Double-stranded rnai agents and compositions for reducing expression of angiopoietin-like 3 (angptl3) and methods of use thereof

Abstract

There are disclosed certain double-stranded RNA (dsRNA) or siRNA agents for inhibition of angiopoietin-like 3 gene expression, compositions that include angiopoietin-like 3 agents and methods of use thereof. The double-stranded RNA (dsRNA) or siRNA agents are particularly useful in the treatment or prophylaxis of cardiovascular disease and metabolic conditions as well as in the treatment of heart failure and chronic kidney disease.

Description

[0001] 201286 1 DOUBLE-STRANDED RNAI AGENTS AND COMPOSITIONS FOR REDUCING EXPRESSION OF ANGIOPOIETIN-LIKE 3 (ANGPTL3) AND METHODS OF USE THEREOF 5 TECHNICAL FIELD The technical field relates to certain double-stranded RNA (dsRNA) or siRNA agents for inhibition of angiopoietin-like 3 gene expression, compositions that include angiopoietin- like 3 agents and methods of use thereof.10SEQUENCE LISTING The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 201286-PCT01-NP_SL.xml (Homo Sapiens angiopoietin-like 3 (ANGPTL3) transcript GenBank NM_014495.4 (SEQ ID NO: 1)), created on January 31, 2025, which is 193,866 bytes in size. The information in the electronic format 15 of the sequence listing is incorporated herein by reference in its entirety. Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, 20 an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of an uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any25combination of natural or modified RNA and / or DNA, unless otherwise stated, including, but not limited to such nucleic acids having modified nucleobases. BACKGROUND Angiopoietin-like 3 (also called ANGPTL3, ANGPL3, ANG3, or angiopoietin-like protein 3)30is an angiopoietin protein encoded by the human angiopoietin-like 3 gene that is reported to be involved in regulating lipid metabolism. ANGPTL3 is a 460-amino acid polypeptide that 201286 2 consists of a signal peptide, N-terminal coiled-coil domain, and a C-terminal fibrinogen (FBN)-like domain. ANGPTL3 is known to be primarily produced in hepatocytes in humans, and after synthesis is secreted into circulation. ANGPTL3 acts as an inhibitor of lipoprotein lipase, which catalyzes hydrolysis of triglycerides, and endothelial lipase, which hydrolyzes 5 lipoprotein phospholipids. Inhibition of these enzymes can cause increases in plasma levels of triglycerides, high-density lipoproteins (HDL), and phospholipids. Further, loss-of-function mutations in ANGPTL3 lead to familial hypobetalipoproteinemia, which is characterized by low levels of triglycerides and low-density lipoprotein (LDL-C) in plasma. In humans, loss of-function in ANGPTL3 is also correlated with a decreased risk of atherosclerotic10cardiovascular disease. An effective therapeutic that targets ANGPTL3 has been reported to potentially provide a beneficial impact in the treatment (including prophylactic treatment) of cardiometabolic diseases such as hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis type I diabetes mellitus. cardiovascular disease, 15 coronary artery disease, non alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin resistant hypercholesterolemia and other metabolic related disorders and diseases. Certain double-stranded RNA (dsRNA) or siRNA agents have been identified as being capable of inhibiting the expression of an ANGPTL3 gene (see e.g. WO 2012 / 17784, WO 20 2016 / 168286, WO 2016 / 154127, WO 2019 / 055633 and WO 2021 / 188795), the specific ANGPTL3 siRNA agent disclosed herein were not previously disclosed or known, and enable highly efficient ANGPTL3-specific inhibition of expression of an ANGPTL3 gene. That an effective therapeutic targeting ANPTL3 could provide a beneficial impact in the treatment (including prophylactic treatment) of heart failure, including HFpEF and25HFrEF, or chronic kidney disease (CKD) has never been depicted. SUMMARY There exists a need for novel ANGPTL3-specific RNA interference (RNAi) agents, e.g. double-stranded RNA (dsRNA) or siRNA agents, that are able to inhibit the expression of an30ANGPTL3 gene in vitro and / or in vivo using the ANGPTL3 siRNA agents and compositions that include ANGPTL3 siRNA agents described herein. The ANGPTL3 siRNA agents described herein can selectively and efficiently decrease or inhibit expression of an 201286 3 ANGPTL3 gene, and thereby reducing triglyceride (TG) levels and / or cholesterol in a subject, e.g., a human or animal subject. The described ANGPTL3 siRNA agents can be used in methods for therapeutic treatment (including prophylactic and preventive treatment) of symptoms and diseases associated with 5 elevated TG levels and / or elevated cholesterol levels including but not limited to hypertriglyceridemia, obesity, hyperlipidemia. abnormal lipid and / or cholesterol metabolism, atherosclerosis type I diabetes mellitus. cardiovascular disease, coronary artery disease, non- alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin resistant hypercholesterolemia and other metabolic10related disorders and diseases. The ANGPTL3 siRNA agents disclosed herein can selectively reduce ANGPTL3 gene expression, which can lead to a reduction in, among other things, TG levels and or cholesterol levels, in a subject. The methods disclosed herein include the administration of one or more ANGPTL3 siRNA agents to a subject, e.g. a human or animal subject, using any suitable methods known in the art. such as subcutaneous injection or 15 intravenous administration. An object is to provide a method of treating symptoms and diseases associated with elevated TG levels and / or elevated cholesterol levels including but not limited to hypertriglyceridemia, obesity, hyperlipidemia. abnormal lipid and / or cholesterol metabolism,20 atherosclerosis type I diabetes mellitus. cardiovascular disease, coronary artery disease, non- alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin resistant hypercholesterolemia and other metabolic related disorders and diseases comprising administering to a subject a therapeutically effective amount of a double-stranded siRNA comprising an antisense strand comprising a nucleobase25sequence that is complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, thereby treating hypertriglyceridemia, obesity, hyperlipidemia. abnormal lipid and / or cholesterol metabolism, atherosclerosis type I diabetes mellitus. cardiovascular disease, coronary artery disease, non- alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous30familial hypercholesterolemia, statin resistant hypercholesterolemia and other metabolic related disorders and diseases. 201286 4 An object is to provide a method of treating heart failure comprising administering to a subject a therapeutically effective amount of a double-stranded siRNA comprising an antisense strand comprising a nucleobase sequence that is complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a 5 sense strand, thereby treating heart failure. A further object is to provide a method of treating chronic kidney disease comprising administering to a subject a therapeutically effective amount of a double-stranded siRNA comprising an antisense strand comprising a nucleobase sequence that is complementary to an10equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, thereby treating chronic kidney disease. In one embodiment, the ANGPTL3 siRNA agent is Conjugate 1, a double-stranded RNA (dsRNA) or siRNA capable of inhibiting expression of the human ANGPTL3 gene 15 comprising (i) a first (sense) strand having the sequence: NAG-invAb (ps) mG mC mU mC mA mA mC mA fU fA fU mU mU mG mA mU mC mA mG mU mA (ps) invAb (SEQ ID NO: 10), 20 and (ii) a second (antisense) strand having the sequence: mU (ps) fA (ps) mC (ps) fU mG fA mU fC mA fA mA fU mA fU mG fU mU fG mA fG (ps) mC (SEQ ID NO: 3),25where NAG is a triantennary ligand moiety linked to the 5’ end of the first strand and having the structure:

[0002] 201286 5 In one embodiment, the ANGPTL3 siRNA agent is Conjugate 2, a double-stranded RNA (dsRNA) or siRNA capable of inhibiting expression of the human ANGPTL3 gene 5 comprising (i) a first (sense) strand having the sequence: [M]-mC mU mA mC mA mU fA fU fA mA mA mC mU mA mC mA mA (ps) mG (ps) mU (SEQ ID NO: 11),10and (ii) a second (antisense) strand having the sequence: 201286 6 mA (ps) fC (ps) mU fU mG fU mA fG mU fU mU fA mU fA mU fG mU (ps) fA (ps) mG (SEQ ID NO: 5), where [M] is a triantennary ligand moiety linked to the 5’ end of the first strand and having 5 the structure: . Thus, the terminal phosphorothioate group of the ligand moiety [M] is bonded directly (via the “free” bond indicated “*”) to the 5’ position of the 5’ terminal nucleotide of the first10strand (i.e., to the 5’-carbon of the 2’-O-methyl ribose moiety of the mC residue at the 5’ end of the first strand). Sequences are shown in the conventional 5’ to 3’ direction. In the context of the above formula, the following abbreviations are used: 201286 7 Abbreviation Meaning mA, mU, mC, mG 2’-O-methyl ribonucleotide (adenine, uracil, cytosine, guanine) fA, fU, fC, fG 2’-fluoro-ribonucleotide (adenine, uracil, cytosine, guanine) (ps) phosphorothioate linkage between adjacent nucleotides In a further embodiment there is also provided a chirally enriched population of double- stranded siRNA, wherein the population is enriched for double-stranded siRNA comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical 5 configuration, or polynucleotide conjugates comprising said double-stranded siRNA. The chirally enriched population may be enriched for double-stranded siRNA comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) or (Rp) configuration, or polynucleotide conjugates comprising said double-stranded siRNA. The chirally enriched population may be enriched for double-stranded siRNA having a particular,10independently selected stereochemical configuration at each phosphorothioate internucleoside linkage, or polynucleotide conjugates comprising said double-stranded siRNA. The chirally enriched population may be enriched for double-stranded siRNA having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages, or polynucleotide conjugates 15 comprising said double-stranded siRNA. The chirally enriched population may be enriched for double-stranded siRNA having at least 2 or at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction, or polynucleotide conjugates comprising said double-stranded siRNA. In a population of double-stranded siRNA comprising double-stranded or20polynucleotide conjugates of the invention, all of the phosphorothioate internucleoside linkages of the double-stranded siRNA may be stereorandom. In a further embodiment there is also provided a pharmaceutical composition comprising a double-stranded siRNA, polynucleotide conjugate, and a pharmaceutically acceptable diluent or carrier.25The pharmaceutically acceptable diluent may be water or phosphate-buffered saline. The pharmaceutical composition may consist essentially of said double-stranded siRNA, said polynucleotide conjugate and water or phosphate-buffered saline. 201286 8 In a further embodiment there is also provided a method comprising administering to a subject said double-stranded siRNA, said polynucleotide conjugate, or said pharmaceutical composition. In one embodiment, there is provided a method of treating a disease associated with 5 ANGPTL3 comprising administering to a subject having a disease associated with ANGPTL3 a therapeutically effective amount of Conjugate 2 or said pharmaceutical composition, thereby treating the disease associated with ANGPTL3. The disease associated with ANGPTL3 may be hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type 2 diabetes10mellitus, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non- alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin resistant hypercholesterolemia and other metabolic-related disorders and diseases. In a further embodiment, there is provided a method of treating heart failure 15 comprising administering to a subject a therapeutically effective amount of a double-stranded siRNA comprising an antisense strand comprising a nucleobase sequence that is at least 80% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, thereby treating heart failure. In still a further embodiment, there is provided a method of treating heart failure 20 comprising administering to a subject a therapeutically effective amount of a double-stranded siRNA comprising an antisense strand comprising a nucleobase sequence that is at least 85% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, thereby treating heart failure. In still a further embodiment, there is provided a method of treating heart failure25comprising administering to a subject a therapeutically effective amount of a double-stranded siRNA comprising an antisense strand comprising a nucleobase sequence that is at least 90% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, thereby treating heart failure. In still a further embodiment, there is provided a method of treating heart failure30comprising administering to a subject a therapeutically effective amount of a double-stranded siRNA comprising an antisense strand comprising a nucleobase sequence that is at least 95% 201286 9 complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, thereby treating heart failure. In still a further embodiment, there is provided a method of treating heart failure comprising administering to a subject a therapeutically effective amount of a double-stranded 5 siRNA comprising an antisense strand comprising a nucleobase sequence that is 100% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand.; thereby treating heart failure. In still a further embodiment, there is provided a method of treating heart failure comprising administering to a subject a therapeutically effective amount of Conjugate 2 or10said pharmaceutical composition. In still a further embodiment, there is provided a method of treating heart failure comprising administering to a subject a therapeutically effective amount of Conjugate 1 or said pharmaceutical composition. 