Platelet progenitors for thrombocytopenia
Patent Information
- Authority / Receiving Office
- CA · CA
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-02-13
- Publication Date
- 2025-08-21
AI Technical Summary
There is a constant demand for donor-independent, long-lasting, and readily available platelets to overcome dependency on donors for platelet transfusions, particularly for thrombocytopenia patients, as existing platelets have a very short storage life and hospitals rely on donor supply.
A co-culture system utilizing mesenchymal stem cells (MSCs) with CD34+ cells, supplemented with specific reagents like SCF, TPO, IL-6, FLT3-ligand, and ROCK inhibitors, facilitates the expansion and differentiation of megakaryocytes and platelets, which are manipulated to be HLA-I depleted and HLA-E overexpressing to avoid immune rejection, all conducted in serum-free conditions.
The system achieves a significant expansion potential of megakaryocytes, producing up to 1000-fold more platelets than starting cells, with enhanced efficacy and reduced immune reaction risk, providing a reliable source of platelets for thrombocytopenic patients.
Abstract
Description
PLATELET PROGENITORS FOR THROMBOCYTOPENIA
[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 553,082, filed February 13, 2024, which is incorporated by reference herein in its entirety.SEQUENCE LISTING[0001.5] The instant application contains a Sequence Listing which has been submitted in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on February 13, 2025, is named MDAC.P1385WO - Sequence Listing.xml and is 4,567 bytes in size.TECHNICAL FIELD
[0002] Embodiments of the disclosure concern at least the fields of cell biology, molecular biology, cell culture, and medicine.BACKGROUND
[0003] More than 2 million platelet units are transfused annually in the U.S. to treat thrombocytopenia patients. There has been a constant demand for apheresis-derived platelet products for patients receiving chemotherapy, undergoing surgery, or who have underlying thrombocytopenia of any cause, for example. Platelets have a very short storage life, and hospitals are dependent on the donors to replenish the transfusion unit supply. To overcome dependency on donors, there is a need for development of donor-independent, long-lasting, and readily available platelets, including at least to be used for transfusion units. The present disclosure satisfies this need.BRIEF SUMMARY
[0004] Embodiments of the present disclosure are directed to systems, methods, and compositions that facilitate production of megakaryocytes and platelets. In specific embodiments, megakaryocytes produced in methods of the disclosure generate the platelets. Particular embodiments encompass specific reagents, conditions, timings, and / or certain cell manipulations to produce desired cells. Embodiments of the disclosure include systems and methods in which a linear sequence of events and specific, intentional steps result in expansion and differentiation and collection for desired cells, including megakaryocytes and / or platelets. The system and methods disclosed herein utilize selected media having one or more desired reagents and conditions thatfacilitate the expansion and differentiation of particular cells. In some embodiments, the system may utilize a process including a series of steps (or, in some cases, steps that may be occurring substantially at the same time for different non- synchronous populations of cells in the same system). In any event, the disclosure provides a universal measure to overcome platelet transfusion-related refractoriness.
[0005] In particular embodiments, the present disclosure concerns co-culture of at least two populations of cells that allows expansion and differentiation of a specific, desired population of cells. In specific embodiments, an initial or at least early step in the system and process includes co-culture of mesenchymal stem cells (MSCs) with CD34+ cells (including CD34+-enriched stem cells). In certain embodiments, the use of allogenic MSCs may be advantageous for providing superior support for stem cell expansion and differentiation. In specific embodiments, the system and methods of the disclosure avoid use of artificial extracellular matrices to prevent the apoptosis of the stem cells in co-culture. In some embodiments, fibronectin is utilized to seed the quantum bioreactor, although in particular cases fibronectin is not utilized in cell culture flasks. In particular embodiments, the MSCs and CD34+ cells are derived from a particular source, such as cord blood, bone marrow, adipose tissue, or a mixture thereof. Any CD34+ cells may be selected by positive enrichment or negative selection, or both.
[0006] During at least some parts of methods encompassed herein, the co-culture of two populations of cells may be subjected to media that comprises one or more particular reagents for at least part of the method, including stem cell factor (SCF), thrombopoietin (TPO), IL-3, FLT3- ligand, IL-6, and / or one or more Rho associated coiled - coil containing protein kinase (ROCK) inhibitors, such as N-(2-(3,8-diazabicyclo[3.2.1]octan-8-yl)-5-chloropyrimidin-4-yl)-lH-indazol- 5-amine hydrochloride (which may be referred to herein as KD045). In some embodiments, the ROCK inhibitor comprises Belumosudil (KD025; 2-[3-[4-(lH-Indazol-5-ylamino)quinazolin-2- yl]phenoxy]-N-propan-2-ylacetamide). In some embodiments, the ROCK inhibitor comprises an anti-PD-Ll / IL-15 fusion protein(KD033). The ROCK inhibitor may or may not be a pan-ROCK inhibitor that inhibits multiple ROCK enzymes.
[0007] In some embodiments, the MSCs and / or the CD34+ cells have been manipulated to express one or more heterologous genes and / or to inhibit expression of one or more endogenous genes. In specific embodiments, the MSCs and / or the CD34+ cells may be manipulated prior to initiation of the expansion process, although in other embodiments any of the cells may bemanipulated subsequent to initiation of the expansion process, or at the same time. In some cases, the MSCs and / or the CD34+ cells may be manipulated to have reduced or completely inhibited expression of endogenous ROCK in the MSCs and / or the CD34+ cells. In specific cases, endogenous ROCK1 (also called ROCK I, ROKp, Rho-kinase P, or pl60ROCK) and / or ROCK2 (also known as ROCK II, ROKa, or Rho kinase) have reduced or completely inhibited expression in the MSCs and / or the CD34+ cells. In some embodiments, any step or point(s) in time in the process may employ one or more ROCK inhibitors in the media for the cell culture; in a specific case, one or more ROCK inhibitors are utilized following production of megakaryocytes, such as during platelet production and / or harvest. In particular embodiments, the ROCK inhibitor is KD045.
[0008] In particular embodiments, the MSCs and / or the CD34+ cells are manipulated and / or exposed to conditions that allow platelets produced therefrom to have an enhanced efficacy (e.g., compared to absence of the manipulations and / or conditions) upon delivery to an individual in need thereof, including an individual that is allogenic with respect to the original source of the respective MSCs and / or the CD34+ cells. In at least some cases, the MSCs and / or the CD34+ cells are manipulated such that platelets ultimately produced by their co-culture do not elicit a deleterious immune system reaction in the recipient individual. In at least some cases, the MSCs and / or the CD34+ cells (including from cord blood) are manipulated such that platelets ultimately produced by their co-culture are HLA-I depleted-derived megakaryocyte and platelets. In specific embodiments, the MSCs and / or the CD34+ cells are manipulated such that platelets ultimately produced by their co-culture are not destroyed by T cells and / or NK cells in the recipient individual. In specific embodiments, the MSCs and / or the CD34+ cells are manipulated to have a knock-in of HLA-E. The HLA-E knock-in may be anywhere at the beta-2-microglobulin (B2M) locus of the respective MSCs and / or the CD34+ cells, in certain embodiments. The knock-in may reduce, including completely deplete in at least some cases, the expression of HLA-I, including B2M, by the MSCs and / or CD34+ cells. Any manipulation of MSCs and / or the CD34+ cells may or may not be CRISPR-Cas9 mediated. In some embodiments, any cells encompassed herein have reduced or eliminated expression of a HLA class I or class II gene product (e.g., Class I A, B or C; Class II Dr, DP, DQ). In specific embodiments, the CD34+ cells have been manipulated to comprise a knock-in of HLA class I histocompatibility antigen, alpha chain E (HLA-E), at the genomic locus of P2-microglobulin (02M), thereby reducing or eliminating expression of the corresponding HLA class I gene product in the CD34+ cells.
[0009] In particular embodiments, the system and methods include expansion, differentiation, and platelet production all in media that has the same composition (and that may or may not be changed at particular timepoints) and / or all in the same vessel, although in alternative embodiments different vessels are utilized and / or different steps of the process utilize media having different composition. The system may be GMP -grade compliant, in specific embodiments. The system and methods may be serum-free, including free of bovine serum albumin or any other lipid supplements, in at least some cases.
[0010] The present MSC / CD34+ stem cell co-culture system allows for significantly improved expansion potential of megakaryocytes in the co-culture system, including in specific embodiments at least 10-, 20-, 30-, 40-, 50-, 60-, 70-, 80-, 90-, 100-, 125-, 150-, 175-, 200-, 225-, 250-, 275-, 300-, 325-, 350-, 375-, 400-, 425-, 450-, 475-, 500-, 600-, 700-, 800-, 900-, or 1000- fold or greater compared to starting cells.
