Polyglycerol stabilizing agents, compositions, uses, and manufacturing methods thereof
Patent Information
- Application Number
- CA3304664
- Authority / Receiving Office
- CA · CA
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-09-12
- Filing Date
- 2024-09-09
- Publication Date
- 2025-03-20
AI Technical Summary
Existing lipid nanoparticle (LNP) and nucleic acid-containing lipid nanoparticle (NALNP) formulations face challenges in stability and immunogenicity, particularly due to the use of polyethylene glycol (PEG) or PEGylated lipids as stabilizing agents.
The development of polyglycerol-based stabilizing agents, which are free from PEG and PEGylated lipids, to enhance the stability and compatibility of LNPs and NALNPs, thereby improving their safety and reducing immunogenicity.
The use of polyglycerol-based stabilizing agents in LNP formulations results in improved stability, higher encapsulation efficiency, and reduced immunogenicity compared to traditional PEG-based systems, making them more suitable for medical applications such as oligonucleotide-based therapeutics and gene therapy.
Abstract
Description
POLYGLYCEROL STABILIZING AGENTS, COMPOSITIONS, USES, AND MANUFACTURING METHODS THEREOFCROSS REFERENCE TO RELATED APPLICATION
[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 63 / 537,969, filed September 12, 2023, which is incorporated by reference in its entirety herein.BACKGROUND
[0002] Lipid nanoparticle (LNP) formulations and nucleic acid-containing lipid nanoparticle (NALNP) formulations are used for a variety of applications, particularly medical applications such as oligonucleotide-based therapeutics, e.g., vaccines, immunogenic cell incorporation, and gene therapy. LNP and NALNP formulations can also be used for antibiotics and vitamins, among other uses.
[0003] However, there is a need for improved LNP and NALNP formulations. The present invention provides for ameliorating at least some of the disadvantages of the prior art. These and other advantages of the present invention will be apparent from the description as set forth below.BRIEF SUMMARY
[0004] In one aspect, the invention provides a stabilizing agent having the structure of formula (I):where Ri is hydrogen, Ci-i8 substituted or unsubstituted heteroalkyl group, Ci-i8 unsaturated heteroalkyl group, Ci-i8 heterocyclyl group, Cuis charged heteroalkyl group, or Cuis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; R3 is hydrogen, a targeting ligand, a hydrophilic group, an amphiphilic group, or a combination thereof; A is a Ci- C50 substituted or unsubstituted heteroalkyl group, a C1-C50 unsaturated heteroalkyl group, or a combination thereof; and m is an integer from 5 to 1000.
[0005] In some embodiments, Ri is hydrogen, C1-5 substituted or unsubstituted heteroalkyl group, C1-5 unsaturated heteroalkyl group, C1-5 heterocyclyl group, C1-5 charged heteroalkyl group, C1-5 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and m is an integer from 5 to 80.
[0006] In some embodiments, A is
[0007] In some embodiments, R3 is hydrogen, a peptide, an antibody, a sugar, an oligosaccharide, an aminoglycoside, a sterol, phenyl boronic acid, or a combination thereof.
[0008] In some embodiments, the stabilizing agent is selected from the group consisting of SAF06, SAF10, SAF15, SAF25, SAF89, SAF92, SAF93, SAF182, SAF183, SAF184, or a combination thereof.
[0009] In one aspect, the invention provides a stabilizing agent having the structure of formula (II):where Y is hydrogen, methyl, C1-C24 substituted or unsubstituted heteroalkyl group, Ci-Cis unsaturated heteroalkyl group, C1-C24 heterocyclyl group, Ci-Cis charged heteroalkyl group, Ci- Ci8 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 heterocyclyl group, C1-C50charged heteroalkyl group, C1-C50 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 600.
[0010] In some embodiments, Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C1-C35 substituted or unsubstituted heteroalkyl group, C1-C35 unsaturated heteroalkyl group, Ci- C35 heterocyclyl group, C1-C35 charged heteroalkyl group, C1-C35 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 90.
[0011] In some embodiments, Xi, X2, X3, X4, X5 and Xe are each independently hydrogen,combination thereof.
[0012] In some embodiments, the stabilizing agent is selected from the group consisting of SAFI 9, SAF97, SAF98, SAFI 28, or a combination thereof.
[0013] In some embodiments, the stabilizing agent of formula (I) or (II) is used for stabilizing a lipid nanoparticle or liposome.
[0014] In one aspect, the invention provides a lipid nanoparticle composition including: (a) an ionizable lipid; (b) two or more lipids; and (c) a stabilizing agent of formula (I) or (II).
[0015] In some embodiments, the two or more lipids include a structural lipid, a sterol, or a combination thereof.
[0016] In some embodiments, the lipid nanoparticle composition consists essentially of: (a) an ionizable lipid; (b) two lipids; and (c) the stabilizing agent.
[0017] In some embodiments, the lipid nanoparticle composition is substantially free of PEG or PEG-R, where R is any atom or molecule covalently attached to PEG.
[0018] In some embodiments, the structural lipid is neutrally charged, positively charged, or negatively charged.
[0019] In some embodiments, the ionizable lipid is DODMA, DLin-MC3-DMA, DLin-KC2- DMA, BOCHD-C3-DMA, C12-200, PNI 516, PNI 127, PNI 550, PNI 580, PNI 659, PNI 728, PNI 762, or a combination thereof.
[0020] In some embodiments, the structural lipid includes diacylphosphatidylcholines, diacylphosphatidylethanolamines, diacylphosphatidylglycerols, ceramides, sphingomyelins, dihydrosphingomyelins, cephalins, cerebrosides, or a combination thereof.
[0021] In some embodiments, the structural lipid comprises distearoylphosphatidylcholine, dioleoylphosphatidylcholine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylethanolamine, palmitoyloleoylphosphatidylcholine, 1 -stearoyl -2-oleoyl-sn-gly cero- 3 -phosphocholine, palmitoyloleoyl-phosphatidylethanolamine, di oleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l -carboxylate, dipalmitoyl phosphatidyl ethanolamine, dimyristoylphosphoethanolamine, distearoylphosphatidylethanolamine, 1 ,2-dipalmitoyl-sn-glycero-3 -phosphoethanolamine-N-m ethyl, 1 ,2- dipalmitoyl-sn-glycero-3-phosphoethanolamine-N,N-dimethyl, l,2-dielaidoyl-sn-glycero-3- phosphoethanolamine, 1 -stearoyl -2-oleoyl -phosphatidy ethanol amine, 1,2-dielaidoyl-sn-glycero- 3-phophoethanolamine, distearoylphosphatidylcholine, dioleoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, palmitoyloleyolphosphatidylglycerol, cardiolipin, phosphatidylinositol, diacylphosphatidylserine, diacylphosphatidic acid, monosialoganglioside GM1, or a combination thereof.
[0022] In some embodiments, the sterol includes cholesterol, beta-sitosterol, 20-alpha- hydroxysterol, phytosterol, or a combination thereof.
[0023] In some embodiments, the stabilizing agent has a molecular weight of about 500 Da to about 50,000 Da.
[0024] In some embodiments, the lipid nanoparticle composition comprises about 20 to about 70 mol% ionizable lipid, about 1 to about 25 mol% structural lipid, about 28 to about 50 mol% sterol, and about 0.1 to about 5 mol% stabilizing agent.
[0025] In one aspect, the invention provides a lipid nanoparticle including the lipid nanoparticle composition and a nucleic acid.
[0026] In some embodiments, the nucleic acid is encapsulated by the lipid nanoparticle composition.
[0027] In some embodiments, the nucleic acid includes an antisense oligonucleotide, a siRNA, a miRNA, a self-amplifying RNA (samRNA or saRNA), a self-replicating DNA, an LNA, a DNA, a replicon, an mRNA, a guide RNA, a transposon, a single gene, a vector, aplasmid, a viral particle, an AAV, a complex of RNA and RNA-binding protein, or a combination thereof.
[0028] In some embodiments, the nucleic acid is an antigen encoded mRNA for prophylactic or therapeutic vaccine, a nucleic acid for gene therapy, or a nucleic acid for immunogenic cell incorporation, wherein the immunogenic cell is a T cell.
[0029] In some embodiments, the lipid nanoparticle diameter is about 15 nm to about 500 nm.
[0030] In some embodiments, the lipid nanoparticle has a poly dispersity index of about 0.01 to about 0.40.
[0031] In some embodiments, the lipid nanoparticle has an encapsulation efficiency of about 50% to about 100%.
[0032] In one aspect, the invention provides a pharmaceutical composition including the lipid nanoparticle composition and a pharmaceutically acceptable carrier.
[0033] In another aspect, the invention provides a method for preparing the lipid nanoparticle, the method including: (a) forming the lipid nanoparticle composition by combining the ionizable lipid, the structural lipid, the sterol, and the stabilizing agent; (b) preparing the lipid nanoparticle by combining the lipid nanoparticle composition and the nucleic acid using a microfluidic mixer; and (c) purifying the lipid nanoparticle.
[0034] In some embodiments, the lipid nanoparticle composition and the nucleic acid are combined using a flow ratio of about 1 : 1 to about 10: 1 by volume (aqueous phase: organic phase) at a N / P ratio of about 2 to about 20, and a total flow rate of about 2 to about 2000 mL / min.
[0035] In some embodiments, the aqueous phase comprises a low pH buffer. In some embodiments, the aqueous phase includes a citrate or acetate buffer.
[0036] In some embodiments, the organic phase comprises 1,4-di oxane, tetrahydrofuran, acetone, acetonitrile, dimethyl sulfoxide, dimethylformamide, acids, alcohols, or a combination thereof.
[0037] In some embodiments, the organic phase is an alcohol and the alcohol includes aqueous or anhydrous alcohol, wherein the alcohol is a primary, secondary, or tertiary alcohol having from 1 to 12 branched or unbranched carbons.
[0038] In another aspect, the invention provides use of the lipid nanoparticle or the pharmaceutical composition for preventing, treating, or ameliorating conditions or diseases including administering the lipid nanoparticle as a vaccine or as a treatment to prevent or reduce the severity of a contagion, administering the lipid nanoparticle as a gene therapeutic, or administering the lipid nanoparticle to an immunogenic cell for the treatment of cancer or an infection.
[0039] Further and alternative aspects and features of the disclosed principles will be appreciated from the following detailed description. As will be appreciated, the compositions and methods disclosed herein are capable of being carried out and used in other and different embodiments, and capable of being modified in various respects. Accordingly, it is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and do not restrict the scope of the appended claims.BRIEF DESCRIPTION OF THE DRAWINGS
[0040] FIG. 1A is a bar graph that demonstrates the level of Luciferase expressed by HEK293 cells 24 h after being treated with either untreated Flue mRNA LNPs or Flue mRNA LNPs containing PEG-DMG, SAF10, SAFI 5, or SAF25 as the stabilizing agent, as described herein. The lipid composition used included PNI 516-V02 (lipid concentration: 25 mM), which was 47.5 mol % ionizable lipid, 12.5 mol % structural lipid, 38.5 mol % sterol, and 1.5 mol % stabilizing agent.
[0041] FIG. IB is a bar graph that demonstrates the levels of Luciferase expressed by T cells 24 h after being treated with either untreated Flue mRNA LNPs or Flue mRNA LNPs containing PEG-DMG or SAF25 as the stabilizing agent, as described herein. The lipid composition used included PNI 516-V02 (lipid concentration: 25 mM), which was 47.5 mol% ionizable lipid, 12.5 mol % structural lipid, 38.5 mol % sterol, and 1.5 mol % stabilizing agent.
[0042] FIG. 2A is a schematic representation that shows the hEPO expression study in mice. In this study, four mice per group were injected with EPO-expressing LNPs containing either PBS, SAF06, SAF10, SAF15, SAF25, or SAF93 as the stabilizing agent, as described herein. hEPO expression levels were measured 24 h post administration.
[0043] FIG. 2B includes dot plots that demonstrates hEPO expression levels (24 h post administration) in C57BL / 6 mice sera following IV administration of EPO-expressing LNPscontaining either PBS, SAF06, SAF10, SAF15, SAF25, or SAF93 as the stabilizing agent, as described herein. The mice were administered with 0.25 mg / kg and 200 pL / 20 g mouse dose of recombinant human EPO-encoded mRNA-LNPs using PNI 516 in V02 composition (N / P-8). The lipid composition used included PNI 516-V02 (lipid concentration: 25 mM), which was 47.5 mol % ionizable lipid, 12.5 mol % structural lipid, 38.5 mol % sterol, and 1.5 mol % stabilizing agent.
[0044] FIG. 3A is a schematic representation that shows the SARS-CoV-2 vaccine study in mice. In this study, mice were injected with SARS-CoV-2 expressing LNPs containing either PBS, SAF06, SAF15, or SAF25 as the stabilizing agent, as described herein, and SARS-CoV-2 antigen specific IgG levels were measured 21 and 42 days after IV administration.
[0045] FIG. 3B is a dot plot that demonstrates the SARS-CoV-2 spike protein specific IgG level in sera of mice treated with A5 saRNA lipid nanoparticles (1 pg / 50 pl / 20 g mouse / inj ection) with different stabilizing agents (PBS, SAF06, SAF15, or SAF25), 14 days post boost-injection (42 days post prime-injection). The lipid composition used included PNI 516- V02 (lipid concentration: 25 mM), which was 47.5 mol % ionizable lipid, 12.5 mol % structural lipid, 38.5 mol % sterol, and 1.5 mol % stabilizing agent.
[0046] FIG. 4 is a bar graph that demonstrates the knock out (KO) efficiency in T cells following 24 h treatment (10,000 cells / 100 pL, dose: 4 pg / million cells) with T cell receptor (TCR) single guide RNA (sgRNA) / Cas9 mRNA LNPs with polyglycerol-based stabilizers. The compositions used were 40 mol % PNI 762, 20 mol % DSPC, (40-x) mol % cholesterol, x mol % stabilizer. SAF89 and SAF128 outperformed PEG-DMG stabilizers in the ex vivo experiments.
[0047] FIGS. 5A-5D are line graphs that demonstrate the in vitro potency of various polyglycerol-based LNPs (lipid composition: 40 mol % PNI 550 / PNI 762, 20 mol % DSPC, (40- x) mol % cholesterol, x mol % stabilizer), with the payload of enhanced green fluorescent protein (eGFP) mRNA. The cell lines tested included BHK (FIG. 5A), U937 (FIG. 5B), Jurkat (FIG. 5C) and HeLa (FIG. 5D). SAF89 outperformed PEG-DMG in both the in vitro and ex vivo experiments.
[0048] FIGS. 6A-6B are bar graphs that demonstrate the ex vivo activity of various LNPs. (FIG. 6A) Transfection efficiency (TE) % and (FIG. 6B) mean fluorescence intensity (MFI) for various polyglycerol-based LNPs (lipid composition: 40 mol % PNI 550 / PNI 762, 20 mol % DSPC, (40-x) mol % cholesterol, x mol % stabilizer), with the payload of enhanced greenfluorescent protein (eGFP) mRNA) 24 h post treatment analyzed by flow cytometry. The cell line tested included BHK, U937, HeLa, and Jurkat. The primary cells used for ex vivo studies were human T cells. SAF89 outperformed PEG-DMG in both the in vitro and ex vivo experiments.
[0049] FIGS. 7A-7B are dot plots that demonstrate SARS-CoV-2 spike protein specific IgG expression in C57BL / 6 mice on day 21 and day 42 following IM administration of 1 pg / mouse dose of SARS-CoV-2 spike protein encoded saRNA-containing LNPs formed based on V62 composition (40 mol % PNI 516, 12.5 mol % DSPC. 46 mol % cholesterol, 1.5 mol % stabilizer) (N / P-8). The stabilizers that outperformed PEG-DMG in the V62 compositions in vivo included SAF128.
[0050] FIGS. 8A-8B are dot plots that demonstrate hEPO expression levels (6 h and 24 h post administration) in C57BL / 6 mice following IV administration of 0.25 mg / kg dose of recombinant human EPO-encoded mRNA-LNPs using V62 compositions (40 mol % PNI 516, 12.5 mol % DSPC, 46 mol % cholesterol, 1.5 mol % stabilizer) (N / P-8). The stabilizers that outperformed PEG-DMG in the V62 compositions in vivo included SAF128.