15 In a further embodiment, there is provided a method of treating chronic kidney disease (CKD) comprising administering to a subject a therapeutically effective amount of a double- stranded siRNA comprising an antisense strand comprising a nucleobase sequence that is at least 80% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, thereby treating CKD. 20 In still a further embodiment, there is provided a method of treating chronic kidney disease (CKD) comprising administering to a subject a therapeutically effective amount of a double-stranded siRNA comprising an antisense strand comprising a nucleobase sequence that is at least 85% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, thereby treating CKD.25In still a further embodiment, there is provided a method of treating chronic kidney disease (CKD) comprising administering to a subject a therapeutically effective amount of a double-stranded siRNA comprising an antisense strand comprising a nucleobase sequence that is at least 90% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, thereby treating CKD.30In still a further embodiment, there is provided a method of treating chronic kidney disease (CKD) comprising administering to a subject a therapeutically effective amount of a double-stranded siRNA comprising an antisense strand comprising a nucleobase sequence 201286 10 that is at least 95% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, thereby treating CKD. In still a further embodiment, there is provided a method of treating chronic kidney disease (CKD) comprising administering to a subject a therapeutically effective amount of a 5 double-stranded siRNA comprising an antisense strand comprising a nucleobase sequence that is 100% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, thereby treating CKD. In still a further embodiment, there is provided a method of treating chronic kidney disease (CKD) comprising administering to a subject a therapeutically effective amount of10Conjugate 2 or said pharmaceutical composition. In still a further embodiment, there is provided a method of treating chronic kidney disease (CKD) comprising administering to a subject a therapeutically effective amount of Conjugate 1 or said pharmaceutical composition.15BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 Five-concentration testing of ANGPTL3-targeting siRNAs Conjugate 2 and Conjugate 1 in primary human hepatocytes. Figure 2 Five-concentration testing of ANGPTL3-targeting siRNAs Conjugate 2 and Conjugate 1 in primary cynomolgus monkey hepatocytes.20Figure 3 Baseline-corrected circulating human ANGPTL3 protein humanized mice treated with a single dose of conjugate 2. Figure 4 Human ANGPTL3 mRNA expression in liver on day 49 in humanized mice treated with a single dose of Conjugate 2. Figure 5 Human ANGPTL3 mRNA expression in liver on day 49 in humanized mice treated 25 with a single dose of Conjugate 3 and 4, respectively. Figure 6 Schematic study outline Example 5, Therapeutic effects of Conjugate 1 in an obese HFpEF ZSF1 rat model In Vivo. Figure 7 Body weight (gr) at the end of the 12 weeks treatment period, Example 5. Figure 8 ANGPTL3 protein and TG plasma levels after administration of Conjugate 1 in30ZSF-1 rats, Example 5. Figure 9a Heart content (lipidometic analysis) after administration of Conjugate 1 in ZSF-1 rats. 201286 11 Figure 9b Liver content (lipidometic analysis) after administration of Conjugate 1 in ZSF-1 rats. Figure 10 Diastolic function (IVRT and NT-proBNP) after Conjugate 1 administration in ZSF-1 rats. 5 Figure 11 Tissue proteomics after Conjugate 1 administration in ZSF-1 rats. Figure 12 Renal health represented by UACR, podocyte health and glomerulosclerosis after Conjugate 1 administration in ZSF-1 Rats. Figure 13 Baseline and Endpoint Proton-Density Fat Fraction (PDFF) results in HfpEF NHPs after treatment with ANGPTL3 inhibition.10Figure 14 Baseline and Endpoint Extracellular volume (ECV) results in HfpEF NHPs after treatment with ANGPTL3 inhibition. Figure 15 Left atria volume index (LAVi) results in HfpEF NHPs after treatment with ANGPTL3 inhibition. Figure 16 Plasma ANGPTL3 levels in HfpEF NHPs after treatment with ANGPTL3 15 inhibition. Figure 17 Plasma TG levels in HFpEF NHPs after treatment with ANGPTL3 inhibition. DETAILED DESCRIPTION This detailed description and its specific examples, while indicating embodiments, are 20 intended for purposes of illustration only. Therefore, there is no limitation to the illustrative embodiments described in this specification. In addition, it is to be appreciated that various features that are, for clarity reasons, described in the context of separate embodiments, also may be combined to form a single embodiment. Conversely, various features that are, for brevity reasons, described in the context of a single embodiment, also may be combined to25form sub-combinations thereof. Listed below are definitions of various terms used in the specification and claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the30use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components 12 comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of 5 documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety. Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and10medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent 15 modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described 20 herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts described herein to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to25the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims. Numeric ranges are inclusive of the numbers defining the range. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits30of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within this disclosure. The upper and lower limits of these smaller 13 ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within this disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included 5 limits are also included in this disclosure. “About” may generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20 percent (%), typically, within 10%, and more typically, within 5% of a given value or range of values. Preferably, the term “about” shall be understood herein as plus or minus (±) 5%,10preferably ± 4%, ± 3%, ± 2%, ± 1%, ± 0.5%, ± 0.1%, of the numerical value of the number with which it is being used. The term "consisting of'' refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the invention. 15 Embodiments described herein as “comprising” one or more features may also be considered as disclosure of the corresponding embodiments “consisting of” and / or “consisting essentially of” such features. Concentrations, amounts, volumes, percentages and other numerical values may be presented herein in a range format. It is also to be understood that such range format is used 20 merely for convenience and brevity and should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. The polynucleotides of the present invention may be prepared by any means known in25the art. For example, large amounts of the polynucleotides may be produced by replication in a suitable host cell. The polynucleotides of the present invention may preferably be produced by chemical synthesis, e.g., by the phosphoramidite method or the tri-ester method and may be performed on commercial automated oligonucleotide synthesizers. A double-stranded oligonucleotide may be obtained from the single stranded product of chemical synthesis either30by synthesizing the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence. 201286 14 Methods of determining nucleic acid percentage sequence identity are known in the art. By way of example, when assessing nucleic acid sequence identity, a sequence having a defined number of contiguous nucleotides may be aligned with a nucleic acid sequence (having the same number of contiguous nucleotides) from the corresponding portion of a 5 nucleic acid sequence of the present invention. Tools known in the art for determining nucleic acid percentage sequence identity include Nucleotide BLAST (as described below). The terms “decrease” "reduced", "reduction", or "inhibit" are all used herein to mean a decrease by a statistically significant amount. The terms "reduce," "reduction" or "decrease" or "inhibit" typically means a decrease by at least 10% as compared to a reference level (e.g.10the absence of a given treatment) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more. 15 As used herein, "reduction" or "inhibition" encompasses a complete inhibition or reduction as compared to a reference level. "Complete inhibition" is a 100% inhibition (i.e., abrogation) as compared to a reference level. The terms "increased", "increase", "enhance", or "activate" are all used herein to mean an increase by a statically significant amount. The terms "increased", "increase", "enhance", 20 or "activate" can mean an increase of at least 25%, at least 50% as compared to a reference level, for example an increase of at least about 50%, or at least about 75%, or at least about 80%, or at least about 90%, at least about 95%, or at least about 98%, or at least about 99%, or at least about 100%, or at least about 250% or more compared with a reference level, or at least about a 1.5-fold, or at least about a 2-fold, or at least about a 2.5-fold, or at least about a253-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 1.5-fold and 10-fold or greater as compared to a reference level. As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is30greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having 201286 15 multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides. 5 As used herein, “complementary” in reference to an oligonucleotide means that is at least 70% of the nucleobases of the oligonucleotide and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. “Complementary region” in reference to a region of an oligonucleotide10means that is at least 70% of the nucleobases of that region and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions, i.e. the nucleobase sequences are reverse complementary. For the avoidance of doubt, all references herein to an oligonucleotide (e.g. an antisense strand of a 15 double-stranded oligonucleotide of the invention) as complementary to a target sequence means that the nucleobase sequence of said oligonucleotide (e.g. the antisense strand of a double-stranded oligonucleotide of the invention) is reverse complementary to said target sequence. Complementary nucleobases mean nucleobases that are capable of forming hydrogen 20 bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G). Certain modified nucleobases that pair with natural nucleobases or with other modified nucleobases are known in the art and are not considered complementary nucleobases as defined herein unless indicated otherwise. For example, inosine can pair, but is not25considered complementary, with adenosine, cytosine, or uracil. Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to oligonucleotides means that oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the30oligonucleotide. 201286 16 As used herein, “conjugate group” means a group of atoms that is directly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. As used herein, “conjugate linker” means a single bond or a group of atoms 5 comprising at least one bond that connects a conjugate moiety to an oligonucleotide. As used herein, “conjugate moiety” means a group of atoms that modifies one or more properties of a molecule compared to the identical molecule lacking the conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.10As used herein, “internucleoside linkage” is the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. As used herein, “motif” means the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages, in an oligonucleotide. 