Method for improving nucleic acid sequencing quality by eliminating nucleic acids with deaminated bases from library and method for sequencing in which complexes of primers, polymerases and labelled probes are bound to concatemers

CA3319387A1Pending Publication Date: 2025-08-07ELEMENT BIOSCIENCES INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CA · CA
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-01-29
Publication Date
2025-08-07

AI Technical Summary

Technical Problem

Existing nucleic acid sequencing technologies face challenges with high error rates due to C:G to T:A nucleotide base transitions, leading to poor sequencing quality scores and increased costs.

Method used

A method involving immobilized splint capture primers, enzymes with glycosylase and lyase activities, and rolling circle amplification to reduce deaminated bases, followed by pairwise sequencing and dark sequencing to improve sequencing quality.

Benefits of technology

The method significantly reduces the number of nucleic acid molecules with deaminated bases, enhancing sequencing quality scores from Q30 to Q40 or Q50, thereby improving sequencing accuracy and reducing costs.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure provides methods for reducing sequencing errors comprising one or any combination of: (i) removing deaminated bases in any nucleic acid molecule throughout a library preparation workflow which includes immobilised splints which bind to the library, the use of a compaction oligonucleotide, optionally with an intervening sequence, formation of closed circular nucleic acids, creating gaps using glycosylase and lyase activities at positions with deaminated bases. The library may be sequenced using pairwise sequencing, e.g. with dark sequencing and / or sequencing using a multivalent labelled probe for the formation of an avidity molecule and soluble primer and polymerase. Method for sequencing concatemers in which the concatermers are contacted with polymerases, soluble primers and a multivalent labelled molecule which forms a complex with the polymerase. Detecting polymerase position and nucleobase bound to the polymerase in the complex. These methods generate higher quality base calls during downstream sequencing workflows.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS AND METHODS FORIMPROVING NUCLEIC ACID SEQUENCING QUALITY SCORESRELATED APPLICATIONS

[0001] This application claims the priority to, and benefit of, U.S. Provisional Application No. 63 / 626,912, filed on January 30, 2024, and 63 / 661,989, filed on June 20, 2024, the contents of each of which are incorporated by reference in their entirety.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (ELEM- 029_001WO_SeqList_ST26.xml; Size: 108,120 bytes; and Date of Creation: January 29, 2025) is herein incorporated by reference in its entirety.TECHNICAL FIELD

[0003] The present disclosure provides compositions and methods for reducing C:G to T:A nucleotide base transitions in nucleic acid molecules, which leads to improved sequencing quality scores. Such compositions and methods can be applied to nucleic acid molecules for deaminating nucleotide bases and / or reducing erroneously introduced nucleotide bases in a nucleic acid manipulation workflow, wherein the workflow includes one or more of: fragmentation of input nucleic acids; end repair of double-stranded fragmented nucleic acids; non-template tailing of double-stranded fragmented nucleic acids; appending adaptors via ligation or PCR; PCR amplification; denaturation to generate singlestranded library molecules; circularization of single-stranded library molecules; and / or immobilization of linear library molecules or circularized library molecules.BACKGROUND

[0004] Polynucleotide sequencing technology has applications in biomedical research and healthcare settings. Improved methods of polynucleotide require enhanced surface chemistry, on-support polynucleotide amplification, and base calling. Currently, these elements produce barriers in existing sequencing technology that result in limits in throughput and poor signal- to-noise ratio, and ultimately to increased costs associated with polynucleotide sequencing.

[0005] There exists a need for new polynucleotide sequencing methods with improved surface chemistry, on-support amplification, and base calling. The present disclosure providesmethods and compositions to improve sequencing of polynucleotides by improving basecalling and subsequently increasing sequencing quality, such as sequencing quality scores.SUMMARY

[0006] In some aspect, the present disclosure provides a method for a method for reducing a number of nucleic acid library molecules carrying at least one deaminated nucleotide base in a plurality of library molecules, the method comprising: providing a plurality of splint capture primers immobilized to a support, wherein individual splint capture primers comprise a first portion and a second portion, wherein the plurality of splint capture primers have the same sequence, and wherein the density of the plurality of splint capture primers is between 102- 1015per mm2; contacting the plurality of splint capture primers with a plurality of linear nucleic acid library molecules comprising a first sub-population of linear library molecules and a second sub -population of linear library molecules, wherein the linear library molecules of the first sub-population carry at least one deaminated nucleotide base, and wherein the linear library molecules of the second sub-population lack a deaminated base, and wherein individual library molecules in the plurality are single-stranded and comprise: a universal adaptor sequence having a binding sequence for the first portion of a given splint capture primer, a universal adaptor sequence having a binding sequence for a forward sequencing primer, a sequence-of-interest, a universal adaptor sequence having a binding sequence for a reverse sequencing primer, a universal adaptor sequence having a binding sequence for a compaction oligonucleotide, and a universal adaptor sequence having a binding sequence for the second portion of the same given splint capture primer; wherein the contacting is conducted under a condition suitable for generating a plurality of immobilized open circle library molecules from the linear library molecules, wherein individual immobilized open circle library molecules comprise a nick between the 5’ and 3’ ends of individual library molecules, wherein the nick is enzymatically ligatable, and wherein individual immobilized open circle library molecules comprise a first portion of a splint capture primer hybridized to the universal adaptor sequence having a binding sequence for the first portion of the splint capture primer and a second portion of the same splint capture primer hybridized to the universal adaptor sequence having a binding sequence for the second portion of the splint capture primer, wherein the plurality of immobilized open circle library molecules comprises a first sub-population comprising immobilized open circle library molecules having at least one deaminated base and a second sub-population comprising immobilized open circle library molecules lacking a deaminated base; contacting the pluralityof immobilized open circle library molecules with a ligase enzyme to generate a plurality of immobilized covalently closed circular library molecules, wherein individual covalently closed circular library molecules are hybridized to an immobilized splint capture primer; contacting the plurality of immobilized covalently closed circular library molecules with a deamination reagent comprising: (i) at least one enzyme having glycosylase activity which generates one or more abasic sites in a covalently closed circular library molecule, and (ii) at least one enzyme having lyase activity which releases the abasic sites to generate one or more gaps in the covalently closed circular library molecule, thereby generating a first subpopulation of immobilized covalently closed circular library molecules carrying one or more gaps and a second sub-population of immobilized covalently closed circular library molecules having intact covalently closed circular library molecules, thereby generating a plurality of immobilized linearized library molecules from the second sub-population of immobilized covalently closed circular library molecules, and retaining the second subpopulation of immobilized covalently closed circular library molecules having intact covalently closed circular library molecules, thereby reducing the number of nucleic acid library molecules carrying at least one deaminated nucleotide base from in a plurality of library molecules.

[0007] In some embodiments, the method further comprises (e) contacting the plurality of immobilized covalently closed circular library molecules with a rolling circle amplification reagent to generate a plurality of immobilized nucleic acid concatemer template molecules immobilized to the support.

[0008] In some embodiments, the method further comprises (f) sequencing the plurality of immobilized nucleic acid concatemer template molecules to determine the sequence of at least a portion of the immobilized nucleic acid concatemer template molecules.

[0009] In some embodiments, the sequencing of step (f) comprises conducting pairwise sequencing which comprises sequencing the plurality of immobilized concatemer template molecules thereby generating a plurality of first strand reads (Rl), replacing the plurality of immobilized concatemer molecules by conducting a primer extension reaction to generate a plurality of second concatemer strands each having a sequence that is complementary to a sequence of the immobilized concatemer template molecules, removing the plurality of immobilized concatemer template molecules while retaining the plurality of second concatemer strands, and sequencing the plurality of second concatemer strands thereby generating a plurality of second strand reads (R2).

[0010] In some embodiments, sequencing the plurality of second concatemer strands comprises conducting dark sequencing using a plurality of reverse sequencing primers, a plurality of non-labeled nucleotide reagents and a plurality of sequencing polymerases, wherein the non-labeled nucleotide reagents can incorporate into the 3’ end of the reverse sequencing primers thereby extending the reverse sequencing primers, and wherein incorporation of the non-labeled nucleotide reagents is not detected.

[0011] In some embodiments, the dark sequencing is conducted for 2-30 consecutive cycles.

[0012] In some embodiments, sequencing the plurality of second concatemer strands comprises conducting dark sequencing for 2-30 consecutive sequencing cycles of the initial portion of the second concatemer strands.

[0013] In some embodiments, the at least one enzyme having glycosylase activity comprises any one or any combination of formamidopyrimidine DNA glycosylase (fpg); uracil N-glycosylase (UNG); uracil DNA glycosylase (UDG); 8-oxoguanine glycosylase (OGG including thermostable OGG); DNA (apurinic) lyase; DNA (apyrimidinic) lyase; and / or endonuclease III.

[0014] In some embodiments, the at least one enzyme having lyase activity comprises any one or any combination of AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase (formamidopyrimidine DNA glycosylase), Endonuclease VIII glycosylase / AP lyase and / or endonuclease III.

[0015] In some embodiments, the rolling circle amplification reagent of step (e) comprises a strand displacing polymerase and a plurality of nucleotides comprising dATP, dGTP, dCTP, dTTP and dUTP.

[0016] In some embodiments, the rolling circle amplification reagent generates a plurality of immobilized concatemers carrying at least one uracil.

[0017] In some embodiments, the at least one uracil is distributed at random positions along individual immobilized concatemers molecules in the plurality of immobilized concatemer molecules.

[0018] In some embodiments, the rolling circle amplification reagent of step (e) comprises a plurality of compaction oligonucleotides, wherein individual compaction oligonucleotides comprise a 5’ region, and a 3’ region, and wherein the 5’ and 3’ regions of a given compaction oligonucleotide can hybridize to binding sites in a given immobilized nucleic acid concatemer template molecule to pull together distal portions of the givenimmobilized nucleic acid concatemer template molecule causing compaction of the immobilized nucleic acid concatemer template molecule to form a DNA nanoball.

[0019] In some embodiments, individual compaction oligonucleotides comprise an internal region between the 5’ region and the 3’ region.

[0020] In some embodiments, sequencing the plurality of immobilized nucleic acid concatemer template molecules comprises: contacting the plurality of immobilized nucleic acid concatemer template molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contacting is conducted under a condition suitable to form a plurality of complexed sequencing polymerases, individual complexed sequencing polymerases comprising a sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises an immobilized nucleic acid concatemer template molecule hybridized to a soluble sequencing primer, thereby providing hybridized sequencing primers; contacting the plurality of complexed sequencing polymerases with a plurality of nucleotides under a condition suitable for binding at least one nucleotide to the complexed sequencing polymerase, wherein the plurality of nucleotides comprises at least one nucleotide analog labeled with a fluorophore and having a removable chain terminating moiety at the sugar 3’ position; incorporating at least one nucleotide into the 3’ end of the hybridized sequencing primers, thereby generating a plurality of nascent extended sequencing primers; and detecting the incorporated nucleotide and identifying the nucleo-base of the incorporated nucleotide, wherein the identifying of the nucleo-base comprises base calling.

[0021] In some embodiments, individual nucleotides within the plurality of nucleotides comprise a removable chain terminating moiety at the 3’ sugar group, optionally wherein the removable chain terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, azido group, O-azidomethyl group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, acetal group or silyl group, and wherein the removable chain terminating moiety is cleavable with a chemical compound to generate an extendible 3 ’OH moiety on the sugar group.

[0022] In some embodiments, the plurality of nucleotides comprises one type of nucleotide selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

[0023] In some embodiments, the plurality of nucleotides comprises a mixture of any two or more types of nucleotides selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

[0024] In some embodiments, sequencing the plurality of immobilized nucleic acid concatemer template molecules comprises: contacting the plurality of immobilized nucleic acid concatemer template molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of the soluble sequencing primers, wherein the contacting is conducted under a condition suitable to form a plurality of first complexed sequencing polymerases, individual first complexed sequencing polymerases comprising a sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises an immobilized nucleic acid concatemer molecule hybridized to a soluble sequencing primer; contacting the plurality of first complexed sequencing polymerases with a plurality of detectably labeled multivalent molecules to form a plurality of multival ent-complexed polymerases, under a condition suitable for binding complementary nucleotide moieties of the multivalent molecules to at least two of the plurality of first complexed sequencing polymerases, thereby forming a plurality of multivalent-complexed polymerases, wherein the suitable condition inhibits incorporation of the complementary nucleotide moieties into the soluble sequencing primers of the plurality of multivalent-complexed polymerases, wherein individual multivalent molecules in the plurality of multivalent molecules comprise a core attached to multiple nucleotide arms and each nucleotide arm is attached to a nucleotide moiety; detecting the plurality of multivalent-complexed polymerases; and identifying the nucleo-base of the complementary nucleotide moieties that are bound to the plurality of first complexed sequencing polymerases in the plurality of multivalent-complexed polymerases, thereby determining the sequence of the nucleic acid template, wherein the identifying of the nucleo- base comprises base calling.

[0025] In some embodiments, the method further comprises dissociating the plurality of multivalent-complexed polymerases and removing the plurality of first sequencing polymerases and their bound multivalent molecules, and retaining the plurality of nucleic acid duplexes; contacting the plurality nucleic acid duplexes retained at step (e) with a plurality of second sequencing polymerases, wherein the contacting is conducted under a condition suitable for binding the plurality of second sequencing polymerases to the plurality nucleic acid duplexes, thereby forming a plurality of second complexed sequencing polymerases, individual second complexed sequencing polymerases comprising a second sequencing polymerase bound to a nucleic acid duplex; contacting the plurality of second complexed sequencing polymerases with a plurality of nucleotides comprising at least one non-labeled nucleotide analog having a removable chain terminating moiety at the sugar 3’ position, wherein the contacting is conducted under a condition suitable for: i. bindingcomplementary nucleotides from the plurality of nucleotides to at least two of the second complexed sequencing polymerases of step (f), thereby forming a plurality of nucleotide- complexed polymerases; and ii. promoting incorporation of the bound complementary nucleotides into the sequencing primers of the nucleotide-complexed polymerases.

[0026] In some embodiments, the soluble sequencing primers comprise soluble universal sequencing primers.

[0027] In some aspects, provided herein is a method for sequencing by forming at least one avidity complex, comprising: binding a first universal sequencing primer, a first sequencing polymerase, and a first detectably labeled multivalent molecule to a first portion of the immobilized nucleic acid concatemer template molecule of produced by the method of claim 19, thereby forming a first binding complex, wherein a first nucleotide moiety of the first multivalent molecule binds to the first sequencing polymerase; binding a second universal sequencing primer, a second sequencing polymerase, and the first detectably labeled multivalent molecule to a second portion of the same immobilized nucleic acid concatemer template molecule, thereby forming a second binding complex, wherein a second nucleotide moiety of the first multivalent molecule binds to the second sequencing polymerase, wherein the first and second binding complexes bound to the same multivalent molecule form an avidity complex, wherein the first detectably labeled multivalent molecule comprises a core attached to multiple nucleotide arms and each nucleotide arm is attached to a nucleotide moiety, wherein the immobilized nucleic acid concatemer template molecule comprises two or more tandem repeat sequences of a sequence of interest (110) and a universal primer binding site that binds the first and second universal sequencing primers, and wherein the contacting is conducted under a condition suitable to inhibit polymerase- catalyzed incorporation of the bound first and second nucleotide moieties in the first and second binding complexes; detecting the first and second binding complexes on the same immobilized nucleic acid concatemer template molecule, and identifying the first nucleotide moiety in the first binding complex, thereby determining the sequence of the first portion of the immobilized concatemer template molecule, and identifying the second nucleotide moiety in the second binding complex, thereby determining the sequence of the second portion of the immobilized concatemer template molecule, wherein the identifying of the first nucleotide moiety and the identifying of the second nucleotide moiety comprises base calling.

[0028] In some embodiments, the plurality of nucleotide arms attached to the core of the individual multivalent molecules have the same type of a nucleotide moiety, and wherein thetype of nucleotide moiety is selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

[0029] In some embodiments, the plurality of multivalent molecules comprises a mixture of any combination of two or more types of multivalent molecules each type having nucleotide moieties selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

[0030] In some embodiments, individual nucleotides within the plurality of nucleotides comprise a removable chain terminating moiety at the 3’ sugar group, wherein the removable chain terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, azido group, O-azidomethyl group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, or silyl group, and wherein the removable chain terminating moiety is cleavable with a chemical compound to generate an extendible 3 ’OH moiety on the sugar group.

[0031] In some embodiments, the plurality of nucleotides comprises one type of nucleotide selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

[0032] In some embodiments, the plurality of nucleotides comprises a mixture of any combination of two or more types of nucleotides selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

[0033] In some embodiments, the support comprises a glass or plastic substrate.

[0034] In some embodiments, the support is passivated with at least one hydrophilic polymer coating having a water contact angle of no more than 45 degrees.

[0035] In some embodiments, the at least one hydrophilic polymer coating comprises a molecule selected from the group consisting of polyethylene glycol (PEG), poly(vinyl alcohol) (PVA), poly(vinyl pyridine), poly(vinyl pyrrolidone) (PVP), poly(acrylic acid) (PAA), polyacrylamide, poly(N-isopropylacrylamide) (PNIPAM), poly(methyl methacrylate) (PMA), poly(2 -hydroxylethyl methacrylate) (PHEMA), poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA), polyglutamic acid (PGA), poly-lysine, poly-glucoside, streptavidin, and dextran.

[0036] In some embodiments, the plurality of immobilized splint capture primers is located at pre-determined locations on the polymer-coated support.

[0037] In some embodiments, the plurality of immobilized splint capture primers is located at random locations on the polymer-coated support.

[0038] In some embodiments, the plurality of immobilized nucleic acid concatemer template molecules on the support are in fluid communication with each to permit flowing a solution of reagents onto the support so that the plurality of immobilized nucleic acid concatemer template molecules can be essentially simultaneously reacted with the reagents in a massively parallel manner.

[0039] In some embodiments, the reagents comprise one or more enzymes, nucleotides, divalent cations, or a combination thereof.

[0040] In some embodiments, the method further comprises determining the percent base call error from the sequencing of step (f).

[0041] In some embodiments, the method further comprises determining the quality score of the sequencing data from the percent base call error.

[0042] In some embodiments, the quality score increases from Q30 to Q40 or Q50 when a deamination reagent is employed at step (c) compared to a method that lacks employing a deamination reagent at step (c).

[0043] In some embodiments, the quality score of the first strand reads (Rl) increases from Q30 to Q40 or Q50 when a deamination reagent is employed at step (c) compared to the same method that lacks employing a deamination reagent at step (c).

[0044] In some embodiments, the quality score of the second strand reads (R2) increases from Q30 to Q40 or Q50 when a deamination reagent is employed at step (c) compared to the same method that lacks employing a deamination reagent at step (c).DESCRIPTION OF THE DRAWINGS

[0045] The features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

[0046] FIG. 1 is a schematic of an exemplary low binding support comprising a glass substrate and alternating layers of hydrophilic coatings which are covalently or non- covalently adhered to the glass, and which further comprises chemically-reactive functional groups that serve as attachment sites for oligonucleotide primers (e. ., capture oligonucleotides). The support can be made of any material, such as glass, plastic or a polymer material.

[0047] FIG. 2 is a schematic of various exemplary configurations of multivalent molecules. Left (Class I): schematics of multivalent molecules having a “starbursf ’ or“helter-skelter” configuration. Center (Class II): a schematic of a multivalent molecule having a dendrimer configuration. Right (Class III): a schematic of multiple multivalent molecules formed by reacting streptavidin with 4-arm or 8-arm PEG-NHS with biotin and dNTPs. Nucleotide moieties are designated ‘N’, biotin is designated ‘B’, and streptavidin is designated ‘ SA’ .

[0048] FIG. 3 is a schematic of an exemplary multivalent molecule comprising a generic core attached to a plurality of nucleotide-arms.

[0049] FIG. 4 is a schematic of an exemplary multivalent molecule comprising a dendrimer core attached to a plurality of nucleotide-arms.

[0050] FIG. 5 shows a schematic of an exemplary multivalent molecule comprising a core attached to a plurality of nucleotide-arms, where the nucleotide arms comprise biotin, spacer, linker and a nucleotide moiety.

[0051] FIG. 6 is a schematic of an exemplary nucleotide-arm comprising a core attachment moiety, spacer, linker and nucleotide moiety.

[0052] FIG. 7 shows the chemical structure of an exemplary spacer (top), and the chemical structures of various exemplary linkers, including an 11 -atom Linker, 16-atom Linker, 23-atom Linker and an N3 Linker (bottom).

[0053] FIG. 8 shows the chemical structures of various exemplary linkers, including Linkers 1-9.

[0054] FIG. 9 shows the chemical structures of various exemplary linkers joined / attached to nucleotide moieties.

[0055] FIG. 10 shows the chemical structures of various exemplary linkers joined / attached to nucleotide moieties.

[0056] FIG. 11 shows the chemical structures of various exemplary linkers joined / attached to nucleotide moieties.

[0057] FIG. 12 shows the chemical structure of an exemplary linkers joined / attached to nucleotide moieties.

[0058] FIG. 13 shows the chemical structure of an exemplary biotinylated nucleotide- arm. In this example, the nucleotide moiety is connected to the linker via a propargyl amine attachment at the 5 position of a pyrimidine base or the 7 position of a purine base.

[0059] FIG. 14 shows the chemical structures of various nucleotide bases and their corresponding deaminated bases, including: deamination of cytosine to uracil; deamination of adenine to hypoxanthine; deamination of guanine to xanthine; and deamination of 5- methylcytosine to thymine.

[0060] FIG. 15 is a schematic showing an exemplary linear single stranded library molecule (100) hybridizing with a double-stranded splint molecule (200) thereby circularizing the library molecule to form a library-splint complex (500) with two nicks. The library molecule (100) comprises: a first left universal adaptor sequence (120); a first left unique identification sequence (180); a first left index sequence (160); a second left universal adaptor sequence (140); a sequence of interest (110); a second right universal adaptor sequence (150); a first right index sequence (170); and a first right universal adaptor sequence (130). The double-stranded splint molecule comprises a first splint strand (long strand (300)) hybridized to a second splint strand (short strand (400)). The first splint strand comprises a first region (320) that hybridizes with a sequence on one end of the linear single stranded library molecule, and a second region (330) that hybridizes with a sequence on the other end of the linear single stranded library molecule. The internal region (310) of the first splint strand hybridizes to the second splint strand (400). The second splint strand (400) includes three sub-regions, where the first sub-region comprises a universal binding sequence for a third surface primer, the second sub-region comprises a universal binding sequence for a fourth surface primer, and the third sub-region comprises a sample index sequence having 5- 20 bases and / or a unique identification sequence having 2-10 or more bases (e.g., NN). The internal region (310) of the first splint strand (300) comprises three sub-regions, where the fourth sub-region hybridizes to the first sub-region of the second splint strand (400), and the fifth sub-region hybridizes to the second sub-region of the second splint strand (400), and the sixth sub-region hybridizes to the third sub-region of the second splint strand (400).

[0061] FIG. 16 is a schematic showing an exemplary library-splint complex (500) undergoing a ligation reaction to close the nicks to form a covalently closed circular library molecule (600) which is hybridized to a first splint strand (300), where the first splint strand (300) can be used as an amplification primer to conduct a rolling circle amplification reaction. The dotted line represents the nascent extension product.

[0062] FIG. 17 shows the nucleotide sequences of an exemplary double-stranded splint molecule (200), having a first splint strand (300; (SEQ ID NO: 1)) and a second splint strand (400; (SEQ ID NO: 2)). The exemplary first splint strand comprises a first region (320; SEQ ID NO: 3), a second region (330; SEQ ID NO: 4), and an internal region (310) having a fourth sub-region (SEQ ID NO: 5) and fifth sub-region (SEQ ID NO: 6). The first splint strand (300) comprises the first and second regions ((320) and (330)) and the internal region (310) (SEQ ID NO: 7). The exemplary second splint strand (400) comprises a first sub-region (SEQ ID NO: 8) and second sub-region (SEQ ID NO: 9). The second splint strand (400;(SEQ ID NO: 2) comprises the first and second sub-regions (SEQ ID NOs: 8 and 9, respectively).

[0063] FIG. 18 is a schematic showing an exemplary linear single stranded library molecule (700) hybridizing with a single-stranded splint molecule / strand (800) thereby circularizing the library molecule to form a library-splint complex (900) with a nick. The exemplary library molecule (700) comprises: a first left universal adaptor sequence (720); an optional first left unique identification sequence (780); a first left index sequence (760); a second left universal adaptor sequence (740); a sequence of interest (710); a second right universal adaptor sequence (750); a first right index sequence (770); and a first right universal adaptor sequence (730). The single-stranded splint strand (800) comprises a first region (810) that hybridizes with a sequence on one end of the linear single stranded library molecule, and a second region (820) that hybridizes with a sequence on the other end of the linear single stranded library molecule.

[0064] FIG. 19 is a schematic showing an exemplary library-splint complex (900) undergoing a ligation reaction to close the nick to form a covalently closed circular library molecule (1000) which is hybridized to a single-stranded splint strand (800), where the single-stranded splint strand (800) is used as an amplification primer to conduct a rolling circle amplification reaction. The dotted line represents the nascent extension product.

[0065] FIG. 20 shows the nucleotide sequences of an exemplary single-stranded splint molecule / strand (800; SEQ ID NO: 10). The exemplary single-stranded splint strand comprises a first region (810; SEQ ID NO: 11), a second region (820; SEQ ID NO: 12).

[0066] FIG. 21 is a schematic showing an exemplary support having a first surface primer e.g., a splint capture primer) immobilized thereon, which can be used to conduct an on-support ligation reaction for a pairwise sequencing workflow. FIGs. 21-28, 31A-31B show an exemplary workflow of on-support ligation. FIG. 32 shows an exemplary workflow of an on-support rolling circle amplification reaction. FIGs. 33-45 show an exemplary workflow of pairwise sequencing.

[0067] FIG. 22 is a schematic showing an exemplary single stranded linear library molecule comprising a sequence of interest and various universal adaptor sequences for primer binding sites. The arrangement of the various universal adaptor sequences in this schematic is for illustration purposes. The skilled artisan will appreciate that many other arrangements and combinations of universal adaptor sequences are possible.

[0068] FIG. 23 is a schematic showing an exemplary single stranded linear library molecule hybridized to an immobilized first surface primer (e.g., an immobilized splintcapture primer) to form a circularized library molecule having an asymmetrically positioned gap or nick.

[0069] FIG. 24 is a schematic showing an exemplary single stranded linear library molecule hybridized to an immobilized first surface primer (e.g., an immobilized splint capture primer) to form a circularized library molecule having an asymmetrically positioned gap or nick.

[0070] FIG. 25 is a schematic showing an exemplary single stranded linear library molecule hybridized to an immobilized first surface primer (e.g., an immobilized splint capture primer) to form a circularized library molecule having a symmetrically positioned gap or nick. The schematics shown in FIGs. 23, 24 and 25 represent several embodiments of a circularized library molecule comprising a single stranded linear library molecule hybridized to an immobilized first surface primer.

[0071] FIG. 26 is a schematic showing an exemplary covalently closed circular library molecule generated by covalently closing the gap or nick.

[0072] FIG. 27 is a schematic showing an exemplary covalently closed circular library molecule generated by covalently closing the gap or nick.

[0073] FIG. 28 is a schematic showing an exemplary covalently closed circular library molecule generated by covalently closing the gap or nick. The schematics shown in FIGs. 26, 27 and 28 represent several embodiments of a covalently closed circular library molecule hybridized to an immobilized first surface primer (e.g. , an immobilized splint capture primer).

[0074] FIG. 29 is a schematic showing various embodiments (e.g., (A) - (D)) of linear library molecules comprising (i) a sequence-of-interest (e.g., insert region (15)) and at least one adaptor sequence where the adaptor sequence comprises, (ii) a universal binding site (25) for a first portion of a splint capture primer (or a complementary sequence thereof), (iii) at least one sample index sequence (e.g., (65) and / or (75) which can be used to distinguish sequences of interest obtained from different sample sources in a multiplex assay, (iv) a universal binding site (45) for a forward sequencing primer (or a complementary sequence thereof), (v) a universal binding site (55) for a reverse sequencing primer (or a complementary sequence thereof), (vi) at least one unique molecular index sequence (UMI) (e.g., (85) and / or (86)) which can be used to uniquely identify a nucleic acid molecule (e.g., having a sequence of interest) to which the unique molecular index sequence is appended, and (vii) a universal binding site (35) for a second portion of the immobilized splint capture (or a complementary sequence thereof). For example, the at least one sample index sequence(e.g., (65) and / or (75) comprises a sample index sequence joined to a short random sequence (e.g., NNN), where the short random sequence provides nucleotide sequence diversity and is about 3-20 nucleotides in length. The sequence of interest (15) and any of the adaptor sequences can be arranged in any order.

[0075] FIG. 30 is a schematic showing various embodiments (e.g., (A) - (F)) of linear library molecules comprising (i) a sequence-of-interest (e.g., insert region (15)) and at least one adaptor sequence where the adaptor sequence comprises, (ii) a universal binding site (25) for a first portion of a splint capture primer (or a complementary sequence thereof), (iii) at least one sample index sequence (e.g., (65) and / or (75) which can be used to distinguish sequences of interest obtained from different sample sources in a multiplex assay, (iv) a universal binding site (45) for a forward sequencing primer (or a complementary sequence thereof), (v) a universal binding site (55) for a reverse sequencing primer (or a complementary sequence thereof), and (vi) a universal binding site (35) for a second portion of the immobilized splint capture (or a complementary sequence thereof). For example, the at least one sample index sequence (e.g., (65) and / or (75) comprises a sample index sequence joined to a short random sequence (e.g., NNN), where the short random sequence provides nucleotide sequence diversity and is about 3-20 nucleotides in length. The sequence of interest (15) and any of the adaptor sequences can be arranged in any order. The linear library molecules can comprise one sample index sequence (e.g., (65) or (75)), or can comprise two sample index sequences (e.g., (65) and (75)). The linear library molecule can further comprise a universal binding site (45) for a forward sequencing primer (or a complementary sequence thereof) and lacks a universal binding site (55) for a reverse sequencing primer (or a complementary sequence thereof). The linear library molecule can comprise a universal binding site (45) for a forward sequencing primer (or a complementary sequence thereof) and a universal binding site (55) for a reverse sequencing primer (or a complementary sequence thereof). Alternatively or additionally, the linear library molecule can comprise at least one unique molecular index sequence (UMI) (e.g., see FIG. 29, (85) and / or (86)) which can be used to uniquely identify a nucleic acid molecule (e.g., having a sequence of interest) to which the unique molecular index sequence is appended. The at least one unique molecular index sequence (UMI) can be located at any position in the linear library molecule.

[0076] FIG. 31A is a schematic showing an exemplary splint capture primer (92) immobilized to a support, where the splint capture primer is hybridized to a linear library molecule to form an open circle library (91) having a nick or gap. For example, the splint capture primer (91) comprises a first portion (93) (e.g., SP1-A) and a second portion (94)(e.g., SP1-B). The linear library molecule can comprise (i) a sequence-of-interest (e.g., insert region (15)) and two or more universal adaptor sequences arranged in any order. The linear library molecule can further comprise (i) a universal binding site (25) for a first portion of a splint capture primer (or a complementary sequence thereof), (ii) at least one sample index sequence (e.g., (65) and / or (75) which can be used to distinguish sequences of interest obtained from different sample sources in a multiplex assay, (iii) a universal binding site (45) for a forward sequencing primer (or a complementary sequence thereof), (iv) a universal binding site (55) for a reverse sequencing primer (or a complementary sequence thereof), and (v) a universal binding site (35) for a second portion of the immobilized splint capture (or a complementary sequence thereof). The linear library molecule can further comprise at least one unique molecular index sequence (UMI) (e.g., (85) and / or (86)) which can be used to uniquely identify a nucleic acid molecule e.g., having a sequence of interest) to which the unique molecular index sequence is appended. For example and without limitation, the linear library molecule can comprise any of the linear library molecules shown in FIGs. 29 and 30.