[0011] Embodiments of the disclosure include methods of producing megakaryocytes in an ex vivo system, comprising the step of co-culturing mesenchymal stem cells (MSCs) with CD34+ cells in one or more vessels or substrates in the presence of media comprising an effective amount of agents, said agents comprising, consisting essentially of, or consisting of one or more of stem cell factor (SCF), thrombopoietin (TPO), interleukin 6 (IL-6), IL-3, FLT-31igand, and a ROCK inhibitor under conditions to produce the megakaryocytes, wherein in some cases the CD34+ cells have been manipulated to comprise a knock-in of HLA class I histocompatibility antigen, alpha chain E (HLA-E) at the genomic locus of P2-microglobulin (02M) in the CD34+ cells, thereby reducing or eliminating expression of the HLA class I gene product in the CD34+ cells. In some embodiments, the method further comprises the step of enhancing production of platelets from the megakaryocytes. At least the majority of the CD34+ cells and / or the MSCs may be derived from cord blood, bone marrow, and / or adipose tissue, in certain embodiments. The vessel may further comprise an effective amount of one or more inhibitors of ROCK in addition to KD045, such as Y27632, GSK269962, Azaindole 1, RKL1447, GSK429286a, GSK180736a, fasudil, hydroxyfasudil, KD025, KD033, or a combination thereof, and the one or more ROCK inhibitors may inhibit ROCK1 and / or ROCK2.
[0012] In particular embodiments, the media comprises or does not comprise one or more particular components or have certain concentrations for certain components. For example, the media may lack serum. In some cases, the concentration of SCF may be in the range of 25-50ng / mL and may be 20, 25, 30, 35, 40, 45, or 50 ng / mL, in some embodiments; the concentration of TPO may be in the range of 50-300 ng / mL and may be 75, 100, 125, 150, 175, 200, 225, 260, 275, or 300 ng / mL; the concentration of IL-6 may be in the range of 10-100 ng / mL and may be 25, 50, 75, or 100 ng / mL; the concentration of IL-3 may be in the range of 1-10 ng / mL and may be 1, 2, 3, 4, or 5 ng / mL; and the concentration of FLT3 -ligand may be in the range of 1-25 ng / mL and may be 1, 2, 3, 4, or 5 ng / mL. In specific embodiments, the concentration of SCF, TPO, and IL-6 are substantially the same, such as about 50 ng / mL.
[0013] In specific embodiments, at least part of the method comprises agitation of the one or more vessels or substrates. The agitation may or may not occur during a co-culture, including the co-culture between MSCs and CD34+ cells. The agitation may occur during the production and / or harvesting of platelets. The agitation may or may not occur at a desired angle, such as about 8-9°. The agitation may be sufficient to induce shear stress on the megakaryocytes. In particular embodiments, at least part of the method encompassed herein occurs in a hollow fiber bioreactor.
[0014] In particular embodiments, the megakaryocytes are reused to produce additional platelets. In certain aspects, cells are obtained from the media to analyze them for expression of one or more megakaryocyte markers (such as CD42b, CD41a, CD61, or a combination thereof). The cells may be obtained from the media about 10-12 days from the beginning of the co-culture. The cells may be obtained from the media about 22-24 days from the beginning of the co-culture. In certain embodiments, platelets are obtained from the media, including obtained from the media multiple times, and a certain duration of time between obtaining the platelets may be desired, such as about 3 days. Following procurement of the platelets at different, they may be combined. In any case, the platelets may be analyzed, such as analyzed for aggregation.
[0015] In certain embodiments, the method comprises the step of subjecting the MSCs, CD34+ cells, and / or megakaryocytes to an effective amount of one or more means of fucosylation of the CD34+ cells, MSCs, and / or megakaryocytes. The means of fucosylation may comprise one or more fucosyl-transferase enzymes along with GDP fucose substrate. The media may comprise an effective amount of one or more fucosyl-transferase enzymes.
[0016] In certain embodiments, there is a method of producing platelets that avoid a host individual’s deleterious immune reaction, comprising the steps of: (a) in at least part of the method, co-culturing mesenchymal stem cells (MSCs) with CD34+ cells in one or more vessels or substrates in the presence of media comprising an effective amount of one or more agents, saidagents comprising, consisting essentially of, or consisting of SCF, TPO, IL-6, IL-3, FLT3-ligand, and / or KD045 under conditions to produce the megakaryocytes, wherein the CD34+ cells may or may not have been manipulated to comprise a knock-in of HLA-E at the genomic locus of B2M in the CD34+ cells, thereby reducing or eliminating expression of HLA-I and / or B2M in the CD34+ cells, thereby producing megakaryocytes; and (b) subjecting the megakaryocytes to suitable conditions to produce an effective amount of the platelets. In some cases, the suitable conditions of step (b) comprise an effective amount of one or more ROCK inhibitors in the media. The steps of (a) and (b) may or may not occur in the same vessel or substrate.
[0017] In particular embodiments an effective amount of any platelets encompassed herein are provided to an individual in need thereof. In some cases, the individual in need thereof has thrombocytopenia, cancer, an immune system disorder, anemia, hepatitis C, HIV, is on chemotherapy, is receiving radiation, is taking medication that causes low platelets, bone marrow disease, blood disease, aplastic anemia, coronavirus infection, is receiving and / or will receive an organ or bone marrow transplant, has a traumatic injury, is an individual undergoing and / or that will undergo heart surgery, is a bum victim, or a combination thereof.
[0018] In certain embodiments, there is a method of treating an individual in need of platelets, comprising the step of administering to the individual an effective amount of platelets produced by any method encompassed herein, wherein the individual has thrombocytopenia, cancer, an immune system disorder, anemia, hepatitis C, HIV, is on chemotherapy, is receiving radiation, is taking medication that causes low platelets, bone marrow disease, blood disease, aplastic anemia, coronavirus infection, is receiving and / or will receive an organ or bone marrow transplant, has a traumatic injury, is an individual undergoing and / or that will undergo heart surgery, is a burn victim, or a combination thereof..
[0019] In some embodiments, there is a system comprising, consisting of, or consisting essentially of an effective amount of one or more of the following: MSCs; CD34+ cells, or, optionally, CD34+ cells comprising a knock in of HLA-E at the B2M genomic locus; a vessel or substrate; media; SCF; TPO; IL-6; IL-3, FLT3 -ligand, one or more ROCK inhibitors, including KD045; and, optionally, one or more fucosyl-transferase enzymes.
[0020] The foregoing has outlined rather broadly the features and technical advantages of the present disclosure in order that the detailed description that follows may be better understood. Additional features and advantages will be described hereinafter which form the subject of theclaims herein. It should be appreciated by those skilled in the art that the conception and specific embodiments disclosed may be readily utilized as a basis for modifying or designing other structures for carrying out the same purposes of the present designs. It should also be realized by those skilled in the art that such equivalent constructions do not depart from the spirit and scope as set forth in the appended claims. The novel features which are believed to be characteristic of the designs disclosed herein, both as to the organization and method of operation, together with further objects and advantages will be better understood from the following description when considered in connection with the accompanying figures. It is to be expressly understood, however, that each of the figures is provided for the purpose of illustration and description only and is not intended as a definition of the limits of the present disclosure.BRIEF DESCRIPTION OF THE DRAWINGS
[0021] For a more complete understanding of the present disclosure, reference is now made to the following descriptions taken in conjunction with the accompanying drawings.
[0022] FIGS. 1A-1G. Expanded CB- megakaryocytes (MKs) can be detected in various niches and produce functional platelets in a xenograft thrombocytopenia mouse model. 1A) Scheme of CD34+ CB-derived cell differentiation towards MKs in an in vitro coculture system with CB-MSCs, a cytokine cocktail and a ROCK inhibitor. IB) Transmission electron microscopy images of expanded mature MKs with multiple mitochondria and dense and alpha granules. 1C) Scheme of in vivo evaluation of expanded CB-MKs injected into thrombocytopenic mice. ID) Bar graph showing the percentage of hCD41a+ hCD42+ chimerism in various niches at 4 weeks postinfusion of 7xl06expanded MKs. IE) Scheme of in vivo evaluation of platelet functionality in thrombocytopenic mice treated with CB-MKs. IF) Bar graph showing CB-MK-derived circulating platelet chimerism in mice after transfusion of 15xl06CB-MKs generated with the ROCK inhibitor KD045 compared to the control (without KD045). *P < 0.05, **P < 0.01, one-way ANOVA with Tukey's multiple comparisons test. 1G) Bar graph showing the bleeding times of thrombocytopenic mice treated with 15xl06control CB-MKs on KD045-treated CB-MKs. ***P < 0.001 using paired t-test.
[0023] FIG. 2. One example of a scheme of three-step culture protocol for the manufacture of CB-derived MK expanded cells and platelets describing the process and the preparation of the final formulation.