15 As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used 20 herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A “5-methyl cytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, “nucleobase sequence” means the order of contiguous nucleobases in25a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification. By way of example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having30some DNA bases and some RNA bases such as “AUCGATCG” and compounds having other modified nucleobases, such as “ATmCGAUCG,” whereinmC indicates a cytosine base comprising a methyl group at the 5-position. Finally, for clarity, unless otherwise indicated, 201286 17 the phrase “nucleobase sequence of SEQ ID NO: X”, refers only to the sequence of nucleobases in that SEQ ID NO.: X, independent of any sugar or internucleoside linkage modifications also described in such SEQ ID. As used herein, “nucleoside” means a compound or fragment of a compound 5 comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, "oligomeric agent" means a double-stranded oligonucleotide and optionally one or more additional features, such as a second oligonucleotide. As used herein, "polynucleotide conjugate" means a double-stranded oligonucleotide10and optionally one or more additional features, such as a conjugate group or terminal group. A double-stranded oligonucleotide comprises a first oligonucleotide strand that is paired with a second oligonucleotide strand that is complementary to the first oligonucleotide strand. A double-stranded oligonucleotide comprises a sense oligonucleotide or strand (also known in the art as a passenger oligonucleotide or passenger strand), and an antisense 15 oligonucleotide or strand (also known in the art as a guide oligonucleotide or guide strand). As used herein, “antisense activity” means any detectable and / or measurable change attributable to the hybridization of an antisense strand to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or 20 target protein levels in the absence of the antisense strand. In certain embodiments, antisense activity is the modulation of splicing of a target pre-mRNA. As used herein, “antisense agent” means an antisense strand and optionally one or more additional features, such as a sense strand. Thus, a double-stranded oligonucleotide of the invention may be described as an antisense agent.25As used herein, “antisense compound” means an antisense strand and optionally one or more additional features, such as a conjugate group. An antisense agent may comprise an antisense compound and a sense strand. As used herein, “sense compound” means a sense strand and optionally one or more additional features, such as a conjugate group.30As used herein, “antisense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides 201286 18 include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides. The double-stranded oligonucleotides of the invention are typically siRNA and so comprise an antisense RNAi oligonucleotide. As used herein, “sense oligonucleotide” or “sense strand” means an oligonucleotide, 5 including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide. As used herein, "oligonucleotide" means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked10nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications. As used herein, “stabilized phosphate group” means a 5’-phosphate analog that 15 is metabolically more stable than a 5’-phosphate as naturally occurs on DNA or RNA. As used herein, “standard cell assay” means the assays described in the Examples and reasonable variations thereof. As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random 20 stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic25method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage. As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an oligomeric compound is designed to affect. Target RNA means an RNA transcript and30includes pre-mRNA and mRNA unless otherwise specified. As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize. 201286 19 As used herein, "terminal group" means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide. As used herein, “hybridization” means the annealing of oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of 5 hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid10target. As used herein, “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single- stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may 15 comprise conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent modulates the amount and / or activity, of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H. As used herein, “RNase H agent” means an antisense agent that acts through RNase H to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. In certain 20 embodiments, RNase H agents are single-stranded. In certain embodiments, RNase H agents are double-stranded. RNase H compounds may comprise conjugate groups and / or terminal groups. In certain embodiments, an RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC / Ago2.25As used herein, “reducing” or “inhibiting” ANGPTL3 means reducing expression of ANGPTL3 RNA and / or protein levels in the presence of an oligomeric compound or oligomeric agent described herein compared to expression of ANGPTL3 RNA and / or protein levels in the absence of an oligomeric compound or oligomeric agent described herein. As used herein, “pharmaceutically acceptable carrier or diluent” means any substance30suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain 20 embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid. As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the 5 desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For example, the term “pharmaceutically acceptable” may refer to salts, excipients, carriers, diluents, etc. approved by a regulatory agency of the Federal or a state government, or listed in the U.S. Pharmacopeia, European Pharmacopeia, or other generally recognized pharmacopeia.10As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines. As used herein “prodrug” means a therapeutic agent in a first form outside the body 15 that is converted to a second form within an animal or cells thereof. Typically, conversion of a prodrug within the animal is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and / or by physiologic conditions. In certain embodiments, the first form of the prodrug is less active than the second form. As used herein, “treating” means improving a subject’s disease or condition by 20 administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves a symptom relative to the same symptom in the absence of the treatment. In certain embodiments, treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.25As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent or composition that has been observed to provide a therapeutic benefit to an animal. For example, a therapeutically effective amount may be observed to improve a symptom of a disease. The terms "individual”, "subject”, and "patient”, are used interchangeably herein to30refer to a mammalian subject for whom diagnosis, prognosis, disease monitoring, treatment, therapy, and / or therapy optimisation is desired. The mammal can be (without limitation) a human, non-human primate, mouse, rat, dog, cat, horse, or cow. In a preferred embodiment, 21 the individual, subject, or patient is a human. An “individual” may be an adult, juvenile or infant. An “individual” may be male or female. A "subject in need" of treatment for a particular condition can be an individual having that condition, diagnosed as having that condition, or at risk of developing that condition. 5 A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment or one or more complications or symptoms related to such a condition, and optionally, have already undergone treatment for a condition as defined herein or the one or more complications or symptoms related to said condition. Alternatively, a subject can also be one who has not been previously diagnosed as10having a condition as defined herein or one or more or symptoms or complications related to said condition. For example, a subject can be one who exhibits one or more risk factors for a condition, or one or more or symptoms or complications related to said condition or a subject who does not exhibit risk factors. As used herein, the term “healthy individual” refers to an individual or group of 15 individuals who are in a healthy state, e.g., individuals who have not shown any symptoms of the disease, have not been diagnosed with the disease and / or are not likely to develop the disease e.g., a thrombotic event. Preferably said healthy individual(s) is not on medication affecting haemostasis and has not been diagnosed with any other disease. The one or more healthy individuals may have a similar sex, age, and / or body mass index (BMI) as compared 20 with the test individual. Application of standard statistical methods used in medicine permits determination of normal levels of expression in healthy individuals, and significant deviations from such normal levels. Herein the terms “control” and “reference population” are used interchangeably.25There is provided Conjugate 2, comprising (i) a first (sense) strand having the sequence: [M]-mC mU mA mC mA mU fA fU fA mA mA mC mU mA mC mA mA (ps) mG (ps) mU (SEQ ID NO: 11),30and (ii) a second (antisense) strand having the sequence: 201286 22 mA (ps) fC (ps) mU fU mG fU mA fG mU fU mU fA mU fA mU fG mU (ps) fA (ps) mG (SEQ ID NO: 5), where [M] is a triantennary ligand moiety linked to the 5’ end of the second strand and having 5 the structure: the “free” bond indicated “*”) to the 5’ position of the 5’ terminal nucleotide of the first strand (i.e., to the 5’-carbon of the 2’-O-methyl ribose moiety of the mC residue at the 5’ end10of the first strand). Sequences are shown in the conventional 5’ to 3’ direction. In the context of the above formula, the following abbreviations are used: Abbreviation Meaning 201286 23 mA, mU, mC, mG 2’-O-methyl ribonucleotide (adenine, uracil, cytosine, guanine) fA, fU, fC, fG 2’-fluoro-ribonucleotide (adenine, uracil, cytosine, guanine) (ps) phosphorothioate linkage between adjacent nucleotides In one embodiment there is provided a process for the preparation of conjugate (I), or pharmaceutically acceptable salts of conjugate (I), and the intermediates used in the preparation thereof. 5 Another embodiment is a product obtainable by any of the processes or examples disclosed herein. MEDICAL AND PHARMACEUTICAL USE Conjugate 2, and pharmaceutically acceptable salts thereof, is believed to be useful in10the prevention or treatment of cardiometabolic diseases such as hypertriglyceridemia, obesity, hyperlipidemia. abnormal lipid and / or cholesterol metabolism, atherosclerosis type I diabetes mellitus. cardiovascular disease, coronary artery disease, non alcoholic steatohepatitis, non- alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin resistant hypercholesterolemia and other metabolic related disorders and diseases in a 15 mammal, particularly a human. Conjugate 2, and pharmaceutically acceptable salts thereof, is believed to be useful in the prevention or treatment of heart failure in a mammal, particularly a human. Conjugate 1, and pharmaceutically acceptable salts thereof, is believed to be useful in the prevention or treatment of heart failure in a mammal, particularly a human.20Conjugate 2, and pharmaceutically acceptable salts thereof, is believed to be useful in the prevention or treatment of chronic kidney disease in a mammal, particularly a human. Conjugate 1, and pharmaceutically acceptable salts thereof, is believed to be useful in the prevention or treatment of chronic kidney disease in a mammal, particularly a human.25For the avoidance of doubt, as used herein, the term “treatment” includes therapeutic and / or prophylactic treatment. When a compound or salt described herein is administered as therapy for treating a disorder, a “therapeutically effective amount” is an amount sufficient to reduce or completely alleviate symptoms or other detrimental effects of the disorder, cure the disorder, reverse, 201286 24 completely stop, or slow the progress of the disorder or reduce the risk of the disorder getting worse. The compounds described herein are thus indicated both in the therapeutic and / or prophylactic treatment of these conditions. 5 The compounds described herein have the advantage that they may be more efficacious, be less toxic, be more selective, be more potent, produce fewer side effects, be more easily absorbed, and / or have a better pharmacokinetic profile (e.g. higher oral bioavailability and / or lower clearance), than compounds known in the prior art. For the above-mentioned therapeutic indications, the dosage administered will vary10with the compound employed, the mode of administration and the treatment desired. However, in general, satisfactory results are obtained when the compounds are administered at a dosage of the solid form of between 1 mg and 2000 mg per day. Conjugate 2, and pharmaceutically acceptable salts thereof, may be used on their own, or in the form of appropriate pharmaceutical compositions in which the compound or 15 derivative is in admixture with a pharmaceutically acceptable adjuvant, diluent or carrier. Thus, another aspect concerns a pharmaceutical composition comprising Conjugate 2, or a pharmaceutically acceptable salt thereof, in admixture with a pharmaceutically acceptable adjuvant, diluent or carrier. Conjugate 1, and pharmaceutically acceptable salts thereof, may be used on their own, 20 or in the form of appropriate pharmaceutical compositions in which the compound or derivative is in admixture with a pharmaceutically acceptable adjuvant, diluent or carrier. Thus, another aspect concerns a pharmaceutical composition comprising Conjugate 1, or a pharmaceutically acceptable salt thereof, in admixture with a pharmaceutically acceptable adjuvant, diluent or carrier.25In one embodiment there is provided Conjugate 2, or a pharmaceutically acceptable salt thereof for use in therapy, especially in the prevention or treatment of cardiometabolic diseases such as hypertriglyceridemia, obesity, hyperlipidemia. abnormal lipid and / or cholesterol metabolism, atherosclerosis type I diabetes mellitus. cardiovascular disease, coronary artery disease, non alcoholic steatohepatitis, non-alcoholic fatty liver disease,30homozygous and heterozygous familial hypercholesterolemia, statin resistant hypercholesterolemia and other metabolic related disorders and diseasesin a mammal, particularly a human. 