Virus attenuation by translation kinetic modification

CA3319978A1Pending Publication Date: 2025-09-18INSTITUT FÜR VIROLOGIE & IMMUNOLOGIE +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CA3319978
Authority / Receiving Office
CA · CA
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-10
Filing Date
2025-03-13
Publication Date
2025-09-18

AI Technical Summary

Technical Problem

The rapid development of effective vaccines against emerging viruses or mutated pathogens is hindered by lengthy development times, which can lead to widespread infections before adequate protection is available, especially in the context of high mutation rates and rapid virus spread.

Method used

Modifying viral RNA translation kinetics by altering codon usage in viral genomes to create attenuated viruses, specifically through recoding regions to include more slow or fast translating codons, thereby impairing viral replication and spread.

Benefits of technology

The modified viruses exhibit reduced replication and infectivity, inducing efficient immune responses without substantial antigen alteration, facilitating rapid vaccine development and mucosal immunity.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention relates to a nucleic acid comprising at least one coding sequence of a virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon, wherein said synonymous codon has an altered kinetic of nucleic acid translation. The invention further relates to a vector and an attenuated virus comprising the nucleic acid of the invention as well as a method for its production. Furthermore, the invention relates to a pharmaceutical product comprising the nucleic acid of the invention for use as a medicament and a method for modifying translation kinetics of a virus.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] VIRUS ATTENUATION BY TRANSLATION KINETIC MODIFICATION

[0002] The invention relates to the field of virus attenuation. Specifically, the invention relates to a nucleic acid encoding an attenuated virus, wherein the attenuation is based on altered translation kinetics. The invention further relates to a vector, a genetically modified cell, an attenuated virus comprising the nucleic acid of the invention, and a method for its production. Furthermore, the invention relates to a pharmaceutical product comprising the vector of the invention for use as a medicament and a novel method for modifying translation kinetics of a virus.

[0003] Related art

[0004] The rapid development and availability of vaccines are crucial in combating viruses and bacteria. The production of suitable vaccines is a multi-stage, complex process which is not always successful despite often high investments. Typically, the development of a suitable vaccine takes years. These long development times present a major problem, especially with regard to new emerging viruses or mutated pathogens, as from an epidemiological point of view it is only possible to react too late, if at all, to the emergence of new diseases.

[0005] In this context, viruses are of special interest, as they harbor high mutation rates causing inter alia the spread from other animals to humans. The rapid spreading of viruses, which is also a direct consequence of the high mobility of today's society makes them a major challenge for modem medicine.

[0006] The usual time between the detection / identification of a newly emerging virus and the development of a vaccine is typically years. In a few cases, with sufficient prior knowledge, experimental vaccines could be provided within months. However, this period is much longer than the typical time until thousands or millions of people are infected.

[0007] Ideally, immediately after the identification of a new virus, a vaccine would be available in sufficient quantity and high quality and would allow for a nationwide vaccination of all persons who have somehow come close to the initial outbreak site of the new virus. Furthermore, with an ideal vaccine it would be possible to react to the evolution and adaptation of the virus. In the recent past, the corona virus pandemic has dramatically increased the relevance of developing suitable tools for vaccine production.

[0008] Thus, there is a need to provide means and methods that allow quick production of a safe and efficient vaccine against a virus.

[0009] The above technical problem is solved by the embodiments disclosed herein and as defined in the claims.

[0010] Summary of the Invention

[0011] The inventors used a new approach to develop live attenuated viruses and live attenuated virus vaccines, based preferably on human viruses, such as SARS-CoV-2, MERS-CoV and others. For this purpose, the inventors employed an approach to slowdown or speed-up translation of viral RNAs, preferably mRNAs.

[0012] The attenuated viruses possess genomes in which specific regions were re-coded to alter the translation rate of codons in these regions. This has been accomplished by measuring translation rates, identifying slow-translating codons (“slow codons”) and fast-translating codons (“fast codons”) and substituting codons in nucleic acids of the SARS-CoV-2 and MERS-CoV genome to encode either an increased number of slow or fast codons. Thereby, the number of fast and / or slow codons is changed in the recoded regions.

[0013] Translation rates were measured via ribosomal profiling data obtained from human cells and preferably used to categorize codons according to translation rate, e.g., as fast or slow. Then the viral genome was recoded to contain regions with increased fast and / or slow translating codons. Thereby, the inventors generated viruses with modified structural genes (spike, envelope, membrane, and nucleocapsid) and non-structural genes (ORFI ab).

[0014] To assess the generated viruses' characteristics, the inventors conducted plaquephenotype assays to evaluate their spread. Except for the virus containing increased fast-translating codons in spike RNA, all other viruses exhibited smaller plaque sizes than the Wuhan SARS-CoV-2 wild type. Plaque assays revealed smaller plaque sizes in all viruses modified in the ORFI ab. To assess replication kinetics, growth curves were measured demonstrating a reduction in virus replication kinetics up to 15-20 times compared to SARS-CoV-2 Wuhan wild. To evaluate the viruses' in vivo performance, the inventors used the SARS-CoV-2 version encoding a spike gene with increased slow-translating codons and conducted intra-nasal inoculation in hACE2- transgenic mice. Intriguingly, infected mice experienced significant attenuation compared to animals infected with the SARS-CoV-2 Wuhan wild type, displaying minimal clinical manifestation and less weight loss.

[0015] Since the modification affects the rate of translation of the modified genes, availability of the proteins encoded by the modified genes during infection is impaired which affects virus replication and the virus' ability to spread between cells. The inventors demonstrated that increasing the number of slow and / or fast codons both severely impaired viral replication, infectivity, and spreading and immune response. Mass spectrometry and western blot showed specific lower protein expression of genes with fast and slow codons. Virus infectivity was especially affected in viruses altered in ORFIab, revealing a distinct mechanism of attenuation, such as a change in the ribosome shifting efficiency. In addition, pre-clinical studies in vivo demonstrate that virus attenuation is clearly achieved by increasing the number of slow or fast codons.

[0016] Fast and / or slow codon viruses exhibited smaller plaque sizes than Wuhan wildtype in Vero E6 / TMPRSS2 cells. Growth curve kinetics in Vero E6 / TMPRSS2 cells revealed up to a 15-fold reduction in virus replication compared to Wuhan wild-type at 48 hours post- infection and a 20-fold reduction at 72 hours post-infection. Fast and / or slow codon viruses were also attenuated in human nasal and bronchial epithelial cells cultured in an air-liquid interface. SARS-CoV-2 with increased fast and / or slow translating codons in Spike encoding sequences, decreased Spike protein translation. hACE2 transgenic mice intranasally infected with SARS-CoV-2 increased fast and / or slow translating codons, e.g., for Spike showed lower clinical scores and weight loss than animals infected with Wuhan virus, demonstrating that the recoded viruses were also attenuated in vivo.

[0017] The attenuated virus or pharmaceutical product of the invention is advantageous compared to current vaccines since the virus or product of the invention preferably contain all viral antigens of the reference virus. In addition, immunity can be induced at the site of infection (mucosal immunity) and can be applied via nasal sprays.

[0018] Thus, the inventors were able to engineer viruses with fast and slow codons and show that these viruses are attenuated in vitro and in vivo. This provides evidence that attenuated viruses induce an efficient protective immune response and act as potential vaccines.

[0019] Accordingly, the invention relates, inter alia, to the following embodiments:

[0020] 1 . A nucleic acid comprising at least one coding sequence of a virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon, wherein said synonymous codon has an altered kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus.

[0021] 2. The nucleic acid of embodiment 1 , wherein the altered kinetic of nucleic acid translation is an altered translation rate of a codon.

[0022] 3. The nucleic acid of embodiment 1 or 2, wherein the kinetic of nucleic acid translation is determined by ribosomal profiling data, preferably by relative A-site codon occupancy values, more preferably relative A-site codon occupancy values calculated by the formula

[0023] 4. The nucleic acid of embodiments 3, wherein the relative A-site codon occupancy values are as indicated in Table 1 (“Occupancy”) or Figure 5 (“RP”).

[0024] 5. The nucleic acid of any one of the preceding embodiments, wherein said at least one codon is substituted by a synonymous codon having either a faster or slower kinetic of nucleic acid translation.

[0025] 6. The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid comprises

[0026] (i) the at least one coding sequence of a virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon which has a slower kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of the virus; and

[0027] (ii) at least one additional coding sequence of a virus, wherein at least one codon in said additional coding sequence is substituted by a synonymous codon which has a faster kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of the virus, wherein preferably the coding sequences of (i) and (ii) are adjacent or overlapping, preferably adjacent.

[0028] 7. The nucleic acid of any one of the preceding embodiments, wherein at least 5% of the codons in the coding sequence(s) of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic, preferably between 12% and 35% of the codons in the coding sequence(s) of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic.

[0029] 8.1 The nucleic acid of any one of the preceding embodiments, wherein said virus is a corona virus, preferably a human coronavirus, more preferably SARS-CoV-2.

[0030] 8.2 The nucleic acid of any one of the preceding embodiments, wherein said virus is a human beta coronavirus, preferably said virus is a lineage B or C human beta coronavirus.

[0031] 8.3 The nucleic acid of any one of the preceding embodiments, wherein said virus is a corona virus, preferably a human coronavirus, more preferably SARS-CoV-2 or MERS-CoV.

[0032] 9. The nucleic acid of embodiment 8, wherein said at least one substituted codon is located in a nucleic acid sequence encoding a structural protein and / or said at least one substituted codon is located in a nucleic acid sequence encoding at least one non- structural protein.

[0033] 10.1 The nucleic acid of embodiment 8 or 9, wherein said at least one substituted codon is located in a nucleic acid sequence encoding a structural protein selected from the group consisting of spike, envelope, membrane protein, and nucleocapsid protein or a non-structural protein of ORF1 a and / or ORF1 b.

[0034] 10.2 The nucleic acid of any one of the embodiments 8 to 10.1 , wherein said at least one substituted codon is more than one substituted codon, wherein the substituted codons comprise codons located in ORF1 a and ORF1 b.

[0035] 10.3 The nucleic acid of any one of the embodiments 8 to 10.2, wherein said at least one substituted codon is more than one substituted codon, wherein the substituted codons are located in ORF1 a and ORF1 b. 11 . The nucleic acid of any one of the preceding embodiments, wherein the at least one coding sequence has a length of at least 2.000 nucleotides, preferably 2.000- 20.000 nucleotides, more preferably 3.000-10.000 nucleotides.

[0036] 12. The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid comprises a sequence selected from the group consisting of SEQ ID NO: 12-36 and 37, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 12-36 and 37.

[0037] 13. The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-11 , or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-11.

[0038] 13.1 The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-38 and 39, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-38 and 39.

[0039] 13.2 The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid consists of a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5- 11 and 38, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-11 and 38.

[0040] 13.3 The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid comprises of a sequence selected from the group consisting of SEQ ID NO: 12- 37 and 39, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 12-37 and 39.

[0041] 13.4 The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-39 and 41 , or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-39 and 41 .

[0042] 13.5 The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-39 and 41 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-37.

[0043] 13.6 The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 38, 39 and 41 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 38, 39 and 41 .

[0044] 13.7 The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 12-37, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 12-37.

[0045] 13.8 The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 38 and 41 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 38 and 41 .

[0046] 13.9 The nucleic acid of any one of the preceding embodiments, wherein the nucleic acid consists of a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5- 11 , 38 and 41 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-11 , 38 and 41 .

[0047] 14.1 The nucleic acid of any one of the preceding embodiments 1 -13.1 , wherein the virus is a coronavirus, and the reference virus genome is a naturally occurring coronavirus, preferably a sequence of SEQ ID NO: 3 or 4. 14.2 The nucleic acid of any one of the preceding embodiments 1 -13.9, wherein the virus is a coronavirus, more preferably SARS-CoV-2 or MERS-CoV; and the reference virus genome is a naturally occurring coronavirus genome; preferably the reference virus genome is a SARS-CoV-2 wildtype genome for SARS- CoV-2, and the reference virus genome is a MERS-CoV wildtype genome for MERS- CoV; more preferably the reference virus genome is a sequence of SEQ ID NO: 3 or 4 for SARS-CoV-2, and the reference virus genome is a human beta coronavirus 2c EMC / 2012 genome (accession no. JX869059 of NIH genbank) or a sequence of SEQ ID NO: 40 for MERS-CoV.

[0048] 15. A vector comprising the nucleic acid of any one of the preceding embodiments.

[0049] 16. A genetically modified cell comprising the nucleic acid of any one of the preceding embodiments or the vector of embodiment 16, preferably the genetically modified cell is a host cell for production of a virus.

[0050] 17. A method for producing an attenuated virus, the method preferably comprises a step of culturing the genetically modified cell of embodiment 16.

[0051] 18. An attenuated virus comprising the nucleic acid of any one of embodiments 1 to 14 or the vector of embodiment 15.

[0052] 19. A pharmaceutical product comprising the nucleic acid of any one of embodiments 1 to 14, the vector of embodiment 15, the genetically modified cell of embodiment 16 and / or the attenuated virus of embodiment 17 or 18 for use as a medicament.

[0053] 20. The pharmaceutical product for use according to embodiment 19, wherein the medicament is for use in prevention and / or treatment of a virus infection or a symptom thereof.

[0054] 21.1 The pharmaceutical product for use according to embodiment 19 or 20, wherein the virus infection is an RNA virus infection, preferably a coronavirus infection, more preferably a human coronavirus infection, again more preferably a SARS-CoV-2 infection. 21 .2 The pharmaceutical product for use according to embodiment 19 or 20, wherein the virus infection is caused by a human beta coronavirus, preferably the virus infection is caused by a human lineage B or C beta coronavirus.

[0055] 21 .3 The pharmaceutical product for use according to embodiment 19 or 20, wherein the virus infection is an RNA virus infection, preferably a coronavirus infection, more preferably a human coronavirus infection, again more preferably a SARS-CoV-2 or MERS-CoV infection.

[0056] 22. A method for preparing an attenuated virus, the method comprises the steps of: a) selecting a reference genome of a virus, and selecting at least one coding sequence in the reference genome of the virus; b) computing the translational kinetic of at least two codons, preferably of all codons in the coding sequence, c) optionally categorizing the at least two codons, preferably all codons, in the coding sequence in at least two categories, wherein the categories are indicative of kinetic of nucleic acid translation of codons; d) substituting at least one codon in said coding sequence by a synonymous codon with a faster or slower kinetic of nucleic acid translation; e) expressing the modified coding sequence, preferably in a host cell; wherein preferably the kinetic of nucleic acid is determined by ribosomal profiling, more preferably by determining relative ribosomal A-site codon occupancy, again more preferably by relative ribosomal A-site codon occupancy values as indicated in Table 1.