[0051] FIG. 9 is a dot plot that demonstrates hEPO expression levels (6 h post administration) in C57BL / 6 mice following subcutaneous administration of 0.25 mg / kg dose of recombinant human EPO-encoded mRNA-LNPs formed using the composition of 40 mol % PNI 516, 12.5 mol % DSPC, 46 mol % cholesterol, 1.5 mol % stabilizer (N / P-8).
[0052] FIG. 10 is a bar graph that demonstrates firefly luciferase (Flcu) protein expression levels in the spleen versus the liver (4 h post administration) in Hsd:ICR female mice following IV administration of 0.1 mg / kg dose of Fluc-encoded mRNA-LNPs formed using the composition of 40 mol % PNI 516, 12.5 mol % DSPC, 46 mol % cholesterol, 1.5 mol % stabilizer (N / P-8). FIG. 10 shows that the polyvinylpyrrolidones had higher extrahepatic selectivity than PEG or PEGylated lipids.DETAILED DESCRIPTION
[0053] I. Introduction
[0054] The disclosure provides stabilizing agents and lipid nanoparticle (LNP) compositions including the stabilizing agents, as well as methods for preparing the stabilizing agents and lipid nanoparticles. These lipid nanoparticle (LNP) compositions may be configured to encapsulatenucleic acids. The lipid nanoparticle compositions for encapsulating nucleic acids may comprise an ionizable lipid, two or more lipids, and a polyglycerol stabilizing agent as discussed herein. Advantageously, in contrast with LNP compositions including polyethylene glycol (PEG) or PEGylated lipid (polyethylene glycol (PEG)-lipid conjugate) as stabilizing agents, LNP and NALNP formulations with polyglycerol stabilizing agents in accordance with the invention are free of PEG and free of PEGylated lipids. The inventors have found that the inventive stabilizing agents allow for LNPs that have higher compatibility and safety and lower immunogenicity when compared to PEG or PEGylated lipid based LNP products. In some cases, the PEGylated lipid is PEG-R, where R is any atom or molecule. In some cases, R is DMG, DSG, DSPE, DOPE, or DPPE. In some cases, the PEGylated lipid includes DMG-PEG, DSG-PEG, DSPE- PEG, DOPE-PEG, or DPPE-PEG.
[0055] The resulting encapsulated LNP formulations may be used in a variety of applications, particularly medical applications such as oligonucleotide-based therapeutics, e.g., vaccines, immunogenic cell incorporation, and gene therapy. The compositions surprisingly and unexpectedly provide benefits including more potent protein expression when compared to traditional PEG based products.
[0056] To facilitate an understanding of the present disclosure, a number of terms and phrases are defined below.
[0057] II. Definitions
[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the methods described herein belong. Any reference to standard methods refers to the most recent available version of the method at the time of filing of this disclosure unless otherwise indicated.
[0059] For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
[0060] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
[0061] The words "preferred" and "preferably" refer to embodiments of the invention that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or morepreferred embodiments does not imply that other embodiments are not useful and is not intended to exclude other embodiments from the scope of the invention.
[0062] The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Such terms will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
[0063] The singular form "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. These articles refer to one or to more than one (i.e., to at least one). The use of the term “at least one” followed by a list of one or more items (for example, “at least one of A and B”) is to be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context. As used herein, the term "or" is generally employed in its usual sense including "and / or" unless the content clearly dictates otherwise. The term "and / or" means any one or more of the items in the list joined by "and / or". As an example, "x and / or y" means any element of the three-element set {(x), (y), (x, y)}. In other words, "x and / or y" means "one or both of x and y". As another example, "x, y, and / or z" means any element of the sevenelement set {(x), (y), (z), (x, y), (x, z), (y, z), (x, y, z)}. In other words, "x, y and / or z" means "one or more of x, y and z".
[0064] Where ranges are given, endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.). Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. Herein, "up to" a number (for example, up to 50) includes the number (for example, 50). The term "in the range" or "within a range" (and similar statements) includes the endpoints of the stated range.
[0065] Reference throughout this specification to “one aspect (or embodiment),” “an aspect (or embodiment),” “certain aspects (or embodiments),” or “some aspects (or embodiments),” etc., means that a particular feature, configuration, composition, or characteristic described in connection with the aspect is included in at least one aspect of the disclosure. Thus, the appearances of such phrases in various places throughout this specification are not necessarilyreferring to the same embodiment of the disclosure. Furthermore, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more aspects.
[0066] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." As used herein in connection with a measured quantity, the term "about" refers to that variation in the measured quantity as would be expected by the skilled artisan making the measurement and exercising a level of care commensurate with the objective of the measurement and the precision of the measuring equipment used. The term "about" as used in connection with a numerical value throughout the specification and the claims denotes an interval of accuracy, familiar and acceptable to a person skilled in the art. In general, such interval of accuracy is + / - 10%. Thus, "about" can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 %, 0.5%, 0.1 %, 0.05%, 0.01 %, or 0.001 % greater or less than the stated value. Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0067] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.
[0068] The term "exemplary" means serving as a non-limiting example, instance, or illustration. As utilized herein, the terms "e.g.," and "for example" set off lists of one or more non-limiting aspects, examples, instances, or illustrations.
[0069] As used herein, the term "substantially" refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. Biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term "substantially" is therefore used herein to capturethe potential lack of completeness inherent in many biological and chemical phenomena. For example, "substantially" may refer to being within at least about 20%, alternatively at least about 10%, alternatively at least about 5% of a characteristic or property of interest.
[0070] The term "administering" as used herein refers to the physical introduction of an agent to a subject, such as a lipid nanoparticle disclosed herein, using any of the various methods and delivery systems known to those skilled in the art. Exemplary routes of administration for the formulations disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal, or other parenteral routes of administration, for example by injection or infusion. The phrase "parenteral administration" means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion, as well as in vivo electroporation. In some embodiments, the formulation is administered via a non-parenteral route, e.g., orally. Other non-parenteral routes include a topical, epidermal or mucosal route of administration, for example, intranasally, vaginally, rectally, sublingually or topically. Administering can also be performed, for example, once, a plurality of times, and / or over one or more extended periods.
[0071] The term "cancer" refers to a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream. A "cancer" or "cancer tissue" can include a tumor.
[0072] The term "in vitro" refers to events occurring in an artificial environment, e.g., in a test tube, reaction vessel, cell culture, etc., rather than within a multi-cellular organism. The term "in vitro cell" refers to any cell which is cultured ex vivo. In particular, an in vitro cell can include a T cell. The term "in vivo" refers to events that occur within a multi-cellular organism, such as a human or a non -human animal.
[0073] The term "nucleic acid" refers to any polymeric chain of nucleotides. A nucleic acid may be DNA, RNA, or a combination thereof. In some embodiments, a nucleic acid comprises one or more natural nucleic acid residues. In some embodiments, a nucleic acid comprises of oneor more nucleic acid analogs. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 ,60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long (e.g., 20 to 100, 20 to 500, 20 to 1000, 20 to 2000, or 20 to 5000 or more residues). In some embodiments, a nucleic acid is partly or wholly single stranded; in some embodiments, a nucleic acid is partly or wholly double stranded. In some embodiments a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide.
[0074] The term "pharmaceutically acceptable" refers to a molecule or composition that, when administered to a recipient, is not deleterious to the recipient thereof, or that any deleterious effect is outweighed by a benefit to the recipient thereof. With respect to a carrier, diluent, or excipient used to formulate a composition as disclosed herein, a pharmaceutically acceptable carrier, diluent, or excipient must be compatible with the other ingredients of the composition and not deleterious to the recipient thereof, or any deleterious effect must be outweighed by a benefit to the recipient. The term "pharmaceutically acceptable carrier" means a pharmaceutically- acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting an agent from one portion of the body to another (e.g., from one organ to another). Each carrier present in a pharmaceutical composition must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the patient, or any deleterious effect must be outweighed by a benefit to the recipient. Some examples of materials which may serve as pharmaceutically acceptable carriers comprise: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide andaluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or polyanhydrides; and other nontoxic compatible substances employed in pharmaceutical formulations.
[0075] Treatment" or "treating" of a subject refers to any type of intervention or process performed on, or the administration of an active agent to, the subject with the objective of reversing, alleviating, ameliorating, inhibiting, slowing down or preventing the onset, progression, development, severity or recurrence of a symptom, complication or condition, or biochemical indicia associated with a disease. In one embodiment, "treatment" or "treating" includes a partial remission. In another embodiment, "treatment" or "treating" includes a complete remission. In some embodiments, treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and / or condition and / or of a subject who exhibits only early signs of the disease, disorder, and / or condition. In some embodiments, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and / or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and / or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and / or condition.
[0076] A "disease", as used herein, is a state of health of a subject wherein the subject cannot maintain homeostasis, and wherein if the disease is not ameliorated, the subject's health continues to deteriorate. In contrast, a "disorder" is a state of health in which the subject is able to maintain homeostasis, but in which the subject's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the subject's state of health. A disease or disorder is "alleviated" if the severity of a sign or symptom of the disease or disorder, the frequency with which such a sign or symptom is experienced by a subject, or both, is reduced.
[0077] As used herein, the terms “subject”, “individual”, and “patient” are interchangeable, and relate to vertebrates, preferably mammals. For example, mammals in the context of the disclosure are humans, non-human primates, domesticated animals such as dogs, cats, sheep, cattle, goats, pigs, horses, etc., laboratory animals such as mice, rats, rabbits, guinea pigs, etc., as well as animals in captivity such as animals in zoos. The term "animal" as used herein includeshumans. The term "subject" may also include a patient, i.e., an animal, having a disease. In exemplary aspects, a subject, individual, or patient refers to a human (e.g., a man, a woman, or a child).
[0078] As used herein, the term “preventing a disease” in a subject means, for example, to stop the development of one or more clinical symptoms of a disease or disorder in a subject before they occur or are detectable. Preferably, the disease or disorder does not develop at all, i.e., no symptoms of the disease or disorder are detectable. In some aspects, it can also mean delaying or slowing of the development of one or more symptoms of the disease or disorder. Alternatively, or in addition, it can mean decreasing the severity of one or more subsequently developed symptoms.
[0079] The invention is defined in the claims. However, below is a non-exhaustive listing of non-limiting exemplary aspects. Any one or more of the features of these aspects may be combined with any one or more features of another example, embodiment, or aspect described herein.
[0080] III. Stabilizing Agents
[0081] Lipid nanoparticles including liposomes, cubosomes, hexosomes, solid lipid nanoparticles, and nanostructured lipid carriers can require steric stabilizers to maintain colloidal stability in an aqueous medium and improve pharmacokinetics and biodistribution profiles. One indication of colloidal stability is the polydispersion index (PDI), which needs to be sufficiently low such that aggregation of the nanoparticles does not occur. A high PDI would indicate a decrease in the stability and viability of the nanoparticles over time.
[0082] Currently, polyethylene glycol (PEG)-lipid conjugates are the most commonly employed stabilizers in these systems. However, this PEGylated class of stabilizers can elicit an undesirable immunogenic response and impede cell interactions with nanoparticles containing a PEG layer. Surprisingly, the new class of stabilizers having a polyglycerol group that the inventors developed have favorable profiles (e.g., size, poly dispersion index values, organ selectivity, and encapsulation efficiency) as described herein without eliciting the same immunogenic response and without impeding cell interactions compared to PEGylated stabilizers.
[0083] Methods for generating these polyglycerol stabilizers are described herein. The polyglycerol stabilizers have the general structure of either formula (I) or formula (II):wherein Ri is hydrogen, Ci-is substituted or unsubstituted heteroalkyl group, Cuis unsaturated heteroalkyl group, Ci-is heterocyclyl group, Cuis charged heteroalkyl group, Cuis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; R3 is hydrogen, a targeting ligand, a hydrophilic group, an amphiphilic group, or a combination thereof; A is a Ci- C50 substituted or unsubstituted heteroalkyl group, a C1-C50 unsaturated heteroalkyl group, or a combination thereof; and m is an integer from 5 to 1000.wherein Y is hydrogen, methyl, C1-24 substituted or unsubstituted heteroalkyl group, Ci-is unsaturated heteroalkyl group, C1-24 heterocyclyl group, Cuis charged heteroalkyl group, Cuis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 heterocyclyl group, C1-C50 charged heteroalkyl group, C1-C50 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 600.
[0084] IV. Lipid Nanoparticle Compositions
[0085] In an aspect of the invention, the lipid nanoparticle composition comprises (a) an ionizable lipid; (b) two or more lipids; and (c) a stabilizing agent of formula (I):wherein Ri is hydrogen, Ci-is substituted or unsubstituted heteroalkyl group, Cuis unsaturated heteroalkyl group, Ci-is heterocyclyl group, Cuis charged heteroalkyl group, Cuis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; R3 is hydrogen, a targeting ligand, a hydrophilic group, an amphiphilic group, or a combination thereof; A is a Ci- C50 substituted or unsubstituted heteroalkyl group, a C1-C50 unsaturated heteroalkyl group, or a combination thereof; and m is an integer from 5 to 1000.
[0086] In some embodiments, Ri is hydrogen, C1-5 substituted or unsubstituted heteroalkyl group, C1-5 unsaturated heteroalkyl group, C1-5 heterocyclyl group, C1-5 charged heteroalkyl group, C1-5 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and m is an integer from 5 to 80. In some embodiments, A is a C36 substituted or unsubstituted heteroalkyl group, a C36 unsaturated heteroalkyl group, or a combination thereof.
[0087] In an aspect of the invention, the lipid nanoparticle composition consists essentially of: (a) an ionizable lipid; (b) two or more lipids; and (c) a stabilizing agent of formula (I):
[0088] "Consisting essentially of is meant to include any elements listed after the phrase, and may include other additional elements limited to those that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase "consisting essentially of indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present depending upon whether or not they materially affect the activity or action of the listed elements.
[0089] In another aspect, the invention provides a lipid nanoparticle composition comprising: (a) an ionizable lipid; (b) two or more lipids; and (c) a stabilizing agent of formula (II):Wherein Y is hydrogen, methyl, C1-24 substituted or unsubstituted heteroalkyl group, C1-18 unsaturated heteroalkyl group, C1-24 heterocyclyl group, Cuis charged heteroalkyl group, Cuis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; Xi, X2,X3, X4, X5 and Xe are each independently hydrogen, C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 heterocyclyl group, C1-C50 charged heteroalkyl group, C1-C50 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 600.
[0090] In some embodiments, Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C1-C35 substituted or unsubstituted heteroalkyl group, C1-C35 unsaturated heteroalkyl group, Ci- C35 heterocyclyl group, C1-C35 charged heteroalkyl group, C1-C35 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 90. In some embodiments, Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C35 substituted or unsubstituted heteroalkyl group, C35 unsaturated heteroalkyl group, C35 heterocyclyl group, C35 charged heteroalkyl group, C35 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof.
[0091] In an aspect of the invention, the lipid nanoparticle composition consists essentially of: (a) an ionizable lipid; (b) two or more lipids; and (c) a stabilizing agent of formula (II):
[0092] As used herein, the term “targeting ligand” can be in the form of a moiety capable of specifically binding to a molecule on the surface of a target cell, such as a cell within a target tissue of interest. In certain embodiments, the targeting ligand is a peptide, antibody, sugar, oligosaccharide, aminoglycoside, sterol, phenyl boronic acid, or a combination thereof.
[0093] In some embodiments of the invention, the hydrophilic group can be in the form of a molecule with a water soluble portion that can either carry a formal charge, ionic, or can be neutral, non-ionic.
[0094] In some embodiments of the invention, the ionizable group can be in the form of a molecule which, either by its intrinsic chemical nature, or as a function of the medium and / or of the pH of the medium in which it is present, may be in ionic form.
[0095] In some embodiments of the invention, the amphiphilic group can be in the form of a molecule that possesses both hydrophilic and hydrophobic properties.
