, the hARSA-coding sequence is about 95% to 100% identical to SEQ ID NO: 1. Additionally or alternatively, the function hARSA protein has an amino acid sequence of SEQ ID NO: 2. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 1. In certain embodiments, the vector or a composition comprising the vector is administrable to a subject in need thereof to ameliorate symptoms of a disease associated with an ARSA mutation (for example, MLD), and / or to delay progression of a disease associated with an ARSA mutation (for example, MLD). In a further aspect, provided herein is a composition comprising a rAAV or a vector as described herein and an aqueous suspension media. In certain embodiments, the aqueous composition is provided which comprises a formulation buffer and the rAAV or vector as described. In certain embodiments, the formulation buffer comprises: an artificial cerebrospinal fluid comprising buffered saline and one or more of sodium, calcium, magnesium, potassium, or mixtures thereof; and a surfactant. In certain embodiments, the formulation buffer comprises about 0.0005 % to about 0.001% surfactant. In certain embodiments, the composition is at a pH of 7.2 to 7.8. In another aspect, a method of treating a subject having a disease associated with an ARSA mutation (for example, MLD), or ameliorating symptoms of a disease associated with an ARSA mutation (for example, MLD), or delaying progression of a disease associated with an ARSA mutation (for example, MLD) is provided. The method comprises administrating an effective amount of a rAAV or a vector as described herein to a subject in need thereof. In certain embodiments, the vector or rAAV is administrable to a patient via an intra-cisterna magna injection (ICM), for example, CT-guided sub-occipital injection into the cisterna magna. In certain embodiments, a vector or a composition is provided which is administrable to a patient having Metachromatic Leukodystrophy who is 7 years of age or younger, or who is 6 years of age or younger. In certain embodiments, the method involves delivering the rAAV or the vector to a human patient in a single dose. These and other aspects of the invention are apparent from the following detailed description of the invention. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 provides the engineered hARSA coding sequence (SEQ ID NO: 1, i.e., nt 7 to nt 1527 of SEQ ID NO: 3 and nt 1968 to nt 3488 of SEQ ID NO: 5). FIG. 2 provides a linear map of the AAV.CB7.CI.hARSAco.rBG vector genome. The vector genome is to express an engineered version of human ARSA (hARSAco) under the control of the ubiquitous CB7 promoter. CB7 is composed of a hybrid between a CMV IE enhancer and a chicken BA promoter. ARSA, arylsulfatase A; BA, β-actin; CMV IE, cytomegalovirus immediate-early; ITR, inverted terminal repeats; PolyA, polyadenylation; and rBG, rabbit β- globin. FIG. 3 provides a linear map of the cis plasmid, termed pENN.AAV.CB7.CI.hARSAco.rBG.KanR. BA, β-actin; bp, base pairs; CMV IE, cytomegalovirus immediate-early; hARSAco, human arylsulfatase A (engineered); ITR, inverted terminal repeat; KanR, kanamycin resistance; Ori, origin of replication; PolyA, polyadenylation; rBG, rabbit β-globin. FIG. 4 provides a linear map of the trans plasmid pAAV2 / hu68.KanR. AAV2, adeno- associated virus serotype 2; AAVhu68, adeno-associated virus serotype hu68; bp, base pairs; Cap, capsid; KanR, kanamycin resistance; Ori, origin of replication; Rep, replicase. FIGs. 5A and 5B provide an adenovirus helper plasmid pAdDeltaF6(KanR). FIG. 5A shows derivation of the helper plasmid pAd\Delta F6 from parental plasmid pBHG10 through intermediates pAd<semantics>Δ<annotation encoding="application / x-tex">\Delta< / annotation>< / semantics>F1 and pAd<semantics>Δ<annotation encoding="application / x-tex">\Delta< / annotation>< / semantics>F5. FIG. 5B shows that the ampicillin resistance gene in pAd<semantics>Δ<annotation encoding="application / x-tex">\Delta< / annotation>< / semantics>F6 was replaced by the kanamycin resistance gene to generate pAd<semantics>Δ<annotation encoding="application / x-tex">\Delta< / annotation>< / semantics>F6(Kan). FIG. 6 provides a manufacturing process flow diagram for producing AAVhu68.hARSAco vector. AAV, adeno-associated virus; AEX, anion exchange; CRL, Charles River Laboratories; ddPCR, droplet digital polymerase chain reaction; DMEM, Dulbecco's modified Eagle medium; DNA, deoxyribonucleic acid; FFB, final formulation buffer; GC, genome copies; HEK293, human embryonic kidney 293 cells; ITFFB, intrathecal final formulation buffer; PEI, polyethylenimine; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; TFF, tangential flow filtration; USP, United States Pharmacopeia; WCB, working cell bank. FIG. 7 provides a manufacturing process Flow Diagram for AAVhu68.hARSAco vector. Ad5, adenovirus serotype 5; AUC, analytical ultracentrifugation; BDS, bulk drug substance; BSA, bovine serum albumin; CZ, Crystal Zenith; ddPCR, droplet digital polymerase chain reaction; E1A, early region 1A (gene); ELISA, enzyme-linked immunosorbent assay; FDP, filled drug product; GC, genome copies; HEK293, human embryonic kidney 293 cells; ITFFB, intrathecal final formulation buffer; KanR, kanamycin resistance (gene); MS, mass spectrometry; NGS, next-generation sequencing; qPCR, quantitative polymerase chain reaction; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; TCID50, 50% tissue culture infective dose; UPLC, ultra-performance liquid chromatography; USP, United States Pharmacopeia. FIG. 8 shows ARSA enzyme activity in the left and right cerebral hemispheres of mice following intracerebroventricular administration of the AAVhu68.CB7.CI.hARSAco.rBG vector. Six-week-old C57BL6 / J wild type mice received a single ICV injection of the AAVhu68.CB7.CI.hARSAco.rBG vector into the right ventricle at a dose of either <semantics>1.00×1010<annotation encoding="application / x-tex">1.00 \times 10^{10}< / annotation>< / semantics> GC (low dose) or <semantics>1.00×1011<annotation encoding="application / x-tex">1.00 \times 10^{11}< / annotation>< / semantics> GC (high dose) (N=5 / group). Age-matched C57BL6 / J wild type mice were ICV-administered PBS into the right ventricle as a control (N=4). Mice were necropsied 21 days later, and ARSA enzyme activity in the left and right cerebral hemispheres was measured based upon the rate of hydrolysis of the chromogenic substrate, 4-nitrocatechol sulfate (nmol / mg / hr). ARSA, arylsulfatase A (protein); GC, genome copies; ICV, intracerebroventricular; N, number of animals, PBS, phosphate -buffered saline. See, Example 2 for more details. FIGs. 9A to 9B show ARSA enzyme activity in the liver and serum of mice following intracerebroventricular administration of the AAVhu68.CB7.CI.hARSAco.rBG vector. Six-week- old C57BL6 / J wild type mice received a single ICV injection of the AAVhu68.CB7.CI.hARSAco.rBG vector into the right ventricle at a dose of either <semantics>1.00×1010<annotation encoding="application / x-tex">1.00 \times 10^{10}< / annotation>< / semantics> GC (low dose) or <semantics>1.00×1011<annotation encoding="application / x-tex">1.00 \times 10^{11}< / annotation>< / semantics> GC (high dose) (N=5 / group). Age-matched C57BL6 / J wild type mice were ICV-administered PBS into the right ventricle as a control (N=4). Mice were necropsied 21 days later, and ARSA enzyme activity in the FIG. 9A serum and FIG. 9B liver was measured based upon the rate of hydrolysis of the chromogenic substrate, 4-nitrocatechol sulfate (nmol / mg / hr). ARSA, arylsulfatase A (protein); GC, genome copies; ICV, intracerebroventricular; N, number of animals; PBS, phosphate-buffered saline. FIG. 10 shows delivery of ARSA to Neurons and Oligodendrocytes in the brain following intracerebroventricular administration of AAVhu68.CB7.CI.hARSAcoHA.rBG in mice. Six- week-old C57BL6 / J wild type mice received a single ICV injection of AAVhu68.CB7.CI.hARSAcoHA.rBG into the right ventricle at a dose of either 1.00 x 1010 GC (low dose) or 1.00 x 1011 GC (high dose) (N=5 / group). Age-matched C57BL6 / J wild type mice were ICV-administered PBS into the right ventricle as a control (N=5). Mice were necropsied 21 days later, and brain tissue was obtained. Tissues were sectioned and immunostained to visualize ARSA (green: anti-HA primary antibody detected with a fluorescein isothiocyanate- conjugated secondary antibody) and oligodendrocytes (red: anti-OLIG2 primary antibody) detected with a tetramethylrhodamine-conjugated secondary antibody). Representative images of the brain cortex are shown at 20x magnification with 500 ms exposure. Cropped and zoomed-in views (bottom row) show oligodendrocytes from the subcortical white matter expressing ARSA. ARSA, arylsulfatase A (protein); GC, genome copies; HA, hemagglutinin; ICV, intracerebroventricular; N, number of animals; OLIG2, oligodendrocyte transcription factor 2; PBS, phosphate-buffered saline. FIG. 11 shows ARSA activity levels in cerebrospinal fluid of nonhuman primates following intra-cisterna magna administration of AAVhu68.CB7.CI.hARSAco.rBG. Adult cynomolgus macaques received a single ICM administration of AAVhu68,CB7,CI,hARSAco,rBG at a dose of <semantics>3.00×1012<annotation encoding="application / x-tex">3.00 \times 10^{12}< / annotation>< / semantics> GC (LD), <semantics>1.00×1013<annotation encoding="application / x-tex">1.00 \times 10^{13}< / annotation>< / semantics> GC (MD), or 3.00 x 1013 GC (HD) (N=2 / group). After AAVhu68.CB7.CI.hARSAco.rBG administration (Day 0), CSF was collected on Days 7, 14±1, 21±1, 35±1, and 42±2. ARSA activity was measured by the rate of hydrolysis of the chromogenic substrate, 4-nitrocatechol sulfate (nmol / [hr*mL]). Endogenous macaque ARSA activity, which was defined as each individual's baseline ARSA activity levels prior to ICM administration, was subtracted to obtain ARSA activity resulting from AAVhu68.CB7.CI.hARSAco.rBG administration. The dotted line represents baseline ARSA activity levels for each individual. ARSA, arylsulfatase A (protein); CSF, cerebrospinal fluid; GC, genome copies; HD, high dose; ICM, intra-cisterna magna, LD, low dose; MD, mid-dose; N, number of animals. Arrows from the legend are used to indicate each trial. FIGs. 12A and 12B provide anti-ARSA antibody levels in cerebrospinal fluid and serum of nonhuman primates following intra-cisterna magna administration of AAVhu68.CB7.CI.hARSAco.rBG. Adult cynomolgus macaques received a single ICM administration of AAVhu68.CB7.CI.hARSAco.rBG on Day 0 at a dose of 3.00 x 1012 GC (LD), <semantics>1.00×1013<annotation encoding="application / x-tex">1.00 \times 10^{13}< / annotation>< / semantics> GC (MD), or <semantics>3.00×1013<annotation encoding="application / x-tex">3.00 \times 10^{13}< / annotation>< / semantics> GC (HD) (N=2 / group). Untreated age-matched cynomolgus macagues served as a control (N=2). After AAVhu68.CB7.CI.hARSAco.rBG administration (Day 0), CSF was collected on Days 7, <semantics>14±1<annotation encoding="application / x-tex">14\pm1< / annotation>< / semantics>, <semantics>21±1<annotation encoding="application / x-tex">21\pm1< / annotation>< / semantics>, <semantics>35±1<annotation encoding="application / x-tex">35\pm1< / annotation>< / semantics>, and <semantics>42±2<annotation encoding="application / x-tex">42\pm2< / annotation>< / semantics>. Serum was collected on Days 7, <semantics>14±1<annotation encoding="application / x-tex">14\pm1< / annotation>< / semantics>, <semantics>21±1<annotation encoding="application / x-tex">21\pm1< / annotation>< / semantics>, <semantics>28±1<annotation encoding="application / x-tex">28\pm1< / annotation>< / semantics>, <semantics>35±1<annotation encoding="application / x-tex">35\pm1< / annotation>< / semantics>, and <semantics>42±2<annotation encoding="application / x-tex">42\pm2< / annotation>< / semantics>. An indirect ELISA was performed on the CSF (dilution 1:20, FIG. 12A) and serum (dilution 1:1000, FIG. 12B) using plates pre-coated with recombinant human ARSA to measure anti-hARSA antibody levels (absorbance at 450 nm). The dotted line represents the absorbance average in untreated controls. ARSA, arylsulfatase A (protein); CSF, cerebrospinal fluid; ELISA, enzyme-linked immunosorbent assay; GC, genome copies; hARSA, human arylsulfatase A; HD, high dose; ICM, intra-cistema magna, LD, low dose; MD, mid dose; N, number of animals. Arrows from the legend are used to indicate each trial. FIG. 13A-13L show human ARSA expression in the brain of nonhuman primates following intra-cisterna magna administration of AAVhu68.CB7.CI.hARSAco.rBG. Adult cynomolgus macaques received a single ICM administration of AAVhu68.CB7.CI.hARSAco.rBG at a dose of 3.00 x 1013 GC (HD) (N=2). Untreated age- matched cynomolgus macaques served as a control (N=2). Animals were necropsied 42±2 days after AAVhu68.CB7.CI.hARSAco.rBG administration, and brains were obtained for immunohistochemical staining using an antibody recognizing human ARSA (brown precipitate). Representative images of sections through the brain's cortex (FIG. 13E, FIG. 13F, FIG. 13G, FIG. 13I, and FIG. 13J), hippocampus (FIG. 13H), thalamus (FIG. 13K), and cerebellum (FIG. 13L) for one AAVhu68.CB7.CI.hARSAco.rBG-treated animal is shown, along with sections from an untreated control for signal comparison (FIG. 13A, FIG. 13B, FIG. 13C, and FIG. 13D). ARSA, arylsulfatase A (protein); GC, genome copies; HD, high dose; ICM, intra-cisterna magna; N, number of animals. FIG. 14A, FIG. 14B, FIG. 14C, FIG. 14D, FIG. 14E, FIG. 14F, FIG. 14G, FIG. 14H, and FIG. 14I provide human ARSA expression in the spinal cord and dorsal root ganglia of nonhuman primates following intra-cisterna magna administration of AAVhu68.CB7.CI.hARSAco.rBG. Adult cynomolgus macaques received a single ICM administration of AAVhu68.CB7.CI.hARSAco.rBG at a dose of 3.00 x 1013 GC (HD) (N=2). Untreated age-matched cynomolgus macaques served as a control (N=2). Animals were necropsied 42±2 days after AAVhu68.CB7.CI.hARSAco.rBG administration, and sections of the cervical, thoracic, and lumbar spinal cord and DRG were obtained for immunohistochemical staining using an antibody recognizing human ARSA (brown precipitate). Representative images of sections for one AAVhu68.CB7.CI.hARSAco.rBG-treated animal (FIG. 14D, FIG. 14E, FIG. 14F, FIG. 14G, FIG. 14H, and FIG. 14I) is shown, along with sections from an untreated control for signal comparison (FIG. 14A, FIG. 14B, and FIG. 14C). ARSA, arylsulfatase A (protein); GC, genome copies; HD, high dose; ICM, intra-cisterna magna; N, number of animals. DETAILED DESCRIPTION OF THE INVENTION Compositions and methods for treating a disease caused by mutation(s) in the Arylsulfatase A (ARSA) gene and / or deficiencies in normal levels of functional Arylsulfatase A (e.g., Metachromatic Leukodystrophy (MLD)) are provided herein. In certain embodiments, also provided are compositions and methods for treating disease(s) or symptom(s) caused by mutation(s) in the ARSA gene and / or deficiencies in normal levels of functional Arylsulfatase A. An effective amount of a recombinant adeno-associated virus (rAAV) having an AAVhu68 capsid and packaged therein a vector genome encoding a functional human Arylsulfatase A (hARSA) protein is delivered to a subject in need. Desirably, this rAAV is formulated with an aqueous buffer. In certain embodiments, the suspension is suitable for intrathecal injection. In certain embodiments, the rAAV vector is termed as AAVhu68.hARSAco, in which the hARSA coding sequence is an engineered hARSA coding sequence (termed as "hARSAco" or "hARSA" unless specified, for example, nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1, SEQ ID NO: 3, or a sequence at least about 95% to about 99.9% identical thereto). In certain embodiment, the hARSAco is SEQ ID NO: 1. In certain embodiment, the hARSAco is SEQ ID NO: 3. In certain embodiments, the rAAV vector is termed AAVhu68.CB7.hARSAco, in which the engineered hARSA coding sequence is under the control of regulatory sequences which include a chicken beta actin promoter with a cytomegalovirus enhancer (CB7; SEQ ID NO: 16). In certain embodiments, the compositions are delivered via an intra-cisterna magna injection (ICM). Nucleic acid sequences encoding capsid of a clade F adeno-associated virus (AAV), which is termed herein AAVhu68, are utilized in the production of the AAVhu68 capsid and recombinant AAV (rAAV) carrying the vector genome. Additional details relating to AAVhu68 are provided in WO 2018 / 160582 and in this detailed description. The AAVhu68 vectors described herein are well suited for delivery of the vector genome comprising the engineered hARSA coding sequence to cells within the central nervous system (CNS), including brain, hippocampus, motor cortex, cerebellum, and motor neurons, and the peripheral nervous system (PNS), including nerves and ganglia outside the brain and the spinal cord. These vectors may be used for targeting other cells within the CNS and / or PNS and certain other tissues and cells, for example, kidney or liver or gallbladder. 1. Arylsulfatase A (hARSA) Arylsulfatase A (ARSA) has an enzymatic activity of hydrolyzing cerebroside sulfate (i.e., the following reaction: a cerebroside 3-sulfate <semantics>+H2O=<annotation encoding="application / x-tex">+ H_2O =< / annotation>< / semantics> a cerebroside <semantics>+<annotation encoding="application / x-tex">+< / annotation>< / semantics> sulfate). Two isoforms of human ARSA (hARSA) protein (UniProtKB - P15289, ARSA HUMAN) have been identified: P51608-1, SEQ ID NO: 2; and P51608-2, SEQ ID NO: 15. Throughout this specification, reference to ARSA is hARSA unless otherwise specified. As used herein, a functional hARSA protein refers to an isoform, a natural variant, a variant, a polymorph, or a truncation of a hARSA protein which has at least about 10% of the enzymatic activity (i.e., enzyme activity) of the wildtype hARSA protein (for example, P51608-1, SEQ ID NO: 2; or P51608-2, SEQ ID NO: 15). See, OMIM # 607574 (omim.org / entry / 607574), genecards.org / cgi-bin / carddisp.pl?gene=ARSA and uniprot.org / uniprot / P15289. In certain embodiments, the functional hARSA protein has at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or more of the enzymatic activity of the wildtype hARSA protein (for example, P51608-1, SEQ ID NO: 2; or P51608-2, SEQ ID NO: 15). In certain embodiments, the functional hARSA protein has about 10% to about 15%, about 10% to about 20%, about 10% to about 25%, about 10% to about 30%, about 10% to about 50%, about 10% to about 75%, about 10% to about 90%, about 10% to about 100 %, about 10% to about 3-fold, about 15% to about 20%, about 15% to about 25%, about 15% to about 30%, about 15% to about 50%, about 15% to about 75%, about 15% to about 90%, about 15% to about 100 %, about 15% to about 3-fold, about 20% to about 25%, about 20% to about 30%, about 20% to about 50%, about 20% to about 75%, about 20% to about 90%, about 20% to about 100 %, about 20% to about 3-fold, about 25% to about 30%, about 25% to about 50%, about 25% to about 75%, about 25% to about 90%, about 25% to about 100%, about 25% to about 3-fold, about 50% to about 75%, about 50% to about 90%, about 50% to about 100 %, about 50% to about 3-fold, about 75% to about 90%, about 75% to about 100%, or about 75% to about 3-fold of the enzymatic activity of the wildtype hARSA protein (for example, P51608-1, SEQ ID NO: 2; or P51608-2, SEQ ID NO: 15). Method(s) of measuring the hARSA enzymatic activity (for example, via synthetic substrate-based assays and / or via sulfatide loading assay) can be found in the Examples as well as in various publications, such as Kreysing et al., High residual arylsulfatase A (ARSA) activity in a patient with late-infantile metachromatic leukodystrophy. Am J Hum Genet. 1993 Aug;53(2):339-46.; Lee-Vaupel M and Conzelmann E. A simple chromogenic assay for arylsulfatase A. Clin Chim Acta. 1987 Apr 30;164(2):171-80; Böhringer et al., Enzymatic characterization of novel arylsulfatase A variants using human arylsulfatase A- deficient immortalized mesenchymal stromal cells. Hum Mutat. 2017 Nov;38(11):1511-1520. doi: 10.1002 / humu.23306. Epub 2017 Sep 6; and Francesco Morena, et al., A new analytical bench assay for the determination of arylsulfatase a activity toward galactosyl-3-sulfate ceramide: implication for metachromatic leukodystrophy diagnosis. Anal Chem. 2014 Jan 7;86(1):473-81. doi: 10.1021 / ac4023555. Epub 2013 Dec 11. In certain embodiments, the functional hARSA protein comprises (i) a signal peptide, and (ii) an amino acid sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiments, the functional hARSA protein comprises (i) a signal peptide, and (ii) an amino acid sequence of SEQ ID NO: 15 (i.e., aa 85 to aa 507 of SEQ ID NO: 2) or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiments, the functional hARSA protein comprises (i) a signal peptide, (ii) an amino acid sequence of amino acid (aa) 19 to aa 444 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto, and (iii) an amino acid sequence of aa 448 to aa 507 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In a further embodiment, the amino acid sequence of (ii) may be linked to the amino acid sequence of (iii) by disulfide bond(s). Other chemical bond(s) may be utilized, for example, covalent bond, and noncovalent bond (including hydrogen, ionic, hydrophobic, and Van Der Waals bonding). In yet a further embodiment, the link between the amino acid sequences of (ii) and (iii) is formed by a combination of the bonds described. In another embodiment, the link between the amino acid sequences of (ii) and (iii) is a peptide linker (see, e.g., parts.igem.org / Protein domains / Linker). In certain embodiments, the functional hARSA protein comprises (i) a signal peptide, (ii) an amino acid sequence of amino acid (aa) 85 to aa 444 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto, and (iii) an amino acid sequence of aa 448 to aa 507 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In a further embodiment, the amino acid sequence of (ii) may be linked to the amino acid sequence of (iii) by disulfide bond(s). Other chemical bond(s) may be utilized, for example, covalent bond, and noncovalent bond (including hydrogen, ionic, hydrophobic, and Van Der Waals bonding). In yet a further embodiment, the link between the amino acid sequences of (ii) and (iii) is formed by a combination of the bonds described. In another embodiment, the link between the amino acid sequences of (ii) and (iii) is a peptide linker (see, e.g., parts.igem.org / Protein domains / -Linker). In certain embodiments, the functional hARSA protein comprises (i) a signal peptide, and (ii) an amino acid sequence of amino acid (aa) 23 to an 348 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiments, the functional hARSA protein comprises (i) a signal peptide, and (ii) an amino acid sequence of amino acid (aa) 19 to aa 448 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiments, the functional hARSA protein comprises (i) a signal peptide, and (ii) an amino acid sequence of amino acid (aa) 448 to aa 507 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiments, the functional hARSA protein with the identity specified has its modifications outside of the aa 85 to aa 507 based on the numbering in SEQ ID NO: 2, and / or outside of any one or more of the aa 29, 69, 123, 125, 150, 229, 281, 282 based on the numbering in SEQ ID NO: 2, and / or outside of any of hARSA conserved domain(s) (for example, the sulfatase domain with Pfam: PF00884), and / or outside of an 19 to an 444 based on the numbering in SEQ ID NO: 2, and / or outside of an 448 to aa 507 based on the numbering in SEQ ID NO: 2, and / or outside of aa 23 to aa 348 based on the numbering in SEQ ID NO: 2 or any combination thereof. See. e.g., von Bülow R et al, Crystal structure of an enzyme-substrate complex provides insight into the interaction between human arylsulfatase A and its substrates during catalysis, J Mol Biol. 2001 Jan 12;305(2):269-77. In certain embodiments, the functional hARSA protein has an amino acid sequence of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiment, the functional hARSA protein has an amino acid sequence of SEQ ID NO: 4 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. As used herein, a signal peptide (sometimes referred to as signal sequence, targeting signal, localization signal, localization sequence, transit peptide, leader sequence or leader peptide) is a short peptide (usually 15-30 amino acids long) present at the N-terminus of the majority of newly synthesized proteins that are destined towards the secretory pathway (Blobel G. Dobberstein B (Dec 1975). "Transfer of proteins across membranes. I. Presence of proteolytically processed and unprocessed nascent immunoglobulin light chains on membrane- bound ribosomes of murine myeloma". J Cell Biol. 67 (3): 835–51). These proteins include those that reside either inside certain organelles (the endoplasmic reticulum, golgi or endosomes), secreted from the cell, or inserted into most cellular membranes. In certain embodiments, the signal peptide has an amino acid sequence of aa 1 to aa 18 of SEQ ID NO: 2 or an amino acid sequence of an 1 to an 20 of SEQ ID NO: 4. In certain embodiments, the signal peptide is from another protein which is secreted by a CNS cell (for example, a neuron), a PNS cell, or another cell (such as a kidney cell, or a liver cell). The signal peptide is preferably of human origin or a derivative of a human signal peptide, and is be about 15 to about 30 amino acids, preferably about 17 to 25 amino acids, or about 18 amino acids in length. In certain embodiments, the signal peptide is the native signal peptide (amino acids 1 to 18 of SEQ ID NO: 2). In certain embodiments, the functional hARSA protein comprises an exogenous leader sequence in the place of the native signal peptide. In another embodiment, the signal peptide may be from a human IL2 or a mutated signal peptide. In another embodiment, a human serpinF1 secretion signal may be used as a signal peptide. Such chimeric hARSA proteins comprising an exogenous signal peptide and the mature portion of the hARSA (e.g., as 19 to 507 of SEQ ID NO:2, as 19 to aa 444 of SEQ ID NO: 2, aa 85 to aa 507 of SEQ ID NO: 2, aa 23 to aa 348 of SEQ ID NO: 2, or aa 448 to 507 of SEQ ID NO: 2) is included in the various embodiments described herein when reference is made to a functional hARSA protein. Provided herein is a nucleic acid sequence encoding a functional hARSA protein, termed as hARSA coding sequence or ARSA coding sequence or hARSA or ARSA. In certain embodiments, the hARSA coding sequence is a modified or engineered (hARSA or hARSAco). In certain embodiments, the hARSA coding sequence has a sequence of nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1, or a sequence at least 95% to 99.9% identical thereto. In certain embodiments, the hARSA coding sequence is nt 55 to nt 1521 of SEQ ID NO: 1 or a nucleic acid sequence at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%) identical thereto. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 1 or a sequence at least 95% to 99.9% identical thereto. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 1 or a nucleic acid sequence at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%) identical thereto. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 3 or a sequence at least 95% to 99.9% identical thereto. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 3 or a nucleic acid sequence at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%) identical thereto. Transcript variants of hARSA (which is also hARSA coding sequence) can be found as NCBI Reference Sequences NM 000487.5, NM 001085425.2, NM 001085426.2, NM 001085427.2, NM 001085428.2, NM 001362782.1, AB448736.1, AK092752.1, AK098659.1, AK301098.1, AK310564.1, AK315011.1, BC014210.2, BI770997.1, BM818814.1, BP306351.1, BQ184813.1, BU632196.1, BX648618.1, CA423492.1, CN409235.1, CR456383.1, DA844740.1, DB028013.1, GQ891416.1, KU177918.1, KU177919.1, and X52151.1. embodiments, the modified or engineered hARSA coding sequence shares less than about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity to one of the NCBI Reference Sequences. In certain embodiments, the modified or engineered hARSA coding sequence shares about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity to one of the NCBI Reference Sequences. A "nucleic acid" or a "nucleotide", as described herein, can be RNA, DNA, or a modification thereof, and can be single or double stranded, and can be selected, for example, from a group including: nucleic acid encoding a protein of interest, oligonucleotides, nucleic acid analogues, for example peptide-nucleic acid (PNA), pseudocomplementary PNA (pc-PNA), locked nucleic acid (LNA) etc. Such nucleic acid sequences include, for example, but are not limited to, nucleic acid sequence encoding proteins, for example that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, for example but are not limited to RNAi, shRNAi, siRNA, micro RNAi (mRNAi), antisense oligonucleotides etc. The term "percent (%) identity", "sequence identity", "percent sequence identity", or "percent identical" in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for correspondence. The length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired. Percent identity may be readily determined for amino acid sequences over the full-length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof or the corresponding nucleic acid sequence coding sequences. A suitable amino acid fragment may be at least about 8 amino acids in length, and may be up to about 700 amino acids. Generally, when referring to "identity", "homology", or "similarity" between two different sequences, "identity", "homology" or "similarity" is determined in reference to "aligned" sequences. "Aligned" sequences or "alignments" refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence. Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Sequence alignment programs are available for amino acid sequences, e.g., the "Clustal X", "Clustal Omega" "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME", and "Match-Box" programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments", 27(13):2682-2690 (1999). Multiple sequence alignment programs are also available for nucleic acid sequences. Examples of such programs include, "Clustal W", "Clustal Omega", "CAP Sequence Assembly", "BLAST", "MAP", and "MEME", which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using FastaTM, a program in GCG Version 6.1. FastaTM provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. For instance, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1. 