Compound for regulating activity or expression of mtor and use therof
Patent Information
- Application Number
- CA3319014
- Authority / Receiving Office
- CA · CA
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-14
- Filing Date
- 2025-01-31
- Publication Date
- 2026-09-21
AI Technical Summary
Current treatments for diseases and disorders associated with hyperactivation or overexpression of the mTOR pathway, such as focal cortical dysplasia and epilepsy, are inadequate due to the resistance of mTORC2 to rapamycin and the variability in response to small molecule inhibitors.
Development of RNA-targeted therapeutics, including antisense oligonucleotides and RNAi agents, that specifically target the mTOR gene to modulate the activity and expression levels of both mTORC1 and mTORC2 complexes, thereby inhibiting their hyperactivation.
The RNA-targeted therapeutics effectively reduce mTOR expression and activity, providing a broad-spectrum treatment for conditions caused by mTOR hyperactivation, including focal cortical dysplasia and epilepsy, by inhibiting both mTORC1 and mTORC2 complexes.
Abstract
Description
Compounds for modulating MTOR activity or expression and uses thereof
[0001] The present invention relates to RNA-targeted therapeutics for modulating the expression level and / or activity of the mTOR gene, and more particularly, to compounds and compositions comprising the same, wherein the compounds and compositions are useful for preventing, treating, or alleviating diseases, disorders, and conditions associated with mTOR.
[0002] The mammalian (or mechanistic) target of rapamycin (mTOR) pathway plays a crucial role in regulating diverse biological processes central to cellular life, aging, and death. Given its ubiquitous distribution in diverse cell types throughout the body, the mTOR pathway controls multiple anabolic and catabolic processes in distinct organs and tissues, including but not limited to the liver, lymphocytes, white and brown adipose tissue, skeletal muscle, and the brain. Therefore, impaired mTOR activity, particularly hyperactivation, has been linked to a wide range of human diseases, including cancer, type 2 diabetes, cardiovascular pathology, brain disease, and aging.
[0003] mTOR is a 289 kDa protein kinase encoded by the MTOR gene (1p36.2) in humans. MTOR is an intracellular serine / threonine kinase that plays a crucial role in the proper performance of physiological functions in the body. MTOR forms complexes with other proteins to mediate intracellular signaling pathways. Based on the types of constituent proteins, MTOR complex 1 (MTORC1) and MTOR complex 2 (MTORC2) are distinguished. MTORC1 contains RAPTOR (regulatory associated protein of mTOR) as a component and plays a crucial role in cell growth and proliferation by regulating ribosome biogenesis and protein expression. MTORC2 contains RICTOR (rapamycin-insensitive companion of mTOR) as a component and plays a crucial role in cytoskeletal reorganization and cell migration. These mTOR-containing complexes also differ in terms of upstream regulators, substrate specificity, functional output, and sensitivity to rapamycin. Sensitivity to rapamycin is another important feature that distinguishes mTORC1 and mTORC2 complexes. Rapamycin does not directly inhibit the catalytic (kinase) activity of mTOR. Instead, it binds to the 12-kDa FK506-binding immunophilin FKBP12, a protein that binds to the mTOR FKBP-rapamycin binding domain (FRB). Although the FRB domain is present in both mTORC1 and mTORC2 complexes, Rictor blocks access of the FKBP12-rapamycin complex to the FRB domain of mTORC2, making it only exposed in mTORC1. Consequently, mTORC2 is relatively resistant to the effects of rapamycin both in vitro and in vivo.
[0004] One example of the present invention relates to RNA-targeted therapeutics for modulating the activity and / or expression level of MTOR, including, for example, RNAi agents, antisense oligonucleotides, miRNAs, and the like.
[0005] One example of the present invention relates to a compound for modulating the activity and / or expression level of MTOR, a pharmaceutical composition, method or use of the compound for preventing, improving and / or treating a disease, disorder and condition associated with MTOR comprising the compound as an active ingredient.
[0006] A further example of the present invention relates to a composition or method for modulating the activity and / or expression level of MTOR using a compound for modulating the activity and / or expression level of MTOR.
[0007] The compound for regulating the activity and / or expression level of the above MTOR may be an oligomeric compound and / or an RNAi agent, wherein the oligomeric compound may be an antisense oligonucleotide, and the RNAi agent may include, but is not limited to, ssRNAi, siRNA, shRNA, and miRNA.
[0008] One embodiment of the present invention relates to a compound for modulating the activity and / or expression level (amount) of MTOR, and a pharmaceutical composition or method for preventing, ameliorating, and / or treating diseases, disorders, and conditions associated with MTOR, comprising the compound as an active ingredient. In addition, one embodiment of the present invention relates to a compound for modulating the activity and / or expression level (amount) of MTOR, and a pharmaceutical composition or method for preventing, ameliorating, and / or treating diseases, disorders, and conditions mediated by MTOR, comprising the compound as an active ingredient.
[0009] A specific embodiment of the present invention relates to a method for preventing, ameliorating, and / or treating diseases, disorders, and conditions associated with MTOR, comprising administering to a subject or patient in need thereof a compound for modulating the activity and / or expression level of MTOR. The term "expression," as used herein, refers to the process by which a polynucleotide produces a gene product, such as RNA or a polypeptide (or protein, etc.).
[0010] More specifically, the present invention relates to pharmaceutical compositions or methods for preventing, ameliorating, and / or treating diseases, disorders, and conditions caused by overactivation or overexpression of MTOR.
[0011] As used herein, “subject,” “patient,” or “subject” means a human or non-human animal selected for treatment or therapy, and non-human animals may include, but are not limited to, mammals such as monkeys, rats, mice, rabbits, guinea pigs, and others.
[0012] A specific embodiment of the present invention relates to compounds for modulating the activity and / or expression level (amount) of MTOR, which are oligomeric compounds and / or RNAi agents. One embodiment provides methods, compounds, and compositions for inhibiting MTOR mRNA and protein expression, inhibiting MTOR protein activity, or reducing mRNA and protein levels. In a specific embodiment, the compound for modulating the activity and / or expression level (amount) of MTOR may be an inhibitor that reduces or inhibits the activity and / or expression level (amount) of MTOR.
[0013] Hyperactivation of the MTOR signaling pathway can occur due to mutations in the MTOR gene itself or genes upstream of MTOR, or due to disruption of the homeostasis of other signaling pathways. For example, focal cortical dysplasia (FCD), a representative pediatric intractable epilepsy disease, is classified as a focal malformation of cortical development (FMCD) disease along with hemilateral megalencephaly (HME). It is well known that the genetic cause of these diseases is brain-specific somatic mutations that induce hyperactivation of the MTOR signaling pathway.
[0014] In particular, mutations in the MTOR gene itself, which account for approximately 60% of the various genetic mutations found in patients with FCD type II disease, can alter the structure of the MTOR protein, resulting in hyperactivation of both MTORC1 and MTORC2. It is well known from previous literature that both the MTORC1 and MTORC2 complexes can cause FMCD refractory epilepsy.
[0015] The MTOR target antisense oligonucleotide (ASO) of the present invention reduces the MTOR expression level by degrading the mRNA of the MTOR gene, which in turn reduces the expression level of MTOR itself, which is a common component of the two complexes, thereby inducing inhibition of the activity of both the MTORC1 and MTORC2 complexes, and thus can be used as a drug for treating FMCD refractory epilepsy. In particular, MTOR proteins altered due to mutations may respond differently to small molecule MTOR inhibitors, and the MTOR antisense oligonucleotide of the present invention can overcome this problem.
[0016] The compound according to the present invention may be a disease, disorder, or condition related to MTOR, specifically a disease, disease, disorder, or condition caused by overactivation or overexpression of MTOR, and the mTOR overactivation or overexpression may be due to a gene alteration of the mTOR gene or a gene in a signaling pathway including the mTOR gene, and such gene alteration includes both germline alteration and somatic alteration.
[0017] Examples of the diseases, disorders, or conditions described above may include tumors, neurological disorders, and renal diseases. Neurological disorders include neurodevelopmental and neurodegenerative diseases. Neurodevelopmental disorders may include mTOR pathologies, epilepsy, and seizure-related disorders. mTORpathies include Focal Cortical Dysplasia (FCD) due to somatic mutations, such as FCD type II, and Hemimegalencephaly (HME), and Tuberous Sclerosis Complex (TSC), Megalencephaly (MEG), Cowden Syndrome, PIK3CA-Related Overgrowth Spectrum (PROS), Bannayan-Riley-Ruvalcaba Syndrome (BRRS), Lhermitte-Duclos Disease (LDD), Megalencephaly-Polydactyly-Polymicrogyria-Hydrocephalus (MCAP), Megalencephaly-Polymicrogyria-Hydrocephalus (MPPH), Smith-Kingsmore Syndrome (SKS), Polyhydramnios, Megalencephaly and Symptomatic Epilepsy Syndrome (PMSE), Familial Intellectual Disorders (FAIDs), and Disability-Macrocephaly Syndrome, and Proteus Syndrome. These neurodevelopmental disorders include Fragile X-Syndrome (FXS) and Autism spectrum disorder (ASD).The above neurodevelopmental disorder specifically includes malformations of cortical development (MCDs), examples of the MCD include tuberous sclerosis complex (TSC), focal cortical dysplasia (FCD), for example, focal cortical dysplasia type II (FCDII), HME, etc., and also includes epilepsy, seizures, etc. as symptoms related to the MCD.
[0018]
[0019] The above-mentioned Epilepsy and Seizure-Related Disorders include Familial Focal Epilepsy with Variable Foci (FFEVF), Autosomal Dominant Nocturnal Epilepsy (ADNFLE), Familial Mesial Temporal Lobe Epilepsy (FMTLE), Temporal Lobe Epilepsy (TLE), and Infantile-Onset Developmental and Epileptic Encephalopathies (DEE).
[0020] The above neurodegenerative diseases include Alzheimer's Disease (AD), Parkinson's Disease (PD), Huntington's Disease (HD), and Amyotrophic Lateral Sclerosis (ALS).
[0021] The above tumors include solid cancers and neuro-oncological tumors, and solid cancers include lung cancer, colorectal cancer, gastric cancer, renal cell carcinoma, bladder cancer, prostate cancer, and breast cancer. The neuro-oncological tumors include ganglioma, glioblastoma, dysembryoplastic neuroepithelial tumor (DNET), subependymal giant cell astrocytomas (SGCAs / SEGAs), etc.
[0022] The above kidney diseases may include kidney transplantation, polycystic kidney disease (PKD), renal carcinoma, and diabetic nephropathy, and specific examples include autosomal dominant polycystic kidney disease (ADPKD) or autosomal recessive polycystic kidney disease (ARPKD), which are genetic diseases characterized by the formation of renal cysts, which are known to be caused by mutations in two genes, PKD1 and PKD2, which encode polycystin-1 (PC-1) and polycystin-2 (PC-2), respectively. In addition, ARPKD patients are known to be caused by mutations in the PKHD1 gene. Preclinical results have been reported that mTOR inhibitors delay cyst growth and preserve renal function in PKD patients. Therefore, the present compound can be used for renal diseases associated with mTOR overactivity or overexpression, such as polycystic kidney disease or symptoms thereof, such as cyst growth delay, preservation of renal function, etc.
[0023]
[0024] In the present invention, the compound for regulating the activity and / or expression level of MTOR is a compound useful for specifically regulating the activity of mTOR complex 1 (mTORC1) and / or mTOR complex 2 (mTORC2). In particular, the compound according to the present invention targets the MTOR gene and regulates the activity and / or expression of the m TOR protein commonly included in mTORC1 and mTORC2, and thus can regulate both mTORC1 and mTORC2. In particular, in the case of mutations in the MTOR gene itself, which account for approximately 60% of the various genetic mutations found in patients with FCD type II disease, the structure of the MTOR protein is altered, which can cause hyperactivation of both MTORC1 and MTORC2. Since both the MTORC1 and MTORC2 complexes can cause FMCD refractory epilepsy, the compound according to the present invention has the advantage of being able to act on all FMCD diseases caused by various genetic mutations.
[0025] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an antisense compound is designed to affect. "Target RNA" refers to an RNA transcript, including pre-mRNA and mRNA, unless otherwise specified. As used herein, "RNA" refers to an RNA transcript, including both pre-mRNA and mature mRNA, unless otherwise specified.
[0026] As used herein, "target region" refers to a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize. Here, the "target nucleic acid" and "target RNA" are MTOR. As used herein, the MTOR gene may be a human mTOR gene sequence, a known reference transcript, or a variant thereof, and may be identified in various genetic databases. Specifically, the MTOR nucleic acid sequence, e.g., the human MTOR nucleic acid sequence, can be identified by the NCBI (National Center for Biotechnology Information) Reference sequence Nucleotide ID NG_033239.1 and is located at genomic location 11,106,535 to 11,262,551 on chromosome 1 (corresponding to nucleotides 11,106,535 to 11,262,551 of NCBI Reference sequence Nucleotide ID NC_000001.11 or Ensembl database transcriptome sequence ENST00000361445.9). The coordinates used herein refer to the coordinates of the genome reference assembly GRCh38 (Genome Research Consortium human build 38), also known as Hg38 (Human Genome Build 38).
[0027] The present invention relates to RNA-targeted therapeutics for modulating the activity and / or expression levels of MTOR, including, for example, RNAi agents, antisense oligonucleotides, miRNAs, etc. Specifically, the compounds according to the present invention include, but are not limited to, antisense oligonucleotides and RNA interference agents (RNAi agents) against MTOR nucleic acids. The RNA-targeted therapeutics may be oligonucleotides or RNAi agents having a sequence complementary to a human MROR nucleic acid sequence and containing 8 to 80 nucleotides.
[0028] The above RNAi agent refers to an antisense agent that acts at least in part through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. The RNAi agent is not intended to include antisense oligonucleotides.
[0029] An example of the RNAi agent may be a double-stranded RNAi agent, such as siRNA, which may comprise an antisense strand complementary to a target gene and a sense strand complementary to the antisense strand, and optionally may comprise one or more lipophilic moieties conjugated to one or more internal positions of at least one strand, optionally via a linker or carrier. The sense and antisense strands may each be, but are not limited to, 19 to 25 nucleotides in length.
[0030] Specifically, the nucleobase of the mTOR sequence (Ensembl Nucleotide ID ENST00000361445.9) to be complementarily bound may be GAATGTTGACCAATGCTAT (SEQ ID NO: 464), GGTCTGAGTTTAAGGTCTA (SEQ ID NO: 465), or GGTCTGAGTTTAAGGTCTA (SEQ ID NO: 465), and examples of the sense sequence and antisense sequence of the siRNA that act on these target sequence regions may be the nucleobase sequences set forth in SEQ ID NO: 456 to SEQ ID NO: 463, but are not limited thereto.
[0031] The lipophilic moiety may be an aliphatic, alicyclic, or polyalicyclic compound, and specifically may be a lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexianol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, a heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine, or may contain a saturated or unsaturated C4-C30 hydrocarbon chain and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. More specifically, the lipophilic moiety may contain a saturated or unsaturated C6-C18 hydrocarbon chain, and a detailed description thereof can be found in WO2019217459A1, etc.
[0032] The MTOR inhibitor according to the present invention may comprise a conjugate group and / or a terminal group. In certain embodiments, the MTOR inhibitor modulates the amount and / or activity of a target nucleic acid. The conjugate moiety modifies one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, uptake, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugate moiety imparts new properties to the attached oligonucleotide. As used herein, "conjugate group" means a group of atoms directly attached to an oligonucleotide. The conjugate group comprises a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
[0033] As used herein, the term "inhibiting expression or activity" refers to a reduction or inhibition of expression or activity compared to expression or activity in an untreated or control sample, and does not necessarily refer to a complete elimination of expression or activity. Specifically, the antisense oligomer or RNAi agent according to the present invention may be capable of reducing MTOR expression levels by 70% or less, 65% or less, 60% or less, or 50% or less.
[0034] In certain embodiments, the oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid to produce at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, the antisense compounds have antisense activity when they reduce or inhibit the amount or activity of the target nucleic acid by at least 25% in a standard cell assay. In certain embodiments, the antisense compounds selectively affect one or more target nucleic acids.
[0035] In certain embodiments, the MTOR inhibitor may cause a decrease in the activity or expression level of MTOR RNA or MTOR protein of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, relative to 0% of a control group prior to treatment and not treated with the MTOR inhibitor. Or, the activity or expression level of MTOR RNA or MTOR protein may be about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, based on 100% of the control group before treatment and not treated with the MTOR inhibitor.
[0036] The MTOR inhibitor according to the present invention may be an antisense oligonucleotide, wherein an antisense oligonucleotide refers to an oligonucleotide having a nucleic acid sequence complementary to a target nucleic acid or a region or segment thereof. In certain embodiments, the antisense oligonucleotide is capable of specifically hybridizing to a target nucleic acid or a region or segment thereof. As used herein, "antisense oligonucleotide" refers to an oligonucleotide comprising an oligonucleotide portion of an antisense compound capable of hybridizing to a target nucleic acid and having at least one antisense activity. The terms "antisense oligonucleotide," "antisense compound," "antisense oligonucleotide," or "antisense RNase H oligonucleotide" are used interchangeably and each refers to a base-pairing moiety linked by a nucleobase bond that allows the base-pairing moiety to hybridize. In such embodiments, the portion of the oligonucleotide has a nucleobase sequence complementary to the target nucleobase sequence. In specific embodiments, a region or the entire length of the nucleotide sequence of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% complementary to a target gene or target region. The term "antisense RNase H oligonucleotide" means an oligonucleotide comprising a region that is complementary to a target sequence and includes at least one chemical modification suitable for RNase H-mediated nucleic acid reduction.
[0037] In the present specification, compounds for modulating the activity and / or expression level (amount) of MTOR, for example, oligonucleotides, also include pharmaceutically acceptable salts thereof, and the “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of a compound, for example, an oligomeric compound or an oligonucleotide, i.e., a salt that retains the desired biological activity of the parent compound and does not cause undesirable toxicological effects.
[0038]
[0039] One embodiment relates to an oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleic acid sequence of the modified oligonucleotide is at least 80% complementary to an identical length portion of an MTOR nucleic acid sequence, and wherein the modified oligonucleotide comprises one or more modifications selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage, and a modified base.
[0040] Another embodiment relates to an oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleic acid sequence of the modified oligonucleotide comprises 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from the nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 439, wherein the modified oligonucleotide comprises one or more modifications selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage and a modified base.
[0041] "Oligomer compound" means a compound comprising a single oligonucleotide and optionally one or more additional features, such as a conjugating group or a terminal group. "Oligonucleotide" means a polymer of linked nucleosides, each of which may or may not be modified independently of the others. Unless otherwise specified, the oligonucleotides may have 8 to 80 subunits, 8 to 70 subunits, 8 to 60 subunits, 8 to 50 subunits, 8 to 40 subunits, 8 to 30 subunits, 8 to 25 subunits, 8 to 22 subunits, 8 to 20 subunits, 10 to 80 subunits, 10 to 70 subunits, 10 to 60 subunits, 10 to 50 subunits, 10 to 40 subunits, 10 to 30 subunits, 10 to 25 subunits, 10 to 22 subunits, 10 to 20 subunits, 12 to 80 subunits, 12 to 70 subunits, 12 to 60 subunits, 12 to 50 subunits, 12 to 40 subunits, 12 to It may comprise at least one subunit selected from the group consisting of 30, 12 to 25, 12 to 22, 12 to 20, 14 to 80, 14 to 70, 14 to 60, 14 to 50, 14 to 40, 14 to 30, 14 to 25, 14 to 22, 14 to 20, 16 to 80, 16 to 70, 16 to 60, 16 to 50, 16 to 40, 16 to 30, 16 to 25, 16 to 22, or 16 to 20.
[0042] The length of an oligonucleotide can be increased or decreased without abolishing its activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides ranging from 13 to 25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. An oligonucleotide 25 nucleobase long with 8 or 11 mismatched bases near the ends of the oligonucleotide could direct specific cleavage of the target RNA, albeit to a lesser extent than an oligonucleotide without mismatches.