[0096] As used herein, the term “alkyl group” or “alkyl” can be in the form of a branched, straight-chained (linear), or cyclic hydrocarbon group, having the specified number of carbon atoms, usually from 1 to about 18 or from 1 to about 35 carbon atoms. Exemplary alkyls include, but are not limited to, methyl, ethyl, n- propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, iso-amyl, hexyl, octyl cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclooctyl, and the like. In some embodiments, the alkyl may be substituted. Substituted alkyls are alkyls in which at least one hydrogen atom of the alkyl has been substituted with at least a nonhydrogen group, such as a hydrocarbyl group, a heteroatom, or a heteroatom containing group, such as halogen (such as Br, Cl, F or I) or at least one functional group such as -NR*2, -OR*, - SeR*, -TeR*, -PR*2, -AsR*2, -SbR*2, -SR*, -BR*2, -SiR*, -SiR*3, -GeR*, -GeR*3, -SnR*, - SnR*3, -PbR*3, and the like, where each R* is independently a hydrocarbyl or halocarbyl radical, and two or more R* may join together to form a substituted or unsubstituted saturated, partially unsaturated or aromatic cyclic or polycyclic ring structure, or where at least one heteroatom has been inserted within a hydrocarbyl ring.
[0097] The term "branched alkyl" means that the alkyl group contains a tertiary or quaternary carbon (a tertiary carbon is a carbon atom hound to three other carbon atoms. A quaternary carbon is a carbon atom bound to four other carbon atoms). For example, 3,5,5 trimethylhexylphenyl is an alkyl group (hexyl) having three methyl branches (hence, one tertiaryand one quaternary carbon) and thus is a branched alkyl bound to a phenyl group. Unless otherwise indicated a branched alkyl includes all isomers thereof.
[0098] As used herein, the term “heteroalkyl group” or “heteroalkyl” can be in the form of an alkyl group described herein further in which one or more of the carbon atoms (and any associated hydrogen atoms) are each independently replaced with the same or different heteroatom or heteroatomic group.
[0099] For example, heteroalkyl may include 1, 2, 3, 4, 5, or 6 heteroatomic groups, e.g., 1 heteroatomic group. Heteroatoms include, but are not limited to, N, P, O, S, etc, and combinations thereof. Heteroatomic groups include, but are not limited to, -NR-, - O-, -S-, -PH-, -P(O)2-, -S(O)-, -S(O)2-, and the like, where R is H, alkyl, aryl, cycloalkyl, heteroalkyl, heteroaryl or cycloheteroalkyl. The term "heteroalkyl" includes heterocycloalkyl (a cyclic heteroalkyl group), alkyl-heterocycloalkyl (a linear or branched aliphatic group attached to a cyclic heteroalkyl group), and the like. Heteroalkyl groups include, but are not limited to, - OCH3, -CH2OCH3, -SCH3, - CH2SCH3, -NRCH3, -CH2NRCH3, and the like, where R is hydrogen, alkyl, aryl, arylalkyl, heteroalkyl, or heteroaryl, each of which may be optionally substituted. A heteroalkyl group comprises from 1 to about 10 carbon and hetero atoms, e.g., from 1 to 6 carbon and hetero atoms.
[0100] As used herein, the term “cycloalkyl group” or “cycloalkyl” is a subset of “alkyl” and may be in the form of a saturated partially saturated cyclic group of from 3 to about 10 carbon atoms and no ring heteroatoms and having a single ring or multiple rings including fused, bridged, and spiro ring systems, having the specified number of carbon atoms, usually from 1 to about 18 or from 1 to about 35 carbon atoms. For multiple ring systems having aromatic and non-aromatic rings that have no ring heteroatoms, the term "cycloalkyl" applies when the point of attachment is at a non-aromatic carbon atom (e.g., 5, 6, 7, 8-tetrahydronaphthalene-5-yl). The term "cycloalkyl" includes cycloalkenyl groups. Examples of cycloalkyl groups include, for instance, adamantyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and cyclohexenyl.
[0101] As used herein, the term “heterocyclyl group” can be in the form of a cycloalkyl group, described herein, containing from 1 to about 6 heteroatoms chosen from N, O, S, or combinations thereof with remaining ring atoms being about 3 carbon to about 8 carbon atoms. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl. A heterocyclic ring is a ring having a heteroatom in the ring structure as opposed to a heteroatomsubstituted ring where a hydrogen on a ring atom is replaced with a heteroatom. For example, tetrahydrofuran is a heterocyclic ring and 4-N,N-dimethylamino-phenyl is a heteroatom substituted ring.
[0102] Substituted heterocyclic means a heterocyclic group where at least one hydrogen atom of the heterocyclic radical has been substituted with at least a non-hydrogen group, such as a hydrocarbyl group, a heteroatom, or a heteroatom containing group, such as halogen (such as Br, Cl, F or I) or at least one functional group such as -NR*2, -OR*, -SeR*, -TeR*, -PR*2, - ASR*2, -SbR*2, -SR*, -BR*2, -SiR*, -SiR*3, -GeR*, -GeR*3, -SnR*, -SnR*3, -PbR*3, and the like, where each R* is independently a hydrocarbyl or halocarbyl radical.
[0103] In some embodiments, A is
[0104] In some embodiments, R3 is hydrogen, a peptide, an antibody, a sugar, an oligosaccharide, an aminoglycoside, a sterol, phenyl boronic acid, or a combination thereof.
[0105] In some embodiments, the lipid nanoparticle composition comprises two or more lipids comprising a structural lipid, a sterol, or a combination thereof.
[0106] Any suitable ionizable lipid can be present in the lipid nanoparticle composition and lipid nanoparticle. An ionizable lipid is a lipid that is cationic or becomes ionizable (protonated) as the pH is lowered below the pKa of the ionizable group of the lipid, but is more neutral at higher pH values. At pH values below the pKa, the lipid is able to associate with negatively charged nucleic acids (e.g., oligonucleotides). Ionizable lipid includes lipids that assume a positive charge on pH decrease from physiological pH, or lipids that carry a net positive charge at a selective pH.
[0107] In some embodiments, the lipid nanoparticle composition or lipid nanoparticle comprise one or more ionizable lipids, e.g., two or more ionizable lipids, three or more ionizable lipids, or four or more ionizable lipids. In some embodiments, the ionizable lipid is DODMA (l,2-dioleyloxy-3 -dimethylaminopropane), DLin-MC3-DMA (O-(Z,Z,Z,Z-heptatriaconta- 6,9,26,29-tetraen-19-yl)-4-(N,N-dimethylamino)), DLin-KC2-DMA (2-dilinoleyl-4- dimethylaminoethyl- [l,3]-dioxolane), BOCHD-C3-DMA (4-(dimethylamino)-,9-(2-octylcyclopropyl)- 1-[8-(2 octylcyclopropyl) octyl]nonyl ester), C12-200 (1 , 1 '-[[2-[4-[2-[[2- [Z>z 2-hydroxydodecyl)amino]ethyl](2-hydroxydodecyl)amino]ethyl]-l- piperazinyl]ethyl]imino] / v.s-2-dodecanol), PNI 516 (Z)-3-(2-((l,17-bis(2- octylcyclopropyl)heptadecan-9-yl)oxy)-2-oxoethyl)-2-(pent-2-en- 1 -yl)cy clopentyl 4- (dimethylamino)butanoate, PNI 127 (2R,3S,4R)-2-(((l,4-dimethylpiperidine-4- carbonyl)oxy)methyl)tetrahydrofuran-3,4-diyl (9E,9'E, 12E, 12'E)-bis(octadeca-9, 12-di enoate), PNI 550 3-(2-((l,17-bis(2-octylcyclopropyl)heptadecan-9-yl)oxy)-2-oxoethyl)cyclopentyl 4- (dimethylamino)butanoate, PNI 580 (2S,3R,4R)-2-(((4-(dimethylamino)butanoyl) oxy)methyl)tetrahydrofuran-3,4-diyl bis(2-hexyldecanoate), PNI 659 ((2R,3R,4S)-3,4-bis((2- hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4-(dimethylamino)butanoate, PNI 728 ((2R,3R,4S)- 3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 2-(dimethylamino)ethyl)carbamate, PNI 762 ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl (2- (diethylamino)ethyl)carbamate, or a combination thereof. In some embodiments, the ionizable lipid is PNI 516, PNI 127, PNI 550, PNI 580, PNI 659, PNI 728, PNI 762, or a combination thereof.
[0108] The ionizable lipid can be present in the lipid nanoparticle composition or lipid nanoparticle in any suitable amount or concentration. In some embodiments, the ionizable lipid is present at a concentration of about 20 to about 70 mol%, e.g., about 20 mol%, about 25 mol%, about 30 mol%, about 35 mol%, about 40 mol%, about 45 mol%, about 50 mol%, about 55 mol%, about 60 mol%, about 65 mol%, or about 70 mol%, or a concentration within a range defined by any two of the foregoing values. In some cases, the ionizable lipid is present at a concentration of more than about 10 mol%, more than about 12 mol%, more than about 14 mol%, more than about 16 mol%, more than about 18 mol%, more than about 20 mol%, more than about 22 mol%, more than about 24 mol%, more than about 26 mol%, more than about 28 mol%, or more than about 30 mol%. In some cases, the ionizable lipid is present at a concentration of less than about 80 mol%, less than about 78 mol%, less than about 76 mol%, less than about 74 mol%, less than about 72 mol%, less than about 70 mol%, less than about 68 mol%, less than about 66 mol%, less than about 64 mol%, less than about 62 mol%, less than about 60 mol%, less than about 58 mol%, less than about 56 mol%, less than about 54 mol%, less than about 52 mol%, or less than about 50 mol%.
[0109] In some embodiments, the lipid nanoparticle composition comprises a structural lipid. Any suitable structural lipid can be present in the lipid nanoparticle composition and lipid nanoparticle. A structural lipid, or phospholipid, supports the formation of particles during manufacture. In various embodiments, the structural lipid includes one or more neutrally charged, positively charged, or negatively charged molecules. In some embodiments, the structural lipid has a net negative charge. In some embodiments, the structural lipid has a net neutral charge. In some embodiments, the structural lipid has a net positive charge.
[0110] In some embodiments, the lipid nanoparticle composition or lipid nanoparticle comprise one or more structural lipids, e.g., two or more structural lipids, three or more structural lipids, or four or more structural lipids. In some embodiments, the structural lipid comprises diacylphosphatidylcholines, diacylphosphatidylethanolamines, diacylphosphatidylglycerols, ceramides, sphingomyelins, dihydrosphingomyelins, cephalins, cerebrosides, or a combination thereof. In some embodiments, the structural lipid is distearoylphosphatidylcholine, dioleoylphosphatidylcholine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylethanolamine, palmitoyloleoylphosphatidylcholine, 1 -stearoyl -2-oleoyl-sn-gly cero- 3 -phosphocholine, palmitoyloleoyl-phosphatidylethanolamine, di oleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l -carboxylate, dipalmitoyl phosphatidyl ethanolamine, dimyristoylphosphoethanolamine, distearoylphosphatidylethanolamine, 1 ,2-dipalmitoyl-sn-glycero-3 -phosphoethanolamine-N-m ethyl, 1 ,2- dipalmitoyl-sn-glycero-3-phosphoethanolamine-N,N-dimethyl, l,2-dielaidoyl-sn-glycero-3- phosphoethanolamine, 1 -stearoyl -2-oleoyl -phosphatidy ethanol amine, 1,2-dielaidoyl-sn-glycero- 3-phophoethanolamine, distearoylphosphatidylcholine, or a combination thereof.
[0111] In some embodiments, the structural lipid comprises any suitable lipid that is negatively charged (anionic) at physiological pH. In certain embodiments, the structural lipid comprises dioleoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, palmitoyloleyolphosphatidylglycerol, cardiolipin, phosphatidylinositol, diacylphosphatidylserine, diacylphosphatidic acid, monosial oganglioside GM1, or a combination thereof. In some embodiments, the structural lipid is distearoylphosphatidylcholine.
[0112] The structural lipid can be present in the lipid nanoparticle composition in any suitable amount. In some embodiments the structural lipid is present in the lipid nanoparticle composition at a concentration of about 1 to about 25 mol%, e.g., about 1 mol%, about 2 mol %,about 3 mol %, about 4 mol%, about 5 mol%, about 6 mol%, about 7 mol%, about 8 mol%, about 9 mol%, about 10 mol%, about 11 mol%, about 12 mol%, about 13 mol%, about 14 mol%, about 15 mol%, about 16 mol%, about 17 mol%, about 18 mol%, about 19 mol%, about 20 mol%, about 21 mol%, about 22 mol%, about 23 mol%, about 24 mol%, or about 25 mol%, or a concentration within a range defined by any two of the aforementioned values. In some cases, the structural lipid is present in the lipid nanoparticle composition at a concentration of less than about 1 mol %. In some cases, the structural lipid is present in the lipid nanoparticle composition at a concentration of more than about 20 mol %, more than about 21 mol %, more than about 22 mol %, more than about 23 mol %, more than about 24 mol %, more than about 25 mol %, more than about 26 mol %, more than about 27 mol %, more than about 28 mol %, more than about 29 mol %, more than about 30 mol %, more than about 31 mol %, more than about 32 mol %, more than about 33 mol %, more than about 34 mol %, or more than about 35 mol %.
[0113] In some embodiments, the lipid nanoparticle composition comprises a sterol. Any suitable sterol can be present in the lipid nanoparticle composition. In some embodiments, the lipid nanoparticle composition comprises one or more sterols, e.g., two or more sterols, three or more sterols, or four or more sterols. In some embodiments, the sterol is cholesterol, betasitosterol, 20-alpha-hydroxysterol, phytosterol, or a combination thereof. In some embodiments the sterol is cholesterol.
[0114] The sterol can be present in the lipid nanoparticle composition in any suitable amount. In some embodiments the sterol is present in the lipid nanoparticle composition a concentration of about 28 to about 50 mol%, e.g., about 28 mol%, about 29 mol%, about 30 mol%, about 31 mol%, about 32 mol%, about 33 mol%, about 34 mol%, about 35 mol%, about 36 mol%, about 37 mol%, about 38 mol%, about 39 mol%, about 40 mol%, about 41 mol%, about 42 mol%, about 43 mol%, about 44 mol%, about 45 mol%, about 46 mol%, about 47 mol%, about 48 mol%, about 49 mol%, or about 50 mol%, or a concentration within a range defined by any two of the aforementioned values. In some cases, the sterol is present at a concentration of more than about 18 mol%, more than about 20 mol%, more than about 22 mol%, more than about 24 mol%, more than about 26 mol%, more than about 28 mol%, or more than about 30 mol%. In some cases, the sterol is present at a concentration of less than about 60 mol%, less than about 58 mol%, less than about 56 mol%, less than about 54 mol%, less than about 52 mol%, less than about 50 mol%, less than about 48 mol%, less than about 46 mol%,less than about 44 mol%, less than about 42 mol%, less than about 40 mol%, less than about 38 mol%, less than about 36 mol%, less than about 34 mol%, less than about 32 mol%, or less than about 30 mol%.
[0115] In some embodiments, the lipid nanoparticle composition comprises one or more stabilizing agents, e.g., two or more stabilizing agents, three or more stabilizing agents, or four or more stabilizing agents.
[0116] Any suitable stabilizing agent can be used in the lipid nanoparticle composition. In some embodiments the stabilizing agent is SAF06, SAF10, SAFI 5, SAFI 9, SAF25, SAF89, SAF92, SAF93, SAF97, SAF98, SAF128, SAF182, SAF183, SAF184, or a combination thereof.Table 1 provides the structures of selected stabilizing agents.Table 1
[0117] The stabilizing agent can have any suitable molecular weight. In some embodiments, the stabilizing agent has a molecular weight of about 500 to about 50000 Da, e.g., about 500 Da, about 600 Da, about 700 Da, about 800 Da, about 900 Da, about 1000 Da, about 2000 Da, about 4000 Da, about 6000 Da, about 8000 Da, about 10000 Da, about 12000 Da, about 14000 Da, about 16000 Da, about 18000 Da, about 20000 Da, about 22000 Da, about 24000 Da, about 26000 Da, about 28000 Da, about 30000 Da, about 32000 Da, about 34000 Da, about 36000 Da,about 38000 Da, about 40000 Da, about 42000 Da, about 44000 Da, about 46000 Da, about 48000 Da, or about 50000 Da, or a molecular weight defined by the range of any two of the foregoing values. In some cases, the stabilizing agent has a molecular weight of less than about 1000 Da. In some cases, the stabilizing agent has a molecular weight of more than about 1000 Da, about 2000 Da, about 4000 Da, about 6000 Da, about 8000 Da, or about 10000 Da. In some cases, the stabilizing agent has a molecular weight of less than about 60000 Da, about 58000 Da, about 56000 Da, about 54000 Da, about 52000 Da, about 50000 Da, about 48000 Da, about 46000 Da, about 44000 Da, about 42000 Da, or about 40000 Da.