[0057] 23.1 The method for preparing an attenuated virus of embodiment 22, wherein c) the at least two codons, preferably all codons, in the coding sequence are categorized in at least two categories, wherein the categories are indicative of kinetic of nucleic acid translation of codons; and in step d) at least one codon in said coding sequence is substituted by a synonymous codon with a faster or slower kinetic of nucleic acid translation by replacing a codon categorized in step c) with a synonymous codon of a different category. 23.2 The method of embodiment 22 or 23, wherein the virus is an RNA virus, preferably a coronavirus, more preferably a human coronavirus, again more preferably SARS-CoV-2.

[0058] 23.3 The method of embodiment 22 or 23, wherein the virus is a human beta coronavirus, preferably said virus is a human lineage B or C beta coronavirus.

[0059] 23.4 The method of embodiment 22 or 23, wherein the virus is an RNA virus, preferably a coronavirus, more preferably a human coronavirus, again more preferably SARS-CoV-2 or MERS-CoV.

[0060] 24. A method of treatment and / or prevention of a virus infection or a symptom thereof comprising the step of administering a pharmaceutical product in a therapeutically effective amount to a subject, wherein the pharmaceutical product comprises the nucleic acid molecule of any one of the embodiments 1 to 14, the vector of embodiment 15, the genetically modified cell of embodiment 16 and / or the attenuated virus of embodiment 17 or 18.

[0061] 25. The method of embodiment 24, wherein the virus is an RNA virus, preferably a coronavirus, more preferably a human coronavirus, again more preferably SARS-CoV- 2.

[0062] 26. The method of embodiment 24, wherein the virus is a human beta coronavirus, preferably said virus is a human lineage B or C beta coronavirus.

[0063] 27. The method of embodiment 24, wherein the virus is an RNA virus, preferably a coronavirus, more preferably a human coronavirus, again more preferably SARS-CoV- 2 or MERS-CoV.

[0064] Detailed description of the invention

[0065] In one aspect, the invention relates to a nucleic acid comprising at least one coding sequence, preferably a coding sequence of a virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon and said synonymous codon has an altered kinetic of nucleic acid translation as compared to a corresponding codon.

[0066] Thus, the invention relates to a nucleic acid comprising at least one coding sequence, preferably at least one coding sequence of a virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon whereby the translation rate is altered in this coding sequence.

[0067] In a preferred embodiment, said at least one substituted codon is more than one codon and the codons are substituted by synonymous codons having a faster nucleic acid translation kinetic and by synonymous codons having a slower nucleic acid translation kinetic.

[0068] Preferably, the kinetic of nucleic acid translation is defined as translation rate of a codon.

[0069] In a preferred embodiment, the kinetic of nucleic acid translation and / or the translation rate of a codon is determined by ribosomal profiling data, preferably relative A-site codon occupancy values.

[0070] Preferably, the translation rate for the at least one codon and the synonymous codon is defined by ribosomal profiling data, more specifically by relative A-site codon occupancy values. In preferred embodiments, A-site codon occupancies are derived from ribosome profiling experiments in HEK293T cells, preferably said cells are treated with cycloheximide in the lysis buffer. In preferred embodiments, frequency in three codon positions is calculated, wherein preferably positions +5, +6, +7 are used for the calculation. In preferred embodiments, for calculating relative A-site codon occupancy Ac the formula is used

[0071] Preferably, the Mean read count (Me) is calculated by:

[0072] M>rC,A+5 +rC,A + 6 +rC,A + 7

[0073] Mr — M 77cwhere rc, / i+5 is the count of reads of a codon at 5 codons downstream of the ribosomal A-site, rc,A+e and rc,A+7 correspond to count of the codon 6 or 7 codons downstream of the ribosomal A-site, respectively.

[0074] The ribosome profiling data are as indicated in the dataset with accession code G S E 136940 (htps: / / www.ncbi.nlm.nih.gov / geo / ) . In a preferred embodiment, the relative A-site codon occupancy values are as indicated in Table 1 (“Occupancy”) or Figure 5 (“RP”). In very preferred embodiments, translation kinetics or codon translation rates are defined according to the relative A- site codon occupancy values as specified in Figure 5 (RP) or Table 1 (“Occupancy”).

[0075] In other preferred embodiments, all codons in said at least one coding sequence are categorized into at least two categories, wherein the categories are indicative of nucleic acid translational kinetics, preferably the codon translation rate, e.g., as indicated in Table 1 , wherein at least one codon in said at least one coding sequence is substituted by a synonymous codon belonging to a different category. Preferably, said at least two categories are four categories - slow, fast, fastest and intermediate - as indicated in Table 1 (Relative decoding speed). In other preferred embodiments, if said at least one codon is a codon categorized as slow codon according to Table 1 , it is exchanged by a codon defined as fast or fastest synonymous codon according to Table 1 ; and / or if said at least one codon is a codon defined as fast or fastest codon according to Table 1 , it is exchanged by a codon defined as slow synonymous codon according to Table 1. Preferably, at least 0,05%, at least 0,5%, at least 1 %, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, more preferably at least 95%, again more preferably at least 99% or 100% of the codons of one category are substituted by a synonymous codon belonging to a different category. Preferably, 60-100%, 65-100%, 70-100%, 75-100%, 80-100%, 85-100%, 90-100%, more preferably 95-100%, again more preferably 99-100% of the codons in one category is substituted by a synonymous codon, wherein said synonymous codon belongs to of a different category.

[0076] In certain embodiments, the at least one codon is substituted by a synonymous codon having either a faster or slower kinetic of nucleic acid translation. In certain embodiments, the at least one substitution accelerates or decelerates translation of at least a part of the nucleic acid. In certain embodiments, more than one codon is substituted by a synonymous codon, wherein a first portion of the synonymous codons has a faster kinetic of nucleic acid translation and a second portion of the synonymous codons has a slower kinetic of nucleic acid translation. In other preferred embodiments, said at least one codon is substituted by a synonymous codon having either a faster or slower codon translation rate, wherein preferably the codon translation rates are defined according to the relative A-site codon occupancy values, more preferably the relative A-site codon occupancy values are as indicated in Table 1 or Figure 5.

[0077] The inventors found that altering translation kinetics by using synonymous codons can be used to attenuate viruses without or without substantially altering the antigens available to the immune system. As such, the attenuated virus can be identical in its protein setup but limited in its replication capabilities. The virus retains the ability to replicate but the efficiency of protein production is substantially disturbed, which results in inefficient replication. This facilitates the development of a complete immune answer without escalating virus replication. Accordingly, the invention is at least in part based on the finding that altering translation kinetics can attenuate viruses.

[0078] In certain embodiments, the invention relates to the nucleic acid of the invention, wherein at least one of the alterations slows translation of at least a part of the nucleic acid.

[0079] The inventors found that slowing down translation kinetics by using synonymous codons can be used to attenuate viruses without or without substantially altering the antigens available to the immune system. As such, the attenuated virus can be identical in its protein setup but limited in its replication capabilities. The virus retains the ability to replicate but the efficiency of protein production is substantially lower. This facilitates the development of a complete immune answer without escalating virus replication. Accordingly, the invention is at least in part based on the finding that slowing down translation kinetics can attenuate viruses.

[0080] In certain embodiments, the invention relates to the nucleic acid of the invention, wherein at least one of the alterations accelerates translation of at least a part of the nucleic acid.

[0081] The inventors found that accelerating the translation kinetics by using synonymous codons can be used to attenuate viruses without or without substantially altering the antigens available to the immune system. As such, the attenuated virus can be identical in its protein setup but limited in its replication capabilities despite increased translation kinetics. The virus retains the ability to replicate but the efficiency of protein production is substantially disturbed. This facilitates the development of a complete immune answer without escalating virus replication. Accordingly, the invention is at least in part based on the finding that accelerating translation kinetics of selected codons can attenuate viruses.

[0082] In certain embodiments, the invention relates to the nucleic acid of the invention, wherein at least one substituted codon in a first part of the nucleic acid accelerates translation and wherein at least one additional substituted codon in a second part of the nucleic acid slows down translation.

[0083] The inventors found that simultaneously accelerating and slowing down translation kinetics by using synonymous codons can be used to attenuate viruses without or without substantially altering the antigens available to the immune system. As such, the attenuated virus can be identical in its protein setup but limited in its replication capabilities. Without being bound by theory, this acceleration and slowing down induces “traffic jam” in protein production. The virus retains the ability to replicate but the efficiency of protein production is substantially disturbed. This allows the development of a complete immune response without escalating virus replication. Accordingly, the invention is at least in part based on the finding that accelerating and slowing down translation kinetics in the same nucleic acid sequence can attenuate a virus.

[0084] In certain embodiments, the nucleic acid of the invention comprises (i) the at least one coding sequence of the virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon which has a slower or faster kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus; and (ii) at least one additional coding sequence of the virus, wherein at least one codon in said additional coding sequence is substituted by a synonymous codon which has a slower or faster kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus, wherein preferably the coding sequences of (i) and (ii) are adjacent or overlapping, preferably adjacent.

[0085] In certain embodiments, the nucleic acid of the invention comprises (i) the at least one coding sequence of the virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon which has a slower kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus; and (ii) at least one additional coding sequence of the virus, wherein at least one codon in said additional coding sequence is substituted by a synonymous codon which has a faster kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus, wherein preferably the coding sequences of (i) and (ii) are adjacent or overlapping, preferably adjacent.

[0086] In certain embodiments, the nucleic acid of the invention comprises (i) the at least one coding sequence of the virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon which has a slower kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus; and (ii) at least one additional coding sequence of the virus, wherein at least one codon in said additional coding sequence is substituted by a synonymous codon which has a slower kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus, wherein preferably the coding sequences of (i) and (ii) are adjacent or overlapping, preferably adjacent.

[0087] In certain embodiments, the nucleic acid of the invention comprises (i) the at least one coding sequence of the virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon which has a faster kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus; and (ii) at least one additional coding sequence of the virus, wherein at least one codon in said additional coding sequence is substituted by a synonymous codon which has a faster kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus, wherein preferably the coding sequences of (i) and (ii) are adjacent or overlapping, preferably adjacent.

[0088] In certain embodiments, in the nucleic acid of the invention at least one of the substituted codons in a first part of the nucleic acid accelerates translation and wherein at least one of the substituted codons in a second part of the nucleic acid slows down translation and wherein the first and second part are adjacent or overlapping. The term “adjacent”, as used herein, refers to “next to each other” such that one protein coding part is located after the other protein coding part without any other protein coding part in between. There may be non-coding parts between two “adjacent” protein coding parts of the nucleic acid of the invention.

[0089] The inventors found that simultaneously accelerating and slowing down translation kinetics of parts of the genome that are located next to each other by using synonymous codons can be used to particularly attenuate viruses without or without substantially alter the antigens available to activate the immune system. Accordingly, the invention is at least in part based on the finding that accelerating and slowing down translation kinetics in the same sequence in parts located next to each other can attenuate a virus.

[0090] In certain embodiments, the nucleic acid comprises

[0091] (i) at least one coding sequence of a virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon which has a slower kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus; and

[0092] (ii) at least one additional coding sequence of a virus, wherein at least one codon in said additional coding sequence is substituted by a synonymous codon which has a faster kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus, wherein preferably the coding sequences of (i) and (ii) are adjacent or overlapping

[0093] In certain embodiments, at least one substituted codon in a first part of the nucleic acid accelerates translation and at least one substituted additional codon in a second part of the nucleic acid decelerates translation, wherein preferably the protein coding part of the first part and the second part are adjacent or overlapping.

[0094] In preferred embodiments, at least 5% of the codons in the at least one coding sequence of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic, preferably between 12% and 35% of the codons in the at least one coding sequence of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic. In preferred embodiments, at least 2%, at least 5%, at least 10%, more preferably at least 12% of the codons in the at least one coding sequence of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic. In other embodiments, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 80%, at least 90%, at least 95%, at least 99% or 100% of the codons in the at least one coding sequence of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic.

[0095] In other preferred embodiments, 100% or less than 100%, less than 99,5%, less than 99%, less than 95%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 45%, less than 40%, more preferably less than 35% of the codons in the at least one coding sequence of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic.

[0096] In other preferred embodiments, between 5% and 100%; between 5% and 90%, between 5% and 80%, between 5% and 70%, between 5% and 60%, 5% and 50%, 5% and 45%, 5% and 40%, more preferably between 5% and 35% of the codons in the at least one coding sequence of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic. In other preferred embodiments, between 10% and 60%, 10% and 50%, 10% and 45%, 10% and 40%, more preferably 10% and 35% of the codons in the at least one coding sequence of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic. In other preferred embodiments, between 12% and 60%, 12% and 50%, 12% and 45%, 12% and 40%, more preferably 12% and 35% of the codons in the at least one coding sequence of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic.

[0097] Most preferably between 12% and 35% of the codons in the at least one coding sequence of the virus are substituted by a synonymous codon having either a faster or slower nucleic acid translation kinetic.

[0098] In a certain embodiment, a virus envelope encoded by the genome of the reference virus comprises proteins having an identity of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% compared to the virus envelope encoded by the coding sequence of the virus or compared to the virus envelope of the attenuated virus of the invention. In certain embodiments, the virus envelope encoded by the genome of the reference virus comprises only identical proteins compared to the virus envelope encoded by the coding sequence of the virus or compared to the virus envelope of the attenuated virus of the invention.

[0099] The reference virus genome or the reference nucleotide sequence of the virus and the virus envelope of the attenuated virus of the invention or the coding sequence of the invention or are preferably at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical in the proteins they encode, preferably in the proteins comprised in the virus envelope. In certain embodiments, a virus envelope encoded by the genome of the reference virus or the reference nucleotide sequence of the virus comprises at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical proteins compared to the virus envelope encoded by the coding sequence of the invention or the virus envelope of the attenuated virus of the invention.

[0100] The percentage of similarity between the coding sequence of the virus in the nucleic acid of the invention and the reference nucleotide sequence of a virus is preferably at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or at least 99,9%. In a more preferred embodiment, the percentage of similarity between the coding sequence of the virus in the nucleic acid of the invention and the reference nucleotide sequence of a virus is between 10% and 60%, preferably 10% and 50%, more preferably 10% and 40%, again more preferably 10% and 35% or 12% and 35%.