201286 25 In one embodiment there is provided Conjugate 2, or a pharmaceutically acceptable salt thereof for use in therapy, especially in the prevention or treatment of heart failure in a mammal, particularly a human. In one embodiment there is provided Conjugate 1, or a pharmaceutically acceptable 5 salt thereof for use in therapy, especially in the prevention or treatment of heart failure in a mammal, particularly a human. In one embodiment there is provided Conjugate 2, or a pharmaceutically acceptable salt thereof for use in therapy, especially in the prevention or treatment of chronic kidney disease in a mammal, particularly a human.10In one embodiment there is provided Conjugate 1, or a pharmaceutically acceptable salt thereof for use in therapy, especially in the prevention or treatment of chronic kidney disease in a mammal, particularly a human. These and other embodiments are described in greater detail herein below, where 15 further aspects will be apparent to one skilled in the art from reading this specification. COMBINATION THERAPY Conjugate 2, or pharmaceutically acceptable salts thereof, may also be administered in conjunction with other compounds used for the treatment of the above conditions. 20 In another embodiment, there is a combination therapy wherein Conjugate 2, or a pharmaceutically acceptable salt thereof, and a second active ingredient are administered concurrently, sequentially or in admixture, for the treatment of one or more of the conditions listed above. Such a combination may be used in combination with one or more further active ingredients.25When used in a combination therapy, it is contemplated that Conjugate 2, or pharmaceutically acceptable salts thereof, and the other active ingredients may be administered in a single composition, completely separate compositions, or a combination thereof. It also is contemplated that the active ingredients may be administered concurrently, simultaneously, sequentially, or separately. The particular composition(s) and dosing30frequency(ies) of the combination therapy will depend on a variety of factors, including, for example, the route of administration, the condition being treated, the species of the patient, any potential interactions between the active ingredients when combined into a single 201286 26 composition, any interactions between the active ingredients when they are administered to the animal patient, and various other factors known to physicians (in the context of human patients), veterinarians (in the context of non-human patients), and others skilled in the art. PHARMACEUTICAL COMPOSITIONS 5 There is provided a method of treating a disease associated with ANGPTL3 comprising administering to a subject having a disease associated with ANGPTL3 a therapeutically effective amount of an ANPTL3 siRNA agent, thereby treating the disease associated with ANGPTL3. Typically, the pharmaceutical composition further comprises a pharmaceutically10acceptable diluent or carrier. The pharmaceutically acceptable diluent may be water or saline. A pharmaceutical composition may comprise or consist of a sterile saline solution and an ANPTL3 siRNA agent, which comprises an antisense strand having a nucleobase sequence complementary to a ANGPTL3 target nucleic acid. The sterile saline is preferably pharmaceutical grade saline. 15 A pharmaceutical composition may comprise or consist of an ANPTL3 siRNA agent, which comprises an antisense strand having a nucleobase sequence complementary to a ANGPTL3 target nucleic acid and sterile water. Preferably the sterile water is pharmaceutical grade water, e.g., water for injection. The saline may be phosphate-buffered saline (PBS), preferably sterile PBS. 20 A pharmaceutical composition may comprise an ANPTL3 siRNA agent, which comprises an antisense strand having a nucleobase sequence complementary to a ANGPTL3 target nucleic acid and one or more excipients. Excipients may be selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and25polyvinylpyrrolidone. In certain embodiments, an ANPTL3 siRNA agent, which comprises an antisense strand having a nucleobase sequence complementary to a ANGPTL3 target nucleic acid, may be admixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods30for the formulation of pharmaceutical compositions depend on a number of criteria, 201286 27 including, but not limited to, route of administration, extent of disease, or dose to be administered. Pharmaceutical compositions comprising an ANGPTL3 siRNA agent, which comprises an antisense strand having a nucleobase sequence complementary to a 5 ANGPTL3 target nucleic acid, encompass any pharmaceutically acceptable salts of the ANPTL3 siRNA agent. Pharmaceutical compositions comprising an ANPTL3 siRNA agent, which comprises an antisense strand having a nucleobase sequence complementary to a ANGPTL3 target nucleic acid, upon administration to an animal, including a human, are typically capable of providing (directly or indirectly) the biologically active metabolite10or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of an ANGPTL3 siRNA agent, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. A pharmaceutical composition may comprise a co-solvent system. Certain of such15 co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water- miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™ and 65% w / v 20 polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g.,25polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose. A pharmaceutical composition may be prepared for administration by injection (e.g., intravenous, subcutaneous, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or30physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and 28 the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. 5 Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and10in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in 15 equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a salt thereof” 20 expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with a cation. In certain instances, one or more specific cation is identified. An ANGPTL3 siRNA agent, which comprises an antisense strand having a nucleobase sequence complementary to a ANGPTL3 target nucleic acid, may be in aqueous solution with sodium. An ANGPTL3 siRNA agent, which comprises an antisense strand having a25nucleobase sequence complementary to a ANGPTL3 target nucleic acid, may be in aqueous solution with potassium. An ANGPTL3 siRNA agent, which comprises an antisense strand having a nucleobase sequence complementary to a ANGPTL3 target nucleic acid, may be in PBS. An ANGPTL3 siRNA agent, which comprises an antisense strand having a nucleobase sequence complementary to a ANGPTL3 target nucleic acid, may be in water. The pH of the30solution may be adjusted with NaOH and / or HCl to achieve a desired pH. PREPARATION OF THE COMPOUNDS 29 Example 1 Conjugate 1 (WO2019 / 055633: AD05488 (guide: AM07235-AS, passenger: AM07234-SS)): Sense (passenger): NAG-invAb (ps) mG mC mU mC mA mA mC mA fU fA fU mU mU mG mA mU mC mA mG mU mA (ps) invAb (SEQ ID NO: 10) 5 Antisense (guide): mU (ps) fA (ps) mC (ps) fU mG fA mU fC mA fA mA fU mA fU mG fU mU fG mA fG (ps) mC (SEQ ID NO: 3) SEQ ID NO: 2 invAb (ps) mG mC mU mC mA mA mC mA fU fA fU mU mU mG mA mU mC mA mG mU mA (ps) invAb10SEQ ID NO: 3 mU (ps) fA (ps) mC (ps) fU mG fA mU fC mA fA mA fU mA fU mG fU mU fG mA fG (ps) mC Single strands synthesis, Example 1 All synthetic reactions were performed under an inert atmosphere, unless otherwise stated. In the following examples, when the source of the starting products is not specified, it should be 15 understood that said products are known compounds (e.g., commercially available compounds from suppliers such as Sigma-Aldrich) and / or may be prepared according to known methods, e.g. as described in the literature and patent publications described herein. Nucleotide phosphoramidites were purchased from Sigma-Aldrich or WuXi. Linker phosphoramidites were purchased from Glen Research or WuXi. The 5'-amino-modifier C620was obtained from GlenResearch. UV purities were determined using ion-pairing LCMS and are stated at 260 nm. Yields are given based on the initial resin loading and oligonucleotide content of the final product, as calculated from UV absorption. General synthetic procedure, Example 1 This procedure was used unless otherwise indicated. 25 Oligonucleotides SEQ ID NO: 2, 3 were synthesized on a 10 μmol scale on a K&A system using CUTAG CPG support (Sigma-Aldrich, 25-35 μmol / g). Phosphoramidites were dissolved to a final concentration to 0.1 M (3 equivalents) in DNA grade acetonitrile (ACN) prior to use, except for the GalNAc phosphoramidite, dissolved at 201286 30 0.2 M in dry DCM. Detritylation was performed using 3 vol-% dichloroacetic acid in DCM (contact time 5 x 35 s). Di- and tri-antennary linkers were deprotected using double detritylation. Activator BTT was used as activating agent (0.3 M in ACN) for the couplings. Recirculation times of phosphoramidites were 10 min (single coupling) for all 2’-modified 5 building blocks and 4*10min (quadruple coupling) for GalNAc phosphoramidite (SEQ ID no 1). DDTT was dissolved in pyridine (0.2 M) and used as thiolation reagent with a contact time of 5 min. Oxidizer solution was purchased from Sigma-Aldrich and used as such with a contact time of 9 s. Equal volumes of Cap A (9.1 vol-% acetic anhydride in tetrahydrofuran (THF)) and Cap B (THF / N-methylimidazole / pyridine 80:10:10 vol-%) were mixed in situ for 10 capping (contact time 50 s). Cyanoethyl backbone removal was performed with 20 vol-% diethylamine in ACN (contact time 7 x 1 min) after the synthesis complete. Oligonucleotides were cleaved from the solid support and further deprotected by treatment with ammonia (aq. 40%) solution (10 mL) at 55 °C for 18 h, and subsequently dried on a Speedvac. 15 Purification procedure, Example 1 The single strand oligonucleotides were purified using either ion-pairing HPLC or reverse phase HPLC. Identity and purity of oligonucleotides was confirmed by liquid chromatography-mass spectrometry (LC-MS) using an Acquity I-class LC system, equipped with a PDA and coupled 20 to an RDa via heated electrospray (BioAccord) by the Waters Corporation. Analytical runs were performed on an ACQUITY PREMIER BEH C181.7μm 2.1x100mm (130 Å) column at 80 °C, using a gradient of 35-50% B (100% ACN) in A (10 mM TBAA in 10% ACN / 90% H2O) over 10 min (flow rate 0.5 mL / min). Oligonucleotide SEQ ID NO 2 was purified using RP HPLC (XBridge C18, 5μm 19x150mm,25A: 50 mM NH4HCO3 in water (pH8), B: ACN), gradient 5-12% B 16 min, 12-30% B 3 min, the repurified using same column and A:60 mM DBuAA in (H2O / ACN 95 / 5)pH7.0, B:60 mM DBuAA in ACN, gradient 10-40% in 12min, 40-80% in 5min, UV purity obtained is 95.0% ; m / z (ESI-;TOF) calcd 2158.91 (4-); found: 2158.91 Oligonucleotide SEQ ID NO 3 was purified using RP HPLC (XBridge C18, 5μm 19x150mm, 30 A:60 mM DBuAA in (H2O / ACN 95 / 5), pH 7.0, B:60 mM DbuAA in ACN, gradient 20-50% 201286 31 in 12 min, 50-80% in 0.5min, UV purity obtained is 90.2% ; m / z (ESI-;TOF) calcd 1728.22 (4- ); found: 1728.23 Double strands siRNA synthesis - annealing, Example 1 5 The amounts of the single strands were quantified by UV spectrophotometry at 260 nm and the solutions normalized to 2 mM using calculated extinction coefficients. For siRNA compounds, single strands were mixed in equal molar amounts, warmed to 95°C for 5 min and then left to cool down to room temperature over 1 h. Double stranded siRNAs were analyzed using UPLC-MS method. Analyses of double10stranded siRNAs were performed at ACQUITY PREMIER BEH Amide 1.7μm 2.1x100mm, 300 Å (30°C, flow 0.5ml / min) using gradient: 15-60% B in 5 min, where A: 25 mM ammonium acetate in 70 / 30 ACN / water, B: 25 mM ammonium acetate in 30 / 70 ACN / water. The final siRNAs were freeze-dried and redissolved in 1X PBS to a concentration of 10 mg / mL.15Conjugate 1: Theoretical mass: 15564.6 Deconvolved mass found: 15564.7 Example 2 Conjugate 2: Sense (passenger): [M]-mC mU mA mC mA mU fA fU fA mA mA mC mU mA mC mA mA 20 (ps) mG (ps) mU (SEQ ID NO: 11) Antisense (guide): mA (ps) fC (ps) mU fU mG fU mA fG mU fU mU fA mU fA mU fG mU (ps) fA (ps) mG (SEQ ID NO: 5) SEQ ID NO: 4 mC mU mA mC mA mU fA fU fA mA mA mC mU mA mC mA mA (ps) 25 mG (ps) mU SEQ ID NO: 5 mA (ps) fC (ps) mU fU mG fU mA fG mU fU mU fA mU fA mU fG mU (ps) fA (ps) mG Building block synthesis, Example 2 201286 32 Synthesis of the phosphoramidite derivatives of [M], (ST41-phos) as well as ST23 (ST23- phos) and their precursor compounds can be performed as described in WO2017 / 174657. ST41-phos: 5 Oligonucleotides were synthesized on an AKTA oligopilot 100 synthesizer using standard 10 phosphoramidite chemistry. Commercially