[0043] As used herein, "adjacent" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "adjacent nucleobases" means nucleobases that are immediately adjacent to each other in the sequence.
[0044] As exemplary oligomeric compounds of the present invention, nucleobase sequences that complementarily bind to human MOTR sequences are shown in Tables 1 to 4 below, and the start point and end point of Tables 1 to 4 below indicate the base positions of the MTOR nucleic acid (Ensembl Nucleotide ID ENST00000361445.9) provided by Ensemble.
[0045] Compound IDSEQ ID NO시작점(Start point)끝점(End point)서열(5’ to 3’)5340011155,944155,963TGGTGTCTAGACATGGCTAC5340022155,943155,962GGTGTCTAGACATGGCTACA5340033155,942155,961GTGTCTAGACATGGCTACAC5340044155,941155,960TGTCTAGACATGGCTACACT5340055155,940155,959GTCTAGACATGGCTACACTT5340066155,937155,956TAGACATGGCTACACTTTAT5340077155,935155,954GACATGGCTACACTTTATAC5340088155,934155,953ACATGGCTACACTTTATACT5340099155,933155,952CATGGCTACACTTTATACTT53401010155,931155,950TGGCTACACTTTATACTTTG53401111155,930155,949GGCTACACTTTATACTTTGT53401212155,929155,948GCTACACTTTATACTTTGTG53401313155,928155,947CTACACTTTATACTTTGTGC53401414155,927155,946TACACTTTATACTTTGTGCA53401515155,925155,944CACTTTATACTTTGTGCATT53401616155,923155,942CTTTATACTTTGTGCATTTA53401717155,921155,940TTATACTTTGTGCATTTAGT53401818155,920155,939TATACTTTGTGCATTTAGTT53401919155,919155,938ATACTTTGTGCATTTAGTTG53402020155,905155,924TAGTTGAGTATTTGTTCTGC53402121155,904155,923AGTTGAGTATTTGTTCTGCT53402222155,876155,895CCAATATGTACCAGACCTTC53402323155,875155,894CAATATGTACCAGACCTTCC53402424155,874155,893AATATGTACCAGACCTTCCC53402525155,873155,892ATATGTACCAGACCTTCCCT53402626155,872155,891TATGTACCAGACCTTCCCTG53402727155,871155,890ATGTACCAGACCTTCCCTGT53402828155,867155,886ACCAGACCTTCCCTGTGTTC53402929155,866155,885CCAGACCTTCCCTGTGTTCA53403030155,865155,884CAGACCTTCCCTGTGTTCAG53403131155,864155,883AGACCTTCCCTGTGTTCAGC53403232155,863155,882GACCTTCCCTGTGTTCAGCA53403333155,854155,873TGTGTTCAGCACCTCCATGA53403434155,852155,871TGTTCAGCACCTCCATGACA53403535155,851155,870GTTCAGCACCTCCATGACAG53403636155,843155,862CCTCCATGACAGTATTTCTG53403737155,842155,861CTCCATGACAGTATTTCTGT53403838155,819155,838CTGAGCCCTTGCTCTAAACA53403939155,818155,837TGAGCCCTTGCTCTAAACAG53404040155,817155,836GAGCCCTTGCTCTAAACAGA53404141155,816155,835AGCCCTTGCTCTAAACAGAG53404242155,815155,834GCCCTTGCTCTAAACAGAGT53404343155,814155,833CCCTTGCTCTAAACAGAGTA53404444155,813155,832CCTTGCTCTAAACAGAGTAT53404545155,812155,831CTTGCTCTAAACAGAGTATT53404646155,768155,787CCCTGCTGCAGAAGGCCAGT53404747155,715155,734TGCATCTGCTCAGCCGAGGC53404848155,629155,648CATCACTGGGTCTGATGGAA53404949155,628155,647ATCACTGGGTCTGATGGAAG53405050155,625155,644ACTGGGTCTGATGGAAGACA53405151155,588155,607TTGGCCTATCTTGCAAACAT53405252155,584155,603CCTATCTTGCAAACATTTCT53405353155,550155,569ACCAGTGAGGTCTTGGGATA53405454155,491155,510GTCTAGGATCCTAATCCATG53405555155,490155,509TCTAGGATCCTAATCCATGT53405656155,427155,446CCCATGTTGAGAGGAGCAAC53405757155,426155,445CCATGTTGAGAGGAGCAACT53405858155,425155,444CATGTTGAGAGGAGCAACTA53405959155,424155,443ATGTTGAGAGGAGCAACTAG53406060155,418155,437AGAGGAGCAACTAGGTCATT53406161155,417155,436GAGGAGCAACTAGGTCATTC53406262155,416155,435AGGAGCAACTAGGTCATTCT53406363155,415155,434GGAGCAACTAGGTCATTCTT53406464155,414155,433GAGCAACTAGGTCATTCTTC53406565155,413155,432AGCAACTAGGTCATTCTTCC53406666155,412155,431GCAACTAGGTCATTCTTCCA53406767155,411155,430CAACTAGGTCATTCTTCCAT53406868155,409155,428ACTAGGTCATTCTTCCATCA53406969155,408155,427CTAGGTCATTCTTCCATCAG53407070155,407155,426TAGGTCATTCTTCCATCAGC53407171155,405155,424GGTCATTCTTCCATCAGCAA53407272155,404155,423GTCATTCTTCCATCAGCAAG53407373155,403155,422TCATTCTTCCATCAGCAAGT53407474155,402155,421CATTCTTCCATCAGCAAGTA53407575155,401155,420ATTCTTCCATCAGCAAGTAC53407676155,400155,419TTCTTCCATCAGCAAGTACT53407777155,399155,418TCTTCCATCAGCAAGTACTT53407878155,398155,417CTTCCATCAGCAAGTACTTA53407979155,397155,416TTCCATCAGCAAGTACTTAT53408080155,396155,415TCCATCAGCAAGTACTTATG53408181155,395155,414CCATCAGCAAGTACTTATGA53408282155,394155,413CATCAGCAAGTACTTATGAT53408383155,393155,412ATCAGCAAGTACTTATGATG53408484155,390155,409AGCAAGTACTTATGATGAGT53408585155,389155,408GCAAGTACTTATGATGAGTT53408686155,388155,407CAAGTACTTATGATGAGTTC53408787155,387155,406AAGTACTTATGATGAGTTCT53408888155,386155,405AGTACTTATGATGAGTTCTC53408989155,385155,404GTACTTATGATGAGTTCTCT53409090155,383155,402ACTTATGATGAGTTCTCTTG53409191155,382155,401CTTATGATGAGTTCTCTTGT53409292155,378155,397TGATGAGTTCTCTTGTGAGT53409393155,375155,394TGAGTTCTCTTGTGAGTTAA53409494155,373155,392AGTTCTCTTGTGAGTTAAGT53409595155,372155,391GTTCTCTTGTGAGTTAAGTC53409696155,368155,387TCTTGTGAGTTAAGTCAAAA53409797155,367155,386CTTGTGAGTTAAGTCAAAAC53409898155,366155,385TTGTGAGTTAAGTCAAAACC53409999155,365155,384TGTGAGTTAAGTCAAAACCC534100100155,363155,382TGAGTTAAGTCAAAACCCGT534101101155,362155,381GAGTTAAGTCAAAACCCGTA534102102155,361155,380AGTTAAGTCAAAACCCGTAT534103103155,360155,379GTTAAGTCAAAACCCGTATT534104104155,357155,376AAGTCAAAACCCGTATTTCT534105105155,356155,375AGTCAAAACCCGTATTTCTA534106106155,355155,374GTCAAAACCCGTATTTCTAA534107107155,353155,372CAAAACCCGTATTTCTAAAG534108108155,352155,371AAAACCCGTATTTCTAAAGT534109109155,351155,370AAACCCGTATTTCTAAAGTT534110110155,350155,369AACCCGTATTTCTAAAGTTA,
[0046] Compound IDSEQ ID NO시작점(Start point)끝점(End point)서열(5’ to 3’)534111111155,349155,368ACCCGTATTTCTAAAGTTAT534112112155,348155,367CCCGTATTTCTAAAGTTATG534113113155,347155,366CCGTATTTCTAAAGTTATGG534114114155,346155,365CGTATTTCTAAAGTTATGGA534115115155,341155,360TTCTAAAGTTATGGATCTTC534116116155,339155,358CTAAAGTTATGGATCTTCTG534117117155,335155,354AGTTATGGATCTTCTGTTCC534118118155,334155,353GTTATGGATCTTCTGTTCCC534119119155,333155,352TTATGGATCTTCTGTTCCCC534120120155,321155,340TGTTCCCCAAAATGAATGGC534121121155,320155,339GTTCCCCAAAATGAATGGCT534122122155,318155,337TCCCCAAAATGAATGGCTTG534123123155,306155,325ATGGCTTGATTTACGTGGTA534124124155,305155,324TGGCTTGATTTACGTGGTAT534125125155,304155,323GGCTTGATTTACGTGGTATT534126126155,303155,322GCTTGATTTACGTGGTATTA534127127155,302155,321CTTGATTTACGTGGTATTAC534128128155,301155,320TTGATTTACGTGGTATTACT534129129154,352154,371CAGCCAATATAGCACTGGCA534130130154,282154,301GAACATCCAAAGTGTCATCA534131131154,277154,296TCCAAAGTGTCATCATGAGA534132132153,238153,257AGCTTATCTCGAACCCTGTT534133133153,237153,256GCTTATCTCGAACCCTGTTA534134134153,186153,205CTGGTTTCACCAAACCGTCT534135135153,185153,204TGGTTTCACCAAACCGTCTC534136136152,824152,843GTTCCACACCGTCCAAAATT534137137152,823152,842TTCCACACCGTCCAAAATTT534138138148,215148,234TGTCCATCAGCCTCCAGTTC534139139148,110148,129TGATTCTGTAGTTGCCATCC534140140148,109148,128GATTCTGTAGTTGCCATCCA534141141147,707147,726GTCAACATTCTTGTTAGTCT534142142147,706147,725TCAACATTCTTGTTAGTCTA534143143147,670147,689GAAACTTCTCTCGGGTCATA534144144147,099147,118CACTCAGACGGTCCAGCATC534145145147,098147,117ACTCAGACGGTCCAGCATCA534146146145,529145,548CTATCTCCCAGGCCTAAAAT534147147145,527145,546ATCTCCCAGGCCTAAAATAT534148148141,227141,246GACGGCATGCTCAAACACCT534149149141,226141,245ACGGCATGCTCAAACACCTC534150150141,196141,215ATCAGAGTCAAGTGGTCATA534151151137,978137,997AAGAGCTGCATCACACGCTC534152152137,976137,995GAGCTGCATCACACGCTCAT534153153135,788135,807CCCGGCACATCAGAAGTTTT534154154135,765135,784GAAACATATTGCAGCTCTAA534155155135,764135,783AAACATATTGCAGCTCTAAG534156156135,509135,528TTGAGATTCGTCGGAACACA534157157135,508135,527TGAGATTCGTCGGAACACAT534158158135,423135,442CACTCTTGGGCCTCCATTAA534159159135,422135,441ACTCTTGGGCCTCCATTAAA534160160134,876134,895GCCCCGTTCCATCATAGCAT534161161134,872134,891CGTTCCATCATAGCATGCAA534162162134,841134,860CCTCAAACATGCCTTTCACG534163163134,840134,859CTCAAACATGCCTTTCACGT534164164134,814134,833CCCCAAAGTACAAACGAGAT534165165134,811134,830CAAAGTACAAACGAGATGCC534166166134,497134,516GCTCACACATGTTCTTCAGA534167167134,043134,062GTGAATGAGACGTCCCACCA534168168134,011134,030TATCAATTCTTGCAATGAGC534169169134,010134,029ATCAATTCTTGCAATGAGCT534170170133,610133,629GACCATAATCAAACCATAAG534171171133,602133,621TCAAACCATAAGGTGAGAAC534172172131,850131,869GCATGACGCAGTTTCTTCTT534173173131,849131,868CATGACGCAGTTTCTTCTTC534174174129,419129,438CTGTAGTACTGCAGCACTTT534175175129,366129,385CAGCTGCCACTCTCCAAGTT534176176129,365129,384AGCTGCCACTCTCCAAGTTT534177177129,364129,383GCTGCCACTCTCCAAGTTTC534178178129,363129,382CTGCCACTCTCCAAGTTTCA534179179129,360129,379CCACTCTCCAAGTTTCAGGA534180180129,359129,378CACTCTCCAAGTTTCAGGAA534181181128,111128,130CTGCATGGTCTGGACAAAAT534182182123,140123,159GATCAACTCCCAGGAGCAAC534183183123,136123,155AACTCCCAGGAGCAACACTA534184184123,135123,154ACTCCCAGGAGCAACACTAA534185185122,969122,988TACTTGAGCCAGGTTCTCAT534186186122,919122,938CACCATAAGGATTTTCTGCC534187187122,910122,929GATTTTCTGCCAGTCCTCTA534188188122,906122,925TTCTGCCAGTCCTCTACGAT534189189122,905122,924TCTGCCAGTCCTCTACGATA534190190122,904122,923CTGCCAGTCCTCTACGATAC534191191122,901122,920CCAGTCCTCTACGATACGCT534192192117,884117,903TGCAGTCTCTCCCACCAGAT534193193117,836117,855ACAAGTTTGTACTGGATAAC534194194117,835117,854CAAGTTTGTACTGGATAACC534195195117,834117,853AAGTTTGTACTGGATAACCT534196196117,833117,852AGTTTGTACTGGATAACCTC534197197117,832117,851GTTTGTACTGGATAACCTCC534198198117,831117,850TTTGTACTGGATAACCTCCT534199199117,830117,849TTGTACTGGATAACCTCCTC534200200117,800117,819AGCATGTGGCAAGAAACCAT534201201117,562117,581ATATGCCCGACTGTAACTCT534202202117,561117,580TATGCCCGACTGTAACTCTC534203203117,560117,579ATGCCCGACTGTAACTCTCT534204204117,559117,578TGCCCGACTGTAACTCTCTC534205205117,558117,577GCCCGACTGTAACTCTCTCC534206206117,557117,576CCCGACTGTAACTCTCTCCT534207207117,530117,549CAGTTAATTCAGCATCCAGC534208208117,529117,548AGTTAATTCAGCATCCAGCA534209209115,827115,846CAGTGCCAGCACAGCTCTAT534210210115,826115,845AGTGCCAGCACAGCTCTATA534211211115,823115,842GCCAGCACAGCTCTATAAAA534212212115,822115,841CCAGCACAGCTCTATAAAAT534213213115,814115,833GCTCTATAAAATGCCCCATC534214214115,811115,830CTATAAAATGCCCCATCATG534215215115,779115,798GATCATACAGGTGTATTCTT534216216115,778115,797ATCATACAGGTGTATTCTTC534217217115,777115,796TCATACAGGTGTATTCTTCC534218218115,776115,795CATACAGGTGTATTCTTCCA534219219115,766115,785TATTCTTCCATGCTGTCCCA534220220115,765115,784ATTCTTCCATGCTGTCCCAC,
[0047] Compound IDSEQ ID NO시작점(Start point)끝점(End point)서열(5’ to 3’)534221221105,268105,287TTTCTCATACCAGGTAGCCT53422222295,08495,103CCAAAGTGTTTCATGGCATA53422322395,07795,096GTTTCATGGCATATTCTAAC53422422495,07295,091ATGGCATATTCTAACACTCC53422522595,07195,090TGGCATATTCTAACACTCCG53422622695,06995,088GCATATTCTAACACTCCGGC53422722795,06895,087CATATTCTAACACTCCGGCC53422822895,06795,086ATATTCTAACACTCCGGCCG53422922995,06595,084ATTCTAACACTCCGGCCGCT53423023095,03995,058GGCTGCTGTAGCTTATTATT53423123194,17794,196TAAGTCTTAACTTCTCATCA53423223263,17163,190CAGCAGAACAATGCCATTGT53423323363,17063,189AGCAGAACAATGCCATTGTC53423423463,16663,185GAACAATGCCATTGTCATCT53423523562,98363,002GTGTTCCATGAATTCAGCCA53423623662,97762,996CATGAATTCAGCCAAGTTTA53423723762,90762,926ATGCTTCTGATGAGCTCATC53423823862,90662,925TGCTTCTGATGAGCTCATCC53423923962,89562,914AGCTCATCCTGTTGATCTTC53424024062,85662,875GACACAAATGCAGCATTGAA53424124162,85562,874ACACAAATGCAGCATTGAAG53424224262,85462,873CACAAATGCAGCATTGAAGA53424324362,85062,869AATGCAGCATTGAAGAGATC53424424457,89157,910CTCAGCCGTCTCAGCCATTC53424524557,89057,909TCAGCCGTCTCAGCCATTCC53424624657,87957,898AGCCATTCCAGCCAGTCATC53424724757,87857,897GCCATTCCAGCCAGTCATCT53424824857,87757,896CCATTCCAGCCAGTCATCTT53424924957,87657,895CATTCCAGCCAGTCATCTTT53425025053,11853,137TGGTAAATCAAAGGATCCTC53425125153,11753,136GGTAAATCAAAGGATCCTCC53425225253,11653,135GTAAATCAAAGGATCCTCCT53425325353,11553,134TAAATCAAAGGATCCTCCTC53425425453,11353,132AATCAAAGGATCCTCCTCTT53425525553,11253,131ATCAAAGGATCCTCCTCTTC53425625653,10853,127AAGGATCCTCCTCTTCATCA53425725753,10053,119TCCTCTTCATCAGCAAGTGT53425825851,69851,717CACATCATAGCGCTGATGAT53425925951,69751,716ACATCATAGCGCTGATGATT53426026051,67251,691GGTGTCGCACCAGAACTTTA53426126151,67151,690GTGTCGCACCAGAACTTTAT53426226251,67051,689TGTCGCACCAGAACTTTATT53426326351,66951,688GTCGCACCAGAACTTTATTC53426426451,66851,687TCGCACCAGAACTTTATTCA53426526551,66751,686CGCACCAGAACTTTATTCAC53426626651,66151,680AGAACTTTATTCACCATTGG53426726750,15350,172GGTCCAGTGTTCGAACAATA53426826850,11650,135GGCATAGTCAGTGAAATCCA53426926949,71849,737CTTCAGGGGCATCAAACAAC53427027049,71749,736TTCAGGGGCATCAAACAACT53427127149,71649,735TCAGGGGCATCAAACAACTT53427227249,66349,682ATCCAGGTTGGCGCCAAACA53427327349,05549,074AGCTTAAATTCACCCCCAAG53427427449,05449,073GCTTAAATTCACCCCCAAGA53427527549,05349,072CTTAAATTCACCCCCAAGAG53427627649,05149,070TAAATTCACCCCCAAGAGCT53427727749,05049,069AAATTCACCCCCAAGAGCTA53427827849,02149,040GCTCAATGAGAAGAATGATC53427927946,37146,390CTATTTCATCCATATAAGGT53428028046,37046,389TATTTCATCCATATAAGGTC53428128146,36946,388ATTTCATCCATATAAGGTCT53428228246,36746,386TTCATCCATATAAGGTCTGA53428328346,36646,385TCATCCATATAAGGTCTGAT53428428446,33346,352AAGGACACCAACATTCCCAG53428528533,80733,826GGCAGGAACTGCACACATTT53428628633,80133,820AACTGCACACATTTGAGTCC53428728733,70833,727ATCCGCATCAGGGCCACCAT53428828833,68633,705ACACAGCTGGGTAGAACTCA53428928933,68533,704CACAGCTGGGTAGAACTCAT53429029033,68433,703ACAGCTGGGTAGAACTCATC53429129133,68333,702CAGCTGGGTAGAACTCATCC53429229233,68233,701AGCTGGGTAGAACTCATCCA53429329333,63733,656CATTTCACTAGTGCTATAGT53429429433,63533,654TTTCACTAGTGCTATAGTCA53429529531,55531,574GACTGGTCTATCATGCCAAT53429629631,55031,569GTCTATCATGCCAATGTTCA53429729731,50931,528AAGCCCCTAAAAGCCCTAAC53429829831,50431,523CCTAAAAGCCCTAACACACG53429929931,50331,522CTAAAAGCCCTAACACACGG53430030031,50231,521TAAAAGCCCTAACACACGGA53430130131,50131,520AAAAGCCCTAACACACGGAT53430230231,50031,519AAAGCCCTAACACACGGATG53430330331,20131,220TCAGAAAATTCAGTAGCACC53430430431,16631,185TACTTCCTGTAGGGCTCTAC53430530531,16531,184ACTTCCTGTAGGGCTCTACT53430630631,16331,182TTCCTGTAGGGCTCTACTAC53430730731,16231,181TCCTGTAGGGCTCTACTACA53430830831,16031,179CTGTAGGGCTCTACTACATA53430930931,12731,146ACCAACTGTCCCAGGGTCCA53431031031,12531,144CAACTGTCCCAGGGTCCACA53431131130,97130,990ACACTAACCATGAGCAGAAA53431231230,02430,043CTCATTTCCAGGCCACTAAC53431331329,12229,141CCTATTGTTGCCAGGACATT53431431429,12129,140CTATTGTTGCCAGGACATTA53431531529,12029,139TATTGTTGCCAGGACATTAT53431631629,11929,138ATTGTTGCCAGGACATTATT53431731729,11529,134TTGCCAGGACATTATTGATC53431831829,10829,127GACATTATTGATCACACCTG53431931929,08129,100ATCAGGGTCTGGATCTTTCA53432032028,38928,408TTCAGAATAGGCTCCATGTA53432132128,32028,339GCACTCTGCTCTTTGATTCT53432232228,31128,330TCTTTGATTCTTCCAATCCC53432332328,30928,328TTTGATTCTTCCAATCCCAC53432432424,61424,633GCCAGCTCCCGGATCTCAAA53432532524,61324,632CCAGCTCCCGGATCTCAAAC53432632624,61224,631CAGCTCCCGGATCTCAAACA53432732724,61124,630AGCTCCCGGATCTCAAACAC53432832824,61024,629GCTCCCGGATCTCAAACACC53432932924,60924,628CTCCCGGATCTCAAACACCT53433033024,60824,627TCCCGGATCTCAAACACCTG,