[0101] In preferred embodiments, the reference virus genome or the reference nucleotide sequence of the virus is a naturally occurring genome or sequence of said virus. Preferably, the reference nucleotide sequence of a SARS-CoV-2 virus and MERS-CoV virus is a human beta coronavirus. Preferably, the reference nucleotide sequence of a SARS-CoV-2 virus is SEQ ID NO: 3 or 4. Preferably, the reference genome or sequence of a MERS-CoV virus is a human beta coronavirus 2c EMC / 2012 or SEQ ID NO: 40.

[0102] In preferred embodiments, said virus is a corona virus, preferably a human coronavirus, more preferably SARS-CoV-2. In certain preferred embodiments, the virus is a beta coronavirus, i.e., of the beta genus of coronaviruses. In more preferred embodiments, the virus is a lineage B or C beta coronavirus. In even preferred embodiments, said virus is a SARS-CoV-2 or MERS-CoV. In preferred embodiments, said at least one substituted codon is located in a nucleic acid sequence encoding a structural protein and / or said at least one substituted codon is located in a nucleic acid sequence encoding at least one non-structural protein.

[0103] In a preferred embodiment, said coding sequence of a virus encodes at least one structural protein and / or said coding sequence of a virus encodes at least one non- structural protein.

[0104] In preferred embodiments, said at least one substituted codon is located in a nucleic acid sequence encoding a structural protein selected from the group consisting of spike, envelope, membrane protein, and nucleocapsid protein and / or a non-structural protein of ORF1a and / or ORF1 b.

[0105] Preferably, more than one codon is substituted.

[0106] In certain embodiments, the invention relates to the nucleic acid of the invention, wherein the codon substitutions are located are in a region not coding for structural proteins. In certain embodiments, the invention relates to the nucleic acid of the invention, wherein the codon substitutions are in a region coding for structural proteins.

[0107] In a preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a structural protein selected from the group consisting of spike, envelope, membrane, and nucleocapsid protein and / or a non-structural protein of ORF1a and / or ORF1 b, preferably of a coronavirus.

[0108] In a preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a structural protein selected from the group consisting of spike, envelope, membrane, and nucleocapsid protein and / or a non-structural protein of ORF1 a and / or ORF1 b, preferably of a coronavirus, more preferably a human coronavirus, again more preferably a human beta coronavirus, again more preferably SARS-CoV-2 or MERS-CoV. In a preferred embodiment, said substituted codons are located in a spike encoding nucleic acid and / or ORF1 a and / or ORF1 b, preferably of a coronavirus, more preferably a human coronavirus, again more preferably a human beta coronavirus, again more preferably SARS-CoV-2 or MERS-CoV. In a preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a non-structural protein of ORF1 a and ORF1 b, preferably of a coronavirus, more preferably a human coronavirus, again more preferably a human beta coronavirus, again more preferably SARS-CoV-2 or MERS-CoV.

[0109] In a preferred embodiment, said substituted codons comprise codons located in ORF1a and ORF1 b. Preferably, at least part of the substituted codons is located in ORF1 a and ORF1 b. The inventors demonstrated that attenuated viruses which include the nucleic acid of the invention comprising substitutions to either faster or slower codons, wherein the substitutions are partly or completely located in ORF1a as well as ORF1 b have a highly reduced infectivity.

[0110] In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a spike, envelope, membrane, and nucleocapsid protein, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a structural protein selected from the group consisting of spike, envelope, membrane, and nucleocapsid protein, preferably a of coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a spike protein, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding an envelope protein, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a membrane protein, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a nucleocapsid protein, preferably of a coronavirus.

[0111] In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a non-structural protein of ORF1 a and ORF1 b, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a non-structural protein of ORF1a or ORF1 b, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a non-structural protein selected from the group consisting of nsp4 to nsp13, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding nsp4-nsp13, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding nsp4-nsp13 and a spike, envelope, membrane, and nucleocapsid protein, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding nsp6-nsp13, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding nsp6-nsp12, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a nsp4-nsp12, preferably of a coronavirus. In another preferred embodiment, said substituted codons are located in a nucleic acid sequence encoding a nsp7-nsp12, preferably of a coronavirus. Preferably, the codons are substituted by synonymous codons having a faster nucleic acid translation kinetic and by synonymous codons having a slower nucleic acid translation kinetic. More preferably, said coronavirus is SARS-CoV-2 or MERS-CoV, again more preferably SARS-CoV-2.

[0112] In a preferred embodiment, said coding sequence of a virus encodes at least one structural protein selected from the group consisting of spike, envelope, membrane, and nucleocapsid protein and / or a non-structural protein of ORF1 a and / or ORF1 b, preferably of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes a spike, envelope, membrane, and nucleocapsid protein preferably of SARS-CoV-2 or MERS-CoV, more preferably SARS-CoV-2, or corresponding proteins of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes at least one structural protein selected from the group consisting of spike, envelope, membrane, and nucleocapsid protein, preferably of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes a spike protein, preferably of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes a non-structural protein of ORF1 a and / or ORF1 b, preferably of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes a non-structural protein of ORF1 a and ORF1 b, preferably of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes a non-structural protein selected from the group consisting of nsp4 to nsp13, preferably of SARS-CoV-2 or MERS-CoV, more preferably SARS-CoV-2, or corresponding proteins of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes nsp4-nsp13, preferably of SARS-CoV-2 or MERS-CoV, more preferably SARS-CoV-2, or corresponding proteins of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes nsp4-nsp13 and a spike, envelope, membrane, and nucleocapsid protein, preferably of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes nsp6-nsp13, preferably of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes nsp6-nsp12, preferably of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes nsp4-nsp12, preferably of a coronavirus. In another preferred embodiment, said coding sequence of a virus encodes nsp7-nsp12, preferably of a coronavirus. Preferably, the coding sequence comprises codons that are substituted by synonymous codons having a faster nucleic acid translation kinetic and codons that are substituted by synonymous codons having a slower nucleic acid translation kinetic. More preferably, said coronavirus is SARS- CoV-2 or MERS-CoV, again more preferably SARS-CoV-2.

[0113] In some embodiments, the nucleic acid has further alterations of different nature (i.e. , alterations other than codon alterations to alter translation kinetics) and / or deletions that influence the amino acid sequence in the desired manner.

[0114] In preferred embodiments, the at least one coding sequence of a virus has a length of at least 2000 (2k) nucleotides. Preferably, the at least one coding sequence of a virus has a length of 2000-20’000 (2k-20k), more preferably 3000-10’000 (3k-10k) nucleotides.

[0115] In preferred embodiments, the nucleic acid or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 12-36 and 37, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 12-36 and 37.

[0116] In preferred embodiments, the nucleic acid or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-1 1 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-11 .

[0117] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-37, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-37.

[0118] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 12-36 and 37, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 12-36 and 37. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 12-37. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 12-37, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 12-37.

[0119] In preferred embodiments, the nucleic acid comprises or consists of at least one sequence selected from the group consisting of SEQ ID NO. 1 , 2 and 5-37 or the nucleic acid consists of or comprises a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-37. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 1 , 2 and 5-37, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 1 , 2 and 5-37.

[0120] In preferred embodiments, the nucleic acid or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-11 and 38, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-11 and 38.

[0121] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-11 , 38 and 41 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-11 , 38 and 41 .

[0122] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 12-37 and 39, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 12-37 and 39. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 12-37 and 39. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 12-37 and 39, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 12-37 and 39.

[0123] In preferred embodiments, the nucleic acid comprises or consists of at least one sequence selected from the group consisting of SEQ ID NO. 1 , 2 and 5-39 or the nucleic acid consists of or comprises a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-39. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 1 , 2 and 5-39, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 1 , 2 and 5-39.

[0124] In preferred embodiments, the nucleic acid comprises or consists of at least one sequence selected from the group consisting of SEQ ID NO. 1 , 2, 5-39 and 41 , or the nucleic acid consists of or comprises a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-39 and 41. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 1 , 2, 5-39 and 41 , or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 1 , 2, 5-39 and 41.

[0125] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 1 or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 1. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 2, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 2. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 5 or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 5. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 6 or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 6. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 7, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 7. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 8, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 8. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 9, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 9. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 10, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 10. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 11 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 11. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 12, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 12. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 13, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 13. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 14, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 14. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 15, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 15. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 16, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 16. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 17, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 17. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 18, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 18. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 19, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 19. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 20, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 20. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 21 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 21 . In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 22, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 22. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 23, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 23. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 24, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 24. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 25, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 25. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 26, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 26. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 27, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 27. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 28, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 28. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 29, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 29. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 30, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 30. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 31 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 31. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 32, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 32. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 33, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 33. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 34, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 34. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 35, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 35. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 36, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 36. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 37, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 37. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 38, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 38. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 39, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 39. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 41 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 41 . In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 12-24, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 12-24. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 12-24, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 12-24. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 12-24 and 39, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 12-24 and 39.

[0126] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 25-37, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 12-37. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 25-37, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to SEQ ID NO: 12-37.

[0127] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 21 , 34, 22, 35, 23, 36, 24, 37, 15, 28, 16, 29, 17, 30, 18, and 31 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 21 , 34, 22, 35, 23, 36, 24, 37,15, 28,16, 29,17, 30, 18, and 31. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 21 , 22, 23, 36, 24, 37, 15, 28, 16, 29, 17, 30, 18, and 31 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 21 , 22, 23, 36, 24, 37, 15, 28, 16, 29, 17, 30, 18, and 31 .

[0128] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 21 , 34, 22, 35, 23, 36, 24, and 37, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 21 ,

[0129] 34, 22, 35, 23, 36, 24, and 37. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 21 , 34, 22, and 35, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 21 , 34, 22, and 35.

[0130] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 21 , 22, 23, 36, 24, and 37, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 21 , 22, 23, 36, 24, and 37. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence of SEQ ID NO: 21 or 22, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% a sequence selected from the group consisting of sequence identity to SEQ ID NO: 21 or 22.

[0131] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 21 , and 34, 22, and 35, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 21 , and 34, 22, and

[0132] 35.

[0133] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 21-24, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 21 -24.

[0134] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 12, 25, 13, 26, 14, 27, 15, 28, 16, 29, 17, 30, 18, 31 , 19, 32, 20, and 33, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 12, 25, 13, 26, 14, 27, 15, 28, 16, 29, 17, 30, 18, 31 , 19, 32, 20, and 33.

[0135] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 12-20, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 12-20. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 25-33, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 25-33. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 12-20, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 12-20. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 25-33 or 12-20, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 25-33 or 12-20.

[0136] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 15, 28, 16, 29, 17, 30, 18, and 31 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 15, 28, 16, 29,17, 30, 18, and 31. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 15, 28, 16, 29, 17, and 30, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 15, 28, 16, 29,17, and 30. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 16, 29, 17, 30, 18, and 31 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 16, 29, 17, 30, 18, and 31.

[0137] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 21 , 34, 22, 35, 23, 36, 24, 37, 15, 28, 16, 29, 17, 30, 18, and 31 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 21 , 34, 22, 35, 23, 36, 24, 37, 15, 28, 16, 29,17, 30, 18, and 31. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 21 , 22, 23, 36, 24, 37, 15, 28, 16, 29, 17, 30, 18, and 31 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 21 , 22, 23, 36, 24, 37, 15, 28, 16, 29, 17, 30, 18, and 31 .

[0138] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 21 , 22, 23 and 24, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 21 , 22, 23 and 24. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 34, 35, 36, and 37, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 34, 35, 36, and 37. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 21 and 22 or 34 and 35, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 21 and 22 or 34 and 35. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 21 -24 or 34-37, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 21 -24 or 34-37.

[0139] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 7 and 8 or a sequence comprising SEQ ID NO: 21 and 22 or 34 and 35, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 7 and 8 or a sequence comprising SEQ ID NO: 21 and 22 or 34 and 35. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 7 and 8 or a sequence comprising SEQ ID NO: 21-24 or 34-37, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 7 and 8 or a sequence comprising SEQ ID NO: 21 -24 or 34-37.

[0140] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 8 and 10 or a sequence comprising SEQ ID NO: 28-30 or SEQ ID NO: 34 and 35, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 8 and 10 or sequences comprising SEQ ID NO: 28-30 or SEQ ID NO: 34 and 35.

[0141] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 7, 8 and 10 or a sequence comprising SEQ ID NO: 21 and 22, or SEQ ID NO: 28-30 or SEQ ID NO: 34 and 35, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 7, 8 and 10 or sequences comprising SEQ ID NO: 21 and 22, or SEQ ID NO: 28-30 or SEQ ID NO: 34 and 35.

[0142] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 7, 8 and 10 or a sequence comprising SEQ ID NO: 21 and 22, or SEQ ID NO: 28-30 or SEQ ID NO: 34 and 35, or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 7, 8 and 10 or sequences comprising SEQ ID NO: 21 and 22, or SEQ ID NO: 28-30 or SEQ ID NO: 34 and 35.

[0143] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 15-18 or 28-31 , or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 15-18 or 28-31. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 15-17 or 28-30, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 15-17 or 28-30. In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 16-18 or 29-31 , or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 16- 18 or 29-31 . In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 15, 16, 30 and 31 , or 28, 29, 17 and 18, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 15, 16, 30 and 31 , or 28, 29, 17 and 18.

[0144] In preferred embodiments, the nucleic acid of the invention or the at least one coding sequence of the invention consists of or comprises sequences of SEQ ID NO: 15, 16, 30 and 31 or 28, 29, 17 and 18, or sequences having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence consisting of or comprising SEQ ID NO: 15, 16, 30 and 31 or 28, 29, 17 and 18.

[0145] In preferred embodiments, the virus is a coronavirus; and the reference virus genome is a naturally occurring coronavirus, preferably a most similar naturally occurring coronavirus, more preferably a sequence as defined by SEQ ID NO: 3 or 4; or the reference nucleotide sequence of a virus is a corresponding sequence in a naturally occurring coronavirus, preferably a most similar naturally occurring coronavirus, more preferably a sequence as defined by SEQ ID NO: 3 or 4.

[0146] In preferred embodiments, the virus is a coronavirus, preferably SARS-CoV-2; and the reference virus genome is a naturally occurring coronavirus, preferably a SARS-CoV-

[0147] 2 wildtype virus, more preferably a sequence as defined by SEQ ID NO: 3 or 4; or the reference nucleotide sequence of a virus is a corresponding sequence in a naturally occurring coronavirus, preferably a SARS-CoV-2 wildtype virus, more preferably a sequence as defined by SEQ ID NO: 3 or 4.