[0024] FIGS. 3A-3J. MKs and platelets were produced from CB-derived CD34+ cells using a bioreactor MSC-coculture system. Bar graphs indicate the percentage of CB CD34+ cells 3A), total nucleated cells 3B), percentage of CD41a+ / CD61+ cells 3C), and percentage of CD41a+ / CD61+ / CD42b+ cells 3D) at different steps of the culture. 3E) Flow cytometry analysis of CD41a, CD34, CD61, and CD42b expression on the expanded MKs at day 23. 3F) Phase contrast images of MKs on day 6 and day 10. Scale bars represent 10 pm. 3G) Giemsa staining of mature and immature MKs. Scale bars represent 50 pm. 3H) Polyploidy analysis of MKs assessed using draq7 staining and flow cytometry. 31) The yield of CD34+ CB-MKs in the final product. The TNC and platelet count were performed using a Sysmex and CD41a / CD61 expression was determined by flow cytometry. 3J) Platelet aggregation profile of the final product (MKs / platelets) compared with human platelets and media control (negative) induced by thrombin (0.1U) as an activator.
[0025] FIGS. 4A-4B FIGS. 4A and 4B show examples of schematic representations of a co-culture system of the disclosure. In specific cases, there is a strategy for the production of mature megakaryocytes from cord blood (CB) CD34+ cells, isolated at day 0, in a MSC co-culture system that can be followed on Day 23 (for example) with transfer of cellular matrix from Flask to a G-Rex® bioreactor for optimal expansion. Beta2-microglobulin knockout (KO) may take place around day 3 using CRISPR-Cas9 system (for example). The cellular matrix may be divided into two G-Rex® bioreactors around day 10 two (for example). One of the cultures may be transferred to a Quantum bioreactor at approximately day 19 (for example) to induce platelet production by using shear stress. Media may be changed every 2-4 days (e.g., 3 times a week), merely as examples. Harvesting of megakaryocyte (MK) and / or platelets may take place around day 23 from the appropriate bioreactor (MK may be collected from G-Rex®, platelet may only be collected from the quantum bioreactor, in specific embodiments).
[0026] FIGS. 5A-5B. FIG. 5A depicts the HLA-ABC expression (HLA-I) on the surface of the live cells in the culture at day 9, 6 days after electroporation using the abovementioned 4 sgRNA constructs. FIG. 5B depicts the HLA-ABC expression (HLA-I) on the surface of the live cells and on CD41 positive cells (MK) at day 23 of culture (20 days after electroporation) using the Lonza 4D-Nucleofector® System, utilizing 3 different electroporation programs (CA-137, CA- 189, CM-137). The X-axis reads from -103, 0, 103, 104, and 105. The Y-axis reads from 0, 50K, 100K, 150K, 200K, and 250K.
[0027] FIG. 6 depicts the aggregation of control apheresis platelets (apheresis PLT) compared with platelets produced from B2MK0 MK. Platelets were collected at day 23 of culture (20 days after electroporation) using the Lonza 4D-Nucleofector® System, utilizing 3 different electroporation programs (CA-137, CA-189, CM- 137). 3xl05platelets were used for the assay, stimulated with 0.1U Thrombin.
[0028] FIGS. 7A-7B. FIG. 7A depicts the differential expression of MK and myeloid cell populations at day 19 of culture, prior to adding ROCK inhibitor, without utilizing a MK isolation method. Cells were transitioned to the G-Rex bioreactor at day 10, or left in a flask, with or without valproic acid (VP A), added at day 3 of culture. Pie charts represent the different cell populations with CD41 and CD61 depicting MK, while CD42b expressing cells representing mature MK. Total nucleated cell count (TNC) is noted. FIG. 7B depicts the differential expression of MK and myeloid cell populations at day 19 of culture, prior to adding ROCK inhibitor, without utilizing a MK isolation method. Cells were transitioned to the G-Rex bioreactor at day 10, with or without VP A, added at day 3 of culture, with or without the reversible caspase 3 / 7 inhibitor, Ac-DEVD- CHO (a synthetic peptide aldehyde with the PARP cleavage site DEVD) at a concentration of 10 pM, added at day 10. Pie charts represent the different cell populations with CD41 and CD61 depicting MK, while CD42b expressing cells representing mature MK. TNC is noted. For both images, the X-axis reads 0, 104, and 105. The Y-axis reads -103, 0, 103, 104, and 105.
[0029] FIG. 8 depicts the differential expression of MK and myeloid cell populations at day 19 of culture, prior to adding ROCK inhibitor, without utilizing a MK isolation method. Cells were transitioned to the G-Rex bioreactor at day 10, with or without valproic acid (VP A), added at day 3 of culture, with or without the reversible caspase 3 / 7 inhibitor, Ac-DEVD-CHO at different concentrations (2.5, 5 and 10 pM). Pie charts represent the different cell populations with CD41 and CD61 depicting MK, while CD42b expressing cells representing mature MK. TNC is noted. The X-axis reads 0, 104, and 105. The Y-axis reads -103, 0, 103, 104, and 105.
[0030] FIG. 9 depicts the purity of MK (CD41 positive cells), in addition to contamination with contamination with hematopoietic stem cells (CD34 positive cells) and myeloid cells (CD41 negative / CD34 negative cells) before and after the utilization of MK positive selection. Biotinylated magnetic beads were used together with the following CD61 biotin antibody clones: 2Y / 51, VIPL2, REA 761or with the CD41 biotin antibody clones: REA366. The X-axis reads -103, 0, 103, 104, and 105. The Y-axis reads -103, 0, 103, 104, and 105.
[0031] FIG. 10 depicts the aggregation of control apheresis platelets (apheresis PLT) compared with platelets harvested at day 23 (product), utilizing the exact schematic protocol depicted in FIG. 4, after transferring the megakaryocytes from G-Rex bioreactor to a Quantum bioreactor at day 19 together with ROCK inhibitor. The MK were treated with VP A and the reversible caspase 3 / 7 inhibitor, Ac-DEVD-CHO as depicted in FIG. 4, both were removed from the media at day 19, prior to the transfer to the Quantum bioreactor, as described. 3xl05platelets were used for the assay, stimulated with 0.1U Thrombin.DETAILED DESCRIPTIONI. Examples of Definitions
[0032] As used herein the specification, “a” or “an” may mean one or more. As used herein in the claim(s), when used in conjunction with the word “comprising,” the words “a” or “an” may mean one or more than one. Some embodiments of the disclosure may consist of or consist essentially of one or more elements, method steps, and / or methods of the disclosure. It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined.
[0033] The use of the term “or” in the claims is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or.” For example, “x, y, and / or z” can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.” It is specifically contemplated that x, y, or z may be specifically excluded from an embodiment. As used herein “another” may mean at least a second or more. The terms “about”, “substantially” and “approximately” mean, in general, the stated value plus or minus 5%.
[0034] Throughout this specification, unless the context requires otherwise, the words “comprise”, “comprises” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. By “consisting of is meant including, and limited to, whatever follows the phrase “consisting of.” Thus, the phrase “consisting of indicates that the listed elements are required or mandatory, and that no other elements may be present. By “consisting essentially of is meant including any elements listed after the phrase, and limited to other elements that do notinterfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially of indicates that the listed elements are required or mandatory, but that no other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.
[0035] Reference throughout this specification to “one embodiment,” “an embodiment,” “a particular embodiment,” “a related embodiment,” “a certain embodiment,” “an additional embodiment,” or “a further embodiment” or combinations thereof means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.
[0036] “Treating” or treatment of a disease or condition refers to executing a protocol, which may include administering one or more drugs to a patient, in an effort to alleviate signs or symptoms of the disease. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating, or palliating the disease state, and remission or improved prognosis. Alleviation can occur prior to signs or symptoms of the disease or condition appearing, as well as after their appearance. Thus, “treating” or “treatment” may include “preventing” or “prevention” of disease or undesirable condition. In addition, “treating” or “treatment” does not require complete alleviation of signs or symptoms, does not require a cure, and specifically includes protocols that have only a marginal effect on the patient.
[0037] The term “therapeutic benefit” or “therapeutically effective” as used throughout this application refers to anything that promotes or enhances the well-being of the subject with respect to the medical treatment of this condition. This includes, but is not limited to, a reduction in the frequency or severity of the signs or symptoms of a disease. For example, treatment of cancer may involve, for example, a reduction in the size of a tumor, a reduction in the invasiveness of a tumor, reduction in the growth rate of the cancer, or prevention of metastasis. Treatment of cancer may also refer to prolonging survival of a subject with cancer.
[0038] “Subject” and “patient” and “individual” may be interchangeable and may refer to either a human or non-human, such as primates, mammals, and vertebrates. In particular embodiments, the subject is a human. The subject can be any organism or animal subject that is anobject of a method or material, including mammals, e.g., humans, laboratory animals (e.g., primates, rats, mice, rabbits), livestock (e.g., cows, sheep, goats, pigs, turkeys, and chickens), household pets (e.g., dogs, cats, and rodents), horses, and transgenic non-human animals. The subject can be a patient, e.g., have or be suspected of having a disease (that may be referred to as a medical condition), such as one or more infectious diseases, one or more genetic disorders, one or more cancers, or any combination thereof. The “subject” or "individual", as used herein, may or may not be housed in a medical facility and may be treated as an outpatient of a medical facility. The individual may be receiving one or more medical compositions via the internet. An individual may comprise any age of a human or non-human animal and therefore includes both adult and juveniles (e.g., children) and infants and includes in utero individuals. A subject may or may not have a need for medical treatment; an individual may voluntarily or involuntarily be part of experimentation whether clinical or in support of basic science studies.