available base loaded solid support (Nitto phase HL250, Kinovate, CA), 2´OMe nucleotide phosphoramidites and 2´F nucleotide phosphoramidites (all standard protection. ChemGenes) were used according to the manufacturers recommended procedures. Ancillary reagents were purchased from EMP Biotech. Synthesis was performed using a150.1 M solution of the phosphoramidite in dry acetonitrile and benzylthiotetrazole (BTT) was used as activator (0.3M in acetonitrile). Coupling time was 10 min. A Cap / OX / Cap or Cap / Thio / Cap cycle was applied (Cap: Ac2O / NMI / Lutidine / Acetonitrile. Oxidizer: 0.1M I2in pyridine / H2O). Phosphorothioates were introduced using 0.2M XH (0.2 M Xanthane hydride in pyridine). DMT cleavage was achieved by treatment with 3% dichloroacetic acid in20toluene. Upon completion of the programmed synthesis cycles a diethylamine (DEA) wash was performed. All other reagents and solvents were commercially available and used in standard reagent quality. All oligonucleotides were synthesized in DMT-off mode. The single strands were cleaved off the support by 40% aq. methylamine treatment (90min, RT). The resulting crude 201286 33 oligonucleotide was concentrated under reduced pressure to a concentration of ~10 mg / mL and purified by ion exchange chromatography (SourceQ.7.5 mL. GE Healthcare) on an AKTA Pure HPLC System using a sodium chloride gradient. Product containing fractions were pooled, desalted by UFDF (Sartorius Sartoflow Smart, Sartocon Slice 200 Hydrosart 2k, 5 10 times volume exchange against sterile water). To prove their purity all final single stranded products were analysed by AEX-HPLC (DNA Pac PA2004.0x250 mm & DNAPac PA200 Guard 4x50 mm at 80 °C, using a gradient of 25- 70% B (10 % MeCN, 20 mM TRIS, 0.4 M LiClO4 in water, pH =7.4) in A (10 % MeCN, 20 mM TRIS in water) over 10 min, flow rate 1 mL / min). Purity is given in %FLP (% full length10product) which is the percentage of the UV-area under the assigned product signal in the UV- trace of the AEX-HPLC analysis of the final product. Identity of the respective single stranded products was confirmed by UPLC-MS analysis (Acquity UPLC BEH C182.1x50 mm,1.7 µm Acquity BEH C181.7µM Vanguard Pre-Col at 60°C, using a gradient of 10-22% B (100 mM HFIP, 15 mM TEA in MeOH) in A (100 mM HFIP, 15 mM TEA, 5% MeOH in 15 water) over 5 min, flow rate 0.3 mL / min). Single stranded oligonucleotides: Name MW. calc. MW (ESI-), found %FLP (AEX-HPLC) (free acid) SEQ ID NO: 4 6247.85 Da 6248.0 Da 97.5 SEQ ID NO: 5 7834.46 Da 7835.0 Da 94.9 Double strand formation, Example 2 Individual single strands were dissolved in a concentration of 60 OD / mL in H2O. Both20individual oligonucleotide solutions were added together in a reaction vessel. A titration was performed for easier reaction monitoring. The first strand was added in 25% excess over the second strand as determined by UV-absorption at 260 nm. The reaction mixture was heated to 80 °C for 5 min and then slowly cooled to RT. Double strand formation was monitored by ion pairing reverse phase HPLC (X Bridge BEH C182.1x50 mm 2.5µm, XP VanGuard 25 Cartridges at 15 °C, using a gradient of 5-45% B (100 mM HFIP, 15 mM TEA in MeOH) in A (100 mM HFIP, 15 mM TEA, 5% MeOH in water) over 15 min, flow rate 0.3 mL / min). From the UV-area of the residual single strand the needed amount of the second strand was calculated and added to the reaction mixture. The reaction was heated to 80°C again and 201286 34 slowly cooled to RT. This procedure was repeated until less than 10% of residual single strand was detected. Nucleic acid conjugates: siRNA % double strand Conjugate 2 93.3 5 Abbreviations used in the Examples: Abbreviation Meaning mA, mU, mC, mG 2’-O-methyl ribonucleotide (adenine, uracil, cytosine, guanine) fA, fU, fC, fG 2’-fluoro-ribonucleotide (adenine, uracil, cytosine, guanine) (ps) phosphorothioate linkage between adjacent nucleotides invAb abasic deoxyribose T Thymine [M] is:

[0003] 201286 35 510 201286 36 NAG is: 5 Example 3 In vitro test of GalNac-conjugated siRNAs for inhibition of ANGPTL3 mRNA expression in primary hepatocytes List of abbreviations for Example 3: % Percent µM Micromolar A Adenine ANGPTL3 Angiopoietin-like Protein 3 201286 37 C Cytosine c Sequence identity: cynomolgus Ctr Non-targeting siRNA control cyno Cynomolgus monkey DMSO Dimethyl sulfoxide G Guanine GalNAc N-Acetylgalactosamine h Sequence identity: human LPR Lower primer for RT-PCR mg Milligrams ml Milliliter nM Nanomolar nt Nucleotides PPIB Peptidyl-prolyl cis-trans isomerase B PRB Fluorescently labelled probe for RT-PCR RNA Ribonucleic acid RNAi RNA interference RT-qPCR Reverse transcription quantitative polymerase chain reaction SD Standard deviation siRNA Small interfering RNA T Thymine U Uracil UPR Upper primer for PCR UT Untreated v / v Volume per volume Test Items GalNAc-conjugated siRNAs tested were: Conjugate 1 (Example 1) and Conjugate 2 (Example 2). 5 Cell culture 201286 38 Primary human hepatocytes (Lot Hu8264) and cynomolgus hepatocytes (crab-eating macaque, Macaca fascicularis, Lot CY411) were sourced from Life Technologies. As described by the manufacturer, primary hepatocytes were thawed and plated in Williams’ E medium (Life Technologies), supplemented with 5 % fetal bovine serum, 1 µM 5 Dexamethasone in DMSO (final concentration of DMSO = 0.01 %) and 3.6 % v / v of Thawing / Plating Cocktail-A (Thermo Fisher Scientific, CM3000) at 37 °C in a 5 % CO2 atmosphere. Treatment of primary hepatocytes with GalNac-conjugated siRNAs10Primary hepatocytes were seeded into collagen I-coated 96-well plates (Life Technologies) at a density of 35,000 cells and 45,000 cells per well for human and cynomolgus cells, respectively. GalNAc-conjugated siRNAs Conjugate 1 and Conjugate 2 were serially diluted to achieve final concentrations of 100, 20, 4, 0.8 and 0.16 nM for human cells, and 100, 10, 1, 0.1 and 0.01 nM for cynomolgus cells in the previously defined media in triplicates. Plates 15 were then incubated at 37 °C in a 5 % CO2 atmosphere for 24 hours. Subsequently, cells were lysed, and RNA was isolated form the cells as described in section 4.4. Quantitative RT-PCR Twenty-four hours post treatment with GalNAc conjugated siRNAs Conjugate 1 and 20 Conjugate 2, total RNA was extracted using the InviTrap HTS 96-well kit (Invitek Molecular GmbH, Berlin, Germany) according to the manufacturer’s instructions and eluted in 2x 30 µl of elution buffer. Eluted RNA was stored at -80 °C until analysis by qPCR. For qPCR, 10 µl of RNA were mixed with Takyon 5x Master Mix (Eurogentec, Seraing, Belgium) and primer / probe sets against either ANGPTL3 or PPIB (BioTez GmbH, Berlin,25Germany or Eurogentec, Seraing, Belgium) as listed in Table 1: Table 1: Sequences of primers and probes used for RT-qPCR. Primer / SEQ ID NO: Name Sequence 5’ to 3’ Probe hANL3 UPR 12 AGAGCACCAAGAACTACTCCCTTTC PRB 13 CATGATGGCATTCCTGCTGAATGTACCA 201286 39 LWR 14 TGCCACTTGTATGTTCACCTCTGT cANL3 UPR 12 AGAGCACCAAGAACTACTCCCTTTC PRB 13 CATGATGGCATTCCTGCTGAATGTACCA LWR 15 ACGTGCCACTTATATGTTCACCTCT hcPPIB UPR 16 AGATGTAGGCCGGGTGATCTTT PRB 17 TGTTCCAAAAACAGTGGATAATTTTGTGGCC LWR 18 GTAGCCAAATCCTTTCTCTCCTGT The RT-qPCR reactions were carried out at 20 ml per sample using a QuantStudio 6 Flex cycler (Applied Biosystems, part of Thermo Fisher Scientific, Massachusetts, USA) using standard protocols for RT-qPCR (48 °C 30 min, 95 °C 3 min, 40 cycles at 95 °C 15 s 5 followed by 60 °C 1 min). The data were calculated by using the comparative CT method also known as the 2-DDCtmethod (Livak and Schmittgen, 2001 and Schmittgen and Livak, 2008). In brief, the amount of ANGPTL3 mRNA was normalized to the endogenous housekeeping gene PPIB followed by untreated control cells according to the following formula: 10 Fold-change = 2^^^C T. Data is presented as means of three replicates ± SD. Results Unless stated otherwise, all values presented in the text refer to mean ± standard deviation (SD). Calculations of some tabular presentations were carried out using standard spreadsheet15software (Graph Pad Prism 9, Microsoft®EXCEL®). A higher number of digits than tabulated were used for the calculation of some parameters. Therefore, recalculation of parameters from tabulated data may, in some instances, lead to minor variations. Since the original raw data is unaltered and thus numerically correct, this occurrence is not significant for the outcome of the study.20To estimate the impact of Conjugate 1 and Conjugate 2 on ANGPTL3 mRNA levels in vitro, primary human and cynomolgus hepatocytes were treated at five different concentrations for 24 hours, followed by isolation of RNA and quantification of remaining ANGPTL3 transcript levels by qPCR. Untreated cells were used for normalization. Experimental results are shown in Figure 1 for human primary hepatocytes and in Figure 2 for cynomolgus hepatocytes. 201286 40 As illustrated in Figure 1, Conjugate 2 induced a dose-dependent knockdown of ANGPTL3 in human hepatocytes, exceeding a 50% knockdown at 100 nM, whereas Conjugate 1 exceeded 50% at both 100 and 20 nM. The maximum knockdown measured in this experiment was 59 ± 3% and 60.3 ± 2% for Conjugate 2 and Conjugate 1, respectively. 5 In cynomolgus monkey hepatocytes (Figure 2), tested compounds appeared more potent in general, which is in line with previous observations (data not shown), resulting in a 10-fold dilution series employed in this experiment.50% knockdown levels were exceeded at 1 nM for Conjugate 2, and 10 nM for Conjugate 1. Maximum knockdown levels were observed at10100 nM in both cases (85.4 ± 1% for Conjugate 2 vs.80.4 ± 1% for Conjugate 1). Data is presented as means of three replicates ± SD. Corresponding gene expression levels are depicted in Table 2. Table 2: ANGPTL3 mRNA expression levels in primary hepatocytes normalized to PPIB mRNA Human hepatocytes Cynomolgus hepatocytes siRNA-DDCt -DsiRNA siRNA 2 SD 2DCt2-DDCtSD 2-DDCt(conc.) (conc.) untreated 1.00 0.12 1.00 0.17 100nM 0.41 0.03 100nM 0.15 0.01 20nM 0.57 0.04 10nM 0.16 0.03 Conjugate 2 4nM 0.75 0.07 1nM 0.34 0.03 0.8nM 1.05 0.13 0.1nM 0.66 0.06 0.16nM 0.97 0.09 0.01nM 0.82 0.06 100nM 0.40 0.02 100nM 0.22 0.01 20nM 0.46 0.01 10nM 0.35 0.01 Conjugate 1 4nM 0.62 0.05 1nM 0.65 0.27 0.8nM 0.80 0.09 0.1nM 0.99 0.09 0.16nM 0.83 0.07 0.01nM 0.97 0.02 15 201286 41 Reference compounds Conjugate 3 and Conjugate 4 Conjugate 3 (WO2012 / 177784: AD-52988.1 (guide: A-108397.1, passenger A-108396.1): Sense (passenger): fU mA fC mA fU mA fU mA fA fA fC mU fA mC fA mA fG mU fC mA 5 fA-L96 (SEQ ID NO: 19) Antisense (guide): mU fU mG fA mC fU mU fG mU fA mG mU mU fU mA fU mA fU mG fU mA (ps) fG (ps) mU (SEQ ID NO: 7) SEQ ID NO: 6 fU mA fC mA fU mA fU mA fA fA fC mU fA mC fA mA fG mU fC mA fA 10 SEQ ID NO: 7 mU fU mG fA mC fU mU fG mU fA mG mU mU fU mA fU mA fU mG fU mA (ps) fG (ps) mU Conjugate 4 (WO2012 / 177784: AD-45887.1 (guide: A-96144.1, passenger: A-96143.1): Sense (passenger): mC mU fA mC fA mU fA mU fA fA fA mC mU fA mC fA fA fG mU dT15(ps) dT-L96 (SEQ ID NO: 20) Antisense (guide): fA fC fU fU fG mU fA fG fU fU mU fA mU fA fU fG mU fA fG dT (ps) dT (SEQ ID NO: 9) SEQ ID NO: 8 mC mU fA mC fA mU fA mU fA fA fA mC mU fA mC fA fA fG mU dT20(ps) dT SEQ ID NO: 9 fA fC fU fU fG mU fA fG fU fU mU fA mU fA fU fG mU fA fG dT (ps) dT In the context of the above formula, the following abbreviations are used: Abbreviation Meaning mA, mU, mC, mG 2’-O-methyl ribonucleotide (adenine, uracil, cytosine, guanine) fA, fU, fC, fG 2’-fluoro-ribonucleotide (adenine, uracil, cytosine, guanine) dT 2’-deoxythymidine (ps) phosphorothioate linkage between adjacent nucleotides 201286 42 L96 is a triantennary ligand moiety having the structure: 5 the “free” bond indicated “*”) to the 3’ position of the 3’ terminal nucleotide of the first strand. Single strands synthesis All synthetic reactions were performed under an inert atmosphere, unless otherwise stated. In10the following examples, when the source of the starting products is not specified, it should be 201286 43 understood that said products are known compounds (e.g., commercially available compounds from suppliers such as Sigma-Aldrich) and / or may be prepared according to known methods, e.g. as described in the literature and patent publications described herein. Nucleotide phosphoramidites were purchased from Sigma-Aldrich or WuXi. Linker 5 phosphoramidites were purchased from Glen Research or WuXi. The 5'-amino-modifier C6 was obtained from GlenResearch. UV purities were determined using ion-pairing LCMS and are stated at 260 nm. Yields are given based on the initial resin loading and oligonucleotide content of the final product, as calculated from UV absorption. General synthetic procedure10This procedure was used unless otherwise indicated. Oligonucleotides SEQ ID NO: 7, 9 were synthesised on an ÄKTA OligoPilot Plus 10 synthesizer (GE Healthcare), on a 32 µmole scale, using a standard synthesis cycle of detritylation (3% dichloroacetic acid in toluene), coupling (coupling agent: 0.25 M 5-[3,5- Bis(trifluoromethyl)phenyl]-1H-tetrazole solution in acetonitrile), capping (Cap A: 20% N-15methylimidazole and 80% acetonitrile; Cap B: 20% pyridine, 20% acetic anhydride and 60% acetonitrile), oxidation (0.05 M iodine in pyridine and water) or thiolation (0.2 M Xanthane hydride in pyridine), and solid supports (UNY Primer Support 5G ~353 