[0048] Compound IDSEQ ID NO시작점(Start point)끝점(End point))서열(5’ to 3’)53433133124,60424,623GGATCTCAAACACCTGGTCA53433233223,95323,972ATCCGCACAGTGGCGAACAA53433333323,95223,971TCCGCACAGTGGCGAACAAA53433433423,95123,970CCGCACAGTGGCGAACAAAT53433533523,95023,969CGCACAGTGGCGAACAAATT53433633622,22722,246CAAATTCAAAGCTGCCAAGC53433733722,22622,245AAATTCAAAGCTGCCAAGCG53433833822,22522,244AATTCAAAGCTGCCAAGCGT53433933922,22422,243ATTCAAAGCTGCCAAGCGTT53434034020,95620,975TCCAGCAGCTCCTTGATATC53434134119,37719,396TCCAGCACGCGAGGCAAATA53434234219,37519,394CAGCACGCGAGGCAAATAGA53434334319,37419,393AGCACGCGAGGCAAATAGAC53434434419,37319,392GCACGCGAGGCAAATAGACC53434534519,37219,391CACGCGAGGCAAATAGACCT53434634619,37119,390ACGCGAGGCAAATAGACCTT53434734719,37019,389CGCGAGGCAAATAGACCTTA53434834819,36919,388GCGAGGCAAATAGACCTTAA53434934919,36819,387CGAGGCAAATAGACCTTAAA53435035019,36719,386GAGGCAAATAGACCTTAAAC53435135119,36619,385AGGCAAATAGACCTTAAACT53435235219,36519,384GGCAAATAGACCTTAAACTC53435335319,36419,<h2 style=";text-align:left;direction:ltr">383GCAAATAGACCTTAAACTCA53435435419,36319,382CAAATAGACCTTAAACTCAG53435535519,36219,381AAATAGACCTTAAACTCAGA53435635619,36119,380AATAGACCTTAAACTCAGAC53435735719,36019,379ATAGACCTTAAACTCAGACC53435835819,35919,378TAGACCTTAAACTCAGACCT53435935919,35619, 375ACCTTAAACTCAGACCTCAC53436036019,35519,374CCTTAAACTCAGACCTCACA53436136119,34819,367CTCAGACCTCACAGCCACAG53436236219,34719,366TCAGACCTCACAGCCACAGA53436336319,34619,365CAGACCTCACAGCCACAGAA53436436419,34519,364AGACCTCACAGCCACAGAAA53436536519,34419, 363GACCTCACAGCCACAGAAAG53436636619,34319,362ACCTCACAGCCACAGAAAGT53436736719,34219,361CCTCACAGCCACAGAAAGTA53436836819,34019,359TCACAGCCACAGAAAGTAGC53436936919,33919,358CACAGCCACAGAAAGTAGCC53437037019,33719,356CAGCCACAGAAAGTAGCCCC53437137119,33619, 355AGCCACAGAAAGTAGCCCCA53437237219,33519,354GCCACAGAAAGTAGCCCCAG53437337319,33419,353CCACAGAAAGTAGCCCCAGG53437437419,33019,349AGAAAGTAGCCCCAGGGCTT53437537519,30819,327AAGGCCGCTGTACGTTCCTT53437637619,30719,326AGGCCGCTGTACGTTCCTTC53437737719,30619,325GGCCGCTGTACGTTCCTTCT53437837819,30519,324GCCGCTGTACGTTCCTTCTC53437937919,30419,323CCGCTGTACGTTCCTTCTCC53438038019,30319,322CGCTGTACGTTCCTTCTCCT53438138119,30219,321GCTGTACGTTCCTTCTCCTT53438238219,30119,320CTGTACGTTCCTTCTCCTTC53438338319,30019,319TGTACGTTCCTTCTCCTTCT53438438419,28319,302TCTTGACACAGCTTAGGACA53438538519,28219,301CTTGACACAGCTTAGGACAT53438638617,23117,250AGGCACCAGTAGTACACATA53438738717,23017,249GGCACCAGTAGTACACATAA53438838815,96515,984AACACCTGACCAGCTACATT53438938915,96415,983ACACCTGACCAGCTACATTT53439039015,96315,982CACCTGACCAGCTACATTTC53439139114,88314,902AGCCAAGCGGGGCAACAAAT53439239214,88214,901GCCAAGCGGGGCAACAAATT53439339314,88114,900CCAAGCGGGGCAACAAATTA53439439414,88014,899CAAGCGGGGCAACAAATTAA53439539514,87214,891GCAACAAATTAAGGATTGTC53439639614,84614,865ATCAGCGAGTTCTTGCTATT53439739714,84514,864TCAGCGAGTTCTTGCTATTC53439839814,84414,863CAGCGAGTTCTTGCTATTCC53439939914,84314,862AGCGAGTTCTTGCTATTCCT53440040014,84114,860CGAGTTCTTGCTATTCCTGC53440140114,84014,859GAGTTCTTGCTATTCCTGCA53440240214,83814,857GTTCTTGCTATTCCTGCATT53440340314,83514,854CTTGCTATTCCTGCATTTCA53440440414,83314,852TGCTATTCCTGCATTTCAGC53440540514,83214,851GCTATTCCTGCATTTCAGCA53440640614,83014,849TATTCCTGCATTTCAGCACC53440740714,82914,848ATTCCTGCATTTCAGCACCC53440840814,82614,845CCTGCATTTCAGCACCCACT53440940914,45814,477TCCATTTCTTCTCTCAGACG53441041011,69311,712CCTCCTAATACTCAGGCCAA53441141111,69211,711CTCCTAATACTCAGGCCAAA53441241211,69111,710TCCTAATACTCAGGCCAAAC5344134138,6378,656GATCCGATCATCCCGATTCA5344144148,6368,655ATCCGATCATCCCGATTCAT5344154158,6308,649TCATCCCGATTCATGCCCTT5344164168,6288,647ATCCCGATTCATGCCCTTCT5344174178,6248,643CGATTCATGCCCTTCTCTTT5344184188,6068,625TTGGCCAAGGTCTCATCAAA5344194196,5246,543TCTGCATCTCCTTCGGCTCA5344204206,5236,542CTGCATCTCCTTCGGCTCAC5344214215,5545,573AGGGCTCGCTTCACCTCAAA5344224225,5535,572GGGCTCGCTTCACCTCAAAT5344234235,5525,571GGCTCGCTTCACCTCAAATT5344244245,5515,570GCTCGCTTCACCTCAAATTC5344254255,5495,568TCGCTTCACCTCAAATTCCA5344264265,5485,567CGCTTCACCTCAAATTCCAC5344274274,0384,057GATGCCACCTTTCCTCTCAT5344284284,0314,050CCTTTCCTCTCATTGGCATC5344294294,0154,034CA TCTGAGCTGGAAACCAAT5344304304,0144,033ATCTGAGCTGGAAACCAATT5344314314,0134,032TCTGAGCTGGAAACCAATTC5344324324,0124,031CTGAGCT GGAAACCAATTCA5344334336887CTCAGCTGCCGCCGCCAGCA5344344346786TCAGCTGCCGCCGCCAGCAC5344354351938CACCGCCCGCCTTCCCCGCT5344364361 837ACCGCCCGCCTTCCCCGCTG5344374371736CCGCCCGCCTTCCCCGCTGT5344384381635CGCCCGCCTTCCCCGCTGTC5344394391231CGCCTTCCCCGCTGTCCTCT,
[0049] In a specific embodiment, the oligonucleotide is an oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleic acid sequence of the modified oligonucleotide may be an oligomeric compound comprising 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from a region selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 439. The oligomeric compound may be a modified oligonucleotide comprising one or more modifications selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage and a modified base.
[0050] The specific oligonucleotide may be a TR1 region, more specifically a TR6 region; a TR2 region; a TR3 region, more specifically a TR7 region; a TR4 region; or a TR5 region, in a human MTOR nucleic acid sequence, for example, the MTOR nucleic acid sequence of Ensembl Nucleotide ID ENST00000361445.9. Detailed information about each of the above regions is provided in Tables 5 and 6 below. The target region may be specifically a nucleic acid sequence within a transcript of a human MTOR nucleic acid sequence, for example, the MTOR nucleic acid sequence of Ensembl Nucleotide ID ENST00000361445.9. Accordingly, an example of an antisense oligonucleotide may be an oligomeric compound comprising an oligonucleotide composed of nucleosides linked to 8 to 80, for example 12 to 30, or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases complementary to a region of the MTOR gene selected from the group consisting of SEQ ID NOs: 440 to 446. Specifically, an example of the antisense oligonucleotide may be one that is complementary to a region of the MTOR gene selected from the group consisting of SEQ ID NOs: 440 to 446 and has a KD (knock down) for MTOR of 35% or more, or 40% or more, relative to 0% of a control group before treatment and not treated with the oligonucleotide.
[0051] The above region may be shown to be a region with very effective inhibitors of MTOR expression in antisense oligonucleotide screens, and this region on MTOR mRNA may be a good target region for targeting with RNAi agents.
[0052] Region ID Start site of SEQ ID NO. 2 Stop site of SEQ ID NO. 2 TR region of SEQ ID NO. 2 Nucleotide sequence (5' to 3') SEQ ID NO. TR1155,919155,963CAACTAAATGCACAAAGTATAAAGTGTAGCCATGTCTAGACACCA440TR2155,843155,890CAGAAATACTGTCATGGAGGTGCTGAACACAGGGAAGGTCTGGTACAT441TR3155,395155,428TCATAAGTACTTGCTGATGGAAGAATGACCTAGT 442TR414,83514,865TGAAATGCAGGAATAGCAAGAACTCGCTGAT443TR58,6248,655AAAGAGAAGGGCATGAATCGGGATGATCGG AT444TR6155,925155,950AATGCACAAAGTATAAAGTGTAGCCA445TR7155,402155,426TACTTGCTGATGGAAGAATGACCTA446
[0053] Nucleotide sequence (5' to 3') reverse complementary to the TR region of target region ID SEQ ID NO. 2 SEQ ID NO. TR1 TGGTGTCTAGACATGGCTACACTTTATACTTTGTGCATTTAGTTG 447 TR2 ATGTACCAGACCTTCCCTGTGTTCAGCACCTCCATGACAGTATTTCTG 448 TR3 ACTAGGTCATTCTTCCATCAGCAAGTACTTATGA 449 TR4 ATCAGCGAGTTCTTGCTATTCCTGCATTTCA 450 TR5 ATCCGATCATCCCGATTCATGCCCTTCTCTTT 451 TR6 TGGCTACACTTTATACTTTGTGCATT 452 TR7 TAGGTCATTCTTCCATCAGCAAGTA 453 TR1-part CACTTTATACTTTG 454 TR4-part CTTGCTATT 455
[0054] For example, the oligonucleotide may be an oligomeric compound comprising an oligonucleotide consisting of nucleosides that are reverse complementary to a MTOR gene region (sense strand) selected from the group consisting of SEQ ID NOs: 440 to 446 and are linked to 8 to 80 consecutive, for example 12 to 30, or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19 20, 21, or 22 adjacent nucleobases.
[0055] Specifically, the nucleic acid sequence of the oligonucleotide reverse complementary to the MTOR gene region (sense strand) selected from the group consisting of SEQ ID NOs: 440 to 446 is an oligonucleotide reverse complementary to a part of a nucleic acid sequence of TR1, for example, a nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 19, more specifically, an oligonucleotide reverse complementary to a part of a nucleic acid sequence of TR6, for example, a nucleic acid sequence of SEQ ID NO: 10 to SEQ ID NO: 15; an oligonucleotide reverse complementary to a part of a nucleic acid sequence of TR2, for example, a nucleic acid sequence of SEQ ID NO: 27 to SEQ ID NO: 36; an oligonucleotide reverse complementary to a part of a nucleic acid sequence of TR3, for example, a nucleic acid sequence of SEQ ID NO: 68 to SEQ ID NO: 81, more specifically, an oligonucleotide reverse complementary to a part of a nucleic acid sequence of TR7, for example, a nucleic acid sequence of SEQ ID NO: 70 to SEQ ID NO: 74; An oligonucleotide that is a reverse complementary sequence to a portion of a nucleic acid sequence of TR4, for example, a nucleic acid sequence of SEQ ID NO: 396 to SEQ ID NO: 403; or an oligonucleotide that is a reverse complementary sequence to a portion of a nucleic acid sequence of TR5, for example, an oligonucleotide that comprises 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases from a nucleic acid sequence of SEQ ID NO: 414 to SEQ ID NO: 417. Furthermore, the oligonucleotide may be an oligomeric compound that comprises one or more modifications selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage, and a modified base.
[0056] Specifically, the nucleic acid sequence of the oligonucleotide may be an oligomeric compound comprising 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from a region of one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 10, 11, 12, 13, 14, 28, 32, 35, 71, 396, 397, 398, 399, 400, 401, 402, 403, 414, and 416, and further, the oligonucleotide may be an oligomeric compound comprising one or more modifications selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage and a modified base.
[0057] The above oligonucleotide may be an oligomeric compound comprising an oligonucleotide composed of nucleosides linked to 8 to 80 consecutive, for example 12 to 30, or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19 or 20 adjacent nucleobases from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 447 to 453. In a specific example, the oligonucleotide that complementarily binds to the TR1 region may be an oligomeric compound comprising an oligonucleotide composed of nucleosides linked to 14 to 80 consecutive, for example 14 to 30, or 14 to 22, specifically 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases comprising the nucleic acid sequence of SEQ ID NO: 454, for example an oligomeric compound having the nucleic acid sequence of SEQ ID NO: 10 to 15. The oligonucleotide complementarily binding to the TR4 region may be an oligomeric compound comprising an oligonucleotide composed of nucleosides linked to 9 to 80 consecutive, for example 12 to 30, or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19 or 20 adjacent nucleobases comprising the nucleic acid sequence of SEQ ID NO: 455, and may be, for example, an oligomeric compound having the nucleic acid sequence of SEQ ID NO: 396 to 403.
[0058] In the specification, the term "modified oligonucleotide" means an oligonucleotide having at least one sugar, nucleobase or internucleoside linkage modified, wherein the modified oligonucleotide may comprise one or more modifications selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage and a modified base. The term "unmodified oligonucleotide" means an oligonucleotide that does not comprise any modification of any sugar, nucleobase or internucleoside linkage.
[0059] "Nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.
[0060] As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety.
[0061] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is a group of atoms other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. "5-methyl cytosine" is a modified nucleobase.
[0062] The oligonucleotide may comprise at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 modified nucleobases of any sequence.
[0063] The modified oligonucleotide has a sugar motif, wherein the sugar motif comprises a 5'-wing region consisting of 1 to 10, 1 to 9, 1 to 8, 1 to 7, or 1 to 6 linked modified nucleosides; a central gap region consisting of 6 to 23, 6 to 22, 6 to 21, 6 to 20, 6 to 19, 6 to 18, 6 to 17, 6 to 16, 6 to 15, 6 to 14, 6 to 13, 6 to 12, 6 to 11, or 6 to 10 linked central region nucleosides; A 3'-wing region may comprise 1 to 10, 1 to 9, 1 to 8, 1 to 7, or 1 to 6 linked modified nucleosides. More specifically, the sugar motif may comprise a 5'-region comprising 1 to 6 linked 5'-region nucleosides; a central region comprising 6 to 10 linked central region nucleosides; and a 3'-region comprising 1 to 6 linked 3'-region nucleosides.
[0064] In an embodiment, the modified sugar moiety may comprise one or more selected from the group consisting of non-bicyclic modified sugar moieties and bicyclic or tricyclic sugar moieties. In a specific embodiment, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
[0065] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring having one or more substituents, none of which bridge two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents can be at any position of the furanosyl, including but not limited to substituents at the 2', 3', 4', and / or 5' positions. Examples of suitable 2'-substituents for such non-bicyclic modified sugar moieties include, but are not limited to: 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10 alkoxy, O-C1-C10 substituted alkoxy, O-C1-C10 alkyl, O-C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), or OCH2C(=O)-N(Rm)(Rn), wherein each Rm and Rn is independently H, an amino protecting group. or substituted or unsubstituted C1-C10 alkyl), -O(CH2)2ON(CH3)2 ("DMAOE"), 2'-OCH2OCH2N(CH2)2 ("DMAEOE"), etc.
[0066] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 3'-position. Examples of suitable substituents at the 3'-position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 4'-position. Examples of suitable 4'-substituents for the non-bicyclic modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in WO 2015 / 106128 (Manoharan et al.).
[0067] Examples of suitable 5'-substituents for the non-bicyclic modified sugar moiety include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, ethyl, and 5'-methoxy, 5'-aminopropyl, or 5'-CP. An example of a suitable 5'-substituent for the non-bicyclic modified sugar moiety includes 5'-CP, and specifically, "5'-CP" is a sugar moiety compound in which two methyl groups are substituted at the 5-position of the 2-deoxyribose included therein, and these methyl groups are linked to each other to form a cyclopropane, also referred to as a "5'-CP nucleoside", and detailed descriptions thereof are described in WO2022 / 211095A1. Additionally, in certain embodiments, the non-bicyclic modified sugar moiety comprises more than one non-bridging sugar substituent, for example, but not limited to, a 2'-F-5'-methyl sugar moiety.
[0068] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.