[0077] FIG. 31B is a schematic showing an exemplary covalently closed circular library molecule (95) generated by covalently closing the gap or nick of the open circle library molecule (91) shown in FIG. 31 A. The covalently close circular library molecule (95) of FIG. 3 IB can be used to conduct a workflow comprising rolling circle amplification and sequencing, where the workflow is shown in FIGs. 32-45.

[0078] FIG. 32 is a schematic showing an exemplary on-support rolling circle amplification reaction using a covalently closed circular library molecule hybridized to an immobilized first surface primer (e.g., splint capture primer) shown in FIG. 21, and a mixture of nucleotides including nucleotides having a scissile moiety that can be cleaved to generate an abasic site. The rolling circle amplification reaction generates an immobilized single stranded nucleic acid concatemer template molecule having at least one nucleotide with a scissile moiety which can be cleaved to generate an abasic site in the immobilized concatemer template molecule.

[0079] FIG. 33 is a schematic showing an exemplary support having a first surface primer immobilized thereon, which can be used to conduct a rolling circle amplification reaction and an on-support pairwise sequencing workflow. In FIG. 33, the first surface primer can be a splint capture primer (e.g., see FIGs. 31 A and 3 IB) or a surface capture primer.

[0080] FIG. 34 is a schematic showing an exemplary on-support rolling circle amplification reaction using a covalently closed circular library molecule hybridized to the immobilized first surface primer shown in FIG. 33, and a mixture of nucleotides includingnucleotides having a scissile moiety that can be cleaved to generate an abasic site. The rolling circle amplification reaction generates an immobilized single stranded nucleic acid concatemer template molecule having at least one nucleotide with a scissile moiety which can be cleaved to generate an abasic site in the immobilized concatemer template molecule. The arrangement of the various primer binding sequences in the nucleic acid circular library molecule is for illustration purposes. The skilled artisan will appreciate that many other arrangements are possible. FIGs 36-45 show the workflow of pairwise sequencing the immobilized concatemer template molecule depicted in FIGs. 34 and 35.

[0081] FIG. 35 is a schematic showing an exemplary single stranded nucleic acid concatemer template molecule immobilized to an immobilized first surface primer. The immobilized concatemer template molecule comprises at least one nucleotide having a scissile moiety that can be cleaved to generate an abasic site in the immobilized concatemer template molecule. The immobilized concatemer template molecule can be generated by conducting an on-support rolling circle amplification reaction. The arrangement of the various primer binding sequences is for illustration purposes. The skilled artisan will appreciate that many other arrangements are possible. FIGs. 36-45 show the workflow of pairwise sequencing the immobilized concatemer template molecule depicted in FIG. 35.

[0082] FIG. 36 is a schematic showing an exemplary forward sequencing reaction conducted on the immobilized concatemer template molecule shown in FIG. 35. The forward sequencing reaction can be conducted with a plurality of soluble forward sequencing primers and generates a plurality of extended forward sequencing primer strands. The immobilized concatemer template molecule can have two or more extended forward sequencing primer strands hybridized thereon.

[0083] FIG. 37 is a schematic showing an exemplary method for replacing the extended forward sequencing primer strands by conducting a primer extension reaction with a strand displacing polymerase in the absence of a soluble primer thereby generating a forward extension strand.

[0084] FIG. 38 is a schematic showing an exemplary method for replacing the extended forward sequencing primer strands by conducting a primer extension reaction with a soluble forward sequencing primer thereby generating a forward extension strand.

[0085] FIG. 39 is a schematic showing an exemplary method for replacing the extended forward sequencing primer strands by conducting a primer extension reaction with a soluble amplification primer thereby generating a forward extension strand.

[0086] FIG. 40 is a schematic showing an exemplary method for generating abasic sites in the immobilized single stranded concatemer template molecules at the nucleotides having the scissile moiety and generating gaps at the abasic sites to generate a plurality of gapcontaining concatemer template molecules while retaining the plurality of forward extension strands and retaining the plurality of immobilized first surface primers. The forward extension strand can be generated by the method depicted in FIGs. 37 or 38.

[0087] FIG. 41 is a schematic showing an exemplary retained forward extension strand after removal of the gap-containing concatemer template molecule as shown in FIG. 40.

[0088] FIG. 42 is a schematic showing an exemplary method for generating abasic sites in the immobilized single stranded concatemer template molecules at the nucleotides having the scissile moiety and generating gaps at the abasic sites to generate a plurality of gapcontaining concatemer template molecules while retaining the plurality of forward extension strands and retaining the plurality of immobilized first surface primers. The forward extension strand can be generated by the method depicted in FIG. 39.

[0089] FIG. 43 is a schematic showing an exemplary retained forward extension strand after removal of the gap-containing concatemer template molecule as shown in FIG. 42.

[0090] FIG. 44 is a schematic showing an exemplary reverse sequencing reaction conducted on the retained forward extension strand shown in FIG. 41. The reverse sequencing reaction can be conducted with a plurality of soluble reverse sequencing primers. The retained forward extension strand can have two or more extended reverse sequencing primer strands hybridized thereon. The extended reverse sequencing primer strands are not hybridized to the first surface primer, or covalently joined to the first surface primer. Therefore, the extended reverse sequencing primer strands are not immobilized to the support. For the sake of simplicity, FIGs. 35-44 show an exemplary immobilized concatemer molecule with two copies of the sequence of interest and various universal primer binding sites. The skilled artisan will appreciate that the immobilized concatemer molecule can include two or more tandem copies containing the sequence of interest and various universal primer binding sites.

[0091] FIG. 45 is a schematic showing an exemplary reverse sequencing reaction conducted on the retained forward extension strand shown in Figure 43. The retained forward extension strand can have two or more extended reverse sequencing primer strands hybridized thereon. The extended reverse sequencing primer strands are not hybridized to the first surface primer, or covalently joined to the first surface primer. Therefore, the extended reverse sequencing primer strands are not immobilized to the support. For the sake ofsimplicity, FIGs. 35-45 show an exemplary immobilized concatemer molecule with two copies of the sequence of interest and various universal primer binding sites. The skilled artisan will appreciate that the immobilized concatemer molecule can include two or more tandem copies containing the sequence of interest and various universal primer binding sites.

[0092] FIG. 46 is a schematic showing an exemplary support having a first and second surface primers immobilized thereon. The first surface primer can comprise a surface capture primer or a splint capture primer. The second surface primer can comprise a surface pinning primer. A portion of the immobilized concatemer template molecule shown in FIG. 35 is hybridized to the immobilized second surface primer (e.g., surface pinning primer). The immobilized concatemer template molecule has two or more copies of a universal binding sequence for an immobilized second surface primer. The portion of the immobilized concatemer template molecule that includes the universal binding sequence for an immobilized second surface primer can hybridize to the immobilized second surface primer.

[0093] FIG. 47A is a schematic showing an exemplary in-solution rolling circle amplification reaction using a circular library molecule, a soluble first amplification primer, and a mixture of nucleotides, including nucleotides having a scissile moiety, that can be cleaved to generate an abasic site. The rolling circle amplification reaction generates in solution a nascent single stranded concatemer molecule having at least one nucleotide with a scissile moiety which can be cleaved to generate an abasic site in the concatemer molecule. The arrangement of the various primer binding sequences in the circular library molecule is for illustration purposes only. The skilled artisan will appreciate that many other arrangements are possible.

[0094] FIG. 47B is a schematic showing an exemplary method comprising distributing the rolling circle amplification reaction depicted in FIG. 47A onto a support having a first surface primer (e.g., surface capture primer) immobilized thereon. The concatemer molecule can hybridize to the immobilized first surface primer. The rolling circle amplification reaction can continue on the support, thereby generating an immobilized concatemer template molecule which includes at least one nucleotide with a scissile moiety which can be cleaved to generate an abasic site in the immobilized concatemer template molecule.

[0095] FIG. 47C is a schematic showing an exemplary support comprising a first and second surface primers immobilized thereon. The first surface primer comprises a surface capture primer. The second surface primer comprises a surface pinning primer. A portion of the immobilized concatemer template molecule shown in FIG. 47B is hybridized to the immobilized second surface primer. The immobilized concatemer template molecule has twoor more copies of a universal binding sequence for an immobilized second surface primer. The portion of the immobilized concatemer template molecule that includes the universal binding sequence for an immobilized second surface primer can hybridize to the immobilized second surface primer.

[0096] FIG. 48 is the amino acid sequence of a wild type DNA polymerase having a backbone sequence from RLF 89458.1 (SEQ ID NO: 13).

[0097] FIG. 49 is the amino acid sequence of a wild type DNA polymerase having a backbone sequence from RLF 78286.1 (SEQ ID NO: 14).

[0098] FIG. 50 is the amino acid sequence of a wild type DNA polymerase having a backbone sequence from NOZ 58130.1 (SEQ ID NO: 15).

[0099] FIG. 51 is the amino acid sequence of a wild type DNA polymerase having a backbone sequence from RMF 90817.1 (SEQ ID NO: 16).

[0100] FIG. 52 is the amino acid sequence of a wild type DNA polymerase having a backbone sequence from MBC 7218772.1 (SEQ ID NO: 17).

[0101] FIG. 53 is the amino acid sequence of a wild type DNA polymerase having a backbone sequence from WP 175059460.1 (SEQ ID NO: 18).

[0102] FIG. 54 is the amino acid sequence of a wild type DNA polymerase having a backbone sequence from KUO 42443.1 (SEQ ID NO: 19).

[0103] FIG. 55 is the amino acid sequence of a wild DNA polymerase having a backbone sequence from NOZ 77387.1 (SEQ ID NO: 20).

[0104] FIG. 56 is the amino acid sequence of a wild type DNA polymerase having a backbone sequence from Geobacillus stearothermophilus (Bst polymerase) (SEQ ID NO: 21).

[0105] FIG. 57 is the amino acid sequence of a 9 °N polymerase (SEQ ID NO: 22).

[0106] FIG. 58 is the amino acid sequence of a 9 °N polymerase UniProt Q56366 (SEQID NO: 23).

[0107] FIG. 59 is the amino acid sequence of THERMINATOR polymerase (SEQ ID NO: 24).

[0108] FIG. 60 is the amino acid sequence of a VENT polymerase UniProt P30317 (SEQ ID NO: 25).

[0109] FIG. 61 is the amino acid sequence of a DEEP VENT polymerase UniProtQ51334 (SEQ ID NO: 26).

[0110] FIG. 62 is the amino acid sequence of a Pfu polymerase UniProt P61875 (SEQ ID NO: 27).

[0111] FIG. 63 is the amino acid sequence of a Pyrococcus abyssi polymerase UniProt P0CL77 (SEQ ID NO: 28).

[0112] FIG. 64 is the amino acid sequence of an RB69 polymerase (SEQ ID NO: 29).

[0113] FIG. 65 is two graphs showing sequencing quality scores of concatemer template molecules that were generated by a workflow that included circularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17), with or without USER treatment, and conducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The Control graph on the left shows the sequencing quality scores of base calls T, C, A and G of concatemer template molecules that generated with no USER treatment during the library prep workflow. The Control graph shows that the quality scores of the T base calls were approximately 39. The USER-treated graph on the right shows the sequencing quality scores of base calls T, C, A and G of concatemer template molecules that generated with USER treatment during the library prep workflow. The USER-treated graph shows that the quality scores of the T base calls increased to approximately 43. The linear library molecules were treated prior to hybridizing to double-stranded splint adaptors (see Examples 1, 2 and 3).

[0114] FIG. 66 is two graphs showing sequencing quality scores of concatemer template molecules that were generated by a workflow that included circularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17), with or without USER treatment, and conducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The Control graph on the left shows the sequencing quality scores of base calls T, C, A and G of concatemer template molecules that generated with no USER treatment during the library prep workflow. The Control graph shows that the quality scores of the T base calls were approximately 39. The USER-treated graph on the right shows the sequencing quality scores of base calls T, C, A and G of concatemer template molecules that generated with USER treatment during the library prep workflow. The USER-treated graph shows that the quality scores of the T base calls increased to approximately 45. The linear library molecules were treated after enzymatic digestion of the first splint strand (300) with T7 exonuclease and Therm olabile exonuclease (see Examples 1, 2 and 4).

[0115] FIG. 67A is a graph showing sequencing quality scores of C basecalls of first strand concatemer template molecules that were generated by a workflow that included circularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17 but without unique identification sequences (180) and (190)), with or without heat, andconducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The library preparation workflow compared the effect of heat, NaOH, HEPES buffer, or a cocktail mixture of enzymes that can generate abasic sites and remove the abasic sites. The X-axis is the number of sequencing cycles. The Y-axis is the quality scores.

[0116] FIG. 67B is a graph showing sequencing quality scores of A basecalls of first strand concatemer template molecules that were generated by a workflow that included circularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17, but without unique identification sequences (180) and (190)), with or without heat, and conducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The library preparation workflow compared the effect of heat, NaOH, HEPES buffer, or a cocktail mixture of enzymes that can generate abasic sites and remove the abasic sites. The X-axis is the number of sequencing cycles. The Y-axis is the quality scores.

[0117] FIG. 67C is a graph showing sequencing quality scores of G basecalls of first strand concatemer template molecules that were generated by a workflow that included circularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17 but without unique identification sequences (180) and (190)), with or without heat, and conducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The library preparation workflow compared the effect of heat, NaOH, HEPES buffer, or a cocktail mixture of enzymes that can generate abasic sites and remove the abasic sites. The X-axis is the number of sequencing cycles. The Y-axis is the quality scores.

[0118] FIG. 67D is a graph showing sequencing quality scores of T basecalls of first strand concatemer template molecules that were generated by a workflow that included circularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17 but without unique identification sequences (180) and (190)), with or without heat, and conducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The library preparation workflow compared the effect of heat, NaOH, HEPES buffer, or a cocktail mixture of enzymes that can generate abasic sites and remove the abasic sites. The X-axis is the number of sequencing cycles. The Y-axis is the quality scores.

[0119] FIG. 68A is a graph showing sequencing quality scores of C basecalls of second strand concatemer template molecules that were generated by a workflow that includedcircularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17 but without unique identification sequences (180) and (190)), with or without heat, and conducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The library preparation workflow compared the effect of heat, NaOH, HEPES buffer, or a cocktail mixture of enzymes that can generate abasic sites and remove the abasic sites. The X-axis is the number of sequencing cycles. The Y-axis is the quality scores.

[0120] FIG. 68B is a graph showing sequencing quality scores of A basecalls of second strand concatemer template molecules that were generated by a workflow that included circularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17 but without unique identification sequences (180) and (190)), with or without heat, and conducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The library preparation workflow compared the effect of heat, NaOH, HEPES buffer, or a cocktail mixture of enzymes that can generate abasic sites and remove the abasic sites. The X-axis is the number of sequencing cycles. The Y-axis is the quality scores.

[0121] FIG. 68C is a graph showing sequencing quality scores of G basecalls of second strand concatemer template molecules that were generated by a workflow that included circularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17 but without unique identification sequences (180) and (190)), with or without heat, and conducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The library preparation workflow compared the effect of heat, NaOH, HEPES buffer, or a cocktail mixture of enzymes that can generate abasic sites and remove the abasic sites. The X-axis is the number of sequencing cycles. The Y-axis is the quality scores.

[0122] FIG. 68D is a graph showing sequencing quality scores of T basecalls of second strand concatemer template molecules that were generated by a workflow that included circularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17 but without unique identification sequences (180) and (190)), with or without heat, and conducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The library preparation workflow compared the effect of heat, NaOH, HEPES buffer, or a cocktail mixture of enzymes that can generate abasic sites and remove the abasic sites. The X-axis is the number of sequencing cycles. The Y-axis is the quality scores.

[0123] FIG. 69 is a series of 3 graphs showing sequencing quality scores of A, G, C and T basecalls of first strand concatemer template molecules (read 1) that were generated by a workflow that included circularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17 but without unique identification sequences (180) and (190)), with ligase enzyme deactivation, and conducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The library preparation workflow compared the effect of ligase high heat-kill control, ligase lower heatkill and ligase NaOH deactivation. The X-axis is the number of sequencing cycles. The Y- axis is the quality scores.

[0124] FIG. 70 is a series of 3 graphs showing sequencing quality scores of A, G, C and T basecalls of second strand concatemer template molecules (read 2) that were generated by a workflow that included circularizing linear library molecules using double-stranded splint adaptors (e.g., see FIGs. 15-17 but without unique identification sequences (180) and (190)), with ligase enzyme deactivation, and conducting on-support rolling circle amplification to generate concatemer template molecules immobilized to a coated support. The library preparation workflow compared the effect of ligase high heat-kill control, ligase lower heatkill and ligase NaOH deactivation. The X-axis is the number of sequencing cycles. The Y- axis is the quality scores.

[0125] FIG. 71 is a bar graph showing the mean percent recovery of covalently closed circular library molecules using input DNA from various species as determined by qPCR. Lane 1 : Haemophilus influenzae (38% GC); Lane 2: E. coli (51% GC); Lane 3: Rhodopseudomonas palustris (65% GC); Lane 4: PhiX; Lane 5: Human; Lane 6: Human exome; Lane 7 : Human mRNA.

[0126] FIG. 72 is a bar graph showing the mean polony density obtained by distributing covalently closed circular library molecules onto a support, and performing on-support rolling circle amplification. The covalently closed circular library molecules were prepared from input DNA from various species. Lane 1 : cell free DNA; Lane 2: E. coli; Lane 3: Human; Lane 4: metagenomic DNA; and Lane 5: PhiX.

[0127] FIG. 73 shows two Tables each listing the conditions for library preparation and on-flowcell treatments with or without a reagent for reducing or removing deaminated bases from the library molecules, and corresponding sequencing quality scores for R1 and R2 reads in a pairwise sequencing run. Table A lists data from sequencing A. coli samples. Table B lists data from sequencing human samples.

[0128] FIG. 74 is a graph showing the nucleotide base diversity of a left sample index sequence which lacks a 3-mer random sequence (NNN). The graph shows a nucleotide diversity of approximately 40% for A and T base calls, approximately 15% for C base calls, and approximately 5% for G base calls.

[0129] FIG. 75 is a graph showing the nucleotide base diversity of a right sample index sequence including the 3-mer random sequence (NNN). The graph shows a nucleotide diversity of the 3-mer random sequence (NNN) of approximately 30% for A and T base calls, and approximately 20% for C and G base calls.DETAILED DESCRIPTIONDefinitions:

[0130] The headings provided herein are not limitations of the various aspects of the disclosure, which aspects can be understood by reference to the specification as a whole.

[0131] Unless defined otherwise, technical and scientific terms used herein have meanings that are commonly understood by those of ordinary skill in the art unless defined otherwise. Generally, terminologies pertaining to techniques of molecular biology, nucleic acid chemistry, protein chemistry, genetics, microbiology, transgenic cell production, and hybridization described herein are those well-known and commonly used in the art. Techniques and procedures described herein are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the instant specification. For example, see Sambrook et al., Molecular Cloning: A Laboratory Manual (Third ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 2000). See also Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992). The nomenclatures utilized in connection with, and the laboratory procedures and techniques described herein are those well-known and commonly used in the art.

[0132] Unless otherwise required by context herein, singular terms shall include pluralities and plural terms shall include the singular. Singular forms “a”, “an” and “the”, and singular use of any word, include plural referents unless expressly and unequivocally limited on one referent.

[0133] It is understood the use of the alternative term (e.g., “or”) is taken to mean either one or both or any combination thereof of the alternatives.

[0134] The term “and / or” used herein is to be taken mean specific disclosure of each of the specified features or components with or without the other. For example, the term“and / or” as used in a phrase such as “A and / or B” herein is intended to include: “A and B”; “A or B”; “A” (A alone); and “B” (B alone). In a similar manner, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: “A, B, and C”; “A, B, or C”; “A or C”; “A or B”; “B or C”; “A and B”; “B and C”; “A and C”; “A” (A alone); “B” (B alone); and “C” (C alone).

[0135] As used herein and in the appended claims, terms “comprising”, “including”, “having” and “containing”, and their grammatical variants, as used herein are intended to be non-limiting so that one item or multiple items in a list do not exclude other items that can be substituted or added to the listed items. It is understood that wherever aspects are described herein with the language “comprising,” otherwise analogous aspects described in terms of “consisting of’ and / or “consisting essentially of’ are also provided.

[0136] As used herein, the terms “about” and “approximately” refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined, z.e., the limitations of the measurement system. For example, “about” or “approximately” can mean within one or more than one standard deviation per the practice in the art. Alternatively, “about” or “approximately” can mean a range of up to 10% (z.e., ±10%) or more depending on the limitations of the measurement system. For example, about 5 mg can include any number between 4.5 mg and 5.5 mg.Furthermore, particularly with respect to biological systems or processes, the terms can mean up to an order of magnitude or up to 5-fold of a value. When particular values or compositions are provided in the instant disclosure, unless otherwise stated, the meaning of “about” or “approximately” should be assumed to be within an acceptable error range for that particular value or composition. Also, where ranges and / or subranges of values are provided, the ranges and / or subranges can include the endpoints of the ranges and / or subranges.

[0137] The terms “peptide’, “polypeptide,” and “protein” and other related terms used herein are used interchangeably and refer to a polymer of amino acids and are not limited to any particular length. Polypeptides may comprise natural and non-natural amino acids. Polypeptides include recombinant or chemically-synthesized forms. Polypeptides also include precursor molecules that have not yet been subjected to post-translation modification such as proteolytic cleavage, cleavage due to ribosomal skipping, hydroxylation, methylation, lipidation, acetylation, SUMOylation, ubiquitination, glycosylation, phosphorylation and / or disulfide bond formation. These terms encompass native and artificial proteins, protein fragments and polypeptide analogs (such as muteins, variants, chimeric proteins and fusionproteins) of a protein sequence as well as post-translationally, or otherwise covalently or non- covalently, modified proteins.

[0138] The term “cellular biological sample” refers to a single cell, a plurality of cells, a tissue, an organ, an organism, or section of any of these cellular biological samples. The cellular biological sample can be extracted (e.g., biopsied) from an organism, or obtained from a cell culture grown in liquid or in a culture dish. The cellular biological sample comprises a sample that is fresh, frozen, fresh frozen, or archived (e.g., formalin-fixed paraffin-embedded; FFPE). The cellular biological sample can be embedded in a wax, resin, epoxy or agar. The cellular biological sample can be fixed, for example in any one or any combination of two or more of acetone, ethanol, methanol, formaldehyde, paraform al dehy deTriton or glutaraldehyde. The cellular biological sample can be sectioned or non-sectioned. The cellular biological sample can be stained, de-stained or non-stained.

[0139] The nucleic acids of interest can be extracted from cells or cellular biological samples using any of a number of techniques known to those of skill in the art. For example, a typical DNA extraction procedure comprises (i) collection of the cell sample or tissue sample from which DNA is to be extracted, (ii) disruption of cell membranes (i.e., cell lysis) to release DNA and other cytoplasmic components, (iii) treatment of the lysed sample with a concentrated salt solution to precipitate proteins, lipids, and RNA, followed by centrifugation to separate out the precipitated proteins, lipids, and RNA, and (iv) purification of DNA from the supernatant to remove detergents, proteins, salts, or other reagents used during the cell membrane lysis. A variety of suitable commercial nucleic acid extraction and purification kits are consistent with the disclosure herein. Examples include, but are not limited to, the QIAamp kits (for isolation of genomic DNA from human samples) and DNAeasy kits (for isolation of genomic DNA from animal or plant samples) from Qiagen (Germantown, MD), or the Maxwell® and ReliaPrep™ series of kits from Promega (Madison, WI).

[0140] The term “polymerase” and its variants, as used herein, comprises an enzyme comprising a domain that binds a nucleotide (or nucleoside) where the polymerase can form a complex having a template nucleic acid and a complementary nucleotide. The polymerase can have one or more activities including, but not limited to, base analog detection activities, DNA polymerization activity, reverse transcriptase activity, DNA binding, strand displacement activity, and nucleotide binding and recognition. A polymerase can be any enzyme that can catalyze polymerization of nucleotides (including analogs thereof) into a nucleic acid strand. Typically, but not necessarily, such nucleotide polymerization can occur in a template-dependent fashion. Typically, a polymerase comprises one or more active sitesat which nucleotide binding and / or catalysis of nucleotide polymerization can occur. In some embodiments, a polymerase includes other enzymatic activities, such as for example, 3' to 5' exonuclease activity or 5' to 3' exonuclease activity. In some embodiments, a polymerase has strand displacing activity. A polymerase can include without limitation naturally occurring polymerases and any subunits and truncations thereof, mutant polymerases, variant polymerases, recombinant, fusion or otherwise engineered polymerases, chemically modified polymerases, synthetic molecules or assemblies, and any analogs, derivatives or fragments thereof that retain the ability to catalyze nucleotide polymerization (e.g., catalytically active fragment). The polymerase includes catalytically inactive polymerases, catalytically active polymerases, reverse transcriptases, and other enzymes comprising a nucleotide binding domain. In some embodiments, a polymerase can be isolated from a cell, or can be generated using recombinant DNA technology or chemical synthesis methods. In some embodiments, a polymerase can be expressed in prokaryote, eukaryote, viral, or phage organisms. In some embodiments, a polymerase can be post-translationally modified proteins or fragments thereof. A polymerase can be derived from a prokaryote, eukaryote, virus or phage. A polymerase comprises DNA-directed DNA polymerase and RNA-directed DNA polymerase.

[0141] The term “strand displacing” refers to the ability of a polymerase to locally separate strands of double-stranded nucleic acids and synthesize a new strand in a templatebased manner. Strand displacing polymerases displace a complementary strand from a template strand and catalyze new strand synthesis. Strand displacing polymerases include mesophilic and thermophilic polymerases. Strand displacing polymerases include wild type enzymes, and variants including exonuclease minus mutants, mutant versions, chimeric enzymes and truncated enzymes. Examples of strand displacing polymerases include phi29 DNA polymerase, large fragment of Bst DNA polymerase, large fragment of Bsu DNA polymerase (exo-), Bea DNA polymerase (exo-), KI enow fragment of E. coli DNA polymerase, T5 polymerase, M-MuLV reverse transcriptase, HIV viral reverse transcriptase, Deep Vent DNA polymerase and KOD DNA polymerase. The phi29 DNA polymerase can be wild type phi29 DNA polymerase (e.g., MagniPhi from Expedeon), or variant EquiPhi29 DNA polymerase (e.g., from Thermo Fisher Scientific), or chimeric QualiPhi DNA polymerase (e.g., from 4basebio).

[0142] The terms “nucleic acid”, “polynucleotide”, ‘oligonucleotide’ and other related terms used herein are used interchangeably and refer to polymers of nucleotides and are not limited to any particular length. Nucleic acids include recombinant and chemically- synthesized forms. Nucleic acids can be isolated. Nucleic acids include DNA molecules (e.g.,cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of the DNA or RNA generated using nucleotide analogs (e.g., peptide nucleic acids and non-naturally occurring nucleotide analogs), and chimeric forms containing DNA and RNA. Nucleic acids can be single-stranded or double-stranded. Nucleic acids comprise polymers of nucleotides, where the nucleotides include natural or non-natural bases and / or sugars. Nucleic acids comprise naturally-occurring internucleosidic linkages, for example phosphdiester linkages. Nucleic acids comprise non-natural intemucleoside linkages, including phosphorothioate, phosphorothiolate, or peptide nucleic acid (PNA) linkages. In some embodiments, nucleic acids comprise a one type of polynucleotides or a mixture of two or more different types of polynucleotides.

[0143] The term “operably linked” and “operably joined” or related terms as used herein refers to juxtaposition of components. The juxtapositioned components can be linked together covalently. For example, two nucleic acid components can be enzymatically ligated together where the linkage that joins together the two components comprises phosphodiester linkage. A first and second nucleic acid component can be linked together, where the first nucleic acid component can confer a function on a second nucleic acid component. For example, linkage between a primer binding sequence and a sequence of interest forms a nucleic acid library molecule having a portion that can bind to a primer. In another example, a transgene (e.g., a nucleic acid encoding a polypeptide or a nucleic acid sequence of interest) can be ligated to a vector where the linkage permits expression or functioning of the transgene sequence contained in the vector. In some embodiments, a transgene is operably linked to a host cell regulatory sequence (e.g., a promoter sequence) that affects expression of the transgene. In some embodiments, the vector comprises at least one host cell regulatory sequence, including a promoter sequence, enhancer, transcription and / or translation initiation sequence, transcription and / or translation termination sequence, polypeptide secretion signal sequences, and the like. In some embodiments, the host cell regulatory sequence controls expression of the level, timing and / or location of the transgene.

[0144] The terms “linked”, “joined”, “attached”, “appended” and variants thereof comprise any type of fusion, bond, adherence or association between any combination of compounds or molecules that is of sufficient stability to withstand use in the particular procedure. The procedure can include, but is not limited to: nucleotide binding; nucleotide incorporation; de-blocking (e.g., removal of chain-terminating moiety); washing; removing; flowing; detecting; imaging and / or identifying. Such linkage can comprise, for example, covalent, ionic, hydrogen, dipole-dipole, hydrophilic, hydrophobic, or affinity bonding, bondsor associations involving van der Waals forces, mechanical bonding, and the like. In some embodiments, such linkage occurs intramolecularly, for example linking together the ends of a single-stranded or double-stranded linear nucleic acid molecule to form a circular molecule. In some embodiments, such linkage can occur between a combination of different molecules, or between a molecule and a non-molecule, including but not limited to: linkage between a nucleic acid molecule and a solid surface; linkage between a protein and a detectable reporter moiety; linkage between a nucleotide and detectable reporter moiety; and the like. Some examples of linkages can be found, for example, in Hermanson, G., “Bioconjugate Techniques”, Second Edition (2008); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998).

[0145] The term “primer” and related terms used herein refers to an oligonucleotide that is capable of hybridizing with a DNA and / or RNA polynucleotide template to form a duplex molecule. Primers can be single-stranded along their entire length or have single-stranded and double-stranded portions. Primers comprise natural nucleotides and / or nucleotide analogs. Primers can be recombinant nucleic acid molecules. Primers may have any length, but typically range from 4-50 nucleotides. A typical primer comprises a 5’ end and 3’ end. The 3’ end of the primer can include a 3’ OH moiety which serves as a nucleotide polymerization initiation site in a polymerase-catalyzed primer extension reaction. Alternatively, the 3’ end of the primer can lack a 3’ OH moiety, or can include a terminal 3’ blocking group that inhibits nucleotide polymerization in a polymerase-catalyzed reaction. Any one nucleotide, or more than one nucleotide, along the length of the primer can be labeled with a detectable reporter moiety. A primer can be in solution (e.g., a soluble primer) or can be immobilized to a support (e.g., a capture primer).

[0146] The term “template nucleic acid”, “template polynucleotide”, “target nucleic acid” “target polynucleotide”, “template strand” and other variations refer to a nucleic acid strand that serves as the basis nucleic acid molecule for any of the amplification and / or sequencing methods describe herein. The template nucleic acid can be single-stranded or doublestranded, or the template nucleic acid can have single-stranded or double-stranded portions. The template nucleic acid can be obtained from a naturally-occurring source, recombinant form, or chemically synthesized to include any type of nucleic acid analog. The template nucleic acid can be linear, concatemeric, circular, or other forms.

[0147] The term “adaptor” and related terms refers to oligonucleotides that can be operably linked (appended) to a target polynucleotide, where the adaptor confers a function to the co-joined adaptor-target molecule. Adaptors comprise DNA, RNA, chimeric DNA / RNA, or analogs thereof. Adaptors can include at least one ribonucleoside residue. Adaptors can be single-stranded, double-stranded, or have single-stranded and / or double-stranded portions. Adaptors can be configured to be linear, stem-looped, hairpin, or Y-shaped forms. Adaptors can be any length, including 4-100 nucleotides or longer. Adaptors can have blunt ends, overhang ends, or a combination of both. Overhang ends include 5’ overhang and 3’ overhang ends. The 5’ end of a single-stranded adaptor, or one strand of a double-stranded adaptor, can have a 5’ phosphate group or lack a 5’ phosphate group. Adaptors can include a 5’ tail that does not hybridize to a target polynucleotide (e.g., tailed adaptor), or adaptors can be non-tailed. At least a portion of the adaptors comprise a known and pre-determined sequence. An adaptor can include a sequence that is complementary to at least a portion of a primer, such as an amplification primer, a sequencing primer, or a capture primer (e.g., soluble or immobilized capture primers). Adaptors can include a random sequence or degenerate sequence. Adaptors can include at least one inosine residue. Adaptors can include at least one phosphorothioate, phosphorothiolate and / or phosphoramidate linkage. Adaptors can include at least one barcode sequence which can be used to distinguish polynucleotides (e.g., insert sequences) from different sample sources in a multiplex assay. Adaptors can include at least one unique identification sequence (e.g., a molecular tag) that can be used to uniquely identify a nucleic acid molecule to which the adaptor is appended. In some embodiments, the unique identification sequence comprises 2-12 or more nucleotides having a known sequence. For example, the unique identification sequence comprises a known random sequence where a nucleotide at each position is randomly selected from nucleotides having a base A, G, C, T or U. Adaptors can include at least one restriction enzyme recognition sequence, including any one or any combination of two or more selected from a group consisting of type I, type II, type III, type IV, type Hs or type IIB.