[0148] In certain preferred embodiments, the virus is SARS-CoV-2; and the reference virus genome is a naturally occurring SARS-CoV-2, preferably a most similar naturally occurring SARS-CoV-2, more preferably a sequence as defined by SEQ ID NO: 3 or 4; or the reference nucleotide sequence of a virus is a corresponding sequence in a naturally occurring SARS-CoV-2, preferably a most similar naturally occurring SARS- CoV-2, more preferably a sequence as defined by SEQ ID NO: 3 or 4.

[0149] In certain embodiments, the invention relates to the nucleic acid of the invention, wherein the virus is SARS-CoV-2; and the reference virus genome is a natural SARS- CoV-2 virus (SARS-CoV-2 wildtype), preferably SEQ ID NO: 3 or 4.

[0150] In preferred embodiments, the virus is a coronavirus; and the reference virus genome is a naturally occurring coronavirus genome, preferably a most similar naturally occurring coronavirus genome, more preferably a sequence as defined by SEQ ID NO:

[0151] 3 or 4 or a human beta coronavirus 2c EMC / 2012 genome; the reference nucleotide sequence of a virus is a corresponding sequence in a naturally occurring coronavirus, preferably a most similar naturally occurring coronavirus, more preferably a sequence as defined by SEQ ID NO: 3 or 4 or a sequence of a human beta coronavirus 2c EMC / 2012 or SEQ ID NO: 40. In preferred embodiments, the virus is a coronavirus, preferably SARS-CoV-2 or MERS-CoV; and the reference virus genome is a naturally occurring coronavirus genome, preferably a SARS-CoV-2 wildtype virus genome, more preferably a sequence as defined by SEQ ID NO: 3 or 4 for SARS CoV-2, and a MERS-CoV wildtype virus genome, more preferably a human beta coronavirus 2c EMC / 2012 genome for MERS-CoV; the reference nucleotide sequence of a virus is a corresponding sequence in a naturally occurring coronavirus, preferably a corresponding SARS-CoV-2 wildtype, more preferably a corresponding sequence of SEQ ID NO: 3 or 4 for SARS CoV-2, and a corresponding sequence of a MERS-CoV wildtype, more preferably of a human beta coronavirus 2c EMC / 2012 or SEQ ID NO: 40 for MERS CoV.

[0152] In certain preferred embodiments, the virus is SARS-CoV-2 or MERS-CoV; and the reference virus genome is a naturally occurring SARS-CoV-2 or MERS-CoV genome, preferably a most similar naturally occurring SARS-CoV-2 or MERS-CoV genome, more preferably a sequence as defined by SEQ ID NO: 3 or 4 for SARS-CoV-2 and a human beta coronavirus 2c EMC / 2012 genome for MERS-CoV; the reference nucleotide sequence of a virus is a corresponding sequence of a naturally occurring SARS-CoV-2 or MERS-CoV, preferably of a most similar naturally occurring SARS- CoV-2 or MERS-CoV, more preferably a corresponding sequence of SEQ ID NO: 3 or 4 for SARS-CoV-2 and a corresponding sequence of a human beta coronavirus 2c EMC / 2012 or SEQ ID NO: 40 for MERS-CoV.

[0153] In certain embodiments, the invention relates to the nucleic acid of the invention, wherein the virus is SARS-CoV-2 or MERS-CoV; and the reference virus genome is a natural SARS-CoV-2 virus (SARS-CoV-2 wildtype), preferably SEQ ID NO: 3 or 4 for SARS-CoV-2, and a natural MERS-CoV virus (MERS-CoV wildtype), preferably a human beta coronavirus 2c EMC / 2012 for MERS-CoV.

[0154] The term “SARS-CoV-2”, as used herein, refers to any known SARS-CoV-2 or variants derived thereof. In some embodiments, the SARS-CoV-2 described herein is the genome of a variant selected from the list SARS-CoV-2 variants of concern preferably as of 15 March 2024 (htps: / / www.ecdc.europa.eu / en / covid-19 / variants-concern; preferably updated on 20 Mar 2024). In some embodiments, the SARS-CoV-2 described herein is the genome of a variant selected from the group consisting of Omicron XBB.1 .5; Omicron XBB.1.5-like (a), Omicron BA.2.86, Omicron BA.2.87.1 , BA.2, BA.4 and BA.5. In some embodiments, the SARS-CoV-2 described herein is the genome of a variant selected from the group consisting of Omicron XBB.1.5-like (a), Omicron BA.2.86, Omicron BA.2.87.1. In some embodiments, the SARS-CoV-2 described herein is the genome of a variant selected from the group consisting of Omicron XBB.1.5 and Omicron XBB.1 ,5-like, BA.2, preferably BA.2.8, BA.4 and BA.5.

[0155] In some embodiments, the SARS-CoV-2 described herein is the genome of a variant selected from the group consisting of Alpha, Beta, Gamma, Delta, Omicron Lineage B.1.1.529, Omicron Lineage BA.2, Lambda, Mu, Epsilon, Zeta, Eta, Theta and lota. In some embodiments, the SARS-CoV-2 described herein is a variant derived from a variant selected from the group of Delta, Omicron Lineage B.1.1.529 and Omicron Lineage BA.2. In some embodiments, the SARS-CoV-2 described herein is a sequence with the accession number MT108784. In some embodiments, the SARS- CoV-2 comprises at least one mutation selected from the group of del 69-70, RSYLTPGD246-253N, N440K, G446V, L452R, Y453F, S477G / N, E484Q, E484K, F490S, N501Y, N501 S, D614G, Q677P / H, P681 H and P681 R.

[0156] In a preferred embodiment, the virus or coronavirus is MERS-CoV, also known as Middle East respiratory syndrome-related coronavirus, EMC / 2012 (HCoV-EMC / 2012). The term “MERS-CoV” comprises any of current and futures clades, lineages, variants, or strains of MERS-CoV including the three major clades A, B, and C and unclassified clades. Whereas clades A and C contain extinct strains and strains not circulating in the Arabian Peninsula, clade B strains currently infect humans and dromedary camels in this area. Clade B is subdivided into six phylogenetic lineages. Presumed recombination between lineage 3 and 4 resulted in the formation of a circulating recombinant lineage (lineage 5, also termed NRC for novel recombinant clade) during or before the year 2014 in dromedary camels.

[0157] In certain embodiments, the invention relates to the nucleic acid of the invention, wherein the pathogen is SARS-CoV-2 and wherein the genome of the reference pathogen is a sequence as defined by SEQ ID NO: 3 or 4.

[0158] In certain embodiments, the invention relates to the nucleic acid of the invention, wherein the virus is SARS-CoV-2 or MERS-CoV and the genome of the reference virus is a sequence as defined by SEQ ID NO: 3 or 4 for SARS-CoV-2 and a human beta coronavirus 2c EMC / 2012 or SEQ ID NO: 40 for MERS-CoV. In certain embodiments, the invention relates to the nucleic acid of the invention, wherein the virus is MERS-CoV and the reference genome is a human beta coronavirus 2c EMC / 2012 for MERS-CoV.

[0159] In a further aspect the invention relates to a vector comprising the nucleic acid of the invention.

[0160] The term “vector”, as used herein, refers to a nucleic acid molecule that is designed for being incorporated and expressed by a cell or for transfer between different host cells. A cloning or expression vector may comprise elements, for example, regulatory and / or post-transcriptional regulatory elements and a promoter. A vector may include sequences that allow direct autonomous replication in a cell or may include sequences sufficient to allow integration into host cell DNA. In some embodiments, the vector described herein is a vector selected from the group of plasmids (e.g., DNA plasmids or RNA plasmids), shuttle vectors, transposons, cosmids, artificial chromosomes (e.g., bacterial, yeast, human), and viral vectors.

[0161] In some embodiments, the vector described herein is used in combination with at least one transfection enhancer, e.g., a transfection enhancer selected from the group of oligonucleotides, lipoplexes, polymersomes, polyplexes, dendrimers, inorganic nanoparticles, and cell-penetrating peptides.

[0162] Transduction of host cells by the vector of the invention can be achieved by stable or transient transduction (see, e.g., Stepanenko, A. A., and Heng, H. H., 2017, Mutation Research / Reviews in Mutation Research, 773, 91 -103).

[0163] In a further aspect the invention relates to a genetically modified cell comprising the nucleic acid of the invention, preferably the genetically modified cell is a host cell for production of a virus.

[0164] In a certain aspect, the invention relates to a genetically modified cell comprising the nucleic acid of the invention.

[0165] The term “genetically modified cell”, as used herein, refers to a cell modified by means of genetic engineering. The term as used herein “engineered” and other grammatical forms thereof may refer to one or more changes of nucleic acids, such as nucleic acids within the genome of an organism. In some embodiments, the genetically modified cell described herein is a host cell for recombinant expression of protein and polynucleotides and / or the production of an attenuated virus (preferably SARS-CoV-2 or MERS-CoV) and / or for amplification of the nucleic acid of the invention. The term “host cell”, as used herein, refers to a cell into which one or more exogenous nucleic acid has been introduced, including the progeny of such a cell. Host cells include "transformants" and "transformed cells," which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell but may contain mutations. Mutant progeny that has the same function or biological activity as screened or selected for in the originally transformed cell are included herein.

[0166] In some embodiments, the host cell described herein comprises at least one cell type selected from the group of Vero, VeroE6, VeroE6-TMPRSS2, A549-hACE2, HEK293, HEK293T, MDCK, Chinese hamster ovary (CHO), BHK-21 , SF9, MRC 5, Per.C6, PMK, and WI-38.

[0167] In some embodiments, the genetically modified cell is a cell for use in cell therapy.

[0168] In certain embodiments, the invention relates to a method for production of an attenuated virus, the method comprising a step of culturing the genetically modified cell of the invention. Methods for culturing cells are known in the art (see, e.g., Celis, Julio E., ed. Cell biology: a laboratory handbook. Vol. 1. Elsevier, 2005).

[0169] In certain embodiments, the invention relates to a genetically modified cell comprising the nucleic acid of the invention, wherein the genetically modified cell is a host cell for production of a virus.

[0170] In a further aspect the invention relates to a method for production of an attenuated virus, the method preferably comprises a step of culturing the genetically modified cell of the invention.

[0171] In a further aspect the invention relates to an attenuated virus comprising the nucleic acid molecule of the invention. In some embodiments, the attenuated virus described herein further comprises structural and non-structural proteins of SARS-CoV-2 or MERS-CoV, preferably structural proteins of SARS-CoV-2 or MERS-CoV, more preferably all structural proteins of SARS-CoV-2 or MERS-CoV. In some embodiments, the attenuated virus described herein further comprises structural proteins and ORFI ab encoded proteins of SARS-CoV-2 or MERS-CoV.

[0172] In a further aspect the invention relates to a pharmaceutical product comprising the nucleic acid molecule of the invention, the vector of the invention, the genetically modified cell of the invention and / or the attenuated virus of the invention for use as a medicament.

[0173] In a certain aspect, the invention relates to a pharmaceutical product comprising the vector of the invention, the genetically modified cell of the invention and / or the attenuated virus of the invention.

[0174] In a certain aspect, the invention relates to a pharmaceutical product comprising the vector of the invention, the genetically modified cell of the invention and / or the attenuated virus of the invention for use as a medicament.

[0175] The term “pharmaceutical product”, as used herein, refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered. In a preferred embodiment, the pharmaceutical product is a pharmaceutical composition comprising the vector of the invention, the genetically modified cell of the invention and / or the attenuated virus of the invention and pharmaceutically acceptable carrier. As used herein, “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion). In some embodiments, the pharmaceutical product comprises a device for administering the pharmaceutical composition, such as a syringe.

[0176] In some embodiments, the pharmaceutical product comprises auxiliary substances like carriers and / or adjuvants, e.g., for enhancing an immune response of a patient. In some embodiments, the pharmaceutical product described herein comprises the vector of the invention and vector stabilizers and / or nanoparticles such as LNPs. The terms “use as a medicament” or "treatment" (and grammatical variations thereof such as "treat" or "treating"), as used herein, refer to clinical intervention in an attempt to alter the natural course of the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.

[0177] In a preferred embodiment, the pharmaceutical product, the pharmaceutical composition, the vector, the genetically modified cell and / or the attenuated virus of the invention can be administered by any suitable way, preferably by mucosal, nasal, intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration. Since an attenuated virus comprising the nucleic acid molecule of the invention induces immunity at the site of infection, mucosal immunity can be induced via mucosal administration. Thus, in a preferred embodiment, the attenuated virus or pharmaceutical product or composition of the invention is applied via nasal administration, e.g., via nasal sprays.

[0178] The dose is chosen such that the pharmaceutical product is well tolerated by the patient but evokes an immune response that gives desired medical effect, such as protection against infection or against a severe progression of an infection. In an embodiment, the dose is the lowest protective dose, the highest tolerable dose or lies between the lowest protective dose and the highest tolerable dose.

[0179] Various factors can influence the dose used for a particular application. For example, the frequency of administration, duration of treatment, preventive or therapeutic purpose, the use of multiple treatment agents, route of administration, previous therapy, the patient's clinical history, the discretion of the attending physician and seventy of the disease, disorder and / or condition may influence the required dose to be administered.

[0180] As with the dose, various factors can influence the actual frequency of administration used for a particular application. For example, the dose, duration of treatment, use of multiple treatment agents, route of administration, and severity of the disease, disorder and / or condition may require an increase or decrease in administration frequency. In some cases, an effective duration for administering the pharmaceutical product of the invention (and any additional therapeutic agent) can be any duration that reduces the seventy, or occurrence, of symptoms of the disease, disorder and / or condition to be treated without producing significant toxicity to the subject. Multiple factors can influence the actual effective duration used for a particular treatment. For example, an effective duration can vary with the frequency of administration, effective amount, use of multiple treatment agents, route of administration, and severity of the disease, disorder and / or condition being treated.

[0181] In some embodiments, the pharmaceutical product is administered to the patient at once. In some embodiments, the pharmaceutical product is administered to the patient at least two times, wherein the second administration is separated from the first administration.