[0039] The phrases “pharmaceutical or pharmacologically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic, or other untoward reaction when administered to an animal, such as a human, as appropriate. The preparation of a pharmaceutical composition comprising an antibody or additional active ingredient will be known to those of skill in the art in light of the present disclosure. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biological Standards.
[0040] The term “optionally” as used herein refers to an element, step, or parameter that may or may not be utilized in any method of the disclosure.
[0041] As used herein, “pharmaceutically acceptable carrier” includes any and all aqueous solvents (e.g., water, alcoholic / aqueous solutions, saline solutions, parenteral vehicles, such as sodium chloride, Ringer's dextrose, etc.), non-aqueous solvents (e.g., propylene glycol, polyethylene glycol, vegetable oil, and injectable organic esters, such as ethyloleate), dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial or antifungal agents, anti-oxidants, chelating agents, and inert gases), isotonic agents, absorption delaying agents, salts, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, fluid and nutrient replenishers, such like materials and combinations thereof, as would be known to one of ordinary skill in the art. The pH and exact concentration ofthe various components in a pharmaceutical composition are adjusted according to well-known parameters.II. Embodiments of the Disclosure
[0042] The present disclosure concerns production of desired cells from co-culture of at least two populations of starting cells; the production includes expansion and differentiation steps, followed by harvesting of the desired cells. In particular embodiments, megakaryocytes are produced from a co-culture system that includes at least stem cells as one of the starting populations. In at least some cases, one or more of the initial populations in the co-culture are from cord blood, including human cord blood.
[0043] In specific embodiments, the production of megakaryocytes from the human cord blood (CB) hematopoietic stem cells provides benefits for transfusion medicine. The present disclosure concerns, in particular embodiments, an original approach for the large-scale generation of megakaryocytes (MK) from CB using CB tissue-derived mesenchymal stem cells (MSCs) in a co-culture system. The expansion and differentiation protocols of CB-derived CD34+ cells with MSC co-cultures has been optimized in particular cases to utilize certain reagent(s), condition(s), timing(s), and so forth. In specific embodiments, at least the expansion and differentiation protocols occur in serum-free conditions supplemented with exogenous SCF, TPO, IL-6, IL-3, FLT3-ligand, and / or KD045. In specific embodiments, IL-21 (50-150ng / ml), IL-9 (40-100ng / ml), and / or IL-11 (10-100ng / ml) cytokines can also be added to the method at any time to further enhance the expansion and differentiation potential of megakaryocytes.
[0044] MSC co-culture for the disclosed systems is advantageous in persevering the longterm functions of the hematopoietic stem cells and differentiating megakaryocytes, as it recapitulates the bone marrow microenvironment, where all cells lie in close proximity. These CB- derived ex vivo expanded cells express mature megakaryocyte lineage-specific markers and secrete functional platelets, for example exhibiting CD62P(P-selectin) expression after thrombin receptoractivating peptides (TRAP) stimulation. In certain embodiments, the system and methods are further optimized at the step of the megakaryocyte maturation, platelet secretion, and / or their activation profile upon use of one or more ROCK inhibitors (commercially available, in at least some cases). These expanded megakaryocyte progenitors provide short term platelet support for individuals in need thereof, including at least thrombocytopenic patients.
[0045] The presently disclosed systems and methods address a major problem in transfusion medicine today at least with respect to patients with refractory thrombocytopenia because of sensitization with HLA antibodies [4, 5], The patients do not respond to platelet transfusions, even single donor, and they often experience serious and fatal bleeding complications [6, 7], Certain presently disclosed systems and methods provide strategies to overcome alloimmune antibody-induced rejection of transfused platelets by utilizing genetic engineering, such as clustered regularly interspaced short palindromic repeats / Cas9(CRISPR-Cas9)-induced ablation, to reduce or ablate the expression of HLA genes, including the HLA-I complex molecule P2-microglobulin gene, leading to non-recognition by a host immune system and thereby escape from transfusion-induced thrombocytopenia. This allows for the infusion of CB-derived megakaryocyte progenitors and platelets to evade the alloantibody -mediated destruction and allow them to survive and provide robust platelet support.III. Systems and Methods of Production of Megakaryocytes and Platelets
[0046] The present disclosure concerns systems and methods for producing megakaryocytes, from which platelets may be produced. In some embodiments, the systems and methods utilize a co-culture system to produce megakaryocytes, and in specific cases they concern production of large scale clinical grade mature megakaryocyte and platelet products for any suitable clinical purpose, including therapeutic or preventative. In cases wherein the cells used in the initial step(s) of the system and process are from an individual in need of platelets, the platelets produced by the system and methods may be utilized for the individual in an autologous manner. In cases wherein the cells used in the initial step(s) of the system and process are from an individual or individuals that are not the recipient of the platelets, the platelets produced by the system and methods may be utilized for allogeneic recipients; in such cases, the produced platelets may be used in an off-the-shelf manner. Platelets that are off-the-shelf may or may not be suitably stored prior to use.
[0047] The presently disclosed systems and methods may produce high numbers (for example, at least 109, 1010, 1011, and so forth) of mature megakaryocytes and functional platelets, including cord blood derived mature megakaryocytes and functional platelets. These mature megakaryocytes consistently secrete active platelets and providing a controllable source of platelets from any source, including from HLA-mismatched cord blood sources, for example. In specific embodiments of the disclosure, the mature megakaryocytes retain the ability to consistently produce functional platelets because of an intentional selection of one or more specificreagents, one or more specific conditions, one or more specific timings, and / or one or more specific certain cell manipulations. In specific embodiments, without such one or more specific reagents, one or more specific conditions, one or more specific timings, and / or one or more specific certain cell manipulations, the desired activity and / or numbers of megakaryocytes and / or platelets produced therefrom would not be achievable.
[0048] In particular embodiments, the systems and methods utilize a combination of deliberately chosen (1) two or more cell populations at an initial or at least early starting step for co-culture with (2) a particular combination of reagents (including all or at least some of which are cytokines) for the co-culture; the combination of reagents may be provided in the media and are exogenously added to the media. In alternative embodiments, starting cells are manipulated to express one or more of the exogenous reagents, including one or more of SCF, TPO, IL-3, FLT- 3L, IL-6, and KD045. Such a cocktail may comprise any suitable concentration of the components. Other cytokines like IL-21 (50-150ng / ml), IL-1 l(10-100ng / ml), or IL-9(40-100ng / ml) may be used individually with the cocktail or in various combinations with the cocktail, in specific embodiments for enhanced expansion and differentiation of megakaryocytes. In specific embodiments, the particular combination of reagents comprises, consists essentially or, or consists of SCF, TPO, IL-3, FLT-3L, IL-6, and KD045. In particular embodiments, the systems and methods also have cells in at least one of the two or more cell populations manipulated such that they express one or more exogenous or heterologous genes and / or are manipulated to have knockdown or knock out of one or more endogenous genes in the cells. The exogenous or heterologous gene comprises the HLA class 1 histocompatibility antigen, alpha chain E (HLA-E). In specific cases, cells in at least one of the two or more cell populations are manipulated to be HLA-I depleted and HLA-E overexpressing, which produces megakaryocytes and platelets that are HLA-I depleted and HLA-E overexpressing.
[0049] In particular embodiments, the systems and methods utilize a combination of two cell populations as a co-culture that ultimately generates large quantities of functional megakaryocytes. In specific cases, one or both of the two cell populations are derived from a specific source, such as cord blood (CB), bone marrow and / or adipose. The present systems and methods generate large quantities of megakaryocytes from CB hematopoietic progenitors, in at least some cases. In specific embodiments, one of the initial populations of cells includes CD34+ cells, including CD34+ stem cells, such as from CB. In other embodiments, one of the initial populations of cells includes MSCs, including from CB. In one aspect, the system of the disclosuremimics natural processes in the bone marrow microenvironment by having cells in close proximity.
[0050] In certain embodiments, the systems and methods produce megakaryocytes and platelets that are HLA-I depleted and HLA-E overexpressing, because they are generated from cells that are HLA-I depleted and HLA-E overexpressing. In specific cases, at least some of the starting and some if not all of the resulting megakaryocytes and platelets have HLA-I knockout and HLA-E knock-in, including HLA-E knock-in at an HLA-I genomic locus in the cells. Such a manipulation greatly reduces or eliminates the risk of transfusion-related graft-versus-host disease or any transfusion refractoriness in recipient individual(s). In specific cases, any suitable HLA-I gene is knocked out, but in specific cases, the HLA-I gene is P2-microglobulin (02M).