[0069] Certain modified sugar moieties include substituents that bridge two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. Nucleosides comprising such bicyclic sugar moieties have been referred to as bicyclic nucleosides (BNAs), locked nucleosides (LNAs), or conformationally constrained nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication No. 2013 / 0190383; and PCT Publication No. WO2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose is a ribose ring. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt" when in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof, 4'-C(CH3)(CH3)-O-2' and analogs thereof, 4'-CH2-N(OCH3)-2' and analogs thereof, 4'-CH2-ON(CH3)-2', 4'-CH2-C-(H)(CH3)-2', 4'-CH2-C-(=CH2)-2' and analogs thereof, 4'-C(R a R b )-N(R)-O-2', 4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2' (wherein, R, R a and R b are each independently H, protecting group or C1-C 12 alkyl)) but are not limited to these.
[0070] The modified sugar moiety comprises a substituent that bridges two atoms of the furanosyl ring to form a second ring, thereby forming a bicyclic sugar moiety. A nucleoside comprising such a bicyclic sugar moiety has been referred to as a bicyclic nucleoside (BNA), or a constrained nucleoside. The bicyclic sugar moiety comprises a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose is a ribose ring. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt" when in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof, 4'-C(CH3)(CH3)-O-2' and analogs thereof, 4'-CH2-N(OCH3)-2' and analogs thereof, 4'-CH2-ON(CH3)-2', 4'-CH2-C-(H)(CH3)-2', 4'-CH2-C-(=CH2)-2' and analogs thereof, 4'-C(R a R b )-N(R)-O-2', 4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2' (wherein, R, R a and R b are each independently H, protecting group or C1-C 12 alkyl) (e.g., US 7,427,672 (Imanishi et al.)).
[0071] In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in the embodiments exemplified herein, they are present in the β-D configuration, unless otherwise specified.
[0072]
[0073] In certain embodiments, the modified sugar moiety is a sugar surrogate. In such certain embodiments, an oxygen atom of the sugar moiety is replaced by, for example, a sulfur, carbon, or nitrogen atom.
[0074] Many other bicyclic and tricyclic sugars and sugar substitutes that can be used in modified nucleosides are known in the art.
[0075] In one embodiment, the oligonucleotide compound can comprise an unmodified internucleoside linkage (a phosphodiester internucleoside linkage) and / or one or more modified internucleoside linkages. In certain embodiments, each internucleoside linkage can comprise one or more internucleoside linkages selected from the group consisting of a phosphodiester internucleoside linkage (PO), a phosphorothioate internucleoside linkage (PS), and a methanesulfonyl phosphoramidate internucleoside linkage (MsPA). The methanesulfonyl phosphoramidate internucleoside linkage (MsPA) is also used synonymously with a mesyl phosphoramidate internucleoside linkage.
[0076] In certain embodiments, each internucleoside linking group of the modified oligonucleotide can be independently selected from a phosphorothioate internucleoside linking group and a phosphodiester internucleoside linking group. In one embodiment, each phosphorothioate internucleoside linking group can be a stereorandom phosphorothioate.
[0077] In a specific example, the modified oligonucleotide according to the present invention may include at least one internucleoside linkage group selected from the group consisting of a phosphodiester internucleoside linkage group (PO), a phosphorothioate internucleoside linkage group (PS), and a methanesulfonyl phosphoramidate internucleoside linkage group (MsPA), and may have a mixed internucleoside linkage group of PS, PO, or PS and PO, including, for example, phosphodiester (PO) and / or phosphorothioate (PS). In this case, the modified oligonucleotide may have an unmodified or modified sugar moiety, and an unmodified or modified nucleobase, and the sugar moiety and the nucleobase are as described above. For example, when the internucleoside linkage of the modified oligonucleotide includes both PS and PO, the PO bonds can be located in both the wing and gap regions of the gapmer structure, and preferably can be present in each wing. Specifically, when the oligomeric compound has a gapmer structure including a 5'-wing region, a gap region, and a 3'-wing region, and 1 to 6 internucleoside linkages can be present in each wing region, for example, an example of a modified oligonucleotide including a mixed internucleoside linkage of PO and PS can be selected from the group consisting of SOSSS, SOOSS, SOSOS, SOOOSS, SOOOOS, SSSOSS, SSOOSSS, SSOSOS, SSOOSS, SSOOOS, and SSOOSS. In this case, 'O' represents a phosphodiester internucleoside linkage (PO), and 'S' represents a phosphorothioate internucleoside linkage (PS).Specifically, it may be a combination of a 5'-wing region including at least one selected from the group consisting of SOSSS, SOOSS, SOSOS, SOOOSS, and SOOOOS and a 3'-wing region including at least one selected from the group consisting of SSSOSS, SSOOSSS, SSOSOS, SSOOSS, SSOOOS, and SSOOSS, specifically SOSSSSSSSSSSSSSSOSS, SOSSSSSSSSSSSSSOOSS, SOOSSSSSSSSSSSSOOSS, SOSOSSSSSSSSSSSOSOS, SOOOSSSSSSSSSSSOOSS, SOOOSSSSSSSSSSSOOOS, or SOOOOSSSSSSSSSSOOSS, and more specifically SOSSSSSSSSSSSSSOOSS, SOSOSSSSSSSSSSSOSOS, or SOOOOSSSSSSSSSSOOSS. An example of an oligomeric compound may be a sequence comprising 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleobases from among the nucleic acid sequences of SEQ ID NO: 1 to SEQ ID NO: 439, specifically SEQ ID NO: 1 to 19, SEQ ID NO: 27 to 36, SEQ ID NO: 68 to 81, SEQ ID NO: 396 to 403, or SEQ ID NO: 414 to 417, and more specifically a nucleic acid sequence of SEQ ID NO: 11, 12, 13, 14, 28, 95, 102, 105, 106, 319, 396, 398, 399, 403, 409, 414, or 416. A nucleic acid sequence comprising 12, 13, 14, 15, 16, 17, 18, 19 or 20 adjacent nucleobases in the sequence, which may comprise mixed internucleoside linkages of PO and PS.An example of a modified oligonucleotide comprising a mixed internucleoside linker of PO and PS, when the above oligomeric compound has a gapmer structure comprising a 5'-wing region, a gap region, and a 3'-wing region, is described in Table 12 below.
[0078] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region may comprise the same modified sugar moiety, referred to herein as a uniformly modified sugar motif, or may comprise two or more different types of modified sugar moieties, specifically the modified oligonucleotide may comprise a bicyclic sugar moiety, for example one type of 4' to 2' bridged sugar substituent, or a non-bicyclic modified sugar moiety, specifically one type of 2'-MOE, or may comprise one or more each of a bicyclic sugar moiety and a non-bicyclic modified sugar moiety.
[0079] In certain embodiments, the modified oligonucleotide can comprise a region having a gapmer motif defined by two outer regions or "wings" and a central or inner region or "gap," wherein the central gap region is a region capable of complementary binding to a target nucleic acid to recruit RNase H. The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, wherein at least a portion of the sugar moieties of the nucleosides of each wing can differ from at least a portion of the sugar moieties of the nucleosides of the gap.
[0080] "GAPMER" means an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage, positioned between an external region having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external region. The internal region may be referred to as the "gap" and the external region may be referred to as the "wings". Here, the lengths (in nucleosides) of the three regions of the gapmer may be given using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. For example, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. When chemical modifications are included in the above nomenclature, for example, a 5-10-5 MOE gapmer consists of five modified nucleosides in the 5' wing, ten linked deoxynucleosides in the gap, and five linked MOE nucleosides in the 3' wing. In certain embodiments, the modified oligonucleotide may comprise a 5-10-5 MOE gapmer, a 3-10-3 BNA gapmer, a 3-10-3 cEt gapmer, or a 3-10-3 LNA gapmer, etc. In certain embodiments, the modified oligonucleotide may comprise a 5-10-5 MOE gapmer, a 3-10-3 BNA gapmer, a 3-10-3 cEt gapmer, or a 3-10-3 LNA gapmer, etc.
[0081] The modified oligonucleotide may comprise a 5'-wing region consisting of 1 to 10, 1 to 9, 1 to 8, 1 to 7, or 1 to 6 linked modified nucleosides; a central gap region consisting of 6 to 23, 6 to 22, 6 to 21, 6 to 20, 6 to 19, 6 to 18, 6 to 17, 6 to 16, 6 to 15, 6 to 14, 6 to 13, 6 to 12, 6 to 11, or 6 to 10 linked central region nucleosides; and a 3'-wing region consisting of 1 to 10, 1 to 9, 1 to 8, 1 to 7, or 1 to 6 linked modified nucleosides.
[0082] In certain embodiments, the modified oligonucleotide can comprise one or more modified moieties selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage, and a modified nucleobase in each of the three regions of the gapmer motif (5'-wing, gap, and 3'-wing). Specifically, one or more modified nucleobases, such as 5-mC (5'-methylcytosine), can be included in the modified oligonucleotide, and can be primarily in the gap region, but can also be included in the wing region. The internucleoside linkages, such as PS and PO linkages, can each be included in the overall modified oligonucleotide at least once, for example, the entire linkage can be PS linkages, or a mixture of PS and PO linkages can be included. One or more PO linkages can be included in the overall modified oligonucleotide at least once, and can be primarily in the wing region, but can also be included in the gap region. The modified sugar moiety may be included in one or more of the total nucleotides included in the oligonucleotide, specifically, the non-bicyclic sugar moiety may be included in the wing region, and the bicyclic sugar moiety is mainly included in the wing region, but may also be included in the gap region.As a specific example, (i) the modified oligonucleotide may have a structure in which 5-mC is included in the gap region and all linkages are PS linkages, and a non-bicyclic sugar moiety is included in the wing region, (ii) the modified oligonucleotide may have a structure in which 5-mC is included in the gap region and at least one PS linkage and one PO linkage are included in the gap region, and a non-bicyclic sugar moiety is included in the wing region, for example, 5-mC is included in the gap region, all linkages in the gap region are PS linkages, the wing region includes at least one PO linkage and one PS linkage, and a non-bicyclic sugar moiety is included in the wing region, or (iii) the modified oligonucleotide may have a structure in which 5-mC is included primarily in the gap region but may also be included in the wing region, PS linkages are included throughout the gap region, and the wing region includes PS linkages, PO linkages, or a mixed linkage of PS and PO, and a bicyclic sugar moiety is included primarily in the wing region. It may be a structure that is included in the region but may also be included in the gap region. However, it is illustrative and not limited to the group consisting of a modified sugar moiety, an unmodified or modified internucleoside linkage, and a modified nucleobase included in such a modified oligonucleotide.
[0083] For example, the modified sugar moiety may include at least one selected from the group consisting of a non-bicyclic modified sugar moiety composed of a 2'-MOE sugar moiety and a 2'-OMe sugar moiety; and a bicyclic modified sugar moiety comprising a 2',4'-bridge selected from O-CH2-; and -O-CH(CH3)-. The modified oligomeric compound may include a non-bicyclic modified sugar moiety and a bicyclic modified sugar moiety, and specifically may include at least one modified nucleoside comprising a bicyclic modified sugar moiety having a 2'-4' bridge and at least one modified nucleoside comprising a non-bicyclic modified sugar moiety. In a specific example, the 5'-wing and / or the 3'-wing may include at least one bicyclic modified sugar moiety and a non-bicyclic modified sugar moiety,
[0084] Specifically, when the 5'-wing region comprises 1 to 6 linked 5'-region nucleosides; a central gap region comprising 6 to 10 linked central region nucleosides; and a 3'-wing region comprising 1 to 6 linked 3'-region nucleosides, the 5'-wing region and / or the 3'-wing region may comprise at least one bicyclic modified sugar moiety. For example, the 5'-wing region and / or the 3'-wing region may comprise at least one bicyclic modified sugar moiety, and the remaining nucleosides may comprise non-bicyclic modified sugar moieties, and detailed descriptions thereof are described in patent documents such as WO2016-127002A1, WO2016126995A1, and US20180023081A1.
[0085] In a specific example, a 5'-wing region consisting of 1 to 7 linked 5'-region nucleosides; a central gap region consisting of 6 to 10 linked central region nucleosides; And when the 3'-wing region comprises 1 to 7 linked 3'-region nucleosides, the 5'-wing region and / or the 3'-wing region may each independently comprise one or more bicyclic modified sugar moieties, specifically, the 5'-wing region is selected from the group consisting of L, LL, LDL, LLL, LLLL, LLDL, LDLL, LDDL, LLDD, LLLLL, LLLDL, LLLLL, LDLLL, LLDDL, LDDLL, LLDLD, LLDLL, LDLDL, LLDLLL, LLDDLL, LDLLLL, LDLLLL, LDLDLL, LDDLLL, LDDLLL, LDDDLL, LLLLLLL, LLLLLLL, LLLLLLL, LLLDDDL, LLDDLDL, LLDDLL, LDDLLLL, LDLLLLL, LLLLLLL, LLLLLLL, LLLLLLL, LLLDDDL, LLDDLDL, LLDDLL, LDDLLLL, LDLLLDL, LDDDLLL, LLDDDDL and LLDDLD, or the 3'-wing region may be selected from the group consisting of L, LL, LDL, LLL, LLLL, LLDL, LDLL, LDDL, LLDD, LLLL, LLLLL, LLLDL, LLDLL, LLDDL, LDDLL, LLDLD, LDLLD, LDLDL, LDD LLLLLL, LLLLLDL, LLLDLL, LLLLLLL, LLLLLLL, LLLDDL, LDLDLL, LDDDLL, LLLDLL, LLLLLL, LLLLLL, LLDDLDL, LLDDLL, LDDLLLL, LDLLLLL, LLDDDDL and LLDDL, wherein in the sugar moiety formula, 'D' represents a 2'-deoxyribosyl sugar moiety, and 'L' represents a LNA sugar moiety. It shows.
[0086] Specifically, the oligonucleotide compound of the present invention may be, for example, an LNA modified oligonucleotide or a cEt modified oligonucleotide, when it comprises a specific bicyclic nucleoside (e.g., LNA or cEt) as a modified sugar moiety, and may comprise at least one internucleoside linkage selected from the group consisting of a phosphorothioate internucleoside linkage, a mesyl phosphoramidate internucleoside linkage and a phosphodiester internucleoside linkage, specifically a phosphorothioate (PS) internucleoside linkage (PS linkage) and / or a phosphodiester (PO).
[0087] Additionally, the LNA modified oligonucleotide or cEt modified oligonucleotide may comprise a modified nucleobase and / or an unmodified nucleobase. An example of an oligomeric compound comprising a particular bicyclic nucleoside (e.g., LNA or cEt) as a modified sugar moiety may be a sequence comprising 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleobases from among the nucleic acid sequences of SEQ ID NO: 1 to SEQ ID NO: 439, particularly SEQ ID NO: 1 to SEQ ID NO: 19, SEQ ID NO: 27 to SEQ ID NO: 68 to SEQ ID NO: 396 to SEQ ID NO: 403, or SEQ ID NO: 414 to SEQ ID NO: 417, more particularly SEQ ID NO: 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleobases from among the nucleic acid sequences of SEQ ID NO: 13, 14, 106, 409, or 416. In a nucleic acid sequence comprising 17, 18, 19, or 20 contiguous nucleobases, the modified sugar moiety may be a bicyclic sugar moiety, and the bicyclic sugar moiety may be present in the 5'-wing region and the 3'-wing region. The nucleic acid sequence of the oligomeric compound is specifically a nucleic acid sequence of SEQ ID NO: 13, 14, 106, 409, or 416, wherein the modified sugar moiety may be a bicyclic sugar moiety, and the bicyclic sugar moiety may be present in the 5'-wing region and the 3'-wing region.
[0088] The bicyclic sugar moiety present in the 5'-wing region may be selected from the group consisting of LLLLLL, LLLLL, LLLDLL, LLLDL, LLDLLL, LLDLL, LLDDLL, LLDDL, LDLLLL, LDLLL, LDLLDL, LDLDLL, LDLDLD, LDDLLL, LDDLLD, LDDLDL, LDDL, LDDDLL, and LDDDL, and the bicyclic sugar moiety present in the 3'-wing region may be selected from the group consisting of LLLLLL, LLLDLL, LLDDLL, LDLLLL, LDLDLL, LDDLLL, LDDDLL, LLLLL, LLDLL, LDLLL, LDDLL, LLLL, LDLL, LLLLL, LDLLL, LDDLL, LLLL, LDLL, LLL, and LL. As a specific example, an example of an LNA modified oligonucleotide may be as shown in Table 17 below, but is not limited thereto. The sequences in Table 17 are presented in the 5' to 3' direction, and in the sugar moiety formulas, 'D' represents a 2'-deoxyribosyl sugar moiety and 'L' represents an LNA sugar moiety.
[0089] In certain embodiments, the modified oligonucleotide comprises one or more conjugation moieties or conjugation groups. In certain embodiments, the conjugation moieties modify one or more properties of the molecule, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, uptake, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugation moieties impart new properties to the molecule, such as a fluorophore or reporter group that enables detection of the molecule.
[0090] Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazines, phenanthridines, anthraquinones, adamantanes, acridines, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
[0091] In certain embodiments, the conjugate group comprises a conjugate linker that attaches the conjugate moiety to the remainder of the modified oligonucleotide. In certain embodiments, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached to the remainder of the modified oligonucleotide via the conjugate linker via a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units, such as ethylene glycol, nucleoside, or amino acid units. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker, including the conjugate linker described above, is one known in the art to be useful for attaching a bifunctional linking moiety, e.g., a conjugate group, to an oligomeric compound, such as an oligonucleotide provided herein.
[0092] In certain embodiments, it is desirable for the conjugate group or conjugate moiety to be cleaved from the remainder of the oligonucleotide. For example, in certain circumstances, an oligomeric compound (including an oligomeric compound that is an antisense agent or a portion thereof) or a modified oligonucleotide comprising a particular conjugate moiety may be better absorbed by certain cell types, but once the compound is absorbed, it is desirable for the conjugate group to be cleaved to release the unconjugated oligonucleotide. Accordingly, certain conjugate moieties typically include one or more cleavable moieties within the conjugate linker. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, the cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or an intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.
[0093] In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, each ligand of the cell-targeting moiety has affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has affinity for at least one type of receptor on the surface of a mammalian lung cell. Each ligand of the cell-targeting moiety is a carbohydrate, a carbohydrate derivative, a modified carbohydrate, a polysaccharide, a modified polysaccharide, or a polysaccharide derivative.
[0094]
[0095] One example of the present invention relates to a pharmaceutical composition for preventing, alleviating or treating a disease associated with increased activity and / or expression of MTOR, comprising an agent capable of mediating RNA interference (RNA interference, RNAi) with respect to MTOR, or a method for preventing, alleviating or treating a disease associated with increased activity and / or expression of MTOR, comprising a step of administering an agent capable of mediating RNA interference (RNA interference, RNAi) with respect to MTOR to a subject or individual in need thereof.
[0096] Another embodiment of the present invention provides a composition for reducing human MTOR protein synthesis or human MTOR mRNA levels in a human subject with increased expression levels of the human MTOR gene. Alternatively, the present invention provides a method for reducing MTOR protein synthesis or human MTOR mRNA levels in a human subject with increased expression levels of the MTOR gene.
[0097] In certain embodiments, a method according to the invention comprises administering an RNAi agent to a subject and detecting or quantifying an amount of MTOR RNA or MTOR protein in a cell or biological fluid of the subject. In certain embodiments, the method comprises detecting / quantifying a first amount of MTOR RNA or MTOR protein in a first biological sample obtained prior to the administration, detecting / quantifying a second amount of MTOR RNA or MTOR protein in a second biological sample obtained after the administration, and comparing the first amount to the second amount to detect or quantify a decrease in MTOR RNA or MTOR protein.
[0098] Inhibition of MTOR nucleic acid levels or expression can be assayed by various methods known in the art. For example, target nucleic acid levels can be quantified, for example, by Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. Antisense inhibition of MTOR nucleic acid can be assessed by measuring MTOR protein levels. MTOR protein levels can be assessed or quantified by various methods well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (e.g., caspase activity assays), immunohistochemistry, immunocytochemistry, or fluorescence-activated cell sorting (FACS).
[0099] In some embodiments, the subject or patient to be administered may have received one or more treatments selected from the group consisting of drug therapy, radiation therapy, and surgical therapy prior to treatment.