[0182] In certain embodiments, the invention relates to a pharmaceutical product comprising the vector of the invention, the genetically modified cell of the invention and / or the attenuated virus of the invention for use in treatment and / or prevention of an infection, such as an RNA virus infection, preferably a coronavirus infection, more preferably a SARS-CoV-2 infection or MERS-CoV infection, again more preferably a SARS-CoV-2 infection.

[0183] In certain embodiments, the invention relates to a pharmaceutical product comprising the vector of the invention, the genetically modified cell of the invention and / or the attenuated pathogen of the invention for use in treatment and / or prevention of a symptom of a virus infection, such as an RNA virus infection, preferably a coronavirus infection, more preferably a SARS-CoV-2 infection or MERS-CoV infection, again more preferably a SARS-CoV-2 infection.

[0184] Symptoms of a SARS-CoV-2 infection include, without limitation, cough, fatigue, difficulty breathing, chills, joint or muscle pain, expectoration, sputum production, dyspnoea, myalgia, arthralgia or sore throat, headache, nausea, vomiting, diarrhea, sinus pain, stuffy nose, reduced or altered sense of smell or taste, lack of appetite, loss of weight, stomach pain, conjunctivitis, skin rash, lymphoma, apathy, and somnolence, preferably fever, cough, fatigue, difficulty breathing, chills, joint or muscle pain, expectoration, sputum production, dyspnoea, myalgia, arthralgia, sore throat, headache, nausea, vomiting, diarrhea, sinus pain, stuffy nose and reduced or altered sense of smell or taste.

[0185] Symptoms of a MERS-CoV-2 infection include, without limitation, fever, cough, dyspnea, shortness of breath, breathing difficulties , gastro-intestinal problems, pneumonia, chills / rigors, headache, myalgia. Other signs and symptoms can include sore throat, coryza, productive cough, dizziness, nausea and vomiting, diarrhea, and abdominal pain.

[0186] The inventors found that the means and methods described herein can be used to induce an immune response that is useful in the treatment and / or prevention of a virus infection, such as an RNA virus, preferably a coronavirus infection, more preferably a human coronavirus infection, again more preferably a SARS-CoV-2 infection or MERS- CoV infection, again more preferably a SARS-CoV-2 infection. In certain preferred embodiments, the virus infection is caused by a human beta coronavirus. In more preferred embodiments, the virus infection is caused by a human lineage B or C beta coronavirus. In certain embodiments, the pharmaceutical product described herein is a vaccine and / or a vaccine booster.

[0187] In preferred embodiments, the medicament is for use in prevention and / or treatment of a virus infection or a symptom thereof.

[0188] In certain embodiments, the invention relates to use of the pharmaceutical product or composition, the nucleic acid, the vector, the genetically modified cell and / or the attenuated virus of the invention in the manufacture of a medicament for the treatment of a virus infection or a symptom thereof.

[0189] In certain embodiments, the invention relates to a method of treatment and / or prevention of a virus infection or a symptom thereof, said method comprises the step of administering a pharmaceutical product in a therapeutically effective amount to a subject, wherein the pharmaceutical product comprises the nucleic acid of the invention, the vector of the invention, the genetically modified cell of the invention and / or the attenuated virus of the invention.

[0190] In preferred embodiments, the virus infection is an RNA virus infection, preferably a coronavirus infection, more preferably a human coronavirus infection, again more preferably a SARS-CoV-2 infection. In certain preferred embodiments, the virus infection is caused by a beta coronavirus, preferably a human beta coronavirus. In more preferred embodiments, the virus infection is caused by a lineage B or C beta coronavirus, preferably a human lineage B or C beta coronavirus. In very preferred embodiments, the virus infection is a SARS-CoV-2 or MERS-CoV infection.

[0191] In a further aspect, the invention relates to a method for modifying translation kinetics of a virus, the method comprising the steps of: a) categorizing at least two codons of a virus in at least two categories and / or attributing at least two different weights to at least two codons of a virus, wherein the categories and / or weights are / is indicative of translational kinetic of the codon; b) modifying translation kinetics of the virus by replacing a codon categorized or weighted in step a) with a synonymous codon of a different category or weight; wherein preferably the kinetics of nucleic acid is determined by ribosomal profiling data, more preferably by relative ribosomal A-site codon occupancy values, again more preferably by relative ribosomal A-site codon occupancy values as indicated in Table 1.

[0192] In a further aspect, the invention relates to a method for preparing a nucleic acid comprising at least one coding sequence of a virus, wherein at least one codon in said coding sequence has an altered kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus, the method comprising the steps of: a) categorizing at least two codons of a virus in at least two categories and optionally attributing different weights to the categories, wherein the categories are indicative of translational kinetic of the codon; b) modifying translation kinetic of the virus by replacing a codon categorized in step a) with a synonymous codon of a different category; wherein preferably the kinetic of nucleic acid is determined by ribosomal profiling data, more preferably by relative ribosomal A-site codon occupancy values, again more preferably by relative ribosomal A-site codon occupancy values as indicated in Table 1. In a further aspect the invention relates to a method for preparing an attenuated virus, the method comprises the steps of: a) selecting a reference genome of a virus, and selecting at least one coding sequence in the reference genome of the virus; b) computing the translational kinetic of at least two codons, preferably of all codons in the coding sequence, c) optionally categorizing at least two codons in the coding sequence in at least two categories, wherein the categories are indicative of translational kinetic of the codon; d) substituting at least one codon of said coding sequence by a synonymous codon with a faster or slower rate of translation, optionally by replacing a codon categorized in step c) with a synonymous codon of a different category; e) expressing the modified coding sequence, preferably in a host cell.

[0193] Preferably the kinetic of nucleic acid is determined by ribosomal profiling data, more preferably by relative ribosomal A-site codon occupancy values, again more preferably by relative ribosomal A-site codon occupancy values as indicated in Table 1 .

[0194] Codon translation rate is altered in order to deoptimize translation of the coding sequence thereby producing a nucleic acid molecule deoptimized for expression in a cellular context.

[0195] In preferred embodiments, the virus is an RNA virus, preferably a coronavirus, more preferably a human coronavirus, again more preferably SARS-CoV-2. In preferred embodiments, the virus is an RNA virus, preferably a coronavirus, more preferably a human coronavirus, again more preferably SARS-CoV-2 or MERS-CoV, again more preferably SARS-CoV-2. In certain preferred embodiments, the virus is a beta coronavirus, preferably a human beta coronavirus. In more preferred embodiments, the virus is a lineage B or C beta coronavirus, preferably a human a lineage B or C beta coronavirus.

[0196] Preferably, the term “coding region” or “coding sequence”, as used herein, is a gene that codes for a protein or a portion of a gene's DNA or RNA that codes for a protein. The reference virus genome or reference nucleotide sequence of a virus can be any known virus genome or nucleotide sequence of a virus. The term, "reference" with respect to a virus genome or nucleotide sequence of a virus refers to a virus genome or nucleotide sequence of a virus, preferably to a corresponding virus genome or nucleotide sequence of a virus, wherein no codon in said reference genome or sequence is substituted by a synonymous codon that has an altered kinetic of nucleic acid translation. Preferably, the term “reference virus genome” or a “reference nucleotide sequence of a virus” refers to the corresponding wildtype (WT) virus genome or sequence, i.e., a corresponding naturally occurring virus genome or nucleotide sequence of a virus that preferably does not include a synthetic modification (substitution, insertion, or deletion etc.) at one or more nucleic acid positions. In certain embodiments, the reference virus is a naturally occurring virus with additional genetical modifications not directed to alter translation kinetics.

[0197] Preferably, the reference virus genome or reference nucleotide sequence of a virus is a genome or a sequence of a human virus or zoonotic virus, more preferably WT human or zoonotic virus. More preferably, the reference virus genome or reference nucleotide sequence of a virus is a genome or sequence of a virus, preferably a WT virus, selected from the group consisting of RNA virus, DNA virus and retrovirus. In certain embodiments, the RNA virus is not a reverse transcribing RNA virus. In certain embodiments, the RNA virus is a single stranded (ss) or double stranded (ds) virus, preferably a ssRNA virus, more preferably a WT ssRNA virus. In certain embodiments, the RNA virus described herein is a positive or negative sense virus, preferably a positive sense (+) virus, more preferably a WT (+) virus. In certain embodiments, the RNA virus described herein is a non-enveloped or an enveloped virus, preferably an enveloped virus, more preferably a WT enveloped virus. In a preferred embodiment, the virus is a ss (+) RNA virus, more preferably a WT ss (+) RNA virus. In a more preferred embodiment, the virus is an enveloped positive sense ss RNA virus more preferably a WT enveloped positive sense ss RNA virus. In even more preferred embodiments, the reference virus genome or reference nucleotide sequence of a virus is a genome or nucleotide sequence of a coronavirus, preferably a human coronavirus, more preferably a WT human coronavirus. In certain embodiments the human coronavirus is a beta coronavirus, preferably a beta coronavirus selected from the group consisting of: MERS-CoV, SARS-CoV-1 , and SARS-CoV-2, more preferably MERS-CoV or SARS-CoV-2, even more preferably SARS-CoV-2 wild-type (WT) or MERS-CoV WT. In even more preferred embodiments, the human coronavirus is SARS-CoV-2 wild-type. In even more preferred embodiments, the human coronavirus is SARS-CoV-2 Wuhan wild-type. Even more preferably, the reference virus genome or reference nucleotide sequence of a virus is a genome or nucleotide sequence of SEQ ID NO: 3 or 4. In preferred embodiments, the reference virus genome or reference nucleotide sequence of a virus for MERS-CoV is a human beta coronavirus 2c EMC / 2012 genome or a nucleotide sequence thereof, such as or SEQ ID NO: 40.

[0198] The term “corresponding” in the context of a codon in a reference virus genome or a reference nucleotide sequence of a virus refers to the position of the codon, i.e., corresponding codons occur at aligned loci. The skilled person is aware of how to determine a position of a corresponding codon, for example, using sequence alignment techniques, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software, or using conserved and identical amino acid residues as guides. Those skilled in the art can determine appropriate parameters for aligning sequences and determining positions, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0199] The term “percent (%) identical” with respect to a reference sequence is defined as the percentage of nucleotides in an altered sequence that are identical with the nucleotides in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0200] The term “nucleic acid molecule”, “nucleic acid”, or “nucleic acid”, as used herein, refers to a nucleic acid that includes at least 50 nucleic acid monomer units (e.g., nucleotides), typically more than 100 monomer units, and more typically greater than 200, greater than 500 or greater than 1000 monomer units. Nucleic acids are optionally prepared by any suitable method, including, but not limited to, isolation of an existing or natural sequence, DNA replication or amplification, reverse transcription, cloning and restriction digestion of appropriate sequences, or direct chemical synthesis by methods known in the art. The term “nucleic acid” refers to any kind of deoxyribonucleotide (e.g., DNA, cDNA, ... ) or ribonucleotide (e.g., RNA, such as mRNA, ... ) polymer or a combination of deoxyribonucleotide and ribonucleotide (e.g., DNA / RNA) polymer, in linear or circular conformation, and in either single - or doublestranded form. These terms can encompass known analogs of natural nucleotides, as well as nucleotides that are modified in the base, sugar and / or phosphate moieties (e.g., phosphorothioate backbones). In general, an analog of a particular nucleotide has the same or very similar base-pairing specificity, i.e., an analog of A will base-pair with T. In a preferred embodiment the nucleic acid described herein is mRNA or cDNA.

[0201] As used herein, the term "RNA" means a molecule comprising at least one ribonucleotide residue. By "ribonucleotide" is meant a nucleotide with a hydroxyl group at the 2' position of a beta-D-ribo-furanose moiety. The term includes any type of RNA, such as, mRNA and non-coding RNA, tRNA, tmRNA, rRNA, regulatory RNA, such as miRNA or siRNA, nucleoside modified mRNA; double stranded RNA, single stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and / or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or internally, for example at one or more nucleotides of the RNA. Nucleotides in the RNA molecules of the present invention can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally occurring RNA. The term "double stranded RNA" or "dsRNA" as used herein refers to a ribonucleic acid duplex, including but not limited to, endogenous and artificial siRNAs, short hairpin RNAs (shRNAs) and miRNAs. More preferably, the term RNA refers to mRNA.

[0202] The term “virus”, as used herein, preferably refers to a human virus. In certain embodiments, the virus is selected from the group consisting of RNA virus, DNA virus and retrovirus. The term “RNA virus”, as used herein, refers to a virus in which the genetic information is stored or primarily stored in the form of RNA. In certain embodiments, the RNA virus is not a reverse transcribing RNA virus. In certain embodiments, the RNA virus described herein is a single stranded (ss) or double stranded (ds) virus, preferably a single stranded RNA virus. In certain embodiments, the RNA virus described herein is a positive or negative sense virus, preferably a positive sense virus. In certain embodiments, the RNA virus described herein is a nonenveloped or an enveloped virus, preferably an enveloped virus. In a preferred embodiment, the virus is a ss positive sense RNA virus. In a more preferred embodiment, the virus is an enveloped positive sense ss RNA virus. In an even more preferred embodiment, the virus is a coronavirus, more preferably a human coronavirus. In an even more preferred embodiment, the virus is a beta coronavirus, preferably a human beta coronavirus. In an even more preferred embodiment, the virus is a lineage B or C beta coronavirus, preferably a human a lineage B or C beta coronavirus.

[0203] The term “coronavirus” as used herein refers to enveloped single-stranded positivesense RNA viruses from the viral family of Coronaviridae including but not limited to SARS-CoV, MERS-CoV and SARS-CoV-2. There are four main sub-groupings of coronaviruses, known as alpha, beta, gamma, and delta. The coronaviruses known to- date as infecting humans are alpha coronaviruses and beta coronaviruses including SARS-CoV (interchangeable mentioned herein as SARS-CoV-1 ), SARS-CoV-2, and MERS-CoV which is the coronavirus that causes Middle East Respiratory Syndrome, or MERS. The SARS-CoV and SARS-CoV-2 are a lineage B beta Coronavirus and the MERS-CoV is a lineage C beta coronavirus. Sequence alignment of the nucleic acid sequences derived from the SARS-CoV, MERS-CoV and SARS-CoV-2 coronavirus variants identified five highly conserved regions: ORFIab, S, E, M and N.

[0204] SARS-CoV, MERS-CoV and SARS-CoV-2 fall within the beta genus of coronaviruses and contain a nucleocapsid surrounded by a lipid bilayer derived from the host cell. An envelope-anchored spike protein mediates the entry of the coronavirus into host cells by binding a host receptor and then fusing viral and host membranes.