[0118] The stabilizing agent can be present in any suitable concentration. In some cases, the stabilizing agent has a concentration from about 0.1 mol% to about 10 mol%, e.g., about 0.1 mol%, about 0.2 mol%, about 0.3 mol%, about 0.4 mol%, about 0.5 mol%, about 0.6 mol%, about 0.7 mol%, about 0.8 mol%, about 0.9 mol%, about 1 mol%, about 1.2 mol%, about 1.4 mol%, about 1.6 mol%, about 1.8 mol%, about 2 mol%, about 2.5 mol%, about 3 mol%, about3.5 mol%, about 4 mol%, about 4.5 mol%, about 5 mol%, about 5.5 mol%, about 6 mol%, about6.5 mol%, about 7 mol%, about 7.5 mol%, about 8 mol%, about 8.5 mol%, about 3 mol%, about 9 mol%, about 9.5 mol%, about 10 mol%, or a concentration defined by a range of any two of the foregoing values. In some cases, the stabilizing agent has a concentration of more than about 0.02 mol%, more than about 0.04 mol%, more than about 0.06 mol%, more than about 0.08 mol%, more than about 0.1 mol%, more than about 0.2 mol%, more than about 0.3 mol%, more than about 0.4 mol%, more than about 0.5 mol%, more than about 0.6 mol%, more than about 0.7 mol%, more than about 0.8 mol%, more than about 0.9 mol%, or more than about 1.0 mol%. In some cases, the stabilizing agent has a concentration of less than about 20 mol%, less than about 18 mol%, less than about 16 mol%, less than about 14 mol%, less than about 12 mol%, less than about 10 mol%, less than about 9 mol%, less than about 8 mol%, less than about 7 mol%, less than about 6 mol%, less than about 5 mol%, less than about 4 mol%, or less than about 3 mol%.
[0119] In some embodiments, the lipid nanoparticle composition comprises about 20 to about 70 mol% ionizable lipid, about 1 to about 25 mol% structural lipid, about 28 to about 50 mol% sterol, and about 0.1 to about 5 mol% stabilizing agent. In certain embodiments the lipid nanoparticle composition comprises about 47.5 mol% ionizable lipid, about 12.5 mol% structural lipid, about 38.5 mol% sterol, and about 1.5 mol% stabilizing agent. In some embodiments, thelipid nanoparticle composition comprises about 40 mol% ionizable lipid, about 12.5 mol% structural lipid, about 46 mol% sterol, and about 1.5 mol% stabilizing agent. In some embodiments, the lipid nanoparticle composition comprises about 40 mol% ionizable lipid, about 12.5 mol% structural lipid, about 46 mol% sterol, and about 1.5 mol% stabilizing agent.
[0120] In some embodiments, the lipid nanoparticle composition is used in the formation of a lipid nanoparticle in embodiments of the methods described herein. In some embodiments, the diameter of the lipid nanoparticle is about 15 nm to about 500 nm, e.g., about 15 nm, about 25 nm, about 50 nm, about 75 nm, about 100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, or about 500 nm, or a diameter defined by a range of any two of the foregoing values. Such diameters can be useful for improving the tissue targeting and biodistribution of the lipid nanoparticles. In some cases, the diameter of the lipid nanoparticle is more than about 10 nm, more than about 15 nm, more than about 20 nm, more than about 25 nm, more than about 30 nm, more than about 35 nm, more than about 40 nm, or more than about 45 nm. In some cases, the diameter of the lipid nanoparticle is less than about 700 nm, less than about 675 nm, less than about 650 nm, less than about 625 nm, less than about 600 nm, less than about 575 nm, less than about 550 nm, less than about 525 nm, less than about 500 nm, less than about 475 nm, less than about 450 nm, less than about 425 nm, less than about 400 nm, less than about 375 nm, less than about 350 nm, less than about 325 nm, or less than about 300 nm.
[0121] Embodiments of the lipid nanoparticle described herein can have any suitable poly dispersity index. In some embodiments, the lipid nanoparticle has a poly dispersity index of from about 0.01 to about 0.40, e.g., about 0.01, about 0.02, about 0.03, about 0.04, about 0.05, about 0.06, about 0.07, about 0.08, about 0.09, about 0.10, about 0.11, about 0.12, about 0.13, about 0.14, about 0.15 about 0.16, about 0.17, about 0.18, about 0.19, about 0.20, about 0.21, about 0.22, about 0.23, about 0.24, about 0.25, about 0.26, about 0.27, about 0.28, about 0.29, about 0.30, about 0.31, about 0.32, about 0.33, about 0.34, about 0.35, about 0.36, about 0.37, about 0.38, about 0.39, or about 0.40, or poly dispersity index defined by a range of any two of the foregoing values.
[0122] Embodiments of the lipid nanoparticle described herein can have any suitable encapsulation efficiency. Encapsulation efficiency refers to the percentage of nucleic acid that issuccessfully entrapped into the lipid nanoparticle. In some embodiments, the lipid nanoparticle has an encapsulation efficiency from about 50% to about 100%, e.g., about 50%, about 52%, about 54%, about 56%, about 58%, about 60%, about 62%, about 64%, about 66%, about 68%, about 70%, about 72%, about 74%, about 76%, about 78%, about 80%, about 82%, about 84%, about 86%, about 88%, about 90%, about 92%, about 94%, about 96%, about 98%, or about100%, or an encapsulation efficiency defined by a range of any two of the foregoing values.
[0123] The invention also provides a method for preparing embodiments of the lipid nanoparticle as described herein comprising (a) forming the lipid nanoparticle composition by combining prescribed amounts of ionizable lipid, structural lipid, sterol and stabilizing agent; (b) preparing the lipid nanoparticle by combining the lipid nanoparticle composition and the nucleic acid using a microfluidic mixer; and (c) purifying the lipid nanoparticle.
[0124] Any suitable method of mixing can be used to combine the prescribed amounts of ionizable lipid, structural lipid, sterol, stabilizing agent, and nucleic acid. Any suitable method can be used to combine the prescribed amounts of ionizable lipid, structural lipid, sterol, and stabilizing agent. In some embodiments, the ionizable lipid, structural lipid, sterol, and stabilizing agent are combined by mixing. In some embodiments, the mixing is done using a microfluidic mixer. In some embodiments, the prescribed amounts of ionizable lipid, structural lipid, sterol, and stabilizing agent are as described herein. In some embodiments, the ionizable lipid, structural lipid, sterol, stabilizing agent, and nucleic acid are combined by standard T-tube mixing techniques, turbulent mixing, titration mixing, agitation promoting ordered selfassembly, or passive mixing of all the elements with self-assembly of elements into nanoparticles. A variety of methods have been developed to formulate lipid nanoparticles containing genetic drugs.
[0125] In some embodiments, microfluidic mixing devices, which can involve mixing two or more types of fluids together uniformly in a microfluidic chip, such as the NanoAssemblr® Spark™, NanoAssemblr® Ignite™, NanoAssemblr® Blaze™, NanoAssemblr® GMP system, and NanoAssemblr® commercial formulation system are used. In some embodiments, the lipid nanoparticles formed by using a microfluidic mixing device has an encapsulation efficiency from about 90 to about 100%.
[0126] Any suitable method can be used to combine the lipid nanoparticle composition and the nucleic acid. In some embodiments, the lipid nanoparticle composition and the nucleic acidare combined by mixing. In some embodiments, the mixing is done using a microfluidic mixer. In some embodiments, the microfluidic mixer comprises a first and second stream of reagents, which feed into the microfluidic mixer, and lipid nanoparticles are collected from the outlet.
[0127] In some embodiments, the first stream includes a payload in a first solvent. In some embodiments, the payload may include a nucleic acid. In some cases, the payload may include a therapeutic agent. The combination of the payload in a first solvent can be described as the aqueous phase. Any suitable first solvent can be used. Suitable first solvents include solvents in which the payload is soluble and that are miscible with the second solvent. In some embodiments, the first solvent comprises aqueous buffers. In some embodiments, the aqueous buffer is a low pH buffer. In some embodiments, the low pH buffer is a citrate or acetate buffer.
[0128] In some embodiments, the second stream includes embodiments of the lipid nanoparticle composition as described herein in a second solvent. The combination of the lipid nanoparticle composition and the second solvent can be described as the organic phase. Any suitable second solvent can be used. Suitable second solvents include solvents in which the ionizable lipids according to embodiments of the invention are soluble, and that are miscible with the first solvent. In some embodiments, the second solvent comprises one or more solvents, two or more solvents, three or more solvents, or four or more solvents. In some embodiments, the second solvent comprises 1,4-di oxane, tetrahydrofuran, acetone, acetonitrile, dimethyl sulfoxide, dimethylformamide, acids, alcohols, or a combination thereof. In some embodiments, the second solvent comprises aqueous or anhydrous alcohols. In some cases, the alcohol is a primary, secondary, or tertiary alcohol having from 1 to 12 branched or unbranched carbons (e.g., methanol, ethanol, n-propanol, isopropanol, n-butanol, 2-methyl 1 -propanol, 2-butanol, 2- methylpropan-2-ol).
[0129] In some embodiments, a suitable device for mixing includes one or more microchannels (i.e., a channel having its greatest dimension less than 1 millimeter). In some embodiments, the microchannel has a diameter from about 20 to about 300 pm. In some embodiments, at least one region of the microchannel has a principal flow direction and one or more surfaces having at least one groove or protrusion defined therein, the groove or protrusion having an orientation that forms an angle with the principal direction (e.g., a staggered herringbone mixer) or a bifurcating toroidal flow mixer. To achieve maximal mixing rates, it is advantageous to avoid undue fluidic resistance prior to the mixing region. In some embodiments,a device has non-microfluidic channels having dimensions greater than 1000 gm, to deliver the fluids to a single mixing channel.
[0130] Any suitable flow ratio can be used to combine the lipid nanoparticle composition and the nucleic acid. In some embodiments, the lipid nanoparticle composition and the nucleic acid are combined using a flow ratio of about 1 : 1 (or 1) to about 10: 1 (or 10) (aqueous phase: organic phase) by volume, e.g., about 1, about 2, about 3, about 4, about 5, about 6, or about 7, about 8, about 9, about 10, or a flow ratio defined by a range of any two of the aforementioned values. In some cases, the flow ratio is more than about 0.5. In some cases, the flow ratio is less than about 20, less than about 18, less than about 16, less than about 14, less than about 12, less than about 10, or less than about 8. Any suitable N / P ratio can be used to combine the lipid nanoparticle composition and the nucleic acid. The N / P ratio is the ratio of positively-chargeable polymer amine (N = nitrogen) groups to negatively-charged nucleic acid phosphate (P) groups. In some embodiments, the lipid nanoparticle composition and the nucleic acid are combined at a N / P ratio from about 2 to about 20, e.g., about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20, or at an N / P ratio defined by a range of any two of the aforementioned values. In some case, the N / P ratio is more than about 1, more than about 2, more than about 3, more than about 4, more than about 5, more than about 6, more than about 7, more than about 8, or more than about 9. In some case, the N / P ratio is less than about 40, less than about 38, less than about 36, less than about 34, less than about 32, less than about 30, less than about 28, less than about 26, less than about 24, less than about 22, less than about 20, less than about 18, less than about 16 , less than about 14, less than about 12, or less than about 10. Any suitable total flow rate can be used to combine the lipid nanoparticle composition and the nucleic acid. In some embodiments, the lipid nanoparticle composition and the nucleic acid are combined with a total flow rate of the organic phase and aqueous phase from about 2 to about 2000 mL / min, e.g., about 2 mL / min, about 4 mL / min, about 6 mL / min, about 8 mL / min, about 10 mL / min, about 20 mL / min, about 40 mL / min, about 60 mL / min, about 80 mL / min, or about 100 mL / min, about 120 mL / min, about 140 mL / min, about 160 mL / min, about 180 mL / min, about 200 mL / min, about 220 mL / min, about 240 mL / min, about 260 mL / min, about 280 mL / min, about 300 mL / min, about 350 mL / min, about 400 mL / min, about 450 mL / min, or about 500 mL / min, about 550 mL / min, about 600 mL / min, about 650 mL / min, about 700 mL / min,about 750 mL / min, about 800 mL / min, about 850 mL / min, or about 900 mL / min, about 950 mL / min, about 1000 mL / min, about 1100 mL / min, about 1200 mL / min, about 1300 mL / min, about 1400 mL / min, about 1500 mL / min, about 1600 mL / min, about 1700 mL / min, about 1800 mL / min, about 1900 mL / min, about 2000 mL / min, or a total flow rate defined by a range of any two of the foregoing values. In some cases, the total flow rate is more than about 1 mL / min, 2 mL / min, 4 mL / min, 6 mL / min, 8 mL / min, 10 mL / min, 20 mL / min, or 40 mL / min. In some case, the total flow rate is less than about 3000 mL / min, less than about 2800 mL / min, less than about 2600 mL / min, less than about 2400 mL / min, less than about 2200 mL / min, less than about 2100 mL / min, less than about 2000 mL / min, less than about 1800 mL / min, less than about 1600 mL / min, less than about 1500 mL / min, less than about 1400 mL / min, less than about 1200 mL / min, less than about 1000 mL / min, or less than about 800 mL / min, In some embodiments, the lipid nanoparticle composition and the nucleic acid are combined using a flow ratio from about 1 : 1 (or 1) to about 10: 1 (or 10) by volume (aqueous phase: organic phase) at aN / P ratio from about 2 to about 20, and a total flow rate from about 2 to about 2000 mL / min. In some embodiments, the flow rate is 3 (aqueous phase: organic phase) to optimize for a particular payload or molar ratio of lipid components.
[0131] Any suitable method of purifying the lipid nanoparticles can be used. In some embodiments, the purifying is done using a filter or a centrifuge.
[0132] V. Methods of Use
[0133] In some embodiments, a payload is encapsulated by an exemplary lipid nanoparticle composition. Any suitable payload can be present in the lipid nanoparticle composition. The payload may include a nucleic acid. In some cases, the payload may include a therapeutic agent. The nucleic acid may be a substance intended to have a direct effect in the diagnosis, cure, mitigation, treatment or prevention of disease, or to have direct effect in restoring, correcting or modifying physiological functions, or to act as a research reagent. Exemplary nucleic acids include any oligonucleotide or polynucleotide whose delivery into a cell causes a desirable effect. The nucleic acid can be single-stranded DNA or RNA, or double-stranded DNA or RNA, or DNA-RNA hybrids, or combinations thereof. In some embodiments, the lipid nanoparticle comprises one or more nucleic acids, two or more nucleic acids, three or more nucleic acids, or four or more nucleic acids. Including more than one nucleic acid may be beneficial in some embodiments (e.g., gene editing). In some embodiments, the nucleic acid is an antisenseoligonucleotide, a siRNA, a miRNA, a self-amplifying RNA (samRNA or saRNA), a selfreplicating DNA, an LNA, a DNA, a replicon, an mRNA, a guide RNA, a transposon, a single gene, a vector, a plasmid, a viral particle, an AAV, a complex of RNA and RNA-binding protein(s), or a combination thereof. In some embodiments, the nucleic acid is an antigen encoded mRNA.
[0134] In some embodiments, the lipid nanoparticle composition is a therapeutic composition, such as an mRNA-based therapeutic composition. The therapeutic composition may optionally include one or more therapeutically acceptable carriers, diluents, or excipients such as salts, buffering agents, preservatives, anti adherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes, emollients, emulsifiers, fillers, film formers or coatings, flavors, fragrances, glidants, lubricants, sorbents, suspending or dispersing agents, sweeteners, waters of hydration, and / or other therapeutic agents. As used herein, the term “excipient” means any pharmaceutically acceptable additive, carrier, diluent, adjuvant, or other ingredient, other than the active pharmaceutical ingredient (API) (and typically in addition to components of the delivery vehicle compositions), suitably selected with respect to the intended form of administration, and consistent with conventional pharmaceutical practices. The disclosed compounds can be administered to a subject or patient in a therapeutically effective amount. The complexes can be administered alone or as part of a pharmaceutically acceptable composition or formulation. In addition, the compositions can be administered all at once, as for example, by a bolus injection, multiple times, or delivered substantially uniformly over a period of time. It is also noted that the dose of the compound can be varied over time.