[0148] The term “universal sequence” and related terms refers to a sequence in a nucleic acid molecule that is common among two or more polynucleotide molecules. For example, an adaptor having a universal sequence can be operably joined to a plurality of polynucleotides so that the population of co-joined molecules carry the same universal adaptor sequence. Examples of universal adaptor sequences include an amplification primer sequence, a sequencing primer sequence or a capture primer sequence (e.g., soluble or immobilized capture primers).

[0149] When used in reference to nucleic acid molecules, the terms “hybridize” or “hybridizing” or “hybridization” or other related terms refers to hydrogen bonding between two different nucleic acids to form a duplex nucleic acid. Hybridization also includes hydrogen bonding between two different regions of a single nucleic acid molecule to form a self-hybridizing molecule having a duplex region. Hybridization can comprise Watson-Crick or Hoogstein binding to form a duplex double-stranded nucleic acid, or a double-stranded region within a nucleic acid molecule. The double-stranded nucleic acid, or the two different regions of a single nucleic acid, may be wholly complementary, or partially complementary. Complementary nucleic acid strands need not hybridize with each other across their entire length. The complementary base pairing can be the standard A-T or C-G base pairing, or can be other forms of base-pairing interactions. Duplex nucleic acids can include mismatched base-paired nucleotides.

[0150] When used in reference to nucleic acids, the terms “extend”, “extending”, “extension” and other variants, refers to incorporation of one or more nucleotides into a nucleic acid molecule. Nucleotide incorporation comprises polymerization of one or more nucleotides into the terminal 3’ OH end of a nucleic acid strand, resulting in extension of the nucleic acid strand. Nucleotide incorporation can be conducted with natural nucleotides and / or nucleotide analogs. Typically, but not necessarily, nucleotide incorporation occurs in a template-dependent fashion. Any suitable method of extending a nucleic acid molecule may be used, including primer extension catalyzed by a DNA polymerase or RNA polymerase.

[0151] The term “nucleotides” and related terms refers to a molecule comprising an aromatic base, a five carbon sugar (e.g., ribose or deoxyribose), and at least one phosphate group. Canonical or non-canonical nucleotides are consistent with use of the term. In some embodiments, the nucleotide comprises a monophosphate, diphosphate, triphosphate, or corresponding phosphate analog. The term “nucleoside” refers to a molecule comprising an aromatic base and a sugar. Nucleotides and nucleosides can be non-labeled or labeled with a detectable reporter moiety.

[0152] Nucleotides (and nucleosides) typically comprise a hetero cyclic base including substituted or unsubstituted nitrogen-containing parent heteroaromatic ring which are commonly found in nucleic acids, including naturally-occurring, substituted, modified, or engineered variants, or analogs of the same. The base of a nucleotide (or nucleoside) is capable of forming Watson-Crick and / or Hoogstein hydrogen bonds with an appropriate complementary base. Exemplary bases include, but are not limited to, purines and pyrimidines such as: 2-aminopurine, 2,6-diaminopurine, adenine (A), ethenoadenine, N6-A2-isopentenyladenine (6iA), N6-A2-isopentenyl-2-methylthioadenine (2ms6iA), N6- methyladenine, guanine (G), isoguanine, N2-dimethylguanine (dmG), 7-methylguanine (7mG), 2-thiopyrimidine, 6-thioguanine (6sG), hypoxanthine and O6-methylguanine; 7- deaza-purines such as 7-deazaadenine (7-deaza-A) and 7-deazaguanine (7-deaza-G); pyrimidines such as cytosine (C), 5-propynylcytosine, isocytosine, thymine (T), 4- thiothymine (4sT), 5,6-dihydrothymine, O4-methylthymine, uracil (U), 4-thiouracil (4sU) and 5,6-dihydrouracil (dihydrouracil; D); indoles such as nitroindole and 4-methylindole; pyrroles such as nitropyrrole; nebularine; inosines; hydroxymethylcytosines; 5 -methy cytosines; base (Y); as well as methylated, glycosylated, and acylated base moieties; and the like. Additional exemplary bases can be found in Fasman, 1989, in “Practical Handbook of Biochemistry and Molecular Biology”, pp. 385-394, CRC Press, Boca Raton, Fla.

[0153] Nucleotides (and nucleosides) typically comprise a sugar moiety, such as carbocyclic moiety (Ferraro and Gotor 2000 Chem. Rev. 100: 4319-48), acyclic moieties (Martinez, et al., 1999 Nucleic Acids Research 27: 1271-1274; Martinez, et al., 1997 Bioorganic & Medicinal Chemistry Letters vol. 7: 3013-3016), and other sugar moieties (Joeng, et al., 1993 J. Med. Chem. 36: 2627-2638; Kim, et al., 1993 J. Med. Chem. 36: 30-7; Eschenmosser 1999 Science 284:2118-2124; and U.S. Pat. No. 5,558,991). The sugar moiety comprises: ribosyl; 2'-deoxyribosyl; 3 '-deoxyribosyl; 2', 3 '-dideoxyribosyl; 2', 3'- didehydrodideoxyribosyl; 2'-alkoxyribosyl; 2'-azidoribosyl; 2'-aminoribosyl; 2'-fluororibosyl; 2'-mercaptoriboxyl; 2'-alkylthioribosyl; 3 '-alkoxyribosyl; 3 '-azidoribosyl; 3 '-aminoribosyl;3 '-fluororibosyl; 3'-mercaptoriboxyl; 3 '-alkylthioribosyl carbocyclic; acyclic or other modified sugars.

[0154] In some embodiments, nucleotides comprise a chain of one, two or three phosphorus atoms where the chain is typically attached to the 5’ carbon of the sugar moiety via an ester or phosphoramide linkage. In some embodiments, the nucleotide is an analog having a phosphorus chain in which the phosphorus atoms are linked together with intervening O, S, NH, methylene or ethylene. In some embodiments, the phosphorus atoms in the chain include substituted side groups including O, S or BH3. In some embodiments, the chain includes phosphate groups substituted with analogs including phosphoramidate, phosphorothioate, phosphordithioate, and O-methylphosphoroamidite groups.

[0155] The term “rolling circle amplification” generally refers to an amplification method that employs a circularized nucleic acid template molecule containing a target sequence of interest, an amplification primer binding sequence, and optionally one or more adaptor sequences such as a sequencing primer binding sequence and / or a sample index sequence.The rolling circle amplification reaction can be conducted under isothermal amplification conditions, and includes the circularized nucleic acid template molecule, an amplification primer, a strand-displacing polymerase and a plurality of nucleotides, to generate a concatemer containing tandem repeat sequences of the circular template molecule and any adaptor sequences present in the original circularized nucleic acid template molecule. The concatemer can self-collapse to form a nucleic acid nanoball. The shape and size of the nanoball can be further compacted by including a pair of inverted repeat sequences in the circular template molecule, or by conducting the rolling circle amplification reaction with one or more compaction oligonucleotides. One of the advantages of using rolling circle amplification to generate clonal amplicons for a sequencing workflow, is that the repeat copies of the target sequence in the nanoball can be simultaneously sequenced to increase signal intensity. In some embodiments, the rolling circle amplification reaction can be conducted in the presence of a plurality of compaction oligonucleotides having at least four consecutive guanines. The rolling circle amplification reaction generates concatemers comprising repeat copies of the universal binding sequence for the compaction oligonucleotide. At least one compaction oligonucleotide can form a guanine tetrad and hybridize to the universal binding sequences for the compaction oligonucleotide, and the resulting concatemer can fold to form an intramolecular G-quadruplex structure. The concatemers can self-collapse to form compact nanoballs. Formation of the guanine tetrads and G-quadruplexes in the nanoballs may increase the stability of the nanoballs to retain their compact size and shape which can withstand repeated flows of reagents for conducting any of the sequencing workflows described herein.

[0156] When used in reference to nucleic acids, the terms “amplify”, “amplifying”, “amplification”, and other related terms include producing multiple copies of an original polynucleotide template molecule, where the copies comprise a sequence that is complementary to the template sequence, and / or the copies comprise a sequence that is the same as the template sequence. In some embodiments, the copies comprise a sequence that is substantially identical to a template sequence, and / or is substantially identical to a sequence that is complementary to the template sequence.

[0157] The term “reporter moiety”, “reporter moieties” or related terms refers to a compound that generates, or causes to generate, a detectable signal. A reporter moiety is sometimes called a “label”. Any suitable reporter moiety may be used, including luminescent, photoluminescent, electroluminescent, bioluminescent, chemiluminescent, fluorescent, phosphorescent, chromophore, radioisotope, electrochemical, mass spectrometry,Raman, hapten, affinity tag, atom, or an enzyme. A reporter moiety generates a detectable signal resulting from a chemical or physical change (e.g., heat, light, electrical, pH, salt concentration, enzymatic activity, or proximity events). A proximity event includes two reporter moieties approaching each other, or associating with each other, or binding each other. It is well known to one skilled in the art to select reporter moieties so that each absorbs excitation radiation and / or emits fluorescence at a wavelength distinguishable from the other reporter moieties to permit monitoring the presence of different reporter moieties in the same reaction or in different reactions. Two or more different reporter moieties can be selected having spectrally distinct emission profiles, or having minimal overlapping spectral emission profiles. Reporter moieties can be linked (e.g., operably linked) to nucleotides, nucleosides, nucleic acids, enzymes (e.g., polymerases or reverse transcriptases), or support (e.g., surfaces).

[0158] A reporter moiety (or label) comprises a fluorescent label or a fluorophore. Exemplary fluorescent moieties which may serve as fluorescent labels or fluorophores include, but are not limited to fluorescein and fluorescein derivatives such as carboxyfluorescein, tetrachlorofluorescein, hexachlorofluorescein, carboxynapthofluorescein, fluorescein isothiocyanate, NHS-fluorescein, iodoacetamidofluorescein, fluorescein maleimide, SAMSA-fluorescein, fluorescein thiosemicarbazide, carbohydrazinomethylthioacetyl-amino fluorescein, rhodamine and rhodamine derivatives such as TRITC, TMR, lissamine rhodamine, Texas Red, rhodamine B, rhodamine 6G, rhodamine 10, NHS-rhodamine, TMR-iodoacetamide, lissamine rhodamine B sulfonyl chloride, lissamine rhodamine B sulfonyl hydrazine, Texas Red sulfonyl chloride, Texas Red hydrazide, coumarin and coumarin derivatives such as AMCA, AMCA-NHS, AMCA-sulfo- NHS, AMCA-HPDP, DCIA, AMCE-hydrazide, BODIPY® and derivatives such as BODIPY FL C3-SE, BODIPY 530 / 550 C3, BODIPY 530 / 550 C3-SE, BODIPY 530 / 550 C3 hydrazide, BODIPY 493 / 503 C3 hydrazide, BODIPY FL C3 hydrazide, BODIPY FL IA, BODIPY 530 / 551 IA, Br-BODIPY 493 / 503, Cascade Blue and derivatives such as Cascade Blue acetyl azide, Cascade Blue cadaverine, Cascade Blue ethylenediamine, Cascade Blue hydrazide, Lucifer Yellow and derivatives such as Lucifer Yellow iodoacetamide, Lucifer Yellow CH, cyanine and derivatives such as indolium based cyanine dyes, benzo-indolium based cyanine dyes, pyridium based cyanine dyes, thiozolium based cyanine dyes, quinolinium based cyanine dyes, imidazolium based cyanine dyes, Cy 3, Cy5, lanthanide chelates and derivatives such as BCPDA, TBP, TMT, BHHCT, BCOT, Europium chelates, Terbium chelates, Alexa Fluor® dyes, DyLight® dyes, Atto™ dyes, LightCycler® Red dyes, CALFlour dyes, JOE and derivatives thereof, Oregon Green™ dyes, WellRED dyes, IRD dyes, phycoerythrin and phycobilin dyes, Malachite green, stilbene, DEG dyes, NR dyes, nearinfrared dyes and others known in the art such as those described in Haugland, Molecular Probes Handbook, (Eugene, Oreg.) 6th Edition; Lakowicz, Principles of Fluorescence Spectroscopy, 2nd Ed., Plenum Press New York (1999), or Hermanson, Bioconjugate Techniques, 2nd Edition, or derivatives thereof, or any combination thereof. Cyanine dyes may exist in either sulfonated or non-sulfonated forms, and consist of two indolenin, benzo- indolium, pyridium, thiozolium, and / or quinolinium groups separated by a polymethine bridge between two nitrogen atoms. Commercially available cyanine fluorophores include, for example, Cy3, (which may comprise l-[6-(2,5-dioxopyrrolidin-l-yloxy)-6-oxohexyl]-2- (3-{ l-[6-(2,5-dioxopyrrolidin-l-yloxy)-6-oxohexyl]-3,3-dimethyl-l,3-dihydro-2H-indol-2- ylidenejprop- 1 -en- 1 -yl)-3 ,3 -dimethyl-3H-indolium or 1 - [6-(2, 5-dioxopyrrolidin- 1 -yloxy)-6- oxohexyl]-2-(3-{ l-[6-(2,5-dioxopyrrolidin-l-yloxy)-6-oxohexyl]-3,3-dimethyl-5-sulfo-l,3- dihydro-2H-indol-2-ylidene}prop-l-en-l-yl)-3,3-dimethyl-3H-indolium-5-sulfonate), Cy5 (which may comprise l-(6-((2,5-dioxopyrrolidin-l-yl)oxy)-6-oxohexyl)-2-((lE,3E)-5-((E)-l- (6-((2,5-dioxopyrrolidin-l-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-indolin-2-ylidene)penta-l,3- dien- 1 -yl)-3 ,3 -dimethyl-3H-indol- 1 -ium or 1 -(6-((2, 5-dioxopyrrolidin- 1 -yl)oxy)-6- oxohexyl)-2-((lE,3E)-5-((E)-l-(6-((2,5-dioxopyrrolidin-l-yl)oxy)-6-oxohexyl)-3,3-dimethyl- 5-sulfoindolin-2-ylidene)penta-l,3-dien-l-yl)-3,3-dimethyl-3H-indol-l-ium-5-sulfonate), and Cy7 (which may comprise l-(5-carboxypentyl)-2-[(lE,3E,5E,7Z)-7-(l-ethyl-l,3-dihydro-2H- indol-2-ylidene)hepta-l,3,5-trien-l-yl]-3H-indolium or l-(5-carboxypentyl)-2- [(lE,3E,5E,7Z)-7-(l-ethyl-5-sulfo-l,3-dihydro-2H-indol-2-ylidene)hepta-l,3,5-trien-l-yl]- 3H-indolium-5-sulfonate), where “Cy” stands for 'cyanine', and the first digit identifies the number of carbon atoms between two indolenine groups. Cy2 which is an oxazole derivative rather than indolenin, and the benzo-derivatized Cy3.5, Cy5.5 and Cy7.5 are exceptions to this rule.

[0159] In some embodiments, the reporter moiety can be a FRET pair, such that multiple classifications can be performed under a single excitation and imaging step. As used herein, FRET may comprise excitation exchange (Forster) transfers, or electron-exchange (Dexter) transfers.

[0160] The term “support” as used herein refers to a substrate that is designed for deposition of biological molecules or biological samples for assays and / or analyses. Examples of biological molecules to be deposited onto a support include nucleic acids (e.g., DNA, RNA), polypeptides, saccharides, lipids, a single cell or multiple cells. Examples ofbiological samples include but are not limited to saliva, phlegm, mucus, blood, plasma, serum, urine, stool, sweat, tears and fluids from tissues or organs.

[0161] In some embodiments, the support is solid, semi-solid, or a combination of both. In some embodiments, the support is porous, semi-porous, non-porous, or any combination of porosity. In some embodiments, the support can be substantially planar, concave, convex, or any combination thereof. In some embodiments, the support can be cylindrical, for example comprising a capillary or interior surface of a capillary.

[0162] In some embodiments, the surface of the support can be substantially smooth. In some embodiments, the support can be regularly or irregularly textured, including bumps, etched, pores, three-dimensional scaffolds, or any combination thereof.

[0163] In some embodiments, the support comprises a bead having any shape, including spherical, hemi- spherical, cylindrical, barrel-shaped, toroidal, disc-shaped, rod-like, conical, triangular, cubical, polygonal, tubular or wire-like.

[0164] The support can be fabricated from any material, including but not limited to glass, fused-silica, silicon, a polymer (e.g., polystyrene (PS), macroporous polystyrene (MPPS), polymethylmethacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE), cyclic olefin polymers (COP), cyclic olefin copolymers (COC), polyethylene terephthalate (PET)), or any combination thereof. Various compositions of both glass and plastic substrates are contemplated.

[0165] The present disclosure provides a plurality (e.g., two or more) of nucleic acid template molecules immobilized to a support. In some embodiments, the immobilized plurality of nucleic acid template molecules has the same sequence or have different sequences. In some embodiments, individual nucleic acid template molecules in the plurality of nucleic acid template molecules are immobilized to a different site on the support. In some embodiments, two or more individual nucleic acid template molecules in the plurality of nucleic acid templates are immobilized to a site on the support.

[0166] The term “array” refers to a support comprising a plurality of sites located at predetermined locations on the support to form an array of sites. The sites can be discrete and separated by interstitial regions. In some embodiments, the pre-determined sites on the support can be arranged in one dimension in a row or a column, or arranged in two dimensions in rows and columns. In some embodiments, the plurality of pre-determined sites is arranged on the support in an organized fashion. In some embodiments, the plurality of pre-determined sites is arranged in any organized pattern, including rectilinear, hexagonal patterns, grid patterns, patterns having reflective symmetry’, patterns having rotationalsymmetry, or the like. The pitch between different pairs of sites can be that same or can vary. In some embodiments, the support comprises at least 102sites, at least 103sites, at least 104sites, at least 105sites, at least 106sites, at least 107sites, at least 108sites, at least 109sites, at least IO10sites, at least IO11sites, at least 1012sites, at least IO13sites, at least 1014sites, at least IO15sites, or more, where the sites are located at pre-determined locations on the support. In some embodiments, a plurality of pre-determined sites on the support (e.g., 102- 1015sites or more) are immobilized with nucleic acid template molecules to form a nucleic acid template array. In some embodiments, the nucleic acid template molecules that are immobilized at a plurality of pre-determined sites by hybridization to immobilized surface capture primers, or the nucleic acid template molecules are covalently attached to the surface capture primers. In some embodiments, the nucleic acid template molecules are immobilized at a plurality of pre-determined sites, for example immobilized at 102- 1015sites or more. In some embodiments, the immobilized nucleic acid template molecules are clonally-amplified to generate immobilized nucleic acid clusters at the plurality of pre-determined sites. In some embodiments, individual immobilized nucleic acid clusters comprise linear clusters, or comprise single-stranded or double-stranded concatemers.

[0167] In some embodiments, a support comprising a plurality of sites located at random locations on the support is referred to herein as a support having randomly located sites thereon. The location of the randomly located sites on the support are not pre-determined. The plurality of randomly-located sites is arranged on the support in a disordered and / or unpredictable fashion. In some embodiments, the support comprises at least 102sites, at least 103sites, at least 104sites, at least 105sites, at least 106sites, at least 107sites, at least 108sites, at least 109sites, at least IO10sites, at least 1011sites, at least 1012sites, at least 1013sites, at least 1014sites, at least 1015sites, or more, where the sites are randomly located on the support. In some embodiments, a plurality of randomly located sites on the support e.g., 102- 1015sites or more) are immobilized with nucleic acid template molecules. In some embodiments, the nucleic acid template molecules are immobilized at a plurality of randomly located sites by hybridization to immobilized surface capture primers, or the nucleic acid template molecules are covalently attached to the surface capture primers. In some embodiments, the nucleic acid templates that are immobilized at a plurality of randomly located sites, for example immobilized at 102- 1015sites or more. In some embodiments, the immobilized nucleic acid templates are clonally-amplified to generate immobilized nucleic acid clusters at the plurality of randomly located sites. In some embodiments, individualimmobilized nucleic acid clusters comprise linear clusters, or comprise single-stranded or double-stranded concatemers.

[0168] In some embodiments, the plurality of immobilized surface capture primers on the support (e.g., located at pre-determined or random locations on the support) are in fluid communication with each other to permit flowing a solution of reagents (e.g., nucleic acid template molecules, soluble primers, enzymes, nucleotides, divalent cations, buffers, and the like) onto the support so that the plurality of immobilized surface capture primers on the support can be essentially simultaneously reacted with the reagents in a massively parallel manner. In some embodiments, the fluid communication of the plurality of immobilized surface capture primers can be used to conduct nucleic acid amplification reactions (e.g., RCA, MDA, PCR and bridge amplification) essentially simultaneously on the plurality of immobilized surface capture primers.

[0169] In some embodiments, the plurality of immobilized nucleic acid clusters on the support are in fluid communication with each other to permit flowing a solution of reagents (e.g., enzymes, nucleotides, divalent cations, and the like) onto the support so that the plurality of immobilized nucleic acid clusters on the support can be essentially simultaneously reacted with the reagents in a massively parallel manner. In some embodiments, the fluid communication of the plurality of immobilized nucleic acid clusters can be used to conduct nucleotide binding assays and / or conduct nucleotide polymerization reactions (e.g., primer extension or sequencing) essentially simultaneously on the plurality of immobilized nucleic acid clusters, and optionally to conduct detection and imaging for massively parallel sequencing.

[0170] The term “immobilized” and related terms refer to nucleic acid molecules that are attached to a support through covalent bond or non-covalent interaction, or attached to a coating on the support, or buried within a matrix formed by a coating on the support, where the nucleic acid molecules include surface capture primers, nucleic acid template molecules and extension products of capture primers. Extension products of capture primers can include nucleic acid concatemers (e.g., nucleic acid clusters). The nucleic acid molecules can be immobilized at pre-determined or random locations on the support. The nucleic acid molecules can be immobilized at pre-determined or random locations on or within a coating passivated on the support.

[0171] The term “immobilized” and related terms can also refer to enzymes (e.g., polymerases) that are attached to a support through covalent bond or non-covalent interaction, or attached to a coating on the support, or buried within a matrix formed by acoating on the support. The enzymes can be immobilized at pre-determined or random locations on the support. The enzymes can be immobilized at pre-determined or random locations on or within a coating passivated on the support.

[0172] In some embodiments, one or more nucleic acid template molecules are immobilized on the support, for example immobilized at the sites on the support. In some embodiments, the one or more nucleic acid template molecules are clonally-amplified. In some embodiments, the one or more nucleic acid template molecules are clonally-amplified off the support (e.g., in-solution) and then deposited onto the support and immobilized on the support. In some embodiments, the clonal amplification reaction of the one or more nucleic acid template molecules is conducted on the support resulting in immobilization on the support. In some embodiments, the one or more nucleic acid template molecules are clonally-amplified (e.g., in solution or on the support) using a nucleic acid amplification reaction, including any one or any combination of: polymerase chain reaction (PCR), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, bridge amplification, isothermal bridge amplification, rolling circle amplification (RCA), circle-to-circle amplification, helicase-dependent amplification, recombinase-dependent amplification, and / or single-stranded binding (SSB) proteindependent amplification.

[0173] The term “surface primer” and related terms herein refers to single-stranded oligonucleotides that are immobilized to a support and comprise a sequence that can hybridize to at least a portion of a nucleic acid template molecule. Surface capture primers can be used to immobilize template molecules to a support via hybridization. Surface capture primers can be immobilized to a support in a manner that resists primer removal during flowing, washing, aspirating, and changes in temperature, pH, salts, chemical and / or enzymatic conditions. Typically, but not necessarily, the 5’ end of a surface capture primer can be immobilized to a support or to a coating on the support (or embedded in a coating on the support). Alternatively, an interior portion or the 3’ end of a surface capture primer can be immobilized to a support.

[0174] The sequence of surface capture primers can be wholly or partially complementary along their length to at least a portion of the nucleic acid template molecule. A support can include a plurality of immobilized surface capture primers having the same sequence, or having two or more different sequences. Surface capture primers can be anylength, for example 4-50 nucleotides, or 50-100 nucleotides, or 100-150 nucleotides, or longer lengths.

[0175] A surface capture primer can have a terminal 3’ nucleotide having a sugar 3’ OH moiety which is extendible for nucleotide polymerization (e.g., polymerase catalyzed polymerization). A surface capture primer can have a terminal 3’ nucleotide having the 3’ sugar position linked to a chain-terminating moiety that inhibits nucleotide polymerization. The 3’ chain-terminating moiety can be removed (e.g., de-blocked) to convert the 3’ end to an extendible 3’ OH end using a de-blocking agent. Examples of chain terminating moi eties include alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, acetal group or silyl group. Azide type chain terminating moieties including azide, azido and azidomethyl groups. Examples of deblocking agents include a phosphine compound, such as Tris(2-carboxyethyl)phosphine (TCEP) and bis-sulfo triphenyl phosphine (BS-TPP), for chain-terminating groups azide, azido and azidomethyl groups. Examples of de-blocking agents include tetrakis(triphenylphosphine)palladium(0) (Pd(PPh3)4) with piperidine, or with 2,3-Dichloro- 5,6-dicyano-l,4-benzo-quinone (DDQ), for chain-terminating groups alkyl, alkenyl, alkynyl and allyl. Examples of a de-blocking agent includes Pd / C for chain-terminating groups aryl and benzyl. Examples of de-blocking agents include phosphine, beta-mercaptoethanol or dithiothritol (DTT), for chain-terminating groups amine, amide, keto, isocyanate, phosphate, thio and disulfide. Examples of de-blocking agents include potassium carbonate (K2CO3) in MeOH, triethylamine in pyridine, and Zn in acetic acid (AcOH), for carbonate chainterminating groups. Examples of de-blocking agents include tetrabutyl ammonium fluoride, pyridine-HF, with ammonium fluoride, and triethylamine trihydrofluoride, for chainterminating groups urea and silyl.

[0176] The term “sequencing” and related terms refers to a method for obtaining nucleotide sequence information from a nucleic acid molecule, typically by determining the identity of at least some nucleotides (including their nucleobase components) within the nucleic acid molecule. In some embodiments, the sequence information of a given region of a nucleic acid molecule includes identifying each and every nucleotide within a region that is sequenced. In some embodiments, sequencing information determines only some of the nucleotides a region, while the identity of some nucleotides remains undetermined or incorrectly determined. Any suitable method of sequencing may be used. In an exemplary embodiment, sequencing can include label-free or ion based sequencing methods. In someembodiments, sequencing can include labeled or dye-containing nucleotide or fluorescent based nucleotide sequencing methods. In some embodiments, sequencing can include polonybased sequencing or bridge sequencing methods. In some embodiments, the sequencing employs polymerases and multivalent molecules for generating at least one avidity complex, wherein individual multivalent molecules comprise a plurality of nucleotide moieties tethered to a core. In some embodiments, the sequencing employs polymerases and free nucleotides for performing sequencing-by-synthesis. In some embodiments, the sequencing employs a ligase enzyme and a plurality of sequence-specific oligonucleotides for performing sequence- by-ligation.INTRODUCTION

[0177] In a massively parallel pairwise sequencing workflow using detectably labeled multivalent molecules, high quality sequencing errors have been observed, which include bases that were assigned a high quality sequencing score but mismatched the reference base. Without wishing to be bound by theory, it was believed that these high quality sequencing errors arose from processes upstream or downstream of the sequencing portion of the workflow. An example of upstream processes includes any one or more step(s) of library preparation and loading the prepared library onto a sequencing flowcell for immobilization and sequencing, / .< ., steps prior to sequencing.

[0178] Library preparation workflows include numerous steps, including but not limited to: fragmentation of input nucleic acids; end repair of double-stranded fragmented nucleic acids; non-template tailing of double-stranded fragmented nucleic acids; appending adaptors via ligation or PCR; PCR amplification; denaturation to generate single-stranded library molecules; circularization of single-stranded library molecules; and / or immobilization of linear library molecules or circularized library molecules. In some embodiments, the library preparation workflow can be PCR-free. In some embodiments, the library preparation workflows include removal of deaminated nucleotide bases and gap-generation of nucleic acid molecules carrying at least one deaminated nucleotide base. In some embodiments, the methods for loading a prepared library onto a sequencing flowcell includes removal of deaminated nucleotide bases and gap-generation of nucleic acid molecules carrying at least one deaminated nucleotide base.

[0179] High quality base call errors have been detected for T bases when sequencing the first strand (e.g., R1 reads), and high quality base call errors for A bases when sequencing corresponding positions on the complementary second strand (e.g., R2 reads). Many of thehigh quality T base call errors on the first strand sequence align with C bases in a known reference sequence. It was believed that some of the bases in the library molecules were deaminated, which lead to the base substitutions including C:G to T:A transitions.

[0180] Deamination is generally the removal of an amino group from a molecule. With respect to nucleotide bases, cytosine (C) can be deaminated to generate uracil (U) where uracil can base pair with adenine (A), guanine (G) can be deaminated to generate xanthine where xanthine can base pair with cytosine (C), and adenine (A) can be deaminate to generate hypoxanthine where hypoxanthine can base pair with cytosine (C) (e.g., FIG. 14).

[0181] Workflows for preparing nucleic acid library molecules involve numerous steps that include conditions that can cause deamination of nucleotide bases. For example, and without limitation, deamination can be caused by the presence of deaminase enzymes at any stage in the library prep workflow. As another non-limiting example, any of the library preparation buffers having a low pH can cause base deamination. In another non-limiting example, high temperatures employed for PCR can cause base deamination. In another nonlimiting example, mechanical shearing forces that are used to fragment input nucleic acids can generate damaging free radicals which leads to deamination. Exemplary mechanical forces can include sonication force, acoustic force, nebulizing force, shearing force and cavitation force. In another example, certain chemicals such as bisulfites can cause deamination. The skilled artisan will recognize that nucleotide base deamination can be generated by many other conditions, as well as any combination of the conditions recited above.

[0182] In some embodiments, library preparation workflows can generate a plurality of library molecules comprising a mixture of first and second sub-populations of library molecules. In some embodiments, individual library molecules in the first sub-population carry at least one deaminated nucleotide base. In some embodiments, individual library molecules in the second sub-population lack a deaminated nucleotide base.

[0183] The present disclosure provides compositions and methods for improving sequencing quality scores comprising removing deaminated bases in any nucleic acid molecules throughout the workflow, including, for example, fragmented input nucleic acid molecules. In some embodiments, fragmented input nucleic acid molecules carrying deaminated bases can be removed while retaining fragmented input nucleic acid molecules that lack deaminated bases. In some embodiments, the compositions and methods for removing deaminated bases in a plurality of fragmented input nucleic acid moleculesemploys at least one enzyme comprising glycosylase activity and / or employs at least one enzyme comprising lyase activity.

[0184] The present disclosure also provides compositions and methods for improving sequencing quality scores comprising removing deaminated bases in a plurality of nucleic acid library molecules. In some embodiments, library molecules carrying deaminated bases can be removed while retaining library molecules that lack deaminated bases. In some embodiments, the compositions and methods for removing deaminated bases in library molecules employs at least one enzyme comprising glycosylase activity and / or employs at least one enzyme comprising lyase activity. In some embodiments, the compositions and methods for removing deaminated bases in library molecules can be applied to any type of nucleic acid library molecules, including for example linear or circularized library molecules, and library molecules for sequencing in a massively parallel manner. In some embodiments, the compositions and methods for removing deaminated bases in library molecules can be applied on a support prior to or during a rolling circle amplification reaction.