[0205] Generally, coronaviruses share the same genome organization and structural proteins. Accordingly, substitutions that result in live attenuated variants of SARS-CoV-2, SARS- CoV and MERS-CoV may be introduced to sequences encoding corresponding proteins in other coronaviruses to produce live attenuated variants of these other coronaviruses. The products and methods described herein may thus also be used to prepare vaccines against other (known or yet unknown) coronaviruses than SARS- CoV-2 and MERS-CoV. In certain embodiments the human coronavirus described herein is a beta coronavirus, preferably a beta coronavirus selected from the group consisting of: MERS-CoV, SARS-CoV-1 , and SARS-CoV-2, more preferably a SARS-CoV-2 or MERS-CoV, most preferably SARS-CoV-2.

[0206] The term “attenuated virus”, as used herein, refers to a virus that, in comparison to a reference virus (e.g., a naturally occurring or non-attenuated virus), provokes less and / or less severe or even no symptoms in a host organism after the host organism has been confronted (infected) with the attenuated virus. Preferably, the attenuated virus induces an immune response of the host to the attenuated virus that is at least partially protective against a wild-type virus infection and / or at least one symptom thereof. In certain embodiments, the attenuated virus is capable of replication in the target host.

[0207] The term “codon alteration”, as used herein, refers to any kind of codon modification or alteration (both terms are used interchangeably herein) that results in a synonymous codon compared to the corresponding codon in the genome of the reference virus or the reference sequence. Preferably, the codon alteration or modification alters the translation kinetic of the codon. Codons are given according to the genome / DNA, and T is used interchangeably with U which occurs in the translated mRNA or viral RNA.

[0208] Translation kinetics

[0209] The term “translation” refers preferably to the process of translating the genetic information encoded in an mRNA molecule to a protein or polypeptide or the process of protein or polypeptide by ribosomes.

[0210] The term “translation kinetic(s)”, as used herein, refers preferably to codon translation rates or codon translation speed, relative codon translation speed or speed of amino acid addition. The terms rate and speed are interchangeably used herein. An altered kinetic of nucleic acid translation refers preferably to a faster or slower nucleic acid translation rate, more preferably a faster or slower codon translation rate.

[0211] In preferred embodiments, the translation kinetic is measured. Preferably, translation kinetics is not estimated, but measured, preferably as translation rate. Translation kinetic alteration can be measured using any method known in the art. Preferably, ribosomal profiling is used to determine translation kinetic (or translation rate). Thus, ribosomal profiling values are preferably interpreted as translation kinetic.

[0212] Ribosomal profiling preferably includes the following steps: Cells are treated (preferably with cycloheximide) to arrest translation, ribosomes are fixed and ribosome-protected RNA fragments (named ‘reads’) are recovered. After processing and reverse-transcription, these are sequenced, mapped, and used to derive ribosomal density profiles. This results in a profile for each coding sequence (named ‘ribosome density profile’ or ‘read count profile’). Each position in such a profile is related to one codon, and its value is related to the number of reads (‘read count’) that mapped to that codon. If for a certain coding sequence, a ribosome tends to spend more time on codon x than on codon y (i.e. ‘codon x is slower than codon y’ and the ‘ribosome density in codon x is higher than in codon y’), the read count related to codon x will be higher than the read count for codon y.

[0213] Preferably, relative A-site codon occupancy is used to determine translation kinetic (or translation rate). Preferably, relative A-site codon occupancy values are interpreted as translation kinetic or translation rate.

[0214] Translation kinetic or rate is preferably defined herein as the frequency of a codon in the ribosomal A-site relative to its frequency in the ribosome profiling library (relative A-site codon occupancy). To determine the translation rate of a codon in the ribosome profiling library the frequency in three codon positions is calculated, preferably as described in Nedialkova DD and Leidel SA. Optimization of codon translation rates via tRNA modifications maintains proteome integrity. Cell 2015; 161 (7): 1606-1618, and / or Stadler, M., and Fire, A. (2011 ). Wobble base-pairing slows in vivo translation elongation in metazoans. RNA 17, pp. 2063-2073 and / or Kim, Yeji, et al. "Analysis of codon-specific translation by ribosome profiling." Methods in Enzymology. Vol. 658. Academic Press, 2021. 191-223, with the amendment that the inventors used the codons +5, +6, +7 to reduce biases that stem from sequencing library preparation (and / or Ingolia, N.T., Ghaemmaghami, S., Newman, J.R., and Weissman, J.S. (2009), Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science 324, 218-223). The relative A-site codon occupancy values as for example shown in Figure 5 are values that were determined in “wild-type” human HEK293T cells to determine translation dynamics in humans based on the assumption that this is the cellular context that the virus RNA uses to translate its open reading frames (ORFs).

[0215] A-site codon occupancies are preferably derived from ribosome profiling experiments in HEK293T cells treated with cycloheximide in the lysis buffer but preferably not in the culture medium (cf. Example 3). The dataset is publicly available in the Gene Expression Omnibus Database (https: / / www.ncbi.nlm.nih.gov / geo / ). Accession code is: GSE136940. Samples in this dataset are called HEK293T_minus_plus_1 , H EK293T_m inus_plus_2, H EK293T_m inus_plus_3

[0216] Relative A-site codon occupancy (Ac) is preferably calculated using the following formula: where Ac is the relative A-site occupancy of a codon that was used to assess the relative translation speed of said codon (called herein codon speed); rc, A are the counts of uniquely mapped reads of the codon in the ribosomal A-site; Me is the mean read count of the codon at three downstream positions of the A-site. In preferred embodiments, positions +5, +6, +7 are used for the calculation (Figure 3 and 4).

[0217] Mean read count (Me) is preferably calculated by: where rc,A+5 is the count of uniquely mapped reads assigned to the specific codon at 5 codons downstream of the ribosomal A-site, rc,A+6 and rc,A+7 correspond to count of the specific codon 6 or 7 codons downstream of the ribosomal A-site, respectively.

[0218] To calculate single-codon occupancy, the number of A-site reads at a particular codon was normalized to the average per-codon A-site read density in the ORF containing it.

[0219] In certain embodiments, to avoid biases during ribosome profiling library preparation, three codons (+5, +6, +7) are used in 3' direction of the A-site codons. Based on the relative A-site frequency a codon is considered slower than a synonymous codon if it is more frequent. A codon is considered faster than a synonymous codon if it is less frequent. In certain embodiments, the translation kinetic is measured as described herein (see especially Example 3).

[0220] In preferred embodiments, the substitution slows down or speeds up translation. In preferred embodiments, the coding sequence of a virus was recoded to contain regions with increased fast and / or regions with increased slow translating codons.

[0221] In certain embodiments, the translation kinetics of the at least one codon in the coding sequence of the invention is altered by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to the corresponding codon in the reference virus genome or the reference nucleotide sequence of a virus.

[0222] Codon degeneracy refers to the phenomenon that an amino acid can be encoded by multiple different codons during protein translation. Two codons are considered “synonymous” herein if they code for the same amino acid or for similar amino acids. “Similar amino acids” in the context of synonymous codons are amino acids that can be replaced and wherein the replacement does not or not substantially alter the antigenicity of the protein of which they are part. More preferably, synonymous codons are different codons encoding the same amino acid.

[0223] Alternatively, or complementarily, more preferably complementarily, codon(s), which code(s) for Thr or Ala, can be replaced by codon(s) which code(s) for Ser. For example, the ACA codon, which codes for Thr, may be replaced by the UCA codon, which codes for Ser, which in turn differs from the UAA STOP codon by only one nucleotide. Such codon replacement modifies the amino acid sequence of the encoded protein and therefore is selected to not (substantially) modify the antigenicity of this protein.

[0224] In some embodiments, the nucleic acid has further modifications of different nature (i.e. , modifications other than codon modifications that alter kinetics) and / or deletions that influence the amino acid sequence in the desired manner.

[0225] For each group of synonymous codons, the “fast” and “slow” codons were determined by ribosome profiling based on their relative A-site codon occupancy. A higher relative frequency is considered "slow", and a lower relative frequency is considered "fast". Preferably, codons that were defined as fast are replaced by the slowest synonymous codon and codons that were defined as slow are replaced by the fastest synonymous codon.

[0226] The term "or" should be understood to mean either one, both, or any combination thereof of the alternatives. The term "and / or" should be understood to mean either one, or both of the alternatives.

[0227] Throughout this specification, unless the context requires otherwise, the words "comprise", or the word “include”, and variations such as "comprises / includes" and "comprising / including", will be understood to imply the inclusion of a stated step, integer, element or group of steps or elements but not the exclusion of any other step, integer, element or group of steps or elements. The terms "include" and "comprise" are used synonymously. By "consisting of" is meant including, and limited to, whatever follows the phrase "consisting of".

[0228] The term “preferably” means one option out of a series of options not excluding other options, “e.g.,” means one example without restriction to the mentioned example. The singular forms "a", "an", and "the" include plural referents, i.e. , one or more than one, unless the content clearly dictates otherwise.

[0229] The term “about” or “approximately” when used in connection with a numerical value is meant to encompass numerical values within a range having a lower limit that is 0- 10% smaller than the indicated numerical value and having an upper limit that is 0- 10% larger than the indicated numerical value. The term “about” or “approximately” means preferably ±10%, more preferably ±5%, again more preferably ±3% or most preferably ±0% (referring to the given numeric value, respectively). In each of the invention embodiments, „about” can be deleted.

[0230] All ranges of values disclosed herein should refer to and include any and all values falling within said range including the values defining the range.

[0231] Reference throughout this specification to "one embodiment", "an embodiment", "a particular embodiment", "a related embodiment", "a certain embodiment", "an additional embodiment", “some embodiments”, “a specific embodiment” or "a further embodiment" or combinations thereof means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments. It is also understood that the positive recitation of a feature in one embodiment serves as a basis for excluding the feature in a particular embodiment.

[0232] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0233] The general methods and techniques described herein may be performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992), and Harlow and Lane Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1990).

[0234] While aspects of the invention are illustrated and described in detail in the figures and foregoing description, such illustration and description are to be considered illustrative or exemplary and not restrictive. It will be understood that changes and modifications may be made by those of ordinary skill within the scope and spirit of the following claims. In particular, the present invention covers further embodiments with any combination of features from different embodiments described above and below.

[0235] Brief description of Figures

[0236] Figure 1: Construction and preliminary phenotypic assessment of SARS-CoV-2 constructs with modified replication kinetics. A and B: Schematic overviews of the SARS-CoV-2 genome and recoded regions and corresponding plaque phenotypes. Regions indicated in green and red are enriched in fast- or slow-translating codons, respectively. B: Quantification of plaque sizes. C: Virus replication kinetics in Vero E6 / TMPRSS-II cells. Figure 2: Survival (Figure 2A) and bodyweight (Figure 2B), RNA, 5 dpi and 13 dpi (Figure 2C), and TCID50, 5 dpi and 13 dpi (Figure 2D) of mice infected with 5000 PFU. No clinical scores (#232 and #273, 100% survival), except WT infected (#3 and #48 at 5 dpi. 13 dpi euthanasia of all groups.

[0237] Figure 3: A / P-site-codon assignment

[0238] Figure 4: A-site-codon-frequency calculations

[0239] Figure 5: Using ribosome profiling data and for virus attenuation, based on HEK293T cells. Codon occupancy is used as a measure of translation speed and used to recode SARS-CoV-2. In the right column (“usage”), numbers according to codon frequency in the transcriptome are indicated. These are the numbers of the optimal and non-optimal codons that are used for deoptimization. Red is always the slowest codon, dark green the fastest, light green is close to optimal, yellow is somewhere in between. In the left column (“RP”), the values based on ribosome profiling are indicated. In some cases, the slowest or fastest codons are the same. But there are cases that are clearly different. Some of these are highlighted by red circles.

[0240] Figure 6: SARS CoV-2 ORF7a after redesigning via changing translation speed. A: original decoding speed. B: Slow to fastest transformed. For the slow to fastest design, every “slow” codon is converted to a “fastest” codon. In this case only yellow stayed the same. C: Fastest to slow transformed. For fastest to slow, every codon categorized as “fastest” (dark green) is converted to a codon categorized as “slow”. Codons categorized as “intermediate” (yellow) or “fast” (light green) were not altered.

[0241] Figure 7: Strong digest generates high-quality libraries from murine lungs. Frame 3 nt periodicity was determined in the entire Vero transcriptome. A: Mock control, uninfected. B: SMEN slow-to-fast.

[0242] Figure 8: Differential expression of viral genes in SMEN fast.

[0243] Figure 9: Nucleic acid fragments and coding sequences comprising codons altered in translation kinetic (decelerated “slow” and accelerated “fast” codons) derived from SARS-CoV-2.

[0244]

[0245] Figure 10: SARS-CoV-2 fast or slow Spike codons attenuate replication in human bronchial epithelial cells (hBEC) and induce less STAT1. Growth curve showing the release of the infectious fast spike (#233), or slow spike (#232) SARS-CoV-2 viruses (cf. Figure 9 regarding the ID NOs of the attenuated viruses). into the apical side of primary human bronchial epithelial cells (hBECs) grown at 37°C, infected at an MOI of 0.5 and 0.1 (Figure 10A) compared to the release of the Wuhan wild-type SARS- CoV-2. Virus titers determined by TCID50, n=4, (Figure 10B) Western blot for viral nucleocapsid (N), transcription factor STAT1 , and cellular housekeeping GAPDH from the hBECs at 72hpi. One representative image. (Figure 10C) Quantification of nucleocapsid and (Figure 10D) STAT1 expression from the Western blot membrane, n=4. The average WT expression for each protein was set as 100.

[0246] Figure 11 : SARS-CoV-2 fast or slow Spike codons decrease the Spike protein translation (Figure 11 A) Western blot of lysed Vero E6 TMPRSS2 cells infected with the SARS-CoV-2 wild-type, slow spike (232), and fast spike (233) viruses at an MOI of 0.01 showing the SARS-CoV-2 spike full protein (S), spike S1 subunit, nucleocapsid (N) and cell GAPDH. The full spike (S) and the spike S1 subunit are less expressed in the slow spike (232) and fast spike (233) in comparison to the WT virus. (Figure 11B) The relative quantification of the full Spike protein (S) to N, and (Figure 11C) the relative quantification of the S1 to N, show a lower S / N and S1 / N ratio for slow spike (232) and fast spike (233) viruses, n=2. (Figure 11D) Vero E6 TMPRSS2 cells were infected with the SARS-CoV-2 wild-type, slow spike (232), and fast spike (233) viruses at an MOI of 0.01 for 24h. Infectious viruses from the supernatant harvested 24hpi were quantified by TCID50, and virions were quantified by qPCR targeting the E gene, n=6.