[0135] In some embodiments, the lipid nanoparticle composition may encapsulate an antigen encoded mRNA and be used as a vaccine. In some embodiments, the antigen encoded mRNA is for a prophylactic or therapeutic vaccine. A vaccine may be referred to as a substance used to stimulate the production of antibodies and provide immunity against one or several diseases, prepared from the causative agent of a disease, its products, or a synthetic substitute. The vaccine may further comprise one or more immunologic adjuvants. As used herein, the term "immunologic adjuvant" refers to a compound or a mixture of compounds that acts to accelerate, prolong, enhance or modify immune responses when used in conjugation with an immunogen (e.g., neoantigens). Adjuvant may be non-immunogenic when administered to a host alone, but that augments the host's immune response to another antigen when administered conjointly withthat antigen. Specifically, the terms "adjuvant" and "immunologic adjuvant" are used interchangeably in the present disclosure. Adjuvant-mediated enhancement and / or extension of the duration of the immune response can be assessed by any method known in the art including without limitation one or more of the following: (i) an increase in the number of antibodies produced in response to immunization with the adjuvant / antigen combination versus those produced in response to immunization with the antigen alone; (ii) an increase in the number of T cells recognizing the antigen or the adjuvant; and (iii) an increase in the level of one or more cytokines. Adjuvants may be aluminum based adjuvants including but not limiting to aluminum hydroxide and aluminum phosphate; saponins such as steroid saponins and triterpenoid saponins; bacterial flagellin and some cytokines such as GM-CSF. Adjuvants selection may depend on antigens, vaccines, and routes of administrations.
[0136] In some aspects, adjuvants improve the adaptive immune response to a vaccine antigen by modulating innate immunity or facilitating transport and presentation. Adjuvants act directly or indirectly on antigen presenting cells (APCs) including dendritic cells (DCs). Adjuvants may be ligands for toll-like receptors (TLRs) and can directly affect DCs to alter the strength, potency, speed, duration, bias, breadth, and scope of adaptive immunity. In other instances, adjuvants may signal via proinflammatory pathways and promote immune cell infiltration, antigen presentation, and effector cell maturation. This class of adjuvants includes mineral salts, oil emulsions, nanoparticles, and polyelectrolytes and comprises colloids and molecular assemblies exhibiting complex, heterogeneous structures. In one example, the composition further comprises pidotimod as an adjuvant. In another example, the composition further comprises CpG as an adjuvant.
[0137] In some cases, the lipid nanoparticle composition is used in gene therapy. Gene therapy is a medical technique that produces a therapeutic effect through the manipulation of gene expression or through altering the biological properties of cells. In some cases, a gene encoding a therapeutic protein for incorporation into the host’s DNA or a mRNA encoding the therapeutic protein is administered to treat a disease, where the disease is the result of a missing protein and / or missing activity of the protein. In some cases, a new gene or mRNA is supplied, which may enhance a cell’s function without modifying the genes that cause the disease. In other cases, an antisense oligonucleotide (ASO) or small interfering RNA (siRNA) is used as a therapeutic to silence the activity of a variant protein causing a disease.
[0138] Gene therapy can be performed on a somatic cell level or a germline cell level. Gene therapy can be performed ex vivo or in vivo. Gene therapy can be employed by various gene editing techniques (e.g., CRISPR, homologous recombination, zinc finger nucleases, TALEN).
[0139] In some cases, the nucleic acid is for incorporation into an immunogenic cell. In some cases, the immunogenic cell includes a T cell. In some embodiments, the immunogenic cell can be engineered to express a receptor to a specific antigen or neoantigen, engineered to enhance the immunogenic response or the immunogenic cell, and engineered to decrease proteins associated with an adverse response such as neurotoxicity (e.g., reduction of cytokines to ameliorate the effects of cytokine release syndrome). In some embodiments, the lipid nanoparticle is in an anhydrous form. In some embodiments, the lipid nanoparticle is in an anhydrous form consisting of a lyophilized cake. In some embodiments, the lipid nanoparticle is in a reconstituted form. In a reconstituted form, a lyophilized lipid nanoparticle may have a pharmaceutically acceptable carrier added to the lyophilized lipid nanoparticle.
[0140] In some embodiments, the lipid nanoparticle and the pharmaceutically acceptable carrier are a pharmaceutical composition. Examples of pharmaceutically acceptable carrier are provided herein.ABBREVIATIONS
[0141] A5 saRNA SARS Cov2: Self-amplified RNA encoding viral replicase genes in addition to the SARS Cov2 antigen gene(s)
[0142] C: Degrees Celsius
[0143] Cas9 mRNA: Cas9 messenger RNA from Trilink Biotechnologies (San Diego, CA; L-7606-1000 CleanCap Cas9 mRNA, Img)
[0144] Choi: cholesterol
[0145] EE: encapsulation efficiency
[0146] eGFP-mRNA: Enhanced green fluorescent protein mRNA derived from Aequorea Victoria
[0147] FLuc-mRNA: Firefly luciferase protein mRNA
[0148] H: Hour(s)
[0149] hEPO: Human erythropoietin
[0150] hEPO-mRNA: Human erythropoietin protein mRNA
[0151] HPLC: High performance liquid chromatography
[0152] iL: Ionizable Lipid
[0153] IM: intramuscular administration
[0154] IV: intravenous administration
[0155] KO: knock out
[0156] LNP: lipid nanoparticles
[0157] MFI: Median Fluorescence Intensity
[0158] Min: Minute(s)
[0159] mRNA: messenger RNA
[0160] N / P: nitrogen to phosphorous ratio
[0161] NALNP: nucleic acid containing lipid nanoparticles
[0162] NAT : Nucleic Acid Therapeutic
[0163] PBS: Phosphate buffered saline
[0164] PCSK9 gRNA: PCSK9 gene guide RNA
[0165] PDI: poly dispersity index
[0166] PNI 127: (2R,3S,4R)-2-(((l,4-dimethylpiperidine-4- carbonyl)oxy)methyl)tetrahydrofuran-3,4-diyl (9E,9'E, 12E, 12'E)-bis(octadeca-9, 12-di enoate)
[0167] PNI 516: (Z)-3-(2-((l,17-bis(2-octylcyclopropyl) heptadecan-9-yl) oxy)-2-oxoethyl)-2-(pent-2-en-l-yl)cyclopentyl 4-(dimethylamino)butanoate
[0168] PNI 550: 3-(2-((l,17-bis(2-octylcyclopropyl)heptadecan-9-yl)oxy)-2- oxoethyl)cyclopentyl 4-(dimethylamino)butanoate
[0169] PNI 580: (2S,3R,4R)-2-(((4-(dimethylamino)butanoyl) oxy)methyl)tetrahydrofuran-3 ,4-diyl bis(2-hexyldecanoate)
[0170] PNI 659: ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4-(dimethylamino)butanoate
[0171] PNI 728: ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 2-(dimethylamino)ethyl)carbamate
[0172] PNI 762: ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl (2-(diethylamino)ethyl)carbamate
[0173] RT : room temperature
[0174] SARS-CoV-2: severe acute respiratory syndrome coronavirus 2
[0175] sgRNA: single guide RNA
[0176] TCR sgRNA: T cell receptor single guide RNA
[0177] TTR sgRNA: Transthyretin single guide RNA from Integrated DNA Technologies(Coralville, IA) according to sequence (CCCAUACUCCUACAGCACCA)
[0178] V02: lipid nanoparticle composition of ionizable lipid: structural lipidsterol stabilizing agent (47.5: 12.5:38.5: 1.5 mol%)
[0179] V62: lipid nanoparticle composition of ionizable lipid: structural lipid: sterol stabilizing agent (40: 12.5:46: 1.5 mol%)
[0180] Wt: Weight.
[0181] The following examples further illustrate the invention but, should not be construed in any way as limiting its scope.EXAMPLE 1
[0182] This example demonstrates an illustrative synthetic pathway to access the lipid acyl chain of compound 8, which is needed for synthesizing the stabilizing agents.Scheme 1 . Synthetic procedure for the generation of compound
[0183] Step 1 : Synthesis of compound 2
[0184] A 2000-mL two neck round bottom flask was charged with (2,2-dimethyl-l,3- dioxolan-4-yl) methanol (compound 1), (50.0 g, 0.378 mol) in THF (1000 mL) under argon atmosphere, 60% NaH (20.0 g, 0.833 mol) was added at 0 °C, and stirred for 30 min.(Bromomethyl)benzene (77.72 g, 0.454 mol) was added drop wise at the same temperature, and then stirred the reaction mixture at RT for 12 h and completion of the reaction was monitored by TLC. The reaction mixture was diluted with aqueous NH4CI (500 mL) and extracted with EtOAc(2 x 600 mL), washed with brine solution (80 mL) and the organic layer was dried over ISfeSCU and evaporated on the rotary evaporator to afford the compound 2 (90 g) as a crude product. The formation of the desired product (yellow liquid) was confirmed byJH NMR.JH NMR (CDCh) 400 MHz: 5 ppm: 1.36 (s, 3H), 1.42 (s, 3H), 3.45-3.57(m, 2H), 3.72-3.76 (m, 1H), 4.04-4.07 (m, 1H), 4.30 (m, 1H, J = 6 Hz), 4.57 (d, 2H, J = 6.4 Hz), 7.29-7.35 (m, 5H).
[0185] Step 2: Synthesis of compound 3
[0186] To a 250-mL two neck round bottom flask, 4-((benzyloxy)methyl)-2,2-dimethyl-l,3- dioxolane (compound 2), (45.0 g, 202.44 mmol), water (62 mL), and acetic acid (250 mL) were added and stirred at RT for 16 h. The reaction progress was monitored by TLC. Then, the reaction mixture was concentrated on the rotary evaporator to afford the crude compound. The crude compound was purified by CombiFlash using 2.0% MeOH in DCM as eluent to obtain compound 3 (30.0 g) (yield, 81.32%) as a brown liquid. The desired product was analyzed and confirmed by 'HNMR.XH NMR (CDCh) 400 MHz: 5 ppm: 3.56-3.65 (m, 3H,) 3.69-3.72 (dd, 1H, JI = 11.4 Hz, J2 = 3.6Hz), 3.88-3.91 (m, 1H), 4.55 (br s, 2H), 7.30-7.36 (m, 5H).
[0187] Step 3: Synthesis of compound 4
[0188] A 1000-mL two neck round bottom flask was charged with 3 -(benzyloxy) propane- 1 ,2-diol (compound 3), (30.0 g, 164.83 mmol), dissolved in 450 mL of toluene under argon atmosphere at RT. To this, potassium Lbutoxide (74.0 g, 659 mmol) and bromo tetradecane (137.0 g, 494.0 mmol) were added and then the reaction mixture was kept at 110 °C and stirred for 12 h. The progress of the reaction was monitored by TLC. After completion, the reaction mixture was cooled to RT, concentrated, and toluene removed under reduced vacuum. To this, 100 mL of water and 100 mL of ethyl acetate were added, and the organic layer was separated. The aqueous layer was again washed with ethyl acetate (2x 250 mL). The organic layer was dried over anhydrous Na2SO4 and concentrated under reduced pressure. The crude compound was purified by flash column chromatography by eluting with 14% EtOAc in hexane to get compound 4 (60.0 g) (yield, 63.8%) as an off-white solid. 'H NMR (CDCI3) 400 MHz: 5 ppm: 0.88 (t, 6H, J = 6.8 Hz) 1.18-1.31 (m, 45H), 1.51-1.58 (m, 4H), 3.42 (t, 2H, J = 6.4 Hz), 3.50- 3.59 (m, 6H), 4.55 (br s, 2H), 7.28-7.34 (m, 5H).
[0189] Step 4: Synthesis of compound 5
[0190] A 500-mL parr vessel was charged with 2,3-bis (tetradecyl oxy) propan-l-ol (20 g, 34.782) (compound 4) in 250 mL of ethanol, 4.5 g of 10% Pd / C and the parr shaker washydrogenated at 50 psi of hydrogen gas for 5 h. The progress of the reaction was monitored by TLC. The reaction mixture was filtered through the celite bed, washed with 200 mL of ethanol. The filtrate was concentrated under reduced pressure to get compound 5 (15.0 g) (yield 91%) as a brown liquid. The obtained desired product was confirmed byJH NMR.JH NMR (CDCh) 400 MHz: 5 ppm: 0.88 (t, 6H, J = 6.8 Hz) 1.18-1.31 (m, 46H), 1.51-1.60 (m, 4H), 3.42 (m, 1H), 3.43- 3.59 (m, 6H), 3.61-3.63 (m, 3H).
[0191] Step 5: Synthesis of compound 6
[0192] To the stirred solution of 2-(benzyloxy)ethan-l-ol, (compound 6A), (3.0 g, 19.71 mmol) in dry DCM (dichloromethane; 50 mL) was added, EtsN (8.3 mL, 59.13 mmol) at room temperature for 10 min. After 10 min, mesyl chloride (3 mL, 39.42 mmol) was added at 0 °C and reaction mixture was stirred for 16 h at RT. The completion of the reaction was monitored by TLC (20:80 EtOAc: Hexane, UV active). The desired product was formed (brown liquid), and confirmed by 'H NMR. The yield was 3.5 g.
[0193] Step 6: Synthesis of compound 7
[0194] To the stirred solution of 2,3-bis(tetradecyloxy)propan-l-ol (2.00 g, 4.12 mmol) in dry DMF (10 mL), NaH (0.65 g, 16.48 mmol) was added in small portions at RT, and the reaction mixture was stirred for 30 min at RT. To this, 2-(benzyloxy)ethyl methane sulfonate (1.89 g, 8.24 mmol) was added at rt and stirred for 5 h at 70 °C. The completion of the reaction was monitored by TLC. The reaction mixture was diluted and quenched with saturated NH4CI solution and extracted with EtOAc (3x 50 mL). The combined organic layers were dried over Na2SO4 and concentrated under vacuum. The crude material was purified by MPLC (CombiFlash™, Gradient Elusion, 0-10 % EtOAc in Hexane). The desired product (800 mg, 31%) was obtained as a colorless liquid and confirmed by1H NMR.1H NMR (CDCI3, 400 MHz): 5(ppm): 0.88 (t, 6 H, J = 7.2 Hz), 1.20 -1.38 (m, 48 H), 1.50-1.59 (m, 4 H), 3.42-3.67 (m, 13 H), 4.57 (s, 2 H), 7.29 (m, 5 H).
[0195] Step 6: Synthesis of compound 8
[0196] To this solution of((2-(2,3-bis(tetradecyloxy)propoxy)ethoxy)methyl)benzene (compound 7) (800 mg, 1.29 mmol) in EtOH: EtOAc (20 mL) Pd / C (300 mg) was added at RT and the reaction mixture was stirred under H2 balloon pressure for 5 h. The completion of the reaction was monitored by TLC. The desired product was obtained as a colorless liquid (650 mg, 99% yield) and confirmed by 'H NMR.'H NMR (CDCI3, 400 MHz, 5 ppm): 0.88 (t, 6 H, J= 6.8Hz), 1.15-1.40 (m, 48 H), 1.46-1.60 (m, 5 H), 3.44 (t, 2 H, J= 1.2 Hz), 3.48-3.68 (m, 9 H), 3.69- 3.76 (m, 2 H).EXAMPLE 2
[0197] This example demonstrates an illustrative synthetic pathway to access the polyglycerol stabilizing agents SAF 06, 10, 15, 19, 25, 89, 92, 93, 97, 98, 128, 182, 183, and 184.Scheme 2 General synthetic procedure of the generation of SAF 6, 10, 15, 25, and 93
[0198] To a stirred solution of oxiran-2-yl methanol (compound 9), (10.0 g, 135.13 mmol) in ethoxy ethane (compound 10), (50.0 mL), PTSA.H2O (0.257 g, 1.35 mmol) was added at 0°C portion wise, then reaction mixture was stirred at 40 °C for 3 h. The completion of the reaction was monitored by TLC. The reaction mixture was cooled to RT, quenched with aq NaHCCh and extracted with Et2O (2x 100 mL). The organic layer was washed with brine solution and evaporated on the rotary evaporator to afford the crude compound. TLC analysis (solvent system: EtOAc:Hexane 20:80; UV inactive) was carried out to assess the reaction progress. Crude product was purified by distillation by using a high vacuum pump at 60 °C. The desired product (compound 11) was obtained and confirmed by 'H NMR. The yield was 12.0 g (60%).SAF 06
[0199] 2-(2,3-bis(tetradecyloxy)propoxy)ethan-l-ol (200 mg, 0.378 mmol) in DME(dimethyl ether; 3 mL) was taken into a 100 mL RB flask. To this solution KOtBu (63 mg) was added at RT and stirred as the reaction mixture for 1 h at 80 °C. t-Butanol and solvent wereremoved under vacuum at 100 °C. To this, 2-((l -ethoxy ethoxy )methyl)oxirane (compound 11) (1.38 mL, 9.45 mL) was added dropwise and the reaction mixture was stirred for 16 h at the same temperature. Reaction was monitored by 'H NMR. The reaction mixture was quenched with 0.5 mL of water and dried under vacuum to obtain a crude product. The number of repeating units of the polymer, 26, was determined from 'H NMR analysis. 'H NMR (CDCh, 400 MHz): 5 (ppm): 0.88 (t, 6 H, J = 7.2 Hz), 1.10-1.40 (m, 204 H), 1.50-1.60 (m, 4 H), 3.30- 3.80 (m, 189 H), 3.85-3.95 (m, 3 H), 4.65-4.78 (m, 26 H).