[0100]
[0101] In certain embodiments, the present disclosure provides a pharmaceutical composition comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition comprises the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain embodiments, the excipients are selected from water, a salt solution, an alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0102] In certain embodiments, the pharmaceutical composition comprising an oligomeric compound comprises any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester.
[0103] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions.
[0104] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water, or a physiologically compatible buffer, such as phosphate buffered saline (PBS), artificial CSF (aCSF), Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid solubility or act as preservatives) are included. In certain embodiments, an injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Certain injectable pharmaceutical compositions are presented in unit dosage form, e.g., ampoules or multi-dose containers. Certain injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending agents, stabilizers, and / or dispersing agents. Specific solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.
[0105] The formulation composition and method of a pharmaceutical composition depend on several criteria including, but not limited to, the route of administration, the extent of the disease, or the dosage to be administered.
[0106] In certain embodiments, the oligomeric compound may be mixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. The composition and method for formulating a pharmaceutical composition depend on a number of criteria, including, but not limited to, the route of administration, the extent of the disease, or the dosage administered.
[0107] The RNAi agent according to the present invention can be administered orally or parenterally, with parenteral administration referring to administration via injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal or intracerebroventricular administration.
[0108] The present invention relates to compounds for modulating the expression level and / or activity of the mTOR gene and compositions comprising the same, which are useful for preventing, treating, or alleviating diseases, disorders, and conditions associated with MTOR.
[0109] Figure 1 shows the results of a Western blot experiment for MTOR protein, p-4EBP1, 4EBP1, and α-tubulin after treatment of neurons harboring the MTOR p.Leu2427Pro mutation with modified oligonucleotides complementary to human MTOR (574107, 574109, 574007) at the indicated concentrations. Cells treated with PBS and cells treated with 50 μM of a non-targeting oligonucleotide were used as negative control groups.
[0110] Figure 2 shows the results of weighted mean firing rate, one of the analysis indices of the multi-electrode array system, after treatment of neurons with the MTOR p.Leu2427Pro mutation with modified oligonucleotides complementary to human MTOR (574107, 574109, 574007). (***, p<0.001; ****, p<0.0001; Two-way ANOVA with Tukey's test)
[0111] Figure 3 shows the results of burst frequency, one of the analysis indices of the multi-electrode array system, after treatment of neurons with the MTOR p.Leu2427Pro mutation with modified oligonucleotides complementary to human MTOR (574107, 574109, 574007). (**, p<0.01; ****, p<0.0001; Two-way ANOVA with Tukey's test)
[0112] Figure 4 shows the results of analyzing the size of the soma after immunostaining with MAP2, a neuronal marker, in neurons treated with modified oligonucleotides complementary to the nucleic acid sequence of human MTOR (574107, 574109, 574007) containing the MTOR p.Leu2427Pro mutation. (*, p<0.05; ##, p<0.01; *** or ###, p<0.001; ####, p<0.0001; * indicates comparison with the PBS-treated group, and # indicates comparison with the non-targeting oligonucleotide-treated group. One-way ANOVA with Tukey's test)
[0113]
[0114] The present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not intended to be limited to the following examples.
[0115]
[0116] Example 1: Inhibition of MTOR in SNB-19 cells by 5-10-5 2'-MOE gapmer (single dose)
[0117] A 5-10-5 2'-MOE gapmer modified oligonucleotide was designed to target human MTOR RNA and tested for its effects on MTOR mRNA in vitro. The modified oligonucleotide in the table below is a 5-10-5 2'-MOE gapmer with phosphorothioate (PS) internucleoside linkages (PS linkages) and does not contain any modified bases. This gapmer is 20 nucleosides in length, wherein the central gap segment consists of 10 2'-deoxynucleotides, and the 3' and 5' wings each consist of 5 2'-MOE nucleotides. The motif for the gapmer is (5' to 3'): eeeeeddddddddddeeeee; In the formula, 'd' represents a 2'-deoxyribosyl sugar moiety and 'e' represents a 2'-MOE sugar moiety.
[0118] SNB-19 cells cultured at a density of 7,000 cells / well were treated with 5 μM modified oligonucleotides via free uptake. Total RNA was extracted from the cells after 24 h of treatment. The mRNA expression levels of the MTOR gene, one of the cell maintenance genes, and RPL-13 were measured by quantitative real-time PCR. Human RPL-13 primer probe set (forward primer sequence: ATTTCTGTGGATCCGAGGAGG (SEQ ID NO: 467), reverse primer sequence: GCCAGTTTCAGTTCTTCAGCAGA (SEQ ID NO: 468), probe sequence: AGTACCGCTCCAAACTCATCCTCTTCC (SEQ ID NO: 469) and human MTOR primer probe set 1 (forward primer sequence: GCCTTCACAGATACCCAGTAT (SEQ ID NO: 470), reverse primer sequence: CACGCGAGGCAAATAGACCT (SEQ ID NO: 471), probe sequence: TGTCAAGAAGGAGAAGGAACGTACAGCG (SEQ ID NO: 472)) or human MTOR primer probe set 3 (forward primer sequence: GAGATCCAGGCTACCTGGT (SEQ ID NO: 473), reverse primer sequence: GGTGGAGTTGACCCCATTC (SEQ ID NO: 474), probe sequence: mRNA levels were measured using the primers ATGGACACCAACAAGGACGACCCAGA (SEQ ID NO: 475).
[0119] The results of the analysis represent the relative expression of MTOR mRNA compared to untreated control cells. Each gapmer listed in the table below targets the human MTOR transcript sequence disclosed herein (Ensembl database transcript ID: ENST00000361445.9). Tables 7 to 10 below show the expression levels of human MTOR mRNA by 5-10-5 2'-MOE gapmer-modified oligonucleotides.
[0120] Compound IDSEQ ID NOSequence(5’to 3’)상대적 발현율5340011TGGTGTCTAGACATGGCTAC0.485340022GGTGTCTAGACATGGCTACA0.395340033GTGTCTAGACATGGCTACAC0.645340044TGTCTAGACATGGCTACACT0.535340055GTCTAGACATGGCTACACTT0.665340066TAGACATGGCTACACTTTAT0.595340077GACATGGCTACACTTTATAC0.615340088ACATGGCTACACTTTATACT0.675340099CATGGCTACACTTTATACTT0.6453401010TGGCTACACTTTATACTTTG0.553401111GGCTACACTTTATACTTTGT0.3653401212GCTACACTTTATACTTTGTG0.4453401313CTACACTTTATACTTTGTGC0.2453401414TACACTTTATACTTTGTGCA0.4353401515CACTTTATACTTTGTGCATT0.5153401616CTTTATACTTTGTGCATTTA0.7453401717TTATACTTTGTGCATTTAGT0.4653401818TATACTTTGTGCATTTAGTT0.5453401919ATACTTTGTGCATTTAGTTG0.6153402020TAGTTGAGTATTTGTTCTGC0.6253402121AGTTGAGTATTTGTTCTGCT0.6753402222CCAATATGTACCAGACCTTC0.6853402323CAATATGTACCAGACCTTCC0.9253402424AATATGTACCAGACCTTCCC0.7653402525ATATGTACCAGACCTTCCCT0.6653402626TATGTACCAGACCTTCCCTG0.6253402727ATGTACCAGACCTTCCCTGT0.5353402828ACCAGACCTTCCCTGTGTTC0.4453402929CCAGACCTTCCCTGTGTTCA0.5653403030CAGACCTTCCCTGTGTTCAG0.753403131AGACCTTCCCTGTGTTCAGC0.6553403232GACCTTCCCTGTGTTCAGCA0.4453403333TGTGTTCAGCACCTCCATGA0.7153403434TGTTCAGCACCTCCATGACA0.6253403535GTTCAGCACCTCCATGACAG0.4653403636CCTCCATGACAGTATTTCTG0.5753403737CTCCATGACAGTATTTCTGT0.6753403838CTGAGCCCTTGCTCTAAACA0.8453403939TGAGCCCTTGCTCTAAACAG0.7353404040GAGCCCTTGCTCTAAACAGA0.9453404141AGCCCTTGCTCTAAACAGAG0.953404242GCCCTTGCTCTAAACAGAGT1.0253404343CCCTTGCTCTAAACAGAGTA0.9453404444CCTTGCTCTAAACAGAGTAT1.0553404545CTTGCTCTAAACAGAGTATT1.0153404646CCCTGCTGCAGAAGGCCAGT0.9753404747TGCATCTGCTCAGCCGAGGC0.7653404848CATCACTGGGTCTGATGGAA0.9553404949ATCACTGGGTCTGATGGAAG1.0653405050ACTGGGTCTGATGGAAGACA0.9153405151TTGGCCTATCTTGCAAACAT0.9853405252CCTATCTTGCAAACATTTCT0.9653405353ACCAGTGAGGTCTTGGGATA1.0453405454GTCTAGGATCCTAATCCATG0.7453405555TCTAGGATCCTAATCCATGT0.7453405656CCCATGTTGAGAGGAGCAAC0.9453405757CCATGTTGAGAGGAGCAACT0.853405858CATGTTGAGAGGAGCAACTA153405959ATGTTGAGAGGAGCAACTAG1.0553406060AGAGGAGCAACTAGGTCATT0.7353406161GAGGAGCAACTAGGTCATTC0.6253406262AGGAGCAACTAGGTCATTCT0.753406363GGAGCAACTAGGTCATTCTT0.5653406464GAGCAACTAGGTCATTCTTC0.5653406565AGCAACTAGGTCATTCTTCC0.6553406666GCAACTAGGTCATTCTTCCA0.753406767CAACTAGGTCATTCTTCCAT0.8453406868ACTAGGTCATTCTTCCATCA0.6153406969CTAGGTCATTCTTCCATCAG0.6953407070TAGGTCATTCTTCCATCAGC0.4553407171GGTCATTCTTCCATCAGCAA0.4153407272GTCATTCTTCCATCAGCAAG0.3353407373TCATTCTTCCATCAGCAAGT0.4253407474CATTCTTCCATCAGCAAGTA0.4153407575ATTCTTCCATCAGCAAGTAC0.753407676TTCTTCCATCAGCAAGTACT0.5253407777TCTTCCATCAGCAAGTACTT0.4753407878CTTCCATCAGCAAGTACTTA0.653407979TTCCATCAGCAAGTACTTAT0.6153408080TCCATCAGCAAGTACTTATG0.553408181CCATCAGCAAGTACTTATGA0.6153408282CATCAGCAAGTACTTATGAT0.6953408383ATCAGCAAGTACTTATGATG0.7653408484AGCAAGTACTTATGATGAGT0.5953408585GCAAGTACTTATGATGAGTT0.5653408686CAAGTACTTATGATGAGTTC0.5253408787AAGTACTTATGATGAGTTCT0.5153408888AGTACTTATGATGAGTTCTC0.4853408989GTACTTATGATGAGTTCTCT0.5153409090ACTTATGATGAGTTCTCTTG0.553409191CTTATGATGAGTTCTCTTGT0.5353409292TGATGAGTTCTCTTGTGAGT0.5853409393TGAGTTCTCTTGTGAGTTAA0.6353409494AGTTCTCTTGTGAGTTAAGT0.5853409595GTTCTCTTGTGAGTTAAGTC0.3753409696TCTTGTGAGTTAAGTCAAAA0.7153409797CTTGTGAGTTAAGTCAAAAC0.9853409898TTGTGAGTTAAGTCAAAACC0.7953409999TGTGAGTTAAGTCAAAACCC0.61534100100TGAGTTAAGTCAAAACCCGT0.87534101101GAGTTAAGTCAAAACCCGTA0.76534102102AGTTAAGTCAAAACCCGTAT0.49534103103GTTAAGTCAAAACCCGTATT0.66534104104AAGTCAAAACCCGTATTTCT0.85534105105AGTCAAAACCCGTATTTCTA0.61534106106GTCAAAACCCGTATTTCTAA0.61534107107CAAAACCCGTATTTCTAAAG0.81534108108AAAACCCGTATTTCTAAAGT0.9534109109AAACCCGTATTTCTAAAGTT0.9534110110AACCCGTATTTCTAAAGTTA0.88.
[0121] Compound IDSEQ ID NOSequence(5’to 3’)상대적 발현율534111111ACCCGTATTTCTAAAGTTAT0.64534112112CCCGTATTTCTAAAGTTATG0.66534113113CCGTATTTCTAAAGTTATGG0.81534114114CGTATTTCTAAAGTTATGGA0.78534115115TTCTAAAGTTATGGATCTTC0.8534116116CTAAAGTTATGGATCTTCTG0.71534117117AGTTATGGATCTTCTGTTCC0.66534118118GTTATGGATCTTCTGTTCCC0.6534119119TTATGGATCTTCTGTTCCCC0.56534120120TGTTCCCCAAAATGAATGGC0.9534121121GTTCCCCAAAATGAATGGCT0.77534122122TCCCCAAAATGAATGGCTTG0.85534123123ATGGCTTGATTTACGTGGTA0.58534124124TGGCTTGATTTACGTGGTAT0.61534125125GGCTTGATTTACGTGGTATT0.67534126126GCTTGATTTACGTGGTATTA0.72534127127CTTGATTTACGTGGTATTAC0.92534128128TTGATTTACGTGGTATTACT0.9534129129CAGCCAATATAGCACTGGCA0.97534130130GAACATCCAAAGTGTCATCA0.81534131131TCCAAAGTGTCATCATGAGA0.6534132132AGCTTATCTCGAACCCTGTT0.72534133133GCTTATCTCGAACCCTGTTA0.72534134134CTGGTTTCACCAAACCGTCT1.01534135135TGGTTTCACCAAACCGTCTC0.82534136136GTTCCACACCGTCCAAAATT0.71534137137TTCCACACCGTCCAAAATTT0.89534138138TGTCCATCAGCCTCCAGTTC0.67534139139TGATTCTGTAGTTGCCATCC0.89534140140GATTCTGTAGTTGCCATCCA0.84534141141GTCAACATTCTTGTTAGTCT0.61534142142TCAACATTCTTGTTAGTCTA0.68534143143GAAACTTCTCTCGGGTCATA0.66534144144CACTCAGACGGTCCAGCATC0.74534145145ACTCAGACGGTCCAGCATCA0.89534146146CTATCTCCCAGGCCTAAAAT1.14534147147ATCTCCCAGGCCTAAAATAT0.91534148148GACGGCATGCTCAAACACCT0.69534149149ACGGCATGCTCAAACACCTC0.86534150150ATCAGAGTCAAGTGGTCATA0.8534151151AAGAGCTGCATCACACGCTC0.96534152152GAGCTGCATCACACGCTCAT1.04534153153CCCGGCACATCAGAAGTTTT0.83534154154GAAACATATTGCAGCTCTAA0.96534155155AAACATATTGCAGCTCTAAG0.86534156156TTGAGATTCGTCGGAACACA0.94534157157TGAGATTCGTCGGAACACAT0.87534158158CACTCTTGGGCCTCCATTAA1.03534159159ACTCTTGGGCCTCCATTAAA0.95534160160GCCCCGTTCCATCATAGCAT0.96534161161CGTTCCATCATAGCATGCAA0.87534162162CCTCAAACATGCCTTTCACG0.96534163163CTCAAACATGCCTTTCACGT0.92534164164CCCCAAAGTACAAACGAGAT0.84534165165CAAAGTACAAACGAGATGCC0.98534166166GCTCACACATGTTCTTCAGA0.51534167167GTGAATGAGACGTCCCACCA0.91534168168TATCAATTCTTGCAATGAGC0.67534169169ATCAATTCTTGCAATGAGCT0.65534170170GACCATAATCAAACCATAAG0.92534171171TCAAACCATAAGGTGAGAAC1.05534172172GCATGACGCAGTTTCTTCTT0.81534173173CATGACGCAGTTTCTTCTTC0.81534174174CTGTAGTACTGCAGCACTTT0.86534175175CAGCTGCCACTCTCCAAGTT0.98534176176AGCTGCCACTCTCCAAGTTT0.75534177177GCTGCCACTCTCCAAGTTTC0.67534178178CTGCCACTCTCCAAGTTTCA0.88534179179CCACTCTCCAAGTTTCAGGA0.55534180180CACTCTCCAAGTTTCAGGAA0.81534181181CTGCATGGTCTGGACAAAAT0.79534182182GATCAACTCCCAGGAGCAAC0.88534183183AACTCCCAGGAGCAACACTA1.02534184184ACTCCCAGGAGCAACACTAA0.89534185185TACTTGAGCCAGGTTCTCAT0.99534186186CACCATAAGGATTTTCTGCC1.16534187187GATTTTCTGCCAGTCCTCTA0.85534188188TTCTGCCAGTCCTCTACGAT1534189189TCTGCCAGTCCTCTACGATA0.85534190190CTGCCAGTCCTCTACGATAC0.79534191191CCAGTCCTCTACGATACGCT0.8534192192TGCAGTCTCTCCCACCAGAT0.66534193193ACAAGTTTGTACTGGATAAC0.97534194194CAAGTTTGTACTGGATAACC1.01534195195AAGTTTGTACTGGATAACCT0.92534196196AGTTTGTACTGGATAACCTC0.89534197197GTTTGTACTGGATAACCTCC0.84534198198TTTGTACTGGATAACCTCCT0.98534199199TTGTACTGGATAACCTCCTC1.01534200200AGCATGTGGCAAGAAACCAT1.06534201201ATATGCCCGACTGTAACTCT0.87534202202TATGCCCGACTGTAACTCTC0.89534203203ATGCCCGACTGTAACTCTCT0.73534204204TGCCCGACTGTAACTCTCTC0.66534205205GCCCGACTGTAACTCTCTCC0.92534206206CCCGACTGTAACTCTCTCCT0.97534207207CAGTTAATTCAGCATCCAGC0.83534208208AGTTAATTCAGCATCCAGCA0.83534209209CAGTGCCAGCACAGCTCTAT0.85534210210AGTGCCAGCACAGCTCTATA0.94534211211GCCAGCACAGCTCTATAAAA0.84534212212CCAGCACAGCTCTATAAAAT0.91534213213GCTCTATAAAATGCCCCATC0.85534214214CTATAAAATGCCCCATCATG0.95534215215GATCATACAGGTGTATTCTT0.74534216216ATCATACAGGTGTATTCTTC0.89534217217TCATACAGGTGTATTCTTCC0.8534218218CATACAGGTGTATTCTTCCA0.68534219219TATTCTTCCATGCTGTCCCA0.92534220220ATTCTTCCATGCTGTCCCAC0.91.