[0051] FIG. 1 shows embodiments of methods of the disclosure. In FIG. 1 A, mononuclear cells are obtained from cord blood (as one source), and CD34+ cells are selected. The CD34+ cells may or may not be cultured in differentiation media following this. The CD34+ cells are cocultured with MSCs (for example, on MSC monolayers) in particular media that includes ROCK inhibition. Following this, a sufficient number of mature megakaryocytes produce platelets.
[0052] FIG. 2 provides a detailed embodiment of production of the desired cells. In a step in which there is coculture of CD34+ cells with MSCs (both of which populations may be cord blood-derived), a particular media may be employed for a particular duration of time. The media may comprise one or more of TPO, SCF, IL-6, IL-3, FLT3-L, and a ROCK inhibitor, such as KD045, and in some cases this occurs for about 3 days. In some embodiments, after this time period FLT3-L and / or IL-3 are removed from the media while IL-11 may be added, and the cells are further cultured, such as about 6-7 days. After this, the CD34+ cells and MSC cells are enriched by depleting certain cells, including non-MK-lineage cells (e.g., CD3+, CD19+, CD56, CD235a, CD1 lb, CD14+, CD15+, CD33+ and / or CD16+) may be removed using MACS lineage negative-selection kits, such as in combination with CD33+ beads (e.g., on days 9-10 of culture). Following this, the co-culturing may continue in a media comprising TPO, IL-6, SCF, and IL-11) until mature, with media changes including every third day, in at least some aspects. Following this, the expanded MKs are treated with one or more ROCK inhibitors such as KD045, for about 3-4 days. Following this, the platelets may be harvested. The MKs may be further purified and may be washed and combined with a platelet fraction. In some embodiments, there is irradiation of the cells prior to infusion. In some embodiments, the cells are analyzed.
[0053] In some cases, steps may be occurring substantially at the same time for different populations of cells in the same system. For example, the system may include an initial expansion of certain cells to produce an expanded population, and at least some of the cells from the expanded population then undergo differentiation, ultimately resulting in production of megakaryocytes. Platelets are then produced from the megakaryocytes. In such a system, however, depending on the timing and conditions, there may be a cell population undergoing expansion in the same system that at substantially the same time also includes a cell population undergoing differentiation.
[0054] In particular embodiments, systems and methods of the disclosure produce megakaryocytes and platelets that are genetically modified compared to naturally occurring megakaryocytes and platelets, and such genetic modifications occur because the megakaryocytes and platelets are derived from cells that have been so genetically modified. In some cases, the CD34+ cells and / or MSCs are manipulated such that they express one or more exogenous genes and / or they are manipulated to have knockdown or knock out of one or more endogenous genes in the cells. In specific cases, the CD34+ cells and / or MSCs are manipulated to comprise a knock- in of HLA class I histocompatibility antigen, alpha chain E (HLA-E) at the locus of one or more HLA-I gene, including at least P2-microglobulin (02M), and / or HLA-II genes. The knock-in may be anywhere throughout the locus, including spanning any exon, any intron, or any exon-intron junction. The knock-in may replace all or part of the locus with the HLA-E gene. The knock-in may cause a disruption in the expression of the locus leading to a non-transcribable and / or non- translatable nucleic acid sequence. In some cases, the genetic manipulation of the cells occurs after co-culture has begun, whereas in other cases the genetic manipulation of the cells occurs prior to co-culture. This knock out at 02M produces no 02M gene product from the locus, in particular aspects. In specific cases, a fusion of HLA-E with 02M is not utilized as the construct that is knocked in at 02M. Any genetic manipulation of the cells may be by any suitable method, including at least CRISPR, for example.
[0055] In the specific example in which HLA-E is knocked in at 02M, the produced platelets may be advantageous because they will not elicit or have a reduced capacity to elicit a deleterious immune system reaction upon use in a recipient, compared to platelets produced by cells lacking the HLA-E knock-in at 02M. The produced platelets may be particularly useful because (1) they have exogenous expression of HLA-E that will provide a signal for native NK cells in the recipient individual not to kill the platelets; and (2) they lack expression of 02M thatwill result in the native T cells in the individual not being able to recognize the transfused platelets, thereby avoiding their destruction by the native T cells. Therefore, the same modification in the platelets (knock-in of HLA-E at the 02M locus) allows the platelets to be avoided by both NK cells (by gain of a gene / function) and T cells (by loss of a gene / function).
[0056] In some embodiments for the system and methods, the cells in the system are agitated in any manner. In specific cases, the cells are agitated (such as rocked) for a period of time and at a certain part of the method (for example, upon platelet production following production of the megakaryocytes, although in specific cases there is motion of the culture of cells during expansion and / or differentiation). In some cases, the agitation is at a certain angle, such as 8-180 degrees. In at least particular cases, the agitation of the cells at an angle results in shear stress on the megakaryocytes to facilitate platelet release from the megakaryocytes into the media.
[0057] In certain embodiments, the media in the system comprises one or more means for fucosylation of megakaryocytes, such as by including one or more fucosyl-transferase enzymes.
[0058] At any point in the sequence of events for the method, produced cells and / or cells in production may be suitably stored, such as frozen at a suitable temperature (e.g., -80°C or in liquid nitrogen). In some cases, the megakaryocytes are stored (such as frozen) prior to production of platelets.
[0059] Embodiments of the disclosure encompass systems and methods for producing donor-independent platelets, including for platelet transfusion units, wherein platelets are produced from megakaryocytes that are derived from a co-culture of MSCs and CD34+ cells in the presence of at least TPO, SCF, and IL-6. In at least some cases, any cells during the method are genetically manipulated to be HLA-I depleted and HLA-E overexpressing.IV. Methods of Use of Megakaryocytes and Platelets
[0060] Embodiments of the disclosure include methods of using the megakaryocytes and platelets produced by systems and methods of the disclosure. In specific embodiments, an effective amount of platelets (e.g., IxlO8to IxlO12) from the produced megakaryocytes are provided to an individual in need thereof. The administration of the platelets to the individual may or may not follow a storage step following the production of the platelets. In specific embodiments, the platelets are HLA-I depleted and HLA-E overexpressing that reduces the chance of deleterious immunoreactivity in the recipient individual. In any event, the individual may be inneed of one or more transfusions of platelets, including when the individual is not HLA-matched with a donor. The individual may or may not be receiving platelets as a universal off-the-shelf product, in at least some cases. In any event, the platelets may be transfusion grade.
[0061] Any individual in need of platelets may be provide an effective amount of the platelets in any suitable route of administration. In some cases, the individual has cancer; thrombocytopenia for any reason (whether or not with cancer and / or cancer treatment and whether or not from autoimmune or other causes); any bone marrow disease or blood disease that results directly or indirectly in reduced platelet number; anemia; aplastic anemia; coronavirus infection (including SARS-CoV, SARS-CoV-2, MERS, etc.); organ or bone marrow transplants; victim of traumatic injury; individual undergoing heart surgery; burn victim; and so forth. In specific embodiments, a medical facility providing the platelets lacks platelets from an HLA-matched donor. In specific embodiments, the individual is refractory to standard sources of platelets and may have refractory thrombocytopenia.
[0062] Methods of treatment with platelets produced by systems and methods of the disclosure include transfusion related graft-versus-host disease or any transfusion refractoriness. In at least specific cases, the individual has a reduced change of transfusion related graft-versus- host disease or any transfusion refractoriness because the platelets are HLA-I depleted and HLA- E overexpressing, allowing both NK cells and T cells to avoid the platelets. Methods and systems of the disclosure circumvent the need for apheresis-derived platelet products for individuals in need thereof for any reason, including at least for individuals undergoing surgery, for an underlying thrombocytopenia for any purpose, receiving chemotherapy, a combination thereof, and so forth.
[0063] Embodiments of methods of treating in an individual cancer; thrombocytopenia for any reason (whether or not with cancer and / or cancer treatment and whether or not from autoimmune or other causes); any bone marrow disease or blood disease that results directly or indirectly in reduced platelet number; anemia; aplastic anemia; coronavirus infection (including SARS-CoV, SARS-CoV-2, MERS, etc.); organ or bone marrow transplants; victim of traumatic injury; individual undergoing heart surgery; burn victim; and so forth, comprising the step of providing an effective amount of platelets to the individual, wherein the platelets are produced from systems and methods encompassed herein.