μmole / g, GE Healthcare). All fully protected β-cyanoethyl phosphoramidite monomers were dissolved in anhydrous acetonitrile (0.1 M) under argon immediately prior to use. The phosphoramidite re-20circulation time / coupling time for DNA monomers was 5 min and was extended to 10 min for RNA monomers. Stepwise coupling efficiencies and overall yields were determined by automated trityl cation absorption monitoring exceeding 98% for all oligonucleotides synthesized. At the end of solid phase synthesis, the solid-support bound oligonucleotides were treated with ammonia (aq.40%) solution (10 mL) at 55 °C for 18 h, and subsequently dried on25a Speedvac. Oligonucleotides SEQ ID NO: 6, 8 were synthesised on an ÄKTA OligoPilot Plus 10 synthesizer (GE Healthcare) on a 13 µmole scale, using a standard synthesis cycle described above and solid support Nitto Phase (loading 0.153mmol / g) preloaded with L96 GalNac.30Purification procedure 201286 44 The single strand oligonucleotides were purified using either ion-pairing HPLC or reverse phase HPLC. Identity and purity of oligonucleotides was confirmed by liquid chromatography-mass spectrometry (LC-MS) using an Acquity I-class LC system, equipped with a PDA and coupled 5 to an RDa via heated electrospray (BioAccord) by the Waters Corporation. Analytical runs were performed on an ACQUITY PREMIER BEH C181.7μm 2.1x100mm (130 Å) column at 80 °C, using a gradient of 35-50% B (100% ACN) in A (10 mM TBAA in 10% ACN / 90% H2O) over 10 min (flow rate 0.5 mL / min). Oligonucleotide SEQ ID NO 6 was purified using RP HPLC (XBridge C18, 5μm 19x150mm,10A: 50 mM NH4HCO3 in water (pH8), B: ACN), gradient 5% B for 1 min, 5-20% B in 11 min, 20-90% B in 3 min, UV purity obtained is 94% ; m / z (ESI-;TOF) calcd 1717.19 (5-); found: 1718.0 Oligonucleotide SEQ ID NO 7 was purified using IP HPLC (XBridge C18, 5μm 19x150mm, A:60 mM DBuAA (H2O / ACN 95 / 5) pH7, B:60 mM DBuAA in ACN), gradient 5% B for 1min,1520-40% B in 12min, 50-80% in 0.5 min, UV purity obtained is 95.6% ; m / z (ESI-;TOF) calcd 1879.0 (4-); found: 1878.98 Oligonucleotide SEQ ID NO 8 was purified using RP HPLC (XBridge C18, 5μm 19x150mm, A: 50 mM NH4HCO3 in water (pH8), B: ACN), gradient 5% B for 1 min, 5-18% B in 11 min, 18-90% B in 3 min, UV purity obtained is 96.5% ; m / z (ESI-;TOF) calcd 1709.59 (5-); found:201710.3 Oligonucleotide SEQ ID NO 9 was purified using IP HPLC (XBridge C18, 5μm 19x150mm, A:60 mM DBuAA (H2O / ACN 95 / 5) pH7, B:60 mM DBuAA in ACN), gradient 5% B for 1min, 20-40% B in 12min, 40-80% in 0.5 min, UV purity obtained is 96.3% ; m / z (ESI-;TOF) calcd 2243.27 (3-); found: 2243.26 25 Double strands siRNA synthesis - annealing The amounts of the single strands were quantified by UV spectrophotometry at 260 nm and the solutions normalized to 2 mM using calculated extinction coefficients. 201286 45 For siRNA compounds, single strands were mixed in equal molar amounts, warmed to 95C for 5 min and then left to cool down to room temperature over 1 h. Double stranded siRNAs were analyzed using UPLC-MS method. Analyses of double stranded siRNAs were performed at ACQUITY PREMIER BEH Amide 1.7μm 2.1x100mm, 5 300 Å (30°C, flow 0.5ml / min) using gradient: 15-60% B in 5 min, where A: 25 mM ammonium acetate in 70 / 30 ACN / water, B: 25 mM ammonium acetate in 30 / 70 ACN / water. The final siRNAs were freeze-dried and redissolved in 1X PBS to a concentration of 10 mg / mL. Conjugate 3: Theoretical mass: 16118.8 Deconvolved mass found: 16118.6 10 Conjugate 4: Theoretical mass: 15293.2 Deconvolved mass found: 15293.1 Example 4 In vivo ANGPTL3 knockdown using AAV-based humanized ANGPTL3 model.15The aim of the study was to profile the in vivo effects of Conjugate 2 in its ability to knockdown (KD) human ANGPTL3 mRNA in the liver and reduction of circulating ANGPTL3 protein as compared to Conjugates 3 and 4. List of abbreviations for Example 4: 20 AAT Alpha1-antitrypsin AAV Associated Adeno Virus ApoE Apolipoprotein E EDTA Ethylendiaminetatraacetic acid ELISA Enzyme-linked immunosorbent assay 25 siRNA Small interfering RNA HDL High-density lipoprotein KD Knockdown LDL-C Low Density Lipoprotein – Cholesterol LPL Lipoprotein lipase30ORF Open reading frame 201286 46 PBS Phosphate-buffered saline PCR Polymerase chain reaction RNA Ribonucleic acid UTR Untranslated region 5 VLDL Very low-density lipoprotein Test Formulation Compounds: Conjugate 2 Conjugate 310Conjugate 4 Vehicle: PBS Stock concentration: 10 mg / mL Dosing solution: 0.05, 0.2 and 0.6 mg / mL 15 Test System In Vivo Species: Mouse Strain: C57Bl6N Sex: Females Total No of animals: 50 20 Body weight range: 21.0-26.3 grams at study start Supplier: Charles River Laboratory, Germany Identification method: Tail tatoo Acclimatisation: At least 5 days Housing conditions: Upon arrival, mice were group housed in Macrolon L3 cages.25Twelve-hour light / dark cycle (lights on at 6 am), 40 to 60 humidity, 20 to 22˚C. Water: Bottled tap water, ad lib Diet: Normal chow diet ad lib (R70, Lantmännen, Kimstad, Sweden) / (A40 Safe, Augy, France)30Bedding: Aspen wood chip bedding (Harlan, USA) Pre-treatment: humanANGPTL3 AAV 5E+11gc Participation in previous studies: No 201286 47 Study Design Dose(s): 0.25, 1 or 3 mg / kg of Conjugate 2 0.25, 1 or 3 mg / kg of Conjugate 3 5 0.25, 1 or 3 mg / kg of Conjugate 4 Volume(s) of administration: 5 mL / kg Route(s) and frequency of Administration: S.c. Number / group: 510In vivo design Mice were 8 weeks of age when they arrived the test facility. All mice were put on regular chow diet from the day of arrival and throughout the study. After 6 weeks or 6 days of acclimatization, the mice were injected via the tail vein with AAV. Two weeks after the AAV 15 injection each group was then treated, receiving the assigned treatment via a single subcutaneous injection. Blood samples from the tail vein collected in EDTA glass capillaries (REF#164113 Micro Haematocrit Tubes, Vitrex Medical) were taken on day 0, 7, 22, 30, 42 and 49. Termination was carried out after the last blood sample. At termination, all animals were anesthetized with isoflurane (Abbot, Stockholm, Sweden) 20 using a vaporizer (Univentor 400, Agnthos, Sweden) and blood was withdrawn from the orbital plexus and collected into tubes containing EDTA as anticoagulant (REF#15.1671.101, Multivette 600K3E, Sarstedt). Blood samples were centrifuged at 10.000 x g for 4 minutes at 4 °C temperature. The resulting plasma was aliquoted and stored at -20°C until further analysis was performed. Subsequently, anesthetized mice were culled by cutting out the heart.25The left lateral lobe from the liver was collected and snap frozen in liquid nitrogen and stored at -80°C until subsequent analysis. AAV-ANGPTL3 generation The liver-targeted AAV vector genome construct which carries a liver-specific hAAT-hApoE30promoter (a chimeric promoter with human apolipoprotein E and alpha-1-antitrypsin gene enhancer / promoter) was previously reported ((Liu, 2023 #499). Human ANGPTL3 open reading frame (ORF) sequence was synthesized by GenScripts, and the ORF was amplified by 201286 48 PCR using a primer pair 5’- TTTGAATTCGCCACCATGTTCACAATTAAGCTCCTTCTT- 3’ (SEQ ID NO: 21) and 5’-TACATTGCTAGCTCATTCAAAGCTTTCTGAATCTG-3’ (SEQ ID NO: 22). The PCR products were then purified using QIAquick PCR Purification Kit, digested with EcoRI and NheI and gel purified using QIAquick Gel Extraction Kit. The 5 digested ANGPTL3 ORF was then cloned into the EcoRI and SpeI sites of AAV-hAAT- hApoE-FGF21 mutant vector plasmid, which led to the introduction of human ANGPTL3 ORF under the control of the liver specific hAAT-hApoE promoter. The resulting plasmid was named as pAAV-hAAT-hApoE-ANGPTL3_noUTRs and the insert was confirmed by sequencing using the following primers.10H83 ANGPTL3_L1 TCATGCCTCTTTGCACCATTC (SEQ ID NO: 23) H84 ANGPTL3_L2 AATGGCCTCCTTCAGTTGGG (SEQ ID NO: 24) H85 ANGPTL3_L3 GCCAAGAGCACCAAGAACTAC (SEQ ID NO: 25) H86 ANGPTL3_L4 CACTTCAACTGTCCAGAGGGT (SEQ ID NO: 26) H87 ANGPTL3_R1 TGTCTTGATCAATTCTGGAGGA (SEQ ID NO: 27) 15 H88 ANGPTL3_R2 ATTGGTCTTCCACGGTCTGG (SEQ ID NO: 28) H89 ANGPTL3_R3 TGTTTGTTGTCTTTCCAGTCTTCC (SEQ ID NO: 29) H90 ANGPTL3_R4 CCTTGCTCCATACCACCCC (SEQ ID NO: 30) The full sequence of pAAV-hAAT-hApoE-ANGPTL3_noUTRs is as follows. 20 pAAV-hAAT-hApoE-ANGPTL3_noUTRs 6623 bp DNA FEATURES Location / Qualifiers Annotation 143..172 / label="Annotation Promoter lac_promoter" misc_feature 237..377 25 / label="AAV ITR" misc_feature 446..1167 / label="hAAT-hApoE prom" misc_feature 1203..1695 / label="Human beta globin intron"30CDS 1714..3096 / note="ANGPTL3 CDS" – highlighted in bold Terminator 3111..3589 / label="Terminator human_growth_hormone_poly_A" Reporter 3749..390935 / label="Reporter lacZ_alpha_fragment" Promoter 4753..4781 / label="Promoter ampicillin_resistance_gene(b-lactamase)promoter" Selection 4823..5683 201286 49 / label="Selection ampicillin_resistance_gene_ORF Origin 5838..6457 / label="Origin pBR322_replication_origin 5 ORIGIN (SEQ ID NO: 31) 1 agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 61 acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 10 15 202530 35 404550 55 201286 50 3121 tccctgtgac ccctccccag tgcctctcct ggccctggaa gttgccactc cagtgcccac 3181 cagccttgtc ctaataaaat taagttgcat cattttgtct gactaggtgt ccttctataa 3241 tattatgggg tggagggggg tggtatggag caaggggcaa gttgggaaga caacctgtag 5 101520 25 303540 45 5055 201286 51 6601 gtcagtgagc gaggaagcgg aag Generation of recombinant AAV vectors: Ad293 cells (Agilent, Santa Clara, CA, USA) were plated in a five layered chamber in Gibco DMEM supplemented with 10% Gibco FBS 5 and 1% Gibco penicillin-streptomycin (Thermo Fisher Scientific, Waltham, MA, USA). When these cells reached at 60–85% confluency under the microscope, they were transfected by polyethylenimine (Polyscience, Torrance, CA, USA) with triple plasmids, including pHelper containing adenoviral E2A and E4 genes, pRep2Cap8 encoding AAV2 Rep proteins and AAV8 serotype capsid, and pAAV-hAAT-hApoE-ANGPTL3_noUTRs, in a ratio of102:1.4:1, respectively ((Liu, 2023 #499). After 72 hr of the post-transfection, cells were harvested and lysed via three freeze-thaw cycles followed by 1 hr of benzonase treatment at 37°C. Supernatants were further purified using iodixanol gradient-based ultracentrifugation. Titers of AAV vector preps used for in vivo study were quantitated by quantitative PCR. Since the recombinant AAV8 vector was generated by a standard and helper-free 3 plasmid 15 transfection system, this vector does not express AAV8 and adenoviral helper proteins and cannot replicate in transduced hepatocytes. Human ANGPTL3 mRNA analysis RNA was isolated from ~20 mg snap-frozen liver using RNeasy Mini Kit (Qiagen,20cat#74104) according to manufacturer´s instructions. cDNA was generated using a High- Capacity RNA-to-cDNA™ Kit from Applied Biosystems (ThermoFisher cat# 4387406) and used for real-time PCR with the QuantStudio 7 Flex (Applied Biosystems). ANGPTL3 gene expression was measured using TaqMan Gene Expression assays from Applied Biosystems (ThermoFisher, ANGPTL3: FAM-MGB Hs00205581_m1 cat# 4331182, and mouse RPLP025primer probe set from (Sigma Aldrich) as housekeeping gene. Forward primer: 5´-GAGGAATCAGATGAGGATATGGGA-3´ (SEQ ID NO: 32), Reverse primer 5´-AAGCAGGCTGACTTGGTTGC-3´ (SEQ ID NO: 33)and FAM-TAM labelled probe 5´-TCGGTCTCTTCGACTAATCCCGCCAA-3´ (SEQ ID NO: 34)30Real-time PCR was performed on a Quantstudio 7 flex and PCR cycle numbers (Ct) determined using the Quantstudio Real-Time PCR Software (Applied Biosystems). ANGTPL3 gene expression level was normalized against RPLP0 the housekeeping gene. 201286 52 Human ANGPTL3 mRNA analysis Human ANGPTL3 was measured in mouse plasma using Human Angiopoietin-like 3 Quantikine ELISA Kit (DANL30, R&D Systems, Minneapolis, MN). Prior to use, the ELISA 5 assay was shown to not cross-react with endogenous mouse ANGPTL3 present in the plasma samples (BS003151-48). The mouse plasma samples were analysed for human ANGPTL3 according to the manufacture instructions with the following modifications; the calibration curve was extended with 4 points to cover 0.02-10 ng / mL, the plasma samples were diluted 25-, 50-, or 100-fold prior to analysis. Calibration standards were analysed in duplicated and10study samples as single samples, the ELISA plates were read in an absorbance microplate reader capable of measuring absorbance at 450 nm, with correction wavelength set at 540 nm (e.g. iX3, Molecular Devices). The response of the standard curve was plotted as absorbance units on the linear scale versus concentration on the log scale and the 4- parameter function was used for curve fitting (using SoftMax Pro). To control for between plate variations a 15 human quality control samples was run, in duplicate, in the beginning and end of each analysis plate. ANGPLT3 levels was reported as ng / mL plasma. Data Analysis Plasma ANGPTL3 protein data were baseline-corrected, individually for each animal. The 20 mean and standard error of each group at each day were calculated. Normality of data was investigated using the one-sample Kolmogorov-Smirnov test. Log-transformed data were suggested and used in subsequent tests. For human ANGPTL3 mRNA expression data, mean and standard error of each group were calculated. Normality of data was investigated using the one-sample Kolmogorov-Smirnov test. Log-transformed data