[0185] High quality base call errors near the terminal ends of the insert regions of library molecules have also been detected. For example, G to T errors are detected in the early sequencing cycles of the read 2 strand (R2), or C to A errors are detected on the reverse strand. Without wishing to be bound by theory, it was believed that these errors occurred during end repair steps of a library preparation workflow, for example and without limitation, prior to appending adaptors to the end repaired nucleic acid molecules.

[0186] End repair workflows are typically employed after fragmenting input doublestranded nucleic acids via mechanical shearing, which can generate a mixture of fragmented nucleic acids having 5’ overhang ends, 3’ overhang ends and / or blunt ends. End repair workflows can generate double-stranded fragments having blunt ends at both ends of the fragments. End repair workflows can be performed by conducting enzymatic exonuclease degradation of 5’ or 3’ overhang ends and / or by conducting polymerase-catalyzed extension of 3’ under-hang ends. The exonuclease degradation reactions typically do not generate base errors at the ends of the nucleic acid fragments. By contrast, the polymerase-catalyzed extension reaction can be a relatively low fidelity reaction which can introduce base errors, including G to T base errors, at the ends of the nucleic acid fragments. In some embodiments, the end repair workflows comprise a polymerase-catalyzed extension reaction.

[0187] The present disclosure also provides compositions and methods for improving sequencing quality scores comprising reducing base errors including G to T base errors on one strand by conducting an end repair workflow on a plurality of fragmented input nucleicacids, wherein the end repair workflow lacks a polymerase-catalyzed extension of 3’ underhang ends where the opposite strand comprises a 5’ over-hang end. For example, and without limitation, the end repair workflow comprises employing a nuclease enzyme to degrade the 5’ over-hang ends thereby generating a blunt end. In some embodiments, the end repair workflow can also comprise employing a nuclease enzyme to degrade the 3’ over-hang ends thereby generating a blunt end.

[0188] The present disclosure further provides compositions and methods for improving sequencing quality scores comprising reducing base errors including G to T base errors on one strand by conducting dark sequencing during the initial 2-30 (e.g., 5-30, 2-20, 10-30, 10- 20, 15-30 bases or any range therebetween) bases of the second read (read 2, or R2) strand. In some embodiments, the dark sequencing can be conducted on 2-30 consecutive bases in the initial portion of the read 2 strand (R2). As used herein, “dark sequencing” refers to methods that comprise conducting recursive sequencing cycles using non-labeled nucleotide reagents that can extend the sequencing primer, but nucleotide incorporation is not detected. In some embodiments, the non-labeled nucleotide reagents comprise non-labeled canonical nucleotides and / or non-labeled chain terminator nucleotides.

[0189] The present disclosure also provides compositions and methods for improving sequencing quality scores comprising any one or any combination of two or more of: (i) removing deaminated bases in any nucleic acid molecule throughout the library preparation workflow; (ii) conducting library preparation workflows that include end repair methods that reduce introduction of erroneous nucleotide bases; (iii) deactivating ligase enzyme activity with an alkaline reagent instead of heat; (iv) deactivating exonuclease enzyme activity with an alkaline reagent instead of heat; (v) removing deaminated bases in any nucleic acid molecule that is loaded onto a sequencing flowcell; and / or (vi) dark sequencing. In some embodiments, any of these compositions and methods can reduce C:G to T:A base transitions which can generate higher quality base calls during downstream sequencing workflows. In some embodiments, a sequencing quality score of Q30 can increase to Q40, Q45, Q50, Q55, Q60 or higher sequencing quality scores.

[0190] In some embodiments, the base calling from sequencing data is assessed for accuracy and quality. “Q-score” is a measure of data quality. The Q-score can be defined as a Phred quality score. The Q-score is based on a logarithmic scale. It is generally defined as Q = -10 log(P) where P is the error probability. For example, Q10 represents 10% error, Q20 represents 1% error, Q30 represents 0.1% error and Q40 represent 0.01% error. In anotherexample, Q10 is one error in 10, Q20 is one error in 100, Q30 is one error in 1000, Q40 is one error in 10,000, Q50 is one error in 100,000, and Q60 is one error in 1,000,000.Preparing Nucleic Acid Molecules with Reduced Deaminated Nucleotide Bases

[0191] In some aspects, the present disclosure provides methods for improving sequencing quality scores comprising conducting a library preparation workflow which includes at least one step for reducing / removing deaminated nucleotide bases in the fragmented input nucleic acids and / or in the library molecules and / or in the circularized library molecules and / or in the immobilized circularized library molecules.Removing Deaminated Bases from Fragmented Input Nucleic Acid Molecules

[0192] In some embodiments, methods for preparing fragmented input nucleic acid molecules having reduced deaminated nucleotide bases comprises step (a): fragmenting input nucleic acids to generate a plurality of fragmented input nucleic acids comprising a mixture of first and second sub-populations of fragmented input nucleic acid molecules. In some embodiments, individual fragmented input nucleic acid molecules in the first sub-population carry at least one deaminated nucleotide base. In some embodiments, individual fragmented input nucleic acid molecules in the second sub-population lack a deaminated nucleotide base. The input nucleic acids can be fragmented using any mechanical force, enzymatic (e.g., restriction endonuclease) or chemical fragmentation methods as described herein.

[0193] In some embodiments, methods for preparing fragmented input nucleic acid molecules having reduced deaminated nucleotide bases comprises step (b): contacting the plurality of fragmented input nucleic acid molecules, including the first and second subpopulations of fragmented input nucleic acid molecules, with a reagent that removes deaminated bases thereby generating a plurality of reagent-treated fragmented input nucleic acid molecules wherein individual reagent-treated fragmented input nucleic acid molecules comprise at least one abasic site. In some embodiments, the reagent that removes deaminated bases comprises at least one enzyme having glycosylase activity including any one or any combination of two or more of: formamidopyrimidine DNA glycosylase (fpg); uracil N- glycosylase (UNG); uracil DNA glycosylase (UDG); 8-oxoguanine glycosylase (OGG including thermostable OGG); DNA (apurinic) lyase; DNA (apyrimidinic) lyase; and / or endonuclease III. In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the glycosylase reaction.

[0194] In some embodiments, in step (b), the reagent that removes deaminated bases from the plurality of fragmented input nucleic acids comprises at least one enzyme having lyase activity that can that breaks the phosphodiester backbone at the 5’ and 3’ sides of the abasic site to release the base-free deoxyribose and generate a gap, wherein the enzyme having lyase activity includes any one or any combination of two or more of: AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase (formamidopyrimidine DNA glycosylase), Endonuclease VIII glycosylase / AP lyase and / or endonuclease III. In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the lyase reaction.

[0195] In some embodiments, in step (b), the reagent that removes deaminated bases from the plurality of fragmented input nucleic acids comprises at least one enzyme that generates an abasic site in a nucleic acid strand and at least one enzyme having lyase activity. In some embodiments, the reagent that removes deaminated bases comprises a mixture of uracil DNA glycosylase and DNA glycosylase-lyase endonuclease VIII, for example USER (Uracil-Specific Excision Reagent Enzyme, such as from New England Biolabs®) or thermolabile USER (for example, from New England Biolabs). In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the glycosylase and lyase reactions.

[0196] In some embodiments, methods for preparing fragmented input nucleic acid molecules having reduced deaminated nucleotide bases comprise optional step (c): appending at least one adaptor to one or both ends of the plurality of reagent-treated fragmented input nucleic acid molecules, thereby generating a plurality of library molecules (e.g., a plurality of linear library molecules).Removing Deaminated Bases from Library Molecules

[0197] In some embodiments, methods for preparing a plurality of library molecules having reduced deaminated nucleotide bases comprises step (a): appending at least one adaptor to one or both ends of fragmented input nucleic acid molecules, thereby generating a plurality of library molecules (e.g., a plurality of linear library molecules) comprising a mixture of first and second sub-populations of library molecules. In some embodiments, individual library molecules in the first sub-population carry at least one deaminated nucleotide base. In some embodiments, individual library molecules in the second subpopulation lack a deaminated nucleotide base.

[0198] In some embodiments, methods for preparing a plurality of library molecules having reduced deaminated nucleotide bases comprises optional step (b): contacting the plurality of library molecules, including the first and second sub-populations of library molecules, with a reagent that removes deaminated bases thereby generating a plurality of library molecules wherein individual library molecules comprise at least one abasic site.

[0199] In some embodiments, methods for preparing a plurality of library molecules having reduced deaminated nucleotide bases comprises optional step (c): circularizing the plurality of linear library molecules, thereby generating a plurality of covalently closed circular library molecules having reduced deaminated nucleotide bases. Any of the methods described herein for circularizing linear library molecules can be used to generate a plurality of covalently closed circular library molecules, including for example, employing CIRCLIGASE, employing telomerase TelN, circularization using single stranded splint strands, or circularization using double stranded splint adaptors. Exemplary, non-limiting single-stranded splint strands and double-stranded splint adaptors, and methods related thereto, are described in WO 2023 / 168444, WO 2023 / 168443, WO 2024 / 011145, WO 2024 / 059550, and PCT / US2024 / 39186, the contents of each of which is incorporated by reference herein in their entireties. In some embodiments, linear library molecules can be circularized by hybridizing to single stranded splint capture primers that are immobilized to a support.

[0200] In some embodiments, the plurality of circularized library molecules comprises a mixture of first and second sub-populations of circularized library molecules. In some embodiments, individual circularized library molecules in the first sub-population carry at least one deaminated nucleotide base. In some embodiments, individual circularized library molecules in the second sub-population lack a deaminated nucleotide base.

[0201] In some embodiments, methods for preparing a plurality of circularized library molecules having reduced deaminated nucleotide bases comprises contacting the plurality of circularized library molecules with a reagent that removes deaminated bases thereby generating a plurality of library molecules wherein individual circularized library molecules comprise at least one abasic site.

[0202] In some embodiments, methods for preparing a plurality of library molecules having reduced deaminated nucleotide bases comprise optional step (d): distributing the plurality of circularized library molecules onto a support comprising a plurality of immobilized surface capture primers, to generate a plurality of immobilized circularized library molecules wherein individual immobilized circularized library molecules comprise acircularized library molecule hybridized to at least a portion of an immobilized surface capture primer. In some embodiments, at least a portion of individual immobilized surface capture primers comprise a sequence that can hybridize with at least a portion of individual circularized library molecules. In some embodiments, the plurality of immobilized circularized library molecules can be contacted with a rolling circle amplification reagent for conducting rolling circle amplification reaction to generate a plurality of immobilized concatemer molecules.

[0203] In some embodiments, the plurality of immobilized circularized library molecules can be subjected to enzymatic removal of deaminated bases and gap-generation prior to the rolling circle amplification reaction.

[0204] In some embodiments, the plurality of immobilized circularized library molecules comprises a mixture of first and second sub-populations of immobilized circularized library molecules. In some embodiments, individual immobilized circularized library molecules in the first sub-population carry at least one deaminated nucleotide base. In some embodiments, individual immobilized circularized library molecules in the second sub-population lack a deaminated nucleotide base.

[0205] In some embodiments, methods for preparing a plurality of immobilized circularized library molecules having reduced deaminated nucleotide bases comprises contacting the plurality of immobilized circularized library molecules with a reagent that removes deaminated bases, thereby generating a plurality of immobilized circularized library molecules wherein individual immobilized circularized library molecules comprise at least one abasic site.

[0206] In some embodiments, in steps (b), (c) and (d), the reagent that removes deaminated bases comprises at least one enzyme having glycosylase activity including any one or any combination of two or more of: formamidopyrimidine DNA glycosylase (fpg); uracil N-glycosylase (UNG); uracil DNA glycosylase (UDG); 8-oxoguanine glycosylase (OGG including thermostable OGG); DNA (apurinic) lyase; DNA (apyrimidinic) lyase; and / or endonuclease III. In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the glycosylase reaction.

[0207] In some embodiments, in steps (b), (c) and (d), the reagent that removes deaminated bases comprises at least one enzyme having lyase activity that can that breaks the phosphodiester backbone at the 5’ and 3’ sides of the abasic site to release the base-free deoxyribose and generate a gap, wherein the enzyme having lyase activity includes any one or any combination of two or more of: AP lyase, Endo IV endonuclease, FPG glycosylase / APlyase (formamidopyrimidine DNA glycosylase), Endonuclease VIII glycosylase / AP lyase and / or endonuclease III. In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the lyase reaction.

[0208] In some embodiments, in steps (b), (c) and (d), the reagent that removes deaminated bases comprises at least one enzyme that generates an abasic site in a nucleic acid strand and at least one enzyme having lyase activity. In some embodiments, the reagent that removes deaminated bases comprises a mixture of uracil DNA glycosylase and DNA glycosylase-lyase endonuclease VIII, for example and without limitation, USER (Uracil- Specific Excision Reagent Enzyme, such as from New England Biolabs) or thermolabile USER (for example from New England Biolabs). In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the glycosylase and lyase reactions.

[0209] In some embodiments, the plurality of library molecules (e.g., plurality of linear library molecules) that are generated in step (b) are not subjected to enzymatic removal of deaminated bases and gap-generation.

[0210] In some embodiments, the plurality of covalently closed circular library molecules that are generated in step (c) are not subjected to enzymatic removal of deaminated bases and gap-generation.

[0211] In some embodiments, the plurality of immobilized circularized library molecules that are generated in step (d) are not subjected to enzymatic removal of deaminated bases and gap-generation.

[0212] In some embodiments, methods for enzymatic removal of deaminated bases and gap-generation can be applied to any combination of the plurality of fragmented input nucleic acid molecules of step (a), and / or can be applied to the plurality of library molecules (e.g., a plurality of linear library molecules) that are generated in step (b), and / or can be applied to the plurality of circularized library molecules that are generated in step (c), and / or can be applied to the plurality of immobilized circularized library molecules that are generated in step (d).Preparing Nucleic Acid Molecules with Reduced Introduced Nucleotide Base Errors

[0213] In some aspects, the present disclosure provides methods for improving sequencing quality scores comprising conducting a library preparation workflow which includes at least one step for reducing introduced nucleotide base errors in the fragmented input nucleic acids and / or in the library molecules and / or in the circularized library moleculesand / or in the immobilized circularized library molecules. In some embodiments, a reduction in introduced nucleotide base errors can be achieved by conducting an end repair workflow.End Repair of Fragmented Input Nucleic Acids

[0214] In some embodiments, methods for preparing fragmented input nucleic acids having reduced introduced nucleotide base errors comprise step (a): fragmenting input nucleic acids to generate a plurality of fragmented input nucleic acids comprising a mixture of fragmented nucleic acids having 5’ overhang ends, 3’ overhang ends and / or blunt ends. In some embodiments, the input nucleic acids comprise double-stranded input nucleic acids. In some embodiments, the input nucleic acids can be fragmented using any mechanical force, enzymatic (e.g., restriction endonuclease) or chemical fragmentation methods as described herein.

[0215] In some embodiments, methods for preparing fragmented input nucleic acids having reduced introduced nucleotide base errors comprise step (b): contacting the plurality of fragmented input nucleic acids with at least one nucleic acid end repair reagent under a condition suitable to convert the 5’ overhang ends and the 3’ overhang ends to blunt ends. In some embodiments, the at least one nucleic acid end repair reagent comprises an enzyme that can degrade a 5’ or 3’ overhang end, or can fill-in a 3’ under-hang end e.g., a 5’ overhang end). In some embodiments, one or both strands of the end repaired double stranded nucleic acids comprise 5’ phosphorylated ends.

[0216] In some embodiments, in step (b), the at least one nucleic acid end repair reagent comprises at least one nuclease. In some embodiments, the at least one nucleic acid end repair reagent comprises at least one single stranded nuclease. In some embodiments, the at least one nucleic acid end repair reagent comprises any one or any combination of two or more nucleases including mung bean nuclease, Exonuclease I (from E. colt), Thermolabile exonuclease I, Exonuclease T, Exonuclease VII, Exonuclease VIII and / or RecJf.

[0217] In some embodiments, in step (b), the at least one nucleic acid end repair reagent comprises an enzyme that can degrade a 5’ overhang end thereby generating double-stranded fragmented input nucleic acids having blunt ends. In some embodiments, the at least one nucleic acid end repair reagent comprises SI nuclease.

[0218] In some embodiments, in step (b), the at least one nucleic acid end repair reagent can degrade a 3’ overhang end thereby generating double-stranded fragmented input nucleic acids having blunt ends. In some embodiments, the at least one nucleic acid end repairreagent comprises any one or any combination of two or more of DNA polymerase I, Large (Klenow) fragment, T4 DNA polymerase and / or mung bean nuclease.

[0219] In some embodiments, in step (b), the at least one nucleic acid end repair reagent comprises a single-strand specific endonuclease enzyme that can remove 5' and 3' overhang ends wherein the single-strand specific endonuclease enzyme comprises mung bean nuclease.

[0220] In some embodiments, in step (b), the at least one nucleic acid end repair reagent comprises a polymerase that can catalyze fill-in of a 3’ under-hang end (e.g., a 5’ overhang end). In some embodiments, step (b) comprises contacting the plurality of fragmented input nucleic acids with a polymerase and a plurality of nucleotides, wherein the polymerase comprises T4 DNA polymerase, Tfi DNA polymerase, Tli DNA polymerase, Taq DNA polymerase, Large (Klenow) fragment, phi29 DNA polymerase, polymerase beta (pol P), Mako DNA polymerase and / or Q5U Hot Start high-fidelity DNA polymerase (e.g., catalog # M0515S from New England Biolabs). Any of these polymerases can be heat-stable or heat- labile enzymes.

[0221] In some embodiments, in step (b), the nucleic acid end repair reagent lacks a polymerase that can catalyze fill-in of a 3’ under-hang end and lacks a plurality of nucleotides.

[0222] In some embodiments, step (b) optionally comprises contacting the plurality of fragmented input nucleic acids with (i) at least one nucleic acid end repair reagent to convert the 5’ overhang ends and the 3’ overhang ends to blunt ends, and (ii) a reagent that removes deaminated bases thereby generating a plurality of fragmented input nucleic acid molecules wherein individual fragmented input nucleic acid molecules comprise at least one abasic site. In some embodiments, the reagent that removes deaminated bases comprises at least one enzyme having glycosylase activity including any one or any combination of two or more of: formamidopyrimidine DNA glycosylase (fpg); uracil N-glycosylase (UNG); uracil DNA glycosylase (UDG); 8-oxoguanine glycosylase (OGG including thermostable OGG); DNA (apurinic) lyase; DNA (apyrimidinic) lyase; and / or endonuclease III. In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the glycosylase reaction.

[0223] In some embodiments, step (b) further comprises contacting the plurality of fragmented input nucleic acids with (iii) a reagent that removes deaminated bases from the plurality of fragmented input nucleic acids comprises at least one enzyme having lyase activity that can that breaks the phosphodiester backbone at the 5’ and 3’ sides of the abasic site to release the base-free deoxyribose and generate a gap, wherein the enzyme having lyaseactivity includes any one or any combination of two or more of: AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase (formamidopyrimidine DNA glycosylase), Endonuclease VIII glycosylase / AP lyase and / or endonuclease III. In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the lyase reaction.

[0224] In some embodiments, in steps (b)(ii) and (b)(iii), the reagent that removes deaminated bases from the plurality of fragmented input nucleic acids comprises at least one enzyme that generates an abasic site in a nucleic acid strand and at least one enzyme having lyase activity. In some embodiments, the reagent that removes deaminated bases comprises a mixture of uracil DNA glycosylase and DNA glycosylase-lyase endonuclease VIII, for example, USER (Uracil-Specific Excision Reagent Enzyme, such as from New England Biolabs) or thermolabile USER (for example, from New England Biolabs). In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the glycosylase and lyase reactions.Fragmenting Input Nucleic Acids

[0225] In some aspects, the present disclosure provides methods for improving sequencing quality scores comprising fragmenting input nucleic acids. In some embodiments, input nucleic acids comprise DNA, RNA or cDNA. In some embodiments, the input nucleic acids comprise nucleic acids having the same sequence or a mixture of different sequences. In some embodiments, the input nucleic acids comprise single-stranded or double-stranded nucleic acids. In some embodiments, the input nucleic acid can be fragmented using mechanical force, enzymatic (e.g., restriction endonuclease) or chemical fragmentation methods. In some embodiments, the mechanical force comprises sonication force, acoustic force, nebulizing force, shearing force or cavitation force. In some embodiments, mechanical force can generate free radicals which can deaminate nucleotide bases. In some embodiments, mechanical force can generate a mixture of fragmented input nucleic acid molecules having 5’ overhang ends, 3’ overhang end and / or blunt ends. In some embodiments, the fragmented input nucleic acid can be generated from RNA using reverse transcriptase to produce RNA hybridized to cDNA. In some embodiments, double-stranded DNA can be prepared by reacting DNA polymerase with the RNA hybridized to cDNA. In some embodiments, DNA fragments can be generated by conducting PCR using input nucleic acids and a pair of PCR primers. In some embodiments, input nucleic acids can be fragmented using an enzyme that generates single-stranded nicks and another enzyme that catalyzes double-stranded cleavage.An exemplary enzyme mixture includes FRAGMENTASE (e.g., from New England Biolabs). In yet another embodiment, the input nucleic acid fragments comprise circulating cell-free DNA (e.g., double-stranded cfDNA) which has not been subjected to a fragmentation procedure. The cell-free DNA can be 50-200 bp in length. In some embodiments, the fragmented input nucleic acid can be size-selected or lack size-selection. A skilled artisan will recognize that the fragmented input nucleic acids can be generated using any of these methods and the fragments can be about 50-1000 bp in length or larger than 1000 bp. In some embodiments, the fragmented input nucleic acids can be about 50-100 bp in length, or about 100-250 bp in length, or about 250-500 bp in length, or about 500-750 bp in length, or about 750-2000 bp in length. In some embodiments, one or both ends of the fragmented input nucleic acids comprise 5’ phosphorylated ends.

[0226] In some embodiments, the input nucleic acids can be extracted from any source including a biological sample (e.g., fresh or live sample) such as a single cell, a plurality of cells or tissue. The input nucleic acids can be isolated from healthy or diseases cells or tissues. The input nucleic acids can be obtained from an archived sample such as a fresh frozen paraffin embedded (FFPE) sample, or from needle biopsies, circulating tumor cells, cell free circulating DNA (e.g., from tumor cells or a fetus). Cells or tissues are typically treated with a lysis buffer to release their DNA and RNA, and the desired nucleic acid is separated from non-desired macromolecules such as proteins.

[0227] In some embodiments, the input nucleic acids can be isolated in any form, including chromosomal, genomic (e.g., whole genomic), organellar (e.g., mitochondrial, chloroplast or ribosomal), recombinant molecules, cloned or amplified. The input nucleic acids can be methylated or non-methylated.

[0228] In some embodiments, the input nucleic acids can be isolated from any organism including viruses, fungi, prokaryotes or eukaryotes. The input nucleic acids can be isolated from any organism including human, simian, ape, canine, feline, bovine, equine, murine, porcine, caprine, lupine, ranine, piscine, plant, insect or bacteria. The input nucleic acids can be isolated from organisms borne in air, water, soil or food.

[0229] In some embodiments, the input nucleic acids can be isolated from any biological fluid, including blood, urine, serum, lymph, tumor, saliva, anal secretions, vaginal secretions, amniotic samples, perspiration, semen, smears, environmental samples or culture samples. The input nucleic acids can be isolated from any organ, including head, neck, brain, breast, ovary, cervix, colon, rectum, endometrium, gallbladder, intestines, bladder, prostate, testicles,liver, lung, kidney, esophagus, pancreas, thyroid, pituitary, thymus, skin, heart, larynx, or other organs.

[0230] In some embodiments, the input nucleic acids can be prepared using recombinant nucleic acid technology including but not limited to any combination of vector cloning, transgenic host cell preparation, host cell culturing and / or PCR amplification.Preparing Library Molecules

[0231] In some aspects, the present disclosure provides methods for improving sequencing quality scores comprising conducting a library preparation workflow which includes preparing fragmented input nucleic acids that have been subjected to methods for reducing / removing deaminated nucleotide bases and / or have been subjected to end repair methods that reduce introduced nucleotide base errors as described above. These fragmented input nucleic acids can be further processed to generate a plurality of library molecules, including reactions for phosphorylation, A-tailing and / or adaptor attachment. Exemplary, non-limiting methods of library preparation are described in US 2022 / 0403463 and US 2023 / 0203564, the contents of each of which is incorporated by reference herein in their entireties. In some embodiments, a library molecule comprises a fragmented input nucleic acid molecule appended to at least one adaptor.Phosphorylation

[0232] In some embodiments, a nucleic acid library can be prepared by phosphorylating the 5’ ends of the fragmented input nucleic acids, or removing 5’ or 3’ phosphates. For example, the fragmented input nucleic acids can be treated with T4 polynucleotide kinase to phosphorylate the 5’ end of at least one strand of duplex DNA. In some embodiments, the fragmented input nucleic acids can be treated with a phosphatase to remove a 5’ or 3’ phosphate using shrimp alkaline phosphatase, calf intestinal alkaline phosphatase, bacterial alkaline phosphatase, Antarctic phosphatase, and / or placental alkaline phosphatase.Non-Template Tailing

[0233] In some embodiments, a nucleic acid library can be prepared by adding a nontemplate tail to the 3’ ends of the fragmented input nucleic acids. In some embodiments, an A-tail comprising one or more non-template adenosine nucleotides can be appended to the 3’ ends of the fragmented input nucleic acids using a plurality of dATP and a DNA polymerase, such as for example a Taq DNA polymerase (or a derivative thereof), a Tfi (exo-minus) DNApolymerase, a large fragment Klenow (e.g., 3’ to 5’ exo-minus), a T4 DNA polymerase or a Hemo KlenTaq polymerase (e.g., from New England Biolabs, catalog # M0332S). In some embodiments, a single non-template A-tail can be appended to the 3 ’ ends of the fragmented input nucleic acids using proofreading DNA polymerase, Tfi (exo-) DNA polymerase or Pfu DNA polymerase, both in the presence of dATP. In some embodiments, a non-template A- tail can be appended to the 3’ ends of the fragmented input nucleic acids using terminal transferase and a plurality of dATP.Adaptors

[0234] In some embodiments, a nucleic acid library can be prepared by appending at least one adaptor to one end of individual fragmented input nucleic acids. In some embodiments, an adaptor comprises an oligonucleotide that can be operably linked (appended) to one or both ends of a fragmented input nucleic acid, where the adaptor confers a function to the cojoined adaptor-fragment molecule. Adaptors comprise DNA, RNA, chimeric DNA / RNA, or analogs thereof. Adaptors can include at least one ribonucleoside residue. Adaptors can be single-stranded, double-stranded, or have single-stranded and / or double-stranded portions. Adaptors can be configured to be linear, stem-looped, hairpin, or Y-shaped forms. Adaptors can be any length, including 4-100 nucleotides or longer. Adaptors can have blunt ends, overhang ends, or a combination of both. Overhang ends include 5’ overhang and 3’ overhang ends. The 5’ end of a single-stranded adaptor, or one strand of a double-stranded adaptor, can have a 5’ phosphate group or lack a 5’ phosphate group. Adaptors can include a 5’ tail (e.g., tailed adaptor) that can hybridize to a tailed fragmented input nucleic acid, or adaptors can be non-tailed. At least a portion of the adaptors comprise a known and predetermined sequence. An adaptor can include a sequence that is complementary to at least a portion of a primer, such as an amplification primer, a sequencing primer, or a capture primer (e.g., soluble or immobilized capture primers). Adaptors can include a random sequence or degenerate sequence. Adaptors can include at least one inosine residue. Adaptors can include at least one phosphorothioate, phosphorothiolate and / or phosphoramidate linkage. Adaptors can include at least one sample barcode / index sequence which can be used to distinguish polynucleotides (e.g., insert sequences) from different sample sources in a multiplex assay. Adaptors can include at least one unique identification sequence (e.g., a molecular tag) that can be used to uniquely identify a nucleic acid molecule to which the adaptor is appended. In some embodiments, the unique identification sequence comprises 2-20 or more nucleotides having a known sequence. For example, the unique identification sequence comprises aknown random sequence where a nucleotide at each position is randomly selected from nucleotides having a base A, G, C, T or U. Adaptors can include at least one restriction enzyme recognition sequence, including any one or any combination of two or more selected from a group consisting of type I, type II, type III, type IV, type Hs or type IIB. Adaptors can include at least one scissile moiety that can be cleaved to generate an abasic site, or the adaptors lack a scissile moiety. Exemplary scissile moieties include uridine, 8-oxo-7,8- dihydroguanine (e.g., 8oxoG) and deoxyinosine.

[0235] In some embodiments, adaptors comprise a universal sequence. In some embodiments, a universal sequence and related terms refers to a sequence in a nucleic acid molecule (e.g., an adaptor) that is common among two or more polynucleotide molecules. For example, an adaptor having a universal sequence can be operably joined to a plurality of polynucleotides so that the population of co-joined molecules carry the same universal adaptor sequence. Examples of universal adaptor sequences include an amplification primer sequence, a sequencing primer sequence, a capture primer sequence (e.g., soluble or immobilized capture primers) and compaction oligonucleotide binding sequence.Y-Shaped Adaptors

[0236] In some embodiments the adaptors comprise double-stranded nucleic acid Y- shaped adaptors, wherein individual double-stranded adaptors comprise a first and second oligonucleotide strand hybridized together, wherein both the first and second oligonucleotide strands comprise a complementary region and a mismatched region, thereby forming a Y- shaped adaptor having a double-stranded annealed portion and a mismatched portion having two single strands.

[0237] In some embodiments, the 5’ end of the first and / or second oligonucleotide strands that form the Y-shaped adaptor can be phosphorylated or can be non-phosphorylated. In some embodiments, the first oligonucleotide strand comprises a first universal adaptor sequence comprising a binding sequence for a first sequencing primer or a complementary sequence thereof. In some embodiments, the second oligonucleotide strand comprises a second universal adaptor sequence comprising a binding sequence for a second sequencing primer or a complementary sequence thereof. In some embodiments, the binding sequences for the first and second sequencing primers comprise different sequences. In some embodiments, in a population of Y-shaped adaptors, individual first oligonucleotide strands that form the Y-shaped adaptors have the same sequence. In some embodiments, in a population of Y-shaped adaptors, individual second oligonucleotide stands that form the Y-shaped adaptors have the same sequence. In some embodiments, the double-stranded annealed region of the Y-shaped adaptor includes at least 4 consecutive based-paired nucleotides. In some embodiments, the double-stranded annealed region includes a terminal end that can be joined to a nucleic acid fragment having a sequence-of-interest wherein the joining can be conducted via an enzymatic ligation reaction. In some embodiments, the double-stranded annealed region includes a terminal end that is blunt-ended, or the terminal end can have a 5’ or 3’ overhang region. In some embodiments, the first and second oligonucleotide strands of the mismatched portion can be the same length or different lengths.

[0238] In some embodiments, the first strand of the double-stranded annealed region of the Y-shaped adaptors comprise at least a portion of a binding sequence for the first sequencing primer (e.g., a reverse or forward sequencing primer) or a complementary sequence thereof. In some embodiments, the second strand of the double-stranded annealed region of the Y-shaped adaptors comprise at least a portion of a binding sequence for the second sequencing primer (e.g., a forward or reverse sequencing primer) or a complementary sequence thereof.

[0239] In some embodiments, the first strand of the mismatched region includes at least a portion of a binding sequence for the first sequencing primer (e.g., reverse or forward sequencing primer) or a complementary sequence thereof. In some embodiments, the first strand of the mismatched region further comprises at least a portion of a binding sequence for the first surface primer or a complementary sequence thereof. In some embodiments, the first strand of the mismatched region comprises a universal adaptor sequence comprising a first sample index sequence.

[0240] In some embodiments, the second strand of the mismatched region includes at least a portion of a binding sequence for the second sequencing primer (e.g., forward or reverse sequencing primer) or a complementary sequence thereof. In some embodiments, the second strand of the mismatched region further comprises at least a portion of a binding sequence for a second surface primer or a complementary sequence thereof. In some embodiments, the second strand of the mismatched region further comprises a universal adaptor sequence comprising a second sample index sequence.