11. Metachromatic Leukodystrophy (MLD) Provided herein are rAAV, vector, methods and compositions useful in treating a disease or an abnormal condition caused by mutation(s) of Arylsulfatase A (ARSA) gene and / or deficiencies in normal levels of functional Arylsulfatase A, termed as "disease" herein, for example, Metachromatic leukodystrophy (MLD). See, e.g., omim.org / entry / 250100. Metachromatic Leukodystrophy (MLD) can be classified into the following types: early onset MLD which includes infantile MLD (typically begins equal to or earlier than 30 months of age) and early juvenile MLD (usually begins between 30 months of age to 6 years of age (including 6 years); juvenile MLD which includes early juvenile MLD and late juvenile MLD (usually begins between 7 years of age and 16 years of age, including 16 year old); and adult MLD (with an onset later than 16 years of age). Late infantile MLD patients have a devastating disease course with rapid and predictable decline that is homogeneous in the presentation of both motor and cognitive impairment (Kehrer et al., 2011a; Sessa et al., 2016). The majority of these children die before 5 years of age with a mean survival in 98 patients of 4.2 years and a 5 year survival of 25% (Mahmood et al., 2010). The phenotype of children with early juvenile MLD (symptom onset between 30 months and 6 years of age) is very similar to that of children with late infantile MLD, although early juvenile MLD patients may have a less rapid initial disease evolution (Biffi et al., 2008; Chen et al., 2016; Sessa et al., 2016). However, once overt symptoms appear, in particular when early juvenile MLD patients lose the ability to walk independently, their disease course can deteriorate as rapidly as late infantile MLD patients. These children also have similar signs and symptoms as late infantile MLD patients with neuromuscular difficulties developing first, either in isolation or concurrent with behavioral and cognitive symptoms (Groeschel et al., 2011; Kehrer et al., 2014). The early juvenile and late infantile phenotypes are collectively referred to as early onset MLD (Sessa et al., 2016). In certain embodiments, the rAAV, vector, composition and method described herein are useful in treating MLD, early onset MLD, infantile MLD, late infantile MLD, juvenile MLD, early juvenile MLD, late juvenile MLD, or adult MLD. In certain embodiments, the rAAV, vector, compositions and methods described herein may ameliorate disease symptom and / or delay disease progression in a subject. In certain embodiments, the rAAV, vector, compositions and methods described herein are useful in treating late infantile and early juvenile MLD. In certain embodiments, the subject or patient of the rAAV, vector, method or composition described herein has MLD, or is diagnosed with MLD. In certain embodiments, the subject or patient of rAAV, vector, the method or composition described herein is diagnosed with late infantile MLD or early juvenile MLD. The diagnosis of MLD may be made through both genetic and biochemical testing. Genetic testing can identify mutations in the ARSA, while biochemical testing includes sulfatase enzyme activity and urinary sulfatide excretion. An magnetic resonance imaging (MRI) can confirm a diagnosis of MLD. An MRI shows imaging of a person's brain and can show the presence and absence of myelin. There is a classic pattern of myelin loss in the brains of individuals affected by MLD. As the disease progresses, imaging shows accumulating injury to the brain. In young children, the initial brain imaging can be normal. In certain embodiments, the subject of the rAAV, vector, method or composition described herein is a human less than 18 years old (e.g., less than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 month(s) old, or less than about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, 18 year(s) old). Additionally or alternatively, the subject is a newborn or a human more than 1 month old (e.g., more than about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 month(s) old, or more than about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, 18 year(s) old). In certain embodiments, the patient is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 month(s) old, or about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, 18 year(s) old. In certain embodiments, the patient is about 30 months to about 7 years of age. In certain embodiments, the patient is from about 30 months to 16 years of age, from 7 years to 16 years of age, or from 16 years to 40 years of age. "Patient" or "subject", as used herein interchangeably, means a male or female mammalian animal, including a human, a veterinary or farm animal, a domestic animal or pet, and animals normally used for clinical research. In one embodiment, the subject of these rAAV, vector, methods and compositions is a human patient. In one embodiment, the subject of these rAAV, vector, methods and compositions is a male or female human. In certain embodiments, the subject of these rAAV, vector, methods and compositions is diagnosed with Metachromatic Leukodystrophy and / or with symptoms of Metachromatic Leukodystrophy. Disease symptoms (e.g., MLD symptoms, compared to a healthy control without MLD) may include, but are not limited to the following: decreased concentration and / or level and / or biological activity of ARSA (for example, in serum or in CSF), increased urine sulfatides, CNS myelination (demyelination load and pattern), white matter atrophy as measured by MRI, an abnormal (decreased or increased) neuronal metabolite N-acetylaspartate (NAA), myo-inositol (mI), choline (Cho) and / or lactate (Lac) levels (for example, as measured by proton magnetic resonance spectroscopy (MRS)), increased CSF sulfatide and lyso-sulfatide levels, abnormal Visual evoked potentials (VEPs), abnormal Brainstem auditory evoked responses (BAERs), gall- bladder wall thickening (for example, via ultrasound evaluation); impaired motor function (for example, measured by the Gross Motor Function Classification for Metachromatic Leukodystrophy (GMFC-MLD) or Gross Motor Function Measure (GMFM)), delayed Motor milestones achievement (as defined by World Health Organization [WHO] criteria) assessed by age at achievement, age at loss, and percentage of children maintaining or acquiring motor milestones, impaired cognitive function (for example, Total Intelligence Quotient [IQ] and sub- domain IQ measured by the Bayley Scale of Infant Development [BSID-III], Wechsler Intelligence Scale for Children, Fifth Edition [WISC-V]), increased lifespan (compared to a patient), an abnormal result of neurological clinical exam (NCE), a reduced nerve conduction velocity (NCV) of the ulnar, deep peroneal, median, sural nerves, an earlier age-at-onset and higher frequency of seizures captured by a seizure diary, impaired behavior function (for example, measured by Vineland Adaptive Behavior Scales, Third Edition (Vineland-III)), a lower Lansky Performance Index, a decreased Pediatric Quality of Life Inventory (for example, PedsQL and PedsQL-IS), and / or a decreased caregiver / parent quality of life. In certain embodiments, disease symptoms (e.g., MLD symptoms, compared to a healthy control without MLD) may include abnormal properties (for example biomarker activity, electrophysiological activity, and / or imaging parameters) and clinical observations (for example, impaired gross and fine motor function, impaired cognitive and language development, abnormal neurological exam findings, impaired behavioral and milestone development, and caregiver / parent-reported outcomes and decreased quality of life assessments). The abnormal properties include but are not limited to functional impairment of myelin- producing oligodendrocytes and Schwann cells, peripheral nerve conduction abnormalities, peripheral neuropathy with slow nerve conduction velocities (NCVs), brain magnetic resonance imaging (MRI) showing a typical white matter (for example, the splenium of the corpus callosum and parieto-occipital white matter, projection fibers, cerebellar white matter, basal ganglia, and the thalamus) pattern (for example, a "tigroid pattern" of radiating stripes with bands of normal signal intensity within the abnormal white matter, see, e.g., Gieselmann and Krageloh-Mann, 2010; Martin et al., 2012; van Rappard et al., 2015); U-fiber involvement and cerebellar changes, white matter demyelination, bilateral areas of white matter hypodensity, especially in the frontal lobes, and cerebral atrophy reflecting loss of myelin), abnormal levels of the brain biomarkers N- acetylaspartate and myo-inositol. The clinical observations include but are not limited to gross motor disturbances that manifest as clumsiness, toe walking, and frequent falls; fine motor skills; gait abnormalities; spastic paraparesis or ataxic movement; neuromuscular difficulties; neurologic symptoms (signs of weakness, loss of coordination progressing to spasticity and incontinence); hypotonia, and depressed deep tendon reflexes; seizures; dementia; epilepsy; difficulty urinating spasticity; feeding difficulties; pain in the extremities; impaired language function; impaired cognitive skills; impaired vision and hearing; losing previously acquired motor and cognitive milestones; decline in school or job performance, inattention, abnormal behaviors, psychiatric symptoms, intellectual impairment, uncontrolled laughter, cortical disturbances (e.g., apraxia, aphasia, agnosia), alcohol or drug use, poor money management, emotional lability, inappropriate affect, and neuropsychiatric symptoms (including psychosis, schizophrenia, delusions, and hallucinations). Disease progression refers to subject's age of onset, frequency of appearance, severity, or recurrence, of a disease symptom. A delay in disease progression normally means an elevated age of onset, a lower frequency of appearance, a decreased severity, or less recurrence, of a disease symptom. As described above, the terms "increase" "decrease" "reduce" "ameliorate" "elevate" "lower" "higher" "less" "more" "improve" "delay" "impair" "abnormal" "thick" or any grammatical variation thereof, or any similar terms indication a change, means a variation of about 5 fold, about 2 fold, about 1 fold, about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, about 30%, about 20%, about 10%, about 5 % compared to the corresponding reference (e.g., untreated control or a subject in normal condition without MLD), unless otherwise specified. The compositions and methods herein provide a fast-acting, disease-modifying treatment to symptomatic early onset patients for whom no standard of care exists (HSCT and HSC-GT are not efficacious); and / or provide a therapy that can preserve or correct both CNS pathologies and peripheral nerve function, the latter of which is not corrected by HSCT and causes progressive fine and gross motor function loss and respiratory failure; and / or provide an alternative treatment option to HSC-GT, which requires harsh myeloablative conditioning, is only efficacious when performed prior to onset of symptoms, and may not substantially address peripheral neuropathy in all patients. In certain embodiments, the patient receives a co-therapy for which they would not have been eligible without the rAAV, vector, composition or method described herein. Such co- therapies may include enzyme replacement therapy (ERT) and hematopoietic stem cell transplantation (HSCT) via umbilical cord blood (UCB), allogeneic peripheral blood stem cells, or allogeneic bone marrow. Optionally, an immunosuppressive co-therapy may be used in a subject in need. Immunosuppressants for such co-therapy include, but are not limited to, a glucocorticoid, steroids, antimetabolites, T-cell inhibitors, a macrolide (e.g., a rapamycin or rapalog), and cytostatic agents including an alkylating agent, an anti-metabolite, a cytotoxic antibiotic, an antibody, or an agent active on immunophilin. The immune suppressant may include a nitrogen mustard, nitrosourea, platinum compound, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, an anthracycline, mitomycin C, bleomycin, mithramycin, IL-2 receptor- (CD25-) or CD3-directed antibodies, anti-IL-2 antibodies, ciclosporin, tacrolimus, sirolimus, IFN-<semantics>β<annotation encoding="application / x-tex">\beta< / annotation>< / semantics>, IFN-<semantics>γ<annotation encoding="application / x-tex">\gamma< / annotation>< / semantics>, an opioid, or TNF-<semantics>α<annotation encoding="application / x-tex">\alpha< / annotation>< / semantics> (tumor necrosis factor-alpha) binding agent. In certain embodiments, the immunosuppressive therapy may be started 0, 1, 2, 3, 4, 5, 6, 7, or more days prior to or after the gene therapy administration. Such immunosuppressive therapy may involve administration of one, two or more drugs (e.g., glucocorticoids, prednelisone, micophenolate mofetil (MMF) and / or sirolimus (i.e., rapamycin)). Such immunosuppressive drugs may be administrated to a subject in need once, twice or for more times at the same dose or an adjusted dose. Such therapy may involve co-administration of two or more drugs, the (e.g., prednelisone, micophenolate mofetil (MMF) and / or sirolimus (i.e., rapamycin)) on the same day. One or more of these drugs may be continued after gene therapy administration, at the same dose or an adjusted dose. Such therapy may be for about 1 week (7 days), about 60 days, or longer, as needed. In certain embodiments, a tacrolimus-free regimen is selected. 111. Expression Cassette Provided herein is a nucleic acid sequence comprising a hARSA coding sequence encoding a functional hARSA protein and regulatory sequences which directs the hARSA expression in a target cell, also termed as an expression cassette. As used herein, an "expression" cassette" refers to a nucleic acid molecule which comprises a coding sequence (e.g., a hARSA coding sequence), promoter, and may include other regulatory sequences therefor. The regulatory sequences necessary are operably linked to the hARSA coding sequence in a manner which permits its transcription, translation and / or expression in target cell. As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the hARSA coding sequence and expression control sequences that act in trans or at a distance to control the hARSA coding sequence. Such regulatory sequences typically include, e.g., one or more of a promoter, an enhancer, an intron, a Kozak sequence, a polyadenylation sequence, and a TATA signal. In certain embodiment, the promoter is a chicken beta actin promoter with a cytomegalovirus enhancer (CB7) promoter (e.g., nt 198 to nt 862 of SEQ ID NO: 5, also termed as hSyn or Syn herein). However, in certain embodiments, other promoters, or an additional promoter, may be selected. In certain embodiments, the regulatory sequences direct hARSA expression in a target cell. In certain embodiment, a target cell is a nervous system cell, an oligodendrocyte, a microglia, a Central Nervous System (CNS) cell, a neuron in the CNS, a Peripheral Nervous System (PNS) cell, a Schwann cell, a macrophage in the PNS, or a cell in visceral organs (for example, a kidney cell, a liver cell and a gallbladder cell). In certain embodiment, the target cell may be a central nervous system cell. In certain embodiments, the target cell is one or more of an excitatory neuron, an inhibitory neuron, a glial cell, a cortex cell, a frontal cortex cell, a cerebral cortex cell, a spinal cord cell. In certain embodiments, the target cell is a peripheral nervous system (PNS) cell, for example a retina cell. Other cells other than those from nervous system may also be chosen as a target cell, such as a monocyte, a B lymphocyte, a T lymphocyte, a NK cell, a lymph node cell, a tonsil cell, a bone marrow mesenchymal cell, a stem cell, a bone marrow stem cell, a heart cell, an epithelium cell, a esophagus cell, a stomach cell, a fetal cut cell, a colon cell, a rectum cell, a liver cell, a kindly cell, a lung cell, a salivary gland cell, a thyroid cell, an adrenal cell, a breast cell, a pancreas cell, an islet of Langerhans cell, a gallbladder cell, a prostate cell, a urinary bladder cell, a skin cell, a uterus cell, a cervix cell, a testis cell, or any other cell which expresses a functional hARSA protein in a subject without MLD. See, genecards.org / cgi-bin / carddisp.pl?gene=ARSA&keywords=arsa#expression. In certain embodiments, the regulatory sequences comprise a ubiquitous promoter, for example a CB7 promoter. In certain embodiments, the regulatory elements comprise one or more of a Kozak sequence, a polyadenylation sequence, an intron, an enhancer, and a TATA signal. In certain embodiments, an additional or alternative promoter sequence may be included as part of the expression control sequences (regulatory sequences), e.g., located between the selected 5' ITR sequence and the coding sequence. Constitutive promoters, regulatable promoters [see, e.g., WO 2011 / 126808 and WO 2013 / 04943], tissue specific promoters, or a promoter responsive to physiologic cues may be utilized in the vectors described herein. The promoter(s) can be selected from different sources, e.g., human cytomegalovirus (CMV) immediate-early enhancer / promoter, the SV40 early enhancer / promoter, the JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoters, herpes simplex virus (HSV-1) latency associated promoter (LAP), rouse sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter. In addition to a promoter, an expression cassette may contain one or more other appropriate transcription initiation sequences, transcription termination sequences, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA for example WPRE; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. An example of a suitable enhancer is the CMV enhancer. Other suitable enhancers include those that are appropriate for desired target tissue indications. In one embodiment, the regulatory sequences comprise one or more expression enhancers. In one embodiment, the regulatory sequences contain two or more expression enhancers. These enhancers may be the same or may differ from one another. For example, an enhancer may include a CMV immediate early enhancer (SEQ ID) NO: 19). This enhancer may be present in two copies which are located adjacent to one another. Alternatively, the dual copies of the enhancer may be separated by one or more sequences. In still another embodiment, the expression cassette further contains an intron, e.g., the chicken beta-actin intron (SEQ ID NO: 17). In certain embodiments, the intron is a chimeric intron (CI)— a hybrid intron consisting of a human beta-globin splice donor and immunoglobulin G (IgG) splice acceptor elements. Other suitable introns include those known in the art, e.g., such as are described in WO 2011 / 126808. Examples of suitable polyA sequences include, e.g., Rabbit globin poly A, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyAs. Optionally, one or more sequences may be selected to stabilize mRNA. An example of such a sequence is a modified WPRE sequence, which may be engineered upstream of the polyA sequence and downstream of the coding sequence (see, e.g., MA Zanta-Boussif, et al, Gene Therapy (2009) 16: 605-619). In certain embodiments, no WPRE sequence is present. Optionally, in certain embodiments, in addition to the hARSA coding sequence, another non-AAV coding sequence may be included, e.g., a peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product, of interest. Useful gene products may include miRNAs miRNAs and other small interfering nucleic acids regulate gene expression via target RNA transcript cleavage / degradation or translational repression of the target messenger RNA (mRNA), miRNAs are natively expressed, typically as final 19-25 non- translated RNA products, miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated regions (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors which are subsequently processed into a miRNA duplex, and further into a "mature" single stranded miRNA molecule. This mature miRNA guides a multiprotein complex, miRISC, which identifies target site, e.g., in the 3' UTR regions, of target mRNAs based upon their complementarity to the mature miRNA. In certain embodiments, the expression cassette may further comprises a dorsal root ganglion (drg)-specific miRNA detargetting sequences to modulate expression levels in the CNS or peripheral dorsal root ganglia. In certain embodiments, the expression cassette or vector genome comprises one or more miRNA target sequences in the untranslated region (UTR) 3' to a gene product coding sequence. In certain embodiments, there are at least one target sequence specific for miR-183, miR-182, or miR-96. In certain embodiments, at least two drg-specific miRNA target sequences are located in both 5' and 3' to the hARSA coding sequence. In certain embodiments, the miRNA target sequence for the at least first and / or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is selected from (i) AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 20); (ii) AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 21), (iii) AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 22); and (iv) AGGGATTCCTGGGAAAACTGGAC (SEQ ID NO: 23). In certain embodiments, the construct further comprises at least two tandem repeats comprise at least a first miRNA target sequence and at least a second miRNA target sequence which may be the same or different. In certain embodiments, the tandem miRNA target sequences are continuous or are separated by a spacer of 1 to 10 nucleic acids, wherein said spacer is not an miRNA target sequence. In certain embodiments, there are at least two drg-specific miRNA target sequences located at 3' to the hARSA coding sequence. In certain embodiments, the start of the first of the at least two drg- specific miRNA tandem repeats is within 20 nucleotides from the 3' end of the hARSA-coding sequence. In certain embodiments, the start of the first of the at least two drg-specific miRNA tandem repeats is at least 100 nucleotides from the 3' end of the hARSA-coding sequence. In certain embodiments, the miRNA tandem repeats comprise 200 to 1200 nucleotides in length. In certain embodiments, there are at least two drg-specific miRNA target sequences located at 5' to the hARSA coding sequence. In certain embodiments, two or more consecutive miRNA target sequences are continuous and not separated by a spacer. In certain embodiments, two or more of the miRNA target sequences are separated by a spacer and each spacer is independently selected from one or more of (A) GGAT; (B) CACGTG; or (C) GCATGC. In certain embodiments, the spacer located between the miRNA target sequences may be located 3' to the first miRNA target sequence and / or 5' to the last miRNA target sequence. In certain embodiments, the spacers between the miRNA target sequences are the same. See, Provisional US Patent Application No. 62 / 783,956, filed December 21, 2018, and International Application No. PCT / US2019 / 067872, filed December 20, 2019. In certain embodiments, no miR sequences are included in an expression cassette or vector genome. IV. AAVhu68 The AAVhu68 serotype, which was selected as the capsid for AAVhu68.CB7.CI.hARSAco.RBG, is 99% identical at the amino acid level to AAV9. AAVhu68 displays transduction characteristics in the nervous systems of NHPs and mice comparable to AAV9. This includes widespread transduction of cortical neurons (data not shown) and a small subset of myelin-producing oligodendrocytes. In addition, AAVhu68 transduces motor neurons with axons projecting into the PNS and DRG sensory neurons with axons projecting into the spinal cord and peripheral nerves (data not shown). Transduction was observed in lower motor neurons of the ventral horn and sensory neurons of the DRG. The transduced motor neurons have axons that contribute to the peripheral nerves. Thus, the AAVhu68 capsid targets cells in the CNS and PNS, which are both affected in MLD patients. Additionally, while newly synthesized ARSA can be transported directly from the trans-Golgi network to the lysosome, it can also be secreted and taken up by other cells via mannose-6-phosphate receptors where it is subsequently trafficked to the lysosomes. Thus, the underlying defect can be cross-corrected by rAAVhu68.hARSA expressing ARSA enzyme supplied to neighboring cells of the CNS that lack functional enzyme. AAVhu68 (previously termed AAV3G2) varies from another Clade F virus AAV9 by two encoded amino acids at positions 67 and 157 of vp1, based on the numbering of SEQ ID NO: 7. In contrast, the other Clade F AAV (AAV9, hu31, hu31) have an Ala at position 67 and an Ala at position 157. Provided are novel AAVhu68 capsids and / or engineered AAV capsids having valine (Val or V) at position 157 based on the numbering of SEQ ID NO: 7 and optionally, a glutamic acid (Glu or E) at position 67 based on the numbering of SEQ ID NO: 7. In certain embodiments, the AAV capsid stereotype may be selected from AAVhu31 vp1 (SEQ ID NOs: 11 and 12) or AAVhu32 vp1 (SEQ ID NOs: 13 and 14). As used herein, the term "clade" as it relates to groups of AAV refers to a group of AAV which are phylogenetically related to one another as determined using a Neighbor-Joining algorithm by a bootstrap value of at least 75% (of at least 1000 replicates) and a Poisson correction distance measurement of no more than 0.05, based on alignment of the AAV vp1 amino acid sequence. The Neighbor-Joining algorithm has been described in the literature. See, e.g., M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000). Computer programs are available that can be used to implement this algorithm. For example, the MEGA v2.1 program implements the modified Nei-Gojobori method. Using these techniques and computer programs, and the sequence of an AAV vp1 capsid protein, one of skill in the art can readily determine whether a selected AAV is contained in one of the clades identified herein, in another clade, or is outside these clades. See, e.g., G Gao, et al, J Virol, 2004 Jun; 78(10): 6381-6388, which identifies Clades A, B, C, D, E and F, and provides nucleic acid sequences of novel AAV, GenBank Accession Numbers AY530553 to AY530629. See, also, WO 2005 / 033321. In certain embodiments, an AAVhu68 capsid is further characterized by one or more of the following. AAVhu68 capsid proteins comprise: AAVhu68 vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 736 of SEQ ID NO: 7, vp1 proteins produced from SEQ ID NO: 6, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 6 which encodes the predicted amino acid sequence of 1 to 736 of SEQ ID NO: 7; AAVhu68 vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 7, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 6, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 6 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 7; and / or AAVhu68 vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 7, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 6, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 6 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 7. The AAVhu68 vp1, vp2 and vp3 proteins are typically expressed as alternative splice variants encoded by the same nucleic acid sequence which encodes the full-length vpl amino acid sequence (amino acid 1 to 736). Optionally the vpl-encoding sequence is used alone to express the vp1, vp2 and vp3 proteins. Alternatively, this sequence may be co-expressed with one or more of a nucleic acid sequence which encodes the AAVhu68 vp3 amino acid sequence (about aa 203 to 736) without the vpl-unique region (about aa 1 to about aa 137) and / or vp2- unique regions (about aa 1 to about aa 202), or a strand complementary thereto, the corresponding mRNA or tRNA (for example, the mRNA transcribed from about nucleotide (nt) 607 to about nt 2211 of SEQ ID NO: 6), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) identical to SEQ ID NO: 6 which encodes as 203 to 736 of SEQ ID NO: 7. Additionally, or alternatively, the vp1-encoding and / or the vp2-encoding sequence may be co-expressed with the nucleic acid sequence which encodes the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 7 (about aa 138 to 736) without the vp1- unique region (about as 1 to about 137), or a strand complementary thereto, the corresponding mRNA or tRNA (for example, the mRNA transcribed from nt 412 to 2211 of SEQ ID NO; 6), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) identical to SEQ ID NO: 6 which encodes about aa 138 to 736 of SEQ ID NO: 7. As described herein, a rAAVhu68 has a rAAVhu68 capsid produced in a production system expressing capsids from an AAVhu68 nucleic acid sequence which encodes the vp1 amino acid sequence of SEQ ID NO: 7, and optionally additional nucleic acid sequences, e.g., encoding a vp 3 protein free of the vp1 and / or vp2-unique regions. The rAAVhu68 resulting from production using a single nucleic acid sequence vp1 produces the heterogenous populations of vp1 proteins, vp2 proteins and vp3 proteins. More particularly, the AAVhu68 capsid contains subpopulations within the vp1 proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues in SEQ ID NO: 7. These subpopulations include, at a minimum, deamidated asparagine (N or Asn) residues. For example, asparagines in asparagine - glycine pairs are highly deamidated. In one embodiment, the AAVhu68 vpl nucleic acid sequence has the sequence of SEQ ID NO: 6, or a strand complementary thereto, e.g., the corresponding mRNA or tRNA. In certain embodiments, the vp2 and / or vp3 proteins may be expressed additionally or alternatively from different nucleic acid sequences than the vpl, e.g., to alter the ratio of the vp proteins in a selected expression system. In certain embodiments, also provided is a nucleic acid sequence which encodes the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 7 (about aa 203 to 736) without the vpl-unique region (about as 1 to about as 137) and / or vp2-unique regions (about as 1 to about an 202), or a strand complementary thereto, the corresponding mRNA or tRNA (about nt 607 to about nt 2211 of SEQ ID NO: 6). In certain embodiments, also provided is a nucleic acid sequence which encodes the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 7 (about aa 138 to 736) without the vpl-unique region (about as 1 to about 137), or a strand complementary thereto, the corresponding mRNA or tRNA (nt 412 to 2211 of SEQ ID NO; 6). However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 7 may be selected for use in producing rAAVhu68 capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 6 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 6 which encodes SEQ ID NO: 7. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 6 or a sequence at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 6 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 7. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 6 or a sequence at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt 607 to about nt 2211 of SEQ ID NO: 6 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 7. It is within the skill in the art to design nucleic acid sequences encoding this AAVhu68 capsid, including DNA (genomic or cDNA), or RNA (e.g., mRNA). In certain embodiments, the nucleic acid sequence encoding the AAVhu68 vp1 capsid protein is provided in SEQ ID NO: 6. See, WO 2018 / 160582. In certain embodiments, the AAVhu68 capsid is produced using a nucleic acid sequence of SEQ ID NO: 6 or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, which encodes the vpl amino acid sequence of SEQ ID NO: 7 with a modification (e.g., deamidated amino acid) as described herein. In certain embodiments, the vp1 amino acid sequence is reproduced in SEQ ID NO: 7. As used herein when used to refer to vp capsid proteins, the term "heterogenous" or any grammatical variation thereof, refers to a population consisting of elements that are not the same, for example, having vp1, vp2 or vp3 monomers (proteins) with different modified amino acid sequences. SEQ ID NO: 7 provides the encoded amino acid sequence of the AAVhu68 vp1 protein. The term "heterogenous" as used in connection with vp1, vp2 and vp3 proteins (alternatively termed isoforms), refers to differences in the amino acid sequence of the vp1, vp2 and vp3 proteins within a capsid. The AAV capsid contains subpopulations within the vp1 proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications. As used herein, a "subpopulation" of vp proteins refers to a group of vp proteins which has at least one defined characteristic in common and which consists of at least one group member to less than all members of the reference group, unless otherwise specified. For example, a "subpopulation" of vp1 proteins is at least one (1) vp1 protein and less than all vp1 proteins in an assembled AAV capsid, unless otherwise specified. A "subpopulation" of vp3 proteins may be one (1) vp3 protein to less than all vp3 proteins in an assembled AAV capsid, unless otherwise specified. For example, vp1 proteins may be a subpopulation of vp proteins; vp2 proteins may be a separate subpopulation of vp proteins, and vp3 are yet a further subpopulation of vp proteins in an assembled AAV capsid. In another example, vp1, vp2 and vp3 proteins may contain subpopulations having different modifications, e.g., at least one, two, three or four highly deamidated asparagines, e.g., at asparagine - glycine pairs. Unless otherwise specified, highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidated at a referenced amino acid position, as compared to the predicted amino acid sequence at the reference amino acid position (e.g., at least 80% of the asparagines at amino acid 57 based on the numbering of SEQ ID NO: 7 (AAVhu68) may be deamidated based on the total vpl proteins may be deamidated based on the total vpl, vp2 and vp3 proteins). Such percentages may be determined using 2D-gel, mass spectrometry techniques, or other suitable techniques. Without wishing to be bound by theory, the deamidation of at least highly deamidated residues in the vp proteins in the AAV capsid is believed to be primarily non-enzymatic in nature, being caused by functional groups within the capsid protein which deamidate selected asparagines, and to a lesser extent, glutamine residues. Efficient capsid assembly of the majority of deamidation vp1 proteins indicates that either these events occur following capsid assembly or that deamidation in individual monomers (vp1, vp2 or vp3) is well-tolerated structurally and largely does not affect assembly dynamics. Extensive deamidation in the VP1-unique (VP1-u) region (~aa 1-137), generally considered to be located internally prior to cellular entry, suggests that VP deamidation may occur prior to capsid assembly. The deamidation of N may occur through its C-terminus residue's backbone nitrogen atom conducts a nucleophilic attack to the Asn's side chain amide group carbon atom. An intermediate ring-closed succinimide residue is believed to form. The succinimide residue then conducts fast hydrolysis to lead to the final product aspartic acid (Asp) or iso aspartic acid (IsoAsp). Therefore, in certain embodiments, the deamidation of asparagine (N or Asn) leads to an Asp or IsoAsp, which may interconvert through the succinimide intermediate e.g., as illustrated below. [Image disponible dans le document PDF, Image available in the PDF document] As provided herein, each deamidated N in the VP1, VP2 or VP3 may independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate, and / or an interconverting blend of Asp and isoAsp, or combinations thereof. Any suitable ratio of <semantics>α<annotation encoding="application / x-tex">\alpha< / annotation>< / semantics>- and isoaspartic acid may be present. For example, in certain embodiments, the ratio may be from 10:1 to 1:10 aspartic to isoaspartic, about 50:50 aspartic: isoaspartic, or about 1:3 aspartic: isoaspartic, or another selected ratio. In certain embodiments, one or more glutamine (Q) may deamidates to glutamic acid (Glu), i.e., α-glutamic acid, γ-glutamic acid (Glu), or a blend of α- and γ-glutamic acid, which may interconvert through a common glutarinimide intermediate. Any suitable ratio of <semantics>α<annotation encoding="application / x-tex">\alpha< / annotation>< / semantics>- and <semantics>γ<annotation encoding="application / x-tex">\gamma< / annotation>< / semantics>- glutamic acid may be present. For example, in certain embodiments, the ratio may be from 10:1 to 1:10 <semantics>α<annotation encoding="application / x-tex">\alpha< / annotation>< / semantics> to <semantics>γ<annotation encoding="application / x-tex">\gamma< / annotation>< / semantics>, about 50:50 <semantics>α<annotation encoding="application / x-tex">\alpha< / annotation>< / semantics>: <semantics>γ<annotation encoding="application / x-tex">\gamma< / annotation>< / semantics>, or about 1:3 <semantics>α<annotation encoding="application / x-tex">\alpha< / annotation>< / semantics>: <semantics>γ<annotation encoding="application / x-tex">\gamma< / annotation>< / semantics>, or another selected ratio. [Image disponible dans le document PDF, Image available in the PDF document] Thus, an rAAV includes subpopulations within the rAAV capsid of vp1, vp2 and / or vp3 proteins with deamidated amino acids, including at a minimum, at least one subpopulation comprising at least one highly deamidated asparagine. In addition, other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions. In still other embodiments, modifications may include an amidation at an Asp position. In certain embodiments, an AAV capsid contains subpopulations of vp1, vp2 and vp3 having at least 4 to at least about 25 deamidated amino acid residue positions, of which at least 1% to 10% are deamidated as compared to the encoded amino acid sequence of the vp proteins. The majority of these may be N residues. However, Q residues may also be deamidated. In certain embodiments, a rAAV has an AAV capsid having vp1, vp2 and vp3 proteins having subpopulations comprising combinations of two, three, four or more deamidated residues at the positions set forth in the table provided in Example 11. Deamidation in the rAAV may be determined using 2D gel electrophoresis, and / or mass spectrometry (MS), and / or protein modelling techniques. Online chromatography may be performed with an Acclaim PepMap column and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF with a NanoFlex source (Thermo Fisher Scientific). MS data is acquired using a data-dependent top-20 method for the Q Exactive HF, dynamically choosing the most abundant not-yet-sequenced precursor ions from the survey scans (200–2000 m / z). Sequencing is performed via higher energy collisional dissociation fragmentation with a target value of 1e5 ions determined with predictive automatic gain control and an isolation of precursors was performed with a window of 4 m / z. Survey scans were acquired at a resolution of 120,000 at m / z 200. Resolution for HCD spectra may be set to 30,000 at m / z200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30. The S-lens RF level may be set at 50, to give optimal transmission of the m / z region occupied by the peptides from the digest. Precursor ions may be excluded with single, unassigned, or six and higher charge states from fragmentation selection. BioPharma Finder 1.0 software (Thermo Fischer Scientific) may be used for analysis of the data acquired. For peptide mapping, searches are performed using a single-entry protein FASTA database with carbamidomethylation set as a fixed modification; and oxidation, deamidation, and phosphorylation set as variable modifications, a 10-ppm mass accuracy, a high protease specificity, and a confidence level of 0.8 for MS / MS spectra. Examples of suitable proteases may include, e.g., trypsin or chymotrypsin. Mass spectrometric identification of deamidated peptides is relatively straightforward, as deamidation adds to the mass of intact molecule +0.984 Da (the mass difference between –OH and –NH2 groups). The percent deamidation of a particular peptide is determined by the mass area of the deamidated peptide divided by the sum of the area of the deamidated and native peptides. Considering the number of possible deamidation sites, isobaric species which are deamidated at different sites may co-migrate in a single peak. Consequently, fragment ions originating from peptides with multiple potential deamidation sites can be used to locate or differentiate multiple sites of deamidation. In these cases, the relative intensities within the observed isotope patterns can be used to specifically determine the relative abundance of the different deamidated peptide isomers. This method assumes that the fragmentation efficiency for all isomeric species is the same and independent on the site of deamidation. It is understood by one of skill in the art that a number of variations on these illustrative methods can be used. For example, suitable mass spectrometers may include, e.g, a quadrupole time of flight mass spectrometer (QTOF), such as a Waters Xevo or Agilent 6530 or an orbitrap instrument, such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher). Suitably liquid chromatography systems include, e.g., Acquity UPLC system from Waters or Agilent systems (1100 or 1200 series). Suitable data analysis software may include, e.g., MassLynx (Waters), Pinpoint and Pepfinder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Still other techniques may be described, e.g., in X. Jin et al, Hu Gene Therapy Methods, Vol. 28, No. 5, pp. 255-267, published online June 16, 2017. In addition to deamidations, other modifications may occur that do not result in conversion of one amino acid to a different amino acid residue. Such modifications may include acetylated residues, isomerizations, phosphorylations, or oxidations. Modulation of Deamidation: In certain embodiments, the AAV is modified to change the glycine in an asparagine-glycine pair, to reduce deamidation. In other embodiments, the asparagine is altered to a different amino acid, e.g., a glutamine which deamidates at a slower rate; or to an amino acid which lacks amide groups (e.g., glutamine and asparagine contain amide groups); and / or to an amino acid which lacks amine groups (e.g., lysine, arginine and histidine contain amine groups). As used herein, amino acids lacking amide or amine side groups refer to, e.g., glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan, and / or proline. Modifications such as described may be in one, two, or three of the asparagine-glycine pairs found in the encoded AAV amino acid sequence. In certain embodiments, such modifications are not made in all four of the asparagine - glycine pairs. Thus, a method for reducing deamidation of AAV and / or engineered AAV variants having lower deamidation rates. Additionally, or alternative one or more other amide amino acids may be changed to a non-amide amino acid to reduce deamidation of the AAV. In certain embodiments, a mutant AAV capsid as described herein contains a mutation in an arginine - glycine pair, such that the glycine is changed to an alanine or a serine. A mutant AAV capsid may contain one, two or three mutants where the reference AAV natively contains four NG pairs. In certain embodiments, an AAV capsid may contain one, two, three or four such mutants where the reference AAV natively contains five NG pairs. In certain embodiments, a mutant AAV capsid contains only a single mutation in an NG pair. In certain embodiments, a mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, a mutant AAV capsid contains mutation is two different NG pairs which are located in structurally separate location in the AAV capsid. In certain embodiments, the mutation is not in the VP1-unique region. In certain embodiments, one of the mutations is in the VP1-unique region. Optionally, a mutant AAV capsid contains no modifications in the NG pairs, but contains mutations to minimize or eliminate deamidation in one or more asparagines, or a glutamine, located outside of an NG pair. In the AAVhu68 capsid protein, 4 residues (N57, N329, N452, N512) routinely display levels of deamidation >70% and it most cases >90% across various lots. Additional asparagine residues (N94, N253, N270, N304, N409, N477, and Q599) also display deamidation levels up to <semantics>∼<annotation encoding="application / x-tex">\sim< / annotation>< / semantics>20% across various lots. The deamidation levels were initially identified using a trypsin digest and verified with a chymotrypsin digestion. The AAVhu68 capsid contains subpopulations within the vp1 proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues in SEQ ID NO: 7. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs in SEQ ID NO: 7 and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications. SEQ ID NO: 8 provide an amino acid sequence of a modified AAVhu68 capsid, illustrating positions which may have some percentage of deamidated or otherwise modified amino acids. The various combinations of these and other modifications are described herein. As used herein, an "AAV9 capsid" is a self-assembled AAV capsid composed of multiple AAV9 vp proteins. The AAV9 vp proteins are typically expressed as alternative splice variants encoded by a nucleic acid sequence of SEQ ID NO: 9 or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% thereto, which encodes the vp1 amino acid sequence of GenBank accession: AAS99264. In certain embodiments, "AAV9 capsid" includes an AAV having an amino acid sequence which is 99% identical to AAS99264 or 99% identical to SEQ ID NO: 10. See, also US7906111 and WO 2005 / 033321. As used herein "AAV9 variants" include those described in, e.g., WO2016 / 049230, US 8,927,514, US 2015 / 0344911, and US 8,734,809. Methods of generating the capsid, coding sequences therefore, and methods for production of rAAV viral vectors have been described. See, e.g., Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100 (10), 6081-6086 (2003) and US 2013 / 0045186A1. The term "substantial homology" or "substantial similarity," when referring to a nucleic acid, or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95 to 99% of the aligned sequences. Preferably, the homology is over full-length sequence, or an open reading frame thereof, or another suitable fragment which is at least 15 nucleotides in length. Examples of suitable fragments are described herein. The terms "sequence identity" "percent sequence identity" or "percent identical" in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence. The length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired. Similarly, "percent sequence identity" may be readily determined for amino acid sequences, over the full-length of a protein, or a fragment thereof. Suitably, a fragment is at least about 8 amino acids in length and may be up to about 700 amino acids. Examples of suitable fragments are described herein. The term "substantial homology" or "substantial similarity," when referring to amino acids or fragments thereof, indicates that, when optimally aligned with appropriate amino acid insertions or deletions with another amino acid (or its complementary strand), there is amino acid sequence identity in at least about 95 to 99% of the aligned sequences. Preferably, the homology is over full-length sequence, or a protein thereof, e.g., a cap protein, a rep protein, or a fragment thereof which is at least 8 amino acids, or more desirably, at least 15 amino acids in length. Examples of suitable fragments are described herein. By the term "highly conserved" is meant at least 80% identity, preferably at least 90% identity, and more preferably, over 97% identity. Identity is readily determined by one of skill in the art by resort to algorithms and computer programs known by those of skill in the art. Generally, when referring to "identity", "homology", or "similarity" between two different adeno-associated viruses, "identity", "homology" or "similarity" is determined in reference to "aligned" sequences. "Aligned" sequences or "alignments" refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence. In the examples, AAV alignments are performed using the published AAV9 sequences as a reference point. Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Examples of such programs include, "Clustal Omega", "Clustal W", "CAP Sequence Assembly", "MAP", and "MEME", which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using FastaTM, a program in GCG Version 6.1. FastaTM provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. For instance, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1. Multiple sequence alignment programs are also available for amino acid sequences, e.g., the "Clustal Omega", "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME", and "Match-Box" programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments", 27(13):2682-2690 (1999). V. rAAV Provided herein is a therapeutic, recombinant, and replication-defective adeno-associated virus (rAAV) which is useful for treating a disease associated with an Arylsulfatase A gene (ARSA) mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, Metachromatic Leukodystrophy (MLD)) in a subject in need thereof. The rAAV is desirably replication-defective and carries a vector genome comprising inverted terminal repeats (ITR) and a nucleic acid sequence encoding a functional human Arylsulfatase A (hARSA) under the control of regulatory sequences which direct the hARSA expression in a target cell. In certain embodiments, the hARSA coding sequence comprises a sequence of nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1, or a sequence at least 95% to 99.9% identical thereto which encodes a functional hARSA. In certain embodiments, the vector genome comprises inverted terminal repeats (ITR) and an expression cassette as described in Part III. In a further embodiment, the rAAV comprises an AAV capsid. The AAV capsid may be selected based on the target cell. In certain embodiment, the AAV capsid is suitable for delivery of the vector genome in nervous system (for example, CNS) or PNS). In certain embodiments, the AAV capsid is suitable for delivery of the vector genome in a neuron, a nervous system cell, an oligodendrocyte, a microglia, a Central Nervous System (CNS) cell, a neuron in the CNS, a Peripheral Nervous System (PNS) cell, a Schwann cell, a macrophage in the PNS, or a cell in visceral organs (for example, a kidney cell, a liver cell and a gallbladder cell). In certain embodiments, the AAV capsid is suitable for delivery of the vector genome in another target cell as described herein. In certain embodiments, the AAV capsid is selected from a cy02 capsid, a rh43 capsid, an AAV8 capsid, a rh01 capsid, an AAV9 capsid, an rh8 capsid, a rh10 capsid, a bb01 capsid, a hu37 capsid, a rh02 capsid, a rh20 capsid, a rh39 capsid, a rh64 capsid, an AAV6 capsid, an AAV1 capsid, a hu44 capsid, a hu48 capsid, a cy05 capsid a hu11 capsid, a hu32 capsid, a pi2 capsid, or a variation thereof. In certain embodiments, the AAV capsid is a Clade F capsid, such as AAV9 capsid, AAVhu68 capsid, AAV-PHP.B capsid, hu31 capsid, hu32 capsid, or a variation thereof. See, e.g., WO 2005 / 033321 published April 14, 2015, WO 2018 / 160582, and US 2015 / 0079038. In certain embodiments, the AAV capsid is a non-clade F capsid, for example a Clade A, B, C, D, or E capsid. In certain embodiment, the non-Clade F capsid is an AAV1 or a variation thereof. In certain embodiment, the AAV capsid transduces a target cell other than the nervous system cells. In certain embodiments, the AAV capsid is a Clade A capsid (e.g., AAV1, AAV6), a Clade B capsid (e.g., AAV 2), a Clade C capsid (e.g., hu53), a Clade D capsid (e.g., AAV7), or a Clade E capsid (e.g., rh10). Still, other AAV capsid may be chosen. In certain embodiment, the rAAV comprises an AAVhu68 capsid in which the vector genome is packaged. In certain embodiments, the AAVhu68 capsid is produced from a sequence encoding the predicted amino acid sequence of SEQ ID NO: 7. See, Part V for more details. In certain embodiments, the vector genome is entirely exogenous to the AAVhu68 capsid, as it contains no AAVhu68 genomic sequences. The functional hARSA is described in Part I. In certain embodiments, the functional hARSA has a signal peptide and a sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2. In certain embodiments, the native hARSA signal peptide is used, e.g., aa 1 to aa 18 of SEQ ID NO: 2. In certain embodiments, the signal peptide has an amino acid sequence of as 1 to as 20 of SEQ ID NO: 4. In certain embodiment the functional hARSA has an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4. In certain embodiments, the hARSA coding sequence is about 95% to 100% identical to nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1. In certain embodiments, the hARSA-coding sequence is SEQ ID NO: 1 or SEQ ID NO: 3. In a further embodiment, the hARSA coding sequence encodes a sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2. In yet a further embodiment, the hARSA coding sequence encodes a sequence of SEQ ID NO: 2 or SEQ ID NO: 4. See, Part I for more details about hARSA coding sequence. In certain embodiments, the regulatory sequences direct hARSA expression in nervous system cells. In certain embodiments, the regulatory sequences comprise a ubiquitous promoter, for example, a CB7 promoter. In a further embodiment, the regulatory elements comprise one or more of a Kozak sequence, a polyadenylation sequence, an intron, an enhancer, and a TATA signal. In certain embodiments, the regulatory sequences comprise one or more of the following: a regulatory element derived from the chicken β-actin (BA) promoter and human cytomegalovirus immediate-early enhancer (CMV IE) (for example, CB7 promoter, nt 198 to nt 862 of SEQ ID NO: 5), a chimeric intron consisting of a chicken BA splice donor and a rabbit β- globin (rBG) splice acceptor element(for example, CI, nt 956 to nt 1928 of SEQ ID NO: 5), and polyadenylation (PolyA) signal derived from the rBG gene (for example, rBG, nt 3539 to nt 3665 of SEQ ID NO: 5). In certain embodiments, the vector genome has a sequence of nucleotide (nt) 1 to nt 3883 of SEQ ID NO: 5. See, Part III for more details. In certain embodiments, the rAAV or a composition comprising the rAAV is administrable to a subject in need thereof to ameliorate symptoms of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD), and / or to delay progression of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD). See, part II for more details. In certain embodiments, the rAAV as described herein is suitable for administration to a patient via an intra-cisterna magna injection (ICM), including via a CT-guided sub-occipital injection into the cisterna magna. In certain embodiments, the rAAV as described herein is suitable for administration to a subject who is 7 years of age or younger. In certain embodiments, the rAAV as described herein is suitable for administration to a subject in need thereof to ameliorate symptoms of Metachromatic Leukodystrophy or a disease associated with Arylsulfatase A (ARSA) gene mutation, and / or to delay progression of Metachromatic Leukodystrophy or a disease associated with Arylsulfatase A (ARSA) gene mutation. See, Part II and Part VIII for more details. In certain embodiments, the rAAV as described herein is administered in a single dose. In certain embodiment, the vector genome is a single-stranded AAV vector genome. In certain embodiments, a rAAV vector may be utilized in the invention which contains self- complementary (sc) AAV vector genome. The regulatory control elements necessary are operably linked to the gene (e.g., hARSA) coding sequence) in a manner which permits its transcription, translation and / or expression in a cell which takes up the rAAV. As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. Such regulatory sequences typically include, e.g., one or more of a promoter, an enhancer, an intron, a polyA, a self-cleaving linker (e.g., furin, furin-F2A, an IRES). The examples below utilize CB7 promoter for expression of hARSA. However, in certain embodiments, other promoters, or an additional promoter, may be selected. In certain embodiments, an additional or alternative promoter sequence may be included as part of the expression control sequences (regulatory sequences), e.g., located between the selected 5' ITR sequence and the coding sequence. Constitutive promoters, regulatable promoters [see, e.g., WO 2011 / 126808 and WO 2013 / 04943], tissue specific promoters, or a promoter responsive to physiologic cues may be utilized in the vectors described herein. The promoter(s) can be selected from different sources, e.g., human cytomegalovirus (CMV) immediate-early enhancer / promoter, the SV40 early enhancer / promoter, the JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoters, herpes simplex virus (HSV-1) latency associated promoter (LAP), rouse sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter. In addition to a promoter, a vector may contain one or more other appropriate transcription initiation sequences, transcription termination sequences, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, sequences that stabilize cytoplasmic mRNA for example WPRE; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. An example of a suitable enhancer is the CMV enhancer. Other suitable enhancers include those that are appropriate for desired target tissue indications. In one embodiment, the regulatory sequences comprise one or more expression enhancers. In one embodiment, the regulatory sequences contain two or more expression enhancers. These enhancers may be the same or may differ from one another. For example, an enhancer may include a CMV immediate early enhancer (SEQ ID NO: 19). This enhancer may be present in two copies which are located adjacent to one another. Alternatively, the dual copies of the enhancer may be separated by one or more sequences. In still another embodiment, the expression cassette further contains an intron, e.g., the chicken beta-actin intron (SEQ ID NO: 17). In certain embodiments, the intron is a chimeric intron (CI)—a hybrid intron consisting of a human beta-globin splice donor and immunoglobulin G (IgG) splice acceptor elements. Other suitable introns include those known in the art, e.g., such as are described in WO 2011 / 126808. Examples of suitable polyA sequences include, e.g., SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyAs. Optionally, one or more sequences may be selected to stabilize mRNA. An example of such a sequence is a modified WPRE sequence, which may be engineered upstream of the polyA sequence and downstream of the coding sequence (see, e.g., MA Zanta-Boussif, et al, Gene Therapy (2009) 16: 605-619). In certain embodiments, no WPRE sequence is present. In certain embodiments, in addition to the hARSA coding sequence, another non-AAV coding sequence may be included, e.g., a peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product, of interest. Useful gene products may include miRNAs, miRNAs and other small interfering nucleic acids regulate gene expression via target RNA transcript cleavage / degradation or translational repression of the target messenger RNA (mRNA), miRNAs are natively expressed, typically as final 19-25 non-translated RNA products, miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated regions (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors which are subsequently processed into a miRNA duplex, and further into a "mature" single stranded miRNA molecule. This mature miRNA guides a multiprotein complex, miRISC, which identifies target site, e.g., in the 3' UTR regions, of target mRNAs based upon their complementarity to the mature miRNA. The AAV sequences of the vector typically comprise the cis-acting 5' and 3' inverted terminal repeat (ITR) sequences (See, e.g., B. J. Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155 168 (1990)). The ITR sequences are about 145 base pairs (bp) in length. Preferably, substantially the entire sequences encoding the ITRs are used in the molecule, although some degree of minor modification of these sequences is permissible. The ability to modify these ITR sequences is within the skill of the art. (See, e.g., texts such as Sambrook et al, "Molecular Cloning. A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J. Virol., 70:520 532 (1996)). An example of such a molecule employed in the present invention is a "cis-acting" plasmid containing the transgene, in which the selected transgene sequence and associated regulatory elements are flanked by the 5' and 3' AAV ITR sequences. In one embodiment, the ITRs are from an AAV different than that supplying a capsid. In one embodiment, the ITR sequences are from AAV2. A shortened version of the 5' ITR, termed <semantics>△<annotation encoding="application / x-tex">\triangle< / annotation>< / semantics>ITR, has been described in which the D-sequence and terminal resolution site (trs) are deleted. In other embodiments, the full-length AAV 5' and 3' ITRs are used. However, ITRs from other AAV sources may be selected. Where the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped. However, other configurations of these elements may be suitable. In certain embodiments, vector genomes are constructed which comprise a 5' AAV ITR - promoter – optional enhancer – optional intron – hARSA coding sequence– polyA – 3' ITR, termed as AAV.promoter.optional enhancer.optional intron.hARSA or hARSAco.polyA. In certain embodiments, the ITRs are from AAV2. In certain embodiments, more than one promoter is present. In certain embodiments, the enhancer is present in the vector genome. In certain embodiments, more than one enhancer is present. In certain embodiments, an intron is present in the vector genome. In certain embodiments, the enhancer and intron are present. In certain embodiments, the intron is a chimeric intron (CI)—a hybrid intron consisting of a human beta- globin splice donor and immunoglobulin G (IgG) splice acceptor elements. In certain embodiments, the polyA is an SV40 poly A (i.e., a polyadenylation (PolyA) signal derived from Simian Virus 40 (SV40) late genes). In certain embodiments, the polyA is a rabbit beta-globin (RBG) poly A. In certain embodiments, the vector genome comprises a 5' AAV ITR – CB7 promoter – hARSA coding sequence – poly A – 3' ITR. As used herein, a vector genome or a rAAV comprising the vector genome is illustrated herein as AAV.promoter (optional).Kozak (optional).intron (optional).hARSA coding sequence (e.g., hARSA, hARSAco). miRNA (optional).polyA(optionl).Stuffer (optional). In certain embodiments, a rAAV is illustrated herein as AAVcapsid.promoter (optional).Kozak (optional).intron (optional).hARSA coding sequence. miRNA (optional).polyA (optional).Stuffer (optional). In another aspect, a production system useful for producing the rAAV is provided. In this system, cells were cultured which comprises a nucleic acid sequence encoding an AAVhu68 capsid protein, a vector genome as described herein and sufficient AAV rep functions and helper functions to permit packaging of the vector genome into the AAV capsid. In certain embodiments, the vector genome has a sequence of nt 1 to nt 3883 of SEQ ID NO: 5. In certain embodiments, the cell culture is a human embryonic kidney 293 cell culture. In certain embodiments, the AAV rep is from an AAV different from AAVhu68, for example, from AAV2. In certain embodiments, the AAV rep coding sequence and cap genes are on the same nucleic acid molecule, wherein there is optionally a spacer between the rep sequence and cap gene. In a further embodiment, the spacer is atgacttaaaccaggt (SEQ ID NO: 24). For use in producing an AAV viral vector (e.g., a recombinant (r) AAV), the vector genomes can be carried on any suitable vector, e.g., a plasmid, which is delivered to a packaging host cell. The plasmids useful in this invention may be engineered such that they are suitable for replication and packaging in vitro in prokaryotic cells, insect cells, mammalian cells, among others. Suitable transfection techniques and packaging host cells are known and / or can be readily designed by one of skill in the art. An illustrative production process is provided in FIGs. 6-7. In certain embodiments, the plasmid has a sequence of SEQ ID NO: 5. Methods for generating and isolating AAVs suitable for use as vectors are known in the art. See generally, e.g., Grieger & Samulski, 2005, Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications, Adv. Biochem. Engin / Biotechnol. 