[0122] Compound IDSEQ ID NOSequence(5’to 3’)상대적 발현율534221221TTTCTCATACCAGGTAGCCT0.68534222222CCAAAGTGTTTCATGGCATA0.75534223223GTTTCATGGCATATTCTAAC0.83534224224ATGGCATATTCTAACACTCC0.7534225225TGGCATATTCTAACACTCCG0.52534226226GCATATTCTAACACTCCGGC0.64534227227CATATTCTAACACTCCGGCC0.67534228228ATATTCTAACACTCCGGCCG0.72534229229ATTCTAACACTCCGGCCGCT0.71534230230GGCTGCTGTAGCTTATTATT0.61534231231TAAGTCTTAACTTCTCATCA0.69534232232CAGCAGAACAATGCCATTGT0.77534233233AGCAGAACAATGCCATTGTC0.87534234234GAACAATGCCATTGTCATCT0.81534235235GTGTTCCATGAATTCAGCCA0.7534236236CATGAATTCAGCCAAGTTTA0.72534237237ATGCTTCTGATGAGCTCATC0.59534238238TGCTTCTGATGAGCTCATCC0.54534239239AGCTCATCCTGTTGATCTTC0.63534240240GACACAAATGCAGCATTGAA0.7534241241ACACAAATGCAGCATTGAAG0.66534242242CACAAATGCAGCATTGAAGA0.66534243243AATGCAGCATTGAAGAGATC0.68534244244CTCAGCCGTCTCAGCCATTC0.53534245245TCAGCCGTCTCAGCCATTCC0.67534246246AGCCATTCCAGCCAGTCATC0.67534247247GCCATTCCAGCCAGTCATCT0.67534248248CCATTCCAGCCAGTCATCTT0.76534249249CATTCCAGCCAGTCATCTTT0.66534250250TGGTAAATCAAAGGATCCTC0.68534251251GGTAAATCAAAGGATCCTCC0.6534252252GTAAATCAAAGGATCCTCCT0.75534253253TAAATCAAAGGATCCTCCTC0.8534254254AATCAAAGGATCCTCCTCTT0.72534255255ATCAAAGGATCCTCCTCTTC0.77534256256AAGGATCCTCCTCTTCATCA0.72534257257TCCTCTTCATCAGCAAGTGT0.56534258258CACATCATAGCGCTGATGAT0.8534259259ACATCATAGCGCTGATGATT0.81534260260GGTGTCGCACCAGAACTTTA0.67534261261GTGTCGCACCAGAACTTTAT0.55534262262TGTCGCACCAGAACTTTATT0.59534263263GTCGCACCAGAACTTTATTC0.49534264264TCGCACCAGAACTTTATTCA0.68534265265CGCACCAGAACTTTATTCAC0.68534266266AGAACTTTATTCACCATTGG0.55534267267GGTCCAGTGTTCGAACAATA0.44534268268GGCATAGTCAGTGAAATCCA0.49534269269CTTCAGGGGCATCAAACAAC0.77534270270TTCAGGGGCATCAAACAACT0.65534271271TCAGGGGCATCAAACAACTT0.92534272272ATCCAGGTTGGCGCCAAACA0.64534273273AGCTTAAATTCACCCCCAAG0.66534274274GCTTAAATTCACCCCCAAGA0.67534275275CTTAAATTCACCCCCAAGAG0.73534276276TAAATTCACCCCCAAGAGCT0.74534277277AAATTCACCCCCAAGAGCTA0.79534278278GCTCAATGAGAAGAATGATC0.61534279279CTATTTCATCCATATAAGGT0.73534280280TATTTCATCCATATAAGGTC0.71534281281ATTTCATCCATATAAGGTCT0.72534282282TTCATCCATATAAGGTCTGA0.66534283283TCATCCATATAAGGTCTGAT0.69534284284AAGGACACCAACATTCCCAG0.61534285285GGCAGGAACTGCACACATTT0.51534286286AACTGCACACATTTGAGTCC0.63534287287ATCCGCATCAGGGCCACCAT0.65534288288ACACAGCTGGGTAGAACTCA0.63534289289CACAGCTGGGTAGAACTCAT0.75534290290ACAGCTGGGTAGAACTCATC0.72534291291CAGCTGGGTAGAACTCATCC0.68534292292AGCTGGGTAGAACTCATCCA0.76534293293CATTTCACTAGTGCTATAGT0.74534294294TTTCACTAGTGCTATAGTCA0.75534295295GACTGGTCTATCATGCCAAT0.65534296296GTCTATCATGCCAATGTTCA0.55534297297AAGCCCCTAAAAGCCCTAAC0.63534298298CCTAAAAGCCCTAACACACG0.74534299299CTAAAAGCCCTAACACACGG0.73534300300TAAAAGCCCTAACACACGGA0.7534301301AAAAGCCCTAACACACGGAT0.67534302302AAAGCCCTAACACACGGATG0.7534303303TCAGAAAATTCAGTAGCACC0.67534304304TACTTCCTGTAGGGCTCTAC0.67534305305ACTTCCTGTAGGGCTCTACT0.79534306306TTCCTGTAGGGCTCTACTAC0.67534307307TCCTGTAGGGCTCTACTACA0.82534308308CTGTAGGGCTCTACTACATA0.66534309309ACCAACTGTCCCAGGGTCCA0.62534310310CAACTGTCCCAGGGTCCACA0.7534311311ACACTAACCATGAGCAGAAA0.79534312312CTCATTTCCAGGCCACTAAC0.74534313313CCTATTGTTGCCAGGACATT0.66534314314CTATTGTTGCCAGGACATTA0.68534315315TATTGTTGCCAGGACATTAT0.8534316316ATTGTTGCCAGGACATTATT0.81534317317TTGCCAGGACATTATTGATC0.76534318318GACATTATTGATCACACCTG0.64534319319ATCAGGGTCTGGATCTTTCA0.48534320320TTCAGAATAGGCTCCATGTA0.84534321321GCACTCTGCTCTTTGATTCT0.8534322322TCTTTGATTCTTCCAATCCC0.66534323323TTTGATTCTTCCAATCCCAC0.78534324324GCCAGCTCCCGGATCTCAAA0.8534325325CCAGCTCCCGGATCTCAAAC0.79534326326CAGCTCCCGGATCTCAAACA0.85534327327AGCTCCCGGATCTCAAACAC0.8534328328GCTCCCGGATCTCAAACACC0.84534329329CTCCCGGATCTCAAACACCT1.09534330330TCCCGGATCTCAAACACCTG0.84.
[0123] Compound IDSEQ ID NOSequence(5’to 3’)상대적 발현율534331331GGATCTCAAACACCTGGTCA0.72534332332ATCCGCACAGTGGCGAACAA0.92534333333TCCGCACAGTGGCGAACAAA0.75534334334CCGCACAGTGGCGAACAAAT0.89534335335CGCACAGTGGCGAACAAATT0.87534336336CAAATTCAAAGCTGCCAAGC0.81534337337AAATTCAAAGCTGCCAAGCG0.79534338338AATTCAAAGCTGCCAAGCGT0.88534339339ATTCAAAGCTGCCAAGCGTT0.66534340340TCCAGCAGCTCCTTGATATC0.71534341341TCCAGCACGCGAGGCAAATA0.54534342342CAGCACGCGAGGCAAATAGA0.74534343343AGCACGCGAGGCAAATAGAC0.87534344344GCACGCGAGGCAAATAGACC0.83534345345CACGCGAGGCAAATAGACCT0.94534346346ACGCGAGGCAAATAGACCTT0.28534347347CGCGAGGCAAATAGACCTTA0.34534348348GCGAGGCAAATAGACCTTAA0.77534349349CGAGGCAAATAGACCTTAAA0.85534350350GAGGCAAATAGACCTTAAAC0.75534351351AGGCAAATAGACCTTAAACT0.59534352352GGCAAATAGACCTTAAACTC0.56534353353GCAAATAGACCTTAAACTCA0.7534354354CAAATAGACCTTAAACTCAG0.8534355355AAATAGACCTTAAACTCAGA0.75534356356AATAGACCTTAAACTCAGAC0.75534357357ATAGACCTTAAACTCAGACC0.6534358358TAGACCTTAAACTCAGACCT0.74534359359ACCTTAAACTCAGACCTCAC0.79534360360CCTTAAACTCAGACCTCACA0.9534361361CTCAGACCTCACAGCCACAG0.87534362362TCAGACCTCACAGCCACAGA0.6534363363CAGACCTCACAGCCACAGAA0.56534364364AGACCTCACAGCCACAGAAA0.62534365365GACCTCACAGCCACAGAAAG0.71534366366ACCTCACAGCCACAGAAAGT0.86534367367CCTCACAGCCACAGAAAGTA1.03534368368TCACAGCCACAGAAAGTAGC0.8534369369CACAGCCACAGAAAGTAGCC0.77534370370CAGCCACAGAAAGTAGCCCC0.78534371371AGCCACAGAAAGTAGCCCCA0.93534372372GCCACAGAAAGTAGCCCCAG0.78534373373CCACAGAAAGTAGCCCCAGG0.84534374374AGAAAGTAGCCCCAGGGCTT0.76534375375AAGGCCGCTGTACGTTCCTT0.55534376376AGGCCGCTGTACGTTCCTTC0.71534377377GGCCGCTGTACGTTCCTTCT0.74534378378GCCGCTGTACGTTCCTTCTC0.62534379379CCGCTGTACGTTCCTTCTCC0.56534380380CGCTGTACGTTCCTTCTCCT0.52534381381GCTGTACGTTCCTTCTCCTT0.32534382382CTGTACGTTCCTTCTCCTTC0.59534383383TGTACGTTCCTTCTCCTTCT0.47534384384TCTTGACACAGCTTAGGACA0.61534385385CTTGACACAGCTTAGGACAT0.61534386386AGGCACCAGTAGTACACATA0.7534387387GGCACCAGTAGTACACATAA0.99534388388AACACCTGACCAGCTACATT1.01534389389ACACCTGACCAGCTACATTT0.86534390390CACCTGACCAGCTACATTTC0.87534391391AGCCAAGCGGGGCAACAAAT0.88534392392GCCAAGCGGGGCAACAAATT0.88534393393CCAAGCGGGGCAACAAATTA0.95534394394CAAGCGGGGCAACAAATTAA0.95534395395GCAACAAATTAAGGATTGTC0.67534396396ATCAGCGAGTTCTTGCTATT0.49534397397TCAGCGAGTTCTTGCTATTC0.35534398398CAGCGAGTTCTTGCTATTCC0.27534399399AGCGAGTTCTTGCTATTCCT0.34534400400CGAGTTCTTGCTATTCCTGC0.37534401401GAGTTCTTGCTATTCCTGCA0.25534402402GTTCTTGCTATTCCTGCATT0.51534403403CTTGCTATTCCTGCATTTCA0.34534404404TGCTATTCCTGCATTTCAGC0.64534405405GCTATTCCTGCATTTCAGCA0.58534406406TATTCCTGCATTTCAGCACC0.69534407407ATTCCTGCATTTCAGCACCC0.78534408408CCTGCATTTCAGCACCCACT0.59534409409TCCATTTCTTCTCTCAGACG0.5534410410CCTCCTAATACTCAGGCCAA0.91534411411CTCCTAATACTCAGGCCAAA0.84534412412TCCTAATACTCAGGCCAAAC0.94534413413GATCCGATCATCCCGATTCA0.68534414414ATCCGATCATCCCGATTCAT0.5534415415TCATCCCGATTCATGCCCTT0.6534416416ATCCCGATTCATGCCCTTCT0.41534417417CGATTCATGCCCTTCTCTTT0.5534418418TTGGCCAAGGTCTCATCAAA0.79534419419TCTGCATCTCCTTCGGCTCA0.71534420420CTGCATCTCCTTCGGCTCAC0.64534421421AGGGCTCGCTTCACCTCAAA0.76534422422GGGCTCGCTTCACCTCAAAT0.74534423423GGCTCGCTTCACCTCAAATT0.5534424424GCTCGCTTCACCTCAAATTC0.5 3534425425TCGCTTCACCTCAAATTCCA0.7534426426CGCTTCACCTCAAATTCCAC0.76534427427GATGCCACCTTTCCTCTCAT0.73534428428CCTTTCCTCTCATTGGCATC0.63534429429CATCTGAGCTGGAAACCAAT0.76 534430430ATCTGAGCTGGAAACCAATT0.86534431431TCTGAGCTGGAAACCAATTC0.72534432432CTGAGCTGGAAACCAATTCA0.69534433433CTCAGCTGCCGCCGCCAGCA0.78534434434TCAGCTGCCGCCGCCAGCAC0.99 534435435CACCGCCCGCCTTCCCCGCT0.93534436436ACCGCCCGCCTTCCCCGCTG0.77534437437CCGCCCGC CTTCCCCGCTGT0.77534438438CGCCCGCCTTCCCCGCTGTC0.68534439439CGCCTTCCCCGCTGTCCTCT0.66.
[0124] Example 2: Inhibition of MTOR in SNB-19 cells by 5-10-5 2'-MOE gapmer (multiple doses)
[0125] The 5-10-5 2'-MOE gapmer modified oligonucleotide prepared in Example 1 was tested at various doses in SNB-19 cells.
[0126] SNB-19 cells cultured at a density of 10,000 cells / well were treated with modified oligonucleotides at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM by free uptake. Total RNA was extracted from the cells after 24 h of treatment. The mRNA expression level of the MTOR gene relative to RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. The human RPL-13 primer probe set and human MTOR primer probe set 3 used in Example 1 were used to measure mRNA levels. The results represent relative MTOR mRNA levels compared to untreated control cells.
[0127] IC 50 “Absolute IC” using Prism10 software 50 ” was calculated using the formula. The table below shows the expression level of human MTOR mRNA by 5-10-5 2'-MOE gapmer modified oligonucleotides. In Table 11 below, the MTOR mRNA level and IC at a concentration of 15 μM of the modified oligonucleotides 50 It represents.
[0128] Compound IDSEQ ID NO15μMIC 50(μM)534010100.291.34534011110.170.53534012120.120.11534013 130.110.92534014140.315.37534028280.313.39534032320.230.775 34035350.321.81534071710.190.96534095950.211.175341021020.2 01.305341051050.323.215341061060.241.835341181180.271.09534 3193190.272.635343963960.292.475343973970.332.055343983980.191.305343993990.201.405344004000.201.215344014010.221.095344024020.171.565344034030.302.365344094090.231.185344144140.353.415344164160.323.725344234230.351.285344244240.388.42
[0129] Example 3: Inhibition of MTOR in SNB-19 cells by oligonucleotides with mixed backbone chemistries (single dose)
[0130] Additional gapmers were designed based on the sequences of the oligonucleotides disclosed in the studies described above. The oligonucleotides were designed as 5-10-5 2'-MOE and deoxy oligonucleotides. The 5-10-5 2'-MOE gapmer is 20 nucleotides in length, wherein the central gap segment is composed of ten 2' deoxyribonucleosides and is flanked by wing segments on the 5' and 3' directions, each containing five nucleotides. Each nucleoside within the 5' wing segment and each nucleoside within the 3' wing segment has a 2'-MOE modification. The internucleoside linkages across each gapmer are either phosphodiester or phosphorothioate linkages. The nucleoside linkages of each oligonucleotide are indicated in the backbone chemistry column, where 'o' indicates a phosphodiester linkage and 's' indicates a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5-methylcytosines. Each gapmer listed in the table below targets the human MTOR transcript sequence disclosed herein (Ensembl database transcript ID: ENST00000361445.9).
[0131] In Table 12 below, the sequence numbers (SEQ ID NO) correspond to the nucleic acid sequences described in Tables 1 to 4, but in the corresponding nucleic acid sequences in Tables 1 to 4, the base C (cytosine) is replaced with methylcytosine, and a PO bond is included instead of a PS bond.
[0132]
[0133] SNB-19 cells cultured at a density of 7,000 cells / well were treated with 5 μM modified oligonucleotides via free uptake. Total RNA was extracted from the cells after 24 hours of treatment. The mRNA expression level of the MTOR gene relative to RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. The human RPL-13 primer probe set and human MTOR primer probe set 3 used in Example 1 were used to measure mRNA levels. The results represent the relative expression level of human MTOR mRNA compared to untreated control cells.
[0134] Compound IDMTOR relative expression rateCompound IDMTOR relative expression rateCompound IDMTOR relative expression rateCompound IDMTOR relative Occurrence rate 5740010.175740260.435740510.35740760.455740020.25740270.35740520.315740770.575740030.225740280.345740530.355740780.355740040.195740290.285740540.455740790.475740050.225740300.445740550.455740800.425740060.275740310.45740560. 525740810.455740070.235740320.445740570.425740820.435740080.245740330.495740580.555740830.555740090.25740340.55740590.545740840.545740100.215740350.515740600.635740850.545740110.285740360.535740610.675740860.525740120.395740370 .445740620.755740870.695740130.435740380.555740630.685740880.795740140.435740390.455740640.245740890.775740150.45740400.625740650.275740900.725740160.55740410.725740660.335740910.925740170.555740420.555740670.385740920.51574018 0.525740430.45740680.485740930.445740190.535740440.375740690.435740940.625740200.655740450.435740700.535740950.455740210.65740460.455740710.285740960.595740220.365740470.355740720.35740970.685740230.385740480.425740730.35740980.635740240.35740490.385740740.38****5740250.395740500.295740750.4****.
[0135] Example 4: Inhibition of MTOR in A-431 cells by a 5-10-5 MOE gapmer with mixed backbone chemistries (single dose)
[0136] A-431 cells cultured at a density of 7,000 cells / well were treated with 5 μM modified oligonucleotides via free uptake. Total RNA was extracted from the cells after 24 hours of treatment. The mRNA expression level of the MTOR gene relative to RPL-13, a cell maintenance gene, was measured by quantitative real-time PCR. The human RPL-13 primer probe set and human MTOR primer probe set 3 used in Example 1 were used to measure mRNA levels. The results represent the relative expression level of human MTOR mRNA compared to untreated control cells.
[0137] Compound IDMTOR relative expression rateCompound IDMTOR relative expression rateCompound IDMTOR relative Occurrence rate 5740010.225740340.195740670.155740020.225740350.175740680.255740030.155740360.245740690.245740040.155740370.285740700.325740050.185740380.265740710.155740060.195740390.245740720.145740070.215740400.375740730.125740080.145740410. 375740740.125740090.115740420.315740750.185740100.155740430.235740760.195740110.175740440.185740770.315740120.155740450.155740780.235740130.135740460.195740790.285740140.175740470.155740800.245740150.315740480.215740810.35740160.395 740490.155740820.35740170.445740500.115740830.315740180.445740510.155740840.285740190.485740520.095740850.365740200.535740530.145740860.35740210.485740540.195740870.375740220.25740550.195740880.395740230.195740560.235740890.4557402 40.135740570.225740900.465740250.165740580.315740910.495740260.195740590.315740920.175740270.175740600.365740930.235740280.235740610.375740940.35740290.155740620.475740950.145740300.235740630.495740960.295740310.175740640.125740970.335740320.225740650.115740980.355740330.185740660.21****.
[0138] Example 5: Inhibition of MTOR in SNB-19 cells by 5-10-5 MOE gapmers with mixed backbone chemistries (multiple doses)
[0139] The 5-10-5 2'-MOE gapmer-modified oligonucleotide with the mixed backbone chemistries disclosed in the above-described study was tested at various doses in SNB-19 cells. SNB-19 cells cultured at a density of 10,000 cells / well were treated with the modified oligonucleotide at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM by free uptake. Total RNA was extracted from the cells after 24 h of treatment.
[0140] The mRNA expression level of the MTOR gene, RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. The mRNA level was measured using the human RPL-13 primer probe set and human MTOR primer probe set 3 used in Example 1.
[0141] Results represent relative MTOR mRNA levels compared to untreated control cells. IC 50 “Absolute IC” using Prism10 software 50 ” was calculated using the formula. In Table 15 below, the MTOR mRNA level and IC at a concentration of 15 μM of the modified oligonucleotide 50 It represents.
[0142] Compound ID15μMIC50(μM)Compound ID15μMIC50(μM)5740010.120.355740510.211.355740020.170.735740520.234.595740030.181.045740530.221.555740040.150.475740540.293.095740050.190.915740550.263.345740060.141.355740560.3810.625740070.181.015740570.280.735740080.180.825740640.160.55740090.231.025740650.150.875740100.1815740660.252.115740110.160.875740670.241.845740120.272.65740710.170.775740130.244.185740720.150.945740140.242.715740730.262.355740220.191.525740740.323.465740230.191.025740750.429.195740240.211.245740780.272.015740250.231.355740860.416.725740260.262.65740920.352.495740270.292.315740950.251.345740280.312.665740990.35.335740290.21.345741000.374.255740300.221.435741010.438.925740310.211.595741020.385.625740320.32.025741030.5>155740330.273.285741040.55>155740340.325.465741050.52>155740350.293.875741060.262.245740360.272.045741070.31.915740370.33.945741080.293.655740380.274.765741090.2725740390.251.945741100.253.355740430.293.265741110.387.645740440.241.45741120.375.875740450.365.645741130.343.875740460.33.395741140.479.825740470.294.185741150.363.755740480.243.245741160.313.45740490.293.945741170.435.675740500.252.35741180.415.42.