[0241] In some embodiments, only the first strand of the mismatched region comprises a universal adaptor which comprises the first sample index sequence. In some embodiments, only the second strand of the mismatched region comprises a universal adaptor which comprises the second sample index sequence. In some embodiments, both the first strand ofthe mismatched region comprises the first sample index sequence, and the second strand of the mismatched region comprises the second sample index sequence.Adaptor Attachment

[0242] In some embodiments, one or both ends of fragmented input nucleic acids can be appended to at least one adaptor using a ligation reaction, wherein the fragmented input nucleic acids comprise at least one blunt end, at least one 5’ overhang end or at least one 3’ overhang end. The adaptor ligation reaction can include linear double stranded adaptors and / or double-stranded Y-shaped adaptors. In some embodiments, the ligation reaction can be conducted using a T4 DNA ligase, a T3 DNA ligase, or a T7 DNA ligase.

[0243] In some embodiments, single-stranded tailed primers can be used to append adaptor sequences to one or both ends of fragmented input nucleic acids using at least one primer extension reaction or PCR. In some embodiments, the 5’ end of the tailed primers comprise the adaptor sequence to be appended to the fragmented input nucleic acids. In some embodiments, the 5’ end of the tailed primers do not hybridize to the fragmented input nucleic acids. In some embodiments, the 3’ end of the tailed primers comprise a sequence capable of hybridizing to at least a portion of the fragmented input nucleic acids. In some embodiments, adaptor sequences can be appended to fragmented input nucleic acids by conducting at least one primer extension reaction using the single-stranded tailed primers, a polymerase and a plurality of nucleotides. In some embodiments, the primer extension reaction can employ one type of tailed primers to append adaptor sequences to one end of the fragmented input nucleic acids. In some embodiments, the primer extension reaction can employ two types of tailed primers to append adaptor sequences to both ends of the fragmented input nucleic acids. In some embodiments the multiple primer extension reactions can be employed using PCR. In some embodiments, the heat from the PCR reaction using tailed primers can generate nucleic acid library molecules comprising at least one deaminated nucleotide base. In some embodiments, the library preparation workflow can be PCR-free.Preparing Circularized Library Molecules with Reduced Deaminated Nucleotide Bases

[0244] In some aspects, the present disclosure provides methods for improving sequencing quality scores comprising generating a plurality of circularized library molecules. In some embodiments, a plurality of linear library molecules can be subjected to any of the workflows described herein that generates a plurality of circularized library molecules,including an intra-molecular ligation workflow, a telomerase workflow, or a workflow employing a single-stranded oligonucleotide or double-stranded adaptor.

[0245] In some embodiments, a library molecule comprises a fragmented input nucleic acid molecule appended to at least one adaptor. In some embodiments, a linear library molecule comprises a double-stranded fragmented input nucleic acid molecule appended to at least one double-stranded adaptor. In some embodiments, a double-stranded library molecule can be denatured using heat or an alkaline reagent (e.g., NaOH or KOH) to generate two single-stranded library molecules. In some embodiments, one of the single-stranded library molecules or both of the single-stranded library molecules can be circularized.

[0246] In some embodiments, in any of the circularization workflows, the fragmented input nucleic acids can be treated with a reagent that removes deaminated nucleotide bases. In some embodiments, in any of the circularization workflows, the library molecules can be treated with a reagent that removes deaminated nucleotide bases. In some embodiments, any of the intermediate nucleic acid molecules that are generated in any of the circularization workflows can be treated with a reagent that removes deaminated nucleotide bases. In some embodiments, the covalently closed circular library molecules that are generated by any of the circularization workflows can be treated with a reagent that removes deaminated nucleotide bases.Generating Circularized Library Molecules with CircLigase

[0247] In some embodiments, the ends of single-stranded library molecules can undergo intramolecular ligation using a single-stranded ligase (e.g., CircLigase from Epicentre or Lucigen) to generate a covalently closed circular library molecule. The covalently closed circular library molecule can be subjected to a rolling circle amplification reaction. In some embodiments, the covalently closed circular library molecules generated with CircLigase can be treated with any reagent that removes deaminated nucleotide bases as described herein.Generating Circularized Library Molecules with Telomerases

[0248] In some embodiments circular DNA molecules can be generated without a nucleic acid ligase. Protelomerase enzymes identifies a target enzyme recognition sequence within a nucleic acid molecule (e.g., a linear library molecule), cleaves the enzyme recognition sequence to generate an end having a 5’ and 3’ exposed cleavage ends, rejoins 5’ and 3’ cleavage ends of a single exposed end at the target site to form a single linear molecule from the cleaved 5’ and 3’ ends. When this reaction is performed on both ends of a double-stranded nucleic acid molecule (e.g., double-stranded library molecule) having a target enzyme recognition sequence appended at each end, the result is a circularized nucleic acid molecule. An adaptor carrying the enzyme recognition sequence can be appended to the double-stranded library molecules via ligation or PCR using tailed PCR primers. A number of enzymes or enzyme combinations are compatible with this reaction, including a protelomerase. One exemplary type of protelomerase is TelN protelomerase, such as that from E. coll phage Nl. The covalently closed circular library molecule can be subjected to a rolling circle amplification reaction. In some embodiments, the covalently closed circular library molecules generated with a protelomerase enzyme can be treated with any reagent that removes deaminated nucleotide bases as described herein.Generating Circularized Library Molecules with Nucleic Acid Splints

[0249] In some embodiments, linear library molecules can be generated using any of the adaptors and any of the adaptor-appending methods described herein. In some embodiments, the linear library molecules can be circularized using a single-stranded splint strand or double-stranded splint adaptor. For example, linear library molecules (100) can be hybridized to double-stranded splint adaptors (200) each having short and long splint strands. The long splint strands hold the linear library molecules in a circularized form, and the ends of the short splint strands are juxtapositions to the ends of the linear library molecules for ligation (e.g., FIG. 15). The linear library molecule can hybridize to the double-stranded splint to form a library splint complex (500) having two nicks (e.g., FIG. 15), where the two nicks can be enzymatically ligated to form a covalently closed circular molecule. In another example, linear library molecules (700) can be hybridized to single stranded splints (800) which can bring the ends of the linear molecules juxtapositioned to each other for ligation (e.g., FIG. 18). The linear library molecule can hybridize to the single-stranded splint to form a librarysplint complex (900) having one nick, where the one nick can be enzymatically ligated to form a covalently closed circular molecule. In some embodiments, the covalently closed circular library molecule generated with a double-stranded splint or a single-stranded splint can be treated with any reagent that removes deaminated nucleotide bases as described herein.Removing Deaminated Bases from Covalently Closed Circular Library Molecules

[0250] In some embodiments, a plurality of covalently closed circular library molecules can be generated using any of the methods described above. In some embodiments,individual covalently closed circular library molecules comprise a sequence of interest (insert region) operably linked on both sides by at least one nucleic acid adaptor sequence.

[0251] In some embodiments, the plurality of covalently closed circular library molecules comprises a mixture of first and second sub-populations of covalently closed circular library molecules. In some embodiments, individual covalently closed circular library molecules in the first sub-population carry at least one deaminated nucleotide base. In some embodiments, individual covalently closed circular library molecules in the second sub-population lack a deaminated nucleotide base.

[0252] In some embodiments, methods for preparing a plurality of library molecules having reduced deaminated nucleotide bases comprises contacting the plurality of covalently closed circular library molecules, with a reagent that removes deaminated bases thereby generating a plurality of library molecules wherein individual covalently closed circular library molecules comprise at least one abasic site. In some embodiments, the reagent that removes deaminated bases comprises at least one enzyme having glycosylase activity including any one or any combination of two or more of: formamidopyrimidine DNA glycosylase (fpg); uracil N-glycosylase (UNG); uracil DNA glycosylase (UDG); 8- oxoguanine glycosylase (OGG including thermostable OGG); DNA (apurinic) lyase; DNA (apyrimidinic) lyase; and / or endonuclease III. In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the glycosylase reaction.

[0253] In some embodiments, the reagent that removes deaminated bases from the plurality of covalently closed circular library molecules comprises at least one enzyme having lyase activity that can that breaks the phosphodiester backbone at the 5’ and 3’ sides of the abasic site to release the base-free deoxyribose and generate a gap, wherein the enzyme having lyase activity includes any one or any combination of two or more of: AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase (formamidopyrimidine DNA glycosylase), Endonuclease VIII glycosylase / AP lyase and / or endonuclease III. In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the lyase reaction.

[0254] In some embodiments, the reagent that removes deaminated bases from the plurality of covalently closed circular library molecules comprises at least one enzyme that generates an abasic site in a nucleic acid strand and at least one enzyme having lyase activity. In some embodiments, the reagent that removes deaminated bases comprises a mixture of uracil DNA glycosylase and DNA glycosylase-lyase endonuclease VIII, for example, USER(Uracil-Specific Excision Reagent Enzyme, such as from New England Biolabs) or thermolabile USER (for example, from New England Biolabs). In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the glycosylase and lyase reactions.Methods for Forming a Plurality of Circularized Library Molecules Using Double-Stranded Splint Adaptors

[0255] In some aspects, the present disclosure provides compositions and methods for improving sequencing quality scores comprising preparing a plurality of linear library molecules using any of the methods described herein and circularizing the linear library molecules. In some embodiments, a plurality of covalently closed circularized library molecules can be generated by hybridizing the plurality of linear library molecules with a plurality of double-stranded adaptors as described herein. Exemplary, non-limiting doublestranded splint adaptors, and methods related thereto, are described in WO 2023 / 168443, WO 2024 / 011145, WO 2024 / 059550, and PCT / US2024 / 39186, the contents of each of which is incorporated by reference herein in their entireties. In some embodiments, the covalently closed circular library molecules can be amplified by conducting rolling circle amplification. In some embodiments, the rolling circle amplification can be conducted on a support, or insolution and on a support.

[0256] In some embodiments, methods for generating a plurality of covalently closed circular library molecules comprise step (a): providing a plurality of double-stranded splint adaptors (200) wherein individual double-stranded splint adaptors (200) in the plurality comprise a first splint strand (300) hybridized to a second splint strand (400), wherein the double-stranded splint adaptor includes a double-stranded region and two flanking singlestranded regions, wherein the first splint strand comprises a first region (320), an internal region (310), and a second region (330), and wherein the internal region of the first splint strand (310) is hybridized to the second splint strand (400). In some embodiments, the 5’ end of the first splint strand (300) is phosphorylated or lacks a phosphate group. In some embodiments, the 3’ end of the first splint strand (300) includes a terminal 3’ OH group or a terminal 3’ blocking group. Exemplary double-stranded splint adaptors (200) are shown in FIGs. 15-17.

[0257] In some embodiments, methods for generating a plurality of covalently closed circular library molecules comprise step (b): hybridizing the plurality of double-stranded splint adaptors (200) with a plurality of single-stranded nucleic acid library molecules (100)to form a plurality of library-splint complexes (500). In some embodiments, individual single-stranded library molecules (100) comprise: (i) a universal adaptor sequence (120) having a binding sequence for a first surface primer (e.g., a P5 surface primer or a complementary sequence thereof); (ii) a left sample index sequence (160); (iii) a universal adaptor sequence (140) having a binding sequence for a first sequencing primer (e.g., a reverse sequencing primer); (iv) a sequence of interest (110); (v) a universal adaptor sequence (150) having a binding sequence for a second sequencing primer (e.g., a forward sequencing primer); (vi) a right sample index sequence (170); and (vii) a universal adaptor sequence (130) having a binding sequence for a second surface primer (e.g., a P7 surface primer or a complementary sequence thereof) (e.g., FIGs. 15-16). In some embodiments, any of the universal adaptor sequences including (120), (140), (150) or (130), can hybridize to a portion of a compaction oligonucleotide. In some embodiments, the single-stranded library molecule optionally comprises a unique identification sequence (180) comprising a sequence that is used to uniquely identify an individual sequence of interest (e.g., insert sequence) to which the unique identification sequence (180) is appended in a population of other sequence of interest molecules (e.g., molecular tagging). In some embodiments, the unique identification sequence (180) can be located on the left or right side of the insert region. In some embodiments, the unique identification sequence comprises 2-12 or more nucleotides having a known sequence. For example, the unique identification sequence comprises a known random sequence where a nucleotide at each position is randomly selected from nucleotides having a base A, G, C, T or U. The unique identification sequences (180) can be used for molecular tagging procedures.

[0258] In some embodiments, the hybridizing of step (b) is conducted under a condition suitable for hybridizing the first region of the first splint strand (320) to the universal adaptor sequence (120) having a binding sequence for a first surface primer of the library molecule, and the condition is suitable for hybridizing the second region of the first splint strand (330) to the universal adaptor sequence (130) having a binding sequence for a second surface primer of the library molecule, thereby circularizing the plurality of library molecules to form a plurality of library-splint complexes (500) having two nicks (e.g., FIG. 15). In some embodiments, the library-splint complex (500) comprises a first nick between the 5’ end of the library molecule and the 3’ end of the second splint strand (e.g., FIGs. 15-16). In some embodiments, the library-splint complex (500) also comprises a second nick between the 5’ end of the second splint strand and the 3’ end of the library molecule (e.g., FIGs. 15-16). In some embodiments, the first and second nicks are enzymatically ligatable.

[0259] In some embodiment, in step (b), the first region of the first splint strand (320) can hybridize to a sense or anti-sense strand of a double-stranded library molecule. In some embodiments, the second region of the first splint strand (330) can hybridize to a sense or anti-sense strand of a double-stranded library molecule. The double-stranded library molecule can be denatured to generate the single-stranded sense and anti-sense library strands. In some embodiments, a double-stranded library molecule can be denatured using heat or an alkaline reagent (e.g., NaOH or KOH) to generate the sense and anti-sense library strands.

[0260] In some embodiments, in step (b), the second splint strand (400) does not hybridize to the sequence of interest (110), and the internal region of the first splint strand (310) does not hybridize to the sequence of interest (110).

[0261] In some embodiments, in step (b), the first region of the first splint strand (320) does not hybridize to the sequence of interest (110), and the second region of the first splint strand (330) does not hybridize to the sequence of interest (110).

[0262] In some embodiments, in step (b), the 5’ end of the single-stranded library molecule (100) is phosphorylated or lacks a phosphate group. In some embodiments, the 3’ end of the single-stranded library molecule includes a terminal 3’ OH group or a terminal 3’ blocking group.

[0263] In some embodiments, in step (b), the sample index sequences (160) and (170) can be used to distinguish sequences of interest obtained from different sample sources in a multiplex workflow. In some embodiments, the left index sequence (160) can include a random sequence (e.g., NNN) or lack a random sequence. In some embodiments, the right index sequence (170) can include a random sequence (e.g., NNN) or lack a random sequence.

[0264] The left sample index sequence (160) can be 3-20 nucleotides in length. The right sample index sequence (170) can be 3-20 nucleotides in length. The sequences of the left and right sample index sequences (e.g., (160) and (170)) can be the same or different from each other.

[0265] Multiplex workflows are enabled by preparing sample-indexed libraries using one or both sample index sequences (e.g., left and / or right sample index sequences). The left index sequences (160) and / or right index sequences (170) can be employed to prepare separate sample-indexed libraries using input nucleic acids isolated from different sources. The sample-indexed libraries can be pooled together to generate a multiplex library mixture, and the pooled libraries can be amplified and / or sequenced. The sequences of the insert region along with the left index sequence (160) and / or right index sequence (170) can be used to identify the source of the input nucleic acids. In some embodiments, any number ofsample-indexed libraries can be pooled together, for example 2-10, or 10-50, or 50-100, or 100-200, or more than 200 sample-indexed libraries can be pooled. Exemplary nucleic acid sources include naturally-occurring, recombinant, or chemically-synthesized sources. Exemplary nucleic acid sources include single cells, a plurality of cells, tissue, biological fluid, environmental sample or whole organism. Exemplary nucleic acid sources include fresh, frozen, fresh-frozen or archived sources (e.g., formalin-fixed paraffin-embedded; FFPE). The skilled artisan will recognize that the nucleic acids can be isolated from many other sources. The nucleic acid library molecules can be prepared in single-stranded or double-stranded form.

[0266] In some embodiments, in step (b), the second splint strand (400) comprises at least two sub-regions, including a first and second sub-region (e.g., FIG. 15). The first sub-region comprises a universal binding sequence for a third surface primer, and the second sub-region comprises a universal binding sequence for a fourth surface primer, wherein the first and second sub-regions do not hybridize (or at least exhibit very little hybridization to) the first and second surface primers.

[0267] In some embodiments, in step (b), the second splint strand (400) carries new adaptor sequences and / or new index sequences to be introduced into the covalently closed circular library molecule. In some embodiments, the first and / or second sub-regions of the second splint strand (400) introduce universal sequences to permit individual covalently closed circular library molecules to hybridize to a third surface primer (c.g, a capture primer). In some embodiments, the first and / or second sub-regions of the second splint strand (400) introduce universal sequences to permit hybridization of at least a portion of a concatemer molecule to a fourth surface primer (e.g., a pinning primer). For example, the covalently closed circular library molecules can be distributed onto a support which lacks immobilized first and second capture primers, but the support comprises a plurality of immobilized third capture primers and optionally a plurality of immobilized pinning primers.

[0268] In some embodiments, in step (b), the second splint strand (400) further comprises an optional third sub-region which includes a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., UMI) having 2-10 or more bases (e.g., NN) (e.g., FIG. 15). In some embodiments, the second splint strand (400) comprises only a first sub-region and lacks a second and a third sub-region, where the first sub-region comprises a sample index sequence having 5-20 bases. In some embodiments, the sample index sequence can be used to distinguish sequences of interest obtained from different sample sources in a multiplex assay. In some embodiments, the unique identification sequence comprises arandom sequence. The unique identification sequence can be designed to exhibit reduced or no hybridization to the first, second, third and fourth surface primers. An exemplary arrangement of the sub-regions in the second splint strand (400), in a 5’ to 3’ orientation comprises: 5’- [second sub-region] - [first sub-region] - 3’. Another exemplary arrangement of the sub-regions in the second splint strand (400), in a 5’ to 3’ orientation comprises: 5’- [third sub-region] - [second sub-region] - [first sub-region] - 3’. In some embodiments, the second splint strand (400) can be 20-100 nucleotides in length, or 30-80 nucleotides in length, or 40-60 nucleotides in length. In some embodiments, the second splint strands (400) comprise one or more phosphorothioate linkage at the 5’ and / or 3’ ends to confer exonuclease resistance. In some embodiments, the second splint strands (400) comprise one or more phosphorothioate linkage at an internal position to confer endonuclease resistance. In some embodiments, the second splint strands (400) comprise one or more 2’-O-methylcytosine bases at the 5’ and / or 3’ end, or at an internal position. In some embodiments, the 5’ end of the second splint strand (400) is phosphorylated or non-phosphorylated. In some embodiments, the 3’ end of the second splint strand (400) comprises a terminal 3’ OH group or a terminal 3’ blocking group.

[0269] In some embodiments, in step (b), the first splint strand (300) includes an internal region (310) which comprises at least two sub-regions, including a fourth and fifth sub-region (e.g., FIG. 15). The fourth sub-region hybridizes to the first sub-region of the second splint strand (400). The fifth sub-region hybridizes to the second sub-region of the second splint strand (400). The fourth and fifth sub-regions do not hybridize (or at least exhibit very little hybridization to) the first and second surface primers. In some embodiments, the internal region (310) of the first splint strand further comprises an optional sixth sub-region which hybridizes to the third sub-region of the second splint strand (400) (e.g., FIG. 15). An exemplary arrangement of the sub-regions of the first splint strand (300), in a 5’ to 3’ orientation comprises: 5’ - [fourth sub-region] - [fifth sub-region] - 3’. Another exemplary arrangement of the sub-regions of the first splint strand (300), in a 5’ to 3 ’orientation comprises: 5’ - [fourth sub-region] - [fifth sub-region] - [sixth sub-region] - 3’. In some embodiments, the first splint strand (300) can be 50-150 nucleotides in length, or 60-100 nucleotides in length, or 70-90 nucleotides in length. In some embodiments, the first splint strands (300) comprise one or more phosphorothioate linkage at the 5’ and / or 3’ ends to confer exonuclease resistance. In some embodiments, the first splint strands (300) comprise one or more phosphorothioate linkage at an internal position to confer endonucleaseresistance. In some embodiments, the first splint strands (300) comprise one or more 2’-O- methylcytosine bases at the 5’ and / or 3’ end, or at an internal position.

[0270] In some embodiments, the plurality of library-splint complexes (500) formed in step (b) can be subjected to at least one enzymatic reaction, including a phosphorylation reaction, ligation reaction and / or exonuclease reaction. The enzymatic reactions can be conducted sequentially or essentially simultaneously. The enzymatic reactions can be conducted in a single reaction vessel. Alternatively, a first enzymatic reaction can be conducted in a first reaction vessel, then transferred to a second reaction vessel where the second enzymatic reaction is conducted, then transferred to a third reaction vessel where the third enzymatic reaction is conducted.

[0271] In some embodiments, methods for generating a plurality of covalently closed circular library molecules further comprise conducting separate and sequential phosphorylation and ligation reactions which are conducted in separate reaction vessels. In some embodiments, the methods for generating a plurality of covalently closed circular library molecules further comprise step (cl): contacting in a first reaction vessel the plurality of the double-stranded splint adaptors (200) and the plurality of the single-stranded nucleic acid library molecules (100) with a T4 polynucleotide kinase enzyme under a condition suitable to phosphorylate the 5’ ends of the plurality of double-stranded splint adaptors (200) and / or the plurality of single-stranded nucleic acid library molecules (100); and transferring the phosphorylation reaction to a second reaction vessel. In some embodiments, the methods for forming a plurality of library-splint complexes (500) further comprise step (dl): contacting in the second reaction vessel the plurality of phosphorylated double-stranded splint adaptors (200) and the plurality of phosphorylated single-stranded nucleic acid library molecules (100) with a ligase, under a condition suitable to enzymatically ligate the first and second nicks, thereby generating a plurality of covalently closed circular library molecules (600) each hybridized to the first splint strand (300). In some embodiments, the ligase enzyme comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0272] In some embodiments, methods for generating a plurality of covalently closed circular library molecules further comprise conducting sequential phosphorylation and ligation reactions which are conducted sequentially in the same reaction vessel. In some embodiments, the methods for generating a plurality of covalently closed circular library molecules further comprise step (c2): contacting in a first reaction vessel the plurality of the double-stranded splint adaptors (200) and the plurality of the single-stranded nucleic acid library molecules (100) with a T4 polynucleotide kinase enzyme under a condition suitable tophosphorylate the 5’ ends of the plurality of double-stranded splint adaptors (200) and the plurality of single-stranded nucleic acid library molecules (100). In some embodiments, the methods for forming a plurality of library-splint complexes (500) further comprise step (d2): contacting in the same first reaction vessel the phosphorylated double-stranded splint adaptors (200) and the phosphorylated single- stranded nucleic acid library molecules (100) with a ligase under a condition suitable to enzymatically ligate the first and second nicks, thereby generating a plurality of covalently closed circular library molecules (600) each hybridized to the first splint strand (300). In some embodiments, the ligase enzyme comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0273] In some embodiments, methods for generating a plurality of covalently closed circular library molecules further comprise conducting essentially simultaneous phosphorylation and ligation reactions which are conducted together in the same reaction vessel. In some embodiments, the methods for generating a plurality of covalently closed circular library molecules further comprise step (c3): contacting in a first reaction vessel the plurality of the double-stranded splint adaptors (200) and the plurality of the single-stranded nucleic acid library molecules (100) with a (i) T4 polynucleotide kinase enzyme and (ii) a ligase enzyme, under a condition suitable to phosphorylate the 5’ ends of the plurality of double-stranded splint adaptors (200) and the plurality of single- stranded nucleic acid library molecules (100), and the conditions are suitable to enzymatically ligate the first and second nicks, thereby generating a plurality of covalently closed circular library molecules (600) each hybridized to the first splint strand (300). In some embodiments, the ligase enzyme comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0274] In some embodiments, in any of steps (cl)(dl), (c2)(d2) or (c3), completion of the phosphorylation and ligation reaction generates a plurality of covalently closed circular library molecules (600) (e.g., FIG. 16). In some embodiments, the ligase enzyme can be deactivated after completion of the ligase reaction using heat or an alkaline reagent. In some embodiments, the ligase deactivation comprises contacting the ligase enzyme with an alkaline reagent. In some embodiments, the alkaline reagent comprises NaOH and / or KOH. In some embodiments, the ligase enzyme is not deactivated with heat. In some embodiments, the plurality of covalently closed circular library molecules (600) is retained. In some embodiments, deactivating the ligase enzyme with the alkaline reagent can reduce the formation of deaminated nucleotide bases in the plurality of covalently closed circular library molecule (600) compared to covalently closed circular library molecules that are subjected to ligase heat deactivation.

[0275] In some embodiments, methods for generating a plurality of covalently closed circular library molecules further comprise optional step (e): enzymatically removing the plurality of first splint strands (300) from the plurality of covalently closed circular library molecules (600). In some embodiments, optional step (e): contacting the plurality of covalently closed circular library molecules (600) and the plurality of first splint strands with at least one exonuclease enzyme to remove / degrade the plurality of first splint strands (300) and retaining the plurality of covalently closed circular library molecules (600). In some embodiments, the exonuclease reaction can be conducted in the same reaction buffer used to conduct the phosphorylation and / or ligation reactions, or in a different reaction buffer. In some embodiments, the exonuclease reaction can be conducted in a third reaction vessel after conducting the phosphorylation reaction in the first reaction vessel (cl), and conducting the ligation reaction in the second reaction vessel (dl). In some embodiments, the exonuclease reaction can be conducted in the first reaction vessel after conducting the phosphorylation reaction in the first reaction vessel (c2), and conducting the sequential ligation reaction in the first reaction vessel (d2). In some embodiments, the exonuclease reaction can be conducted in the first reaction vessel after conducting the essentially simultaneous phosphorylation and ligation reactions in the first reaction vessel (c3). In some embodiments, the at least one exonuclease enzyme comprises any combination of two or more of exonuclease I, thermolabile exonuclease I and / or T7 exonuclease.

[0276] In some embodiments, after step (e), completion of the exonuclease reaction generates individual covalently closed circular library molecules (600) and degraded first splint strands (300). In some embodiments, after completion of the exonuclease reaction the exonuclease enzyme can be deactivated using heat or an alkaline reagent. In some embodiments, the exonuclease deactivation comprises contacting the exonuclease enzyme with an alkaline reagent. In some embodiments, the alkaline reagent comprises NaOH and / or KOH. In some embodiments, the exonuclease enzyme is not deactivated with heat. In some embodiments, the plurality of covalently closed circular library molecules (600) is retained. In some embodiments, deactivating the exonuclease enzyme with the alkaline reagent can reduce the formation of deaminated nucleotide bases in the plurality of covalently closed circular library molecule (600) compared to covalently closed circular library molecules that are subjected to exonuclease heat deactivation.

[0277] In some embodiments, any of steps (a) - (e) of the methods for generating a plurality of covalently closed circular library molecules (600) can include applying a deamination reagent and / or an alkaline reagent to any of the linear library molecules and / orany of the circularized library molecules thereby generating a plurality of covalently closed circular library molecules having reduced C:G to T:A base transitions which can generate higher quality base calls during downstream sequencing workflows. In some embodiments, applying a deamination reagent and / or an alkaline reagent can increase sequencing quality scores from Q30 to Q40, Q45, Q50, Q55, Q60 or higher sequencing quality scores.

[0278] In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q40 of about 80-90%, or about 90-95%, or about 95-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q45 of about 75-85%, or about 85-90%, or about 90-95%, or about 95-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q50 of about 65-75%, or about 75-85%, or about 85-95%, or about 95-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q55 of about 60-70%, or about 70-80%, or about 80-85%, or about 85-90%, or about 90-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q60 of about 60-70%, or about 70-80%, or about 80-85%, or about 85-90%, or about 90-100%. For example, see FIGs. 65, 66, 67A-67D, 68A-68D, 69 and 70, and see Tables A and B at FIG. 73.

[0279] In some embodiments, in any of the methods for generating a plurality of covalently closed circular library molecules described herein, the first sub-region of the second splint strand (400) comprises the sequence 5’- CATGTAATGCACGTACTTTCAGGGT-3’ (SEQ ID NO: 30) (or a complementary sequence thereof). In some embodiments, the second sub-region of the second splint strand (400) comprises the sequence 5’-AGTCGTCGCAGCCTCACCTGATC-3’ (SEQ ID NO: 31) (or a complementary sequence thereof). In some embodiments, the second splint strand (400) comprises a first and second sub-region comprising the sequence 5’- AGTCGTCGCAGCCTCACCTGATCCATGTAATGCACGTACTTTCAGGGT-3’ (SEQ ID NO: 32) (or a complementary sequence thereof). See FIG. 17. In some embodiments, the 5’ end of the second splint strand (400) can be phosphorylated or non-phosphorylated.

[0280] In some embodiments, in any of the methods for generating a plurality of covalently closed circular library molecules described herein, the first region of the first splint strand (320) includes a first universal adaptor sequence which comprises a universal bindingsequence (or a complementary sequence thereof) for a first surface primer, where the first region (320) comprises the sequence 5’-TCGGTGGTCGCCGTATCATT-3’ (SEQ ID NO: 33) (or a complementary sequence thereof). For example, the first region of the first splint strand (320) can hybridize to a P5 surface primer or a complementary sequence of the P5 surface primer. For example, the P5 surface primer comprises the sequence 5’- AATGATACGGCGACCACCGA-3’ (SEQ ID NO: 34; short P5) (or a complementary sequence thereof), or the P5 surface primer comprises the sequence 5’- AATGATACGGCGACCACCGAGATC-3’ (SEQ ID NO: 35; long P5) (or a complementary sequence thereof). In some embodiments, the second region of the first splint strand (330) includes a second universal adaptor sequence which comprises a universal binding sequence for a second surface primer, where the second region (330) comprises the sequence 5’- CAAGCAGAAGACGGCATACGA-3’ (SEQ ID NO: 36) (or a complementary sequence thereof). For example, the second region of the first splint strand (330) can hybridize to a P7 surface primer or a complementary sequence of the P7 surface primer. For example, the P7 surface primer comprises the sequence 5’- CAAGCAGAAGACGGCATACGA-3’ (SEQ ID NO: 36; short P7) (or a complementary sequence thereof), or the P7 surface primer comprises the sequence 5’ - CAAGCAGAAGACGGCATACGAGAT-3’ (SEQ ID NO: 37; long P7) (or a complementary sequence thereof). In some embodiments, the first splint strand (300) includes an internal region (310) which comprises a fourth sub-region having the sequence 5’-ACCCTGAAAGTACGTGCATTACATG-3’ (SEQ ID NO: 38) (or a complementary sequence thereof). In some embodiments, the first splint strand (300) includes an internal region (310) which comprises a fifth sub-region having the sequence 5’-GATCAGGTGAGGCTGCGACGACT-3’ (SEQ ID NO: 39) (or a complementary sequence thereof). In some embodiments, the first splint strand (300) comprises a first region (320), an internal region (310) having a fourth and fifth sub-region, and a second region (330), having the sequence 5’- TCGGTGGTCGCCGTATCATTACCCTGAAAGTACGTGCATTACATGGATCAGGTGAGGCTGCGACGACTCAAGCAGAAGACGGCATACGA-3’ (SEQ ID NO: 40) (or a complementary sequence thereof). See FIG. 17. In some embodiments, the 5’ end of the first splint strand (300) can be phosphorylated or nonphosphorylated. In some embodiments, the first sub-region of the second splint strand (400) can hybridize to the fourth sub-region of the first splint strand (300). In some embodiments, the second sub-region of the second splint strand (400) can hybridize to the fifth sub-region of the first splint strand (300).

[0281] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the first region of the first splint strand (320) comprises a sequence that can bind a universal adaptor sequence (120) of a library molecule, where the first region of the first splint strand (320) comprises the sequence 5’- ACCCTGAAAGTACGTGCATTACATG -3’ (SEQ ID NO: 38) (or a complementary sequence thereof).