99: 119-145; Buning et al., 2008, Recent developments in adeno-associated virus vector technology, J. Gene Med. 10:717-733; and the references cited below. For packaging a gene into virions, the ITRs are the only AAV components required in cis in the same construct as the nucleic acid molecule containing the gene. The cap and rep genes can be supplied in trans. In one embodiment, the selected genetic element may be delivered to an AAV packaging cell by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. Stable AAV packaging cells can also be made. The methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012). The term "AAV intermediate" or "AAV vector intermediate" refers to an assembled rAAV capsid which lacks the desired genomic sequences packaged therein. These may also be termed an "empty" capsid. Such a capsid may contain no detectable genomic sequences of an expression cassette, or only partially packaged genomic sequences which are insufficient to achieve expression of the gene product. These empty capsids are non-functional to transfer the gene of interest to a host cell. The recombinant adeno-associated virus (AAV) described herein may be generated using techniques which are known. See, e.g., WO 2003 / 042397; WO 2005 / 033321, WO 2006 / 110689; US 7588772 B2. Such a method involves culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein; a functional rep gene; an expression cassette composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a transgene; and sufficient helper functions to permit packaging of the expression cassette into the AAV capsid protein. Methods of generating the capsid, coding sequences therefor, and methods for production of rAAV viral vectors have been described. See, e.g., Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100 (10), 6081-6086 (2003) and US 2013 / 0045186A1. In one embodiment, a production cell culture useful for producing a recombinant AAVhu68 is provided. Such a cell culture contains a nucleic acid which expresses the AAVhu68 capsid protein in the host cell; a nucleic acid molecule suitable for packaging into the AAVhu68 capsid, e.g., a vector genome which contains AAV ITRs and a non-AAV nucleic acid sequence encoding a gene operably linked to regulatory sequences which direct expression of the gene in a host cell; and sufficient AAV rep functions and adenovirus helper functions to permit packaging of the vector genome into the recombinant AAVhu68 capsid. In one embodiment, the cell culture is composed of mammalian cells (e.g., human embryonic kidney 293 cells, among others) or insect cells (e.g., Spodoptera frugiperda (Sf9) cells). In certain embodiments, baculovirus provides the helper functions necessary for packaging the vector genome into the recombinant AAVhu68 capsid. Optionally the rep functions are provided by an AAV other than AAVhu68. In certain embodiments, at least parts of the rep functions are from AAVhu68. In another embodiment, the rep protein is a heterologous rep protein other than AAVhu68rep, for example but not limited to, AAV1 rep protein, AAV2 rep protein, AAV3 rep protein, AAV4 rep protein, AAV5 rep protein, AAV6 rep protein, AAV7 rep protein, AAV8 rep protein; or rep 78, rep 68, rep 52, rep 40, rep68 / 78 and rep40 / 52; or a fragment thereof; or another source. Any of these AAVhu68 or mutant AAV capsid sequences may be under the control of exogenous regulatory control sequences which direct expression thereof in a host cell. In one embodiment, cells are manufactured in a suitable cell culture (e.g., HEK 293 or Sf9) or suspension. Methods for manufacturing the gene therapy vectors described herein include methods well known in the art such as generation of plasmid DNA used for production of the gene therapy vectors, generation of the vectors, and purification of the vectors. In some embodiments, the gene therapy vector is an AAV vector and the plasmids generated are an AAV cis-plasmid encoding the AAV vector genome and the gene of interest, an AAV trans-plasmid containing AAV rep and cap genes, and an adenovirus helper plasmid. The vector generation process can include method steps such as initiation of cell culture, passage of cells, seeding of cells, transfection of cells with the plasmid DNA, post-transfection medium exchange to serum free medium, and the harvest of vector-containing cells and culture media. The harvested vector- containing cells and culture media are referred to herein as crude cell harvest. In yet another system, the gene therapy vectors are introduced into insect cells by infection with baculovirus- based vectors. For reviews on these production systems, see generally, e.g., Zhang et al., 2009, Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production, Human Gene Therapy 20:922-929. Methods of making and using these and other AAV production systems are also described in the following U.S. patents: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065. The crude cell harvest may thereafter be subject method steps such as concentration of the vector harvest, diafiltration of the vector harvest, microfluidization of the vector harvest, nuclease digestion of the vector harvest, filtration of microfluidized intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation and filtration to prepare bulk vector. A two-step affinity chromatography purification at high salt concentration followed anion exchange resin chromatography are used to purify the vector drug product and to remove empty capsids. These methods are described in more detail in WO 2017 / 160360, International Patent Application No. PCT / US2016 / 065970, filed December 9, 2016 and its priority documents, US Patent Application Nos. 62 / 322,071, filed April 13, 2016 and 62 / 226,357, filed December 11, 2015 and entitled "Scalable Purification Method for AAV9". To calculate empty and full particle content, VP3 band volumes for a selected sample (e.g., in examples herein an iodixanol gradient-purified preparation where # of genome copies <semantics>(GC)=#<annotation encoding="application / x-tex">(GC) = \#< / annotation>< / semantics> of particles) are plotted against GC particles loaded. The resulting linear equation (y = mx+c) is used to calculate the number of particles in the band volumes of the test article peaks. The number of particles (pt) per 20 µL loaded is then multiplied by 50 to give particles (pt) / mL. Pt / mL divided by GC / mL gives the ratio of particles to genome copies (pt / GC). Pt / mL-GC / mL gives empty pt / mL. Empty pt / mL divided by pt / mL and x 100 gives the percentage of empty particles. Generally, methods for assaying for empty capsids and AAV vector particles with packaged genomes have been known in the art. See, e.g., Grimm et al., Gene Therapy (1999) 6:1322-1330; Sommer et al., Molec. Ther. (2003) 7:122-128. To test for denatured capsid, the methods include subjecting the treated AAV stock to SDS-polyacrylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3-8% Tris-acetate in the buffer, then running the gel until sample material is separated, and blotting the gel onto nylon or nitrocellulose membranes, preferably nylon. Anti-AAV capsid antibodies are then used as the primary antibodies that bind to denatured capsid proteins, preferably an anti-AAV capsid monoclonal antibody, most preferably the B1 anti-AAV-2 monoclonal antibody (Wobus et al., J. Virol. (2000) 74:9281-9293). A secondary antibody is then used, one that binds to the primary antibody and contains a means for detecting binding with the primary antibody, more preferably an anti-IgG antibody containing a detection molecule covalently bound to it, most preferably a sheep anti-mouse IgG antibody covalently linked to horseradish peroxidase. A method for detecting binding is used to semi-quantitatively determine binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, samples from column fractions can be taken and heated in SDS-PAGE loading buffer containing reducing agent (e.g., DTT), and capsid proteins were resolved on pre-cast gradient polyacrylamide gels (e.g., Novex). Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions or other suitable staining method, i.e. SYPRO ruby or coomassie stains. In one embodiment, the concentration of AAV vector genomes (vg) in column fractions can be measured by quantitative real time PCR (Q-PCR). Samples are diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the samples are further diluted and amplified using primers and a TaqManTM fluorogenic probe specific for the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 Sequence Detection System. Plasmid DNA containing identical sequences to that contained in the AAV vector is employed to generate a standard curve in the Q-PCR reaction. The cycle threshold (Ct) values obtained from the samples are used to determine vector genome titer by normalizing it to the Ct value of the plasmid standard curve. End-point assays based on the digital PCR can also be used. In one aspect, an optimized q-PCR method is used which utilizes a broad spectrum serine protease, e.g., proteinase K (such as is commercially available from Qiagen). More particularly, the optimized qPCR genome titer assay is similar to a standard assay, except that after the DNase I digestion, samples are diluted with proteinase K buffer and treated with proteinase K followed by heat inactivation. Suitably samples are diluted with proteinase K buffer in an amount equal to the sample size. The proteinase K buffer may be concentrated to 2 fold or higher. Typically, proteinase K treatment is about 0.2 mg / mL, but may be varied from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally conducted at about 55 °C for about 15. minutes, but may be performed at a lower temperature (e.g., about 37 °C to about 50 °C) over a longer time period (e.g., about 20 minutes to about 30 minutes), or a higher temperature (e.g., up to about 60 °C) for a shorter time period (e.g., about 5 to 10 minutes). Similarly, heat inactivation is generally at about 95 °C for about 15 minutes, but the temperature may be lowered (e.g., about 70 to about 90 °C) and the time extended (e.g., about 20 minutes to about 30 minutes). Samples are then diluted (e.g., 1000 fold) and subjected to TaqMan analysis as described in the standard assay. Additionally, or alternatively, droplet digital PCR (ddPCR) may be used. For example, methods for determining single-stranded and self-complementary AAV vector genome titers by ddPCR have been described. See, e.g., M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr;25(2):115-25. doi: 10.1089 / hgtb.2013.131. Epub 2014 Feb 14. In brief, the method for separating rAAVhu68 particles having packaged genomic sequences from genome-deficient AAVhu68 intermediates involves subjecting a suspension comprising recombinant AAVhu68 viral particles and AAVhu68 capsid intermediates to fast performance liquid chromatography, wherein the AAVhu68 viral particles and AAVhu68 intermediates are bound to a strong anion exchange resin equilibrated at a pH of about 10.2, and subjected to a salt gradient while monitoring eluate for ultraviolet absorbance at about 260 nanometers (nm) and about 280 nm. Although less optimal for rAAVhu68, the pH may be in the range of about 10.0 to 10.4. In this method, the AAVhu68 full capsids are collected from a fraction which is eluted when the ratio of A260 / A280 reaches an inflection point. In one example, for the Affinity Chromatography step, the diafiltered product may be applied to a Capture SelectTM Poros- AAV2 / 9 affinity resin (Life Technologies) that efficiently captures the AAV2 / hu68 serotype. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flow through the column, while AAV particles are efficiently captured. The rAAV.hARSA is suspended in a suitable physiologically compatible composition (e.g., a buffered saline). This composition may be frozen for storage, later thawed and optionally diluted with a suitable diluent. Alternatively, the vector may be prepared as a composition which is suitable for delivery to a patient without proceeding through the freezing and thawing steps. As used herein, the term "NAb titer" a measurement of how much neutralizing antibody (e.g., anti-AAV Nab) is produced which neutralizes the physiologic effect of its targeted epitope (e.g., an AAV). Anti-AAV NAb titers may be measured as described in, e.g., Calcedo, R., et al., Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associated Viruses. Journal of Infectious Diseases, 2009. 199(3): p. 381-390. The abbreviation "sc" refers to self-complementary. "Self-complementary AAV" refers a construct in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intra-molecular double-stranded DNA template. Upon infection, rather than waiting for cell mediated synthesis of the second strand, the two complementary halves of scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription. See, e.g., D M McCarty et al, "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", Gene Therapy, (August 2001), Vol 8, Number 16, Pages 1248- 1254. Self-complementary AAVs are described in, e.g., U.S. Patent Nos. 6,596,535; 7,125,717; and 7,456,683. A "replication-defective virus" or "viral vector" refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the gene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication. In many instances, rAAV particles are referred to as DNase resistant. However, in addition to this endonuclease (DNase), other endo- and exo- nucleases may also be used in the purification steps described herein, to remove contaminating nucleic acids. Such nucleases may be selected to degrade single stranded DNA and / or double-stranded DNA, and RNA. Such steps may contain a single nuclease, or mixtures of nucleases directed to different targets, and may be endonucleases or exonucleases. The term "nuclease-resistant" indicates that the AAV capsid has fully assembled around the expression cassette which is designed to deliver a gene to a host cell and protects these packaged genomic sequences from degradation (digestion) during nuclease incubation steps designed to remove contaminating nucleic acids which may be present from the production process. VI. Other Vector In one aspect, provided herein is a vector which is useful for treating a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD) in a subject in need thereof. The vector carries a nucleic acid sequence encoding a functional human Arylsulfatase A (hARSA) under the control of regulatory sequences which direct the hARSA expression in a target cell. In certain embodiments, the hARSA coding sequence is about 95% to 100% identical to SEQ ID NO: 1. Additionally or alternatively, the function hARSA protein has an amino acid sequence of SEQ ID NO: 2. In certain embodiments, the hARSA-coding sequence is SEQ ID NO: 1. In certain embodiments, the vector or a composition comprising the vector is administrable to a subject in need thereof to ameliorate symptoms of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD), and / or to delay progression of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD). In certain embodiments, the vector comprises an expression cassette. In certain embodiments, the expression cassette comprises a nucleic acid sequence encoding a functional human Arylsulfatase A (hARSA) under control of regulatory sequences which direct the hARSA expression. In certain embodiments, the functional hARSA protein comprises a signal peptide and an amino acid sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2. In certain embodiments, the signal peptide has an amino acid sequence of an 1 to an 18 of SEQ ID NO: 2 or an amino acid sequence of an 1 to an 20 of SEQ ID NO: 4. In certain embodiments, the hARSA coding sequence has a sequence of nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1, or a sequence at least 95% to 99.9% identical thereto which encodes a functional hARSA. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 1 or SEQ ID NO: 3. See, Parts I, and III for more details. In certain embodiments, the vector is a viral vector selected from a recombinant parvovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adenovirus; or a non-viral vector selected from naked DNA, naked RNA, an inorganic particle, a lipid particle, a polymer-based vector, or a chitosan-based formulation. The selected vector may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. The methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. In certain embodiments, the vector is suitable for administration to a patient via an intra- cisterna magna injection (ICM), including via a CT-guided sub-occipital injection into the cisterna magna. In certain embodiments, the vector is suitable for administration to a subject who is 7 years of age or younger. In certain embodiments, the vector is suitable for administration to a subject in need thereof to ameliorate symptoms of Metachromatic Leukodystrophy or a disease associated with Arylsulfatase A (ARSA) gene mutation, and / or to delay progression of Metachromatic Leukodystrophy or a disease associated with Arylsulfatase A (ARSA) gene mutation. In certain embodiments, the vector is administered in a single dose. See, Part II and Part VIII for more details. A "replication-defective virus" or "viral vector" refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest (e.g., hARSA coding sequence) is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the transgene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication. Such replication-defective viruses may be adeno-associated viruses (AAV), adenoviruses, lentiviruses (integrating or non-integrating), or another suitable virus source. VII. Compositions In a further aspect, provided herein is a composition comprising a rAAV or a vector as described herein and an aqueous suspension media. In certain embodiments, the aqueous composition is provided which comprises a formulation buffer and the rAAV or vector as described. In certain embodiments, the formulation buffer comprises: an artificial cerebrospinal fluid comprising buffered saline and one or more of sodium, calcium, magnesium, potassium, or mixtures thereof; and a surfactant. In certain embodiments, the formulation buffer comprises about 0.0005 % to about 0.001% surfactant. In certain embodiments, the composition is at a pH of 7.2 to 7.8. In certain embodiments, AAV.CB7.CI.hARSAco.rBG drug product consists of a non-replicating recombinant adeno-associated viral (rAAV) vector as described herein and a formulation buffer. In certain embodiments, an aqueous pharmaceutical composition comprising a rAAV according to any one of claims 1 to 10 and a formulation buffer is provided. In certain embodiments, the formulation buffer comprises: an artificial cerebrospinal fluid comprising buffered saline and one or more of sodium, calcium, magnesium, potassium, or mixtures thereof; and a surfactant. In certain embodiments, the surfactant is present at 0.0005 % to about 0.001% of the pharmaceutical composition. In certain embodiments, the composition is at a pH in the range of 7.5 to 7.8. In certain embodiments, the formulation buffer is suitable for intravenous delivery, intrathecal administration, or intracerebroventricular administration. In certain embodiments, provided is a pharmaceutical composition comprising a vector as described and a formulation buffer. In certain embodiments, the formulation buffer is suitable for intravenous delivery, intrathecal administration, or intracerebroventricular administration. In certain embodiments, the composition is suitable for administration to a patient via an intra-cisterna magna injection (ICM), including via a CT-guided sub-occipital injection into the cisterna magna. In certain embodiments, the composition is suitable for administration to a subject who is 7 years of age or younger. In certain embodiments, the composition is suitable for administration to a subject in need thereof to ameliorate symptoms of Metachromatic Leukodystrophy or a disease associated with Arylsulfatase A (ARSA) gene mutation, and / or to delay progression of Metachromatic Leukodystrophy or a disease associated with Arylsulfatase A (ARSA) gene mutation. In certain embodiments, the composition is administered in a single dose. In certain embodiments, the composition has an at least <semantics>2.50×1013<annotation encoding="application / x-tex">2.50 \times 10^{13}< / annotation>< / semantics> GC rAAV per mL. Provided herein are compositions containing at least one rAAV stock (e.g., an rAAVhu68 stock or a mutant rAAVhu68 stock) and an optional carrier, excipient and / or preservative. An rAAV stock refers to a plurality of rAAV vectors which are the same, e.g., such as in the amounts described below in the discussion of concentrations and dosage units. As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase "pharmaceutically-acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present invention into suitable host cells. In particular, the rAAV vector delivered vector genomes may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like. In one embodiment, a composition includes a final formulation suitable for delivery to a subject, e.g., is an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition may be transported as a concentrate which is diluted for administration to a subject. In other embodiments, the composition may be lyophilized and reconstituted at the time of administration. A suitable surfactant, or combination of surfactants, may be selected from among non- ionic surfactants that are nontoxic. In one embodiment, a difunctional block copolymer surfactant terminating in primary hydroxyl groups is selected, e.g., such as Pluronic® F68 [BASF], also known as Poloxamer 188, which has a neutral pH, has an average molecular weight of 8400. Other surfactants and other Poloxamers may be selected, i.e., nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (Macrogol-15 Hydroxystearate), LABRASOL (Polyoxy capryllic glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid esters), ethanol and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are commonly named with the letter "P" (for poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit x 10 gives the percentage polyoxyethylene content. In one embodiment Poloxamer 188 is selected. In one embodiment, the surfactant may be present in an amount up to about 0.0005 % to about 0.001% (based on weight ratio, w / w %) of the suspension. In another embodiment, the surfactant may be present in an amount up to about 0.0005 % to about 0.001% (based on volume ratio, v / v %) of the suspension. In yet another embodiment, the surfactant may be present in an amount up to about 0.0005 % to about 0.001% of the suspension, wherein n % indicates n gram per 100 mL of the suspension. In yet another embodiment, the surfactant may be present in an amount up to about 0.0005 % to about 0.001% (based on weight over volume ratio, v / w %) of the suspension. As used herein, in certain embodiments, "%" upon referring to a concentration, is a weight ratio, for example, percentage of the substance (to be dissolved via a solvent into a solution) weight over the solvent's weight, or percentage of the substance (to be dissolved via a solvent into a solution) weight over the solution's weight. In certain embodiments, "%" upon referring to a concentration, is a volume ratio, for example, percentage of the substance (to be dissolved via a solvent into a solution ) volume over the solvent's volume, or percentage of the substance (to be dissolved via a solvent into a solution) volume over the solution's volume. In certain embodiments, "%" upon referring to a concentration, indicates gram of the substance (to be dissolved via a solvent into a solution ) per 100 mL of the solvent or solution. In certain embodiments, "%" upon referring to a concentration, is a weight over volume ratio, for example, percentage of the substance (to be dissolved via a solvent into a solution ) weight over the solvent's volume, or percentage of the substance (to be dissolved via a solvent into a solution) weight over the solution's volume. The vectors are administered in sufficient amounts to transfect the cells and to provide sufficient levels of gene transfer and expression to provide a therapeutic benefit without undue adverse effects, or with medically acceptable physiological effects, which can be determined by those skilled in the medical arts. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to a desired organ (e.g., brain, CSF, the liver (optionally via the hepatic artery), lung, heart, eye, kidney,), oral, inhalation, intranasal, intrathecal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, intraparenchymal, intracerebroventricular, intrathecal, ICM, lumbar puncture and other parenteral routes of administration. Routes of administration may be combined, if desired. Dosages of the viral vector depend primarily on factors such as the condition being treated, the age, weight and health of the patient, and can thus vary among patients. For example, a therapeutically effective human dosage of the viral vector is generally in the range of from about 25 to about 1000 microliters to about 100 mL of solution containing concentrations of from about 1 x 109 to 1 x 1016 vector genome copies. In certain embodiments, a volume of about 1 mL to about 15 mL, or about 2.5 mL to about 10 mL, or about 5 mL suspension is delivered. In certain embodiments, a volume of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 mL suspension is delivered. In certain embodiments, a dose of about <semantics>8.9×1012<annotation encoding="application / x-tex">8.9 \times 10^{12}< / annotation>< / semantics> to <semantics>2.7×1014<annotation encoding="application / x-tex">2.7 \times 10^{14}< / annotation>< / semantics> GC total is administered in this volume. In certain embodiments, a dose of about <semantics>1.1×1010<annotation encoding="application / x-tex">1.1 \times 10^{10}< / annotation>< / semantics> GC / g brain mass to about <semantics>3.3×1011<annotation encoding="application / x-tex">3.3 \times 10^{11}< / annotation>< / semantics> GC / g brain mass is administered in this volume. In certain embodiments, a dose of about <semantics>3.0×109<annotation encoding="application / x-tex">3.0 \times 10^9< / annotation>< / semantics>, about <semantics>4.0×109<annotation encoding="application / x-tex">4.0 \times 10^9< / annotation>< / semantics>, about <semantics>5.0×109<annotation encoding="application / x-tex">5.0 \times 10^9< / annotation>< / semantics>, about <semantics>6.0×109<annotation encoding="application / x-tex">6.0 \times 10^9< / annotation>< / semantics>, about <semantics>7.0×109<annotation encoding="application / x-tex">7.0 \times 10^9< / annotation>< / semantics>, about <semantics>8.0<annotation encoding="application / x-tex">8.0< / annotation>< / semantics> <semantics>×109<annotation encoding="application / x-tex">\times 10^9< / annotation>< / semantics>, about 9.0 <semantics>×109<annotation encoding="application / x-tex">\times 10^9< / annotation>< / semantics>, about 1.0 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 1.1 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 1.5 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 2.0 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 2.5 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 3.0 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 3.3 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 3.5 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 4.0 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 4.5 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about <semantics>5.0×1010<annotation encoding="application / x-tex">5.0 \times 10^{10}< / annotation>< / semantics>, about <semantics>5.5×1010<annotation encoding="application / x-tex">5.5 \times 10^{10}< / annotation>< / semantics>, about <semantics>6.0×1010<annotation encoding="application / x-tex">6.0 \times 10^{10}< / annotation>< / semantics>, about <semantics>6.5×1010<annotation encoding="application / x-tex">6.5 \times 10^{10}< / annotation>< / semantics>, about <semantics>7.0×1010<annotation encoding="application / x-tex">7.0 \times 10^{10}< / annotation>< / semantics>, about <semantics>7.5×1010<annotation encoding="application / x-tex">7.5 \times 10^{10}< / annotation>< / semantics>, about <semantics>8.0×1010<annotation encoding="application / x-tex">8.0 \times 10^{10}< / annotation>< / semantics>, about <semantics>8.5×1010<annotation encoding="application / x-tex">8.5 \times 10^{10}< / annotation>< / semantics>, about <semantics>9.0×1010<annotation encoding="application / x-tex">9.0 \times 10^{10}< / annotation>< / semantics>, about <semantics>9.5×1010<annotation encoding="application / x-tex">9.5 \times 10^{10}< / annotation>< / semantics>, about <semantics>1.0×1011<annotation encoding="application / x-tex">1.0 \times 10^{11}< / annotation>< / semantics>, about <semantics>1.1<annotation encoding="application / x-tex">1.1< / annotation>< / semantics> <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about 1.5 <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about 2.0 <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about 2.5 <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about 3.0 <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about 3.3 <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about <semantics>3.5×1011<annotation encoding="application / x-tex">3.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>4.0×1011<annotation encoding="application / x-tex">4.0 \times 10^{11}< / annotation>< / semantics>, about <semantics>4.5×1011<annotation encoding="application / x-tex">4.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>5.0×1011<annotation encoding="application / x-tex">5.0 \times 10^{11}< / annotation>< / semantics>, about <semantics>5.5×1011<annotation encoding="application / x-tex">5.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>6.0×1011<annotation encoding="application / x-tex">6.0 \times 10^{11}< / annotation>< / semantics>, about <semantics>6.5×1011<annotation encoding="application / x-tex">6.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>7.0×1011<annotation encoding="application / x-tex">7.0 \times 10^{11}< / annotation>< / semantics>, about <semantics>7.5×1011<annotation encoding="application / x-tex">7.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>8.0×1011<annotation encoding="application / x-tex">8.0 \times 10^{11}< / annotation>< / semantics>, about <semantics>8.5×1011<annotation encoding="application / x-tex">8.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>9.0×1011<annotation encoding="application / x-tex">9.0 \times 10^{11}< / annotation>< / semantics> GC per gram brain mass is administered in this volume. [Image disponible dans le document PDF, Image available in the PDF document] The dosage is adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed. The levels of expression of the transgene product can be monitored to determine the frequency of dosage resulting in viral vectors, preferably AAV vectors containing the minigene. Optionally, dosage regimens similar to those described for therapeutic purposes may be utilized for immunization using the compositions of the invention. The replication-defective virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about <semantics>1.0×109<annotation encoding="application / x-tex">1.0 \times 10^9< / annotation>< / semantics> GC to about <semantics>1.0×1016<annotation encoding="application / x-tex">1.0 \times 10^{16}< / annotation>< / semantics> GC (to treat an subject) including all integers or fractional amounts within the range, and preferably <semantics>1.0×1012<annotation encoding="application / x-tex">1.0 \times 10^{12}< / annotation>< / semantics> GC to <semantics>1.0×1014<annotation encoding="application / x-tex">1.0 \times 10^{14}< / annotation>< / semantics> GC for a human patient. In one embodiment, the compositions are formulated to contain at least 1x109, 2x109, 3x109, 4x109, 5x109, 6x109, 7x109, 8x109, or 9x109 GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1×1010<annotation encoding="application / x-tex">1 \times 10^{10}< / annotation>< / semantics>, <semantics>2×1010<annotation encoding="application / x-tex">2 \times 10^{10}< / annotation>< / semantics>, <semantics>3x1010<annotation encoding="application / x-tex">3x10^{10}< / annotation>< / semantics>, <semantics>4x1010<annotation encoding="application / x-tex">4x10^{10}< / annotation>< / semantics>, <semantics>5x1010<annotation encoding="application / x-tex">5x10^{10}< / annotation>< / semantics>, <semantics>6x1010<annotation encoding="application / x-tex">6x10^{10}< / annotation>< / semantics>, <semantics>7x1010<annotation encoding="application / x-tex">7x10^{10}< / annotation>< / semantics>, <semantics>8x1010<annotation encoding="application / x-tex">8x10^{10}< / annotation>< / semantics>, or <semantics>9x1010<annotation encoding="application / x-tex">9x10^{10}< / annotation>< / semantics> GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1×1011<annotation encoding="application / x-tex">1 \times 10^{11}< / annotation>< / semantics>, <semantics>2×1011<annotation encoding="application / x-tex">2 \times 10^{11}< / annotation>< / semantics>, <semantics>3×1011<annotation encoding="application / x-tex">3 \times 10^{11}< / annotation>< / semantics>, <semantics>4×1011<annotation encoding="application / x-tex">4 \times 10^{11}< / annotation>< / semantics>, <semantics>5×1011<annotation encoding="application / x-tex">5 \times 10^{11}< / annotation>< / semantics>, <semantics>6×1011<annotation encoding="application / x-tex">6 \times 10^{11}< / annotation>< / semantics>, <semantics>7×1011<annotation encoding="application / x-tex">7 \times 10^{11}< / annotation>< / semantics>, <semantics>8×1011<annotation encoding="application / x-tex">8 \times 10^{11}< / annotation>< / semantics>, or <semantics>9×1011<annotation encoding="application / x-tex">9 \times 10^{11}< / annotation>< / semantics> GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1x1012<annotation encoding="application / x-tex">1x10^{12}< / annotation>< / semantics>, <semantics>2x1012<annotation encoding="application / x-tex">2x10^{12}< / annotation>< / semantics>, <semantics>3x1012<annotation encoding="application / x-tex">3x10^{12}< / annotation>< / semantics>, <semantics>4x1012<annotation encoding="application / x-tex">4x10^{12}< / annotation>< / semantics>, <semantics>5x1012<annotation encoding="application / x-tex">5x10^{12}< / annotation>< / semantics>, <semantics>6x1012<annotation encoding="application / x-tex">6x10^{12}< / annotation>< / semantics>, 7x1012, 8x1012, or 9x1012 GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1×1013<annotation encoding="application / x-tex">1 \times 10^{13}< / annotation>< / semantics>, <semantics>2x1013<annotation encoding="application / x-tex">2x10^{13}< / annotation>< / semantics>, <semantics>3x1013<annotation encoding="application / x-tex">3x10^{13}< / annotation>< / semantics>, <semantics>4x1013<annotation encoding="application / x-tex">4x10^{13}< / annotation>< / semantics>, <semantics>5x1013<annotation encoding="application / x-tex">5x10^{13}< / annotation>< / semantics>, <semantics>6x1013<annotation encoding="application / x-tex">6x10^{13}< / annotation>< / semantics>, <semantics>7x1013<annotation encoding="application / x-tex">7x10^{13}< / annotation>< / semantics>, <semantics>8x1013<annotation encoding="application / x-tex">8x10^{13}< / annotation>< / semantics>, or <semantics>9x1013<annotation encoding="application / x-tex">9x10^{13}< / annotation>< / semantics> GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1x1014<annotation encoding="application / x-tex">1x10^{14}< / annotation>< / semantics>, <semantics>2x1014<annotation encoding="application / x-tex">2x10^{14}< / annotation>< / semantics>, <semantics>3x1014<annotation encoding="application / x-tex">3x10^{14}< / annotation>< / semantics>, <semantics>4x1014<annotation encoding="application / x-tex">4x10^{14}< / annotation>< / semantics>, <semantics>5x1014<annotation encoding="application / x-tex">5x10^{14}< / annotation>< / semantics>, <semantics>6x1014<annotation encoding="application / x-tex">6x10^{14}< / annotation>< / semantics>, <semantics>7x1014<annotation encoding="application / x-tex">7x10^{14}< / annotation>< / semantics>, <semantics>8x1014<annotation encoding="application / x-tex">8x10^{14}< / annotation>< / semantics>, or 9x1014 GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1×1015<annotation encoding="application / x-tex">1 \times 10^{15}< / annotation>< / semantics>, <semantics>2×1015<annotation encoding="application / x-tex">2 \times 10^{15}< / annotation>< / semantics>, <semantics>3×1015<annotation encoding="application / x-tex">3 \times 10^{15}< / annotation>< / semantics>, <semantics>4×1015<annotation encoding="application / x-tex">4 \times 10^{15}< / annotation>< / semantics>, 5x1015, 6x1015, 7x1015, 8x1015, or 9x1015 GC per dose including all integers or fractional amounts within the range. In one embodiment, for human application the dose can range from 1x1010 to about <semantics>1×1012<annotation encoding="application / x-tex">1 \times 10^{12}< / annotation>< / semantics> GC per dose including all integers or fractional amounts within the range. These above doses may be administered in a variety of volumes of carrier, excipient or buffer formulation, ranging from about 25 to about 1000 microliters, or higher volumes, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of carrier, excipient or buffer is at least about 25 µL. In one embodiment, the volume is about 50 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 75 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 100 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 125 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 150 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 175 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In yet another embodiment, the volume is about 200 µL. In another embodiment, the volume is about 225 μL. In yet another embodiment, the volume is about 250 μL. In yet another embodiment, the volume is about 275 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In yet another embodiment, the volume is about 300 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In yet another embodiment, the volume is about 325 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 350 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 375 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 400 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 450 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 500 µL. In another embodiment, the volume is about 550 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 650 μL. In another embodiment, the volume is about 700 μL. In another embodiment, the volume is between about 700 and 1000 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In certain embodiments, the dose may be in the range of about <semantics>1×109<annotation encoding="application / x-tex">1 \times 10^9< / annotation>< / semantics> GC / g brain mass to about 1 x 1012 GC / g brain mass. In certain embodiments, the dose may be in the range of about <semantics>1×1010<annotation encoding="application / x-tex">1 \times 10^{10}< / annotation>< / semantics> GC / g brain mass to about <semantics>1×1012<annotation encoding="application / x-tex">1 \times 10^{12}< / annotation>< / semantics> GC / g brain mass. In certain embodiments, the dose may be in the range of about <semantics>3×1010<annotation encoding="application / x-tex">3 \times 10^{10}< / annotation>< / semantics> GC / g brain mass to about <semantics>5×1011<annotation encoding="application / x-tex">5 \times 10^{11}< / annotation>< / semantics> GC / g brain mass. In one embodiment, the viral constructs may be delivered in doses of from at least about least <semantics>1×109<annotation encoding="application / x-tex">1 \times 10^9< / annotation>< / semantics> GC to about <semantics>1×1015<annotation encoding="application / x-tex">1 \times 10^{15}< / annotation>< / semantics>, or about <semantics>1×1011<annotation encoding="application / x-tex">1 \times 10^{11}< / annotation>< / semantics> to <semantics>5×1013<annotation encoding="application / x-tex">5 \times 10^{13}< / annotation>< / semantics> GC. Suitable volumes for delivery of these doses and concentrations may be determined by one of skill in the art. For example, volumes of about 1 μL to 150 mL may be selected, with the higher volumes being selected for adults. Typically, for newborn infants a suitable volume is about 0.5 mL to about 10 mL, for older infants, about 0.5 mL to about 15 mL may be selected. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, volumes of up to about 30 mL may be selected. For pre-teens and teens, volumes up to about 50 mL may be selected. In still other embodiments, a patient may receive an intrathecal administration in a volume of about 5 mL to about 15 mL are selected, or about 7.5 mL to about 10 mL. Other suitable volumes and dosages may be determined. The dosage may be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed. The above-described recombinant vectors may be delivered to host cells according to published methods. The rAAV, preferably suspended in a physiologically compatible carrier, may be administered to a human or non-human mammalian patient. In certain embodiments, for administration to a human patient, the rAAV is suitably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt or mixture of salts. Suitably, the formulation is adjusted to a physiologically acceptable pH, e.g., in the range of pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8. As the pH of the cerebrospinal fluid is about 7.28 to about 7.32, for intrathecal delivery, a pH within this range may be desired; whereas for intravenous delivery, a pH of about 6.8 to about 7.2 may be desired. However, other pHs within the broadest ranges and these subranges may be selected for other route of delivery. In another embodiment, the composition includes a carrier, diluent, excipient and / or adjuvant. Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the transfer virus is directed. For example, one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should include a component that prevents the rAAV, from sticking to the infusion tubing but does not interfere with the rAAV binding activity in vivo. A suitable surfactant, or combination of surfactants, may be selected from among non-ionic surfactants that are nontoxic. In one embodiment, a difunctional block copolymer surfactant terminating in primary hydroxyl groups is selected, e.g., such as Poloxamer 188 (also known under the commercial names Pluronic® F68 [BASF], Lutrol® F68, Synperonic® F68, Kolliphor® P188) which has a neutral pH, has an average molecular weight of 8400. Other surfactants and other Poloxamers may be selected, i.e., nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (Macrogol-15 Hydroxystearate), LABRASOL (Polyoxy capryllic glyceride), polyoxy -oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid esters), ethanol and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are commonly named with the letter "P" (for poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit x 10 gives the percentage polyoxyethylene content. In one embodiment Poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005 % to about 0.001% of the suspension. In one example, the formulation may contain, e.g., buffered saline solution comprising one or more of sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate ·7H2O), potassium chloride, calcium chloride (e.g., calcium chloride ·2H2O), dibasic sodium phosphate, and mixtures thereof, in water. Suitably, for intrathecal delivery, the osmolarity is within a range compatible with cerebrospinal fluid (e.g., about 275 to about 290); see, e.g., emedicine.medscape.com / -article / 2093316-overview. Optionally, for intrathecal delivery, a commercially available diluent may be used as a suspending agent, or in combination with another suspending agent and other optional excipients. See, e.g., Elliotts B® solution [Lukare Medical]. Each 10 mL of Elliotts B Solution contains: Sodium Chloride, USP - 73 mg; Sodium Bicarbonate, USP - 19 mg; Dextrose, USP8 mg; Magnesium Sulfate • 7H2O, USP 3 mg; Potassium Chloride, USP- 3 mg; Calcium Chloride • 2H2O, USP - 2 mg; Sodium Phosphate, dibasic • 7H2O, USP- 2 mg; Water for Injection, USP qs 10 mL. Concentration of Electrolytes: Sodium 149 mEq / liter; Bicarbonate 22.6 mEq / liter; Potassium 4.0 mEq / liter; Chloride 132 mEq / liter; Calcium 2.7 mEq / liter; Sulfate 2.4 mEq / liter; Magnesium 2.4 mEq / liter; Phosphate 1.5 mEq / liter. The formulae and molecular weights of the ingredients are: [Image disponible dans le document PDF, Image available in the PDF document] The pH of Elliotts B Solution is 6 to 7.5, and the osmolarity is 288 mOsmol per liter (calculated). In certain embodiments, the composition containing the rAAVhu68.hARSA is delivered at a pH in the range of 6.8 to 8, or 7.2 to 7.8, or 7.5 to 8. For intrathecal delivery, a pH above 7.5 may be desired, e.g., 7.5 to 8, or 7.8. In certain embodiments, the formulation may contain a buffered saline aqueous solution not comprising sodium bicarbonate. Such a formulation may contain a buffered saline aqueous solution comprising one or more of sodium phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride and mixtures thereof, in water, such as a Harvard's buffer. The aqueous solution may further contain Kolliphor® P188, a poloxamer which is commercially available from BASF which was formerly sold under the trade name Lutrol® F68. The aqueous solution may have a pH of 7.2. In another embodiment, the formulation may contain a buffered saline aqueous solution comprising 1 mM Sodium Phosphate (Na3PO4), 150 mM sodium chloride (NaCl), 3mM potassium chloride (KCl), 1.4 mM calcium chloride (CaCl2), 0.8 mM magnesium chloride (MgCl2), and 0.001% poloxamer (e.g., Kolliphor®) 188, pH 7.2. See, e.g., harvardapparatus.com / harvard-apparatus-perfusion-fluid.html. In certain embodiments, Harvard's buffer is preferred due to better pH stability observed with Harvard's buffer. The table below provides a comparison of Harvard's buffer and Elliot's B buffer. Cerebrospinal Fluid (CSF) Compositions [Image disponible dans le document PDF, Image available in the PDF document] [Image disponible dans le document PDF, Image available in the PDF document] In certain embodiments, the formulation buffer is artificial CSF with Pluronic F68. In other embodiments, the formulation may contain one or more permeation enhancers. Examples of suitable permeation enhancers may include, e.g., mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-laurel ether, or EDTA. Optionally, the compositions of the invention may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin. The compositions according to the present invention may comprise a pharmaceutically acceptable carrier, such as defined above. Suitably, the compositions described herein comprise an effective amount of one or more AAV suspended in a pharmaceutically suitable carrier and / or admixed with suitable excipients designed for delivery to the subject via injection, osmotic pump, intrathecal catheter, or for delivery by another device or route. In one example, the composition is formulated for intrathecal delivery. As used herein, the terms "intrathecal delivery" or "intrathecal administration" refer to a route of administration for drugs via an injection into the spinal canal, more specifically into the subarachnoid space so that it reaches the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular (including intracerebroventricular (ICV)), suboccipital / intracisternal, and / or C1-2 puncture. For example, material may be introduced for diffusion throughout the subarachnoid space by means of lumbar puncture. In another example, injection may be into the cisterna magna. As used herein, the terms "intracisternal delivery" or "intracisternal administration" refer to a route of administration for drugs directly into the cerebrospinal fluid of the cisterna magna cerebellomedularis, more specifically via a suboccipital puncture or by direct injection into the cisterna magna or via permanently positioned tube. In certain embodiments, the final formulation buffer comprises an artificial cerebrospinal fluid comprising buffered saline and one or more of sodium, calcium, magnesium, potassium, or mixtures thereof, and a surfactant. In certain embodiments, the surfactant is about 0.0005 % w / w to about 0.001% w / w of the suspension. In certain embodiments, the surfactant is Pluronic F68. In certain embodiments, the Pluronic F68 is present in an amount of about 0.0001% of the suspension. In certain embodiments, the composition is at a pH in the of 7.5 to 7.8 for intrathecal delivery. In certain embodiments, treatment of the composition described herein has minimal to mild asymptomatic degeneration of DRG sensory neurons in animals and / or in human patients, well-tolerated with respect to sensory nerve toxicity and subclinical sensory neuron lesions. In certain embodiment, the composition described herein is useful in improving functional and clinical outcomes in the subject treated. Such outcomes may be measured at about 30 days, about 60 days, about 90 days, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, about 24 months, about 2.5 years, about 3 years, about 3.5 years, about 4 years, about 4.5 years and then yearly up to the about 5 years after administration of the composition. Measurement frequency may be about every 1 month, about every 2 months, about every 3 months, about every 4 months, about every 5 months, about every 6 months, about every 7 months, about every 8 months, about every 9 months, about every 10 months, about every 11 months, or about every 12 months. In certain embodiments, the composition described herein shows pharmacodynamics and clinical efficacy measured in treated subjects compared to untreated controls. In certain embodiments, the pharmacodynamics efficacy, clinical efficacy, functional outcomes, clinical outcomes, disease amelioration, or disease progression may be assessed via one or more of the following: concentration and / or level and / or biological activity of ARSA (for example, in serum or in CSF), urine sulfatides, CNS myelination (demyelination load and pattern), white matter atrophy as measured by MRI, neuronal metabolite N-acetylaspartate (NAA), myo-inositol (mI), choline (Cho) and / or lactate (Lac) levels (for example, as measured by proton magnetic resonance spectroscopy (MRS)), CSF sulfatide and lyso-sulfatide levels, Visual evoked potentials (VEPs), Brainstem auditory evoked responses (BAERs), gall-bladder wall thickening (for example, via ultrasound evaluation); motor function (for example, measured by the Gross Motor Function Classification for Metachromatic Leukodystrophy (GMFC-MLD) or Gross Motor Function Measure (GMFM)), Motor milestones achievement (as defined by World Health Organization [WHO] criteria) assessed by age at achievement, age at loss, and percentage of children maintaining or acquiring motor milestones, cognitive function (for example, Total Intelligence Quotient [IQ] and sub-domain IQ measured by the Bayley Scale of Infant Development [BSID-III], Wechsler Intelligence Scale for Children, Fifth Edition [WISC-V]), lifespan (compared to a patient), neurological clinical exam (NCE), nerve conduction velocity (NCV) of the ulnar, deep peroneal, median, sural nerves, age-at-onset and frequency of seizures captured by a seizure diary, behavior function (for example, measured by Vineland Adaptive Behavior Scales, Third Edition (Vineland-III)), Lansky Performance Index, Pediatric Quality of Life Inventory (for example, PedsQL and PedsQL-IS), and caregiver / parent quality of life. In certain embodiments, the pharmacodynamics efficacy, clinical efficacy, functional outcomes, clinical outcomes, disease amelioration, or disease progression may be assessed abnormal properties (for example biomarker activity, electrophysiological activity, and / or imaging parameters) and clinical observations (for example, gross and fine motor function, cognitive and language development, neurological exam findings, behavioral and milestone development, and caregiver / parent-reported outcomes and decreased quality of life assessments). Other disease amelioration or disease progression may be assessed, see, Parts II and VIII. Alternatively or additionally, the pharmacodynamics efficacy, clinical efficacy, functional outcomes, or clinical outcomes may include biomarkers, for example, pharmacodynamics and biological activity of rAAVhu68.hARSAco... IIX. Methods In another aspect, a method of treating a subject having a disease associated with an ARSA. mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD), or ameliorating symptoms of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD), or delaying progression of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD) is provided. The method comprises administrating an effective amount of a rAAV or a vector as described herein to a subject in need thereof. In certain embodiments, the vector or rAAV is administrable to a patient via an intra- cisterna magna injection (ICM), for example, CT-guided sub-occipital injection into the cisterna magna. In certain embodiments, a vector or a composition is provided which is administrable to a patient having Metachromatic Leukodystrophy who is 7 years of age or younger. In certain embodiments, the method involves delivering the rAAV or the vector to a human patient in a single dose. In certain embodiments, the rAAV is administered at a dose between <semantics>3.00×1010<annotation encoding="application / x-tex">3.00 \times 10^{10}< / annotation>< / semantics> genome copies (GC) per gram (GC / g) of brain mass and 1.00 x 1012 GC / g of brain mass. In certain embodiments, following the administration, disease symptom of the subject is ameliorated and / or the disease progression is delayed. Although nervous system-directed AAV gene therapy targets primarily neurons in vivo, the cross-correction potential opens the possibility to correct ARSA-deficient myelinating cells, which cannot be transduced in vivo by most gene therapy vectors (Cearley et al., 2008; Lawlor et al., 2009). In certain embodiments, an "effective amount" herein is the amount which achieves amelioration of MLD symptoms and / or delayed MLD progression. The vectors are administered in sufficient amounts to transfect the cells and to provide sufficient levels of gene transfer and expression to provide a therapeutic benefit without undue adverse effects, or with medically acceptable physiological effects, which can be determined by those skilled in the medical arts. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to a desired organ (e.g., brain, CSF, the liver (optionally via the hepatic artery), lung, heart, eye, kidney,), oral, inhalation, intranasal, intrathecal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, intraparenchymal, intracerebroventricular, intrathecal, ICM, lumbar puncture and other parenteral routes of administration. Routes of administration may be combined, if desired. Dosages of the viral vector (for example, rAAV) depend primarily on factors such as the condition being treated, the age, weight and health of the patient, and can thus vary among patients. For example, a therapeutically effective human dosage of the viral vector is generally in the range of from about 25 to about 1000 microliters to about 100 mL of solution containing concentrations of from about <semantics>1×109<annotation encoding="application / x-tex">1 \times 10^9< / annotation>< / semantics> to <semantics>1×1016<annotation encoding="application / x-tex">1 \times 10^{16}< / annotation>< / semantics> vector genome copies. In certain embodiments, a volume of about 1 mL to about 15 mL, or about 2.5 mL to about 10 mL, or about 5 mL suspension is delivered. In certain embodiments, a volume of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 mL suspension is delivered. In certain embodiments, a dose of about <semantics>8.9×1012<annotation encoding="application / x-tex">8.9 \times 10^{12}< / annotation>< / semantics> to <semantics>2.7×1012<annotation encoding="application / x-tex">2.7 \times 10^{12}< / annotation>< / semantics> <semantics>1014<annotation encoding="application / x-tex">10^{14}< / annotation>< / semantics> GC total is administered in this volume. In certain embodiments, a dose of about <semantics>1.1×1010<annotation encoding="application / x-tex">1.1 \times 10^{10}< / annotation>< / semantics> <semantics>GC / g<annotation encoding="application / x-tex">GC / g< / annotation>< / semantics> brain mass to about 3.3 x <semantics>1011<annotation encoding="application / x-tex">10^{11}< / annotation>< / semantics> <semantics>GC / g<annotation encoding="application / x-tex">GC / g< / annotation>< / semantics> brain mass is administered in this volume. In certain embodiments, a dose of about <semantics>3.0×109<annotation encoding="application / x-tex">3.0 \times 10^9< / annotation>< / semantics>, about <semantics>4.0×109<annotation encoding="application / x-tex">4.0 \times 10^9< / annotation>< / semantics>, about <semantics>5.0×109<annotation encoding="application / x-tex">5.0 \times 10^9< / annotation>< / semantics>, about <semantics>6.0×109<annotation encoding="application / x-tex">6.0 \times 10^9< / annotation>< / semantics>, about <semantics>7.0×109<annotation encoding="application / x-tex">7.0 \times 10^9< / annotation>< / semantics> <semantics>×109<annotation encoding="application / x-tex">\times 10^9< / annotation>< / semantics>, about 8.0 <semantics>×109<annotation encoding="application / x-tex">\times 10^9< / annotation>< / semantics>, about 9.0 <semantics>×109<annotation encoding="application / x-tex">\times 10^9< / annotation>< / semantics>, about 1.0 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 1.1 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 1.5 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 2.0 <semantics>x1010<annotation encoding="application / x-tex">x10^{10}< / annotation>< / semantics>, about 2.5 <semantics>x1010<annotation encoding="application / x-tex">x10^{10}< / annotation>< / semantics>, about 3.0 <semantics>x1010<annotation encoding="application / x-tex">x10^{10}< / annotation>< / semantics>, about 3.3 <semantics>x1010<annotation encoding="application / x-tex">x10^{10}< / annotation>< / semantics>, about 3.5 <semantics>x1010<annotation encoding="application / x-tex">x10^{10}< / annotation>< / semantics>, about 4.0 <semantics>x1010<annotation encoding="application / x-tex">x10^{10}< / annotation>< / semantics>, about <semantics>4.5×1010<annotation encoding="application / x-tex">4.5 \times 10^{10}< / annotation>< / semantics>, about <semantics>5.0×1010<annotation encoding="application / x-tex">5.0 \times 10^{10}< / annotation>< / semantics>, about <semantics>5.5×1010<annotation encoding="application / x-tex">5.5 \times 10^{10}< / annotation>< / semantics>, about <semantics>6.0×1010<annotation encoding="application / x-tex">6.0 \times 10^{10}< / annotation>< / semantics>, about <semantics>6.5×1010<annotation encoding="application / x-tex">6.5 \times 10^{10}< / annotation>< / semantics>, about <semantics>7.0×1010<annotation encoding="application / x-tex">7.0 \times 10^{10}< / annotation>< / semantics>, about 7.5 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 8.0 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 8.5 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 9.0 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 9.5 <semantics>×1010<annotation encoding="application / x-tex">\times 10^{10}< / annotation>< / semantics>, about 1.0 <semantics>x1011<annotation encoding="application / x-tex">x10^{11}< / annotation>< / semantics>, about 1.1 <semantics>x1011<annotation encoding="application / x-tex">x10^{11}< / annotation>< / semantics>, about 1.5 <semantics>x1011<annotation encoding="application / x-tex">x10^{11}< / annotation>< / semantics>, about 2.0 <semantics>x1011<annotation encoding="application / x-tex">x10^{11}< / annotation>< / semantics>, about 2.5 <semantics>x1011<annotation encoding="application / x-tex">x10^{11}< / annotation>< / semantics>, about 3.0 <semantics>x1011<annotation encoding="application / x-tex">x10^{11}< / annotation>< / semantics>, about 3.3 <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about 3.5 <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about 4.0 <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about 4.5 <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about 5.0 <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about 5.5 <semantics>×1011<annotation encoding="application / x-tex">\times 10^{11}< / annotation>< / semantics>, about <semantics>6.0×1011<annotation encoding="application / x-tex">6.0 \times 10^{11}< / annotation>< / semantics>, about <semantics>6.5×1011<annotation encoding="application / x-tex">6.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>7.0×1011<annotation encoding="application / x-tex">7.0 \times 10^{11}< / annotation>< / semantics>, about <semantics>7.5×1011<annotation encoding="application / x-tex">7.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>8.0×1011<annotation encoding="application / x-tex">8.0 \times 10^{11}< / annotation>< / semantics>, about <semantics>8.5×1011<annotation encoding="application / x-tex">8.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>8.5×1011<annotation encoding="application / x-tex">8.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>8.5×1011<annotation encoding="application / x-tex">8.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>8.5×1011<annotation encoding="application / x-tex">8.5 \times 10^{11}< / annotation>< / semantics>, about <semantics>8.5×1<annotation encoding="application / x-tex">8.5 \times 1< / annotation>< / semantics> <semantics>x1011<annotation encoding="application / x-tex">x10^{11}< / annotation>< / semantics>, about 9.0 <semantics>x1011<annotation encoding="application / x-tex">x10^{11}< / annotation>< / semantics> GC per gram brain mass is administered in this volume. The dosage is adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed. The levels of expression of the transgene product can be monitored to determine the frequency of dosage resulting in viral vectors, preferably AAV vectors containing the minigene. Optionally, dosage regimens similar to those described for therapeutic purposes may be utilized for immunization using the compositions of the invention. The replication-defective virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about <semantics>1.0×109<annotation encoding="application / x-tex">1.0 \times 10^9< / annotation>< / semantics> GC to about <semantics>1.0×1016<annotation encoding="application / x-tex">1.0 \times 10^{16}< / annotation>< / semantics> GC (to treat an subject) including all integers or fractional amounts within the range, and preferably <semantics>1.0×1012<annotation encoding="application / x-tex">1.0 \times 10^{12}< / annotation>< / semantics> GC to <semantics>1.0×1014<annotation encoding="application / x-tex">1.0 \times 10^{14}< / annotation>< / semantics> GC for a human patient. In one embodiment, the compositions are formulated to contain at least 1x109, 2x109, 3x109, 4x109, 5x109, 6x109, <semantics>7x109<annotation encoding="application / x-tex">7x10^9< / annotation>< / semantics>, <semantics>8x109<annotation encoding="application / x-tex">8x10^9< / annotation>< / semantics>, or <semantics>9x109<annotation encoding="application / x-tex">9x10^9< / annotation>< / semantics> GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1x1010<annotation encoding="application / x-tex">1x10^{10}< / annotation>< / semantics>, <semantics>2x1010<annotation encoding="application / x-tex">2x10^{10}< / annotation>< / semantics>, <semantics>3x1010<annotation encoding="application / x-tex">3x10^{10}< / annotation>< / semantics>, <semantics>4x1010<annotation encoding="application / x-tex">4x10^{10}< / annotation>< / semantics>, <semantics>5x1010<annotation encoding="application / x-tex">5x10^{10}< / annotation>< / semantics>, <semantics>6x1010<annotation encoding="application / x-tex">6x10^{10}< / annotation>< / semantics>, <semantics>7x1010<annotation encoding="application / x-tex">7x10^{10}< / annotation>< / semantics>, <semantics>8x1010<annotation encoding="application / x-tex">8x10^{10}< / annotation>< / semantics>, or <semantics>9x1010<annotation encoding="application / x-tex">9x10^{10}< / annotation>< / semantics> GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1×1011<annotation encoding="application / x-tex">1 \times 10^{11}< / annotation>< / semantics>, <semantics>2×1011<annotation encoding="application / x-tex">2 \times 10^{11}< / annotation>< / semantics>, <semantics>3×1011<annotation encoding="application / x-tex">3 \times 10^{11}< / annotation>< / semantics>, <semantics>4×1011<annotation encoding="application / x-tex">4 \times 10^{11}< / annotation>< / semantics>, <semantics>5×1011<annotation encoding="application / x-tex">5 \times 10^{11}< / annotation>< / semantics>, <semantics>6×1011<annotation encoding="application / x-tex">6 \times 10^{11}< / annotation>< / semantics>, <semantics>7×1011<annotation encoding="application / x-tex">7 \times 10^{11}< / annotation>< / semantics>, <semantics>8×1011<annotation encoding="application / x-tex">8 \times 10^{11}< / annotation>< / semantics>, or <semantics>9×1011<annotation encoding="application / x-tex">9 \times 10^{11}< / annotation>< / semantics> GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1x1012<annotation encoding="application / x-tex">1x10^{12}< / annotation>< / semantics>, <semantics>2x1012<annotation encoding="application / x-tex">2x10^{12}< / annotation>< / semantics>, <semantics>3x1012<annotation encoding="application / x-tex">3x10^{12}< / annotation>< / semantics>, <semantics>4x1012<annotation encoding="application / x-tex">4x10^{12}< / annotation>< / semantics>, <semantics>5x1012<annotation encoding="application / x-tex">5x10^{12}< / annotation>< / semantics>, <semantics>6x1012<annotation encoding="application / x-tex">6x10^{12}< / annotation>< / semantics>, 7x1012, 8x1012, or 9x1012 GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1x1013<annotation encoding="application / x-tex">1x10^{13}< / annotation>< / semantics>, <semantics>2x1013<annotation encoding="application / x-tex">2x10^{13}< / annotation>< / semantics>, <semantics>3x1013<annotation encoding="application / x-tex">3x10^{13}< / annotation>< / semantics>, <semantics>4x1013<annotation encoding="application / x-tex">4x10^{13}< / annotation>< / semantics>, <semantics>5x1013<annotation encoding="application / x-tex">5x10^{13}< / annotation>< / semantics>, <semantics>6x1013<annotation encoding="application / x-tex">6x10^{13}< / annotation>< / semantics>, <semantics>7x1013<annotation encoding="application / x-tex">7x10^{13}< / annotation>< / semantics>, <semantics>8x1013<annotation encoding="application / x-tex">8x10^{13}< / annotation>< / semantics>, or <semantics>9x1013<annotation encoding="application / x-tex">9x10^{13}< / annotation>< / semantics> GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1×1014<annotation encoding="application / x-tex">1 \times 10^{14}< / annotation>< / semantics>, <semantics>2×1014<annotation encoding="application / x-tex">2 \times 10^{14}< / annotation>< / semantics>, <semantics>3×1014<annotation encoding="application / x-tex">3 \times 10^{14}< / annotation>< / semantics>, <semantics>4×1014<annotation encoding="application / x-tex">4 \times 10^{14}< / annotation>< / semantics>, <semantics>5×1014<annotation encoding="application / x-tex">5 \times 10^{14}< / annotation>< / semantics>, <semantics>6×1014<annotation encoding="application / x-tex">6 \times 10^{14}< / annotation>< / semantics>, <semantics>7×1014<annotation encoding="application / x-tex">7 \times 10^{14}< / annotation>< / semantics>, <semantics>8×1014<annotation encoding="application / x-tex">8 \times 10^{14}< / annotation>< / semantics>, or 9x1014 GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least <semantics>1x1015<annotation encoding="application / x-tex">1x10^{15}< / annotation>< / semantics>, <semantics>2x1015<annotation encoding="application / x-tex">2x10^{15}< / annotation>< / semantics>, <semantics>3x1015<annotation encoding="application / x-tex">3x10^{15}< / annotation>< / semantics>, <semantics>4x1015<annotation encoding="application / x-tex">4x10^{15}< / annotation>< / semantics>, 5x1015, 6x1015, 7x1015, 8x1015, or 9x1015 GC per dose including all integers or fractional amounts within the range. In one embodiment, for human application the dose can range from <semantics>1x1010<annotation encoding="application / x-tex">1x10^{10}< / annotation>< / semantics> to about <semantics>1×1015<annotation encoding="application / x-tex">1 \times 10^{15}< / annotation>< / semantics> GC per kg body weight including all integers or fractional amounts within the range. In one embodiment, the effective amount of the vector is about <semantics>1x109<annotation encoding="application / x-tex">1x10^9< / annotation>< / semantics>, <semantics>2x109<annotation encoding="application / x-tex">2x10^9< / annotation>< / semantics>, <semantics>3x109<annotation encoding="application / x-tex">3x10^9< / annotation>< / semantics>, 4x109, 5x109, 6x109, 7x109, 8x109, or 9x109 GC per kg body weight including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1×1010<annotation encoding="application / x-tex">1 \times 10^{10}< / annotation>< / semantics>, <semantics>2×1010<annotation encoding="application / x-tex">2 \times 10^{10}< / annotation>< / semantics>, <semantics>3×1010<annotation encoding="application / x-tex">3 \times 10^{10}< / annotation>< / semantics>, <semantics>4×1010<annotation encoding="application / x-tex">4 \times 10^{10}< / annotation>< / semantics>, <semantics>5×1010<annotation encoding="application / x-tex">5 \times 10^{10}< / annotation>< / semantics>, <semantics>6×1010<annotation encoding="application / x-tex">6 \times 10^{10}< / annotation>< / semantics>, <semantics>7×1010<annotation encoding="application / x-tex">7 \times 10^{10}< / annotation>< / semantics>, <semantics>8×1010<annotation encoding="application / x-tex">8 \times 10^{10}< / annotation>< / semantics>, or <semantics>9×1010<annotation encoding="application / x-tex">9 \times 10^{10}< / annotation>< / semantics> GC per kg body weight including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1×1011<annotation encoding="application / x-tex">1 \times 10^{11}< / annotation>< / semantics>, <semantics>2×1011<annotation encoding="application / x-tex">2 \times 10^{11}< / annotation>< / semantics>, <semantics>3×1011<annotation encoding="application / x-tex">3 \times 10^{11}< / annotation>< / semantics>, <semantics>4×1011<annotation encoding="application / x-tex">4 \times 10^{11}< / annotation>< / semantics>, <semantics>5×1011<annotation encoding="application / x-tex">5 \times 10^{11}< / annotation>< / semantics>, <semantics>6×1011<annotation encoding="application / x-tex">6 \times 10^{11}< / annotation>< / semantics>, <semantics>7×1011<annotation encoding="application / x-tex">7 \times 10^{11}< / annotation>< / semantics>, 8x1011, or 9x1011 GC per kg body weight including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1x1012<annotation encoding="application / x-tex">1x10^{12}< / annotation>< / semantics>, <semantics>2x1012<annotation encoding="application / x-tex">2x10^{12}< / annotation>< / semantics>, <semantics>3x1012<annotation encoding="application / x-tex">3x10^{12}< / annotation>< / semantics>, <semantics>4×1012<annotation encoding="application / x-tex">4 \times 10^{12}< / annotation>< / semantics>, <semantics>5×1012<annotation encoding="application / x-tex">5 \times 10^{12}< / annotation>< / semantics>, <semantics>6×1012<annotation encoding="application / x-tex">6 \times 10^{12}< / annotation>< / semantics>, <semantics>7×1012<annotation encoding="application / x-tex">7 \times 10^{12}< / annotation>< / semantics>, <semantics>8×1012<annotation encoding="application / x-tex">8 \times 10^{12}< / annotation>< / semantics>, or <semantics>9×1012<annotation encoding="application / x-tex">9 \times 10^{12}< / annotation>< / semantics> GC per kg body weight including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1×1013<annotation encoding="application / x-tex">1 \times 10^{13}< / annotation>< / semantics>, <semantics>2×1013<annotation encoding="application / x-tex">2 \times 10^{13}< / annotation>< / semantics>, <semantics>3×1013<annotation encoding="application / x-tex">3 \times 10^{13}< / annotation>< / semantics>, <semantics>4×1013<annotation encoding="application / x-tex">4 \times 10^{13}< / annotation>< / semantics>, <semantics>5×1013<annotation encoding="application / x-tex">5 \times 10^{13}< / annotation>< / semantics>, <semantics>6×1013<annotation encoding="application / x-tex">6 \times 10^{13}< / annotation>< / semantics>, <semantics>7×1013<annotation encoding="application / x-tex">7 \times 10^{13}< / annotation>< / semantics>, <semantics>8×1013<annotation encoding="application / x-tex">8 \times 10^{13}< / annotation>< / semantics>, or <semantics>9×1013<annotation encoding="application / x-tex">9 \times 10^{13}< / annotation>< / semantics> GC per kg body weight including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1×1014<annotation encoding="application / x-tex">1 \times 10^{14}< / annotation>< / semantics>, <semantics>2×1014<annotation encoding="application / x-tex">2 \times 10^{14}< / annotation>< / semantics>, <semantics>3×1014<annotation encoding="application / x-tex">3 \times 10^{14}< / annotation>< / semantics>, <semantics>4×1014<annotation encoding="application / x-tex">4 \times 10^{14}< / annotation>< / semantics>, <semantics>5×1014<annotation encoding="application / x-tex">5 \times 10^{14}< / annotation>< / semantics>, <semantics>6×1014<annotation encoding="application / x-tex">6 \times 10^{14}< / annotation>< / semantics>, <semantics>7×1014<annotation encoding="application / x-tex">7 \times 10^{14}< / annotation>< / semantics>, 8x1014, or 9x1014 GC per kg body weight including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1x1015<annotation encoding="application / x-tex">1x10^{15}< / annotation>< / semantics>, <semantics>2x1015<annotation encoding="application / x-tex">2x10^{15}< / annotation>< / semantics>, <semantics>3x1015<annotation encoding="application / x-tex">3x10^{15}< / annotation>< / semantics>, <semantics>4x1015<annotation encoding="application / x-tex">4x10^{15}< / annotation>< / semantics>, <semantics>5x1015<annotation encoding="application / x-tex">5x10^{15}< / annotation>< / semantics>, <semantics>6x1015<annotation encoding="application / x-tex">6x10^{15}< / annotation>< / semantics>, <semantics>7x1015<annotation encoding="application / x-tex">7x10^{15}< / annotation>< / semantics>, <semantics>8x1015<annotation encoding="application / x-tex">8x10^{15}< / annotation>< / semantics>, or <semantics>9x1015<annotation encoding="application / x-tex">9x10^{15}< / annotation>< / semantics> GC per kg body weight including all integers or fractional amounts within the range. In one embodiment, for human application the dose can range from <semantics>1x1010<annotation encoding="application / x-tex">1x10^{10}< / annotation>< / semantics> to about 1x1015 GC per gram (g) brain mass including all integers or fractional amounts within the range. In one embodiment, the effective amount of the vector is about <semantics>1x109<annotation encoding="application / x-tex">1x10^9< / annotation>< / semantics>, <semantics>2x109<annotation encoding="application / x-tex">2x10^9< / annotation>< / semantics>, <semantics>3x109<annotation encoding="application / x-tex">3x10^9< / annotation>< / semantics>, <semantics>4x109<annotation encoding="application / x-tex">4x10^9< / annotation>< / semantics>, 5x109, 6x109, 7x109, 8x109, or 9x109 GC per gram (g) brain mass including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1×1010<annotation encoding="application / x-tex">1 \times 10^{10}< / annotation>< / semantics>, <semantics>2×1010<annotation encoding="application / x-tex">2 \times 10^{10}< / annotation>< / semantics>, <semantics>3×1010<annotation encoding="application / x-tex">3 \times 10^{10}< / annotation>< / semantics>, <semantics>4×1010<annotation encoding="application / x-tex">4 \times 10^{10}< / annotation>< / semantics>, <semantics>5×1010<annotation encoding="application / x-tex">5 \times 10^{10}< / annotation>< / semantics>, <semantics>6×1010<annotation encoding="application / x-tex">6 \times 10^{10}< / annotation>< / semantics>, <semantics>7×1010<annotation encoding="application / x-tex">7 \times 10^{10}< / annotation>< / semantics>, <semantics>8×1010<annotation encoding="application / x-tex">8 \times 10^{10}< / annotation>< / semantics>, or <semantics>9×1010<annotation encoding="application / x-tex">9 \times 10^{10}< / annotation>< / semantics> GC per gram (g) brain mass including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1×1011<annotation encoding="application / x-tex">1 \times 10^{11}< / annotation>< / semantics>, <semantics>2×1011<annotation encoding="application / x-tex">2 \times 10^{11}< / annotation>< / semantics>, <semantics>3×1011<annotation encoding="application / x-tex">3 \times 10^{11}< / annotation>< / semantics>, <semantics>4×1011<annotation encoding="application / x-tex">4 \times 10^{11}< / annotation>< / semantics>, <semantics>5×1011<annotation encoding="application / x-tex">5 \times 10^{11}< / annotation>< / semantics>, <semantics>6×1011<annotation encoding="application / x-tex">6 \times 10^{11}< / annotation>< / semantics>, <semantics>7×1011<annotation encoding="application / x-tex">7 \times 10^{11}< / annotation>< / semantics>, 8x1011, or 9x1011 GC per gram (g) brain mass including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1x1012<annotation encoding="application / x-tex">1x10^{12}< / annotation>< / semantics>, <semantics>2x1012<annotation encoding="application / x-tex">2x10^{12}< / annotation>< / semantics>, <semantics>3×1012<annotation encoding="application / x-tex">3 \times 10^{12}< / annotation>< / semantics>, <semantics>4×1012<annotation encoding="application / x-tex">4 \times 10^{12}< / annotation>< / semantics>, <semantics>5×1012<annotation encoding="application / x-tex">5 \times 10^{12}< / annotation>< / semantics>, <semantics>6×1012<annotation encoding="application / x-tex">6 \times 10^{12}< / annotation>< / semantics>, <semantics>7×1012<annotation encoding="application / x-tex">7 \times 10^{12}< / annotation>< / semantics>, <semantics>8×1012<annotation encoding="application / x-tex">8 \times 10^{12}< / annotation>< / semantics>, or <semantics>9×1012<annotation encoding="application / x-tex">9 \times 10^{12}< / annotation>< / semantics> GC per gram (g) brain mass including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1×1013<annotation encoding="application / x-tex">1 \times 10^{13}< / annotation>< / semantics>, <semantics>2×1013<annotation encoding="application / x-tex">2 \times 10^{13}< / annotation>< / semantics>, <semantics>3×1013<annotation encoding="application / x-tex">3 \times 10^{13}< / annotation>< / semantics>, <semantics>4×1013<annotation encoding="application / x-tex">4 \times 10^{13}< / annotation>< / semantics>, <semantics>5×1013<annotation encoding="application / x-tex">5 \times 10^{13}< / annotation>< / semantics>, <semantics>6×1013<annotation encoding="application / x-tex">6 \times 10^{13}< / annotation>< / semantics>, <semantics>7×1013<annotation encoding="application / x-tex">7 \times 10^{13}< / annotation>< / semantics>, <semantics>8×1013<annotation encoding="application / x-tex">8 \times 10^{13}< / annotation>< / semantics>, or <semantics>9×1013<annotation encoding="application / x-tex">9 \times 10^{13}< / annotation>< / semantics> GC per gram (g) brain mass including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1x1014<annotation encoding="application / x-tex">1x10^{14}< / annotation>< / semantics>, <semantics>2x1014<annotation encoding="application / x-tex">2x10^{14}< / annotation>< / semantics>, <semantics>3x1014<annotation encoding="application / x-tex">3x10^{14}< / annotation>< / semantics>, <semantics>4x1014<annotation encoding="application / x-tex">4x10^{14}< / annotation>< / semantics>, 5x1014, 6x1014, 7x1014, 8x1014, or 9x1014 GC per gram (g) brain mass including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about <semantics>1×1015<annotation encoding="application / x-tex">1 \times 10^{15}< / annotation>< / semantics>, <semantics>2×1015<annotation encoding="application / x-tex">2 \times 10^{15}< / annotation>< / semantics>, <semantics>3×1015<annotation encoding="application / x-tex">3 \times 10^{15}< / annotation>< / semantics>, <semantics>4×1015<annotation encoding="application / x-tex">4 \times 10^{15}< / annotation>< / semantics>, <semantics>5×1015<annotation encoding="application / x-tex">5 \times 10^{15}< / annotation>< / semantics>, <semantics>6×1015<annotation encoding="application / x-tex">6 \times 10^{15}< / annotation>< / semantics>, <semantics>7×1015<annotation encoding="application / x-tex">7 \times 10^{15}< / annotation>< / semantics>, <semantics>8×1015<annotation encoding="application / x-tex">8 \times 10^{15}< / annotation>< / semantics>, or <semantics>9×1015<annotation encoding="application / x-tex">9 \times 10^{15}< / annotation>< / semantics> GC per gram (g) brain mass including all integers or fractional amounts within the range. These above doses may be administered in a variety of volumes of carrier, excipient or buffer formulation, ranging from about 25 to about 1000 microliters, or higher volumes, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of carrier, excipient or buffer is at least about 25 µL. In one embodiment, the volume is about 50 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 75 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 100 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 125 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 150 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 175 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In yet another embodiment, the volume is about 200 µL. In another embodiment, the volume is about 225 μL. In yet another embodiment, the volume is about 250 μL. In yet another embodiment, the volume is about 275 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In yet another embodiment, the volume is about 300 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In yet another embodiment, the volume is about 325 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 350 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 375 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 400 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 450 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 500 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 550 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 650 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is about 700 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In another embodiment, the volume is between about 700 and 1000 <semantics>μ<annotation encoding="application / x-tex">\mu< / annotation>< / semantics>L. In certain embodiments, the dose may be in the range of about <semantics>1×109<annotation encoding="application / x-tex">1 \times 10^9< / annotation>< / semantics> GC / g brain mass to about 1 x 1012 GC / g brain mass. In certain embodiments, the dose may be in the range of about <semantics>1×1010<annotation encoding="application / x-tex">1 \times 10^{10}< / annotation>< / semantics> GC / g brain mass to about <semantics>3×1011<annotation encoding="application / x-tex">3 \times 10^{11}< / annotation>< / semantics> GC / g brain mass. In certain embodiments, the dose may be in the range of about <semantics>1×1010<annotation encoding="application / x-tex">1 \times 10^{10}< / annotation>< / semantics> GC / g brain mass to about <semantics>2.5×1011<annotation encoding="application / x-tex">2.5 \times 10^{11}< / annotation>< / semantics> GC / g brain mass. In certain embodiments, the dose may be in the range of about <semantics>5×1010<annotation encoding="application / x-tex">5 \times 10^{10}< / annotation>< / semantics> GC / g brain mass. In one embodiment, the viral constructs may be delivered in doses of from at least about least <semantics>1×109<annotation encoding="application / x-tex">1 \times 10^9< / annotation>< / semantics> GC to about <semantics>1×1015<annotation encoding="application / x-tex">1 \times 10^{15}< / annotation>< / semantics>, or about <semantics>1×1011<annotation encoding="application / x-tex">1 \times 10^{11}< / annotation>< / semantics> to <semantics>5×1013<annotation encoding="application / x-tex">5 \times 10^{13}< / annotation>< / semantics> GC. Suitable volumes for delivery of these doses and concentrations may be determined by one of skill in the art. For example, volumes of about 1 μL to 150 mL may be selected, with the higher volumes being selected for adults. Typically, for newborn infants a suitable volume is about 0.5 mL to about 10 mL, for older infants, about 0.5 mL to about 15 mL may be selected. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, volumes of up to about 30 mL may be selected. For pre-teens and teens, volumes up to about 50 mL may be selected. In still other embodiments, a patient may receive an intrathecal administration in a volume of about 5 mL to about 15 mL are selected, or about 7.5 mL to about 10 mL. Other suitable volumes and dosages may be determined. The dosage may be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed. The above-described recombinant vectors may be delivered to host cells according to published methods. The rAAV, preferably suspended in a physiologically compatible carrier, may be administered to a human or non-human mammalian patient. In certain embodiments, for administration to a human patient, the rAAV is suitably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt or mixture of salts. Suitably, the formulation is adjusted to a physiologically acceptable pH, e.g., in the range of pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8. As the pH of the cerebrospinal fluid is about 7.28 to about 7.32, for intrathecal delivery, a pH within this range may be desired; whereas for intravenous delivery, a pH of about 6.8 to about 7.2 may be desired. However, other pHs within the broadest ranges and these subranges may be selected for other route of delivery. In certain embodiments, treatment of the composition described herein has minimal to mild asymptomatic degeneration of DRG sensory neurons in animals and / or in human patients, well-tolerated with respect to sensory nerve toxicity and subclinical sensory neuron lesions. In certain embodiments, the proposed population for the rAAV, vector, composition, and method consist of subjects with early onset late infantile and early juvenile MLD who have symptom onset <7 years of age and whose predictable and rapid decline supports a robust study design and evaluation of functional outcomes within a reasonable follow-up period. Treatment via the rAAV, vector, composition or method is for disease symptom amelioration and delayed disease progression, including stabilizing the underlying pathology, thereby preventing disease onset and enabling normal or near-normal motor and cognitive development, or substantially preventing or delaying loss of skills (such as acquired developmental and motor milestones) and disease progression. Pre-symptomatic patients are eligible for this treatment. The AAVhu68 capsid of AAV hARSAco and the ICM ROA effectively transduces cortical neurons, a small subset of myelin-producing oligodendrocytes, motor neurons with axons projecting into the PNS, and DRG sensory neurons with axons projecting into both the spinal cord and peripheral nerves. Given the broad transduction profile in both the CNS and PNS, ARSA enzyme cross-correction may treat both the CNS manifestations and the peripheral neuropathy observed in many MLD patients, which is not addressed by HSC-GT or HSCT. Given the nature of MLD, with CNS injury thought to be largely irreversible and the rapid disease progression in the early onset population, the rAAV, vector, composition or method as described herein confers the greatest potential for benefit in patients with no or mild to moderate disease. ICM-delivered AAV gene therapies, such as AAV. hARSAco, show rapid kinetic onset compared to that of HSC-based therapies, with peak ARSA expression in the CSF by 3 weeks after administration (See, Examples). As a result, AAVhARSAco may halt disease progression even in patients who already have some clinical signs of disease. Therefore, patients with early onset MLD who have mild to moderate signs and symptoms would be eligible for the treatment by the rAAV, vector, composition or method as described herein (termed as "treatment"), including those with mild gait abnormalities in patients who are ambulatory and are able to walk at least 10 steps independently, apparent delays in motor milestones acquisition (defined as >95th percentile for age in achieving a given milestone based on WHO criteria (Wijnhoven et al., 2004)), and mild signs on neurological exam. Indicators of disease progression that are not commonly found in patients with mild to moderate symptoms, include, such as feeding difficulties requiring gastrostomy, development of seizures, low cognitive function, severe abnormalities found on neurological exam (such as very brisk reflexes, severe hypotonus or spasticity of the limbs, severe dysphagia, dyspraxia, or ataxia), and vision or hearing loss would result in exclusion from the trial. A delay in this disease progression, in certain embodiments, is shown as stabilization of disease at a low level of clinical function. In certain embodiments, pharmacodynamic and efficacy outcomes of the methods is measured at 1, 3, and 6 months, and then every 6 months during the 2 year short-term follow-up period, except for those that require sedation and / or LP. During the long term follow up phase, evaluation frequency decreases to once every 12 months. The early time points and 6 month intervals for the first 2 years were also selected in consideration of the rapid rate of disease progression in untreated early onset MLD patients. In certain embodiments, amelioration of a disease symptom or delay in disease progression is shown via assessing gross motor function. The GMFC-MLD is a validated, reliable, and simple tool for standardized assessment of gross motor function and decline over time in MLD patients (Kehrer et al., 2011b). It was modeled on a similar tool that assesses motor function in children with cerebral palsy and classifies children's motor function into one of five levels based on differences in self-initiated movements (Palisano et al., 2006). Kehrer et al. adapted the classification system to be relevant to patients with MLD and to provide a classification system in which distinctions between the levels would be considered meaningful in the daily life of children with MLD (the table below) (Kehrer et al., 2011a; Kehrer et al., 2011b). The GMFC-MLD has been used to both describe the natural history of MLD (Kehrer et al., 2011a) and evaluate motor function after therapeutic intervention (Sessa et al., 2016). One potential limitation of the GMFC-MLD is that the tool was validated for children from 18 months of age onwards, as this represents the upper age limit when children normally learn to walk (Largo et al., 1985; WHO, 2006). However, the tool would still apply for children who achieve the walking milestone before this age. Table. Gross Motor Function Classification System in Metachromatic Leukodystrophy [Image disponible dans le document PDF, Image available in the PDF document] [Image disponible dans le document PDF, Image available in the PDF document] The GMFM is included as a measurement for evaluating amelioration of a disease symptom or delay in disease progression. It is a standardized observational instrument designed and validated to measure change in gross motor function over time and after intervention in children with cerebral palsy (Russell et al., 1989; Lundkvist Josenby et al., 2009; Alotaibi et al., 2014). The GMFM is an 88-item tool that assesses motor function grouped across five functional domains: lying and rolling, sitting, crawling and kneeling, standing, and walking, running and jumping. Reference curves have also been developed for healthy children, who typically attain the most difficult skills on the scale (walking, running, jumping) by 5 years of age (Palisano et al., 2006). Although the tool is not validated for children with MLD, it has been proven useful for early onset MLD patients who received HSC-GT in demonstrating (near) normal gross motor development in subjects treated in the pre-symptomatic stage (Sessa et al., 2016; Fumagalli et al., 2017). One of the advantages of the 88-item instrument is that it contains a large amount of information about various aspects of motor function and the sub-domains can be summarized and reported separately. Due to a plateau effect, the tool may not be as informative in older early juvenile patients who may already have reached the maximum GMFM score prior to study enrolment (i.e., cannot measure acquisition of new skills), although it would still be able to show maintenance or loss of gross motor function over time. Peripheral neuropathy is a common, painful, and progressively debilitating manifestation of MLD that can aggravate the fine and gross motor dysfunction in these patients (Gieselmann) and Krageloh-Mann, 2010; van Rappard et al., 2015). HSC-based treatments do not appear to substantially ameliorate peripheral neuropathy (Boucher et al., 2015; van Rappard et al., 2016). The ability of AAV.hARSAco to transduce neurons, DRG, and peripheral nerve axons cells allow for expression of the ARSA enzyme within the brain and peripheral nerve dysfunction. Neurological examinations may be performed to assess clinical manifestations of peripheral neuropathy, and nerve conduction studies may be performed on representative motor and sensory nerves (deep peroneal nerve, median nerve, ulnar nerve, and sural nerve). As MLD is primarily a demyelinating disease, nerve conduction velocity is considered a relevant neurophysiologic parameter of the disease (Biffi et al., 2008) and may be measured. Motor milestone development depends on the age and stage of disease at the time of subject enrollment. Depending on the age of the subject at enrollment, subjects may have achieved certain motor skills or not yet shown signs of motor milestone development. Assessments will track age-at-achievement and age-at-loss for all milestones. Motor milestone achievement will be defined for six gross milestones based on the WHO criteria outlined in the table below. Table. World Health Organization Performance Criteria for Gross Motor Milestones [Image disponible dans le document PDF, Image available in the PDF document] [Image disponible dans le document PDF, Image available in the PDF document] Neurocognitive and behavioral manifestations may be assessed to show amelioration of a disease symptom or delay in disease progression. Assessing these manifestations is especially important in children with early juvenile MLD, in whom behavioral and cognitive symptoms are an important manifestation of the disease that may develop simultaneously with motor dysfunction. Clinical scales may be used to quantify the effects of AAV.hARSAco on development of and changes in cognition, language, and motor function, which may be assessed using the BSID-III and the WISC-V with transition to age-appropriate assessment tools done according to the patient's estimated developmental age. Outcomes may be compared to the norms of typically developing children and untreated children. Each proposed measure has been previously used in the MLD population (Clarke et al., 1989; Boucher et al., 2015; Sessa et al., 2016). • BSID-III: This scale used primarily to assess the development of infants and toddlers, ages 1-42 months (Albers and Grieve, 2007). It consists of a standardized series of developmental play tasks. It derives a developmental quotient by converting raw scores of successfully completed items to scale scores and composite scores followed by a comparison of the scores with norms taken from typically developing children of the same age. The BSID-III has three main subtests. A Cognitive Scale includes such items as attention to familiar and unfamiliar objects, looking for a fallen object, and pretend play. A Language Scale assesses understanding and expression of language (e.g., the ability to follow directions and naming objects). A Motor Scale measures gross and fine motor skills (e.g., grasping, sitting, stacking blocks, and climbing stairs). Thus, the BSID-III can provide additional motor function information to complement the GMFC-MLD and GMFM. • WISC-V: This scale is an individually administered intelligence test or children between the ages of 6 and 16 years of age. It generates a Full Scale IQ that represents a child's general intellectual ability and provides five primary index scores: Verbal Comprehension Index, Visual Spatial Index, Fluid Reasoning Index, Working Memory Index, and Processing Speed Index. These indices represent a child's abilities in discrete cognitive domains. Survival is included as a measurement for amelioration of a disease symptom or delay in disease progression. Death is expected in the first 5 years of life for the majority of patients diagnosed with late infantile MLD, with 5 year survival of 25% (Mahmood et al., 2010), although survival can extend into the second decade of life with current levels of supportive care (Gomez- Ospina, 2017). Thus, the 5 year follow-up may be sufficient to demonstrate a survival benefit in the late infantile population, although it may not be sufficiently long to assess survival in the early juvenile cohort. Importantly, with improved levels of supportive care, children with early onset MLD can now remain alive beyond 10 years of age, albeit it at a very low level of function. While seizures are not usually a presenting symptom for the early onset population, it is a feature of later stages of the disease (Gieselmann and Krageloh-Mann, 2010; Mahmood et al., 2010). Parents may be asked to maintain a diary to record seizure activity (onset, frequency, length, and type of seizure), which enables assessing whether AAV.hARSAco can either prevent or delay onset of seizures or decrease the frequency of seizure events. Measures of adaptive behavior along with parent and patient quality of life may be evaluated to show amelioration of a disease symptom or delay in disease progression using the tools that have been previously utilized in MLD patients (Martin et al., 2013; Boucher et al., 2015; Sessa et al., 2016): • Vineland-III: Assesses adaptive behavior from birth through adulthood (0– 90 years) across five domains: communication, daily living skills, socialization, motor skills, and maladaptive behavior. Improvements from the Vineland-II to the Vineland-III incorporate questions to enable better understanding of developmental disabilities. PedsQOL and PedsQL-IS: As is the case with severe pediatric diseases, the burden of the disease on the family is significant. The Pediatric Quality of Life InventoryTM is a validated a tool that assesses quality of life in children and their parents (by parent proxy reports). It has been validated in healthy children and adolescents and has been used in various pediatric diseases (Iannaccone et al., 2009; Absoud et al., 2011; Consolaro and Rayelli, 2016). Therefore, the PedsQL is included to evaluate the impact of AAV.hARSAco on the quality of life of the patient and their family. It can be applied to parents of children 2 years old and above and may therefore be informative as the children age over the 5 year follow-up period. The Pediatric Quality of Life InventoryTM Infant Scale (Varni et al., 2011) is a validated modular instrument completed by parents designed to measure health-related quality of life specifically for healthy and ill infants aged 1–24 months. It also provides the possibility for self-reporting by children aged 5 years and up. Lansky Performance Index: A scale that measures the functional status of an individual and provides a score that represents the person's ability to carry out normal daily activities. Effect of rAAV (e.g., AAV..hARSAco), vector, composition or method as described herein on disease pathology may be measured to show amelioration of a disease symptom or delay in disease progression, including changes in myelination, functional outcomes related to myelination, and potential disease biomarkers. The primary hallmark of MLD, central and peripheral demyelination, may be examined to show amelioration of a disease symptom or delay in disease progression following rAAV administration. Central demyelination may be tracked by MRI measurements of white matter regions, changes in which are indicators of disease state and progression (Gieselmann and Krageloh-Mann, 2010; Martin et al., 2012; van Rappard et al., 2015). Central demyelination detected by MRI positively correlates with the degree of gross motor dysfunction (Groeschel et al., 2011). Peripheral demyelination may be measured indirectly via NCV studies on the motor nerves (deep peroneal, tibial, and ulnar nerves) and sensory nerves (sural and median nerves), which also provides a readout of peripheral neuropathy. NCV studies monitor for fluctuations indicative of a change in biologically active myelin (i.e., F-wave and distal latencies, amplitude, or presence or absence of a response). In addition to measuring total demyelination scores and brain white matter atrophy, various brain neuronal metabolites, including NAA, mI, Cho, and Lac, may be measured over time using proton MRS. There is evidence that NAA levels strongly correlate with gross motor function, with the NAA signal intensity decreasing as the disease process advances (Kruse et al., 1993; Dali et al., 2010). Additionally, proton MRS studies have shown a decrease in the NAA / creatinine ratio and an increase in the Cho / creatinine ratio and mI and Lac levels during MLD disease evolution (Martin et al., 2012). Thus, neuronal metabolites may be evaluated as biomarkers showing amelioration of a disease symptom or delay in disease progression. There is evidence that peripheral nerve and CSF sulfatide and lysosulfatide accumulation correlates with abnormalities in electrophysiological parameters and large myelinated fiber loss in the sural nerve (Dali et al., 2015). CSF (lyso)-sulfatide levels may therefore reflect disease severity in the PNS and could provide a marker to assess the impact