[0143] Example 6: Inhibition of MTOR in A-431 cells by 5-10-5 MOE gapmers with mixed backbone chemistries (multiple doses)
[0144] The 5-10-5 2'-MOE gapmer-modified oligonucleotide with the mixed backbone chemistries disclosed in the above-described study was tested at various doses in A-431 cells. A-431 cells cultured at a density of 10,000 cells / well were treated with the modified oligonucleotide at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM by free uptake. Total RNA was extracted from the cells after 24 h of treatment.
[0145] The mRNA expression level of the MTOR gene, RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. The mRNA level was measured using the human RPL-13 primer probe set and human MTOR primer probe set 3 used in Example 1.
[0146] The results in Table 16 are the relative MTOR mRNA levels and IC at 15 μM compared to untreated control cells. 50 It represents IC 50 “Absolute IC” using Prism10 software 50 " was calculated using the formula.
[0147] Compound ID15μMIC50(μM)Compound ID15μMIC50(μM)5740010.190.155740510.190.245740020.160.095740520.210.625740030.150.15740530.190.395740040.140.075740540.190.855740050.150.085740550.190.615740060.170.15740560.291.385740070.140.135740570.190.195740080.140.075740640.140.245740090.10.045740650.140.225740100.150.075740660.210.445740110.120.045740670.20.325740120.170.25740710.110.085740130.110.215740720.140.065740140.130.165740730.130.15740220.140.115740740.130.125740230.160.155740750.190.195740240.150.165740780.130.095740250.170.15740860.320.855740260.190.355740920.291.15740270.20.445740950.160.485740280.210.675740990.140.275740290.170.465741000.180.475740300.110.325741010.180.555740310.110.285741020.180.625740320.220.365741030.240.965740330.250.515741040.231.665740340.230.885741050.363.085740350.230.825741060.130.155740360.414.455741070.150.135740370.251.845741080.180.165740380.251.075741090.150.115740390.250.565741100.170.215740430.230.875741110.210.525740440.220.435741120.180.465740450.230.755741130.270.555740460.250.475741140.30.515740470.150.525741150.260.455740480.180.915741160.260.465740490.230.685741170.240.215740500.190.215741180.340.83.
[0148] Example 7: Inhibition of MTOR in SNB-19 cells by LNA oligonucleotides (single dose)
[0149] LNA-modified oligonucleotides were designed to target human MTOR RNA and tested for their effects on MTOR mRNA in vitro. The modified oligonucleotides, shown in Table 17 below, have phosphorothioate (PS) internucleoside linkages (PS linkages) and do not contain modified bases. The sequences in Table 17 are presented in the 5' to 3' direction, and in the sugar moiety formulas, 'D' represents a 2'-deoxyribosyl sugar moiety and 'L' represents an LNA sugar moiety.
[0150]
[0151] SNB-19 cells cultured at a density of 7,000 cells / well were treated with 5 μM modified oligonucleotides via free uptake. After 24 hours of treatment, total RNA was extracted from the cells. The mRNA expression level of the MTOR gene relative to RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. The human RPL-13 primer probe set and human MTOR primer probe set 3 used in Example 1 were used to measure mRNA levels.
[0152] The analysis results represent the relative expression of MTOR mRNA compared to untreated control cells. Each gapmer listed in the table below targets the human MTOR transcript sequence disclosed herein (Ensembl database transcript ID: ENST00000361445.9). Table 18 below shows the expression levels of human MTOR mRNA by LNA-modified oligonucleotides.
[0153] Compound IDMTOR relative expression rateCompound IDMTOR relative expression rateCompound IDMTOR relative Occurrence rate: 5360010.215360500.315361120.415360020.175360510.475361150.475360030.225360520.365361170.255360040.25360530.455361190.255360050.255360540.495361210.145360060.135360550.415361220.415360070.215360560.55361230.165360080.175360570.565 361290.185360090.155360580.295361300.255360100.135360590.415361310.165360110.175360600.155361320.315360120.255360610.255361330.15360130.235360620.485361340.325360140.135360630.435361350.135360150.275360640.165361360.325360160.1453606 50.165361370.425360170.135360660.255361410.315360180.235360670.145361420.145360190.235360680.215361430.395360200.165360690.45361450.255360210.185360700.185361480.395360220.175360710.235361500.185360230.215360720.455361610.55360240.18 5360750.245361630.345360250.225360760.345361640.125360260.225360770.45361660.215360270.175360780.435361670.35360280.295360790.375361680.335360290.25360820.35361690.155360300.185360830.365361700.145360310.25360840.445361710.235360320.155360860.175361720.285360330.155360870.245361730.175360340.265360880.245361740.195360350.195360890.375361750.135360360.465360900 .225361760.115360370.35360910.25361770.165360380.425360920.225361780.125360390.245360930.345361790.195360400.215360940.165361800. 315360410.25360950.175361810.165360420.515360960.185361820.395360430.345360970.35361830.235360440.425360980.225361840.285360450.2 85360990.195361870.25360460.225361000.255361880.415360470.435361010.245361910.135360480.255361020.225361920.215360490.51********.
[0154] Example 8: Inhibition of MTOR in SH-SY5Y cells by LNA oligonucleotides (single dose)
[0155] SH-SY5Y cells cultured at a density of 40,000 cells / well were transfected with 5 μM modified oligonucleotides using electroporation. After a 24-h treatment period, total RNA was extracted from the cells.
[0156] The mRNA expression level of the MTOR gene, RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. The mRNA level was measured using the human RPL-13 primer probe set and human MTOR primer probe set 3 used in Example 1.
[0157] The analysis results represent the relative expression of MTOR mRNA compared to untreated control cells. Each gapmer listed in the table below targets the human MTOR transcript sequence disclosed herein (Ensembl database transcript ID: ENST00000361445.9). Table 19 below shows the expression levels of human MTOR mRNA by LNA-modified oligonucleotides.
[0158] Compound IDMTOR relative expression rateCompound IDMTOR relative expression rateCompound IDMTOR relative expression rateCompound IDMTOR relative Occurrence rate 5360010.445360410.285360970.395361480.355360020.385360420.365360980.385361490.435360030.435360430.385360990.45361500.385360040.65360440.325361000.335361530.25360050.465360450.555361010.345361540.465360060.555360460.535361020. 355361550.455360070.425360470.635361100.385361570.465360080.245360480.515361110.355361600.315360090.395360490.585361120.35361610.165360100.345360500.245361130.435361620.285360110.315360510.445361150.345361630.215360120.55360520. 365361160.395361640.395360130.525360530.465361180.55361650.25360140.335360540.65361190.365361660.295360150.375360550.395361200.445361670.165360160.295360560.455361210.395361680.245360170.335360570.535361230.255361690.235360180.3 45360580.365361240.495361700.165360190.45360590.535361250.375361710.355360200.275360600.195361270.365361720.185360210.355360610.285361280.385361730.125360220.335360620.335361290.285361740.225360230.345360630.725361300.315361750.185360240.395360640.225361310.25361760.245360250.325360650.275361320.245361770.245360260.355360660.385361330.45361780.175360270.315360670.245361340.315361790.225360280. 325360680.35361350.365361800.175360290.245360690.485361360.35361810.175360300.265360700.355361370.285361820.155360310.325360710.425361380.415361830.335360320.225360750.3 85361390.345361840.235360330.215360860.295361400.35361850.125360340.255360870.315361410.45361860.245360350.415360880.295361420.35361870.145360360.335360900.335361430.345 361880.175360370.255360910.395361440.415361890.215360380.395360940.215361450.255361900.235360390.25360950.255361460.315361910.125360400.245360960.375361470.345361920.15.
[0159] Example 9: Inhibition of MTOR in SNB-19 cells by LNA oligonucleotides (multiple doses)
[0160] The LNA-modified oligonucleotides prepared in Example 7 were tested at various doses in SNB-19 cells. SNB-19 cells cultured at a density of 10,000 cells / well were treated with the modified oligonucleotides at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM by free uptake. Total RNA was extracted from the cells after 24 h of treatment. The mRNA expression levels of the MTOR gene, one of the cell maintenance genes, relative to RPL-13, were measured by quantitative real-time PCR. mRNA levels were measured using human RPL-13 primer probe set (forward sequence: ATTTCTGTGGATCCGAGGAGG, reverse sequence: GCCAGTTTCAGTTCTTCAGCAGA, probe sequence: AGTACCGCTCCAAACTCATCCTCTTCC) and human MTOR primer probe set 3 (forward sequence: GAGATCCAGGCTACCTGGT, reverse sequence: GGTGGAGTTGACCCCATTC, probe sequence: ATGGACACCAACAAGGACGACCCAGA).
[0161] The results in Table 20 show the relative MTOR mRNA levels and IC at 15 μM compared to untreated control cells. 50 It represents IC 50 “Absolute IC” using Prism10 software 50 " was calculated using the formula.
[0162] Compound ID15μMIC50(μM)5360080.120.325360100.120.45360110.231.175360140 .150.325360160.180.395360170.190.615360180.310.835360200.160.3 75360211.10.255360220.140.245360230.190.465360250.270.595360260.140.725360270.150.445360290.170.385360300.150.515360310.150.6 25360320.160.315360330.140.275360340.230.475360600.20.375360860.220.55360870.262.575360900.330.575360940.120.485360950.350.0 65361010.342.045361700.10.175361730.120.195361750.120.115361780.110.095361810.090.125361870.110.265361910.10.235361920.190.25
[0163] Example 10: Inhibition of intracellular MTOR by siRNA and C16-siRNA (multiple doses)
[0164] Lipophilic moieties are well known to enhance the cellular uptake of oligonucleotides and siRNAs and their delivery to various organs, including the central nervous system (CNS). siRNAs targeting human MTOR RNA, conjugated with C16 (palmitic acid), were treated with SNB-19 cells and SK-N-AS cells, respectively, and MTOR mRNA expression levels were measured.
[0165] In Table 21 below, duplexes D-598701, D-598702, D-598703, and D-598704 do not have a C16-conjugate in the sense strand, while D-598705, D-598706, D-598707, and D-598708 have a C16-conjugate attached to the sense strand. The nucleobase sequence of the mTOR sequence (Ensembl Nucleotide ID ENST00000361445.9) to which it will complementarily bind is shown in the target sequence column of Table 14 below, and the start point and end point indicate the base positions of the MTOR nucleobase sequence (Ensembl Nucleotide ID ENST00000361445.9) provided by Ensemble.
[0166] Duplex oligos, name, strand oligos, sequence, sequence number, start site, end site, target sequence (sequence number), D-598701, 598001, sense, AUUCUAUCACUAGCGUGACTT456N / AN / AN / A, 598002, antisense, GUCACGCUAGUGAUAGAAUTT457, D-598702, 598003, sense, GAAUGUUGACCAAUGCUAUTT458147, 717147, 735, GAATGTTGACCAATGCTAT(464), 598004, antisense, AUAGCAUUGGUCAACAUUCTT459, D-5987 03598005 SenseGGUCUGAGUUUAAGGUCUATT46019,36019,378GGTCTGAGTTTAAGGTCTA(465)598006 AntisenseUAGACCUUAAACUCAGACCTT461D-598704598007 SenseGCCGCAUUGUCUCUAUCAATT46249,13449,152GCCGCATTGTCTCTATCAA(466)598008 AntisenseUUGAUAGAGACAAUGCGGCT T463D-598705598009 SenseAUUCUAUCACUAGCGUGACTT456N / AN / AN / A598002 AntisenseGUCACGCUAGUGAUAGAAUTT457D-598706598010 SenseGAAUGUUGACCAAUGCUAUTT458147,717147,735GAATGTTGACCAATGCTAT(464)598004 AntisenseAUAGCAUUGGUCAACAUUCTT459D-59870759 8011 SenseGGUCUGAGUUUAAGGUCUATT46019,36019,378GGTCTGAGTTTAAGGTCTA(465)598006 AntisenseUAGACCUUAAACUCAGACCTT461D-598708598012 SenseGCCGCAUUGUCUCUAUCAATT46249,13449,152GCCGCATTGTCTCTATCAA(466)598008 AntisenseUUGAUAGAGACAAUGCGGCTT463
[0167] SNB-19 and SK-N-AS cells cultured at densities of 8,000 cells / well and 20,000 cells / well, respectively, were transfected with 0.3, 3, and 30 nM of unmodified siRNA and C16-conjugated siRNA using Lipofectamine™ RNAiMAX Transfection Reagent (Thermo Fisher Scientific). Total RNA was extracted from the cells after 24 h of treatment.
[0168] The mRNA expression level of the MTOR gene, RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. The mRNA level was measured using the human RPL-13 primer probe set and human MTOR primer probe set 3 used in Example 1.
[0169] CompoundSNB-19SK-N-ASDuplex0.3nM3nM30nM0.3nM3nM30nMD-5987011.231.100.960.900 .890.95D-5987020.520.350.290.410.360.28D-5987030.450.290.270.350.260.28D-5987 040.460.360.250.370.270.21D-5987051.091.270.820.890.730.77D-5987060.480.350.3 50.240.470.24D-5987070.570.450.360.340.310.25D-5987080.800.580.410.510.440.32
[0170] The above experimental results represent relative MTOR mRNA levels compared to untreated control cells. As shown in Table 22, MTOR mRNA levels were reduced in a dose-dependent manner in modified siRNA-treated cells.
[0171]
[0172] Example 11: Tolerability of a modified oligonucleotide complementary to human MTOR at a dose of 600 μg in mice.
[0173] The modified oligonucleotide used in this study has the mixed backbone chemistry prepared in Example 3, with the cytosine bases modified to 5-mC, and is a 5-10-5 2'-MOE gapmer. This gapmer is 20 nucleosides long, wherein the central gap segment consists of 10 2'-deoxynucleotides, and the 3' and 5' wings each consist of 5 2'-MOE nucleotides. The modified oligonucleotide described above was tested in mice to evaluate the tolerability of the oligonucleotide.
[0174] Specifically, wild-type C57 / Bl6 mice received a single 600 μg intracerebroventricular injection of the oligonucleotides listed in the table below. Each treatment group consisted of three mice. A group of mice receiving DPBS served as a negative control. Three hours after administration, the mice were evaluated according to seven different criteria. These criteria included: (1) whether the mouse was bright, alert, and responsive; (2) whether the mouse stood or crouched without stimulation; (3) whether the mouse exhibited any movement without stimulation; (4) whether the mouse moved forward after being lifted; (5) whether the mouse exhibited any movement after being lifted; (6) whether the mouse responded to a tail pinch; and (7) whether the mouse was breathing regularly. For each of the seven criteria, a subscore of 0 was given if the mouse met the criterion, and a score of 1 (Functional Observation Global Assessment score, or FOB) was given otherwise. After assessing all seven criteria, scores were summed for each mouse and averaged within each treatment group. The results are presented in Table 23 below. “nd” indicates that no deaths were measured in the treated individuals.
[0175] Compound IDscoreCompound IDscoreDPBS057406535740012.357406605740031.557406705740041.5574071157 40060.5574072057400705740786574022nd5741002.757402365741012.75740245.3 5741021.75740254.75741061.35740295.35741070574030357410805740312.35741090.35740443.35741100.75740506574111057405165741120.357406435741170.7
[0176] Brain tissue autopsied 8 weeks after intracerebroventricular administration was used to measure mRNA levels of Iba1, a microglial marker, and Gfap, an astroglial marker, in the cerebellum. Both Iba1 and Gfap are markers of CNS inflammation, and therefore, higher levels of either marker are thought to indicate a lower tolerance of the oligonucleotide in mice. mRNA expression levels of Iba1 and Gfap genes relative to Hprt, a cell maintenance gene, were measured by quantitative real-time PCR. mRNA levels were measured using the mouse Hprt primer set (forward primer sequence: TCAGTCAACGGGGGACATAAA (SEQ ID NO: 476), reverse primer sequence: GGGGCTGTACTGCTTAACCAG (SEQ ID NO: 477)), Gfap primer set (forward sequence: AACCTGGCTGCGTATAGA (SEQ ID NO: 478), reverse sequence: CGAACTTCCTCCTCATAGAT (SEQ ID NO: 479)), and Iba1 primer set (forward sequence: ATCAACAAGCAATTCCTC (SEQ ID NO: 480), reverse sequence: ATATCTCCATTTCCATTCAG (SEQ ID NO: 481)). “nd” indicates that the death of the administered individual was not measured.
[0177] Compound ID Cerebellum Gfap Cerebellum Iba1 Compound ID Cerebellum Gfap Cerebellum Iba1DPBS115740652.281.725740010.791.025740661.331.295740030.910.875740671.741.755740041.321.545740714.373.825740060 .871.325740724.13.625740070.821.165740780.790.69574022ndnd5741000.921.13574023n.dnd5741011.121.455740240.760.695741 021.031.35740250.980.695741060.871.35740290.840.555741070.861.135740300.780.65741080.971.125740310.770.625741090.951.115740441.861.395741100.881.045740501.040.865741111.141.395740510.730.775741120.971.15740641.481.335741170.911.12
[0178] Example 12: Tolerability of a modified oligonucleotide complementary to human MTOR at a dose of 3 mg in rats.
[0179] The modified oligonucleotides described above were tested in rats to assess their tolerability. Sprague-Dawley rats received a single intrathecal injection of 3 mg of the oligonucleotides listed in the table below. Each treatment group consisted of three rats, and a group receiving PBS served as a negative control. Locomotor and wakefulness were assessed for each rat at 3 hours and 8 weeks after administration.
[0180] For the gait assessment, each mouse was given a score based on the following criteria: -2 for ataxia or excessive swaying; -1 for dragging or splaying limbs; 0 for normal gait with limb support; 1 for walking on toes; and 2 for walking with a hunched back. For the arousal status, each mouse was given a score based on the following criteria: 1 for anesthesia or coma; 2 for significantly low arousal, with only slight head or body movement; 3 for low arousal, with no movement and a slight stroll; 4 for normal state, with vigilance and strolling; 5 for high arousal, with excitement, tension, sudden lunging, and stiffness; and 6 for significantly high arousal, with high vigilance, excitement, and running around. The scores for the gait and arousal status assessments were summed for each mouse and averaged within each treatment group. The results are presented in Table 25 below.
[0181] Compound ID3 hours walking3 hours awakening state8 weeks walking8 weeks awakening stateDPBS0404574001-0.72.704574004-0.7404574007-0.73.704574031-1304574066-0.73.30457410604045741070404574108040457410904045741100404
[0182] Tolerability was assessed by measuring mRNA levels of the Iba1 microglial marker and Gfap astroglial marker in the cerebral cortex and cerebellum regions using brain tissue autopsied 8 weeks after administration. Both Iba1 and Gfap are markers of CNS inflammation, and therefore, higher levels of either marker are considered to indicate a lower tolerability of the oligonucleotide in rats. mRNA expression levels of the Iba1 and Gfap genes relative to Gapdh, a cell maintenance gene, were measured by quantitative real-time PCR. mRNA levels were measured using rat Gapdh primer probe set (forward sequence: TGCTCCTCCCTGTTCTAGAGACA (SEQ ID NO: 482), reverse sequence: CACCGACCTTCACCATCTTGT (SEQ ID NO: 483), probe sequence: CCGCATCTTCTTGTGCAGTGCCAG (SEQ ID NO: 484)), Gfap primer probe set (Thermo Fisher, Assay ID Rn01253033_m1), and rat Iba1 primer probe set (forward sequence: AGGAGAAAAACAAAGAACACCAGAA (SEQ ID NO: 485), reverse sequence: CAATTAGGGCAACTCAGAAATAGCT (SEQ ID NO: 486), probe sequence: CCAACTGGTCCCCCAGCCAAGA (SEQ ID NO: 487)). The results are presented in Table 26 below.