[0282] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the second region of the first splint strand (330) comprises a sequence that can bind a universal adaptor sequence (130) of a library molecule, where the second region of the first splint strand (330) comprises the sequence 5’ - GATCAGGTGAGGCTGCGACGACT -3’ (SEQ ID NO: 39) (or a complementary sequence thereof).

[0283] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence (120) which binds the first region of the first splint strand (320), where the universal binding sequence (120) comprises the sequence 5’- AATGATACGGCGACCACCGA-3’ (SEQ ID NO: 34) (or a complementary sequence thereof).

[0284] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence (120) which binds the first region of the first splint strand (320), where the left universal binding sequence (120) comprises the sequence 5’- CATGTAATGCACGTACTTTCAGGGT -3’ (SEQ ID NO: 30) (or a complementary sequence thereof).

[0285] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence (120) which binds the first region of the first splint strand (320), where the left universal binding sequence (120) comprises the sequence 5’- GAACGACATGGCTACGATCC -3’ (SEQ ID NO: 41) (or a complementary sequence thereof).

[0286] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence (120) which binds the first region of the first splint strand (320), where the left universal binding sequence (120) comprises the sequence 5’-CTCTCAGTACGTCAGCAGTT -3’ (SEQ ID NO: 42) (or a complementary sequence thereof).

[0287] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence for a sequencing primer (140) where the left universal binding sequence comprises the sequence5’- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3’ (SEQ ID NO: 43) (or a complementary sequence thereof).

[0288] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence for a sequencing primer (140) where the left universal binding sequence comprises the sequence5’ - TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3’ (SEQ ID NO: 44) (or a complementary sequence thereof).

[0289] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence for a sequencing primer (140) where the left universal binding sequence comprises the sequence5’ - CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT -3’ (SEQ ID NO: 45) (or a complementary sequence thereof).

[0290] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence for a sequencing primer (140) where the left universal binding sequence comprises the sequence5’ - GAACGACATGGCTACGATCCGACTT -3’ (SEQ ID NO: 46) (or a complementary sequence thereof).

[0291] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence for a sequencing primer (140) where the left universal binding sequence comprises the sequence5’- GCTCACAGAACGACATGGCTACGATCCGACTT -3’ (SEQ ID NO: 47) (or a complementary sequence thereof).

[0292] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal bindingsequence for a sequencing primer (150) where the left universal binding sequence comprises the sequence5’- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3’ (SEQ ID NO: 48) (or a complementary sequence thereof).

[0293] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence for a sequencing primer (150) where the left universal binding sequence comprises the sequence 5’- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3’ (SEQ ID NO: 49) (or a complementary sequence thereof).

[0294] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence for a sequencing primer (150) where the left universal binding sequence comprises the sequence5’- ATGTCGGAAGGTGTGCAGGCTACCGCTTGTCAACT -3’ (SEQ ID NO: 50) (or a complementary sequence thereof).

[0295] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence for a sequencing primer (150) where the left universal binding sequence comprises the sequence5’- TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT -3’ (SEQ ID NO: 51) (or a complementary sequence thereof).

[0296] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence (130) which binds the first region of the first splint strand (330), where the right universal binding sequence (130) comprises the sequence 5’- TCGTATGCCGTCTTCTGCTTG -3’ (SEQ ID NO: 52) (or a complementary sequence thereof).

[0297] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence (130) which binds the first region of the first splint strand (330), where the right universal binding sequence (130) comprises the sequence 5’- AGTCGTCGCAGCCTCACCTGATC -3’ (SEQ ID NO: 31) (or a complementary sequence thereof).

[0298] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence (130) which binds the first region of the first splint strand (330), where the right universal binding sequence (130) comprises the sequence 5’- GTTGAGGAACCGAGTGT - 3’ (SEQ ID NO: 53) (or a complementary sequence thereof).

[0299] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence (130) which binds the first region of the first splint strand (330), where the right universal binding sequence (130) comprises the sequence 5’- GACTATTCCAGCGGTACG - 3’ (SEQ ID NO: 54 (or a complementary sequence thereof).

[0300] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (500) described herein, the library molecule includes a universal binding sequence (130) which binds the first region of the first splint strand (330), where the right universal binding sequence (130) comprises the sequence 5’- CTGATAAGGTCGCCATGC - 3’ (SEQ ID NO: 55) (or a complementary sequence thereof).Methods for Rolling Circle AmplificationUsing Circularized Library Molecules Generated via ds-Splint Adaptors

[0301] In some aspects, the present disclosure provides methods for improving sequencing quality scores comprising conducting rolling circle amplification reaction on the covalently closed circular library molecules (600) to generate a plurality of immobilized concatemer molecules. The rolling circle amplification reaction can be conducted after the phosphorylation and ligation reactions, or after the ligation reaction. In some embodiments, the rolling circle amplification reaction can be conducted on covalently closed circular library molecules (600) that are no longer hybridized to the first splint strands (300) following the exonuclease reaction. In some embodiments, the rolling circle amplification reaction can be conducted on covalently closed circular library molecules (600) that are hybridized to the first splint strands (300). In some embodiments, the covalently closed circular library molecules (600) can be distributed onto a support and then be subjected to rolling circle amplification reaction. In some embodiments, the covalently closed circular library molecules (600) can be subjected to rolling circle amplification reaction in-solution and then distributed onto a support. In some embodiments, the rolling circle amplification reactions can employ the retained first splint strand (300) as an amplification primer, or the first splint strand (300)can be removed (e.g., via exonuclease digestion) and replaced with a soluble amplification primer.On-Support Rolling Circle AmplificationUsing Circularized Library Molecules Generated via ds-Splint Adaptors

[0302] In some embodiments, the methods for conducting rolling circle amplification reaction on a plurality of covalently closed circular library molecules (600) which lack hybridized first splint strands (300), wherein individual covalently closed circular library molecules (600) in the plurality comprise a second splint strand region (400) which includes a universal binding sequence for a third surface primer (e.g., an immobilized capture primer), the method comprises step (a): distributing the plurality of covalently closed circular library molecules (600) onto a support having a plurality of the third surface primers immobilized on the support, under a condition suitable for hybridizing individual covalently closed circular library molecules (600) to individual immobilized third surface primers thereby immobilizing the plurality of covalently closed circular library molecules (600). In some embodiments, the support further comprises a plurality of fourth surface primers (e.g., a plurality of immobilized pinning primers). In some embodiments, distributing the plurality of covalently closed circular library molecules (600) onto a support immobilizes the plurality of covalently closed circular library molecules (600) on the support.

[0303] In some embodiments, in step (a), the immobilized third surface primers comprise single stranded oligonucleotides comprising DNA, RNA or a combination of DNA and RNA. The third surface primers comprise a sequence that is wholly complementary or partially complementary along their lengths to at least a portion of a nucleic acid library molecule (e.g., linear or circular library molecules). The third surface primers can include a terminal 3’ nucleotide having a sugar 3’ OH moiety which is extendible for nucleotide polymerization (e.g., polymerase-catalyzed polymerization).

[0304] In some embodiments, in step (a), the immobilized third surface primers can be immobilized to the support or immobilized to a coating on the support. In some embodiments, the coating comprises a hydrophilic polymer coating. The immobilized third surface primers can be embedded and attached (e.g., coupled) to the coating on the support. In some embodiments, the 5’ end of the immobilized third surface primers can be immobilized to a support or immobilized to a coating on the support. Alternatively, an interior portion or the 3’ end of the immobilized third surface primers can be immobilized toa support or immobilized to a coating on the support. The support comprises a plurality of immobilized third surface primers having the same sequence. The immobilized third surface primers can be any length, for example 4-50 nucleotides, or 50-100 nucleotides, or 100-150 nucleotides, or longer lengths.

[0305] In some embodiments, in step (a), the purpose of individual third surface primers is to hybridize to a portion of a covalently closed circular library molecule thereby immobilizing the library molecule to the support or to the coating on the support. In some embodiments, individual third surface primers can hybridize to a universal binding sequence for a third surface primer in a covalently closed circular library molecule. In some embodiments, the plurality of immobilized third surface primers serve as a plurality of immobilized capture primers. In some embodiments, the terminal 3’ end of a third surface primer can initiate a rolling circle amplification reaction to generate a concatemer molecule immobilized to the support (e.g., FIGs. 33 and 34).

[0306] In some embodiments, in step (a), the plurality of immobilized third surface primers comprise at least one phosphorothioate diester bond at their 5’ ends which can render the third surface primers resistant to exonuclease degradation. In some embodiments, the plurality of immobilized third surface primers comprise 2-5 or more consecutive phosphorothioate diester bonds at their 5’ ends. In some embodiments, the plurality of immobilized third surface primers comprise at least one ribonucleotide and / or at least one 2’- O-methyl or 2’-O-methoxyethyl (MOE) nucleotide which can render the third surface primers resistant to exonuclease degradation.

[0307] In some embodiments, in step (a), the immobilized third surface primers comprise at least one locked nucleic acid (LNA) which comprises a methylene bridge bond between a 2’ oxygen and 4’ carbon of the pentose ring. Immobilized third surface primers that include at least one LNA can be resistant to nuclease digestions and can exhibit increased melting temperature when hybridized to the forward extension strand.

[0308] In some embodiments, in step (a), the immobilized third surface primers comprise at least one spacer arm at the 5’ end. In some embodiments, the 5’ end of individual immobilized third surface primers comprise 1-10 consecutive spacer arms. In some embodiments, the spacer arm comprises a hexaethylene glycol phosphoramidite. For example, the spacer arm comprises an 18-atom hexaethylene glycol spacer.

[0309] In some embodiments, in step (a), the support further comprises a plurality of a fourth surface primer immobilized thereon. In some embodiments, the sequences of the third and fourth surface primers are different. In some embodiments, the fourth primers comprisesingle stranded oligonucleotides comprising DNA, RNA or a combination of DNA and RNA. In some embodiments, the fourth surface primers comprise a sequence that is wholly complementary or partially complementary along their lengths to at least a portion of concatemer template molecule (e.g., FIG. 46). In some embodiments, the plurality of fourth surface primers can be immobilized to the support or immobilized to a coating on the support. In some embodiments, the immobilized fourth surface primers can be embedded and attached (coupled) to the coating on the support. In some embodiments, the 5’ end of the fourth surface primers can be immobilized to a support or immobilized to a coating on the support. Alternatively, an interior portion or the 3’ end of the fourth surface primers can be immobilized to a support or immobilized to a coating on the support. In some embodiments, the support comprises a plurality of immobilized fourth surface primers having the same sequence. The immobilized fourth surface primers can be any length, for example 4-50 nucleotides, or 50-100 nucleotides, or 100-150 nucleotides, or longer lengths.

[0310] In some embodiments, in step (a), the purpose of individual fourth surface primers is to hybridize to a portion of a nucleic acid concatemer molecule thereby pinning down a portion of the concatemer molecule to the support or to the coating on the support (e.g., FIG. 46). In some embodiments, individual fourth surface primers can hybridize to a universal binding sequence for a fourth surface primer in a concatemer molecule. In some embodiments, the plurality of immobilized fourth surface primers serve as a plurality of immobilized pinning primers. In some embodiments, the terminal 3’ end of a fourth surface primer comprises a blocking moiety that renders the fourth surface primer non-extendible. Thus, a fourth surface primers cannot initiate a primer extension reaction. In some embodiments, an immobilized third surface primer can hybridize / capture a covalently closed circular library molecule and initiate a rolling circle amplification reaction to generate an immobilized concatemer molecule, and an immobilized fourth surface primer can hybridize to a portion of the immobilized concatemer molecule to pin down a portion of the concatemer molecule (e.g., FIG. 46).

[0311] In some embodiments, in step (a), the 3’ terminal end of the immobilized fourth surface primers comprise an extendible 3’ OH moiety. In some embodiments, the 3’ terminal end of the immobilized fourth surface primers comprise a 3’ non-extendible moiety. The 3’ terminal end of the immobilized fourth surface primers comprise a moiety that blocks primer extension, such as for example a phosphate group, a dideoxycytidine group, an inverted dT, or an amino group. The immobilized fourth surface primers are not extendible in a primer extension reaction. The immobilized fourth surface primers lack a nucleotide having ascissile moiety. For example, the fourth surface primers lack uridine, 8-oxo-7,8- dihydroguanine (e.g., 8oxoG) and deoxyinosine.

[0312] In some embodiments, in step (a), the plurality of immobilized fourth surface primers comprise at least one phosphorothioate diester bond at their 5’ ends which can render the fourth surface primers resistant to exonuclease degradation. In some embodiments, the plurality of immobilized fourth surface primers comprise 2-5 or more consecutive phosphorothioate diester bonds at their 5’ ends. In some embodiments, the plurality of immobilized fourth surface primers comprise at least one ribonucleotide and / or at least one 2’-O-methyl or 2’ -O-m ethoxy ethyl (MOE) nucleotide which can render the fourth surface primers resistant to exonuclease degradation.

[0313] In some embodiments, in step (a), the immobilized fourth surface primers comprise at least one locked nucleic acid (LNA) which comprises a methylene bridge bond between a 2’ oxygen and 4’ carbon of the pentose ring. Immobilized fourth surface that include at least one LNA can be resistant to nuclease digestions and can exhibit increased melting temperature when hybridized to a portion of a concatemer molecule.

[0314] In some embodiments, in step (a), the immobilized fourth surface primers comprise at least one spacer arm at the 5’ end. In some embodiments, the 5’ end of individual immobilized fourth surface comprise 1-10 consecutive spacer arms. In some embodiments, the spacer arm comprises a hexaethylene glycol phosphoramidite. For example, the spacer arm comprises an 18-atom hexaethylene glycol spacer.

[0315] In some embodiments, the support comprises about 102- 1015immobilized surface capture primers per mm2. In some embodiments, the support comprises about 102- 1015immobilized surface pinning primers per mm2. In some embodiments, the support comprises about 102- 1015immobilized surface capture primers and immobilized surface pinning primers per mm2. In some embodiments, the immobilized surface capture primers and immobilized surface pinning primers are in fluid communication with each other to permit flowing various solutions of linear or circular nucleic acid template molecules, soluble primers, enzymes, nucleotides, divalent cations, buffers, reagents, and the like, onto the support so that the plurality of immobilized surface capture primers and immobilized surface pinning primers can react with the solutions in a massively parallel manner.

[0316] In some embodiments, the methods for conducting rolling circle amplification reaction comprise step (b): contacting the plurality of covalently closed circular library molecules which are immobilized on the support with reagent that removes deaminated bases. In some embodiments, the plurality of covalently closed circular library molecules(600) comprises a mixture of first and second sub-populations of covalently closed circular library molecules. In some embodiments, individual covalently closed circular library molecules in the first sub-population carry at least one deaminated nucleotide base. In some embodiments, individual covalently closed circular library molecules in the second subpopulation lack a deaminated nucleotide base.

[0317] In some embodiments, the contacting of step (b) comprises contacting the plurality of covalently closed circular library molecules (e.g., first and second subpopulations) which are immobilized on the support with a reagent that removes deaminated bases thereby generating a plurality of immobilized covalently closed circular library molecules wherein a sub-population of covalently closed circular library molecules comprise at least one abasic site. In some embodiments, the reagent that removes deaminated bases comprises at least one enzyme having glycosylase activity including any one or any combination of two or more of: formamidopyrimidine DNA glycosylase (fpg); uracil N- glycosylase (UNG); uracil DNA glycosylase (UDG); DNA (apurinic) lyase; DNA (apyrimidinic) lyase; and / or endonuclease III.

[0318] In some embodiments, in step (b), the reagent that removes deaminated bases comprises at least one enzyme having lyase activity that can that breaks the phosphodiester backbone at the 5’ and 3’ sides of the abasic site to release the base-free deoxyribose and generate a gap, wherein the enzyme having lyase activity includes any one or any combination of two or more of: AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase (formamidopyrimidine DNA glycosylase), Endonuclease VIII glycosylase / AP lyase and / or endonuclease III.

[0319] In some embodiments, in step (b), the reagent that removes deaminated bases comprises at least one enzyme that generates an abasic site in a nucleic acid strand and at least one enzyme having lyase activity. In some embodiments, the reagent that removes deaminated bases comprises a mixture of uracil DNA glycosylase and DNA glycosylase- lyase endonuclease VIII, for example USER (Uracil-Specific Excision Reagent Enzyme, such as from New England Biolabs) or thermolabile USER (for example, from New England Biolabs).

[0320] In some embodiments, in step (b), the reagent that removes deaminated bases can be washed away or deactivated after completion of the glycosylase reaction. In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the lyase reaction. In some embodiments, the reagent that removesdeaminated bases can be washed away or deactivated after completion of the glycosylase and lyase reactions.

[0321] In some embodiments, the methods for conducting rolling circle amplification reaction further comprises step (c): contacting the plurality of covalently closed circular library molecules (600) with a plurality of strand-displacing polymerases and a plurality of nucleotides (e.g., comprising bases A, G, C, T and / or U), under a condition suitable to conduct a rolling circle amplification reaction on the support using the plurality of third surface primers as immobilized amplification primers and the plurality of covalently closed circular library molecules (600) as template molecules, thereby generating a plurality of nucleic acid concatemer template molecules immobilized to the third surface primers. In some embodiments, the plurality of nucleotides comprises any combination of two or more of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the rolling circle amplification generates a plurality of concatemer molecules wherein individual nucleic acid concatemer template molecules comprise multiple tandem repeat polynucleotide units wherein each polynucleotide unit comprises a sequence-of-interest, a binding site for a third surface primer and a binding site for a fourth surface primer. In some embodiments, individual nucleic acid concatemer template molecules are covalently joined to individual third surface primers (e.g., immobilized nucleic acid concatemer template molecules). In some embodiments, individual covalently closed circular library molecules (600) in the plurality comprise a second splint strand region (400) which also include a universal binding sequence for a fourth surface primer so that the rolling circle amplification reaction generates concatemer molecules having multiple copies of universal binding sequences for third and fourth surface primers. In some embodiments, the method comprises distributing the covalently closed circular library molecules (600) onto a support comprising a plurality of immobilized third and fourth surface primers, conducting a rolling circle amplification reaction to generate concatemer molecules under a condition suitable for hybridizing at least a portion of the second splint strand region (400) of the concatemer molecules to immobilized fourth surface primers thereby pinning down at least one portion of the concatemer molecules to the support. In some embodiments, the immobilized concatemers can be subjected to sequencing reactions.

[0322] In some embodiments, the rolling circle amplification reaction of step (c) can be conducted with a nucleotide mixture containing dATP, dCTP, dGTP, dTTP and a nucleotide having a scissile moiety to generate immobilized concatemer template molecules which includes at least one nucleotide having a scissile moiety. The scissile moieties in theimmobilized concatemer template molecules can be converted into abasic sites. In some embodiments, in the nucleotide mixture, the nucleotide having the scissile moiety comprises uridine, 8-oxo-7,8-dihydroguanine (e.g., 8oxoG) or deoxyinosine. In the immobilized concatemer template molecules, the uridine can be converted to an abasic site using uracil DNA glycosylase (UDG), the 8oxoG can be converted to an abasic site using FPG glycosylase, and the deoxyinosine can be converted to an abasic site using AlkA glycosylase.

[0323] In some embodiments, the nucleotide mixture can include an amount of dUTP so that a target percent of the thymidine in the resulting concatemer molecules are replaced with dUTP. For example, when 30% of dTTP in the concatemer molecules are to be replaced with dUTP (e.g., 30% is the target percent) then the nucleotide mixture can contain 7.5% dUTP (e.g., 30 / 4 = 7.5%), 17.5% dTTP, and 25% each for dATP, dCTP and dGTP. The target percent of dTTP to be replaced by dUTP can be about 0.1-1%, or about 1-5%, or about 5- 10%, or about 10-20%, or about 20-30% , or about 30-45%, or about 45-50%, or a higher percent of the dTTP in the immobilized concatemer template molecules are replaced with nucleotides having a scissile moiety.

[0324] In some embodiments, the nucleotide mixture can include an amount of deoxyinosine so that a target percent of the guanosine in the resulting concatemer molecules are replaced with deoxyinosine. For example, when 30% of dGTP in the concatemer molecules are to be replaced with deoxyinosine (e.g, 30% is the target percent) then the nucleotide mixture can contain 7.5% deoxyinosine (e.g, 30 / 4 = 7.5%), 17.5% dGTP, and 25% each for dATP, dCTP and dTTP. The target percent of dGTP to be replaced by deoxyinosine can be about 0.1-1%, or about 1-5%, or about 5-10%, or about 10-20%, or about 20-30% , or about 30-45%, or about 45-50%, or a higher percent of the dGTP in the immobilized concatemer template molecules are replaced with nucleotides having a scissile moiety.

[0325] In some embodiments, the nucleotide mixture can include an amount of 8oxoG so that a target percent of the guanosine in the resulting concatemer molecules are replaced with 8oxoG. For example, when 30% of dGTP in the concatemer molecules are to be replaced with 8oxoG (e.g., 30% is the target percent) then the nucleotide mixture can contain 7.5% 8oxoG (e.g., 30 / 4 = 7.5%), 17.5% dGTP, and 25% each for dATP, dCTP and dTTP. The target percent of dGTP to be replaced by 8oxoG can be about 0.1-1%, or about 1-5%, or about 5-10%, or about 10-20%, or about 20-30% , or about 30-45%, or about 45-50%, or a higher percent of the dGTP in the immobilized concatemer template molecules are replaced with nucleotides having a scissile moiety.

[0326] In some embodiments, the rolling circle amplification reaction generates immobilized nucleic acid concatemer template molecules with incorporated nucleotides having a scissile moiety that are distributed at random positions along individual immobilized nucleic acid concatemer template molecules. In some embodiments, the nucleotides having a scissile moiety are distributed at different positions in the different immobilized nucleic acid concatemer template molecules.

[0327] In some embodiments, rolling circle amplification (RCA) can generate single stranded nucleic acid concatemer molecules having multiple copies of a polynucleotide unit arranged in tandem, where each polynucleotide unit comprises a sequence-of-interest and at least one binding site for a compaction oligonucleotide. In some embodiments, the rolling circle amplification reaction of step (c) can be conducted in the presence or absence of a plurality of compaction oligonucleotides. In some embodiments, the compaction oligonucleotides include a 5’ region, an optional internal region (intervening region), and a 3’ region. The 5’ and 3’ regions of the compaction oligonucleotide can hybridize to binding sites in the nucleic acid concatemer template molecule to pull together distal portions of the nucleic acid concatemer template molecule causing compaction of the nucleic acid concatemer template molecule to form a DNA nanoball. For example, the 5’ region of the compaction oligonucleotide is designed to hybridize to a first portion of the nucleic acid concatemer template molecule, and the 3’ region of the compaction oligonucleotide is designed to hybridized to a second portion of the nucleic acid concatemer template molecule. In some embodiments, the 3’ end of the compaction oligonucleotides are non-extendible which inhibits them from extending during rolling circle amplification. Inclusion of compaction oligonucleotides during RCA can promote formation of DNA nanoballs having tighter size and shape compared to nucleic acid concatemer template molecules generated in the absence of the compaction oligonucleotides. The compact and stable characteristics of the DNA nanoballs improves sequencing accuracy by increasing signal intensity and they retain their shape and size during multiple sequencing cycles.

[0328] In some embodiments, the methods for conducting rolling circle amplification further comprise step (d): sequencing the plurality of nucleic acid concatemer template molecules immobilized on the support (immobilized nucleic acid concatemer template molecules). In some embodiments, the immobilized nucleic acid concatemer template molecules comprise nucleic acid template molecules to be sequenced. In some embodiments, the sequencing of step (d) can be conducting by contacting the immobilized nucleic acid concatemer template molecules with a plurality of sequencing primers, a plurality ofsequencing polymerases, and a plurality of nucleotide reagents, and conducting at least two cycles of sequencing reactions. In some embodiments, the nucleotide reagents comprise nucleotides, nucleotide analogs and / or multivalent molecules. In some embodiments, the sequencing reactions employ nucleotide reagents comprising detectably labeled nucleotide analogs. In some embodiments, the sequencing reactions employ nucleotide reagents comprising detectably labeled multivalent molecules. In some embodiments, the sequencing reactions employ a two-stage sequencing reaction comprising binding detectably labeled multivalent molecules, and incorporating nucleotide analogs as described herein. In some embodiments, the sequencing reactions employ labeled or non-labeled nucleotide analogs as described herein. In some embodiments, the sequencing reactions employ a sequencing-by- binding reaction as described herein. In some embodiments, step (d) comprises pairwise sequencing wherein 2-30 consecutive bases in the initial portion of the read 2 strand (R2) are sequenced using non-labeled nucleotide analogs (e.g., dark sequencing).

[0329] In some embodiments, any of steps (a) - (d) of the methods for conducting rolling circle amplification on a plurality of covalently closed circular library molecules (600) can include applying a deamination reagent and / or an alkaline reagent to any of the covalently closed circular library molecules (600) thereby generating a plurality of covalently closed circular library molecules having reduced C:G to T:A base transitions which can generate higher quality base calls during downstream sequencing workflows. In some embodiments, applying a deamination reagent and / or an alkaline reagent can increase sequencing quality scores from Q30 to Q40, Q45, Q50, Q55, Q60 or higher sequencing quality scores. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q40 of about 80-90%, or about 90-95%, or about 95-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q45 of about 75-85%, or about 85-90%, or about 90-95%, or about 95-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q50 of about 65-75%, or about 75-85%, or about 85-95%, or about 95-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q55 of about 60-70%, or about 70-80%, or about 80-85%, or about 85-90%, or about 90-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q60 of about 60-70%, or about 70-80%, or about 80-85%, or about 85-90%, orabout 90-100%. For example, see FIGs. 65, 66, 67A-67D, 68A-68D, 69 and 70, and see Tables A and B at FIG. 73.

[0330] In some embodiments, in step (a), the plurality of covalently closed circular library molecules (600) can be distributed onto a support that is coated with one or more compounds to produce a passivated layer on the support (e.g., FIG. 1). In some embodiments, the passivated layer forms a porous or semi-porous layer. In some embodiments, the third surface primers (e.g., surface capture primers), fourth surface primers (e.g., surface pinning primers), concatemer template molecules and / or polymerase, can be attached to the passivated layer for immobilization to the support. In some embodiments, the support comprises a low non-specific binding surface that enable improved nucleic acid hybridization and amplification performance on the support. In general, the support may comprise one or more layers of a covalently or non-covalently attached low-binding, chemical modification layers, e.g., silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used for immobilizing a plurality of nucleic acid concatemer template molecules to the support. In some embodiments, the support can comprise a functionalized polymer coating layer covalently bound at least to a portion of the support via a chemical group on the support, a primer grafted to the functionalized polymer coating, and a water-soluble protective coating on the primer and the functionalized polymer coating. In some embodiments, the functionalized polymer coating comprises a poly(N-(5- azidoacetamidylpentyl)acrylamide-co-acrylamide (PAZAM). In some embodiments, the support comprises a surface coating having at least one hydrophilic polymer coating layer and at least one layer of a plurality of oligonucleotides. The hydrophilic polymer coating layer can comprise polyethylene glycol (PEG). The hydrophilic polymer coating layer can comprise branched PEG having at least 4 branches. In some embodiments, the low nonspecific binding coating has a degree of hydrophilicity which can be measured as a water contact angle, where the water contact angle is no more than 45 degrees. In some embodiments, the density of the covalently closed circular library molecules (600) immobilized to the support or immobilized to the coating on the support is about 102- 106per mm2, or about 106- 109per mm2, or about 109- 1012per mm2. In some embodiments, the plurality of covalently closed circular library molecules (600) is immobilized to the support or immobilized to the coating on the support at pre-determined sites on the support (or the coating on the support), or immobilized to the coating on the support at random sites on the support (or the coating on the support).

[0331] In some embodiments, the distributing of step (a) can be conducted in the presence of a high-efficiency hybridization buffer which comprises: (i) a first polar aprotic solvent having a dielectric constant that is no greater than 40 and having a polarity index of 4-9; (ii) a second polar aprotic solvent having a dielectric constant that is no greater than 115 and is present in the hybridization buffer formulation in an amount effective to denature double-stranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in a range of about 4-8; and (iv) a crowding agent in an amount sufficient to enhance or facilitate molecular crowding. In some embodiments, the high efficiency hybridization buffer comprises: (i) the first polar aprotic solvent comprises acetonitrile at 25-50% by volume of the hybridization buffer; (ii) the second polar aprotic solvent comprises formamide at 5-10% by volume of the hybridization buffer; (iii) the pH buffer system comprises 2-(A-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5; and (iv) the crowding agent comprises polyethylene glycol (PEG) at 5-35% by volume of the hybridization buffer. In some embodiments, the high efficiency hybridization buffer further comprises betaine.

[0332] In some embodiments, in step (a), the plurality of the third surface primers (e.g., capture primers) immobilized on the support comprise the sequence 5’-GATCAGGTGAGGCTGCGACGACT-3’ (SEQ ID NO: 39) (or a complementary sequence thereof). Individual third surface primers (e.g., capture primers) can hybridize to a covalently closed circular library molecule (600) having a second splint strand region (400) which includes a universal binding sequence for a third surface primer, where the universal binding sequence for a third surface primer comprises a second sub-region which comprises the sequence 5’-AGTCGTCGCAGCCTCACCTGATC-3’ (SEQ ID NO: 31) (or a complementary sequence thereof).

[0333] In some embodiments, in step (a), the plurality of the third surface primers (e.g., capture primers) immobilized on the support comprise the sequence5’- CAAGCAGAAGACGGCATACGA -3’ (SEQ ID NO: 36) (or a complementary sequence thereof).

[0334] In some embodiments, in step (c), the plurality of the fourth surface primers (e.g., pinning primers) immobilized on the support comprise the sequence 5’-CATGTAATGCACGTACTTTCAGGGT-3’ (SEQ ID NO: 30) (or a complementary sequence thereof). In some embodiments, in step (c), the plurality of the fourth surface primers (e.g., pinning primers) immobilized on the support comprise the sequence5’-AATGCACGTACTTTCAGGGT-3’ (SEQ ID NO: 56) (or a complementary sequence thereof). Individual fourth surface primers (e.g., pinning primers) can hybridize to a portion of the concatemer molecules having a second splint strand region (400) which includes a universal binding sequence for a fourth surface primer, where the universal binding sequence for the fourth surface primer comprises a first sub-region which comprises the sequence 5’- CATGTAATGCACGTACTTTCAGGGT -3’ (SEQ ID NO: 30) (or a complementary sequence thereof).

[0335] In some embodiments, in step (a), the plurality of the fourth surface primers (e.g., pinning primers) immobilized on the support comprise the sequence5’- AATGATACGGCGACCACCGA -3’ (SEQ ID NO: 34) (or a complementary sequence thereof).In-Solution Rolling Circle Amplification Using Soluble Amplification Primers Using Circularized Library Molecules Generated via ds-Splint Adaptors

[0336] In some embodiments, the methods for conducting rolling circle amplification reaction on a plurality of covalently closed circular library molecules (600), wherein individual covalently closed circular library molecules (600) in the plurality comprise a second splint strand region (400) which includes a universal binding sequence for a third and fourth surface primer, the method comprises step (a): hybridizing in solution a plurality of soluble amplification primers to the plurality of covalently closed circular library molecules (e.g., FIG. 47A). In some embodiments, the plurality of soluble amplification primers comprises a plurality of first splint strands (300) each having an extendible 3’ end (e.g., FIG. 16, bottom). In some embodiments, the plurality of first splint strands (300) have been degraded or removed and replaced with a plurality of soluble amplification primers that can hybridize to a universal adaptor sequence (120) having a binding sequence for a first surface primer. In some embodiments, the plurality of first splint strands (300) have been degraded or removed and replaced with a plurality of soluble amplification primers that can hybridize to a universal adaptor sequence (130) having a binding sequence for a second surface primer.