of a therapy on the peripheral nervous system. CSF sulfatide and lyso-sulfatide levels may be included to show amelioration of a disease symptom or delay in disease progression. Similar to seizures, vision loss is not a common presenting symptom in early onset MLD, but it does appear in the later stages of disease (Gieselmann and Krageloh-Mann, 2010; van Rappard et al., 2015). Tracking vision loss through the use of VEPs offers the opportunity to assess the ability of the rAAV as described herein to delay or prevent vision loss. VEPs may be used to objectively measure responses to visual stimuli as an indicator of central visual impairment or loss. Hearing loss is also common during disease progression, and early indications of auditory abnormalities may be measured via BAER testing. One of the sequelae of MLD in visceral tissues involves sulfatide deposition in the gallbladder wall, resulting in gallbladder wall thickening and polyps that may require surgical intervention and can be visualized on ultrasound (Rodriguez-Waitkus et al., 2011; Kim et al., 2017). Gallbladder abnormalities are a common finding in MLD and predispose the patient to gallbladder carcinoma (van Rappard et al., 2016) and occur in all subtypes of MLD. In certain embodiment, the assays listed below may be performed to show amelioration of a disease symptom and / or a delay in disease progression: Hematology, Serum Chemistry, Coagulation, LFTs; Urinalysis; HepB / HepC / HIV Serology; Serum Biomarkers (ARSA); Vector DNA in serum and urine; Serum anti-AAVhu68 nAbs; ELISpot (capsid and ARSA); CSF Collection and Assessments; LP (to collect CSF); CSF Cytology and Chemistry; CSF Disease Biomarkers (ARSA, sulfatide, lyso-sulfatide); CSF anti- AAVhu68 nAbs; Vector DNA in CSF; Physical Exam (including length and weight); Neurological Exam; Vital Signsd; ECGd; Sensory Nerve Conduction Studies; GMFC-MLD; GMFM; BSID-IIIe; WISC-V; Vineland-IIIe; Lansky Performance Index; PedsQL; PedsQL-IS; Caregiver / Parent QoL Assessment; Motor Milestone Assessment; Training on Seizure Diary Completion; Review of Seizure Diary; Imaging Assessments; MRI; MRS; NCV Measurements; and VEP. Related abbreviations are listed below: AAVhu68, adeno-associated virus serotype hu68; AE, adverse event; ARSA, Arylsulfatase A; BAER, brainstem auditory evoked response; BSID-III, Bayley Scales of Infant and Toddler Development, Third Edition; CSF, cerebrospinal fluid; DNA, deoxyribonucleic acid; ECG, electrocardiogram; ELISpot, enzyme-linked immunospot; GMFC-MLD, Gross Motor Function Classification in Metachromatic Leukodystrophy; GMFM, Gross Motor Function Measure; HepB, hepatitis B; HepC, hepatitis C; HIV, human immunodeficiency virus; ICM, intra-cisterna magna; LFTs, liver function tests; LP, lumbar puncture; MRI, magnetic resonance imaging; MRS, magnetic resonance spectroscopy; nAbs, neutralizing antibodies; NCV, nerve conduction velocity; PedsQL / PedQL-IS, Pediatric Quality of Life Inventory, QoL, Quality of Life; VEP, visual evoked potentials; Vineland-III, Vineland Adaptive Behavior Scales, Third Edition; WISC-V, Wechsler Intelligence Scale for Children, Fifth Edition. The rAAV, vector, composition and methods provides supra-physiologic levels of the ARSA enzyme within days of administration to both the CNS and PNS, both of which are affected in MLD patients. The AAVhu68 capsid and ICM route were selected based upon the observation of superior transduction of neurons, DRG, and peripheral nerve axons cells. Although vector transduction of myelinating cells is limited, the cross-correction potential would allow for enzyme uptake by oligodendrocytes. Furthermore, AAV vector and ARSA enzyme can be transported along axons, expanding the expression of the therapeutic enzyme within the brain and to the periphery. Χ. Apparatus and Method For Delivery of a Pharmaceutical Composition into Cerebrospinal Fluid In certain embodiments, the AAV.CB7.CI.hARSAco.rBG is administered as a single dose via a computed tomography- (CT-) guided sub-occipital injection into the cisterna magna (intra- cisterna magna [ICM]). Many animal models of monogenic CNS diseases have been successfully treated using AAV-mediated gene transfer, and several early human studies using a first-generation AAV vector demonstrated the safety of vector delivery to the brain (Janson et al., 2002; Mandel and Burger, 2004; Kaplitt et al., 2007; Mittermeyer et al., 2012; Bartus et al., 2014). However, the low efficiency of these vectors prevented the translation of efficacy in animal models into clinical benefits. With the advent of second-generation AAV vectors, the potential for gene transfer to the brain has been greatly enhanced. In particular, some clade F isolates, such as AAV9, have demonstrated extremely efficient brain transduction (Gray et al., 2013; Haurigot et al., 2013; Hinderer et al., 2014; Bell et al., 2015). Using these more efficient vectors, gene therapy has shown greatly enhanced potential to treat a variety of neurological disorders, and several programs utilizing second-generation vectors have progressed into the clinic (Haurigot et al., 2013; Hinderer et al., 2014; Bell et al., 2015; Gurda et al., 2016; Hinderer et al., 2016). Early studies of CNS gene transfer were challenged not only by the low gene transfer efficiency of first-generation AAV vectors, but also limitations in the available delivery methods. Most early non-clinical and clinical studies utilized direct vector injection into the parenchyma of the brain or spinal cord (Vite et al., 2005; Worgall et al., 2008; Colle et al., 2010; Ellinwood et al., 2011; Tardieu et al., 2014). While this method yields robust transduction near the injection site, translating this approach to diseases affecting cells throughout the CNS was difficult because large numbers of vector injections were required to achieve widespread transgene delivery. An additional obstacle to CNS gene transfer was the finding that intraparenchymal vector injection could trigger inflammation at the injection site, which could promote adaptive immune responses against the transgene product (Worgall et al., 2008; Colle et al., 2010; Ellinwood et al., 2011; Ciesielska et al., 2013). Two alternative vector delivery methods have been developed to more safely and effectively target large regions of the CNS. The first was based on the discovery that some AAV vectors, including AAV9, can transduce cells within the CNS after IV delivery (Foust et al., 2009). However, IV vector delivery has two critical limitations. First, the low efficiency of vector penetration into the CNS necessitates extremely large vector doses to achieve therapeutic levels of transgene expression, increasing the risk of systemic toxicity and potentially requiring quantities of vector that may not be feasible to manufacture for many patient populations (Gray et al., 2011; Hinderer et al., 2014; Gurda et al., 2016). Second, gene transfer to the CNS after IV vector delivery is profoundly limited by pre-existing NAbs to the vector capsid (Gray et al., 2011). Given the high prevalence of AAV NAbs in humans, this leaves a significant population of patients who would not be candidates for IV AAV treatment. In order to circumvent the limitations of IV AAV for targeting the CNS, IT vector delivery has been developed as an alternative approach. Using the CSF as a vehicle for vector dispersal, the IT ROA has the potential to achieve transgene delivery throughout the CNS and PNS with a single minimally invasive injection. Animal studies have demonstrated that by obviating the need to cross the blood-brain barrier, IT delivery results in substantially more efficient CNS gene transfer with much lower vector doses than those required for the IV approach (Gray et al., 2011; Hinderer et al., 2014). Since antibodies are present at very low levels in CSF, IT vector delivery is not affected by pre-existing NAbs to the AAV capsid, making this approach applicable to a broader patient population (Haurigot et al., 2013). IT AAV delivery can be performed using a variety of routes for CSF access. Lumbar puncture (LP) is the most common method for accessing CSF, and was therefore evaluated as a route for AAV administration in NHPs. Delivery of an AAV9 vector into the CSF via an LP was found to be at least 10-fold less efficient at transducing cells of the brain and spinal cord compared to injection of the vector more superiorly at the level of the cisterna magna (Hinderer et al., 2014). The superior brain transduction achieved with a single ICM injection in NHPs resulted in the selection of this ROA for the clinical studies of AAV.CB7.CI.hARSAco.rBG. Once a common procedure, ICM injection (also known as suboccipital puncture) was ultimately supplanted by LPs in the pre-imaging era due to rare cases of injury to the brainstem or nearby blood vessels (Saunders and Riordan, 1929). Today, the procedure can be performed under real- time CT guidance, allowing for visualization of critical structures, such as the medulla, vertebral arteries, and posterior inferior cerebellar arteries during needle insertion (Pomerantz et al., 2005; Hinderer et al., 2014). In one aspect, the vectors provided herein may be administered intrathecally via the method and / or the device provided in this section and described in WO 2018 / 160582. Alternatively, other devices and methods may be selected. In certain embodiments, the method comprises the steps of CT-guided sub-occipital injection via spinal needle into the cisterna magna of a patient. As used herein, the term Computed Tomography (CT) refers to radiography in which a three-dimensional image of a body structure is constructed by computer from a series of plane cross-sectional images made along an axis. On the day of treatment, the appropriate concentration of rAAVhu68.hARSAco is be prepared. A syringe containing 5.6 mL of rAAVhu68.hARSAco at the appropriate concentration is delivered to the procedure room. The following personnel are present for study drug administration: interventionalist performing the procedure; anesthesiologist and respiratory technician(s); nurses and physician assistants; CT (or operating room) technicians; site research coordinator. Prior to drug administration, a lumbar puncture is performed to remove a predetermined volume of CSF and then to inject iodinated contrast intrathecally (IT) to aid in visualization of relevant anatomy of the cisterna magna. Intravenous (IV) contrast may be administered prior to or during needle insertion as an alternative to the intrathecal contrast. The decision to used IV or IT contrast is at the discretion of the interventionalist. The subject is anesthetized, intubated, and positioned on the procedure table. The injection site is prepped and draped using sterile technique. A spinal needle (22-25 G) are advanced into the cisterna magna- under fluoroscopic guidance. A larger introducer needle may be used to assist with needle placement. After confirmation of needle placement, the extension set are attached to the spinal needle and allowed to fill with CSF. At the discretion of the interventionalist, a syringe containing contrast material may be connected to the extension set and a small amount injected to confirm needle placement in the cisterna magna. After the needle placement is confirmed by CT guidance + / - contrast injection, a syringe containing 5.6 mL of rAAVhu68.hARSAco is connected to the extension set. The syringe contents are slowly injected over 1-2 minutes, delivering a volume of 5.0 mL. The needle are slowly removed from the subject. In one embodiment, doses may be scaled by brain mass, which provides an approximation of the size of the CSF compartment. In a further embodiment, dose conversions are based on a brain mass of 0.4 g for an adult mouse, 90 g for a juvenile rhesus macaque, and 800 g for children 4–18 months of age. The following table provides illustrative doses for a murine MED study, NHP toxicology study, and equivalent human doses. [Image disponible dans le document PDF, Image available in the PDF document] In certain embodiments, a rAAVhu68.hARSAco vector is administered to a subject in a single dose. In certain embodiments, multiple doses (for example 2 doses) may be desired. For example, for infants under 6 months, multiple doses delivered days, weeks, or months, apart may be desired. In certain embodiments, a single dose of rAAVhu68.hARSAco vector is about 1 x 109 GC to about <semantics>3×1011<annotation encoding="application / x-tex">3 \times 10^{11}< / annotation>< / semantics> GC. In certain embodiments, the dose of rAAVhu68.HARSA is <semantics>1×1010<annotation encoding="application / x-tex">1 \times 10^{10}< / annotation>< / semantics> GC / brain mass to <semantics>3.33×1011<annotation encoding="application / x-tex">3.33 \times 10^{11}< / annotation>< / semantics> GC / brain mass. In other embodiments, different doses may be selected. The compositions can be formulated in dosage units to contain an amount of AAV that is in the range of about <semantics>1×109<annotation encoding="application / x-tex">1 \times 10^9< / annotation>< / semantics> genome copies (GC) to about <semantics>5×1013<annotation encoding="application / x-tex">5 \times 10^{13}< / annotation>< / semantics> GC (to treat an average subject of 70 kg in body weight). In one embodiment, a spinal tap is performed in which from about 15 mL (or less) to about 40 mL CSF is removed and in which vector is admixed with the CSF and / or suspended in a compatible carrier and delivered to the subject. In one example, the vector concentration is about <semantics>3×10−13<annotation encoding="application / x-tex">3 \times 10^{-13}< / annotation>< / semantics> GC, but other amounts such as about <semantics>1×109<annotation encoding="application / x-tex">1 \times 10^9< / annotation>< / semantics> GC, about <semantics>5×10−13<annotation encoding="application / x-tex">5 \times 10^{-13}< / annotation>< / semantics> GC, about <semantics>5×10−13<annotation encoding="application / x-tex">5 \times 10^{-13}< / annotation>< / semantics> GC, about <semantics>5×10−13<annotation encoding="application / x-tex">5 \times 10^{-13}< / annotation>< / semantics> GC, about <semantics>5×10−13<annotation encoding="application / x-tex">5 \times 10^{-13}< / annotation>< / semantics> GC, about <semantics>5×10−13<annotation encoding="application / x-tex">5 \times 10^{-13}< / annotation>< / semantics> GC, 109 GC, about 1 X 1010 GC, about 5 X 1010 GC, about 1 X 1011 GC, about 5 X 1011 GC, about 1 <semantics>X1012<annotation encoding="application / x-tex">X 10^{12}< / annotation>< / semantics> GC, about 5 X <semantics>1012<annotation encoding="application / x-tex">10^{12}< / annotation>< / semantics> GC, or about <semantics>1.0×1013<annotation encoding="application / x-tex">1.0 \times 10^{13}< / annotation>< / semantics> GC. A co-therapy may be delivered with the rAAVhu68.hARSAco compositions provided herein. The words "comprise", "comprises", and "comprising" are to be interpreted inclusively rather than exclusively. The words "consist", "consisting", and its variants, are to be interpreted exclusively, rather than inclusively. While various embodiments in the specification are presented using "comprising" language, under other circumstances, a related embodiment is also intended to be interpreted and described using "consisting of" or "consisting essentially of" language. The term "expression" is used herein in its broadest meaning and comprises the production of RNA or of RNA and protein. With respect to RNA, the term "expression" or "translation" relates in particular to the production of peptides or proteins. Expression may be transient or may be stable. As used herein, an "expression cassette" refers to a nucleic acid molecule which comprises a coding sequence, promoter, and may include other regulatory sequences therefor. In certain embodiments, a vector genome may contain two or more expression cassettes. In other embodiments, the term "transgene" may be used interchangeably with "expression cassette". Typically, such an expression cassette for generating a viral vector contains the coding sequence for the gene product described herein flanked by packaging signals of the viral genome and other expression control sequences such as those described herein. The term "heterologous" when used with reference to a protein or a nucleic acid indicates that the protein or the nucleic acid comprises two or more sequences or subsequences which are not found in the same relationship to each other in nature. For instance, the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid. For example, in one embodiment, the nucleic acid has a promoter from one gene arranged to direct the expression of a coding sequence from a different gene. Thus, with reference to the coding sequence, the promoter is heterologous. As used herein, an "effective amount" refers to the amount of the rAAV composition which delivers and expresses in the target cells an amount of the gene product from the vector genome. An effective amount may be determined based on an animal model, rather than a human patient. Examples of a suitable murine or NHP model are described herein. The term "translation" in the context of the present invention relates to a process at the ribosome, wherein an mRNA strand controls the assembly of an amino acid sequence to generate a protein or a peptide. It is to be noted that the term "a" or "an", refers to one or more, for example, "an enhancer", is understood to represent one or more enhancer(s). As such, the terms "a" (or "an"), "one or more," and "at least one" is used interchangeably herein. As described above, the term "about" when used to modify a numerical value means a variation of <semantics>±10%<annotation encoding="application / x-tex">\pm 10\%< / annotation>< / semantics>, unless otherwise specified. Unless defined otherwise in this specification, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art and by reference to published texts, which provide one skilled in the art with a general guide to many of the terms used in the present application. EXAMPLES The following examples are illustrative only and are not intended to limit the present invention. The vector AAVhu68.CB7.CI.hARSAco.rBG (also termed as AAV.CB7.CI.hARSAco.rBG or AAVhu68.hARSAco or AAV.hARSAco) was delivered into the CSF to achieve therapeutic ARSA expression levels and rescue several biomarkers of MLD. Several proof-of-concept pharmacology studies of AAV.CB7.CI.hARSAco.rBG were performed in healthy wild type mice. Non-clinical studies in healthy mice and nonhuman primates (NHPs) have demonstrated that CSF delivery of AAV.CB7.CI.hARSAco.rBG results in overexpression of ARSA in the CNS, PNS, and CSF (Examples 1 to 4). Example 2 demonstrated that intracerebroventricular (ICV) administration of AAV.CB7.CI.hARSAco.rBG leads to expression of enzymatically active ARSA in the brain of healthy wild type mice. Example 3 demonstrated that the observed -expression of ARSA results in part from the transduction and / or cross-correction of both cortical neurons and oligodendrocytes, which are the two main cell types affected by ARSA deficiency in MLD patients. Potentially therapeutic levels of ARSA have also been obtained in a size-relevant animal, the cynomolgus macaque (Example 4), and efficacy studies are conducted in an in vivo and / or in vitro MLD disease model. Additional experiment testing a dose range was also performed in healthy adult cynomolgus macaques, which demonstrated that despite the induction of anti-human ARSA (hARSA) antibodies, neurons of the brain, spinal cord, and DRG showed robust expression of ARSA for at least 6 weeks after ICM administration of AAV.CB7.CI.hARSAco.rBG (Example 4). A doubling of baseline CSF ARSA activity levels was also observed 2 weeks after treatment (Example 4), suggesting the possibility of achieving therapeutic expression levels of ARSA in early onset MLD patients. Experiments are also performed in order to assess the pharmacology and toxicology of AAV.CB7.CI.hARSAco.rBG in a new mouse model of MLD (Experiment 5) for subsequent use in a MED study (Example 6). An in vitro model is under investigation to test the efficacy of AAV.CB7.CI.hARSAco.rBG for reducing disease biomarkers in MLD patient-derived cell lines (Example 7). Further, Example 8 provides a pharmacology and toxicology study of AAV.CB7.CI.hARSAco.rBG in juvenile rhesus macaques. Example 10 shows a trial of AAV.CB7.CI.hARSAco.rBG in a pediatric MLD population. EXAMPLE 1 – AAV.hARSAco Vector Components of an AAV.hARSAco are illustrated in the following table. [Image disponible dans le document PDF, Image available in the PDF document] Vectors are constructed from cis-plasmids containing a coding sequence for human ARSA (SEQ ID NO: 1 and SEQ ID NO: 3) expressed from the chicken beta actin promoter with a cytomegalovirus enhancer (CB7; SEQ ID NO: 16) flanked by AAV2 inverted terminal repeats. The vectors are packaged in an AAV serotype hu68 capsid (WO 2018 / 160582) by triple transfection of adherent HEK 293 cells and purified by iodixanol gradient centrifugation as previously described in Lock, M., et al. Rapid, Simple, and Versatile Manufacturing of Recombinant Adeno-Associated Viral Vectors at Scale. Human Gene Therapy 21, 1259-1271 (2010). More particularly, AAV.CB7.CI.hARSAco.rBG is produced by triple plasmid transfection of HEK293 working cell bank (WCB) cells with the AAV cis plasmid (pENN.AAV.CB7.CI.hARSAco.rBG.KanR), the AAV trans plasmid encoding the AAV2 rep and AAVhu68 cap genes (pAAV2 / hu68.KanR), and the helper adenovirus plasmid (pAd<semantics>Δ<annotation encoding="application / x-tex">\Delta< / annotation>< / semantics>F6.KanR). The size of the AAV.CB7.CI.hARSAco.rBG packaged vector genome is 3883 bases (nt 1 to nt 3883 of SEQ ID NO: 5). The cis plasmid (FIG. 2) contains the following vector genome sequence elements: Inverted Terminal Repeat (ITR): The ITRs are identical, reverse complementary sequences derived from AAV2 (130 base pairs [bp], GenBank; NC_001401) that flank all components of the vector genome. The ITRs function as both the origin of vector DNA replication and the packaging signal for the vector genome when AAV and adenovirus helper functions are provided in trans. As such, the ITR sequences represent the only cis sequences required for vector genome replication and packaging. Human Cytomegalovirus Immediate-Early Enhancer (CMV IE): This enhancer sequence obtained from human-derived cytomegalovirus (382 bp, GenBank: K03104.1) increases expression of downstream transgenes. Chicken β-Actin (BA) Promoter (SEQ ID NO: 18): This ubiquitous promoter (281 bp, GenBank: X00182.1) was selected to drive transgene expression in any cell type. Chimeric Intron (CI): The hybrid intron consists of a chicken BA splice donor (973 bp, GenBank: X00182.1) and rabbit β-globin splice acceptor element. The intron is transcribed, but removed from the mature messenger ribonucleic acid (mRNA) by splicing, bringing together the sequences on either side of it. The presence of an intron in an expression cassette has been shown to facilitate the transport of mRNA from the nucleus to the cytoplasm, thus enhancing the accumulation of the steady level of mRNA for translation. This is a common feature in gene vectors intended for increased levels of gene expression. Coding Sequence: The engineered complementary deoxyribonucleic acid (cDNA) of the human ARSA gene (SEQ ID NO: 1 or SEQ ID NO: 3) encodes arylsulfatase A, which is a lysosomal enzyme responsible for the desulfation of the sulfated galactosphingolipids, galactosylceramide-3-O-sulfate and galactosylsphingosine-3-O-sulfate (1527 bp; 509 amino acids [aa], GenBank: NP 000478.3). Rabbit β-Globin Polyadenylation Signal (rBG PolyA): The rBG PolyA signal (127 bp, GenBank: V00882.1) facilitates efficient polyadenylation of the transgene mRNA in cis. This element functions as a signal for transcriptional termination, a specific cleavage event at the 3' end of the nascent transcript and the addition of a long polyadenyl tail. All component parts of the plasmid have been verified by direct sequencing. The AAV2 / hu68 trans plasmid (FIG. 3) is pAAV2 / hu68.KanR. It is 8030 bp in length and encodes four wild type AAV2 replicase (Rep) proteins required for the replication and packaging of the AAV vector genome. The pAAV2 / hu68.KanR plasmid also encodes three wild type AAVhu68 virion protein capsid (Cap) proteins, which assemble into a virion shell of the AAV serotype hu68 to house the AAV vector genome. The novel AAVhu68 sequence was obtained from human heart tissue DNA. To create the pAAV2 / hu68.KanR trans plasmid, the AAV9 cap gene from plasmid pAAV2 / 9n (which encodes the wild type AAV2 rep and AAV9 cap genes on a plasmid backbone derived from the pBluescript KS vector) was removed and replaced with the AAVhu68 cap gene. The ampicillin resistance (AmpR) gene was also replaced with the kanamycin resistance (KanR) gene, yielding pAAV2 / hu68.KanR. This cloning strategy relocated the AAV p5 promoter sequence (which normally drives rep expression) from the 5' end of rep to the 3' end of cap, leaving behind a truncated p5 promoter upstream of rep. This truncated promoter serves to down- regulate expression of rep and, consequently, maximize vector production. All component parts of the plasmid have been verified by direct sequencing. Plasmid pAdDeltaF6(KanR) (FIG. 4) was constructed and is 15,770 bp in size. The plasmid contains the regions of adenovirus genome that are important for AAV replication; namely, E2A, E4, and VA RNA (the adenovirus E1 functions are provided by the HEK293 cells). However, the plasmid does not contain other adenovirus replication or structural genes. The plasmid does not contain the cis elements critical for replication, such as the adenoviral ITRs; therefore, no infectious adenovirus is expected to be generated. The plasmid was derived from an E1, E3-deleted molecular clone of Ad5 (pBHG10, a pBR322-based plasmid). Deletions were introduced into Ad5 to eliminate expression of unnecessary adenovirus genes and reduce the amount of adenovirus DNA from 32 kb to 12 kb (FIG. 5A). Finally, the ampicillin resistance gene was replaced by the kanamycin resistance gene to create pAdeltaF6(KanR) (FIG. 5B). The E2, E4, and VA adenoviral genes that remain in this plasmid, along with E1, which is present in HEK293 cells, are necessary for AAV vector production. AAV.CB7.CI.hARSAco.rBG is manufactured by transient transfection of HEK293 cells followed by downstream purification. A manufacturing process flow diagram is shown FIGs 6 and 7. The major reagents entering into the preparation of the product are indicated on the left side of the diagram and in-process quality assessments are depicted on the right side of the diagram. A description of each production and purification step is also provided. Product manufacturing follows a linear flow of unit operations and utilizes disposable, closed bioprocessing systems unless otherwise specified. All steps of the production process involving cell culture, from cell seeding to harvest collection, are performed aseptically using sterile, single-use disposable tubing and bag assemblies. Cells are expanded using Corning flatware (T- Flasks, CellSTACKs [CS-10] and / or HYPERStacks [HS-36]). Cells are transfected in a bioreactor(s), and all open manipulations are performed in class II biological safety cabinets (BSCs) in an ISO Class 5 environment. The purification process are performed in a closed system. where possible. The manufacturing process for AAV.CB7.CI.hARSAco.rBG was developed and involves transient transfection of human embryonic kidney 293 (HEK293) cells with plasmid DNA. The HEK293 working cell bank (WCB) used in the production was tested and qualified as detailed in FDA and International Council for Harmonisation (ICH) guidelines. To support clinical development, a single batch or multiple batches of the bulk drug substance (BDS) is / are produced by polyethylenimine- (PEI-) mediated triple transfection of HEK293 cells in bioreactors. Harvested AAV material is purified sequentially by clarification, tangential flow filtration (TFF), affinity chromatography, and anion exchange chromatography in disposable, closed bioprocessing systems where possible. The product is formulated in intrathecal final formulation buffer (ITFFB; artificial CSF with 0.001% Pluronic F-68). The BDS batch or batches are frozen, subsequently thawed, pooled if necessary, adjusted to the target concentration, and sterile-filtered through a 0.22 µm filter, and vials are filled. Two different bioreactors are used: a small or pilot-scale bioreactor and a large-scale bioreactor. The small-scale bioreactor is a linearly scaled bioreactor with equal bed height for cell growth with respect to the large-scale bioreactor. The use of the small-scale bioreactor and the large-scale bioreactor allows for scalable manufacturing with minimal process and material impact. The large-scale bioreactor and / or the small-scale bioreactor is utilized for the production of the toxicology lot(s). The large-scale bioreactor is used for the production of the good manufacturing practice (GMP) drug substance (DS) lot(s) to be utilized in clinical trials and for licensure. Large-scale GMP production batch sizes are generated with multiple batches planned and pooled if necessary to satisfy the needed vector amount for drug product (DP) supply. The manufacturing process for AAV.CB7.CI.hARSAco.rBG remains largely unchanged as the product moves from IND-enabling non-clinical studies to clinical development and through licensure. Process parameters hypothesized to affect product quality are not be modified. Most critical source materials remain the same, including the HEK293 WCB, although the PEI and plasmid DNA utilized for GMP manufacturing is GMP-SourceTM or INDReadyTM grade materials. As the scale-up manufacturing process with the large-scale bioreactor is implemented, and based on the combined manufacturing experience in the current bioreactor platform, any potential impact is addressed related to changes in the process through comparability testing to ensure there is no change to identity, purity, potency, and safety of the product. The comparability testing that is conducted to compare a new lot manufactured with an updated procedure or with new material to a previous lot consists of a subset of tests included in the certificate of analysis (COA). The new lot meets the specifications that were previously established, and any tests included in the comparability assessment (the table below) are completed using similar methodologies and, if possible, the same testing sites. Table. Comparability Assessment [Image disponible dans le document PDF, Image available in the PDF document] a Particle content analysis by AUC is determined upon completion of toxicology lot manufacturing and product establishment manufacturing runs. AUC, analytical ultracentrifugation; GC, genome copies; ITR, inverted terminal repeat; IU, infectious units; MS, mass spectrometry; NGS, next-generation sequencing; qPCR, quantitative polymerase chain reaction; rcAAV, replication-competent adeno-associated virus; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; TBD, to be determined; TCID50, 50% tissue culture infective dose; USP, United States Pharmacopeia. The cell culture and harvest manufacturing process comprise four main manufacturing steps: (a) cell seeding and expansion, (b) transient transfection, (c) vector harvest, and (d) vector clarification. These process setups are depicted in the overview process diagram (FIG. 6). General descriptions of each of these processes are provided below. (a) Cell Seeding and Expansion A fully characterized HEK293 cell line is used for the production process. A WCB has been produced. Cell culture used for vector production is initiated from one or two thawed WCB vials and expanded as per a Master Batch Record (MBR) document. Cells are expanded using tissue culture plastic to allow sufficient cell mass to be generated for seeding in a large-scale bioreactor vessel surface area for vector production per DS batch. Cells are cultivated in medium composed of Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% gamma irradiated New Zealand-sourced fetal bovine serum (FBS). The cells are anchorage-dependent, and cell disassociation is accomplished using TrypLETM Select, an animal product-free cell dissociation reagent. Cell seeding is accomplished using sterile, single-use disposable bioprocess bags and tubing sets. The reactor is temperature-, pH-, and dissolved oxygen- (DO-) controlled. (b) Transient Transfection Following approximately 4 days of growth (DMEM media + 10% FBS), cell culture media is replaced with fresh, serum-free DMEM media and the cells are transfected with the three production plasmids using a PEI-based transfection method. All plasmids used in the production process are produced in the context of a CMO quality system as described above with infrastructure-utilizing controls to ensure traceability, document control, and materials segregation. Sufficient plasmid DNA transfection complexes are prepared in the BSC to transfect up to 500 m2 (per BDS batch). Initially, a DNA / PEI mixture is prepared containing cis (vector genome) plasmid, trans (rep and cap genes) plasmid, and helper plasmid in an optimal ratio with GMP-grade PEI (PEIPro HQ, PolyPlus Transfection SA). This plasmid ratio was determined to be optimal for AAV production in small-scale optimization studies. After mixing well, the solution is allowed to sit at room temperature for up to 25 minutes, then added to serum-free media to quench the reaction, and finally added to the bioreactor. The reactor is temperature- and DO-controlled, and cells are incubated for 5 days. (c) Vector Harvesting Transfected cells and media are harvested from the bioreactor using disposable bioprocess bags by aseptically pumping the medium out of the bioreactor. Following the harvest, detergent, endonuclease, and MgCl2 (a co-factor for the endonuclease) are added to release vector and digest unpackaged DNA. The product (in a disposable bioprocess bag) is incubated at 37°C for 2 hours in a temperature-controlled single-use mixer to provide sufficient time for enzymatic digestion of residual cellular and plasmid DNA present in the harvest as a result of the transfection procedure. This step is performed to minimize the amount of residual DNA in the final vector DP. Following incubation, NaCl is added to a final concentration of 500 mM to aid in the recovery of the product during filtration and downstream TFF. (d) Vector Clarification Cells and cellular debris are removed from the product using a pre-filter and depth filter capsule (1.2 / 0.22 μm) connected in series as a sterile, closed tubing and bag set that is driven by a peristaltic pump. Clarification assures that downstream filters and chromatography columns are protected from fouling, and bioburden reduction filtration ensures that at the end of the filter train, any bioburden potentially introduced during the upstream production process is removed before downstream purification. The purification process comprises four main manufacturing steps: (a) concentration and buffer exchange by TFF, (b) affinity chromatography, (c) anion exchange chromatography, and (d) concentration and buffer exchange by TFF. These process steps are depicted in the overview process diagram (FIG. 6). General descriptions of each of these processes are provided below. (a) Large-Scale Tangential Flow Filtration Volume reduction (20-fold) of the clarified product is achieved by TFF using a custom sterile, closed bioprocessing tubing, bag, and membrane set. The principle of TFF is to flow a solution under pressure parallel to a membrane of suitable porosity (100 kDa). The pressure differential drives molecules of smaller size through the membrane and effectively into the waste stream while retaining molecules larger than the membrane pores. By recirculating the solution, the parallel flow sweeps the membrane surface, preventing membrane pore fouling and product loss through binding to the membrane. By choosing an appropriate membrane pore size and surface area, a liquid sample may be rapidly reduced in volume while retaining and concentrating the desired molecule. Diafiltration in TFF applications involves addition of a fresh buffer to the recirculating sample at the same rate that liquid is passing through the membrane and to the waste stream. With increasing volumes of diafiltration, increasing amounts of the small molecules are removed from the recirculating sample. This diafiltration results in a modest purification of the clarified product, but also achieves buffer exchange compatible with the subsequent affinity column chromatography step. Accordingly, a 100 kDa, PES (polyethersulfone) membrane for concentration is utilized, which is then diafiltered with a minimum of four diavolumes of a buffer composed of 20 mM Tris pH 7.5 and 400 mM NaCl. The diafiltered product is then further clarified with a 1.2 / 0.22 µm depth filter capsule to remove any precipitated material. (b) Affinity Chromatography The diafiltered product is applied to a PorosTM Capture-SelectTM AAV affinity resin (Life Technologies) that efficiently captures the AAVhu68 serotype. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flow through the column, while AAV particles are efficiently captured. Following application, the column is treated with 5 volumes of a low-salt endonuclease solution (250 U / mL endonuclease, 20 mM Tris pH 7.5, 40 mM NaCl, and 1.5 mM MgCl2) to remove any remaining host cells and plasmid nucleic acids. The column is washed to remove additional feed impurities followed by a low pH step elution (400 mM NaCl, 20 mM sodium citrate, pH 2.5) that is immediately neutralized by collection into a 1 / 10th volume of neutralization buffer (200 mM Bis-Tris propane, pH 10.2). (c) Anion Exchange Chromatography To achieve further reduction of in-process impurities, including empty AAV particles, the Poros-AAV elution pool is diluted 50-fold (20 mM Bis-Tris propane, 0.001% Pluronic F-68, pH 10.2) to reduce ionic strength and enable binding to a CIMultusTM QA monolith matrix (BIA) Separations). Following a low-salt wash, vector product is eluted using a 60 column volume NaCl linear salt gradient (10–180 mM NaCl). This shallow salt gradient effectively separates capsid particles without a vector genome (empty particles) from particles containing vector genome (full particles) and results in a preparation enriched for full particles. The full particle peak eluate is collected and neutralized. The peak area is assessed and compared to previous data for determination of the approximate vector yield. (d) Concentration and Buffer Exchange by Hollow Fiber Tangential Flow Filtration The pooled anion exchange intermediate is concentrated and buffer-exchanged using TFF. In this step, a 100 kDa membrane hollow fiber TFF membrane is used. During this step, the product is brought to a target concentration and then buffer-exchanged into the ITFFB (artificial CSF with 0.001% Pluronic F-68). Samples are removed for testing (FIG. 7). The bulk drug substance (BDS) is sterile-filtered (0.22 µm), stored in sterile containers, and frozen at <semantics>≤<annotation encoding="application / x-tex">\leq< / annotation>< / semantics> -60°C in a quarantine location until release for final fill. The frozen bulk drug substance are thawed, pooled, and adjusted to the target concentration (dilution or concentrating step via TFF) using the final formulation buffer (FFB). The product is terminally filtered through a 0.22 µm filter and filled into sterile West Pharmaceutical's Crystal Zenith (cyclic olefin polymer) vials with crimp seal stoppers. Labeled vials are stored at <semantics>≤−60∘<annotation encoding="application / x-tex">\leq -60^{\circ}< / annotation>< / semantics>C. Bacterial master cell bank (BMCB) glycerol stocks of the cis, trans and helper plasmids were made by mixing 1 mL from a 1 L overnight culture of transformed Stbl2™ E. coli cells with an equal volume of sterile 50% glycerol. Two 0.5 mL aliquots of the BMCB glycerol stocks per construct are prepared from the mixture and stored in Nalgene cryogenic vials at -80°C. To verify BMCB glycerol stocks, amplified plasmid DNA is subjected to in-house structure analysis involving restriction enzyme digestion followed by gel electrophoresis, and full-plasmid sequence analysis by Sanger sequencing at Qiagen. To prepare bacterial working cell bank (BWCB) glycerol stock aliquots for shipping to the plasmid DNA manufacturer, a 3 mL culture is inoculated from a BMCB glycerol stock and grown overnight. Next, 1 mL of the overnight culture is used to prepare BWCB glycerol stock aliquots as described above. New BWCB glycerol stock aliquots are verified by the aforementioned structure analysis on DNA extracted from the remaining 2 mL of overnight bacterial culture. Once received at the plasmid DNA manufacturer, the BWCB glycerol stock is stored in a project-specific location at -80°C. Production cultures are inoculated by scraping the frozen BWCB glycerol stock. Plasmids used as source material for Good Manufacturing Practice (GMP) vector manufacturing are produced at a facility that is not qualified as a GMP facility; however, plasmids are produced in a manner that is designed to meet the requirements for Current Good Manufacturing Practice (cGMP) intermediates. Plasmid production is conducted on dedicated components and in a dedicated suite. The production procedures and oversight are conducted to ensure a consistent quality product with highly pure DNA, which meets stringent release criteria as captured in the following table. Components used in the production of plasmids are "animal- free" (based on the COAs from each vendor for component products), and all components used in the process (fermentation flasks, containers, membranes, resin, columns, tubing and any component that comes into contact with the plasmid) are dedicated to a single plasmid and are certified TSE- / BSE-free. The PolyFlo® resin, columns and components utilized are procured for the exclusive use in the manufacturing of a single plasmid. The fermentation, lysis and purification of the plasmid occurs in dedicated rooms marked with the designated plasmid name. No other plasmids are processed in those rooms at the same time. The rooms and equipment are cleaned between each plasmid production campaign. Prior to use in the production of recombinant vectors, each manufactured plasmid is fully sequenced using next-generation sequencing (NGS) to rule out contamination by other plasmids, in addition to testing for sterility and the presence of mycoplasma. All plasmid DNA used in the production of vectors for pharmacology / toxicology are made through Puresyn's Premium-Research Ready Program. Puresyn's Premium-Research Ready Program are produced using cleaning and segregation procedures and single-use components however they are not produced in a dedicated room. Table. Release Specifications for Plasmid Production [Image disponible dans le document PDF, Image available in the PDF document] HEK293 cells were originally generated by transforming HEK cells with sheared adenovirus type 5 (Ad5) DNA (Graham et al., 1977). The cells express the E1A and E1B gene products required for rAAV production. HEK293 cells are highly transfectable, yielding high levels of rAAV upon plasmid DNA transfection. Vector Genome Identity: DNA Sequencing AAV vector (2.00 x 1011 GC) is treated with Baseline Zero endonuclease and Plasmid Safe DNAse to eliminate non-encapsulated DNA in the environment and then incubated for 10 min at 95°C in 1x phosphate-buffered saline (PBS) and 0.5% sodium dodecyl sulfate (SDS) to denature the vector genome. Denatured vector genome is subsequently annealed by slowly cooling the reaction mix to 24°C at a rate of 0.6°C / minute in a thermocycler, cleaned up using the QIAquick PCR Purification Kit (QIAGEN), and sheared to an average size of 500 bp on a Covaris Ultrasonicator. DNA shearing is evaluated on a 2100 Bioanalyzer with High Sensitivity DNA reagent kit (Agilent). Sheared DNA is prepared into NGS libraries using the NEBNextUltraII library kit according to the manufacturer's protocol, size-selected, and cleaned up by Agencourt AMPure XP beads (Beckman Coulter). Individual NGS libraries are then analyzed on a Bioanalyzer again for fragment size distribution and quantified by a Qubit® 3.0 Fluorometer prior to pooling at equal molarity. The concentration of final pooled library is measured by a Qubit® 3.0 Fluorometer, denatured, and diluted to 8 pM according to Illumina's Miseq System Denature and Dilute Libraries Guide. PhiX control is spiked in the final library at 10%. Sequencing is performed using an Illumina MiSeq Nano Reagent Kit V2 (250 bp paired- end) on a MiSeq sequencer. Data analysis is performed as described above using the NGS alignment approach. Sequencing reads are automatically de-multiplexed and adapter-trimmed by the MiSeq computer. The trimmed reads for each plasmid are aligned to the corresponding reference sequence, and sequence variants are called using BBTools bioinformatics software suite (sourceforge.net / projects / bbmap). Additionally, BBMap (jgi.doe.gov / data-and-tools / bbtools / ) is used to generate VCF and BAM files. VCF files are further parsed by a custom UNIX script to generate simplified tab-delimited tables (retaining only CHROM, REF, ALT, QUAL, TYPE, DEPTH, AF, RAF, SB, DP4 fields). BAM files are visually inspected in IGV Integrated Genomic Viewer software (software broadinstitute org / software / igv / ) to ensure proper NGS alignments. In parallel with the NGS alignment approach, de novo assembly is conducted to build a long, circularized sequence using NOVOPlasty (github.com / ndierckx / NOVOPlasty). The de novo sequence is aligned against the original vector genome reference sequence to characterize large sequence arrangements that can be overlooked in the alignment approach. Vector Capsid Identity: AAV Capsid Mass Spectrometry of VP1 Confirmation of the AAVhu68 serotype of the DP is achieved using a new assay developed at the University of Pennsylvania and Bioproximity, LLC based upon the analysis of peptides of a AAV capsid protein. The method involves trypsin digestion of the VP followed by tandem mass spectrometry (MS) characterization on a Q-Exactive Orbitrap mass spectrometer to sequence the capsid protein peptides. A spectral library from the tandem mass spectra sequenced and a targeted MS method is used to assay for signature peptides that can uniquely identify specific AAV viral particles serotypes. A bank of signature peptides specific for eight serotypes (AAVhu68, AAV1, AAV2, AAV6, AAV8, AAV9, AAVrh10, and AAVhu37) are screened against the tandem mass spectra produced by digestion of the test article. For a positive identification, signature peptide(s) from a single serotype only are detected. Genomic Copy Titer A ddPCR-based technique for determining the GC titer for AAV vectors has been developed (Lock et al., 2014). The reference standard is generated during the pilot runs and is used to qualify the assay. The method is practical, reports equivalent or better titers than qPCR, and does not require a plasmid standard curve. The assay utilized involves digestion with DNase I, followed by ddPCR analysis to measure encapsulated vector GC. DNA detection is accomplished using sequence-specific primers targeting the poly A region in combination with a fluorescently tagged probe hybridizing to this same region. A number of standards, validation samples, and controls (for background and DNA contamination) have been introduced into the assay. This assay is qualified using pilot reference standard. The assay is qualified by establishing and defining assay parameters, including sensitivity, limit of detection (LOD), range of qualification, and intra- and inter-assay precision. An internal AAVhu68 reference lot is established and used to perform the qualification studies. Infectious Unit Titer The infectious unit (IU) assay is used to determine the productive uptake and replication of rAAV vector in RC32 cells (rep2 expressing HeLa cells). A 96-well endpoint format has been employed similar to that previously published. Briefly, RC32 cells are co-infected by serial dilutions of rAAV BDS and a uniform dilution of Ad5 with 12 replicates at each dilution of rAAV. Seventy-two hours after infection, the cells are lysed, and qPCR is performed to detect rAAV vector amplification over input. An endpoint dilution 50% tissue culture infectious dose (TCID50) calculation (Spearman-Karber) is performed to determine a replicative titer expressed as IU / mL. Since "infectivity" values are dependent on each particle's contact with cells, receptor binding, internalization, transport to the nucleus, and genome replication, they are influenced by assay geometry and the presence of appropriate receptors and post-binding pathways in the cell line used. Receptors and post-binding pathways are not usually maintained in immortalized cell lines, and thus infectivity assay titers are not an absolute measure of the number of "infectious". particles present. However, the ratio of encapsidated GC to "infectious units" (described as GC / IU ratio) can be used as a measure of product consistency from lot to lot. Particle Content Analysis Sedimentation velocity, as measured in an analytical ultracentrifuge (AUC), can detect aggregates, other minor components, as well as provide good quantitation of relative amounts of different particle species based upon their different sedimentation coefficients. This is an absolute method based on fundamental units of length and time, requiring no standard molecules as references. Vector samples are loaded into cells with two-channel charcoal-epon centerpieces with 12 mM optical path length. The supplied dilution buffer is loaded into the reference channel of each cell. The loaded cells are then placed into an AN-60Ti analytical rotor and loaded into a Beckman-Coulter ProteomeLab XL-I analytical ultracentrifuge equipped with both absorbance and RI detectors. After full temperature equilibration at 20°C, the rotor is brought to the final run speed of 12,000 revolutions per minute (RPM). Absorbance at 280 nm scans are recorded approximately every 3 minutes for approximately 5.5 hours (110 total scans for each sample). The raw data is analyzed using the <semantics>c(s)<annotation encoding="application / x-tex">c(s)< / annotation>< / semantics> method and implemented in the analysis program SEDFIT. The resultant size distributions are graphed and the peaks integrated. The percentage values associated with each peak represent the peak area fraction of the total area under all peaks and are based upon the raw data generated at 280 nm. Many labs use these values to calculate full:empty ratios. However, because empty and full particles have different extinction coefficients at this wavelength, the raw data can be adjusted accordingly. The ratio of the empty particle and full monomer peak values both before and after extinction coefficient adjustment is used to determine the full:empty ratio, and both ratios are recorded. Host Cell DNA A qPCR assay is used to detect residual HEK293 DNA. After spiking with a "non- relevant DNA," total DNA (non-relevant, vector, and residual genomic DNA) is extracted from approximately 1 mL of product. The HCDNA is quantified using qPCR targeting 18S rDNA. The quantities of DNA detected are normalized based on the recovery of the spiked non-relevant DNA. Three different amplicon sizes are tested to establish the size spectrum of residual HCDNA. Host Cell Protein An ELISA is performed to measure levels of contaminating host HEK293 cell proteins. The Cygnus Technologies HEK293 Host Cell Proteins 2nd Generation ELISA kit is used according to the instructions provided by the vendor. Replication-Competent AAV Assay A sample is analyzed for the presence of replication-competent AAV2 / hu68 (rcAAV) that could potentially arise during the production process. A three-passage assay has been developed consisting of cell-based amplification and passage followed by detection of rcAAV DNA by real- time qPCR (caphu68 target). The cell-based component consists of inoculating monolayers of HEK293 cells (P1) with dilutions of the test sample and wild type human Ad5. The maximal amount of the product tested is <semantics>1.00×1010<annotation encoding="application / x-tex">1.00 \times 10^{10}< / annotation>< / semantics> GC of the vector product. Due to the presence of adenovirus, rcAAV amplifies in the cell culture. After 2 days, a cell lysate is generated, and Ad5 is heat-inactivated. The clarified lysate is then passed onto a second round of cells (P2) to enhance sensitivity (again in the presence of Ad5). After 2 days, a cell lysate is generated, and Ad5 is heat-inactivated. The clarified lysate is then passed onto a third round of cells (P3) to maximize sensitivity (again in the presence of Ad5). After 2 days, cells are lysed to release DNA, which is then subjected to qPCR to detect AAVhu68 cap sequences. Amplification of AAVhu68 cap sequences in an Ad5-dependent manner indicates the presence of rcAAV. The use of a AAV2 / hu68 surrogate positive control containing AAV2 rep and AAVhu68 cap genes enables the LOD of the assay to be determined (0.1 IU, 1 IU, 10 IU, and 100 IU). Using a serial dilution of rAAV <semantics>(1.00×1010 GC,1.00×109 GC,1.00×108 GC, and 1.00×107 GC)<annotation encoding="application / x-tex">(1.00 \times 10^{10} \text{ GC}, 1.00 \times 10^9 \text{ GC}, 1.00 \times 10^8 \text{ GC}, \text{ and } 1.00 \times 10^7 \text{ GC})< / annotation>< / semantics>, the approximate quantity of rcAAV present in the test sample can be quantitated. The test method is performed. In Vitro Potency To relate the ddPCR GC titer to gene expression, an in vitro re...
Claims
<pat:Claims com:id="claims"> <pat:Claim com:id="CLM-00001"> <pat:ClaimNumber>1< / pat:ClaimNumber> <pat:ClaimText>1. A recombinant adeno-associated virus (rAAV) comprising: (a) an AAVhu68 capsid; and (b) a vector genome in the AAVhu68 capsid of (a), wherein the vector genome comprises inverted terminal repeats (ITR) and an expression cassette comprising a nucleic acid sequence encoding a functional human Arylsulfatase A (hARSA) operably linked to regulatory sequences for the hARSA, wherein the regulatory sequences comprise a promoter, and wherein hARSA coding sequence comprises a sequence of nucleotide (nt) 1 to 1527 of SEQ ID NO: 3, or a sequence at least 99% identical thereto which encodes a functional hARSA having an amino acid sequence of amino acids 1 to 509 of SEQ ID NO:
4. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00002"> <pat:ClaimNumber>2< / pat:ClaimNumber> <pat:ClaimText>2. The rAAV according to claim 1, wherein the regulatory sequences direct hARSA expression in nervous system cells. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00003"> <pat:ClaimNumber>3< / pat:ClaimNumber> <pat:ClaimText>3. The rAAV according to claim 1 or 2, wherein the regulatory sequences comprise a CB7 promoter which has a cytomegalovirus immediate early enhancer, a chicken beta actin promoter, and an intron. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00004"> <pat:ClaimNumber>4< / pat:ClaimNumber> <pat:ClaimText>4. The rAAV according to any one of claims 1 to 3, wherein the regulatory sequences comprise one or more of a Kozak sequence, a polyadenylation sequence, an intron, an enhancer, and a TATA signal. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00005"> <pat:ClaimNumber>5< / pat:ClaimNumber> <pat:ClaimText>5. The rAAV according to claim 1, wherein the vector genome comprises a human cytomegalovirus immediate early enhancer (CMV IE), a chicken beta actin promoter, a chicken beta actin splice donor and a rabbit b-globin splice acceptor element, the hARSA coding sequence, and a rabbit beta globin polyadenylation signal. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00006"> <pat:ClaimNumber>6< / pat:ClaimNumber> <pat:ClaimText>6. The rAAV according to any one of claims 1 to 5, wherein the hARSA coding sequence is SEQ ID NO:
3. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00007"> <pat:ClaimNumber>7< / pat:ClaimNumber> <pat:ClaimText>7. The rAAV according to any one of claims 1 to 6, wherein the vector genome has a sequence of nt 1 to nt 3883 of SEQ ID NO:
5. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00008"> <pat:ClaimNumber>8< / pat:ClaimNumber> <pat:ClaimText>8. An aqueous pharmaceutical composition comprising a rAAV according to any one of claims 1 to 7 and a formulation buffer. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00009"> <pat:ClaimNumber>9< / pat:ClaimNumber> <pat:ClaimText>9. The pharmaceutical composition according to claim 8, wherein the formulation buffer comprises: an artificial cerebrospinal fluid comprising buffered saline and one or more of sodium, calcium, magnesium, potassium, or mixtures thereof; and a surfactant. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00010"> <pat:ClaimNumber>10< / pat:ClaimNumber> <pat:ClaimText>10. The pharmaceutical composition according to claim 9, wherein the surfactant is present at 0.0005 % to 0.001% of the pharmaceutical composition. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00011"> <pat:ClaimNumber>11< / pat:ClaimNumber> <pat:ClaimText>11. The pharmaceutical composition according to any one of claims 8 to 10, wherein the composition is at a pH in the range of 7.5 to 7.
8. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00012"> <pat:ClaimNumber>12< / pat:ClaimNumber> <pat:ClaimText>12. The pharmaceutical composition according to any one of claims 8 to 11, wherein the formulation buffer is suitable for an intra-cisterna magna injection (ICM), intravenous delivery, intrathecal administration, or intracerebroventricular administration. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00013"> <pat:ClaimNumber>13< / pat:ClaimNumber> <pat:ClaimText>13. A recombinant nucleic acid molecule useful in producing an rAAV, wherein the nucleic acid molecule comprises an expression cassette, wherein the expression cassette comprises a nucleic acid sequence comprising a sequence of nucleotide (nt) 1 to nt 1527 of SEQ ID NO:3 or a sequence at least 99% identical thereto which encodes the amino acid sequence of amino acids 1 to 509 of SEQ ID NO:4 (human Arylsulfatase A (hARSA)) operably linked to regulatory sequences which direct the hARSA expression. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00014"> <pat:ClaimNumber>14< / pat:ClaimNumber> <pat:ClaimText>14. The nucleic acid molecule according to claim 13, wherein the hARSA coding sequence is SEQ ID NO:
3. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00015"> <pat:ClaimNumber>15< / pat:ClaimNumber> <pat:ClaimText>15. The nucleic acid molecule according to claim 13, wherein the regulatory sequences direct hARSA expression in nervous system cells. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00016"> <pat:ClaimNumber>16< / pat:ClaimNumber> <pat:ClaimText>16. The nucleic acid molecule according to claim 13 or 14, wherein the regulatory sequences comprise a CB7 promoter which has a cytomegalovirus immediate early enhancer, a chicken beta actin promoter, and an intron. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00017"> <pat:ClaimNumber>17< / pat:ClaimNumber> <pat:ClaimText>17. The nucleic acid molecule according to any one of claims 13 to 16, wherein the regulatory elements comprise one or more of a Kozak sequence, a polyadenylation sequence, an intron, an enhancer, and a TATA signal. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00018"> <pat:ClaimNumber>18< / pat:ClaimNumber> <pat:ClaimText>18. The nucleic acid molecule according to claim 13, wherein the expression cassette comprises a human cytomegalovirus immediate early enhancer (CMV IE), a chicken beta actin promoter, a chicken beta actin splice donor and a rabbit b-globin splice acceptor element, the hARSA coding sequence, and a rabbit beta globin polyadenylation signal. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00019"> <pat:ClaimNumber>19< / pat:ClaimNumber> <pat:ClaimText>19. The nucleic acid molecule according to any one of claims 1 to 18, wherein the molecule comprises a vector genome which comprises a 5' AAV inverted terminal repeat (ITR), the expression cassette, and a 3' AAV ITR. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00020"> <pat:ClaimNumber>20< / pat:ClaimNumber> <pat:ClaimText>20. The nucleic acid molecule according to any one of claims 1 to 19 which comprises the sequence of nt 1 to nt 3883 of SEQ ID NO:
5. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00021"> <pat:ClaimNumber>21< / pat:ClaimNumber> <pat:ClaimText>21. The nucleic acid molecule according to any one of claims 1 to 20, wherein the molecule is a plasmid. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00022"> <pat:ClaimNumber>22< / pat:ClaimNumber> <pat:ClaimText>22. Use of the rAAV according to any one of claims 1 to 7, the pharmaceutical composition according to any one of claims 8-12, or the nucleic acid molecule according to any one of claims 13 to 21, for treating Metachromatic Leukodystrophy or a disease associated with Arylsulfatase A (ARSA) gene mutation in a subject in need thereof. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00023"> <pat:ClaimNumber>23< / pat:ClaimNumber> <pat:ClaimText>23. Use of the rAAV according to any one of claims 1 to 7, the pharmaceutical composition according to any one of claims 8-12, or the nucleic acid molecule according to any one of claims 13 to 21, in the manufacture of a medicament for treating Metachromatic Leukodystrophy or a disease associated with Arylsulfatase A (ARSA) gene mutation in a subject in need thereof. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00024"> <pat:ClaimNumber>24< / pat:ClaimNumber> <pat:ClaimText>24. The use according to claim 22 or 23, wherein the rAAV or the nucleic acid molecule is for administration via a CT-guided sub-occipital injection into the cisterna magna. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00025"> <pat:ClaimNumber>25< / pat:ClaimNumber> <pat:ClaimText>25. The use according to any one of claims 22-24, wherein the rAAV, the pharmaceutical composition, or the nucleic acid molecule are for administration in a single dose. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00026"> <pat:ClaimNumber>26< / pat:ClaimNumber> <pat:ClaimText>26. The use according to any one of claims 22 to 25, wherein the rAAV is for administration at a dose between 3.00 x 1010 genome copies (GC) per gram (GC / g) of brain mass and <semantics>1.00×1012<annotation encoding="application / x-tex">1.00 \times 10^{12}< / annotation>< / semantics> GC / g of brain mass. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00027"> <pat:ClaimNumber>27< / pat:ClaimNumber> <pat:ClaimText>27. The use according to any one of claims 22 to 26, wherein following administration, disease symptom of the subject is ameliorated and / or the disease progression is delayed. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00028"> <pat:ClaimNumber>28< / pat:ClaimNumber> <pat:ClaimText>28. A rAAV according to any one of claims 1 to 7, or a pharmaceutical composition according to any one of claims 8-12, for administration to a patient via an intra-cisterna magna injection (ICM), including via a CT-guided sub-occipital injection into the cisterna magna. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00029"> <pat:ClaimNumber>29< / pat:ClaimNumber> <pat:ClaimText>29. A rAAV according to any one of claims 1 to 7, or a pharmaceutical composition according to any one of claims 8-12, for administration to a subject who is 7 years of age or younger. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00030"> <pat:ClaimNumber>30< / pat:ClaimNumber> <pat:ClaimText>30. A rAAV according to any one of claims 1 to 7, or a pharmaceutical composition according to any one of claims 8-12, for administration to a subject in need thereof to ameliorate symptoms of Metachromatic Leukodystrophy or a disease associated with Arylsulfatase A (ARSA) gene mutation, and / or to delay progression of Metachromatic Leukodystrophy or a disease associated with Arylsulfatase A (ARSA) gene mutation. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00031"> <pat:ClaimNumber>31< / pat:ClaimNumber> <pat:ClaimText>31. A rAAV according to any one of claims 1 to 7, or a pharmaceutical composition according to any one of claims 8-12, wherein the rAAV or vector or composition is administrable in a single dose. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00032"> <pat:ClaimNumber>32< / pat:ClaimNumber> <pat:ClaimText>32. An rAAV production system useful for producing the rAAV according to any of claims 1 to 7, wherein the production system comprises a cell culture comprising: (a) a nucleic acid sequence encoding the AAVhu68 capsid protein; (b) a vector genome comprising the nucleic acid sequence of any one of claims 13 to 20; and (c) AAV rep functions and helper functions to permit packaging of the vector genome into the AAVhu68 capsid. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00033"> <pat:ClaimNumber>33< / pat:ClaimNumber> <pat:ClaimText>33. The rAAV production system according to claim 32, wherein the vector genome has a sequence of nt 1 to nt 3883 of SEQ ID NO:
5. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00034"> <pat:ClaimNumber>34< / pat:ClaimNumber> <pat:ClaimText>34. The rAAV production system according to claim 32 or 33, wherein the cell culture is a human embryonic kidney 293 cell culture. < / pat:ClaimText> < / pat:Claim> <pat:Claim com:id="CLM-00035"> <pat:ClaimNumber>35< / pat:ClaimNumber> <pat:ClaimText>35. The system according to any one of claims 32 to 34, wherein the AAV rep coding sequence and cap genes are on the same nucleic acid molecule, wherein there is optionally a spacer between the rep sequence and cap gene. < / pat:ClaimText> < / pat:Claim> < / pat:Claims>