were suggested and used in25subsequent tests. For all analyses, Tukey’s post hoc test was used for multiple comparisons. Calculations were performed in MATLAB (R2022b; MathWorks). Specifically, the function kstest was used to test for normality, and the functions anova1 and multcompare were used for multiple comparison tests.30Results For Conjugate 2, maximum reductions of baseline-corrected ANGPTL3 protein concentrations were 37%, 58%, and 86% for single doses of 0.25, 1, and 3 mg / kg, 201286 53 respectively (Table 3; Figure 3). For the treated groups, the maximum reductions were observed 22 to 30 days after dosing. The baseline-corrected ANGPTL3 protein concentration decreased over time in the placebo group with a maximum reduction of 37% at Day 42 and a reduction of 22% at the study end (Day 49). Neither the 0.25 mg / kg group nor the 1 mg / kg 5 group showed statistically significant reductions in baseline-corrected ANGPTL3 protein concentration compared to placebo at the P < 0.05 level. The high-dose group of 3 mg / kg showed statistically significant reduction in baseline-corrected ANGPTL3 protein concentration compared to placebo at all measured time-points (P < 0.05). For the 1 mg / kg group, the baseline-corrected ANGPTL3 protein concentration started to return towards10baseline, and reached the same level as the placebo group, but did not fully return to baseline, at Day 49. For the 3 mg / kg group, the baseline-corrected ANGPTL3 protein concentration did not fully return to baseline during the 7-week study. At study termination on Day 49, knockdown of human ANGPTL3 mRNA in liver was 56% compared to placebo (P < 0.005 versus all other groups) for the high-dose group of 3 mg / kg. The groups dosed with 0.25 and 15 1 mg / kg did not show knockdown of human ANGPTL3 mRNA in the liver at Day 49 (Table 4; Figure 4). For Conjugate 3, maximum reductions of baseline-corrected ANGPTL3 protein concentrations were 31%, 28%, and 43% for single doses of 0.25, 1, and 3 mg / kg, respectively (Table 3). For Conjugate 4, maximum reductions of baseline-corrected ANGPTL3 protein concentrations were 0%, 20%, and 30% for single doses of 0.25, 1, and 3 20 mg / kg, respectively (Table 3). None of the dose groups for Conjugates 3 or 4 did show any knockdown of human ANGPTL3 mRNA in the liver at Day 49 (Table 4; Figure 5). Table 3 Circulating Human ANGPTL3 Protein (% of baseline) In Humanized Mice Treated with A Single Dose Of Conjugate 2, Conjugate 3 or25Conjugate 4. Treatment Dose Baseline Day Day Day Day Day (mg / kg) 7 22 30 42 49 PBS 0 100 136 74 92 66 78 PBS 0 100 66 45 44 32 40 PBS 0 100 137 68 45 67 38 PBS 0 100 90 97 105 66 127 PBS 0 100 91 98 88 85 104 N 5 5 5 5 5 5 Mean 100 104 76 75 63 78 201286 54 Treatment Dose Baseline Day Day Day Day Day (mg / kg) 7 22 30 42 49 Conjugate 2 0.25 100 70 85 65 89 76 Conjugate 2 0.25 100 128 111 57 97 145 Conjugate 2 0.25 100 87 134 63 102 128 Conjugate 2 0.25 100 61 83 65 77 46 Conjugate 2 0.25 100 55 64 65 122 101 N 5 5 5 5 5 5 Mean 100 80 96 63 97 99 Conjugate 2 1 100 39 25 31 25 54 Conjugate 2 1 100 45 52 90 81 98 Conjugate 2 1 100 45 49 12 29 64 Conjugate 2 1 100 105 94 34 42 78 Conjugate 2 1 100 54 45 45 46 79 N 5 5 5 5 5 5 Mean 100 58 53 42 45 75 Conjugate 2 3 100 13 5 6 16 26 Conjugate 2 3 100 21 22 21 44 56 Conjugate 2 3 100 17 19 22 51 17 Conjugate 2 3 100 11 8 8 11 20 Conjugate 2 3 100 25 16 18 21 32 N 5 5 5 5 5 5 Mean 100 17 14 15 29 30 Conjugate 3 0.25 100 103 81 94 79 53 Conjugate 3 0.25 100 122 132 137 95 94 Conjugate 3 0.25 100 113 93 85 58 85 Conjugate 3 0.25 100 102 84 98 59 75 Conjugate 3 0.25 100 69 66 68 54 57 N 5 5 5 5 5 5 Mean 100 102 91 96 69 73 Conjugate 3 1 100 69 89 118 101 77 Conjugate 3 1 100 80 71 38 46 42 Conjugate 3 1 100 161 138 121 173 102 Conjugate 3 1 100 129 85 40 72 78 Conjugate 3 1 100 127 100 44 88 60 N 5 5 5 5 5 5 Mean 100 113 97 72 96 72 201286 55 Treatment Dose Baseline Day Day Day Day Day (mg / kg) 7 22 30 42 49 Conjugate 3 3 100 74 75 51 60 102 Conjugate 3 3 100 84 140 53 103 89 Conjugate 3 3 100 80 110 56 85 66 Conjugate 3 3 100 102 121 58 125 116 Conjugate 3 3 100 70 127 66 90 93 N 5 5 5 5 5 5 Mean 100 82 115 57 93 93 Conjugate 4 0.25 100 147 132 142 129 75 Conjugate 4 0.25 100 156 104 93 87 88 Conjugate 4 0.25 100 129 203 108 121 118 Conjugate 4 0.25 100 151 151 133 138 147 Conjugate 4 0.25 100 144 102 90 61 80 N 5 5 5 5 5 5 Mean 100 145 138 113 107 102 Conjugate 4 1 100 82 88 79 72 53 Conjugate 4 1 100 84 131 69 54 68 Conjugate 4 1 100 90 113 85 94 83 Conjugate 4 1 100 86 136 86 106 71 Conjugate 4 1 100 100 159 149 92 123 N 5 5 5 5 5 5 Mean 100 88 125 94 84 80 Conjugate 4 3 100 136 79 75 68 48 Conjugate 4 3 100 124 156 123 157 116 Conjugate 4 3 100 89 98 92 118 71 Conjugate 4 3 100 118 66 81 61 53 Conjugate 4 3 100 124 78 66 119 63 N 5 5 5 5 5 5 Mean 100 118 95 87 105 70 ANGPTL3, angiopoietin-like protein 3; mRNA, messenger ribonucleic acid; N, number. 201286 56 Table 4 Human ANGPTL3 mRNA Expression in Liver On Day 49 In Humanized Mice Treated With A Single Dose Of Conjugate 2,5Conjugate 3 or Conjugate 4. Treatment Dose Human (mg / kg) ANGPTL3 mRNA (2-ΔCtvs mRPLO) PBS 0 7.67 PBS 0 4.07 PBS 0 5.06 PBS 0 6.74 PBS 0 4.77 N 5 Mean 5.66 Conjugate 2 0.25 5.26 Conjugate 2 0.25 9.16 Conjugate 2 0.25 11.1 Conjugate 2 0.25 4.23 Conjugate 2 0.25 6.51 N 5 Mean 7.24 Knockdown (%) -27.9 Conjugate 2 1 4.48 Conjugate 2 1 4.87 Conjugate 2 1 5.22 Conjugate 2 1 4.73 Conjugate 2 1 9.37 N 5 Mean 5.73 Knockdown (%) -1.2 Conjugate 2 3 2.81 Conjugate 2 3 2.45 Conjugate 2 3 2.10 201286 57 Treatment Dose Human (mg / kg) ANGPTL3 mRNA ( -ΔCt2 vs mRPLO) Conjugate 2 3 1.93 Conjugate 2 3 3.12 N 5 Mean 2.48 Knockdown (%) 56.2 Conjugate 3 0.25 7.38 Conjugate 3 0.25 5.48 Conjugate 3 0.25 4.48 Conjugate 3 0.25 3.73 Conjugate 3 0.25 5.74 N 5 Mean 5.36 Knockdown (%) 5.3 Conjugate 3 1 3.50 Conjugate 3 1 6.93 Conjugate 3 1 5.59 Conjugate 3 1 5.14 Conjugate 3 1 5.50 N 5 Mean 5.33 Knockdown (%) 5.9 Conjugate 3 3 9.02 Conjugate 3 3 8.24 Conjugate 3 3 5.13 Conjugate 3 3 6.48 Conjugate 3 3 7.76 N 5 Mean 7.32 Knockdown (%) -29.3 201286 58 Treatment Dose Human (mg / kg) ANGPTL3 mR CN -Δ tA (2 vs mRPLO) Conjugate 4 0.25 4.57 Conjugate 4 0.25 6.16 Conjugate 4 0.25 7.89 Conjugate 4 0.25 10.65 Conjugate 4 0.25 6.84 N 5 Mean 7.22 Knockdown (%) -27.5 Conjugate 4 1 8.64 Conjugate 4 1 5.74 Conjugate 4 1 3.23 Conjugate 4 1 5.57 Conjugate 4 1 4.68 N 5 Mean 5.57 Knockdown (%) 1.6 Conjugate 4 3 4.99 Conjugate 4 3 10.68 Conjugate 4 3 6.18 Conjugate 4 3 1.40 Conjugate 4 3 4.24 N 5 Mean 5.50 Knockdown (%) 2.9 ANGPTL3, angiopoietin-like protein 3; mRNA, messenger ribonucleic acid; N, number. Example 5 Therapeutic effects of Conjugate 1 in an obese HFpEF ZSF1 rat model In Vivo. 201286 59 Abbreviation or Explanation special term ELISA Enzyme-linked immunosorbent assay GalNAc Galactose / N-acetylgalactosamine HF Heart failure HFpEF Heart failure with preserved ejection fraction HS High salt IVRT Isovolumic relaxation time LPL Lipoprotein lipase LV Left ventricle NT-proBNP N-terminal pro B-type natriuretic peptide PBS Phosphate buffered saline SC Subcutaneous siRNA Small interfering ribonucleic acid T2DM Type 2 diabetes TG Triglyceride UACR Urine albumin-creatinine ratio Unx Uninephrectomized - One kidney removed surgically ZSF-1 Male obese Zucker diabetic fatty / spontaneously hypertensive heart failure F1 hybrid (ZSF1) rats with leptin mutations, when uninephrectomized and under high-salt diet they develop HFpEF A ZSF-1 obese rat model with heart failure with preserved ejection fraction (HFpEF) was used to study the effect of ANGPTL3 protein reduction using Conjugate 1. Once secreted into the circulation, ANGPTL3 acts as an inhibitor of lipoprotein lipase (LPL), 5 thus, play a major role in regulating total levels of circulating plasma triglycerides (Prog Lipid Res.2022;85101140). It is known that similar to the positive metabolic profile in individuals deficient in ANGPTL3 protein (The Journal of clinical endocrinology and metabolism. 2012;97(7):E1266-75), pharmacological reduction in circulating ANGPTL3 protein has been demonstrated to cause clinically meaningful and well-tolerated reductions in cardiovascular10risk factors (Evinacumab. (EVKEEZA®) Prescribing Information. Regeneron Pharmaceuticals, Inc.2023, Circulation 2019. p. E987-8). Data from observational studies (Arterioscler Thromb Vasc Biol.2018; 38(2): 464-72) has also indicated the potential clinical benefit of such reductions in patients with metabolically driven heart failure. The ZSF-1 rat is a cross of two different leptin receptor mutations and the offspring 15 can be either obese or lean. The obese ZSF-1 rats spontaneously develop obesity, hypertension, type 2 diabetes, hyperlipidemia, left ventricular (LV) dysfunction, nephropathy 201286 60 and insulin resistance. The lean ZSF-1 rat is hypertensive, but shows none of the other conditions. Obese uninephrectomized ZSF-1 rats were treated for 12 weeks with Conjugate 1 or vehicle respectively, and given high salt diet (to induce HFpEF phenotype). Non-invasive imaging, echocardiography, was used in this study as the “golden standard” of evaluating 5 heart function. It was concluded that ANGPTL3 protein reduction decreases circulating triglyceride (TG) levels, reduces TG content in heart and reduces the development of diastolic dysfunction in ZSF-1 obese rats with HFpEF (as shown by NT-proBNP and IVRT results), without significant increase of liver TGs. Obese uninephrectomized (Unx) ZSF-1 rats were treated for 12 weeks with Conjugate101 or vehicle, n=8 respectively, in high salt (HS) diet. Lean ZSF-1 rats (n=8) were used as a control group. Blood samples were taken before start of the treatment and after 12 weeks treatment for analysis of NT-proBNP, ANGPTL3 and circulating lipids and lipoproteins. At termination, tissue from heart, kidney and liver was collected for analysis. Non-invasive imaging, echocardiography, was used in this study as the “golden standard” for evaluating 15 heart function. Isovolumic relaxation time (IVRT) was the primary endpoint. The study design for each rat is outlined in Figure 6. The rats were grouped 4 and 4 in each cage and were fed pellets containing high salt diet or Purina and normal tap water ad libitum throughout the study. Once every week, the rats were weighed. The rats were randomised into groups by IVRT, glucose, UACR and body weight. Following 20 acclimatization, baseline echocardiography and baseline blood sampling was initiated. Study design Dose(s): 4 mg / kg Infusion / injection rate(s) and / or time: Sub cutaneous injections Duration of treatment: 12 weeks Number / group: 8, Groups are outlined in Table 5 Number of groups: 7 Individual animal Identification or reference number is the identification No / reference No : individual identifying number which was given to each animal in the study 201286 61 Table 5 Groups, Doses and Number of Animals Group Group Treatment Diet Dose Number of Disease- number animals population 1 ZSF1 Lean PBS Purina - 8 2 ZSF1 Obese PBS Purina - 8 sham 3 ZSF1 Obese Conjugate 1 Purina 4 mg / kg 8 sham 4 ZSF1 Obese PBS Purina - 8 CKD Unx 5 ZSF1 Obese Conjugate 1 Purina 4 mg / kg 8 CKD Unx 6 ZSF1 Obese PBS Purina + - 8 HFpEF Unx + HS High Salt 7 ZSF1 Obese Conjugate 1 Purina + 4 mg / kg 8 HFpEF Unx + HS High Salt Total number of animals 56 The study design for each rat is outlined in Figure 6. The rats were grouped 4 and 4 in each cage and were fed pellets containing high salt diet or Purina and normal tap water ad libitum throughout the study. Once every week, the rats were weighed. The rats were 5 randomised into groups by IVRT, glucose, UACR and body weight. Following acclimatization, baseline echocardiography and baseline blood sampling was initiated. Obese uninephrectomized ZSF1 rats on hight salt diet were treated for 12 weeks with Conjugate 1 or vehicle, n=8 respectively. Lean ZSF1 rats (n=8) were used as a control group. Treatments (either PBS or Conjugate 1) were administered subcutaneously at study week 1, 4,107 and 10. Blood samples were taken before start of the treatment, every third week and after 12 weeks treatment for analysis of NT-proBNP, ANGPTL3 and circulating lipids. At termination, blood was collected as well as tissue from heart, kidney and liver for analysis. Non-invasive imaging, echocardiography, was used in this study as the “golden standard” of evaluating heart function. Isovolumic relaxation time (IVRT from echocardiography), was the15primary endpoint. Animals N 25 (Obese Unx+ HS+AD) 30 and 32 (Obese Unx+ HS) died before endpoint. 201286 62 Experimental Procedures Blood Sampling from Tail Vein At baseline, every third week and endpoint (as described in Figure 1), a tail vein blood sample was collected from the wake rats via a butterfly catheter (21G, BD Valu-Set™ , Plymouth, 5 UK) in EDTA coated vials (MiniCollect, K3EDTA, Kremsmünster, Austria). Plasma Analysis Blood was centrifuged for 10 min at 5000 x g. EDTA-plasma and was used for analysis of NT-proBNP and ANGPTL3. The assays were performed according to the manufacturer’s instructions. 