[0200] To the stirred solution of poly-7-(l-ethoxy)-4-methyl-14-(tetradecyloxy)-3,5,9, 12,16- entaoxatriacontane (1.2 g, 0.26 mmol) in THF (20 mL) was added 12 M HC1 (1.0 mL) and the reaction mixture was stirred for 2 h. Reaction was monitored by1H NMR. The reaction mixture was concentrated under vacuum and dissolved in MeOH (20 mL). The solution was neutralized with solid NaHCCh until the evolution of bubbles ceased. The solution was filtered to remove NaHCCh and the filtrate was concentrated under vacuum to obtain crude product. Polymer was purified by fractional precipitation using MeOH:acetone (1 :20). The desired product was obtained as a colorless sticky liquid, confirmed by 'H NMR (monomer units -12, yield: 150 mg). 'HNMR (CD3OD, 400 MHz): 5 (ppm): 0.88 (t, 6 H, J = 6.8 Hz), 1.22-1.40 (m, 47 H), 1.40-1.50 (m, 4 H), 3.40-3.80 (m, 68 H).
[0201] A 50 mL two neck round bottom flask was charged with 2-(2,3- bis(tetradecyloxy)propoxy)ethan-l-ol (300 mg, 0.567 mmol) in DME (dimethyl ether; 3.0 mL), KOtBu (96 mg, 0.850 mmol) was added and stirred at 80 °C for 1 h. To this slurry, 2-((l ethoxy ethoxy) methyl)oxirane (1.24 g, 8.508 mmol) was added slowly, then reaction mixture was stirred at 100°C for 16 h. The reaction mixture was cooled to RT, quenched with 0.4 mL of water and concentrated on the rotavapor to afford the desired product (1.0 g, crude), which was confirmed by1H NMR. The number of monomer units of the polymer, 16, is confirmed by1H NMR. 'HNMR (CDCh, 400 MHz): 5 (ppm): 0.88 (t, 6 H, J = 7.2 Hz), 1.10-1.40 (m, 146 H), 1.50-1.60 (m, 4 H), 3.30-3.80 (m, 124 H), 4.65-4.80 (m, 16 H).
[0202] To the stirred solution of above crude polymer (1.0 g) in THF (20.0 mL), Cone. HC1 (2.0 mL) was added at 0 °C then reaction mixture was further stirred at RT for 6 h. The reactionmixture was concentrated and dried on the rotavapor to afford the desired compound. Deprotection of the crude polymer product was confirmed by1H NMR (yield: 500 mg, crude polymer). 500 mg of crude product was dissolved in methanol (5 mL), precipitated with acetone (5x 5 mL) and the decantation layer (mother liquor) was evaporated to obtain the desired product as pale-yellow gummy. The desired product was obtained and confirmed byJH NMR (monomer units-14) and GPC. Yield: 350 mg. 'H NMR (CDC13, 400 MHz): 5 (ppm): 0.88 (t, 6 H, J = 6.8 Hz), 1.15-1.40 (m, 48 H), 1.46-1.60 (m, 5 H), 3.44 (t, 2 H, J = 1.2 Hz), 3.48-3.68 (m, 9 H), 3.69- 3.76 (m, 2 H).
[0203] A 100 mL 2-neck flask was charged with 2-(2,3-bis(tetradecyloxy)propoxy)ethan-l- ol (450 mg, 0.850 mmol) in DME (dimethyl ether; 1.0 mL), KOtBu (0.143 g, 1.276 mmol) was added and stirred at 80 °C for 1 h. The reaction mixture was dried under vacuum at 100°C for 2 h. The dried product was dissolved in DME (1.0 mL), 2-((l -ethoxy ethoxy)methyl)oxirane (4.98 g, 34.03 mmol) in DME (4.0 mL) was added dropwise over a period of 2 h at 100 °C, stirred at 100 °C for 24 h . The reaction mixture was cooled to RT, quenched with 0.4 mL of water. The reaction mixture was concentrated and dried on the rotavapor to afford the crude compound (4.0 g, crude), which was confirmed by1H NMR and the number of repeating units was determined as 35 repeating units in the polymer. *HNMR (CDCI3, 400 MHz): 5 (ppm): 0.88 (t, 6 H, J = 7.2 Hz), 1.10-1.40 (m, 264 H), 3.38-3.80 (m, 253 H), 4.60-4.78 (m, 35 H). Monomodal distribution of the polymer was confirmed by gel permeation chromatography (fe= 10.43, mobile phase- DMF).
[0204] The above dried crude polymer (protected) (4.0 g, 0607 mmol) in THF (40.0 mL), cone. HC1 (8.0 mL) was added at 0 °C and stirred at RT for 6 h. The reaction mixture was concentrated and dried on the rotavapor to afford the dried product. The dried product was dissolved in MeOH, which was precipitated with acetone 3 times. The supernatant was decanted, the remaining precipitate (mother liquor) was concentrated to afford pure compound. This precipitation was repeated one more time, the desired product was confirmed by1H NMR andGPC. ‘H NMR (CDCh, 400 MHz): 5 (ppm): 0.80 (t, 6H), 1.2 (br, 44H), 1.5 (br, 4H), 3.6 (br, 91H). The molecular weight determined from1H NMR using end group analysis was 1712 Da.
[0205] A 100 mL two neck RB flask was charged with 2-(2,3- bis(tetradecyloxy)propoxy)ethan-l-ol (450 mg, 0.850 mmol) in DME (1.0 mL), KOtBu (0.143 g, 1.276 mmol) was added and stirred at 80 °C for 1 h. The reaction mixture was dried over vacuum at 100°C for 2 h. The dried product was dissolved in DME (1.0 mL), 2-((l- ethoxyethoxy)methyl)oxirane (4.98 g, 34.03 mmol) in DME (4.0 mL) was added dropwise over a period of 2 h at 100 °C, and was stirred at 100 °C for 24 h. The reaction mixture was cooled to RT, quenched with 0.4 mL of water, concentrated, and dried on the rotavapor to afford the crude compound (4.0 g, crude) which was confirmed by 'HNMR (35 repeating units) and GPC (ZR = 10.43, mobile phase-DMF). 'HNMR (CDCh, 400 MHz): (5 ppm): 0.88 (t, 6 H, J= 7.2 Hz), 1.10-1.40 (m, 264 H), 3.38-3.80 (m, 253 H), 4.60-4.78 (m, 35 H).
[0206] The crude product (4.0 g, 0607 mmol) in THF (40.0 mL), cone. HC1 (8.0 mL) was added at 0 °C and stirred at RT for 6 h. The reaction mixture was concentrated, dried on the rotavapor to afford the dried product. This crude product was dissolved in MeOH, which was precipitated with acetone 3 times. The supernatant was decanted and the remaining mother liquid was concentrated. This precipitation was repeated one more time, supernatant was separated and dried (780 mg). The remaining residue was also dried to yield the deprotected product with higher molecular weight (700 mg), confirmed by GPC (ZR = 9.0 min, Shodex KD-802 300 by 8.0 mm, mobile phase: 0.1 mM LiBr in DMF, 60 °C, concentration of the sample: 10 mg / mL). 'H NMR (400 MHz, MeOD): 5(ppm): 0.80 (t, 6H), 1.2 (br, 56H), 1.5 (br, 4H), 2 (br, 3H), 3.3 (br, 6H), 3.5 (br, 50H), 3.7 (br, 191H), 4.3 (br, 4H). The molecular weight of the polymer (5570 Da) was determined from1H NMR using end group analysis.SAF 89
[0207] A 100 mL two neck round bottom flask was charged with 2-(2,3- bis(tetradecyloxy)propoxy)ethan-l-ol (450 mg, 0.850 mmol) in DME (1.0 mL), KOtBu (0.143 g, 1.276 mmol) was added and stirred at 80 °C for 1 h. The reaction mixture is dried over vacuum at 100 °C for 2 h. The reaction mixture was dissolved in DME (1.0 mL), 2-((l- ethoxyethoxy)methyl)oxirane (4.98 g, 34.03 mmol) in DME (4.0 mL) was added dropwise over a period of 2 h at 100 °C and stirred at 100 °C for 24 h. The reaction mixture was cooled to RT, quenched with 0.4 mL of water, concentrated, and dried on the rotavapor to afford the crude protected polymer (4.0 g) which was confirmed byJH NMR (35 repeating units) and GPC (monomodal distribution, ZR= 10.43). 'H NMR (CDCh, 400 MHz): 5(ppm): 0.88 (t, 6 H, J = 7.2 Hz), 1.10 - 1.40 (m, 264 H), 3.38 - 3.80 (m, 253 H), 4.60 - 4.78 (m, 35 H).
[0208] To the above crude protected polymer (1.7 g, 0.829 mmol) in THF (34.0 mL), cone. HC1 (1.7 mL) was added at 0 °C and stirred at RT for 3 h. The reaction mixture was concentrated and dried on the rotavapor to afford dried product. This dried product was dissolved in MeOH, precipitated with acetone 3 times. The supernatant was decanted, the remaining slurry was concentrated to afford a brown gummy liquid. The desired deprotected polyglycerol product (Yield: 890 mg) was confirmed by *HNMR and GPC ( ZR = 10.14 min, determined by GPC (Shodex KD-802 300 by 8.0 mm, Mobile phase: 0.1 mM LiBr in DMF, 40 °C, concentration of the sample: 10 mg / mL).1H NMR (400 MHz, MeOD): 5 (ppm): 0.80 (t, 6H), 1.3 (br, 48), 1.5 (br, 4), 3.5 (br, 3), 3.7 (br, 68). The molecular weight (1416 Da) of the polymer was determined from1H NMR using end group analysis.SAF 93
[0209] A 50 mL two neck RB flask was charged with 2,3-bis(tetradecyloxy)propan-l-ol (50 mg, 0.103 mmol) in DME (1.0 mL), KOtBu (18 mg, 0.154 mmol) was added and stirred at 80 °C for 1 h. The reaction mixture was dried under vacuum for 1 h. The dried product was dissolved in DME (0.5 mL), 2-((l -ethoxy ethoxy)methyl)oxirane (452 mg, 3.093 mmol) was added dropwise at 110 °C for 1 h, and stirred for another 20 h. The reaction mixture was cooled to RT, quenched with 0.1 mL of water, concentrated, and dried on the rotavapor to afford the crude compound. The crude polymer product was dissolved in diethyl ether, centrifuged for 10minutes, supernatant was separated and evaporated on the rotavapor to afford the protected polymer product as a brown gum liquid (350 mg, crude), which was confirmed byNMR (number of repeating units was 30).NMR (CDCI3, 400 MHz): 5 (ppm): 0.88 (t, 6 H, J = 7.2 Hz), 1.10-1.40 (m, 226 H), 1.50-1.60 (m, 3 H), 3.30-3.80 (m, 222 H), 3.85-4.0 (m, 4 H), 4.65- 4.78 (m, 30 H), 4.9-5.20 (m, 5 H).
[0210] To the above crude product (350 mg, 0.075 mmol) in THF (10.0 mL), Cone. HC1 (0.4 mL) was added dropwise at 0 °C and stirred at RT for 3 h. The reaction mixture was concentrated and dried on the rotavapor to afford the deprotected polymer. The crude product was dissolved in MeOH, which was precipitated with acetone 3 times and the solvent layer was decanted and the mother liquor was concentrated to afford a brown gummy liquid. This viscous liquid was washed with n-hexane (2x 5 mL) and dried over vacuum (yield: 105 mg). The desired deprotected polymer product was confirmed byXH NMR (24 monomer repeating units) and GPC (monomodal distribution).XH NMR (400 MHz, MeOD): 5 (ppm): 0.80 (t, 6H), 1.3 (br, 42H), 1.5 (br, 4H), 3.3 (m, 2H), 3.6 (br, 64H), 3.8 (br, 64H). The molecular weight (2304 Da) of the polymer was determined fromXH NMR. The retention time (fe= 10.12) was determined by GPC (Shodex KD-802 300 by 8.0 mm, mobile phase: 0.1 mM LiBr in THF, 60 °C, concentration of the sample: lO mg / mL).
[0211] Synthesis of SAF 97 and SAF 98
[0212] To a stirred solution of 2-ethyl-2-(hydroxymethyl)propane- 1,3 -diol (0.400 g, 2.981 mmol) in benzene (3.0 mL), CSOH.H2O (0.150 g, 0.894 mmol) was added and stirred at RT for 30 minutes, then benzene was removed at 40 °C under high vacuum for 5 h. To this residue, oxiran-2-ylmethanol (6.625 g, 89.43 mmol) in DME (2 mL) was added dropwise over a period of 3 h at RT and reaction mixture was stirred at 100 °C for 16 h. The reaction mixture was cooled to RT, quenched with 0.5 mL of MeOH and concentrated and dried on the rotavapor to afford the crude compound. The crude was taken in MeOH, washed with acetone and mother liquor47SUBSTITUTE SHEET (RULE 26)(acetone layer) was concentrated to get the desired product. The desired product was obtained and confirmed by 'H NMR (yield: 5.0 g) and GPC (DMF-GPC showed monomodal peak at retention time 8.697). ’H NMR (CDCh, 400 MHz): 5(ppm): 0.89 (t, 6 H, J= 6.0 Hz), 1.32-1.48 (m, 2 H), 3.32-3.40 (m, 44 H), 3.42-3.80 (m, 130 H), 3.82-4.0 (m, 7 H).
[0213] To the solution of the above dried product (500 mg, 0.25 mmol) and 4-(2,3- bis(tetradecyloxy)propoxy)-4-oxobutanoic acid (439 mg, 0.75 mmol) in DMF (5.0 mL), DCC (258 mg, 1.25 mmol) and DMAP (9 mg, 0.07 mmol) were added and then reaction mixture was stirred at RT for 16 h. The reaction mixture was concentrated, residue was washed with diethyl ether (2x 3 mL) and dried on rotavapor to afford the dried product. This product was taken in EtOAc (10 mL), extracted with water (2x 10 mL) and the water layer was dried under lyophilization to afford the desired product as viscous white gummy product. The desired product was obtained and confirmed by *HNMR (Yield: 130 mg) and GPC (ZR= 8.70 min, Shodex KD-802 300 by 8.0 mm, mobile phase: 0.1 mM LiBr in DMF, 60 °C, concentration of the sample: 10 mg / mL). ’H NMR (400 MHz, MeOD): 5 (ppm): 0.80 (t, 6H), 1.2 (br, 22H), 1.5 (br, 2H), 1.8 (br, 5H), 2.5 (br, 2H), 3 (br, 1H), 3.5 (br, 197H). The molecular weight (3567 Da) was determined from1H NMR using end group analysis.SAF 97
[0214] To a stirred solution of 2-ethyl-2-(hydroxymethyl)propane-l,3-diol (0.300 g, 2.235 mmol) in benzene (3.0 mL), CsOH.ThO (0.150 g, 0.894 mmol) was added and stirred at RT for 30 minutes, then benzene was removed at 40°C under high vacuum for 5 h. To this residue, oxiran-2-ylmethanol (3.313 g, 44.7 mmol) in DME (2 mL) was added dropwise over a period of 2.5 h at RT and reaction mixture was stirred at 100 °C for 16 h. The reaction mixture was cooled to RT, quenched with 0.5 mL of MeOH, concentrated and dried on the rotavapor to afford the desired product. The crude product was taken in MeOH, washed with acetone and mother liquor (acetone layer) was concentrated to get the desired product. The desired product (yield: 4 g) was obtained and confirmed by1H NMR and GPC (DMF-GPC showed monomodal peak at retention time 9.42). *H NMR (CD3OD, 400 MHz): 5 ppm: 0.70-0.88 (m, 3 H), 1.20-1.30 (m, 2 H), 3.30- 3.90 (m, 44 H).