[0064] In some embodiments, platelets, including platelet made from megakaryocytes encompassed herein, are lysed to create platelet lysates. The platelet lysates may be used topically. In some embodiments, the platelet lysates are used for hemostasis and / or wound healing. The wounds may be any wound, such as a surgical wound, a diabetic ulcer, or a burn.EXAMPLES
[0065] The following examples are included to demonstrate particular embodiments of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered to function well in the practice of the systems and methods of the disclosure, and thus can be considered to constitute particular modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the systems and methods of the disclosure.EXAMPLE 1GENERATION AND VALIDATION OF MKS GENERATED FROM CB CD34+ CELLS WITH MSC CO-CULTURE
[0066] In initial studies, a modality was developed to produce and expand MK progenitors and MKs in vitro from CB hematopoietic stem and progenitor cells (HSPCs) using various genetic, biochemical, and physical manipulations. This included co-culturing CB CD34+ cells with MSCs in serum-free media containing at least one ROCK inhibitor and a cytokine cocktail over 20 days (FIG. 1A). This strategy yielded differentiated and expanded, platelet-producing CB-MKs (FIG. IB). Using a thrombocytopenia xenograft mouse model (as one example), in which immunodeficient NOD-scid gamma null (NSG) mice are sub-lethally (2.5 Gy) irradiated to induce thrombocytopenia, the CB-MKs could be detected in several organs at 4 weeks following CB-MK infusion (FIGS. 1C and ID) This cellular product also increased platelet counts for at least 14 days in thrombocytopenic mice, indicating that the product continued to produce platelets in vivo after infusion (FIGS. IE and IF) Platelets generated from this product were functional, aggregated in response to various agonists, and reduced bleeding in mice (FIG. 1G).EXAMPLE 2COLLECTION AND EXPANSION OF CB CD34+ CELLS ANDCB-MKS AND PLATELETS
[0067] In initial studies, a dynamic protocol was established to generate platelet-producing MKs from CB, comprising a co-culture system inside of a hollowfiber bioreactor that enabled the mass production of MKs from CD34+ CB cells (FIG. 2). This system enhanced MK / platelet production by using an in vitro MSC co-culture system with cytokines and pharmacological inhibitors to enrich and differentiate CB CD34+ cells and MKs. CB and CB-derived MSCs were obtained from the MDACC Cord Blood and MSC Banks, respectively.
[0068] Approximately 1-3 x 106CD34+ cells / cord (n=15 cords, purity of CD34+ cells >90%) were obtained from CB mononuclear cells (MNCs) following density gradient centrifugation and CD34+ positive selection. CD34+ cells were seeded over MSC monolayers and grown in serum-free good manufacturing practice (GMP) grade SCGM media, supplemented with recombinant human thrombopoietin (TPO, lOOng / ml), IL-6 (50 ng / ml), stem cell factor (SCF, 25 ng / ml), IL-3 (2.5 ng / ml), and FLT3-ligand (FLT3-L, 2.5 ng / ml) (referred to as MK early differentiation media) at 37°C and 5% CO2 for the initial 3 days. After three days, IL-3 and FLT3- L used for the initial myeloid commitment were removed from the culture and the cells were maintained in MK late differentiation media (SCGM supplemented with TPO lOOng / ml, IL-6 50 ng / ml, SCF 25ng / ml, and IL-11 25 ng / ml) until mature, with media changes every third day. Non- MK -lineage cells (CD3+, CD19+, CD56, CD235a, CDl lb, CD14+, CD15+, CD33+ and / or CD16+) were removed using MACS lineage negative-selection kits in combination with CD33+ beads on days 9-10 of culture. To improve the scalable production of MKs / platelets, the inventors optimized a coculture system using the hollow fiber bioreactor. Briefly, CB-derived MSC passage 3 (0.5e8) were seeded in the bioreactor with MSC growth media for 4-5 days until they reached about 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95% or greater of confluency (such as determined by glucose and lactate levels). The enriched population of CD34+ and expanded MKs obtained on day 10 were seeded on the hollowfiber bioreactor, establishing a co-culture system, with late differentiation media (e.g., TPO, IL-6, SCF, and / or IL-11) for 9 days. On day 19, the late differentiation media was supplemented with a ROCK inhibitor, such as KD045, using a pre- established concentration of 0.5uM for 3-4 days. On day 23 the bioreactor was harvested, and the total number of cells and platelets were counted using a Sysmex XN 1000. Platelets were purifiedby sequential centrifugation and resuspended in saline solution and reserved at room temperature. The cell fraction was washed and the MKs were purified using a cocktail of Clinimacs beads against CD34+, CD33+, CD14+, CD3+, and CD16+ (Miltenyi). The purified cells were resuspended in saline solution and combined with the platelet fraction. After 23 days in culture, the percentage of CD34+ cells decreased (FIG. 3A) and the total number of cells increased by several hundred-fold (FIG. 3B) The average number of expanded cells using the bioreactor system was 1.09 x 109at day 23. The percentage of CD41a+CD61+ CB-derived early MKs cocultured with MSCs increased from 38.5% of total cells at day 10 to 78.1% on day 20 (FIG. 3C) and persisted until day 23.EXAMPLE 3PHENOTYPIC CHARACTERIZATION OF CB-DERIVED MKS
[0069] CB-MK differentiation and maturation were examined by evaluating the expression of CD41a / CD61 (allbb3 integrin) and CD42b (GPIba) on each phase of the culture (FIG. 3D), revealing a substantially increased percentage of triple positive cells (CD41a+ / CD61+ / CD42b+) in the culture at day 23 (FIG. 3E). Increases in the size and number of cells were observed during the co-culture expansion (FIG. 3F). Wright-Giemsa staining on the final product demonstrated the presence of large multinuclear cells with granular cytoplasm, which are morphological indicators of MKs (FIG. 3G).EXAMPLE 4ROCK INHIBITION INCREASED MK YIELD AND POLYPLOIDY
[0070] Compared to MKs from adult bone marrow, CB-MKs have defective maturation characterized by impaired endomitosis, lower ploidy and reduced platelet production. Downregulation of Rho signaling is critical in thrombopoiesis. Inhibiting ROCK1 / 2, which is downstream of Rho, enhances MK maturation and platelet shedding. We examined the impact of combining ROCK inhibitors and MSC co-culture on CB-MK maturation. MKs generated in the presence of MSCs and 0.5pM of the ROCK inhibitor KD045 displayed significantly higher ploidy (>8N) than those generated without the ROCK inhibitor. Cells obtained from the final harvest were evaluated by flow cytometry and draq7 staining, revealing a higher presence of cells with 8n (45.8%) and 16n (15.2%) nuclei compared to untreated cells (FIG. 3H).EXAMPLE 5CB-DERIVED PLATELETS ARE FUNCTIONAL
[0071] The total number of platelets produced with the bioreactor system was determined using a Sysmex count during the harvest of the final product. From a single CB unit the inventors were able to produce a total of 0.6el 1 platelets (FIG. 31). Using a light transmission aggregometry assay, it was found that the CB-MK-derived platelets aggregated robustly to 0.1U of thrombin (FIG. 3 J), indicating the platelets are functional.EXAMPLE 6EXAMPLES OF PRODUCTION OF MEGAKARYOCYTES AND PLATELETS
[0072] The present example concerns one embodiment of a novel, robust approach for large-scale generation of MK from CB using CB tissue-derived allogenic MSCs in a serum free co-culture system with a cocktail of exogenous cytokines (SCF, TPO, IL-3, IL-11, FLT3-L and IL-6 in addition to Delta-like protein 1- DLL1). MSCs from other sources can be used including those from bone marrow and / or adipose tissue, for example. This strategy of ex-vivo expansion and differentiation yields mature megakaryocytes that can efficiently and continuously produce a large number of platelets from the terminally differentiated megakaryocytes. The platelets and / or purified megakaryocytes may be utilized in platelet transfusion units, as one example.
[0073] The vessel may comprise an effective amount of one or more inhibitors of histone deacetylases (HD AC), such as valproic acid, romidepsin, vorinostat, belinostat, Panobinostat or a combination of thereof, and the HD AC inhibitor may inhibit one or more of the 18 known human histone deacetylases. The vessel may further comprise an effective amount of one or more reversible inhibitors of caspase endoproteases, such as Ac-DEVD-CHO, DEVD-CHO-CPP 32, M876, M826, (Rac)-M826 or a combination of thereof, and they may inhibit caspase 3 and / or caspase 7 or one or more of the 12 known human caspase endoproteases. The vessel may comprise nicotinamide, which has been reported to decreases in p53 activity, accelerated DNA synthesis, and is reportedly responsible for higher ploidy and delayed apoptosis in MK (by increasing p53 activity, it increases endomitosis and megakaryocyte polyploidization). The vessel may comprise one or more Colony stimulating factor 1 receptor (CSF-1R) inhibitors, such as, but not limited to, at least PLX5622.
[0074] In particular embodiments, the media comprises or does not comprise one or more particular components or have certain concentrations for certain components. For example, the media may or may not lack serum. In some cases, the concentration of SCF may be in the range of about 25-50 ng / mL; the concentration of TPO may be in the range of 50-300 ng / mL; the concentration of FLT3-L may range from 2.5-25 ng / ml; the concentration of IL-11 may range from 10-100 ng / ml; the concentration of IL-3 may range from 2.5-10 ng / ml; concentration of IL-6 may be in the range of 10-100 ng / mL; the concentration of valproic acid may be in the range of 50-200 pM; and / or the concentration of Ac-DEVD-CHO may be in the range of 2.5-20 pM.
[0075] In particular embodiments, Romiplostin may be used instead of or in addition to TPO; the concentration of Romiplostin may be in the range of 50-200 ng / mL.