[0337] In some embodiments, the methods for conducting rolling circle amplification reaction further comprise step (b): conducting a first rolling circle amplification reaction by contacting the plurality of covalently closed circular library molecules (600) and the plurality of soluble amplification primers with a plurality of strand-displacing polymerases and a plurality of nucleotides (e.g., comprising bases A, G, C, T and / or U), under a conditionsuitable to conduct a rolling circle amplification reaction in solution using the plurality of soluble amplification primers to initiate primer extension and the plurality of covalently closed circular library molecules (600) as template molecules, thereby generating a plurality of nascent nucleic acid concatemer template molecules which are still hybridized to their cognate covalently closed circular library molecules (600) (e.g., FIG. 47A). In some embodiments, the in-solution rolling circle amplification generates a plurality of nascent concatemer molecules wherein individual nascent nucleic acid concatemer template molecules comprise multiple tandem repeat polynucleotide units wherein each polynucleotide unit comprises a sequence-of-interest, a binding site for a third surface primer and a binding site for a fourth surface primer.

[0338] In some embodiments, the first rolling circle amplification reaction of step (b) can be conducted in the presence or absence of a plurality of compaction oligonucleotides. In some embodiments, the compaction oligonucleotides include a 5’ region, an optional internal region (intervening region), and a 3’ region. The 5’ and 3’ regions of the compaction oligonucleotide can hybridize to binding sites in the nascent nucleic acid concatemer template molecule to pull together distal portions of the nascent nucleic acid concatemer template molecule causing compaction of the nascent nucleic acid concatemer template molecule to form a DNA nanoball. For example, the 5’ region of the compaction oligonucleotide is designed to hybridize to a first portion of the nascent nucleic acid concatemer template molecule, and the 3’ region of the compaction oligonucleotide is designed to hybridized to a second portion of the nascent nucleic acid concatemer template molecule. In some embodiments, the 3’ end of the compaction oligonucleotides are non-extendible which inhibits them from extending during the first rolling circle amplification reaction. Inclusion of compaction oligonucleotides during RCA can promote formation of DNA nanoballs having tighter size and shape compared to concatemers generated in the absence of the compaction oligonucleotides.

[0339] In some embodiments, the methods for conducting rolling circle amplification reaction further comprises step (c): distributing the plurality of nascent nucleic acid concatemer template molecules onto a support having a plurality of the third surface primers immobilized thereon (e.g., immobilized capture primers), under a condition suitable for hybridizing at least a portion of individual nascent nucleic acid concatemer template molecules to an immobilized third surface primer thereby immobilizing the plurality of nascent nucleic acid concatemer template molecules (immobilized nascent nucleic acid concatemer template molecules) (e.g., FIG. 47B). In some embodiments, individualimmobilized nascent nucleic acid concatemer template molecules are still hybridized to their cognate covalently closed circular library molecules (600). In some embodiments, the support further comprises a plurality of immobilized fourth primers (e.g., immobilized pinning primers) that can hybridize with at least a portion of an immobilized nucleic acid concatemer template molecule thereby pinning down a portion of the immobilized nascent nucleic acid concatemer template molecule.

[0340] In some embodiments, in step (c), the immobilized third surface primers comprise single stranded oligonucleotides comprising DNA, RNA or a combination of DNA and RNA. The third surface primers comprise a sequence that is wholly complementary or partially complementary along their lengths to at least a portion of the nascent nucleic acid concatemer template molecule. In some embodiments, the third surface primers comprise a terminal 3’ end comprising a blocking moiety that renders the third surface primers non-extendible. In some embodiments, the third surface primers comprise a terminal 3’ nucleotide comprising a 3’ OH moiety which is extendible for nucleotide polymerization (e.g., polymerase-catalyzed polymerization).

[0341] In some embodiments, in step (c), the immobilized third surface primers can be immobilized to the support or immobilized to a coating on the support. The immobilized third surface primers can be embedded and attached (e.g., coupled) to the coating on the support. In some embodiments, the 5’ end of the immobilized third surface primers can be immobilized to a support or immobilized to a coating on the support. Alternatively, an interior portion or the 3’ end of the immobilized third surface primers can be immobilized to a support or immobilized to a coating on the support. The support comprises a plurality of immobilized third surface primers having the same sequence. The immobilized third surface primers can be any length, for example 4-50 nucleotides, or 50-100 nucleotides, or 100-150 nucleotides, or longer lengths.

[0342] In some embodiments, in step (c), the purpose of individual third surface primers is to hybridize to a portion of the nascent concatemer molecule, thereby immobilizing the nascent concatemer molecule to the support or to the coating on the support (e.g., FIG. 47B). In some embodiments, individual third surface primers can hybridize to a universal binding sequence for a third surface primer in the nascent concatemer molecule. In some embodiments, the plurality of immobilized third surface primers serve as a plurality of immobilized capture primers.

[0343] In some embodiments, in step (c), the plurality of immobilized third surface primers comprise at least one phosphorothioate diester bond at their 5’ ends which can renderthe third surface primers resistant to exonuclease degradation. In some embodiments, the plurality of immobilized third surface primers comprise 2-5 or more consecutive phosphorothioate diester bonds at their 5’ ends. In some embodiments, the plurality of immobilized third surface primers comprise at least one ribonucleotide and / or at least one 2’- O-methyl or 2’-O-methoxyethyl (MOE) nucleotide which can render the third surface primers resistant to exonuclease degradation.

[0344] In some embodiments, in step (c), the immobilized third surface primers comprise at least one locked nucleic acid (LNA) which comprises a methylene bridge bond between a 2’ oxygen and 4’ carbon of the pentose ring. Immobilized third surface primers that include at least one LNA can be resistant to nuclease digestions and can exhibit increased melting temperature when hybridized to the forward extension strand.

[0345] In some embodiments, in step (c), the immobilized third surface primers comprise at least one spacer arm at the 5’ end. In some embodiments, the 5’ end of individual immobilized third surface primers comprise 1-10 consecutive spacer arms. In some embodiments, the spacer arm comprises a hexaethylene glycol phosphoramidite. For example, the spacer arm comprises an 18-atom hexaethylene glycol spacer.

[0346] In some embodiments, in step (c), the support further comprises a plurality of a fourth surface primer immobilized thereon. In some embodiments, the sequences of the third and fourth surface primers are different. In some embodiments, the fourth primers comprise single stranded oligonucleotides comprising DNA, RNA or a combination of DNA and RNA. In some embodiments, the fourth surface primers comprise a sequence that is wholly complementary or partially complementary along their lengths to at least a portion of concatemer template molecule (e.g., FIG. 47C). In some embodiments, the plurality of fourth surface primers can be immobilized to the support or immobilized to a coating on the support. In some embodiments, the immobilized fourth surface primers can be embedded and attached (coupled) to the coating on the support. In some embodiments, the 5’ end of the fourth surface primers can be immobilized to a support or immobilized to a coating on the support. Alternatively, an interior portion or the 3’ end of the fourth surface primers can be immobilized to a support or immobilized to a coating on the support. In some embodiments, the support comprises a plurality of immobilized fourth surface primers having the same sequence. The immobilized fourth surface primers can be any length, for example 4-50 nucleotides, or 50-100 nucleotides, or 100-150 nucleotides, or longer lengths.

[0347] In some embodiments, in step (c), the purpose of individual fourth surface primers is to hybridize to a portion of a nucleic acid concatemer template molecule thereby pinningdown a portion of the nucleic acid concatemer template molecule to the support or to the coating on the support (e.g., FIG. 47C). In some embodiments, individual fourth surface primers can hybridize to a universal binding sequence for a fourth surface primer in a concatemer molecule. In some embodiments, the plurality of immobilized fourth surface primers serve as a plurality of immobilized pinning primers. In some embodiments, the terminal 3’ end of a fourth surface primer comprises a blocking moiety that renders the fourth surface primer non-extendible. Thus, a fourth surface primers cannot initiate a primer extension reaction. In some embodiments, an immobilized third surface primer can hybridize / capture a covalently closed circular library molecule and initiate a rolling circle amplification reaction to generate an immobilized concatemer molecule, and an immobilized fourth surface primer can hybridize to a portion of the immobilized nucleic acid concatemer template molecule to pin down a portion of the nucleic acid concatemer template molecule (e.g., FIG. 47C).

[0348] In some embodiments, in step (c), the 3’ terminal end of the immobilized fourth surface primers comprise an extendible 3’ OH moiety. In some embodiments, the 3’ terminal end of the immobilized fourth surface primers comprise a 3’ non-extendible moiety. The 3’ terminal end of the immobilized fourth surface primers comprise a moiety that blocks primer extension, such as for example a phosphate group, a dideoxycytidine group, an inverted dT, or an amino group. The immobilized fourth surface primers are not extendible in a primer extension reaction. The immobilized fourth surface primers lack a nucleotide having a scissile moiety. For example, the fourth surface primers lack uridine, 8-oxo-7,8- dihydroguanine (e.g., 8oxoG) and deoxyinosine.

[0349] In some embodiments, in step (c), the plurality of immobilized fourth surface primers comprise at least one phosphorothioate diester bond at their 5’ ends which can render the fourth surface primers resistant to exonuclease degradation. In some embodiments, the plurality of immobilized fourth surface primers comprise 2-5 or more consecutive phosphorothioate diester bonds at their 5’ ends. In some embodiments, the plurality of immobilized fourth surface primers comprise at least one ribonucleotide and / or at least one 2’-O-methyl or 2’ -O-m ethoxy ethyl (MOE) nucleotide which can render the fourth surface primers resistant to exonuclease degradation.

[0350] In some embodiments, in step (c), the immobilized fourth surface primers comprise at least one locked nucleic acid (LNA) which comprises a methylene bridge bond between a 2’ oxygen and 4’ carbon of the pentose ring. Immobilized fourth surface that include at least one LNA can be resistant to nuclease digestions and can exhibit increasedmelting temperature when hybridized to a portion of a nucleic acid concatemer template molecule.

[0351] In some embodiments, in step (c), the immobilized fourth surface primers comprise at least one spacer arm at the 5’ end. In some embodiments, the 5’ end of individual immobilized fourth surface comprise 1-10 consecutive spacer arms. In some embodiments, the spacer arm comprises a hexaethylene glycol phosphoramidite. For example, the spacer arm comprises an 18-atom hexaethylene glycol spacer.

[0352] In some embodiments, the support comprises about 102- 1015immobilized surface capture primers per mm2. In some embodiments, the support comprises about 102- 1015immobilized surface pinning primers per mm2. In some embodiments, the support comprises about 102- 1015immobilized surface capture primers and immobilized surface pinning primers per mm2. In some embodiments, the immobilized surface capture primers and immobilized surface pinning primers are in fluid communication with each other to permit flowing various solutions of linear or circular nucleic acid template molecules, soluble primers, enzymes, nucleotides, divalent cations, buffers, reagents, and the like, onto the support so that the plurality of immobilized surface capture primers and immobilized surface pinning primers can react with the solutions in a massively parallel manner.

[0353] In some embodiments, in step (c), the methods comprise contacting the plurality of nascent nucleic acid concatemer template molecules with a reagent that removes deaminated bases. In some embodiments, the plurality of plurality of nascent nucleic acid concatemer template molecules comprises a mixture of first and second sub-populations of nascent nucleic acid concatemer template molecules. In some embodiments, individual nascent concatemer molecules in the first sub-population carry at least one deaminated nucleotide base. In some embodiments, individual nascent nucleic acid concatemer template molecules in the second sub-population lack a deaminated nucleotide base.

[0354] In some embodiments, the contacting of step (c) comprises contacting the plurality of nascent nucleic acid concatemer template molecules (e.g., first and second subpopulations) with a reagent that removes deaminated bases thereby generating a plurality of immobilized nascent nucleic acid concatemer template molecules wherein a sub-population of the plurality of nascent nucleic acid concatemer template molecules comprise at least one abasic site. In some embodiments, the reagent that removes deaminated bases comprises at least one enzyme having glycosylase activity including any one or any combination of two or more of: formamidopyrimidine DNA glycosylase (fpg); uracil N-glycosylase (UNG); uracilDNA glycosylase (UDG); DNA (apurinic) lyase; DNA (apyrimidinic) lyase; and / or endonuclease III.

[0355] In some embodiments, in step (c), the reagent that removes deaminated bases comprises at least one enzyme having lyase activity that can that breaks the phosphodiester backbone at the 5’ and 3’ sides of the abasic site to release the base-free deoxyribose and generate a gap, wherein the enzyme having lyase activity includes any one or any combination of two or more of: AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase (formamidopyrimidine DNA glycosylase), Endonuclease VIII glycosylase / AP lyase and / or endonuclease III.

[0356] In some embodiments, in step (c), the reagent that removes deaminated bases comprises at least one enzyme that generates an abasic site in a nucleic acid strand and at least one enzyme having lyase activity. In some embodiments, the reagent that removes deaminated bases comprises a mixture of uracil DNA glycosylase and DNA glycosylase- lyase endonuclease VIII, for example USER (Uracil-Specific Excision Reagent Enzyme, such as from New England Biolabs) or thermolabile USER (for example, from New England Biolabs).

[0357] In some embodiments, in step (c), the reagent that removes deaminated bases can be washed away or deactivated after completion of the glycosylase reaction. In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the lyase reaction. In some embodiments, the reagent that removes deaminated bases can be washed away or deactivated after completion of the glycosylase and lyase reactions.

[0358] In some embodiments, the methods for conducting rolling circle amplification reaction further comprises step (d): contacting the plurality of nascent nucleic acid concatemer template molecules (immobilized nascent nucleic acid concatemer template molecules) with a plurality of strand-displacing polymerases and a plurality of nucleotides (e.g., comprising bases A, G, C, T and / or U), under a condition suitable to conduct a second rolling circle amplification reaction on the support using the plurality of covalently closed circular library molecules (600) as template molecules, thereby continuing extension of the plurality of immobilized nascent nucleic acid concatemer template molecules (e.g., FIG. 47B). In some embodiments, the first and / or the second rolling circle amplification reactions can be conducted with a plurality of nucleotides which comprise any combination of two or more of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the second rolling circle amplification generates a plurality of immobilized nucleic acid concatemer templatemolecules wherein individual immobilized nucleic acid concatemer template molecules comprise multiple tandem repeat polynucleotide units wherein each polynucleotide unit comprises a sequence-of-interest, a binding site for a third surface primer and a binding site for a fourth surface primer. In some embodiments, individual immobilized nucleic acid concatemer template molecules are hybridized to individual third surface primers. In some embodiments, individual covalently closed circular library molecules (600) in the plurality comprise a second splint strand region (400) which also include a universal binding sequence for a fourth surface primer so that the first rolling circle amplification reaction in solution generates nucleic acid concatemer template molecules having multiple copies of universal binding sequences for third and fourth surface primers (i.e., nucleic acid concatemer template molecules that are not immobilized). In some embodiments, the method comprises distributing the nucleic acid concatemer template molecules onto a support lacking immobilized first and second capture primers, and the support comprises a plurality of immobilized third and fourth surface primers. In some embodiments, the method comprises incubating the nucleic acid concatemer template molecules under a condition suitable for hybridizing a first and / or second sub-region of the second splint strand region (400) of the concatemer molecules to immobilized third and fourth surface primers, thereby pinning down at least one portion of the nucleic acid concatemer template molecules to the support (and generating immobilized nucleic acid concatemer template molecules). In some embodiments, the immobilized concatemers can be subjected to sequencing reactions.

[0359] In some embodiments, the covalently closed circular library molecules of step (a) comprise a second splint strand (400) region which carries new adaptor sequences and / or new index sequences. In some embodiments, the first and / or second sub-regions of the second splint strand (400) introduce universal sequences to permit individual covalently closed circular library molecules to hybridize to a third surface primer (e.g., a third capture primer). In some embodiments, the first and / or second sub-regions of the second splint strand (400) introduce universal sequences to permit hybridization of at least a portion of a concatemer template molecule to a fourth surface primer (e.g., a pinning primer). For example, the covalently closed circular library molecules can be distributed onto a support which lacks immobilized first and second capture primers, but the support comprises a plurality of immobilized third capture primers and optionally a plurality of immobilized pinning primers.

[0360] In some embodiments, the first and / or second sub-regions of the second splint strand (400) introduce universal sequences to permit individual covalently closed circular library molecules to hybridize to a third surface primer (e.g., a capture primer). In someembodiments, the first and / or second sub-regions of the second splint strand (400) introduce universal sequences to permit hybridization of at least a portion of a concatemer template molecule to a fourth surface primer (e.g., a pinning primer). For example, at step (c), the nascent nucleic acid concatemer template molecules (e.g., hybridized to their cognate covalently closed circular library molecules) can be distributed onto a support which lacks immobilized first and second capture primers, but the support comprises a plurality of immobilized third capture primers and a plurality of pinning primers.

[0361] In some embodiments, the on-support rolling circle amplification reaction of step (d) can be conducted with a nucleotide mixture containing dATP, dCTP, dGTP, dTTP and a nucleotide having a scissile moiety to generate immobilized nucleic acid concatemer template molecules which includes at least one nucleotide having a scissile moiety. The scissile moieties in the immobilized nucleic acid concatemer template molecules can be converted into abasic sites. In some embodiments, in the nucleotide mixture, the nucleotide having the scissile moiety comprises uridine, 8-oxo-7,8-dihydroguanine (e.g., 8oxoG) or deoxyinosine. In the immobilized concatemer template molecules, the uridine can be converted to an abasic site using uracil DNA glycosylase (UDG), the 8oxoG can be converted to an abasic site using FPG glycosylase, and the deoxyinosine can be converted to an abasic site using AlkA glycosylase.

[0362] In some embodiments, the nucleotide mixture of step (d) can include an amount of dUTP so that a target percent of the thymidine in the resulting nucleic acid concatemer template molecules is replaced with dUTP. For example, when 30% of dTTP in the nucleic acid concatemer template molecules are to be replaced with dUTP (e.g., 30% is the target percent) then the nucleotide mixture can contain 7.5% dUTP (e.g, 30 / 4 = 7.5%), 17.5% dTTP, and 25% each for dATP, dCTP and dGTP. The target percent of dTTP to be replaced by dUTP can be about 0.1-1%, or about 1-5%, or about 5-10%, or about 10-20%, or about 20-30% , or about 30-45%, or about 45-50%, or a higher percent of the dTTP in the nucleic acid concatemer template molecules are replaced with nucleotides having a scissile moiety.

[0363] In some embodiments, the nucleotide mixture of step (d) can include an amount of deoxyinosine so that a target percent of the guanosine in the resulting concatemer molecules are replaced with deoxyinosine. For example, when 30% of dGTP in the concatemer molecules are to be replaced with deoxyinosine (e.g, 30% is the target percent) then the nucleotide mixture can contain 7.5% deoxyinosine (e.g., 30 / 4 = 7.5%), 17.5% dGTP, and 25% each for dATP, dCTP and dTTP. The target percent of dGTP to be replaced by deoxyinosine can be about 0.1-1%, or about 1-5%, or about 5-10%, or about 10-20%, orabout 20-30% , or about 30-45%, or about 45-50%, or a higher percent of the dGTP in the nucleic acid concatemer template molecules are replaced with nucleotides having a scissile moiety.

[0364] In some embodiments, the nucleotide mixture of step (d) can include an amount of 8oxoG so that a target percent of the guanosine in the resulting nucleic acid concatemer template molecules is replaced with 8oxoG. For example, when 30% of dGTP in the nucleic acid concatemer template molecules are to be replaced with 8oxoG (e.g., 30% is the target percent) then the nucleotide mixture can contain 7.5% 8oxoG (e.g., 30 / 4 = 7.5%), 17.5% dGTP, and 25% each for dATP, dCTP and dTTP. The target percent of dGTP to be replaced by 8oxoG can be about 0.1-1%, or about 1-5%, or about 5-10%, or about 10-20%, or about 20-30% , or about 30-45%, or about 45-50%, or a higher percent of the dGTP in the nucleic acid concatemer template molecules are replaced with nucleotides having a scissile moiety.

[0365] In some embodiments, the rolling circle amplification reaction of step (d) can generate nucleic acid concatemer template molecules with incorporated nucleotides having a scissile moiety that are distributed at random positions along individual concatemer template molecules. In some embodiments, the nucleotides having a scissile moiety are distributed at different positions in the different immobilized concatemer template molecules. In some embodiments, the nucleic acid concatemer template molecules are immobilized.

[0366] In some embodiments, rolling circle amplification (RCA) of step (d) can generate nucleic acid concatemer template molecules having multiple copies of a polynucleotide unit arranged in tandem, where each polynucleotide unit comprises a sequence-of-interest and at least one binding site for a compaction oligonucleotide. In some embodiments, the second rolling circle amplification reaction of step (d) can be conducted in the presence or absence of a plurality of compaction oligonucleotides. In some embodiments, the compaction oligonucleotides include a 5’ region, an optional internal region (intervening region), and a 3’ region. The 5’ and 3’ regions of the compaction oligonucleotide can hybridize to binding sites in the concatemer molecule to pull together distal portions of the nucleic acid concatemer molecule causing compaction of the nucleic acid concatemer template molecule to form a DNA nanoball. For example, the 5’ region of the compaction oligonucleotide is designed to hybridize to a first portion of the nucleic acid concatemer template molecule, and the 3’ region of the compaction oligonucleotide is designed to hybridized to a second portion of the nucleic acid concatemer template molecule. In some embodiments, the 3’ end of the compaction oligonucleotides are non-extendible which inhibits them from extending during rolling circle amplification. Inclusion of compaction oligonucleotides during RCA canpromote formation of DNA nanoballs having tighter size and shape compared to concatemers generated in the absence of the compaction oligonucleotides. The compact and stable characteristics of the DNA nanoballs improves sequencing accuracy by increasing signal intensity and they retain their shape and size during multiple sequencing cycles. In some embodiments, the nucleic acid concatemer template molecule is single stranded.

[0367] In some embodiments, the methods for conducting rolling circle amplification further comprise step (e): sequencing the plurality of concatemer molecules. In some embodiments, the nucleic acid concatemer template molecules are immobilized (immobilized nucleic acid concatemer template molecules). In some embodiments, the nucleic acid concatemer template molecules comprise nucleic acid template molecules to be sequenced. In some embodiments, the sequencing of step (e) can be conducting by contacting the nucleic acid concatemer template molecules with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of nucleotide reagents, and conducting at least two cycles of sequencing reactions. In some embodiments, the nucleotide reagents comprise nucleotides, nucleotide analogs and / or multivalent molecules. In some embodiments, the sequencing reactions employ nucleotide reagents comprising detectably labeled nucleotide analogs. In some embodiments, the sequencing reactions employ nucleotide reagents comprising detectably labeled multivalent molecules. In some embodiments, the sequencing reactions employ a two-stage sequencing reaction comprising binding detectably labeled multivalent molecules, and incorporating nucleotide analogs as described herein. In some embodiments, the sequencing reactions employ labeled or non-labeled nucleotide analogs as described herein. In some embodiments, the sequencing reactions employ a sequencing-by- binding reaction as described herein. In some embodiments, step (e) comprises pairwise sequencing wherein 2-30 consecutive bases in the initial portion of the read 2 strand (R2) are sequenced using non-labeled nucleotide analogs (e.g., dark sequencing).

[0368] In some embodiments, any of steps (a) - (e) of the methods for conducting rolling circle amplification on a plurality of covalently closed circular library molecules (600) can include applying a deamination reagent and / or an alkaline reagent to any of the covalently closed circular library molecules (600) thereby generating a plurality of covalently closed circular library molecules having reduced C:G to T:A base transitions which can generate higher quality base calls during downstream sequencing workflows. In some embodiments, applying a deamination reagent and / or an alkaline reagent can increase sequencing quality scores from Q30 to Q40, Q45, Q50, Q55, Q60 or higher sequencing quality scores. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acidmanipulation workflow can achieve a sequencing quality score Q40 of about 80-90%, or about 90-95%, or about 95-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q45 of about 75-85%, or about 85-90%, or about 90-95%, or about 95-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q50 of about 65-75%, or about 75-85%, or about 85-95%, or about 95-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q55 of about 60-70%, or about 70-80%, or about 80-85%, or about 85-90%, or about 90-100%. In some embodiments, applying a deamination reagent and / or an alkaline reagent to a nucleic acid manipulation workflow can achieve a sequencing quality score Q60 of about 60-70%, or about 70-80%, or about 80-85%, or about 85-90%, or about 90-100%. For example, see FIGs. 65, 66, 67A-67D, 68A-68D, 69 and 70, and see Tables A and B at FIG. 73.

[0369] In some embodiments, in step (c), the plurality of nascent nucleic acid concatemer template molecules and their cognate covalently closed circular library molecules (600) can be distributed onto a support that is coated with one or more compounds to produce a passivated layer on the support (e.g., FIG. 1). In some embodiments, the passivated layer forms a porous or semi-porous layer. In some embodiments, the first and / or second surface primers, nucleic acid concatemer template molecules and / or polymerase, can be attached to the passivated layer for immobilization to the support. In some embodiments, the support comprises a low non-specific binding surface that enable improved nucleic acid hybridization and amplification performance on the support. In general, the support may comprise one or more layers of a covalently or non-covalently attached low-binding, chemical modification layers, e.g., silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used for immobilizing a plurality of nucleic acid concatemer template molecules to the support. In some embodiments, the support can comprise a functionalized polymer coating layer covalently bound at least to a portion of the support via a chemical group on the support, a primer grafted to the functionalized polymer coating, and a water-soluble protective coating on the primer and the functionalized polymer coating. In some embodiments, the functionalized polymer coating comprises a poly(N-(5- azidoacetamidylpentyl)acrylamide-co-acrylamide (PAZAM). In some embodiments, the support comprises a surface coating having at least one hydrophilic polymer coating layer and at least one layer of a plurality of oligonucleotides. The hydrophilic polymer coatinglayer can comprise polyethylene glycol (PEG). The hydrophilic polymer coating layer can comprise branched PEG having at least 4 branches. In some embodiments, the low nonspecific binding coating has a degree of hydrophilicity which can be measured as a water contact angle, where the water contact angle is no more than 45 degrees. In some embodiments, the density of the nascent concatemer molecules immobilized to the support or immobilized to the coating on the support is about 102- 106per mm2, or about 106- 109per mm2, or about 109-l 012per mm2. In some embodiments, the plurality of nascent concatemer molecules is immobilized to the support or immobilized to the coating on the support at predetermined sites on the support (or the coating on the support), or immobilized to the coating on the support at random sites on the support (or the coating on the support).

[0370] In some embodiments, the distributing of step (c) can be conducted in the presence of a high-efficiency hybridization buffer which comprises: (i) a first polar aprotic solvent having a dielectric constant that is no greater than 40 and having a polarity index of 4-9; (ii) a second polar aprotic solvent having a dielectric constant that is no greater than 115 and is present in the hybridization buffer formulation in an amount effective to denature double-stranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in a range of about 4-8; and (iv) a crowding agent in an amount sufficient to enhance or facilitate molecular crowding. In some embodiments, the high efficiency hybridization buffer comprises: (i) the first polar aprotic solvent comprises acetonitrile at 25-50% by volume of the hybridization buffer; (ii) the second polar aprotic solvent comprises formamide at 5-10% by volume of the hybridization buffer; (iii) the pH buffer system comprises 2-(A-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5; and (iv) the crowding agent comprises polyethylene glycol (PEG) at 5-35% by volume of the hybridization buffer. In some embodiments, the high efficiency hybridization buffer further comprises betaine.

[0371] In some embodiments, in step (c), the plurality of the third surface primers (e.g., capture primers) immobilized on the support comprise the sequence 5’-GATCAGGTGAGGCTGCGACGACT-3’ (SEQ ID NO: 39) (or a complementary sequence thereof). Individual third surface primers (e.g., capture primers) can hybridize to a covalently closed circular library molecule (600) having a second splint strand region (400) which includes a universal binding sequence for a third surface primer, where the universal binding sequence for a third surface primer comprises a second sub-region which comprises the sequence5’-AGTCGTCGCAGCCTCACCTGATC-3’ (SEQ ID NO: 31) (or a complementary sequence thereof).

[0372] In some embodiments, in step (c), the plurality of the third surface primers (e.g., capture primers) immobilized on the support comprise the sequence 5’- CAAGCAGAAGACGGCATACGA -3’ (SEQ ID NO: 36) (or a complementary sequence thereof).

[0373] In some embodiments, in step (c), the plurality of the fourth surface primers (e.g., pinning primers) immobilized on the support comprise the sequence 5’-CATGTAATGCACGTACTTTCAGGGT-3’ (SEQ ID NO: 30) or a complementary sequence thereof). In some embodiments, in step (c), the plurality of the fourth surface primers (e.g., pinning primers) immobilized on the support comprise the sequence 5’-AATGCACGTACTTTCAGGGT-3’ (SEQ ID NO: 56) or a complementary sequence thereof). Individual fourth surface primers (e.g., pinning primers) can hybridize to a portion of the concatemer molecules having a second splint strand region (400) which includes a universal binding sequence for a fourth surface primer (or a complementary sequence thereof), where the universal binding sequence for the fourth surface primer comprises a first sub-region which comprises the sequence 5’ - CATGTAATGCACGTACTTTCAGGGT -3’ (SEQ ID NO: 30).

[0374] In some embodiments, in step (c), the plurality of the fourth surface primers (e.g., pinning primers) immobilized on the support comprise the sequence 5’- AATGATACGGCGACCACCGA -3’ (SEQ ID NO: 34 or a complementary sequence thereof).Kits Comprising Double-Stranded Splint Adaptors

[0375] In some aspects, the present disclosure provides a kit for the use of introducing one or more new adaptor sequences into linear nucleic acid library molecules using any of the double-stranded splint adaptors described herein. In some embodiments, the kit can be used to circularize single-stranded nucleic acid library molecules having a sequence of interest (110) flanked on both sides with universal adaptor sequences (e.g., see FIG. 15). In some embodiments, the circularized library molecules can be converted to covalently closed circular molecules (e.g., FIGs. 15-16). which can be subjected to a rolling circle amplification (RCA) reaction to generate nucleic acid concatemers. The concatemers can be immobilized to a support for massively parallel sequencing.

[0376] The present disclosure provides kits comprising nucleic acid double-stranded splint adaptors (200), comprising: (i) a first splint strand (long splint strand (300)) which is hybridized to (ii) a second splint strand (short splint strand (400)). The first splint strand comprises a first region (320), an internal region (310), and a second region (330). The internal region of the first splint strand (310) is hybridized to the second splint strand (400) to form a double-stranded splint adaptor (200) having a double-stranded region and two flanking single-stranded regions. The second splint strand (400) includes a new adaptor sequence that can be introduced the linear nucleic acid library molecules. Exemplary doublestranded splint adaptors are shown in FIGs. 15 and 17. The kit can include a container which contains the first splint strands (300) hybridized to the second splint strands (400). The kit can include a first container which contains the first splint strands (300) and a second container which contains the second splint strands (400).

[0377] In some embodiments, in the kit, the second splint strand (400) comprises at least two sub-regions, including a first and second sub-region (e.g., see FIGs. 15 and 17). The first sub-region comprises a universal binding sequence for a third surface primer, and the second sub-region comprises a universal binding sequence for a fourth surface primer, wherein the first and second sub-regions do not hybridize (or at least exhibit very little hybridization to) the first and second surface primers. In some embodiments, the second splint strand (400) further comprises an optional third sub-region which includes a sample index sequence having 5-20 bases and / or a unique identification sequence (180) having 2-10 or more bases (e.g., NN) (e.g., see FIG. 15). In some embodiments, the second splint strand (400) comprises only one sub-region and lacks a second and third sub-region, where the first sub-region comprises a sample index sequence having 5-20 bases. In some embodiments, the sample index sequence can be used to distinguish sequences of interest obtained from different sample sources in a multiplex assay. In some embodiments, the unique identification sequence comprises a random sequence. The unique identification sequence can be designed to exhibit reduced or no hybridization to the first, second, third and fourth surface primers. An exemplary arrangement of the sub-regions in the second splint strand (400), in a 5’ to 3’ orientation comprises: 5’- [second sub-region] - [first sub-region] - 3’. Another exemplary arrangement of the sub-regions in the second splint strand (400), in a 5’ to 3’ orientation comprises: 5’- [third sub-region] - [second sub-region] - [first sub-region] - 3’. Exemplary first (300) and second (400) splint strands are shown in FIGs. 15 and 17. In some embodiments, the second splint strand (400) can be 20-100 nucleotides in length, or 30-80 nucleotides in length, or 40-60 nucleotides in length.