[0183] Compound ID Cerebral Cortex Gfap Cerebral Cortex Iba1 Cerebellum Gfap Cerebellum Iba1 DPBS1.001.001.001.005740011.321.291.051.645740041.11.120.880.95740070.690.920.680.815740311.131.290.841.13574 0660.981.230.590.985741060.971.131.021.665741070.931.410.611.25741080.781.380.771.045741090.660.980.671.035741100.981.490.631.2
[0184] Example 13: Inhibition of MTOR in SH-SY5Y cells by 5-10-5 MOE gapmers with mixed backbone chemistries (multiple doses):
[0185] The modified oligonucleotides of the above examples were tested at various doses in SH-SY5Y human cells. Cells were seeded at a density of 3,700 cells per well and transfected using electroporation with the modified oligonucleotides at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM. After a 24-hour treatment period, total RNA was extracted from the cells.
[0186] The mRNA expression level of the MTOR gene, RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. The mRNA level was measured using the human RPL-13 primer probe set and human MTOR primer probe set 3 used in Example 1.
[0187] The results in Table 27 show the relative MTOR mRNA levels and IC at 15 μM compared to untreated control cells. 50 It represents IC 50 “Absolute IC” using Prism10 software 50 " was calculated using the formula.
[0188] Compound ID15μMIC50(μM)5740010.170.835740040.110.885740070.160.665740310.151.355740660 .060.485741060.160.435741070.120.535741080.140.575741090.170.435741100.130.39
[0189] Example 14: Inhibition of MTOR in human neurons by 5-10-5 MOE gapmers with mixed backbone chemistries (multiple doses)
[0190] Selected modified oligonucleotides complementary to human MTOR were tested for their effects on MTOR mRNA levels in human neurons by in vitro free uptake. Human embryonic stem cell (ESC)-derived neurons were seeded at a density of 30,000 cells per well. Cultured human neurons were treated with modified oligonucleotides at concentrations of 0.39, 0.78, 1.56, 3.12, 6.25, 12.5, 25, and 50 μM for 3 days. After 3 days, the medium was replaced with modified oligonucleotide-free medium, and total RNA was extracted from the cells 6 days later.
[0191] The mRNA expression level of the MTOR gene, one of the cell maintenance genes, was measured using quantitative real-time PCR. The mRNA level was measured using the human HPRT primer probe set and human MTOR primer probe set 1 used in Example 1.
[0192] The results in Table 28 show the relative MTOR mRNA levels and IC at 15 μM compared to untreated control cells. 50 It represents IC 50 “Absolute IC” using Prism10 software 50 " was calculated using the formula.
[0193] Compound ID15μMIC50(μM)5740070.241.785741070.201.775741090.272.07
[0194] Example 15: Inhibition of MTOR expression and activity in human neurons with MTOR mutations using modified oligonucleotides complementary to human MTOR.
[0195] To determine whether modified oligonucleotides complementary to human MTOR inhibit MTOR expression and activity in the hyperactive MTOR signaling pathway, human embryonic stem cell (ESC)-derived neural cells harboring the MTOR p.Leu2427Pro mutation found in FCD type II patients were utilized. Human ESCs harboring the MTOR p.Leu24247Pro (c.7280T>C) mutation were differentiated into neural cells using CRISPR / Cas9 technology, and then seeded at a density of 400,000 cells per well. The modified oligonucleotides (compound IDs 574120, 574007, 574107, and 574109 in Table 30 below) at concentrations of 5 μM, 10 μM, and 50 μM were treated together with the cultured human neural cells for 3 days. After 3 days, the medium was replaced with a medium without the modified oligonucleotide, and 21 days later, proteins were extracted from the cells. Compound ID 574120 was used as a negative control, along with a non-targeting oligonucleotide (Compound ID 574120) presented in Table 29.
[0196] Compound IDSEQ ID NOSequence MoietyNucleoside Bond574120449CCTATAGGACTATCCAGGAAeeeeeddddddddddeeeeesoooosssssssssooss
[0197] As shown in Fig. 1, the expression level of MTOR (Cell signaling technology, cat no. 2983S) protein relative to α-tubulin (Cell signaling technology, cat no. 3873S), one of the cell maintenance proteins, and the expression level of p-4EBP1 (Cell signaling technology, cat no. 2855S) protein relative to 4EBP1 (Cell signaling technology, cat no. 9644S), an activity indicator of the MTOR signaling system, were analyzed by Western blotting for inhibition of MTOR expression and activity.
[0198] The results in Tables 30 and 31 represent relative MTOR and p-4EBP1 protein levels compared to untreated control cells. As illustrated in the table below, MTOR and p-4EBP1 protein levels were reduced in a dose-dependent manner in cells treated with the modified oligonucleotides. "N / A" indicates that the condition was not evaluated.
[0199] Compound IDMTOR protein relative expression 5μM 10μM 50μM 574120N / AN / A 1.075740070.48N / A 0.205741070.520.410.185741090.480.290.14
[0200] Compound IDp-4EBP1 / 4EBP1 relative expression level 5μM 10μM 50μM 574120N / AN / A 0.915740070.73N / A 0.335741070.520.520.335741090.580.450.38
[0201] Example 16: Evaluation of the efficacy of 5-10-5 2'-MOE gapmer in FCD type II human neurospheres.
[0202] The modified oligonucleotide used in this study is a 5-10-5 2'-MOE gapmer in which the cytosine base of the 5-10-5 2'-MOE gapmer without the modified base and having the PS linkage prepared in Example 1 is modified to 5-mC. This gapmer is 20 nucleosides in length, wherein the central gap segment is composed of 10 2'-deoxynucleotides, and the 3' and 5' wings are each composed of 5 2'-MOE nucleotides.
[0203] Differentiation into neural spheres was induced for a total of 42 days from stem cells harboring the MTOR mutation (c.7280T>C) reported in normal and FCD type II disease. Embryoid bodies (EBs) were treated with 10 μM SB431542 and 5 μM Dorsomorphin for 4 days, followed by 8 days of differentiation into early neuroectoderm with neural rosettes (NRs). Only neural rosettes were selectively selected and differentiated into 3D neural precursor cells (NPCs) for 9 days. The 3D-shaped neural precursors were replaced with a medium that can develop into neurons, and matured into neural spheroids for 21 days.
[0204] Differentiated normal and MTOR mutant neurospheres were treated with the modified oligonucleotides described above at concentrations of 2 and 5 μM for 10 days by free absorption, and total RNA was extracted from the cells. The mRNA expression level of the MTOR gene was compared and analyzed with respect to RPL-13, one of the cell maintenance genes, using quantitative real-time PCR based on the TaqMan technique. The human RPL-13 primer probe set used in Example 1 and the human MTOR primer probe set (Thermo Fisher Scientific, 4331182, HS00234508_m1) were used for quantification. The results were analyzed for the relative MTOR mRNA expression level compared to the PBS-treated group of normal-derived neurospheres that were not treated with the modified oligonucleotides. The results of the analysis are shown in Table 32 below for the relative expression level of MTOR mRNA, where “nd” indicates that the level of inhibition was not measured, and WT neurons are wild type.
[0205] Compound ID Sequence Number WT Neuron FCD Type II Neuron 0μM 2μM 5μM 0μM 2μM 5μM 5 34442 121.000.470.340.940.470.365344553981.000.27nd0.940.29n.d.
[0206] Example 17: Effect of modified oligonucleotides complementary to human MTOR on abnormal neuronal firing in human neurons with MTOR mutations
[0207] Similar to epilepsy in patients with mTORopathy diseases such as FCD type II and TSC, the firing rate in human neurons with hyperactivation of the MTOR signaling pathway is abnormally increased. Therefore, using human embryonic stem cell-derived neurons with the MTOR p.Leu2427Pro mutation inserted as used in the above example, we analyzed the weighted mean firing rate and burst frequency using a multi-electrode array system, and tried to confirm the effect of modified oligonucleotides complementary to human MTOR on these.
[0208] On the third day of differentiation of human embryonic stem cells into neurons, 100,000 human neurons and 16,700 rat cortical astrocytes per well were co-cultured in CytoView MEA 48-well plates (M768-tMEA-48W; Axion Biosystems), and the medium was replaced every 3–4 days. On day 27 of differentiation, neurons were treated with modified oligonucleotides (Compound ID 574120, 574007, 574107, 574109 in Table 30) at a concentration of 50 μM for 3 days, and then the medium was replaced with the medium without the modified oligonucleotides after 3 days. PBS-treated cells and non-targeting oligonucleotide (Compound ID 574120) were used as negative controls. From day 13 to day 48 of neuronal differentiation, multielectrode array system recordings were performed every 3-4 days, and the weighted average firing rate and burst frequency were analyzed.
[0209] As shown in Figures 2 and 3, it was confirmed that the weighted average firing rate and burst frequency of MTOR p.Leu24247Pro mutant neurons, which were increased compared to normal neurons on day 27 of differentiation, were reduced to the level of normal neurons on day 48 of differentiation by treatment with modified oligonucleotides complementary to human MTOR (compound ID 574007, 574107, 574109).
[0210]
[0211] Example 18: Effect of modified oligonucleotides complementary to human MTOR on hypertrophic variants in human neurons with MTOR mutations
[0212] It is well known that neurons harboring mutations in the brains of patients with FMCD, a disorder characterized by hyperactivation of the mTOR signaling pathway, such as FCD type II, HME, and TSC, are enlarged compared to normal neurons. To determine whether a modified oligonucleotide complementary to human MTOR exhibits efficacy against these hypertrophic variants, we utilized human embryonic stem cell (ESC)-derived neurons harboring the MTOR p.Leu2427Pro mutation found in FCD type II patients.
[0213] Human embryonic stem cells harboring the MTOR p.Leu24247Pro (c.7280T>C) mutation were differentiated into neurons using CRISPR / Cas9 technology and seeded at a density of 140,000 cells per well. Oligonucleotides modified at a concentration of 50 μM (compound IDs 574120, 574007, 574107, and 574109 in Table 30) were treated with cultured human neurons for 4 days. Cells treated with PBS and a non-targeting oligonucleotide (NT ASO) of compound ID 574120 served as negative controls.
[0214] After 4 days, the medium was replaced with a medium without the modified oligonucleotide, and 10 days later, the size of the cell bodies (soma) was analyzed by immunostaining for the neuronal marker MAP2 (Sigma, M1406). The size of 51-81 neurons per test group was measured.
[0215] As a result of the above experiment, as shown in Fig. 4, it was confirmed that the hypertrophic transformed form, which was increased compared to normal nerve cells, was restored to a normal level by treatment with modified oligonucleotides complementary to human MTOR (compound ID 574007, 574107, 574109).
[0216]
[0217] Example 19: Inhibition of MTOR in the nonhuman primate cell line CO31 by a 5-10-5 MOE gapmer with mixed backbone chemistries (multiple doses)
[0218] The modified oligonucleotide described above is complementary to the MTOR gene sequence of the cynomolgus monkey. The modified oligonucleotide was tested at various doses in CO31 cynomolgus monkey fibroblast cells. Cells were seeded at a density of 12,000 cells per well and transfected using electroporation with the modified oligonucleotide at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM. After a 24-hour treatment period, total RNA was extracted from the cells.
[0219] The mRNA expression level of the MTOR gene, RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. The mRNA level was measured using the RPL-13 primer probe set and MTOR primer probe set 3 used in Example 1.
[0220] The results in Table 33 below show the relative MTOR mRNA levels and IC at 15 μM compared to untreated control cells. 50It represents IC 50 “Absolute IC” using Prism10 software 50 " was calculated using the formula.
[0221] Compound ID15μMIC50(μM)5740010.181.705740040.171.465740070.081.655740310.161.805740660 .061.245741060.220.925741070.180.755741080.141.015741090.241.045741100.210.76
[0222] Example 20: Efficacy of modified oligonucleotides complementary to human MTOR in nonhuman primates
[0223] The modified oligonucleotides described above were further evaluated for efficacy in nonhuman primates (NHPs). Two cynomolgus monkeys received an intrathecal bolus injection of 40 mg of each compound on days 1 and 29 of the study. Two weeks after administration on day 29, relative MTOR mRNA expression levels in the brain cortex and spinal cord were analyzed.
[0224] The mRNA expression level of the MTOR gene, one of the cell maintenance genes, was measured by quantitative real-time PCR. mRNA levels were measured using the nonhuman primate UBC primer probe set (Thermo Fisher, Assay ID Mf02798368_m1) and the nonhuman primate MTOR primer probe set (Thermo Fisher, Assay ID Mf01042402_m1). Brain tissue from monkeys that received no treatment was used as a control, and the relative expression of MTOR mRNA is shown in Table 34 below. As shown in the table below, the modified oligonucleotides reduced MTOR mRNA in the cerebral cortex and spinal cord regions compared to the control.
[0225] Compound ID Prefrontal cortex Motor cortex Temporal cortex Lumbar spinal cord 5740070.360.400.340.425741070.410.490.390.315741090.320.490.310.13
Claims
1. An oligomeric compound comprising a modified oligonucleotide comprising 8 to 80 linked nucleosides complementary to an MTOR nucleotide sequence, as a compound for regulating the activity and / or expression level of MTOR, An oligomeric compound wherein the nucleic acid sequence of the modified oligonucleotide has at least 80% complementary sequence identity to a target region within an MTOR transcript, and the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage, and a modified base.
2. An oligomeric compound according to claim 1, wherein the target region comprises a nucleic acid sequence selected from the group consisting of sequence numbers 440 to 446.
3. In the second paragraph, the nucleic acid sequence of the modified oligonucleotide comprises 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 adjacent nucleobases among the nucleic acid sequences of SEQ ID NOs: 1 to 19, the nucleic acid sequences of SEQ ID NOs: 27 to 36, the nucleic acid sequences of SEQ ID NOs: 68 to 81, the nucleic acid sequences of SEQ ID NOs: 396 to 403, or the nucleic acid sequences of SEQ ID NOs: 414 to 417, An oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage, and a modified base.
4. In the first paragraph, the nucleic acid sequence of the modified oligonucleotide comprises 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 adjacent nucleobases among the nucleic acid sequences of SEQ ID NO: 447 to SEQ ID NO: 453, An oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage, and a modified base.
5. In the first paragraph, the nucleic acid sequence of the modified oligonucleotide comprises an oligonucleotide composed of nucleosides linked to 14 to 80 consecutive, for example, 14 to 30, or 14 to 22, specifically 14, 15, 16, 17, 18, 19, 20, 21, or 22 adjacent nucleobases, including the nucleic acid sequence of SEQ ID NO: 454, An oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage, and a modified base.
6. In the first paragraph, the nucleic acid sequence of the modified oligonucleotide comprises an oligonucleotide composed of nucleosides linked to 9 to 80 consecutive, for example, 12 to 30, or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19 or 20 adjacent nucleobases, including the nucleic acid sequence of SEQ ID NO: 455, An oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified internucleoside linkage, and a modified base.
7. An oligomeric compound according to claim 2, wherein the nucleic acid sequence of the modified oligonucleotide comprises 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases selected from one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 10, 11, 12, 13, 14, 28, 32, 35, 71, 396, 397, 398, 399, 400, 401, 402, 403, 414, and 416.
8. In the second paragraph, the nucleic acid sequence of the modified oligonucleotide is an oligomeric compound having SEQ ID NO: 10, 11, 12, 13, or 14.
9. In any one of paragraphs 1 to 8, the modified oligonucleotide is A 5'-wing region consisting of 1 to 7 linked 5'-region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and 3'-wing region consisting of 1 to 7 linked 3'-region nucleosides An oligomeric compound comprising:
10. An oligomeric compound according to any one of claims 1 to 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
11. An oligomeric compound according to any one of claims 1 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic modified sugar moiety having a 2'-4' bridge and at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
12. In any one of claims 1 to 11, the modified sugar moiety is a non-bicyclic modified sugar moiety consisting of a 2'-MOE sugar moiety and a 2'-OMe sugar moiety; and An oligomeric compound comprising at least one selected from the group consisting of bicyclic modified sugar moieties comprising a 2',4'-bridge selected from O-CH2-; and -O-CH(CH3)-.
13. In the 11th paragraph, the modified oligonucleotide comprises a 5'-wing region; a central gap region; and a 3'-wing region, An oligomeric compound comprising a bicyclic modified sugar moiety and a non-bicyclic modified sugar moiety at one or more nucleosides selected from the group consisting of the above 5'-wing and 3'-wing, wherein the bicyclic modified sugar moiety is a bicyclic modified sugar moiety having a 2'-4' bridge.
14. An oligomeric compound according to any one of claims 1 to 13, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
15. An oligomeric compound according to any one of claims 1 to 14, wherein the modified oligonucleotide comprises at least one nucleoside linkage selected from the group consisting of a phosphorothioate nucleoside linkage, a mesyl phosphoramidate nucleoside linkage, and a phosphodiester nucleoside linkage.
16. An oligomeric compound according to any one of claims 1 to 15, wherein the modified oligonucleotide comprises a bicyclic modified sugar moiety comprising a 2',4'-bridge and a 2'-MOE sugar moiety in the nucleic acid sequence of SEQ ID NO: 13, 14, 106, 409, or 416, wherein at least one modified internucleoside linkage comprises a phosphorothioate internucleoside linkage.
17. An oligomeric compound according to any one of claims 1 to 15, wherein the modified oligonucleotide comprises at least one 2'-MOE sugar moiety in the nucleic acid sequence of SEQ ID NO: 11, 12, 13, 14, 28, 95, 102, 105, 106, 319, 396, 398, 399, 403, 409, 414, or 416, and comprises at least one internucleoside linkage selected from the group consisting of phosphorothioate and phosphodiester internucleoside linkages.
18. An oligomeric compound according to any one of claims 1 to 17, wherein the modified oligonucleotide comprises a modified nucleobase.
19. An oligomeric compound according to claim 18, wherein the modified nucleobase is 5-methyl cytosine.
20. An oligomeric compound according to claim 13, wherein each nucleoside in the central gap region is a 2'-β-D-deoxynucleoside.
21. An oligomeric compound further comprising a conjugate according to any one of claims 1 to 20.
22. A composition for reducing or inhibiting the activity or expression level of MTOR, comprising an oligomeric compound according to any one of claims 1 to 21.
23. A pharmaceutical composition for preventing, improving or treating a disease or disorder related to MTOR, comprising an oligomeric compound according to any one of claims 1 to 22.
24. A pharmaceutical composition according to claim 23, wherein the composition further comprises a pharmaceutically acceptable carrier or diluent.
25. A pharmaceutical composition according to claim 24, wherein the pharmaceutically acceptable diluent is artificial spinal fluid (aCSF) or phosphate-buffered saline (PBS).
26. A pharmaceutical composition according to any one of claims 23 to 25, wherein the disease or disorder associated with MTOR is cancer, kidney disease, neurodevelopmental disorders, or neurodegenerative diseases.
27. In claim 26, the disease or disorder is Focal Cortical Dysplasia (FCD), Hemimegalencephaly (HME), Tuberous Sclerosis Complex (TSC), Megalencephaly (MEG), Cowden Syndrome, PIK3CA-Related Overgrowth Spectrum (PROS), Bannayan-Riley-Ruvalcaba Syndrome (BRRS), Lhermitte-Duclos Disease (LDD), Megalencephaly-Polydactyly-Polymicrogyria-Hydrocephalus (MCAP), Megalencephaly-Polymicrogyria-Hydrocephalus (MPPH), Smith-Kingsmore Syndrome (SKS), Polyhydramnios, Megalencephaly, and Symptomatic Epilepsy Syndrome (PMSE), Familial Intellectual Disability-Macrocephaly Syndrome, Proteus Syndrome, Fragile Encephalopathies (DEE), Alzheimer's Disease (AD), Parkinson's Disease (PD), Huntington's Disease (HD),Amyotrophic Lateral Sclerosis (ALS), Lung Cancer, Colorectal Cancer, Gastric Cancer, Renal Cell Carcinoma, Bladder Cancer, Prostate Cancer, Breast Cancer, Ganglioma, Glioblastoma, Dysembryoplastic Neuroepithelial Tumor (DNET), Subependymal Giant Cell Astrocytomas (SGCAs / SEGAs), Polycystic Kidney Disease (PKD), or seizures or epilepsy associated with these diseases or disorders, pharmaceutical composition.