[0076] In particular embodiments, the MSC can be manipulated to have a knock-in of TPO and / or SCF, which in specific embodiments results in the production of those factors by MSC. Various methods may be utilized for TPO knock-in and / or and SCF knock-in, including, but not limited to, viral transduction and CRISPR-Cas9, as examples.
[0077] One can isolate CD34 CB-derived positive hematopoietic stem cells using a CD34 positive selection system. Those cells may then be cultured with CB-derived MSC for expansion and megakaryocytic differentiation. During the expansion and differentiation part of the system and methods, there may or may not be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more changes in media to provide a fresh source of media including reagents of any kind, such as SCF, TPO, FLT3-L, IL-3, IL-11, and / or IL-6. The concentration of SCF, TPO, FLT3-L, IL-3, IL-11, and / or IL-6 during these media changes may or may not be the same concentration as in the first step. In some cases, valproic acid and / or Ac-DEVD-CHO may be added to the media. In some cases, media changes occur after a specific number of days, such as after 1, 2, 3, 4, 5, or more days, but in specific cases the media may be changed 3 times a week. In specific embodiments, the media is changed every 2-4 days, such as 3 times a week. In some cases, during the expansion and / or differentiation steps, the cells in culture may or may not be transferred to a different vessel, such as a different flask and / or bioreactor. Examples for bioreactors include but are not limited to G-Rex® bioreactor and / or the Quantum Cell Expansion System. In some cases, during the expansion and differentiation steps, the cells in culture are re-plated onto fresh MSCs. In specific embodiments, a Quantum bioreactor system is used to culture the ROCK inhibitor-induced terminally differentiated megakaryocyte to liberate platelets, such as by utilizing shear stress.
[0078] In some embodiments, at about day 3 of culture, B2M sgRNA is mixed with Cas9 in about a 1 : 1 ratio for about 20 minutes and then mixed with cultured cells, followed by electroporation, in order to engineer the megakaryocytes to knockout HLA-I. Knockout efficacy may be measured throughout the culture using flow cytometry and may peak around day 9 of culture and remain stable. The closed electroporation systems used for this purpose includes, but is not limited to, the Lonza 4D-Nucleofector® System, Invitrogen Neon NxT Electroporation System, or the CTS Xenon Electroporation system. The sgRNA constructs used for this process, may include, but are not limited to AAGTCAACTTCAATGTCGGA (PAM: TTG- construct 1; SEQ ID NO: 1), CUGAAUCUUUGGAGUACCUG (PAM: TTG- construct 2; SEQ ID NO:2), UCACGUCAUCCAGCAGAGAA (PAM:TGG- construct 3; SEQ ID NO:3), AAGUCAACUUCAAUGUCGGA (PAM: TTG- construct 4) ; SEQ ID NO:4)
[0079] At day 17 of culture, the culture may comprise between 39.6%-69.42% CD41+ cells. One can employ both positive selection and negative selection strategies to isolate MK, in at least some examples. Isolation may take place between about day 10 to about day 23 of culture. In some embodiments, biotinylated magnetic beads may be used together with the following CD61 biotin antibody clones: 2Y / 51, VIPL2, and / or REA 761. In some embodiments, biotinylated magnetic beads may be used with the following CD41 biotin antibody clones: MEM06, REA366, 2530A, and / or HIP8. The CD61 and CD41 biotin antibody clones utilized may not be limited to the clones specified. In some embodiments, negative selection strategies may be utilized, including, but not limited to, human cell lineage depletion kit and / or biotinylated magnetic beads using the following antibodies conjugated with biotin: CD34, CD15, CD16, CD33, CD13, CD14, CD45RA, CD123, CD1 lb, CD11c, CD3, CD19, and / or CD56. Various cell isolation systems may be used for this process, including, but not limited to, the following magnetic beads separation systems: MACS Column technology, MACS Cell Separation Instruments, EasySep Cell Separation System, DETACHaBEAD, Dynabeads, Gibco CTS DynaCellect system, and / or the MARS Bar Platform.
[0081] Although the present disclosure and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the design as defined by the appended claims. Moreover, the scope of the present application is not intended to be limited to the particular embodiments of the process, machine, manufacture, composition of matter, means, methods and steps described in the specification. As one of ordinary skill in the art will readily appreciate fromthe present disclosure, processes, machines, manufacture, compositions of matter, means, methods, or steps, presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present disclosure. Accordingly, the appended claims are intended to include within their scope such processes, machines, manufacture, compositions of matter, means, methods, or steps.
Claims
CLAIMSWhat is claimed is:
1. A method of producing megakaryocytes (MK) in an ex vivo system, comprising: co-culturing for a first time period mesenchymal stem cells (MSCs) with CD34+ cells in one or more vessels or substrates in the presence of media comprising an effective amount of agents, said agents comprising, consisting essentially of, or consisting of N-(2-(3,8-diazabicyclo[3.
2. l]octan-8-yl)-5-chloropyrimidin-4-yl)- lH-indazol-5-amine hydrochloride; stem cell factor (SCF); thrombopoietin (TPO) and / or Romiplostin; interleukin 6 (IL-6); IL-3; and FLT3-ligand (FLT3-L); and optionally Delta-like protein 1- DLL1, thereby producing the megakaryocytes (MK).
2. The method of claim 1, wherein the first time period is 1, 2, 3, 4, 5, or more days.
3. The method of claim 1 or 2, wherein the media further comprises one or more HD AC inhibitors.
4. The method of claim 3, wherein the HDAC inhibitor is added to the media about day 2, 3, or 4 of the first time period.
5. The method of claim 3 or 4, wherein the HDAC inhibitor is valproic acid, romidepsin, vorinostat, belinostat, Panobinostat or a combination of thereof.
6. The method of any one of claims 1-5, wherein cells in the media are subject to knockout or knockdown of beta-2-microglobulin.
7. The method of claim 1 or 2, wherein after the first time period is complete, for a second time period the media lacks one or both of IL-3 and FLT3-L.
8. The method of claim 3, wherein during the second time period, the media comprises, consists of, or consists essentially of TPO, SCF, IL-6, and IL-11.
9. The method of claim 7 or 8, wherein the media further comprises one or more inhibitors of caspase endoproteases.
10. The method of claim 9, wherein the caspase endoprotease is caspase-3 and / or caspase-7.
11. The method of claim 9 or 10, wherein the inhibitor of caspase endoprotease is Ac-DEVD- CHO, DEVD-CHO-CPP 32, M876, M826, (Rac)-M826 or a combination of thereof.
12. The method of any one of claims 7-11, wherein the media further comprises nicotinamide and / or one or more colony stimulating factor 1 receptor (CSF-1R) inhibitors.
13. The method of any one of claims 1-12, wherein the media is changed out every 1, 2, 3, 4, 5, or more days.
14. The method of any one of claims 7-13, wherein the second time period is from 5-10 days.
15. The method of any one of claims 1-14, wherein the MSCs comprise a knock-in of TPO and / or SCF.
16. The method of any one of claims 1-15, wherein the media is changed 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times.
17. The method of any one of claims 1-6, wherein non-MK-lineage cells are removed from the culture.
18. The method of claim 7, wherein the non-MK-lineage cells are further defined as being CD3+, CD19+, CD56, CD235a, CDl lb, CD14+, CD15+, CD33+, CD34+, CD13+, CD45RA+, CD123+, CDl lc+, and / or CD16+.
19. The method of claim 17 or 18, wherein following removal of the non-MK-lineage cells, the cells in the culture are subject to a hollow fiber bioreactor.
20. The method of claim 19, wherein the cells are cultured in the hollow fiber bioreactor for a third time period.
21. The method of claim 20, wherein the third time period is from 6-19 days.
22. The method of claim 20 or 21, wherein the cells are cultured in a medium comprising, consisting of, or consisting essentially of TPO, IL-6, SCF, and IL-11.
23. The method of claim 22, wherein the media is supplemented with one or more ROCK inhibitors.
24. The method of claim 23, wherein the cells are cultured with the ROCK inhibitor for 1, 2, 3, 4, 5, 6, 7, or more days.
25. The method of any one of claims 1-24, wherein megakaryocytes and / or platelets are harvested from the culture.
26. The method of claim 25, wherein platelets are harvested following culturing of the cells with one or more ROCK inhibitors.
27. The method of any one of claims 1-26, wherein the MKs are one or more of CD41a+, CD61+, and CD42b+.
28. The method of any one of claims 25-27, wherein the platelets are purified by sequential centrifugation.
29. The method of any one of claims 15-18, wherein MKs from the culture are subjected to CD34+, CD33+, CD14+, CD3+, and / or CD16+ beads.
30. The method of any one of claims 25-29, wherein an effective amount of the platelets are provided to an individual in need thereof.