[0378] In some embodiments, in the kit, the second splint strands (400) comprise one or more phosphorothioate linkage at the 5’ and / or 3’ ends to confer exonuclease resistance. In some embodiments, the second splint strands (400) comprise one or more phosphorothioate linkage at an internal position to confer endonuclease resistance. In some embodiments, the second splint strands (400) comprise one or more 2’-O-methylcytosine bases at the 5’ and / or 3’ end, or at an internal position. In some embodiments, the 5’ end of the second splint strand (400) is phosphorylated or non-phosphorylated. In some embodiments, the 3’ end of the second splint strand (400) comprises a terminal 3’ OH group or a terminal 3’ blocking group.

[0379] In some embodiments, in the kit, the first splint strand (300) comprises a first region (320), a second region (330), and internal region (310). The first region (320) comprises a first universal adaptor sequence which can hybridize to the first universal binding sequence at one end of the linear nucleic acid library molecule e.g., FIG. 15). The second region (330) comprises a second universal adaptor sequence which can hybridize to the second universal binding sequence at the other end of the linear nucleic acid library molecule (e.g., FIG. 15). In some embodiments, the first region of the first splint strand (320) includes a first universal adaptor sequence which comprises a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer, or a universal binding sequence for a compaction oligonucleotide. In some embodiments, the second region of the first splint strand (330) includes a second universal adaptor sequence which comprises a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer, or a universal binding sequence for a compaction oligonucleotide. In some embodiments, the first splint strand (300) can be 50-150 nucleotides in length, or 60-100 nucleotides in length, or 70-90 nucleotides in length. In some embodiments, the first splint strands (300) comprise one or more phosphorothioate linkage at the 5’ and / or 3’ ends to confer exonuclease resistance. In some embodiments, the first splint strands (300) comprise one or more phosphorothioate linkage at an internal position to confer endonuclease resistance. In some embodiments, the first splint strands (300) comprise one or more 2’-O-methylcytosine bases at the 5’ and / or 3’ end, or at an internal position. In some embodiments, the 5’ end of the first splint strand (300) is phosphorylated or nonphosphorylated. In some embodiments, the 3’ end of the first splint strand (300) comprises a terminal 3’ OH group or a terminal 3’ blocking group.

[0380] In some embodiments, in the kit, the first splint strand (300) includes an internal region (310) which comprises at least two sub-regions, including a fourth and fifth sub-region (e.g., FIGs. 15 and 17). The fourth sub-region hybridizes to the first sub-region of the second splint strand (400). The fifth sub-region hybridizes to the second sub-region of the second splint strand (400). The fourth and fifth sub-regions do not hybridize (or at least exhibit very little hybridization to) the first and second surface primers. In some embodiments, the internal region (310) of the first splint strand further comprises an optional sixth sub-region which hybridizes to the third sub-region of the second splint strand (400). An exemplary arrangement of the sub-regions of the first splint strand (300), in a 5’ to 3 ’orientation comprises: 3’ - [fourth sub-region] - [fifth sub-region] - 5’. Another exemplary arrangement of the sub-regions of the first splint strand (300), in a 5’ to 3’orientation comprises: 3’ - [fourth sub-region] - [fifth sub-region] - [sixth sub-region] - 5’.

[0381] In some embodiments, the kit comprises a plurality of first splint strands (300) having a first region (320) that can hybridize to one end of a linear library molecule comprising a universal adaptor sequence (120) having a binding sequence for a first surface primer (e.g., see FIG. 15). Exemplary sequences of the universal adaptor sequence (120) having a binding sequence for a first surface primer are listed above.

[0382] In some embodiments, the kit comprises a plurality of first splint strands (300) having a second region (330) that can hybridize to the other end of the same linear library molecule comprising a universal adaptor sequence (130) having a binding sequence for a second surface primer (e.g., see FIG. 15). Exemplary sequences of the universal adaptor sequence (130) having a binding sequence for a second surface primer are listed above.

[0383] In some embodiments, the kit comprises a plurality of second splint strands (400) having first sub-region comprising a universal binding sequence for a third surface primer (e.g., universal binding sequence for a surface capture primer) (e.g., FIG. 15).

[0384] In some embodiments, the kit comprises a plurality of second splint strands (400) having second sub-region comprising a universal binding sequence for a fourth surface primer (e.g., universal binding sequence for a surface pinning primer) (e.g., FIG. 15). Exemplary sequences of the first and second sub-regions of the second splint strand (400) are listed above.

[0385] In some embodiments, the sequence of the first splint strand (300) and the sequence of the second splint strand (400) are shown in FIG. 17.Methods for Forming a Plurality of Circularized Library Molecules Using Single-Stranded Splint Strands

[0386] In some aspects, the present disclosure provides compositions and methods for improving sequencing quality scores comprising preparing a plurality of linear library molecules using any of the methods described herein and circularizing the linear library molecules. In some embodiments, a plurality of covalently closed circularized library molecules can be generated by hybridizing the plurality of linear library molecules with a plurality of single-stranded splint strands as described herein. In some embodiments, the covalently closed circular library molecules can be amplified by conducting rolling circle amplification. In some embodiments, the rolling circle amplification can be conducted on a support, or in-solution and on a support. Exemplary, non-limiting single-stranded splint strands and double-stranded splint adaptors, and methods related thereto, are described in WO 2023 / 168444 the contents of which is incorporated by reference herein in its entirety.

[0387] In some embodiments, methods for generating a plurality of covalently closed circular library molecules comprise step (a): providing a plurality of library molecules (700) wherein individual library molecules (700) comprise: (i) a universal adaptor sequence (720) having a binding sequence for a second surface primer (e.g., pinning primer); (ii) a left sample index sequence (760); (iii) a universal adaptor sequence (740) having a binding sequence for a first sequencing primer (e.g., a reverse sequencing primer); (iv) a sequence of interest (710); (v) a universal adaptor sequence (750) having a binding sequence for a second sequencing primer (e.g., a forward sequencing primer); (vi) a right sample index sequence (770); and (vii) a universal adaptor sequence (730) having a binding sequence for a first surface primer (e.g., capture primer) (e.g., FIGs. 18-19). In some embodiments, any of the universal adaptor sequences including (720), (740), (750) or (730), can hybridize to a portion of a compaction oligonucleotide. In some embodiments, the single-stranded library molecule further comprises a unique identification sequence (780) comprising a sequence that is used to uniquely identify an individual sequence of interest (e.g., insert sequence) to which the unique identification sequence (780) is appended in a population of other sequence of interest molecules (e.g., molecular tagging). In some embodiments, the unique identification sequence (780) can be located on the left or right side of the insert region. In some embodiments, the unique identification sequence comprises 2-12 or more nucleotides having a known sequence. For example, the unique identification sequence comprises a known random sequence where a nucleotide at each position is randomly selected from nucleotideshaving a base A, G, C, T or U. The unique identification sequences (780) can be used for molecular tagging procedures.

[0388] In some embodiments, methods for generating a plurality of covalently closed circular library molecules further comprise step (b): hybridizing a plurality of single-stranded splint strands (800) with a plurality of library molecules (700), wherein individual singlestranded splint strands (800) in the plurality comprise (i) a first region (810) that is capable of hybridizing with the universal adaptor sequence (720) of an individual library molecule, and (ii) a second region (820) that is capable of hybridizing with the universal adaptor sequence (730) of an individual library molecule. In some embodiments, the 5’ end of the singlestranded splint strand (800) is phosphorylated or lacks a phosphate group. In some embodiments, the 3’ end of the single-stranded splint strand (800) includes a terminal 3’ OH group or a terminal 3’ blocking group. Exemplary single-stranded splint strands (800) are shown in FIGs. 18-19. In some embodiments, the single-stranded splint strand (800) can be 20-150 nucleotides in length, or 60-100 nucleotides in length, or 70-90 nucleotides in length, or 60-80 nucleotides in length.

[0389] In some embodiments, the hybridizing of step (b) is conducted under a condition suitable for hybridizing the first region (810) of the single-stranded splint strand to the universal adaptor sequence (720) having a binding sequence for a second surface primer (e.g., pinning primer) of the library molecule, and the condition is suitable for hybridizing the second region (820) of the single-stranded splint strand to the universal adaptor sequence (730) having a binding sequence for a first surface primer (e.g., capture primer) of the library molecule, thereby circularizing the plurality of library molecules to form a plurality of library-splint complexes (900) having one nick (e.g., FIG. 18). In some embodiments, the library-splint complex (900) comprises a nick between the terminal 5’ and 3’ ends of the library molecule (e.g., FIGs. 18-19). In some embodiments, the nick is enzymatically ligatable.

[0390] In some embodiment, in step (b), the first region (810) of the single-stranded splint strand can hybridize to a sense or anti-sense strand of a double-stranded library molecule (700). In some embodiments, the second region (820) of the single-stranded splint strand can hybridize to a sense or anti-sense strand of a double-stranded library molecule (700). The double-stranded library molecule can be denatured to generate the single-stranded sense and anti-sense library strands. In some embodiments, a double-stranded library molecule can be denatured using heat or an alkaline reagent (e.g., NaOH or KOH) to generate the sense and anti-sense library strands.

[0391] In some embodiments, in step (b), the first region (810) of the single-stranded splint strand does not hybridize to the sequence of interest (710), and the second region (820) of the single-stranded splint strand does not hybridize to the sequence of interest (710).

[0392] In some embodiments, in step (b), the sample index sequences (760) and (770) can be used to distinguish sequences of interest obtained from different sample sources in a multiplex workflow. In some embodiments, the left index sequence (760) can include a random sequence (e.g., NNN) or lack a random sequence. In some embodiments, the right index sequence (770) can include a random sequence (e.g., NNN) or lack a random sequence. The left sample index sequence (760) can be 3-20 nucleotides in length. The right sample index sequence (770) can be 3-20 nucleotides in length. The sequences of the left and right sample index sequences (e.g., (760) and (770)) can be the same or different from each other.

[0393] Multiplex workflows can be enabled by preparing sample-indexed libraries using one or both sample index sequences (e.g., left and / or right sample index sequences). The left index sequences (760) and / or right index sequences (770) can be employed to prepare separate sample-indexed libraries using input nucleic acids isolated from different sources. The sample-indexed libraries can be pooled together to generate a multiplex library mixture, and the pooled libraries can be amplified and / or sequenced. The sequences of the insert region along with the left index sequence (760) and / or right index sequence (770) can be used to identify the source of the input nucleic acids. In some embodiments, any number of sample-indexed libraries can be pooled together, for example 2-10, or 10-50, or 50-100, or 100-200, or more than 200 sample-indexed libraries can be pooled. Exemplary nucleic acid sources include naturally-occurring, recombinant, or chemically-synthesized sources.Exemplary nucleic acid sources include single cells, a plurality of cells, tissue, biological fluid, environmental sample or whole organism. Exemplary nucleic acid sources include fresh, frozen, fresh-frozen or archived sources (e.g., formalin-fixed paraffin-embedded; FFPE). The skilled artisan will recognize that the nucleic acids can be isolated from many other sources. The nucleic acid library molecules can be prepared in single-stranded or double-stranded form.

[0394] In some embodiments, in step (b), the single-stranded splint strands (800) comprise one or more phosphorothioate linkage at their 5’ and / or 3’ ends to confer exonuclease resistance. In some embodiments, the single-stranded splint strands (800) comprise one or more phosphorothioate linkage at an internal position to confer endonuclease resistance. In some embodiments, the single- stranded splint strands (800) comprise one or more 2’-O-methylcytosine bases at their 5’ and / or 3’ ends, or at an internal position. In someembodiments, the 5’ end of the single-stranded splint strand (800) is phosphorylated or nonphosphorylated. In some embodiments, the 3’ end of the single-stranded splint strand (800) comprises a terminal 3’ OH group or a terminal 3’ blocking group.

[0395] In some embodiments, the plurality of library-splint complexes (900) formed in step (b) can be subjected to at least one enzymatic reaction, including a phosphorylation reaction, ligation reaction and / or exonuclease reaction. The enzymatic reactions can be conducted sequentially or essentially simultaneously. The enzymatic reactions can be conducted in a single reaction vessel. Alternatively, a first enzymatic reaction can be conducted in a first reaction vessel, then transferred to a second reaction vessel where the second enzymatic reaction is conducted, then transferred to a third reaction vessel where the third enzymatic reaction is conducted.

[0396] In some embodiments, any of the methods for forming a plurality of library-splint complexes (900) described herein further comprise conducting separate and sequential phosphorylation and ligation reactions which are conducted in separate reaction vessels. In some embodiments, the methods for forming a plurality of library-splint complexes (900) further comprise step (cl): contacting in a first reaction vessel the plurality of the singlestranded splint strands (800) and the plurality of the single-stranded nucleic acid library molecules (700) with a T4 polynucleotide kinase enzyme under a condition suitable to phosphorylate the 5’ ends of the plurality of single-stranded splint strands (800) and / or the plurality of single-stranded nucleic acid library molecules (700); and transferring the phosphorylation reaction to a second reaction vessel. In some embodiments, the methods for forming a plurality of library-splint complexes (900) further comprise step (dl): contacting in the second reaction vessel the plurality of phosphorylated single-stranded splint strands (800) and the plurality of phosphorylated single-stranded nucleic acid library molecules (700) with a ligase, under a condition suitable to enzymatically ligate the nicks, thereby generating a plurality of covalently closed circular library molecules (1000) each hybridized to a singlestranded splint strand (800). In some embodiments, the ligase enzyme comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0397] In some embodiments, any of the methods for forming a plurality of library-splint complexes (900) described herein further comprise conducting sequential phosphorylation and ligation reactions which are conducted sequentially in the same reaction vessel. In some embodiments, the methods for forming a plurality of library-splint complexes (900) further comprise step (c2): contacting in a first reaction vessel the plurality of the single-stranded splint strands (800) and the plurality of the single-stranded nucleic acid library molecules(700) with a T4 polynucleotide kinase enzyme under a condition suitable to phosphorylate the 5’ ends of the plurality of single-stranded splint strands (800) and the plurality of singlestranded nucleic acid library molecules (700). In some embodiments, the methods for forming a plurality of library-splint complexes (900) further comprise step (d2): contacting in the same first reaction vessel the phosphorylated single- stranded splint strands (800) and the phosphorylated single-stranded nucleic acid library molecules (700) with a ligase under a condition suitable to enzymatically ligate the nicks, thereby generating a plurality of covalently closed circular library molecules (1000) each hybridized to a single-stranded splint strand (800). In some embodiments, the ligase enzyme comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0398] In some embodiments, any of the methods for forming a plurality of library-splint complexes (900) described herein further comprise conducting essentially simultaneous phosphorylation and ligation reactions which are conducted together in the same reaction vessel. In some embodiments, the methods for forming a plurality of library-splint complexes (900) further comprise step (c3): contacting in a first reaction vessel the plurality of the single-stranded splint strands (800) and the plurality of the single-stranded nucleic acid library molecules (700) with a (i) T4 polynucleotide kinase enzyme and (ii) a ligase enzyme, under a condition suitable to phosphorylate the 5’ ends of the plurality of single-stranded splint strands (800) and the plurality of single-stranded nucleic acid library molecules (700), and the conditions are suitable to enzymatically ligate the nicks, thereby generating a plurality of covalently closed circular library molecules (1000) each hybridized to a singlestranded splint strand (800). In some embodiments, the ligase enzyme comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0399] In some embodiments, in any of steps (cl)(dl), (c2)(d2) or (c3), completion of the phosphorylation and ligation reaction generates a plurality of covalently closed circular library molecules (1000) (e.g., FIG. 19). In some embodiments, the ligase enzyme can be deactivated after completion of the ligase reaction using heat or an alkaline reagent. In some embodiments, the ligase deactivation comprises contacting the ligase enzyme with an alkaline reagent. In some embodiments, the alkaline reagent comprises NaOH and / or KOH. In some embodiments, the ligase enzyme is not deactivated with heat. In some embodiments, the plurality of covalently closed circular library molecules (1000) is retained. In some embodiments, deactivating the ligase enzyme with the alkaline reagent can reduce the formation of deaminated nucleotide bases in the plurality of covalently closed circular librarymolecule (1000) compared to covalently closed circular library molecules that are subjected to ligase heat deactivation.

[0400] In some embodiments, any of the methods for forming a plurality of library-splint complexes (900) described herein further comprise the optional step of enzymatically removing the plurality of single-stranded splint strands (800) from the plurality of covalently closed circular library molecules (1000), which comprises optional step (e): contacting the plurality of covalently closed circular library molecules (1000) with at least one exonuclease enzyme to remove the plurality ...

Claims

CLAIMSWhat is claimed:

1. A method for reducing a number of nucleic acid library molecules carrying at least one deaminated nucleotide base in a plurality of library molecules, the method comprising: a) providing a plurality of splint capture primers immobilized to a support, wherein individual splint capture primers comprise a first portion and a second portion, wherein the plurality of splint capture primers have the same sequence, and wherein the density of the plurality of splint capture primers is between 102- 1015per mm2; b) contacting the plurality of splint capture primers with a plurality of linear nucleic acid library molecules comprising a first sub-population of linear library molecules and a second sub-population of linear library molecules, wherein the linear library molecules of the first sub-population carry at least one deaminated nucleotide base, and wherein the linear library molecules of the second sub-population lack a deaminated base, and wherein individual library molecules in the plurality are single-stranded and comprise:(i) a universal adaptor sequence having a binding sequence for the first portion of a given splint capture primer,(ii) a universal adaptor sequence having a binding sequence for a forward sequencing primer,(iii) a sequence-of-interest,(iv) a universal adaptor sequence having a binding sequence for a reverse sequencing primer,(v) a universal adaptor sequence having a binding sequence for a compaction oligonucleotide, and(vi) a universal adaptor sequence having a binding sequence for the second portion of the same given splint capture primer; wherein the contacting is conducted under a condition suitable for generating a plurality of immobilized open circle library molecules from the linear library molecules, wherein individual immobilized open circle library molecules comprise a nick between the 5’ and 3’ ends of individual library molecules, wherein the nick is enzymatically ligatable, and wherein individual immobilized open circle library molecules comprise a first portion of a splint capture primer hybridized to the universal adaptor sequence having a binding sequence for the first portion of the splint capture primer and a second portion of the same splint capture primer hybridized to the universal adaptor sequence having a binding sequence for the secondportion of the splint capture primer, wherein the plurality of immobilized open circle library molecules comprises a first sub-population comprising immobilized open circle library molecules having at least one deaminated base and a second sub-population comprising immobilized open circle library molecules lacking a deaminated base; c) contacting the plurality of immobilized open circle library molecules with a ligase enzyme to generate a plurality of immobilized covalently closed circular library molecules, wherein individual covalently closed circular library molecules are hybridized to an immobilized splint capture primer; d) contacting the plurality of immobilized covalently closed circular library molecules with a deamination reagent comprising:(vii) (i) at least one enzyme having glycosylase activity which generates one or more abasic sites in a covalently closed circular library molecule, and(ii) at least one enzyme having lyase activity which releases the abasic sites to generate one or more gaps in the covalently closed circular library molecule, thereby generating a first sub-population of immobilized covalently closed circular library molecules carrying one or more gaps and a second sub-population of immobilized covalently closed circular library molecules having intact covalently closed circular library molecules, thereby generating a plurality of immobilized linearized library molecules from the second sub-population of immobilized covalently closed circular library molecules, and retaining the second sub-population of immobilized covalently closed circular library molecules having intact covalently closed circular library molecules, thereby reducing the number of nucleic acid library molecules carrying at least one deaminated nucleotide base from in a plurality of library molecules.

2. The method of claim 1, further comprising (e) contacting the plurality of immobilized covalently closed circular library molecules with a rolling circle amplification reagent to generate a plurality of immobilized nucleic acid concatemer template molecules immobilized to the support.

3. The method of claim 1 or 2, further comprising (f) sequencing the plurality of immobilized nucleic acid concatemer template molecules to determine the sequence of at least a portion of the immobilized nucleic acid concatemer template molecules.

4. The method of claim 3, wherein the sequencing of step (f) comprises conducting pairwise sequencing which comprises sequencing the plurality of immobilized concatemer template molecules thereby generating a plurality of first strand reads (Rl), replacing the plurality of immobilized concatemer molecules by conducting a primer extension reaction to generate a plurality of second concatemer strands each having a sequence that is complementary to a sequence of the immobilized concatemer template molecules, removing the plurality of immobilized concatemer template molecules while retaining the plurality of second concatemer strands, and sequencing the plurality of second concatemer strands thereby generating a plurality of second strand reads (R2).

5. The method of claim 4, wherein the sequencing the plurality of second concatemer strands comprises conducting dark sequencing using a plurality of reverse sequencing primers, a plurality of non-labeled nucleotide reagents and a plurality of sequencing polymerases, wherein the non-labeled nucleotide reagents can incorporate into the 3’ end of the reverse sequencing primers thereby extending the reverse sequencing primers, and wherein incorporation of the non-labeled nucleotide reagents is not detected.

6. The method of claim 5, wherein the dark sequencing is conducted for 2-30 consecutive cycles.

7. The method of any one of claims 4-6, wherein sequencing the plurality of second concatemer strands comprises conducting dark sequencing for 2-30 consecutive sequencing cycles of the initial portion of the second concatemer strands.

8. The method of any one of claims 1-7, wherein the at least one enzyme having glycosylase activity comprises any one or any combination of formamidopyrimidine DNA glycosylase (fpg); uracil N-glycosylase (UNG); uracil DNA glycosylase (UDG); 8- oxoguanine glycosylase (OGG including thermostable OGG); DNA (apurinic) lyase; DNA (apyrimidinic) lyase; and / or endonuclease III.

9. The method of any one of claims 1-8, wherein the at least one enzyme having lyase activity comprises any one or any combination of AP lyase, Endo IV endonuclease, FPGglycosylase / AP lyase (formamidopyrimidine DNA glycosylase), Endonuclease VIII glycosylase / AP lyase and / or endonuclease III.

10. The method of any one of claims 2-9, wherein the rolling circle amplification reagent of step (e) comprises a strand displacing polymerase and a plurality of nucleotides comprising dATP, dGTP, dCTP, dTTP and dUTP.

11. The method of claim 10, wherein the rolling circle amplification reagent generates a plurality of immobilized concatemers carrying at least one uracil.

12. The method of claim 11, wherein the at least one uracil is distributed at random positions along individual immobilized concatemers molecules in the plurality of immobilized concatemer molecules.

13. The method of any one of claims 2-12, wherein the rolling circle amplification reagent of step (e) comprises a plurality of compaction oligonucleotides, wherein individual compaction oligonucleotides comprise a 5’ region, and a 3’ region, and wherein the 5’ and 3’ regions of a given compaction oligonucleotide can hybridize to binding sites in a given immobilized nucleic acid concatemer template molecule to pull together distal portions of the given immobilized nucleic acid concatemer template molecule causing compaction of the immobilized nucleic acid concatemer template molecule to form a DNA nanoball.

14. The method of claim 13, wherein individual compaction oligonucleotides comprise an internal region between the 5’ region and the 3’ region.

15. The method of any one of claims 3-14, wherein sequencing the plurality of immobilized nucleic acid concatemer template molecules comprises: a) contacting the plurality of immobilized nucleic acid concatemer template molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contacting is conducted under a condition suitable to form a plurality of complexed sequencing polymerases, individual complexed sequencing polymerases comprising a sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises an immobilized nucleic acid concatemer template molecule hybridized to a soluble sequencing primer, thereby providing hybridized sequencing primers;b) contacting the plurality of complexed sequencing polymerases with a plurality of nucleotides under a condition suitable for binding at least one nucleotide to the complexed sequencing polymerase, wherein the plurality of nucleotides comprises at least one nucleotide analog labeled with a fluorophore and having a removable chain terminating moiety at the sugar 3’ position; c) incorporating at least one nucleotide into the 3’ end of the hybridized sequencing primers, thereby generating a plurality of nascent extended sequencing primers; and d) detecting the incorporated nucleotide and identifying the nucleo-base of the incorporated nucleotide, wherein the identifying of the nucleo-base comprises base calling.

16. The method of claim 15, wherein individual nucleotides within the plurality of nucleotides comprise a removable chain terminating moiety at the 3’ sugar group, optionally wherein the removable chain terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, azido group, O- azidomethyl group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, acetal group or silyl group, and wherein the removable chain terminating moiety is cleavable with a chemical compound to generate an extendible 3 ’OH moiety on the sugar group.

17. The method of claim 15 or 16, wherein the plurality of nucleotides comprises one type of nucleotide selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

18. The method of claim 15 or 16, wherein the plurality of nucleotides comprises a mixture of any two or more types of nucleotides selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

19. The method of any one of claims 3-14, wherein sequencing the plurality of immobilized nucleic acid concatemer template molecules comprises: a) contacting the plurality of immobilized nucleic acid concatemer template molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of the soluble sequencing primers, wherein the contacting is conducted under a condition suitable to form aplurality of first complexed sequencing polymerases, individual first complexed sequencing polymerases comprising a sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises an immobilized nucleic acid concatemer molecule hybridized to a soluble sequencing primer; b) contacting the plurality of first complexed sequencing polymerases with a plurality of detectably labeled multivalent molecules to form a plurality of multivalent- complexed polymerases, under a condition suitable for binding complementary nucleotide moieties of the multivalent molecules to at least two of the plurality of first complexed sequencing polymerases, thereby forming a plurality of multivalent-complexed polymerases, wherein the suitable condition inhibits incorporation of the complementary nucleotide moieties into the soluble sequencing primers of the plurality of multivalent-complexed polymerases, wherein individual multivalent molecules in the plurality of multivalent molecules comprise a core attached to multiple nucleotide arms and each nucleotide arm is attached to a nucleotide moiety; c) detecting the plurality of multivalent-complexed polymerases; and d) identifying the nucleo-base of the complementary nucleotide moieties that are bound to the plurality of first complexed sequencing polymerases in the plurality of multivalent-complexed polymerases, thereby determining the sequence of the nucleic acid template, wherein the identifying of the nucleo-base comprises base calling.

20. The method of claim 19, further comprising: e) dissociating the plurality of multivalent-complexed polymerases and removing the plurality of first sequencing polymerases and their bound multivalent molecules, and retaining the plurality of nucleic acid duplexes; f) contacting the plurality nucleic acid duplexes retained at step (e) with a plurality of second sequencing polymerases, wherein the contacting is conducted under a condition suitable for binding the plurality of second sequencing polymerases to the plurality nucleic acid duplexes, thereby forming a plurality of second complexed sequencing polymerases, individual second complexed sequencing polymerases comprising a second sequencing polymerase bound to a nucleic acid duplex; g) contacting the plurality of second complexed sequencing polymerases with a plurality of nucleotides comprising at least one non-labeled nucleotide analog having aremovable chain terminating moiety at the sugar 3’ position, wherein the contacting is conducted under a condition suitable for: i. binding complementary nucleotides from the plurality of nucleotides to at least two of the second complexed sequencing polymerases of step (f), thereby forming a plurality of nucleotide-complexed polymerases; and ii. promoting incorporation of the bound complementary nucleotides into the sequencing primers of the nucleotide-complexed polymerases.

21. The method of any one of claims 15-20, wherein the soluble sequencing primers comprise soluble universal sequencing primers.

22. A method for sequencing by forming at least one avidity complex, comprising: a) binding a first universal sequencing primer, a first sequencing polymerase, and a first detectably labeled multivalent molecule to a first portion of the immobilized nucleic acid concatemer template molecule of produced by the method of claim 19, thereby forming a first binding complex, wherein a first nucleotide moiety of the first multivalent molecule binds to the first sequencing polymerase; b) binding a second universal sequencing primer, a second sequencing polymerase, and the first detectably labeled multivalent molecule to a second portion of the same immobilized nucleic acid concatemer template molecule, thereby forming a second binding complex, wherein a second nucleotide moiety of the first multivalent molecule binds to the second sequencing polymerase, wherein the first and second binding complexes bound to the same multivalent molecule form an avidity complex, wherein the first detectably labeled multivalent molecule comprises a core attached to multiple nucleotide arms and each nucleotide arm is attached to a nucleotide moiety, wherein the immobilized nucleic acid concatemer template molecule comprises two or more tandem repeat sequences of a sequence of interest (110) and a universal primer binding site that binds the first and second universal sequencing primers, and wherein the contacting is conducted under a condition suitable to inhibit polymerase-catalyzed incorporation of the bound first and second nucleotide moieties in the first and second binding complexes; c) detecting the first and second binding complexes on the same immobilized nucleic acid concatemer template molecule, and d) identifying the first nucleotide moiety in the first binding complex, thereby determining the sequence of the first portion of the immobilized concatemer templatemolecule, and identifying the second nucleotide moiety in the second binding complex, thereby determining the sequence of the second portion of the immobilized concatemer template molecule, wherein the identifying of the first nucleotide moiety and the identifying of the second nucleotide moiety comprises base calling.

23. The method of any one of claims 19 or 22, wherein the plurality of nucleotide arms attached to the core of the individual multivalent molecules have the same type of a nucleotide moiety, and wherein the type of nucleotide moiety is selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

24. The method of any one of claims 19 or 22, wherein the plurality of multivalent molecules comprises a mixture of any combination of two or more types of multivalent molecules each type having nucleotide moieties selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

25. The method of any one of claims 15-18, wherein individual nucleotides within the plurality of nucleotides comprise a removable chain terminating moiety at the 3’ sugar group, wherein the removable chain terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, azido group, O- azidomethyl group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, or silyl group, and wherein the removable chain terminating moiety is cleavable with a chemical compound to generate an extendible 3 ’OH moiety on the sugar group.

26. The method of any one of claims 15-18, wherein the plurality of nucleotides comprises one type of nucleotide selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

27. The method of any one of claims 15-18, wherein the plurality of nucleotides comprises a mixture of any combination of two or more types of nucleotides selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP.

28. The method of any one of claims 1-27, wherein the support comprises a glass or plastic substrate.

29. The method of any one of claims 1-28, wherein the support is passivated with at least one hydrophilic polymer coating having a water contact angle of no more than 45 degrees.

30. The method of claim 29, wherein the at least one hydrophilic polymer coating comprises a molecule selected from the group consisting of polyethylene glycol (PEG), poly(vinyl alcohol) (PVA), poly(vinyl pyridine), poly(vinyl pyrrolidone) (PVP), poly(acrylic acid) (PAA), polyacrylamide, poly(N-isopropylacrylamide) (PNIPAM), poly(methyl methacrylate) (PMA), poly(2 -hydroxylethyl methacrylate) (PHEMA), poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA), polyglutamic acid (PGA), poly-lysine, polyglucoside, streptavidin, and dextran.

31. The method of any one of claims 1-30, wherein the plurality of immobilized splint capture primers is located at pre-determined locations on the polymer-coated support.

32. The method of any one of claims 1-30, wherein the plurality of immobilized splint capture primers is located at random locations on the polymer-coated support.

33. The method of any one of claims 1-32, wherein the plurality of immobilized nucleic acid concatemer template molecules on the support are in fluid communication with each to permit flowing a solution of reagents onto the support so that the plurality of immobilized nucleic acid concatemer template molecules can be essentially simultaneously reacted with the reagents in a massively parallel manner.

34. The method of claim 33, wherein the reagents comprise one or more enzymes, nucleotides, divalent cations, or a combination thereof.

35. The method of any one of claims 3-34, further comprising: determining the percent base call error from the sequencing of step (f).

36. The method of claim 35, further comprising determining the quality score of the sequencing data from the percent base call error.

37. The method of claim 36, wherein the quality score increases from Q30 to Q40 or Q50 when a deamination reagent is employed at step (c) compared to a method that lacks employing a deamination reagent at step (c).

38. The method of claim 36 or 37, wherein the quality score of the first strand reads (Rl) increases from Q30 to Q40 or Q50 when a deamination reagent is employed at step (c) compared to the same method that lacks employing a deamination reagent at step (c).

39. The method of any one of claims 36-38, wherein the quality score of the second strand reads (R2) increases from Q30 to Q40 or Q50 when a deamination reagent is employed at step (c) compared to the same method that lacks employing a deamination reagent at step (c).