[0247] Figure 12: SARS-CoV-2 fast or slow in ORFIab changes the ratio of ORF1a / ORF1 b proteins and virus infectivity (Figure 12A) Mass spectrometry data were obtained from Vero E6 TMPRSS2 cells infected with he indicated viruses at an MOI of 0.01 for 24h. n=3 (Figure 12B) The ORF1b / ORF1b ratio were based on the protein amounts from the mass spectrometry data. (Figure 12C) Western blot of lysed Vero E6 TMPRSS2 cells infected with the SARS-CoV-2 wild-type, 235 (fast Fg5-6A_slow Fg6B_Fg7), 236 (fast Fg5-6A), and 237 (slow Fg6B_Fg7) viruses at an MOI of 0.01 24hpi showing the SARS-CoV-2 NSP12, NSP5, nucleocapsid (N) and cell B-actin. (Figure 12D) Vero E6 TMPRSS2 cells were infected with the SARS-CoV-2 wild-type, 235 (fast Fg5-6A_slow Fg6B_Fg7), 236 (fast Fg5-6A), and 237 (slow Fg6B_Fg7) viruses at an MOI of 0.01 for 24h. Infectious viruses from the supernatant harvested 24hpi were quantified by TCID50, and virions were quantified by qPCR targeting the E gene.

[0248] Figure 13: SARS-CoV-2 fast or slow in ORFIab might change the ribosome shifting efficiency.

[0249] Figure 14: Schematic overviews of the MERS-CoV-2 genome and recoded spike region (slow spike 6B 7A).

[0250] Figure 15: Mice were inoculated intranasally with 5000 plaque-forming units (PFU) of the following viruses: Wuhan wild type (WT), WT with polybasic cleavage site deletion (WT deltaCS), Slow Spike (ID NO. 232) and Slow Spike with CS deletion (Slow Spike deltaCS, ID NO. 273). Samples were collected on 5 and 13 dpi (Figure 15A). Body weight changes (Figure 15B), clinical scores (Figure 15C), infectious virus titers (Figure 15D) and RNA load in the organs were determined (Figure 15E; upper line 5 dpi, lower line 13 dpi) and histopathology (pathological score) was analyzed (Figure 15F)

[0251] Figure 16: Mice were inoculated intranasally with 5000 plaque-forming units (PFU) of the following viruses: Wuhan wild type (WT), fast spike (Fast spike, ID NO. 233), fast open reading frame (ORF) 1a (Fast ORF1a, ID NO. 236) and Slow ORF1 b (ID NO. 237). Samples were collected on 5 and 14 dpi (Figure 16A). Body weight changes (Figure 16B), clinical scores (Figure 16C), infectious virus titers (Figure 16D) and RNA load in the organs were determined (Figure 16E; upper line 5 dpi, lower line 14 dpi) and histopathology (pathological score) was analyzed (Figure 16F).

[0252] Examples

[0253] Aspects of the present invention are additionally described by way of the following illustrative non-limiting examples that provide a better understanding of embodiments of the present invention and of its many advantages. The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques used in the present invention to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should appreciate, in light of the present disclosure that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

[0254] Example 1 - Protection via of fast / slow SARS-CoV-2 viruses

[0255] Ribosomal profiling data were used to categorize codons as fast or slow, and the SARS-CoV-2 and MERS-CoV genome were re-coded to contain regions with increased fast or slow-translating codons. Using this approach, the inventors generated viruses with modified structural genes, including spike, envelope, membrane, and nucleocapsid encoding genes, and non-structural genes of ORF1 a and / or ORF1 b, as illustrated in Figure 1A and 1 B. In the MERS-CoV genome, the structural spike gene was recoded to contain increased fast- or slow-translating codons (MERC-CoV spike fast or slow).

[0256] Plaque phenotype of fast / slow SARS-CoV-2 viruses

[0257] As the recoded genes affect translation speed in structural genes, availability during infection is changed, compromising the virus' ability to spread between cells. To assess the generated viruses' characteristics, the inventors conducted plaque-phenotype assays to evaluate their spread in Vero E6 / TMPRSS2 cells.

[0258] After rescuing the fast / slow viruses, based on the ribosome profiling data, the inventors infected VeroE6 / TMPRSS2 cells, previously seeded in 6-well plates and maintained at 37°C, with serially diluted viruses in the cell-culture medium at 1 :10 dilution. Cells were washed after 1 hour and covered with a media overlay composed of 2% methylcellulose, 1 x DMEM, 10% fetal bovine serum, 100 units ml-1 of penicillin, and 100 pg ml-1 of streptomycin. The overlay was removed after 48 hours, the cells were fixed with formalin 4% for 15 min, and stained with crystal violet for 30 min. The plaques were photographed, and the plaque sizes were measured using the software QuPath vO.4.3. The areas of the virus plaques were compared to the average area of the SARS-CoV-2 Wuhan WT virus. The statistical analysis was performed using Prism 9 v9.5.1 . (733) using the Ordinary One-Way ANOVA.

[0259] Except for the virus containing increased fast-translating codons in spike RNA (#233), all other viruses exhibited smaller plaque sizes than the Wuhan SARS-CoV-2 wild type (Figure 1 C). The inventors also recoded SARS-CoV-2 non-structural genes to carry increased fast or slow-translating codons, as these genes encode nonstructural proteins responsible for viral transcription, replication, proteolytic processing, suppression of host immune responses, and suppression of host gene expression. Plaque assays revealed smaller plaque sizes in all viruses modified in the ORFI ab (Figure 1 C).

[0260] Replication is attenuated and protein expression is modified in attenuated viruses

[0261] SARS-CoV-2 with spike codons modified to fast or slow also attenuate replication in human bronchial epithelial cells (hBEC) and induce decreased expression of STAT1 , nucleocapsid, and cellular housekeeping GAPDH in hBECs as compared to WT (Figure 10B-D).

[0262] Since the modifications affect the rate of translation of the modified genes, protein quantification showed decreased protein expression, e.g., of full spike (S) and spike S1 subunit as compared to WT (Figure 11A-C). Similar results are also expected in MERS-CoV containing fast / slow attenuation mutations in the spike gene.

[0263] Virus infectivity is reduced by the modification (Figure 11 D and 12). Especially, changes from slow to fast and fast to slow in ORFIab resulted in reduction of infectivity. SARS-CoV-2 fast or slow in ORFI ab might change the ribosome shifting efficiency. Growth curve kinetics offast / slow SARS-CoV-2 viruses in cells

[0264] To assess replication kinetics, the inventors infected Vero E6 / TMPRSS2 cells with the modified viruses and determined virus titers by TCID50 from the supernatants. VeroE6 / TMPRSS2 cells were infected with the fast / slow viruses, based on the ribosome profiling data, at an MOI of 0.01 in 6-well plates at 37°C. Cells supernatants were collected at the specified time points and TCID50 assays were performed in order to determine the virus titers. The graph shows the results of biological triplicates.

[0265] Growth curves demonstrated a reduction in virus replication kinetics up to 15 times compared to SARS-CoV-2 Wuhan wild type 48 hours post-infection, and 20 times less 72 hours post-infection in VeroE6 / TMPRSS2 cells (Figure 1 D). These results have been confirmed in human HBECs (Figure 10A).

[0266] Example 2A - Attenuation of SARS-CoV-2 Slow Spike and SARS-CoV-2 Slow Spike delta CS in K18-hACE2 mice compared to WT infections

[0267] To evaluate the viruses' in vivo performance, the inventors used the SARS-CoV-2 encoding a spike gene with increased slow-translating codons and conducted intranasal inoculation in hACE2-transgenic mice.

[0268] K18-ACE2 mice were bred at the specific pathogen-free facility of the Institute of Virology and Immunology and 7-12 weeks old female and male (n=3-7 mice / group) were intranasally inoculated with 5’000 PFU of either Slow Spike (ID NO.232), Slow Spike delta CS (ID NO. 273), SARS CoV 2-WT (ID NO. 3) and SARS CoV-2 WT delta CS (ID NO. 48) (20 pl per nostril). All mice were monitored for body weight loss and clinical symptoms over the 14-day course of infection. On 5 dpi, mice (n=3-4 mice from each group) were euthanized and organ samples were collected (data not shown).

[0269] Intriguingly, infected mice experienced significant attenuation compared to animals infected with the SARS-CoV-2 Wuhan wild type (WT), displaying minimal clinical manifestation and less weight loss (Figure 2A and 2B).

[0270] No clinical scores were observed except in the WT infected group. WT animals were euthanized 5 days post infection (dpi). Animals treated with Slow Spike (ID NO. 232) or Slow Spike delta CS (ID NO. 273) were euthanized 13 dpi and demonstrated survival during this period. Example 2B - Attenuation of SARS-CoV-2 Slow Spike, Fast Spike, Fast ORF1a and Slow ORF1b

[0271] Mouse studies

[0272] Well-characterized SARS-CoV-2 model hACE2-K18Tg mice (Tg(K18- hACE2)2Prlmn) were bred at the specific-pathogen-free facility of the Institute of Virology and Immunology and housed as previously described36. For infection, 7-16- week-old female and male mice were anaesthetized with isoflurane and inoculated intranasally with 20 pl per nostril (5,000 p.f.u.s per mouse). The mice were observed for clinical symptoms, weighed and swabbed at specific timepoints. The clinical symptoms were scored, and the animals were euthanized before they reached the humane endpoint. On euthanasia day, oropharyngeal swabs, serum and organs samples were collected as mentioned in our previous studies35.

[0273] Processing of animal specimens, viral RNA and infectious particle quantification

[0274] Organ samples of ~0.1 cm3 size from hamsters were homogenized in a 1 ml mixture composed of equal volumes of Hank’s balanced salts MEM and Earle’s balanced salts MEM containing 2 mM l-glutamine, 850 mg 1-1 NaHCO3, 120 mg 1-1 sodium pyruvate and 1 % penicillin-streptomycin at 300 Hz for 2 min using a Tissuelyser II (Qiagen) and were then centrifuged to clarify the supernatant.

[0275] Nucleic acid was extracted from 100 pl of the hamster nasal washes after a short centrifugation step or from 100 pl of organ sample supernatant using the NucleoMag Vet kit (Macherey Nagel). Nasal washings, oropharyngeal swabs and organ samples from hamsters were tested using virus-specific RT-qPCR. The RT-qPCR reaction was prepared using the qScript XLT One-Step RT-qPCR ToughMix (QuantaBio) in a volume of 12.5 pl including 1 pl of the respective FAM mix and 2.5 pl of extracted RNA. The reaction was performed for 10 min at 50 °C for reverse transcription, 1 min at 95 °C for activation and 42 cycles of 10 s at 95 °C for denaturation, 10 s at 60 °C for annealing and 20 s at 68 °C for elongation. Fluorescence was measured during the annealing phase. RT-qPCRs were performed on a Bio-Rad real-time CFX96 detection system (Bio-Rad).

[0276] Organ samples from mice were either homogenized in 0.5 ml of RA1 lysis buffer supplemented with 1 % [3-mercaptoethanol and later used for RNA isolation, or in gentleMACS M-tubes containing 1 ml DMEM (Miltenyi Biotec) for the detection of infectious particles as previously described36. RNA was isolated using the NucleoMag Vet kit (Macherey Nagel). The RT-qPCR reaction was prepared using TaqPath 1-Step Multiplex Master Mix kit (Thermo Fisher) with primers and probes targeting the SARS- CoV-2 E gene, and was performed for 10 min at 45 °C for reverse transcription, 10 min at 95 °C for activation and 45 cycles of 15 s at 95 °C for denaturation, 30 s at 58 °C for annealing and 30 s at 72 °C for elongation. Fluorescence was measured during the annealing phase. RT-qPCRs were performed on a Bio-Rad real-time CFX96 detection system (Bio-Rad). The primers are listed in Supplementary Table 2. Infectious virus titers were determined by TCID50 measurement on Vero E6 cells and were calculated according to the Spearman-Kaerber formula.

[0277] Histopathological and immunohistochemical analysis in mice

[0278] The left lung and the left hemisphere of the brain from mice were collected into 4% formalin. After fixation, both tissues were embedded in paraffin, cut at 4 pm and stained with haematoxylin and eosin (H&E) for histological evaluation. Scoring of the lung tissue pathology was done according to a previously published scoring scheme36. Immunohistochemical (IHC) analysis of the lung and the brain was performed by using a rabbit polyclonal anti-SARS-CoV nucleocapsid antibody (Rockland, 200-401 -A50) in a BOND RXm immunostainer (Leica Biosystems). For this purpose, paraffin blocks were cut at 3 pm, incubated with citrate buffer for 30 min at 100 °C for antigen retrieval and incubated with a 1 :3,000 dilution of the first antibody for 30 min at room temperature. Bond Polymer Refine Detection Visualization kit (Leica Biosystems) was afterwards used for signal detection using 3,3'-diaminobenzidine as chromogen and counterstaining with haematoxylin.

[0279] Results

[0280] Moreover, mice (four per group) were inoculated intranasally with 5000 plaque-forming units (PFU) of the following viruses: Wuhan wild type (WT), WT with polybasic cleavage site deletion (WT deltaCS), Slow Spike (ID NO. 232, SEQ ID NO: 7) and Slow Spike with CS deletion (Slow Spike deltaCS, ID NO. 273, SEQ ID NO: 2). Mice were weighed and observed for clinical scoring on the indicated days after infection (days post infection, dpi). Samples from the nose, lung, brain and olfactory bulbs were collected on the 5- and 13-days post-infection (Figure 15A). Body weight changes (Figure 15B) and clinical scores (Figure 15C) indicated that all viruses were notably attenuated in comparison to the WT virus causing no weight loss or clinical scores. Infectious virus titers are determined in Vero E6 / TMPRSS2 cells by TCID50 assay (Figure 15D). RNA load in the organs were determined with RT-qPCR (Figure 15E). At 5 dpi, RNA from all 4 viruses were detected at comparable levels in the nose and lung samples. However, only WT and WTdelCS were found in the olfactory bulbs and brains at very high copy numbers. One mouse infected with Slow spike delCS presented low levels of RNA in the olfactory bulb. At 13 dpi, no detectable infectious virus levels were found but the RNA of Slow Spike and Slow Spike delCS could be detected in the nose samples. Histopathological analysis of the lungs showed very high scores for WT and intermediate scores for the other viruses indicating inflammation and immune cell infiltration into the tissues at 5 dpi, and the scores were much lower at 13 dpi suggesting a recovery to the healthy state (Figure 15F).