31. The method of claim 30, wherein the individual has thrombocytopenia.
32. The method of claim 30 or 31, wherein the individual has cancer, an immune system disorder, anemia, hepatitis C, HIV, is on chemotherapy, is receiving radiation, is taking medication that causes low platelets, bone marrow disease, blood disease, aplastic anemia, coronavirus infection, is receiving and / or will receive an organ or bone marrow transplant, has a traumatic injury, is an individual undergoing and / or that will undergo heart surgery, is a burn victim, or a combination thereof.
33. The method of any one of claims 1-32, wherein the CD34+ cells have been manipulated to have reduced or eliminated expression of a HLA class I or class II gene product.
34. The method of claim 33, wherein the CD34+ cells have been manipulated to comprise a knock-in of HLA class I histocompatibility antigen, alpha chain E (HLA-E), at the genomic locusof P2-microglobulin (02M), thereby reducing or eliminating expression of the HLA class I gene product in the CD34+ cells.
35. The method of any one of claims 1-34, wherein at least the majority of the CD34+ cells and / or the MSCs are derived from cord blood, bone marrow, or adipose tissue.
36. The method of any one of the preceding claims, wherein the media lacks serum.
37. The method of any one of the preceding claims, wherein SCF is in the media and the concentration of SCF is in the range of 20-50 ng / mL.
38. The method of any one of the preceding claims, wherein TPO is in the media and the concentration of TPO is in the range of 100-300 ng / mL or 50-200 ng / mL.
39. The method of any one of the preceding claims, wherein IL-6 is in the media and the concentration of IL-6 is in the range of 10-100 ng / mL.
40. The method of any one of the preceding claims, wherein IL-3 is in the media, and the concentration of IL-3 is in the range of 1-10 ng / mL.
41. The method of any one of the preceding claims, wherein FLT3-L is in the media and the concentration of FLT3-L is in the range of 1-25 ng / mL.
42. The method of any one of the preceding claims, wherein the megakaryocytes are reused to produce additional platelets.
43. The method of any one of the preceding claims, further comprising the step of obtaining a sample of cells from the media to analyze the sample of cells for expression of one or more megakaryocyte markers.
44. The method of claim 43, wherein the sample of cells are obtained from the media about 10-12 days from the beginning of the co-culture.
45. The method of claim 43 or 44, wherein the sample of cells are obtained from the media about 22-24 days from the beginning of the co-culture.
46. The method of any one of claims 43-45, wherein the megakaryocyte markers are selected from the group consisting of CD42b, CD41a, CD61, and a combination thereof.
47. The method of any one of the preceding claims, wherein platelets are obtained from the media multiple times.
48. The method of claim 47, wherein the duration of time between obtaining the platelets in at least two successive times is about 3 days.
49. The method of any one of claims 25-48, wherein the platelets are analyzed.
50. The method of claim 49, wherein the platelets are analyzed for functional studies.
51. The method of claim 50, wherein the functional studies comprise aggregation and / or bleeding time.
52. The method of any one of the preceding claims, further comprising the step of subjecting the MSCs, the CD34+ cells, and / or megakaryocytes to an effective amount of one or more means of fucosylation of the CD34+ cells, MSCs, and / or megakaryocytes, respectively.
53. The method of claim 52, wherein the means of fucosylation comprises one or more fucosyl- transferase enzymes and / or GDP fucose substrate.
54. The method of any of the preceding claims, wherein the media comprises an effective amount of one or more fucosyl-transferase enzymes.
55. The method of any one of the preceding claims, further comprising the step of manipulating the MSCs, the CD34+ cells, and / or megakaryocytes to express fucosyltransferase VI (FTVI) and / or fucosyltransferase VI (FTVII) FTVII.
56. A method of producing platelets, comprising the steps of:(a) co-culturing mesenchymal stem cells (MSCs) with CD34+ cells in one or more vessels or substrates in the presence of media comprising an effective amount of agents, said agents comprising, consisting essentially of, or consisting of SCF, TPO, IL-3, IL-6, a ROCK inhibitor, thereby producing megakaryocytes; and(b) subjecting the megakaryocytes to suitable conditions to produce an effective amount of the platelets.
57. The method of claim 56, wherein (a) and (b) occur in the same vessel or substrate.
58. The method of clam 56 or 57, wherein an effective amount of the platelets are provided to the host individual in need thereof.
59. The method of claim 58, wherein the individual in need thereof has thrombocytopenia, cancer, an immune system disorder, anemia, hepatitis C, HIV, is on chemotherapy, is receiving radiation, is taking medication that causes low platelets, bone marrow disease, blood disease, aplastic anemia, coronavirus infection, is receiving and / or will receive an organ or bone marrow transplant, has a traumatic injury, is an individual undergoing and / or that will undergo heart surgery, is a burn victim, or a combination thereof.
60. A method of preparing or producing megakaryocytes (MK) in an ex vivo system, comprising:(a) co-culturing CD34+ cells with MSCs in a media comprising, consisting of, or consisting essentially of TPO, SCF, IL-6, IL-3, and FLT3-L;(b) co-culturing CD34+ cells with MSCs in a media lacking FLT3-L and / or IL-3, optionally comprising IL-11;(c) optionally enriching MK and / or platelets in the media by removing non-MK cells to produce enriched cells; and(d) culturing the enriched cells in a hollowfiber bioreactor in media comprising, consisting essentially of, or consisting of TPO, IL-6, SCF, and IL-11 and optionally one or more ROCK inhibitors.
61. The method of claim 60, further comprising the step of obtaining platelets at or after initiation of (d).
62. The method of claim 60 or 61, wherein (a) occurs in the range of for about 2-5 days.
63. The method of any one of claims 60-62, wherein the ROCK inhibitor is KD045.
64. The method of any one of claims 60-63, wherein (b) occurs in the range of for about 5-10 days.
65. The method of any one of claims 60-64, wherein (d) occurs in the range of for about 1-7 days.
66. A method of producing megakaryocytes, comprising:(a) co-culturing MSCs and CD34+ cells in a media comprising, consisting of, or consisting essentially of SCF, TPO, IL-3, IL-11, FLT3-L, IL-6, one or more ROCK inhibitors, and optionally DLL1, optionally wherein the media is serum-free and for a period of time of about 3 days;(b) culturing cells from the media in (a), wherein the media comprises, consists of, or consists essentially of IL-6, SCF, TPO, and IL-11.
67. The method of claim 66, wherein in (a), the media further comprises one or more HDAC inhibitors.
68. The method of claim 66 or 67, wherein megakaryocytes produced by the method are modified to have knockout or knockdown of beta 2-microglobulin.
69. The method of any one of claims 66-68, further comprising the step of isolating the CD34+ cells from cord blood.
70. The method of any one of claims 66-69, wherein in (b) the media further comprises one or more inhibitors of caspase endoproteases.
71. The method of claim 70, wherein the caspase endoprotease is caspase-3 and / or caspase-7.
72. The method of claim 70 or 71, wherein the inhibitor of caspase endoprotease is Ac-DEVD- CHO, DEVD-CHO-CPP 32, M876, M826, (Rac)-M826 or a combination of thereof.
73. The method of any one of claims 66-72, wherein in (b) the media further comprises nicotinamide and / or one or more colony stimulating factor 1 receptor (CSF-1R) inhibitors.
74. The method of any one of claims 66-73, wherein in (b), the media is subject to reduction in number or depletion of non-MK-lineage cells from the culture.
75. The method of claim 74, wherein the non-MK-lineage cells are further defined as being CD3+, CD19+, CD56, CD235a, CDl lb, CD14+, CD15+, CD33+, CD34+, CD13+, CD45RA+, CD123+, CDl lc+, and / or CD16+.
76. The method of any one of claims 66-75, further comprising collecting MK from the media.
77. The method of claim 76, wherein prior to the collecting of MK the one or more caspase inhibitors are removed from the media, one or more ROCK inhibitors are added to the media, or both.
78. The method of claim 76 or 77, wherein prior to the collecting of MK at least some of the culture is subject to CD61 and / or CD41 positive selection or negative selection.
79. The method of any one of claims 76-78, wherein the culturing occurs in a closed system comprising a gas-permeable membrane.
80. The method of any one of claims 76-79, further comprising collecting platelets from the media.
81. The method of claim 80, wherein prior to collecting the platelets, one or more caspase inhibitors are removed from the media, one or more ROCK inhibitors are added to the media, or both.
82. The method of claim 80 or 81, wherein the culturing occurs in a bioreactor capable of exerting shear stress.
83. A system comprising, consisting of, or consisting essentially of an effective amount of 2, 3, 4, or more of the following:MSCs;CD34+ cells, or, optionally, CD34+ cells comprising a knock in of HLA-E at the B2M genomic locus; a vessel or substrate; media;SCF;TPO;IL-6;IL-3;ROCK inhibitor(s);Caspase endonuclease inhibitor(s);Nicotinamide;and, optionally one or more fucosyl-transferase enzymes.
84. The system of claim 83, wherein the ROCK inhibitor is N-(2-(3,8- diazabicyclo[3.2.1]octan-8-yl)-5-chloropyrimidin-4-yl)-lH-indazol-5-amine hydrochloride.