[0215] To this crude product (1.0 g, 0.625 mmol), 4-(2,3-bis(tetradecyloxy)propoxy)-4- oxobutanoic acid (1.1g, 1.875 mmol) in DMF (15.0 mL), THF (15 mL), DIPEA (N,N- diisopropylethylamine; 807 mg, 6.250 mmol), EDC.HC1 (480 mg, 2.500 mmol) and HOBT (hydroxybenzotriazole; 254 mg, 1.875 mmol) were added and then reaction mixture was stirred at RT for 16 h. The reaction mixture was concentrated, residue was dissolved in DCM (150 mL), washed with water (20 mL) and DCM layer dried on the rotavapor to afford crude product. The crude product was dissolved in water and dried under lyophilisation (for removal of DMF traces) for 2 days. This dried product was taken in DCM (150 mL), washed with dil HC1 (2x 20 mL) and the DCM layer was evaporated to afford the desired product as brown gummy liquid. The desired product (yield: 900 mg) was obtained and confirmed by1H NMR & GPC (Retention time = 9.54 min, Shodex KD-802 300 by 8.0 mm, mobile phase: 0.1 mM LiBr in THF, 60 °C, concentration of the sample: 10 mg / mL). 'H NMR (400 MHz, MeOD): 5 (ppm): 0.80 (t, 16H), 1.3 (br, 113H), 1.5 (br, 10H), 2.6 (m, 10H), 3.6 (br, 44H), 3.9 (br, 3H), 4 (br, 7H), 4.3 (br, 3H). The molecular weight determined from1H NMR data was 2553 Da.SAF 98
[0216] To a stirred solution of 2-ethyl-2-(hydroxymethyl)propane- 1,3 -diol (0.25 g, 1.861 mmol) in benzene (3.0 mL), CsOH.ThO (0.150 g, 0.894 mmol) was added and stirred at RT for 30 minutes, then benzene was removed at 40°C under high vacuum for 5 h. To this residue, oxiran-2-ylmethanol (3.908 g, 65.187 mmol) in DME (2 mL) was added dropwise over a period of 2.5 h at RT and reaction mixture was stirred at 100 °C for 16 h. The reaction mixture was cooled to RT, quenched with 0.5 mL of MeOH, concentrated, and dried on the rotavapor to afford the desired product. The dried product was taken in MeOH, washed with acetone and the mother liquor (acetone layer) was concentrated to get the desired product. The desired product (yield: 2.7 g) was obtained and confirmed by 'HNMR and GPC (Monomodal peak at retention time 9.53). ‘H NMR (CD3OD, 400 MHz): 5 ppm: 0.77 (t, 3 H, J= 7.2 Hz), 1.14-1.40 (m, 4 H), 1.98-2.15 (m, 8 H), 3.25-3.30 (m, 5 H), 3.30-4.10 (m, 116 H).
[0217] To this dried product (1.6 g, 0.615 mmol), 4-(2,3-bis(tetradecyloxy)propoxy)-4- oxobutanoic acid (1.079 g, 1.846 mmol) in DMF (15.0 mL) and THF (15 mL), DIPEA (795 mg, 6.153 mmol), EDC.HC1 (472 mg, 2.461 mmol) and HOBT (333 mg, 2.461 mmol) were added and then reaction mixture was stirred at RT for 16 h. The reaction mixture was concentrated,residue was dissolved in DCM (150 mL), washed with water (20 mL) and DCM layer dried on the rotavapor to afford dried product. The dried product was taken in DCM (150 mL), washed with saturated NH4CI (2x 20 mL) and the DCM layer was evaporated to afford the desired product as viscous white gummy liquid. The viscous crude product was dissolved in water and dried under lyophilization (for removal of DMF traces) for 2 days (yield: 1.6 g). The desired product was obtained and confirmed byJH NMR and GPC (Retention time, 9.62 min, Shodex KD-802 300 by 8.0 mm, mobile phase: 0.1 mM LiBr in THF, 60 °C, concentration of the sample: 10 mg / mL). *HNMR (400 MHz, MeOD): 5 (ppm): 0.80 (t, 37H), 1.3 (br, 273H), 1.5 (br, 24H), 2.6 (m, 22H), 3.4 (br, 10H), 3.7 (br, 116H), 4.2 (br, 24H). The molecular weight (5339 Da) was determined from1H NMR.SAF 92
[0219] To a stirred solution of oxiran-2-ylmethanol (10.0 g, 135.13 mmol) in ethoxyethene (50.0 mL), PTSA.H2O (0.257 g, 1.35 mmol) was added at 0 °C dropwise, then the reaction mixture was stirred at RT for 6 h. The completion of the reaction was monitored by TLC. The reaction mixture cooled to RT, quenched with aq NaHCCL and extracted with Et2O (2x 100 mL). The organic layer was washed with brine solution and evaporated on the rotary evaporator to afford the crude compound. TLC analysis (solvent system: EtOAc:Hexane 20:80; UV inactive) was carried out to assess the reaction progress. The crude product was purified by distillation by using high vacuum pump at 60 °C. The desired product, compound 5, was obtained and confirmed by 'H NMR (yield: 12.0 g, 60%).
[0220] Step 2:MsCl, Et3NDCM, RT
[0221] To the stirred solution of 2-(benzyloxy)ethan-l-ol ( 3.0 g, 19.71 mmol) in dry DCM (50 mL) was added, EtsN (8.3 mL, 59.13 mmol) at room temperature for 10 min. After 10 min, MsCl (3 mL, 39.42 mL) was added at 0 °C and reaction mixture was stirred for 16 h at RT. The completion of the reaction was monitored by TLC (20:80) (EtOAc: hexane, UV active). The desired product was formed (brown liquid) and confirmed by!H NMR (yield: 3.5 g).
[0222] Step 3:
[0223] To the solution of ((2-(2,3-bis(tetradecyloxy)propoxy)ethoxy)methyl)benzene (compound 7) (800 mg, 1.29 mmol) in EtOH: EtOAc (20 mL), Pd / C (300 mg) was added at RT and stirred the reaction mixture under H2 balloon pressure for 5 h . The completion of the reaction was monitored by TLC. The desired product (compound 8) was obtained as a colorless liquid (650 mg, 99% yield) and confirmed by!H NMRdH NMR (CDCI3, 400 MHz, 5 ppm): 0.88 (t, 6 H, J= 6.8 Hz), 1.15-1.40 (m, 48 H), 1.46-1.60 (m, 5 H), 3.44 (t, 2 H, J= 1.2 Hz), 3.48-3.68 (m, 9 H), 3.69-3.76 (m, 2 H).
[0224] To a stirred solution of 2-(2,3-bis(tetradecyloxy)propoxy)ethan-l-ol, compound 8, (100 mg, 0.189 mmol) in DME (1.0 mL), KOtBu (32 mg, 0.283 mmol) was added and stirred at 80 °C for 1 h. The formed biproducts were removed by vacuum for 1 h. The dried reaction mixture was dissolved in DME (1.0 mL), 2-((l-hoxyethoxy)methyl)oxirane (387 mg, 2.647 mmol) was added dropwise at 110 °C and stirred at 110°C for 24 h. The reaction mixture was cooled to RT, quenched with 0.4 mL of water, concentrated, and dried on the rotavapor to afford the desired product. The crude product was dissolved in di ethylether, centrifuged for 10 minutes and then solvent layer was separated and evaporated on the rotavapor to afford the desired product as brown gummy liquid. The desired product (11 repeating monomer units) was obtained and confirmed byXH NMR (Yield: 300 mg).XH NMR (400 MHz, MeOD): 5 0.80 (t, 6H), 1.3 (br, 106H), 1.5 (br, 4H), 3.6 (br, 90H), 3.9 (br, 4H), 4.7 (m, 12H). The molecular weight was determined fromXH NMR data and was 2280 Da. The retention time (fe=9.353 min) for the52SUBSTITUTE SHEET (RULE 26)product was determined by GPC (Shodex KD-802 300 by 8.0 mm, Mobile phase: 0.1 mM LiBr in DMF, 40 C, concentration of the sample: 10 mg / mL).EXAMPLE 3
[0225] This example demonstrates an illustrative manner of preparing the lipid nanoparticles (LNP).
[0226] Components of the lipid nanoparticle composition including ionizable lipid, structural lipid, sterol and inventive stabilizing or control stabilizing (PEG-DMG) agents were mixed together in different molar ratios. Lipid nanoparticle compositions were prepared in ethanol by combining prescribed amounts of lipids from individual lipid stocks in ethanol. LNPs were then prepared by running the lipid nanoparticle composition and nucleic acid through the NanoAssemblr® Ignite™ microfluidic mixer.
[0227] Lipid nanoparticles (LNPs) formulations were produced by mixing the lipid nanoparticle composition (PNI 516: V02 or PNI 516:V62 or PNI 580 V62; lipid concentration: 25 mM), with the nucleic acid (e.g., mRNA or saRNA) solution (100 mM acetate buffer; pH 4) using a microfluidic mixer such as the one from the NanoAssemblr® platform at an aqueous:organic solution ratio of 3: 1 volume. The formulations were diluted with 25x PBS followed by storing at 4 °C for 30 min. To purify LNPs, formulations were centrifuged utilizing UF Amicon™ tubes at 2200 x g for 45 min. EPO mRNA LNPs were stored at 4 °C until further use. A5 saRNA LNPs were mixed with a cryopreservation buffer and kept at -80 °C until further use. Particles were concentrated to a desired target dose. This example demonstrated the preparation of the lipid nanoparticles (LNP) for testing.EXAMPLE 4
[0228] This example demonstrates illustrative methods used for measuring the size, poly dispersity index (PDI) and encapsulation efficiency (EE) of the lipid nanoparticles (LNPs).
[0229] Size and PDI of the LNPs was measured by Dynamic Light Scattering (DLS) using a ZetaSizer™ Nano ZS™ (Malvern Instruments). He / Ne laser of 633 nm wavelength was used as the light source. Data were measured from the scattered intensity data conducted in backscattering detection mode (measurement angle = 173°). 0.5 to 2 pL of the sample was placed in a cuvette and diluted with PBS (0.3 mL). Measurements were an average of 10 runs oftwo cycles each per sample. Z -Average size was reported as the particle size and is defined as the harmonic intensity averaged particle diameter. EE of the LNPs was measured by Quant-iT™ RiboGreen® RNA reagent. These LNP characteristics, as well as the results of the nucleic acid EE for the LNP in the various lyophilization buffers (LB) are described in the following examples.
[0230] Size, PDI and EE of lipid nanoparticles with polyglycerol (PG) based stabilizing agents and different nucleic acid payloads were measured and provided in Table 2. The lipid nanoparticle composition used for EPO mRNA and A5 saRNA studies included PNI 516:V02 (lipid concentration: 25 mM) (Table 3). The lipid nanoparticle composition used for the TTR sgRNA / Cas9 mRNA study included PNI 516: V62 (lipid concentration: 25 mM). The N / P ratio used for EPO mRNA and A5 saRNA formulations was 8. The N / P ratio used for TTR sgRNA / Cas9 mRNA formulation was 6. The sgRNA:Cas9 mRNA was 1 : 1 by wt. The LNP size was measured by dynamic light scattering (DLS) using a ZetaSizer™ Nano ZS™ (Malvern Instruments, UK). The EE measurements were determined by a modified Ribogreen™ assay (Quanti-iT RiboGreen™ RNA assay kit, Thermo Fisher). This example demonstrated the methods used to determine the size, poly dispersity index (PDI), and encapsulation efficiency (EE) of the lipid nanoparticles (LNP).
[0231] Table 2. Physiochemical properties and encapsulation efficiency (EE%) of LNPs formulated by varying different polyglycerol stabilizing agents in CT10, V01, V02 or V62 using PNI 516 or PNI 580 for various nucleic acid payloads.Table 2Table 3. Lipid Nanoparticle CompositionsEXAMPLE 5
[0232] This example demonstrates an illustrative protocol for Luciferase quantification.
[0233] HEK293 cells were seeded on 96-well plate at 12,000 cells / well (100 uL / well) for 24 h. The cells were treated with Flue mRNA LNPs (dose: 25 ng / well) for 24 h. Afterwards, the luciferase expression and cell viability were quantified using ONE-Glo+Tox assay according to the manufacturer protocol.
[0234] As shown in FIGS. 1A-1B, polyglycerol based stabilizing agent containing LNP showed high levels of Luciferase protein expression in both HEK293 and T cells following 24 treatment with Flue mRNA LNPs. The lipid nanoparticle composition used included PNI 516:V02 (lipid concentration: 25 mM). Further, these LNPs showed predominate protein expression compared to PEG-DMG containing LNPs. This example demonstrated the Luciferase quantification protocol.EXAMPLE 6
[0235] This example demonstrates an illustrative procedure used for the erythropoietin (EPO) expression evaluation of EPO-expressing LNPs in vivo.
[0236] LNPs were intravenously injected into mice (6-week old female C57BL6 mice) at a single dose of 0.25 mg / kg. The sera samples were collected 6 h post-injection via the tail nick method. For serum preparation, after collection of the whole blood, the blood was allowed to clot by leaving the collection tube at room temperature for 15-30 minutes. The clot was removed by centrifuging the tubes at 1000-2000 x g for 10 min at 4 °C. The clear golden-yellow color supernatant was carefully removed and transferred to a sterile screw-capped clear polypropylene tube on ice. The serum is then stored at -80 °C until further use. The terminal blood collection was performed 24 h post injection. The Erythropoietin (EPO) protein level in sera samples was determined using the Ella kit (ProteinSimple, Catalog # SPCKB-PS-000487). SAF 06, 10, 15, 25, and 93 containing LNPs showed potent expression (FIGS. 2A-2B). Furthermore, this expression was superior compared to PEG-DMG containing LNPs. SAF 06, 10, 15, 25, and 93 containing LNPs showed potent expression. This example demonstrated the procedure used for the erythropoietin (EPO) expression evaluation of EPO-expressing LNPs in vivo.EXAMPLE 7
[0237] This example demonstrates an illustrative procedure used for the SARS-CoV-2 expression evaluation of SARS-CoV-2 expressing A5 PNI saRNA-LNPs in vivo.
[0238] LNPs were intramuscularly injected into groups of four mice (N =4, 6-week old male BALB / c mice) at a prime dose of 0.05 mg / kg (1 pg / 50 pL / 20-g mouse) on Day 0 and a booster dose of 0.05 mg / kg (1 pg / 50 pL / 20-g mouse) on Day 28 (7 days after the first sera collection). The sera samples were collected on Day -21 and Day-42 post-prime injection. For serum preparation, after collection of the whole blood, the blood was allowed to clot by leaving the collection tube at room temperature for 15-30 minutes. The clot was removed by centrifuging the tubes at 1000-2000 x g for 10 min at 4 °C. The clear golden-yellow color supernatant was carefully removed and transferred to a sterile screw-capped clear polypropylene tube on ice. The serum was then stored at - 80 °C until further use. The SARS-CoV-2 antigen specific IgG level in sera was determined using enzyme-linked immunoassay (ELISA) assay. SAF 29 and 34 containing LNPs induced the potent expression of SARS-CoV-2 spike protein specific IgGstiters in mice (FIGS. 3A-3B) along with booster response. SAF 06, 15, and 25 containing LNPs induced the expression of SARS-CoV-2 spike protein specific IgGs. Furthermore, this expression is similar to PEG-DMG containing LNPs. SAF 06, 15, and 25 containing LNPs induced the expression of SARS-CoV-2 spike protein specific IgGs. This example demonstrated the procedure used for the SARS-CoV-2 expression evaluation of SARS-CoV-2 expressing A5 PNI saRNA-LNPs in vivo.EXAMPLE 8
[0239] This example illustrates the physio-chemical properties of selected compositions. Size and PDI of the LNPs were measured by Dynamic Light Scattering (DLS) using a ZetaSizer™ Nano ZS™ (Malvern Instruments). He / Ne laser of 633 nm wavelength was used as the light source. Data were measured from the scattered intensity data conducted in backscattering detection mode (measurement angle = 173°). Measurements were an average of 10 runs of two cycles each per sample. Z - Average size was reported as the particle size and is defined as the harmonic intensity averaged particle diameter. Encapsulation efficiency (EE) of the LNPs was measured by Quant-iT™ RiboGreen® RNA reagent.