[0281] Further, mice (four per group) were inoculated intranasally with 5000 plaque-forming units (PFU) of the following viruses: Wuhan wild type (WT), fast spike (Fast spike, ID NO. 233), fast open reading frame (ORF) 1a (Fast ORF1 a, ID NO. 236) and Slow ORF1 b (ID NO. 237). Mice were weighed and observed for clinical scoring on the indicated days after infection (days post infection, dpi). Samples from the nose, lung, brain, and olfactory bulbs were collected on the 5- and 14-days post-infection (Figure 16A). Body weight changes (Figure 16B) and clinical scores (Figure 16C) indicated that SlowORFI b was notably attenuated causing no weight loss or clinical score. Fast spike and Fast ORF1 a viruses induced only slight weight loss and clinical scores. Infectious virus titers are determined in Vero E6 / TMPRSS2 cells by TCID50 assay (Figure 16D). RNA load in the organs were determined with RT-qPCR (Figure 16E). Slow ORF1 b viral RNA was detected at 5 dpi in infected mice in the oropharyngeal swabs and nose, no infectious Slow ORF1 b virus was detected in the tissues tested, and the pathological score in the lungs were minimal. RNA of fast spike and fast ORF1 a were detected in the oropharyngeal swabs, lung and nose tissues at 5 dpi. In the lungs, Fast Spike and Fast ORF1 a viruses were detected at 5 dpi at levels comparable to the WT. In the brain, only WT infectious titers were present. On day 14, no infectious viruses were detected in any of the indicated organs. Histopathological analysis of the lungs confirmed that Fast Spike virus induced pathology comparable to WT on 5 dpi, but the pathological score went down over time reaching the levels of the other attenuated viruses on day 14 (Figure 16F). Only one mouse at 14 dpi showed fast ORF1 a RNA in the olfactory bulb and brain but there were no detectable levels of infectious virus. In addition, according to the pathological analysis, fast ORF1 a showed less inflammation markers compared to the other viruses. This could indicate that fast 0RF1a can replicate in the nose and the lungs but does not cause pathology as bad as the other viruses in the comparison.

[0282] Example 3 - High-resolution ribosome profiling and use of codon occupancy as a measure of translation speed

[0283] The inventors used a high-resolution ribosome profiling protocol to determine apparent codon-translation rates in HEK293T cells. The dataset is publicly available in the Gene Expression Omnibus Database (https: / / www.ncbi.nlm.nih.gov / geo / ). Accession code is: GSE136940. Samples in this dataset are called HEK293T_minus_plus_1 , H EK293T_m inus_plus_2, H EK293T_m inus_plus_3.

[0284] To this end randomized linker and RT primers were used that were introduced into ribosome profiling (Lecanda et al., 2016, DOI: 10.1016 / j.ymeth.2016.07.011 ). Cycloheximide (CHX) was used in the lysis buffer but pre-incubation with CHX in the cell medium prior to cell lysis was not performed (Sharma et al., 2021 , DOI: 10.1038 / s41467-021 -25411 -y). The inventors used a strong RNasel digest to obtain high codon-frame periodicity (Sharma et al., 2021 ). The protocol is summarized in (Kim et al., 2021 , DOI: 10.1016 / bs.mie.2O21 .06.025).

[0285] HEK293T cells were grown to 80% confluency (each dish was treated separately during the lysis steps). 2 h before harvesting, cells fed with fresh medium. Cells were placed on ice and the medium was quickly aspirated. Cells were quickly washed with Dubecco's phosphate buffered saline (PBS). PBS was aspirated and dish was floated on liquid N2 for 10 s. The dish was removed from liquid N2 and placed on ice. 400 pl of lysis buffer (10 mM Tris-HCI, pH 7.5; 100 mM NaCI; 5 mM MgCI2; 1 % Triton X-100; deoxycholate 0.5 %; 1 mM DTT; 100 pg / ml cycloheximide) was added to the dish drop by drop.

[0286] As soon as the lysis buffer thawed, cells were scraped and resuspended in the lysis buffer. Lysate was transferred to a microcentrifuge tube and centrifuged for 5"min at 10'000 g at 4°C. The material from the 10 dishes was pooled into a 15 ml tube. A260 was determined using a nanodrop instrument. 8 U (A260) of cell lysate was digested with 900 U in a shaking thermoblock for 1 h at 22°C and 1400 rpm. The reaction tube was transferred to ice and 18 pl SuperaselN (20 ll / pl) was added and deoxycholate to a final concentration of 0.5 %. A 10-50 % sucrose gradient was prepared in H2O containing 1 mM DTT and 100 pg / ml CHX) in a 12 ml ultracentrifuge tube. Sucrose gradients were overlayed with the digested sample and run for 3 h at 35'000 rpm at 4°C. The gradient was run through a fractionator and fractions corresponding to the monosome peak were collected. 1 / 1 Oth of the volume of 10 % SDS was added to the fractions and fractions snap frozen on liquid N2. Samples were thawed at 65 °C and RNA extracted with 800 pl acidic phenol and 100 pl 1 -Brom-3-chloropropane (BCP). Samples were washed with 800 pL BCP. Samples were precipitated with glycogen, NaOAc, and ethanol. Samples were resuspended in 20 pL Milli-Q water. RNA was separated on a 15 % polyacrylamide (PAA) 8M urea gel and visualized by SYBR Gold. Ribosomal footprints were excised between 28 and 32 nt and eluted from the gel slice into gel elution buffer (0.3 M NaOAc, pH 5.5; 1 mM EDTA, pH 8.0; 0.1 U / pL SuperaselN) overnight on the wheel at 4 °C. RNA was precipitated and resuspended in H2O. Footprints were dephosphorylated with T4 nucleic acid kinase, phenol extracted and re-precipitated. Dephosphorylated RNA was resuspended in H2O and ligated to randomized cloning linker (5'(rApp)NNNNNNCTGTAGGCACCATCAAT (3ddC) 3' using truncated T4 RNA Ligase 2 KQ. The reaction was precipitated and separated on a 15% PAA / 8 M urea gel. Ligated fragments were gel eluted and extended by Superscript III using randomized RT primer: 5' (5Phos) NNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC( SpC18)CACTCA(SpC1 8)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTA CAG 3'. The RT reaction was separated on a 10 % PAA / 8 M urea gels, the correct fragment excised from the gel and precipitated. The sample was resuspended in H2O and circularized using CircLigase II. Final libraries were generated by PCR using Phusion HF, forward library PCR primer (5': AAT GAT ACG GCG ACC ACC GAG ATC TAC AC 3') and a compatible NEB index primer.

[0287] Library fragments were excised from an 8 % PAA gel, eluted and precipitated overnight. Libraries were sequenced on an Illumina sequencer in a single-end flow cell.

[0288] Computational analysis

[0289] Ribosome profiling reads were processed by clipping the adapter sequence and trimming the randomized nucleotides of the linker sequences. rRNA and tRNA reads were removed from the library. Residual reads were uniquely mapped to non-dubious human ORFs. Reference ORFs (hg38 UCSC canonical transcripts) were extended by 18nt into the 5' UTR for mapping in the beginning of ORFs. A / P-site mapping was performed according to Ingolia et al. (Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science 324, 218-223, 2009) (Figure 3). Frame periodicity plots were generated and footprint lengths and reading frames that provided meaningful information were selected (Sharma et al., 2021 , DOI: 10.1038 / s41467-021 -25411-y). Relative codon occupancy is used as a parameter for decoding speed of a specific codon (Figure 4) (Nedialkova and Leidel 2015, 10.1016 / j.cell.2O15.05.022; Stadler and Fire, 2011 , 10.1261 / rna.02890211 ). Specifically, the A-site frequency of each codon is calculated by dividing its occurrence in the ribosomal A-site by the expected frequency in the library. For this the +5, +6, +7 or the +8, +9, +10 codons were used since they are not part of the library and therefore do not suffer from library preparation biases. The values for relative A-site-codon frequency are calculated for each codon (Figure 5).

[0290] Within each group of codons that code for the same amino acid, the codon with the highest value is considered the slowest (red), and the codon with the lowest value is considered the fastest (dark green). Codons with values that are relatively similar to the fastest codon are also considered fast (light green). Codons that were between these values are considered intermediate (yellow). For the re-coding of viral sequences, codons that encode for a particular amino acid were replaced by a different codon that encodes for the same amino acid (Figure 5 and 6A-C). For slow-to-fast recoding, codons classified as slowest type of codon within one group of synonymous codons were converted to the codon classified as fastest codon within the same group. Intermediate and fast codons were not altered (Figure 6B). For fast-to-slow re-coding, codons classified as fastest type of codon within one group of synonymous codons were converted to the codon classified as slowest codon within the same group. Intermediate and fast codons were not altered (Figure 6C). Recoded sequences were synthesized as gene blocks according to Thi Nhu Thao et al., 2020 (doi: 10.1038 / S41586-020-2294-9).

[0291] Table 1 :

Claims

Claims1 . A nucleic acid comprising at least one coding sequence of a virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon, wherein said synonymous codon has an altered kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or as compared to a reference nucleotide sequence of a virus.

2. The nucleic acid of claim 1 , wherein the kinetic of nucleic acid translation is determined by ribosomal profiling, preferably the kinetic of nucleic acid translation is determined by determining relative A-site codon occupancy, preferably the relative A- site codon occupancy is calculated by the formulawherein Ac is the relative A-site occupancy of a codon; rc,A are counts of reads of the codon in the ribosome A-site; Me is a mean read count of the codon at three downstream positions of the ribosome A-site.

3. The nucleic acid of any one of the preceding claims, wherein the relative A-site codon occupancy values are as indicated in Table 1 (“Occupancy”) or Figure 5 (“RP”).

4. The nucleic acid of any one of the preceding claims, wherein the nucleic acid comprises(i) the at least one coding sequence of the virus, wherein at least one codon in said coding sequence is substituted by a synonymous codon which has a faster or slower kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus; and / or(ii) at least one additional coding sequence of the virus, wherein at least one codon in said additional coding sequence is substituted by a synonymous codon which has a faster or slower kinetic of nucleic acid translation as compared to a corresponding codon in a reference virus genome or a reference nucleotide sequence of a virus,wherein preferably the coding sequences of (i) and (ii) are adjacent or overlapping, preferably adjacent.

5. The nucleic acid of any one of the preceding claims, wherein at least 5% of the codons in the coding sequence(s) of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic, preferably between 12% and 35% of the codons in the coding sequence(s) of the virus are substituted by a synonymous codon having an altered nucleic acid translation kinetic.

6. The nucleic acid of any one of the preceding claims, wherein the virus is a coronavirus, and the reference virus genome or reference nucleotide sequence is of a naturally occurring coronavirus; preferably the virus is SARS-CoV-2 and the reference virus genome or reference nucleotide sequence is of SARS-CoV-2 wildtype genome or the virus is MERS-CoV and the reference virus genome or reference nucleotide sequence is of MERS-CoV wildtype genome; more preferably the virus is SARS-CoV- 2 or MERS-CoV, and the reference virus genome is a sequence of SEQ ID NO: 3 or 4 for a coding sequence of SARS-CoV-2 and the reference virus genome is a human beta-coronavirus 2c EMC / 2012 genome (accession no. JX869059 of NIH genbank) or SEQ ID NO: 40 for a coding sequence of MERS-CoV.

7. The nucleic acid of claim 6, wherein said at least one substituted codon is located in a coding sequence encoding a structural protein selected from the group consisting of spike, envelope, membrane protein, and nucleocapsid protein, and / or a non-structural protein of ORF1 a and / or ORF1 b, preferably more than one codon is substituted, and the substituted codons comprise codons located in ORF1 a, ORF1 b or ORF1 a and ORF1 b, more preferably the more than one substituted codons comprise codons located in ORF1 a and ORF1 b.

8. The nucleic acid of any one of the preceding claims, wherein the at least one coding sequence has a length of at least 2.000 nucleotides, preferably 2.000-20.000 nucleotides, more preferably 3.000-10.000 nucleotides.

9. The nucleic acid of any one of the preceding claims, wherein the nucleic acid comprises a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-39,and 41 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 5-39 and 41 .

10. The nucleic acid of any one of the preceding claims, wherein the nucleic acid consists of or comprises a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-11 , 38 and 41 , or a sequence having 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , 2 and 5-11 , 38 and 41 .

11. A vector comprising the nucleic acid of any one of the preceding claims.

12. An attenuated virus comprising the nucleic acid of any one of claims 1 to 10 or the vector of claim 11 .

13. A pharmaceutical product comprising the nucleic acid of any one of claims 1 to 10, the vector of claim 11 and / or the attenuated virus of claim 12 for use as a medicament.

14. The pharmaceutical product for use according to claim 13, wherein the medicament is for use in prevention and / or treatment of a virus infection or a symptom thereof, wherein preferably the virus infection is an RNA virus infection, more preferably a coronavirus infection, again more preferably a SARS-CoV-2 or MERS- CoV infection.

15. A method for preparing an attenuated virus, the method comprises the steps of: a) selecting a reference genome of a virus, and selecting at least one coding sequence in the reference genome of the virus; b) computing the translational kinetic of at least two codons, preferably of all codons in the coding sequence, c) optionally categorizing the at least two codons, preferably all codons, in the coding sequence in at least two categories, wherein the categories are indicative of kinetic of nucleic acid translation of codons; d) substituting at least one codon in said coding sequence by a synonymous codon with a faster or slower kinetic of nucleic acid translation, preferably byreplacing a codon categorized in step c) with a synonymous codon of a different category; e) optionally expressing the modified coding sequence, preferably in a host cell; wherein preferably the translational kinetic is determined by ribosomal profiling, more preferably the translational kinetic is determined by determining relative ribosomal A-site codon occupancy; preferably the relative A-site codon occupancy is calculated by the following formula:wherein Ac is the relative A-site occupancy of a codon; rc,A are counts of reads of the codon in the ribosome A-site; Me is a mean read count of the codon at three downstream positions of the ribosome A-site; more preferably the relative A-site codon occupancy values are as indicated in Table 1 (“Occupancy”) or Figure 5 (“RP”).