[0240] Table 4 Attributes of various LNPs formed based on polyglycerol-based stabilizersEXAMPLE 9
[0241] This example illustrates the T cell knock out studies performed ex vivo. Cryopreserved primary human pan T cells were thawed, activated using CD3 / CD28 / CD2 T cell activator and cultured (96 well-plate, 0.2 mL / well, 0.125 million cell / well) for 3 days in the incubator (37 °C, 95% humidity and 5% CO2). Afterwards, cells were treated with the TCR sgRNA / cas9 mRNA loaded LNPs (4 pg / well) for 24 h followed by washing for activator removal. The washed cells were kept in the complete media (IL-2 containing T cell expansion media) for 3 days in the incubator followed by staining and flow cytometry analysis. For cell staining, cells were stained with Anti-CD3 (PE conjugate), Anti-TCR a / p (FITC conjugate) and FVS660 dye (APC conjugate) according to the manufacturer’s protocols. The number of live cells and TCRa / p+ cells were calculated using CytExpert software and the T cell receptor (TCR) knockout efficiency (%) of the LNP samples was calculated and shown in FIG. 4.EXAMPLE 10
[0242] This example illustrates the in vitro studies of GFP expression. Cells (BHK, U937, Jurkat, and HeLa) were cultured and seeded (96 well-plate, 0.1 mL / well, 12,000 cell / well).Afterwards, cells were treated with the GFP mRNA loaded LNPs for 24 h followed by analysis (fluorescence microscopy for BHK and U937 cells and flow cytometry for Jurkat and HeLa).The results are shown in FIGS. 5A-5D.EXAMPLE 11
[0243] This example illustrates the T cell GFP ex vivo expression studies. Cryopreserved primary human pan T cells were thawed, activated using CD3 / CD28 / CD2 T cell activator and cultured (96 well-plate, 0.2 mL / well, 0.125 million cell / well) for 3 days in the incubator (37 °C, 95% humidity and 5% CO2). Afterwards, cells were treated with the GFP mRNA loaded LNPs (4 pg / well) for 24 h followed by staining and flow cytometry analysis. For cell staining, cells were stained with FVS660 dye (BD Biosciences) according to the manufacturer’s protocols. The data were interpreted using CytExpert software and the transfection efficiency (TE) % and mean fluorescence intensity (MFI) of the LNP samples were calculated and shown in FIGS. 6A-6B.EXAMPLE 12
[0244] This example illustrates the in vivo vaccine studies. This study describes the procedure used for the SARS-CoV-2 expression evaluation of SARS-CoV-2 expressing A5 PNI saRNA-LNPs in vivo. LNPs were intramuscularly injected into mice (6-week old male BALB / c mice) at a prime dose of 0.05 mg / kg (1 pg / 20-g mouse) on Day 0 and a booster dose of 0.05 mg / kg (1 pg / 20-g mouse) on Day 28 (7 days after the first sera collection). The sera samples were collected 21 and 42 days post-prime injection. For serum preparation, after collection of the whole blood, the blood was allowed to clot by leaving the collection tube at room temperature for 15-30 minutes. The clot was removed by centrifuging the tubes at 1000-2000 x g for 10 min at 4 °C. The clear golden -yellow color supernatant was carefully removed and transferred to a sterile screw-capped clear polypropylene tube on ice. The serum was then stored at - 80 °C until further use. The SARS-CoV-2 antigen specific IgG level in sera was determined using enzyme- linked immunoassay (ELISA) assay and shown in FIGS. 7A-7B.EXAMPLE 13
[0245] This example illustrates the in vivo protein replacement studies. This study describes the procedure used for the erythropoietin (EPO) expression evaluation of EPO-expressing LNPs in vivo. LNPs were intravenously injected into mice (6-week old female C57 BL6 mice) at a single dose of 0.25 mg / kg. The sera samples were collected 6 h post-injection via the tail nick method. For serum preparation, after collection of the whole blood, the blood was allowed to clot by leaving the collection tube at room temperature for 15-30 minutes. The clot was removed bycentrifuging the tubes at 1000-2000 x g for 10 min at 4 °C. The clear golden-yellow color supernatant was carefully removed and transferred to a sterile screw-capped clear polypropylene tube on ice. The serum was then stored at -80 °C until further use. The terminal blood collection was performed 24 h post injection. The Erythropoietin (EPO) protein level in sera samples was determined using the Ella kit (ProteinSimple, Catalog # SPCKB-PS-000487) and shown in FIGS. 8A-8BEXAMPLE 14
[0246] This example illustrates the in vivo subcutaneous studies. This study describes the procedure used for the erythropoietin (EPO) expression evaluation of EPO-expressing LNPs in vivo. LNPs were subcutaneously injected into mice (6-week old female C57 BL6 mice) at a single dose of 0.25 mg / kg. The sera samples were collected 6h post-injection via the tail nick method. For serum preparation, after collection of the whole blood, the blood was allowed to clot by leaving the collection tube at room temperature for 15-30 minutes. The clot was removed by centrifuging the tubes at 1000-2000 x g for 10 min at 4 °C. The clear golden-yellow color supernatant was carefully removed and transferred to a sterile screw-capped clear polypropylene tube on ice. The serum was then stored at -80 °C until further use. The terminal blood collection was performed 24 h post injection. The Erythropoietin (EPO) protein level in sera samples was determined using the Ella kit (ProteinSimple, Catalog # SPCKB-PS-000487) and shown in FIG.9EXAMPLE 15
[0247] This example illustrates the in vivo biodistribution (BD) studies. This study describes the procedure used for the firefly-luciferase (Flue) expression evaluation of Flue-expressing LNPs in vivo. LNPs were intravenously injected into mice (6-week old female Hsd:IRC mice) at a single dose of 0.1 mg / kg. Four hours after administration, mice were given an intraperitoneal injection of D-luciferin substrate solution (150 mg / kg, 200 pL / 20g) followed by anesthetizing with isoflurane and imaged at 12 minutes post-administration with the exposure time of 30 s. Post-imaging, blood and organs (liver, lung, spleen, kidney, heart) were collected, rinsed with PBS, and imaged ex vivo with exposure times of 1 s, 5 s, 10 s, and 30 s. Liver and blood (500 pL) were imaged separately. Bioluminescence values were quantified by measuring photon flux (photons / second) using the Living Image® software program for both in vivo and ex vivoimaging. FIG. 10 shows that the polyglycerols had higher extrahepatic selectivity than PEG- DMG.
[0248] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[0249] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
Claims
CLAIM(S):
1. A stabilizing agent comprising a structure of formula (I):wherein Ri is hydrogen, Cuis substituted or unsubstituted heteroalkyl group, Cuis unsaturated heteroalkyl group, C1-18 heterocyclyl group, Cuis charged heteroalkyl group, or Cuis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; R3 is hydrogen, a targeting ligand, a hydrophilic group, an amphiphilic group, or a combination thereof; A is a Ci- C50 substituted or unsubstituted heteroalkyl group, a C1-C50 unsaturated heteroalkyl group, or a combination thereof; and m is an integer from 5 to 1000.
2. The stabilizing agent of claim 1, wherein Ri is hydrogen, C1-5 substituted or unsubstituted heteroalkyl group, C1-5 unsaturated heteroalkyl group, C1-5 heterocyclyl group, C1-5 charged heteroalkyl group, C1-5 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and m is an integer from 5 to 80.
3. The stabilizing agent of claims 1 or 2, wherein A is4. The stabilizing agent of any one of claims 1-3, wherein R3 is hydrogen, a peptide, an antibody, a sugar, an oligosaccharide, an aminoglycoside, a sterol, phenyl boronic acid, or a combination thereof.
5. The stabilizing agent of any one of claims 1-4, wherein the stabilizing agent is selected from the group consisting of SAF06, SAF10, SAF15, SAF25, SAF89, SAF92, SAF93, SAFI 82, SAFI 83, SAFI 84, or a combination thereof.
6. A stabilizing agent comprising a structure of formula (II):wherein Y is hydrogen, methyl, C1-C24 substituted or unsubstituted heteroalkyl group, Ci-Cis unsaturated heteroalkyl group, C1-C24 heterocyclyl group, Ci-Cis charged heteroalkyl group, Ci- Cis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 heterocyclyl group, C1-C50 charged heteroalkyl group, C1-C50 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 600.
7. The stabilizing agent of claim 6, wherein Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C1-C35 substituted or unsubstituted heteroalkyl group, C1-C35 unsaturated heteroalkyl group, C1-C35 heterocyclyl group, C1-C35 charged heteroalkyl group, Ci-C35 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 90.
8. The stabilizing agent of claims 6 or 7, wherein Xi, X2, X3, X4, X5 and Xe are each independently hydrogen,thereof.
9. The stabilizing agent of any one of claims 6-8, wherein the stabilizing agent is selected from the group consisting of SAF19, SAF97, SAF98, SAF128, or a combination thereof.
10. The stabilizing agent of any one of claims 1 to 9, wherein the stabilizing agent is used for stabilizing a lipid nanoparticle or liposome.
11. A lipid nanoparticle composition comprising: (a) an ionizable lipid; (b) two or more lipids; and (c) the stabilizing agent of any one of claims 1-10.
12. The lipid nanoparticle composition of claim 11, wherein the two or more lipids comprises a structural lipid, a sterol, or a combination thereof.
13. The lipid nanoparticle composition of claim 11 or 12 consisting essentially of: (a) an ionizable lipid; (b) two lipids; and (c) the stabilizing agent of any one of claims 1-10.
14. The lipid nanoparticle composition of claim 13, wherein the lipid nanoparticle composition is substantially free of PEG or PEG-R, wherein R is any atom or molecule covalently attached to PEG.
15. The lipid nanoparticle composition of any one of claims 12-14, wherein the structural lipid is neutrally charged, positively charged, or negatively charged.
16. The lipid nanoparticle composition of any one of claims 11-15, wherein the ionizable lipid is DODMA, DLin-MC3-DMA, DLin-KC2-DMA, BOCHD-C3-DMA, C12-200, PNI 516, PNI 127, PNI 550, PNI 580, PNI 659, PNI 728, PNI 762, or a combination thereof.
17. The lipid nanoparticle composition of any one of claims 11-16, wherein the structural lipid comprises diacylphosphatidylcholines, diacylphosphatidylethanolamines, diacylphosphatidylglycerols, ceramides, sphingomyelins, dihydrosphingomyelins, cephalins, cerebrosides, or a combination thereof.
18. The lipid nanoparticle composition of any one of claims 11-17, wherein the structural lipid comprises distearoylphosphatidylcholine, dioleoylphosphatidylcholine, dipalmitoylphosphatidylcholine, dioleoyl-phosphatidylethanolamine, palmitoyloleoylphosphatidylcholine, l-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine, palmitoyloleoyl-phosphatidylethanolamine, dioleoyl-phosphatidylethanolamine 4-(N- maleimidomethyl)-cyclohexane-l -carboxylate, dipalmitoyl phosphatidyl ethanolamine, dimyristoylphosphoethanolamine, distearoyl -phosphatidylethanolamine, 1,2-dipalmitoyl-sn- glycero-3-phosphoethanolamine-N-methyl, l,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N,N-dimethyl, l,2-dielaidoyl-sn-glycero-3-phosphoethanolamine, 1 -stearoyl -2-oleoyl- phosphatidy ethanol amine, l,2-dielaidoyl-sn-glycero-3-phophoethanolamine, distearoylphosphatidylcholine, dioleoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, palmitoyloleyolphosphatidylglycerol, cardiolipin, phosphatidylinositol, diacylphosphatidylserine, diacylphosphatidic acid, monosial oganglioside GM1, or a combination thereof.
19. The lipid nanoparticle composition of any one of claims 11-18, wherein the sterol comprises cholesterol, beta-sitosterol, 20-alpha-hydroxysterol, phytosterol, or a combination thereof.
20. The lipid nanoparticle composition of any one of claims 11-19, wherein the stabilizing agent has a molecular weight of about 500 Da to about 50,000 Da.
21. The lipid nanoparticle composition of any one of claims 11-20, wherein the lipid nanoparticle composition comprises about 20 to about 70 mol% ionizable lipid, about 1 to about 25 mol% structural lipid, about 28 to about 50 mol% sterol, and about 0.1 to about 5 mol% stabilizing agent.
22. A lipid nanoparticle comprising the lipid nanoparticle composition of any one of claims 11-21 and a nucleic acid.
23. The lipid nanoparticle of claim 22, wherein the nucleic acid is encapsulated by the lipid nanoparticle composition.
24. The lipid nanoparticle of claim 22 or 23, wherein the nucleic acid comprises an antisense oligonucleotide, a siRNA, a miRNA, a self-amplifying RNA (samRNA or saRNA), a self-replicating DNA, an LNA, a DNA, a replicon, an mRNA, a guide RNA, a transposon, a single gene, a vector, a plasmid, a viral particle, an AAV, a complex of RNA and RNA-binding protein, or a combination thereof.
25. The lipid nanoparticle of any one of claims 22-24, wherein the nucleic acid is an antigen encoded mRNA for prophylactic or therapeutic vaccine, a nucleic acid for gene therapy, or a nucleic acid for immunogenic cell incorporation, wherein the immunogenic cell is a T cell.
26. The lipid nanoparticle of any one of claims 22-25, wherein the lipid nanoparticle diameter is about 15 nm to about 500 nm.
27. The lipid nanoparticle of any one of claims 22-26, wherein the lipid nanoparticle has a poly dispersity index of about 0.01 to about 0.40.
28. The lipid nanoparticle of any one of claims 22-27, wherein the lipid nanoparticle has an encapsulation efficiency of about 50% to about 100%.
29. A pharmaceutical composition comprising the lipid nanoparticle of any one of claims 22-28 and a pharmaceutically acceptable carrier.
30. A method for preparing the lipid nanoparticle of any one of claims 22-28 or the pharmaceutical composition of claim 29, the method comprising:(i) forming the lipid nanoparticle composition by combining the ionizable lipid, structural lipid, sterol and stabilizing agent;(ii) preparing the lipid nanoparticle by combining the lipid nanoparticle composition and the nucleic acid using a microfluidic mixer; and(iii) purifying the lipid nanoparticle.
31. The method of claim 30, wherein the lipid nanoparticle composition and the nucleic acid are combined using a flow ratio of about 1 : 1 to about 10: 1 by volume (aqueous phase: organic phase) at a N / P ratio of about 2 to about 20, and a total flow rate of about 2 to about 2000 mL / min.
32. The method of claim 31, wherein the aqueous phase comprises a low pH buffer.
33. The method of claims 31 or 32, wherein the aqueous phase comprises a citrate or acetate buffer.
34. The method of any one of claims 31-33, wherein the organic phase comprises 1,4- dioxane, tetrahydrofuran, acetone, acetonitrile, dimethyl sulfoxide, dimethylformamide, acids, alcohols, or a combination thereof.
35. The method of any one of claims 31-34, wherein the organic phase is an alcohol and the alcohol comprises aqueous or anhydrous alcohol, wherein the alcohol is a primary, secondary, or tertiary alcohol having from 1 to 12 branched or unbranched carbons.
36. Use of the lipid nanoparticle of any one of claims 22-28 or the pharmaceutical composition of claim 29 for preventing, treating, or ameliorating conditions or diseases including administering the lipid nanoparticle as a vaccine or as a treatment to prevent or reduce the severity of a contagion, administering the lipid nanoparticle as a gene therapeutic, or administering the lipid nanoparticle to an immunogenic cell for the treatment of cancer or an infection.