10 Metabolic cages Animals were place in metabolic cages urine sampling and fasting period for later blood collection. From an animal welfare perspective, a shorter time, such as 4 hours, is recommended as it is less challenging for the rats (less stressful and less impact on body weight, food, and water intake). At study weeks -1, 7, 10 and 12, animals were placed in15metabolic cages for 4 hours with water ad libitum but no food. For the fasting period of the blood collection of week 4, animals were placed in a plastic box for 4 hours with water ad libitum. Echocardiography Animal Preparation Echocardiography20Non-invasive imaging, Echocardiography, was performed three times: at baseline, week 9 and study week 12. The animals were initially anaesthetised with isoflurane (Isoba® vet, Schering-Plough Ltd., England) gas (5%) in a gas chamber. The gas concentration was established by exerting a flow of O2 (200 mL / min) and air (500 mL / min) to a solution of isoflurane. During the experiment the animals were kept anaesthetised by breathing isoflurane25gas (approximately 2.2%) through a mask. Hair removal of the chest and left back side is done with Veet® removal cream after shaving. The skin was carefully rinsed with lukewarm tap water. Experimental Protocol Echocardiography Echocardiography was performed using a high-resolution ultrasound scanner (Vevo 3100,30Visualsonics Inc) with MX201 solid state transducers. A parasternal long axis (LAX) view 201286 63 was used to visualize a long axis image of the heart. Subsequently a short-axis (SAX) image was collected at the mid-ventricular level, with the right ventricle (RV) oriented to the left side of the field of view (FOV), and the papillary muscles on the right side. B-mode and m- mode loops were collected. 5 To assess diastolic function including isovolumic relaxation time (IVRT), analyses of the blood flow spectrum from a pulse wave Doppler on the mitral valve were performed. This image was acquired via a modified apical four chamber view. From the same view Tissue Doppler Imaging (TDI) was performed on the septal mitral valve annulus to assess longitudinal velocities of the myocardium.10Termination and Organ Sampling At endpoint, the heart, lungs, spleen, liver and one kidney were harvested and weighed and the tibia was dissected and the length was measured. Rat ANGPTL3 ELISA This method was set up fully automated in a Beckman Coulter Motoman robotic15system (FLIPR). Including Biomek FX Span-8 / 96-head Biotek cellwasher, Cytomat Incubators (shake), Carousel and MD Paradigm Reader. Assay kit Mouse / Rat Angiopoietin- like protein 3 ELISA (ANGPTL3, Cat No RAG011R, Czech Republic) was used. Robot assay: Samples were pre-diluted in two steps from 10 μL Sample, to in total 800 x (separate method). Standards were serial diluted (2 x) and transferred to predilution20plate.100 μL prediluted sample / standard were pipetted to ELISA plate. Incubation for 1 h at 37°C. ELISA plate was washed (ELISA35 x washes).100 μL detection antibody was added. Incubation for 1 h at 37°C. ELISA plate was washed (ELISA35 x washes).100 μL HRP Conjugate was added. Incubation for 1 h at 37°C. ELISA plate was washed (ELISA35x washes).100 μL Substrate TMB was added. Incubation for 15 min at room temperature in the 25 dark.100µl top solution was added. Absorbance at 450 nm and reference wavelength at 540 nm (within 20 min) was read. Rat NT-proBNP MSD ELISA Assay This method was set up fully automated in a Beckman Coulter SCARA robotic system (Lambda) including Biomek NX Span-8, Biomek FX 96 / 96-heads, biotek cellwasher, cytomat30Incubators, hotels and MD Paradigm Reader and MSD S600. Rat NT-proBNP kit (Cat No K153JKD-1) was used. 201286 64 Robot assay: Samples were pre-diluted (3 x) in Diluent 34 with protease inhibitor. MSD plate was washed (3 x in wash buffer).50 μL of standards, controls and diluted sample were dispensed. Incubation for 1 h with vigorous shaking (500 rpm) at room temperature. Plate was washed (3 x in wash buffer).25 μL detection antibody was dispensed. Incubation for 2 h with 5 vigorous shaking (500 rpm) at room temperature. Plate was washed (3 x in wash buffer). 150μL reading buffer was dispensed. Plate was read within 2 min in the MSD Sector Imager S600. Straight Phase HPLC for Plasma TGs Plasma triglycerides were extracted using liquid / liquid extraction (Lofgren L, 2012). The10liquid extract was evaporated under a stream of nitrogen and reconstituted in heptane:isopropanol [9:1]. The analysis was done using straight phase HPLC as described previously (J Chromatogr B Biomed Sci Appl.1998; 708(1-2): 21-6). Quantification was made against an external calibration curve. TG content in Liver15Pieces (app.50 mg) of liver were homogenized with isopropanol (2-isopropanol) so the triglycerides is released from the tissue. Triglycerides in sample were hydrolyzed enzymatically to glycerol and fatty acids. Glycerol generates, by two enzymatic steps, hydrogen peroxide that contributes to the formation of a red quinoneimine derivat. Colour intensity is directly proportional to the amount of triglycerides (glycerol) in the sample, and is20measured colorimetrically at wave length 500 nm. Lipidomics for TG content in the heart Pre-weighed frozen ZSF1 heart samples were homogenized by bead beating in 10X (v / w) 3:1:6 IPA:water:EtOAc containing 1:100 EquiSplash (Avanti) internal standard mixture. A fraction of the clarified supernatant was dried via speedvac before resuspension in 25 an equal volume of 9:1 MeOH:Toluene (10X ratio maintained).1 μL of sample was analyzed using a C18 LCMS-based approach. Mass Spectrometry: Untargeted (full scan) mass spectrometry analysis was performed using Thermo Tribrid ID-X with a scan range of 50 to 950 m / z for metabolomics and 50 to 1700 m / z for lipidomics. Individual samples were acquired in MS1 only mode, using a30polarity switching approach. Data analysis: Thermo raw files were analyzed in MS-DIAL (≥v.4.8) for feature detection, alignment, identification, and normalization. Peak areas were normalized to 201286 65 EquiSplash standards for lipidomics and to the total ion current for metabolomics. Features were filtered in R based on QC / Blank signal >3X and a QC RSD<30%. Statistical analysis was performed using the MetaboAnalystR package (v.3.2.0) with R language (v.4.1.0). Briefly, data was normalized by median, log-transformed and scaled with a Pareto approach. 5 Fold change calculations are using data before the column-wise normalization was applied (ie at the original scale). Proteomics Proteomics data aquisition: Mouse heart tissues were lysed in metabolite extraction buffer (IPA:H2O:EtOAt=6:1:3) and beads beat, protein pellets with leftover buffer will be used for10proteome profiling. High pH Reversed-Phase Peptide Fractionation (Thermo 84868) was performed for the peptide fractionation. LC–MS / MS analysis was conducted on a timsTOF Pro mass spectrometer (Bruker) coupled with a Evosep LC-system and nano-electrospray ion source (CaptiveSpray Source, Bruker). Data-dependent acquisition (DDA) and Data- independent acquisition (DIA)-PASEF mode were performed to obtain the peptide data. The 15 combined DDA and DIA acquisition raw files were analyzed via Spectronaut (Biognosys AG) software (Version 18) with Pulsar search engine (SN14.10.201222) to build the library, using UniProt rat proteome database (UP000002494_20231024). Proteomics data analysis: Protein intensities were analyzed using R (v.4.2.3) and DEP package (v.1.20.0). Briefly, the data was normalized using svm approach, and missing values 20 were imputed using missForest approach(v.1.5). Finally, differential analysis was done using linear models and empirical Bayes statistics. PCA was calculated using the imputed values. Enrichment analysis was performed using clusterProfiler package (v.4.6.2). Electron microscopy for Podocyte health A thin slice of the kidney was fixed in a mix of 2.5% glutaraldehyde + 1% paraformaldehyde25(both from Sigma-Aldrich) in 0.1 M phosphate buffer (pH 7.4) and stored at 4°C. Electron microscopy analysis was conducted at the electron microscopy unit at Huddinge University Hospital (Stockholm, Sweden). 201286 66 Data Analysis Holm-Sidak’s multiple comparisons test or Unpaired t-test was used for statistical evaluation. Data is presented as mean±SD. In other cases it is indicated in the footnotes of the figures. 5 Histology readouts: Glomerular score, Podocyte stress and TEM (Glomerular Basement Membrane, GBM, thickness and slit / µm). Assays used for analyzing urine samples: U-Albumin and U-Creatinine are measured in Pentra 400. U-Albumin is determined colorimetric: Albumin CP ABX Pentra, ref A11A01664. U-Creatinine is determined by Jaffe’s reaction (picric acid): Creatinine 120CP,10Horiba ABX A11A01933. U-Albumin and creatine volume required for analyses around 50 µL. Results Body weight15As seen in Figure 7, changes in body weight between lean and obese rats were observed. No change in body weight was observed in obese animal treated with Conjugate 1 (C1) compared to obese control group. Filled-black circles represent individual animals. Stars indicate significant changes between the comparison groups. Not significant (ns) indicates no significant changes between the comparison groups. Holm-Sidak’s multiple comparisons test 20 was used. Lean (N=8), Obese Unx+HS (N=6) Obese, Unx+HS+C1 (N=7). Lean - control animals, Obese Unx+HS - uninephrectomy + high-salt diet to induce HFpEF, Obese Unx+HS+AD, uninephrectomy + high-salt diet to induce HFpEF + treatment with Conjugate 1. ANGPTL3 Protein and TG Plasma Levels 25 As seen in Figure 8, Conjugate 1 reduced more than 95% of ANGPTL3 circulating protein levels in the Obese Unx+HS+AD group compared to the control group. This changes were also observed in the reduction of circulating plasma triglyceride (TG) levels that were reduced almost to baseline levels after treatment. Filled-black circles represent individual animals. Stars indicate significant changes between the comparison groups. Holm-Sidak’s multiple30comparisons test was used. Lean (N=8), Obese Unx+HS (N=6) Obese, Unx+HS+AD (N=7). Lean - control animals, Obese Unx+HS - uninephrectomy + high-salt diet to induce HFpEF, Obese 201286 67 Unx+HS+AD, uninephrectomy + high-salt diet to induce HFpEF + treatment with Conjugate 1. TG content (lipidometic analysis) in ZSF-1 rat hearts and liver Figure 9a shows a significant reduction in TG content (lipidomic analysis) in heart tissue by 5 Conjugate 1 in the Obese Unx+HS+AD group compared to control group Tissue triglyceride 51:4, 51 carbons, 4 double bonds). As seen in Figure 9b, ANGPTL3 gene silencing does not affect liver TG content in the Obese Unx+HS+AD group compared to comparison group. Filled-black circles represent individual animals. Stars indicate significant changes between the comparison groups. Not significant (ns) indicates no significant changes between the10comparison groups. Holm-Sidak’s multiple comparisons test was used. Lean (N=8), Obese Unx+HS (N=6) Obese, Unx+HS+C1 (N=7). Lean - control animals, Obese Unx+HS - uninephrectomy + high-salt diet to induce HFpEF, Obese Unx+HS+AD, uninephrectomy + high-salt diet to induce HFpEF + treatment with Conjugate 1. NT-proBNP and IVRT 15 At a functional level, prevention of cardiac diastolic dysfunction was demonstrated by decreased isovolumic relaxation time and circulating N-terminal pro B-type natriuretic peptide levels (Figure 10). NT-proBNP is a biomarker for strain in the heart muscle and isovolumic relaxation time is an echocardiography diastolic function parameter. Filled-black circles represent individual animals. Stars indicate significant changes between the 20 comparison groups. Not significant (ns) indicates no significant changes between the comparison groups. Holm-Sidak’s multiple comparisons test was used. Lean (N=8), Obese Unx+HS (N=6) Obese, Unx+HS+C1 (N=7). Lean - control animals, Obese Unx+HS - uninephrectomy + high-salt diet to induce HFpEF, Obese Unx+HS+AD, uninephrectomy + high-salt diet to induce HFpEF + treatment with Conjugate 1.25Proteomics data (heart tissue) Proteomics data from heart tissue showed changes in proteins involved in Fatty acid metabolism. This was confirmed in using several pathway platforms. Specifically, ANGPTL3 inhibition altered the concentration of several Apolipoproteins. This results suggest that the treatment enhances the lipid degradation in heart tissue.30A) Volcano plot showing proteins changing significantly (Adj p-value < .1 &|log2(FC)|> 0.5). B) KEGG pathways significantly enriched. C) Levels of Apolipoproteins in the different treatment groups ("***"=0.001, "**"=0.01, "*"=0.05). Lean - control animals, Obese 201286 68 Unx+HS - uninephrectomy + high-salt diet to induce HFpEF, Obese Unx+HS+ARO, uninephrectomy + high-salt diet to induce HFpEF + treatment with Conjugate 1. Renal health As shown in Figure 8, ANGPTL3 inhibition prevents kidney damage in ZSF-1 rats with 5 CKD, represented by UACR, podocyte injury, and glomerulosclerosis. The rats used for the CKD indication were not under high salt diet. They received purina diet for the duration of the study. Filled-black circles, triangles and squares represent individual animals. Stars indicate significant changes between the comparison groups. Holm-Sidak’s multiple comparisons test was used. N number varies depending on the assay performed.10Lean - control animals, Obese Unx - uninephrectomy to induce CKD, Obese Unx+ARO, uninephrectomy to induce CKD + treatment with Conjugate 1. Treatment with Conjugate 1 showed that reduction in ANGPTL3 protein improves cardiometabolic outcomes in ZSF-1 HFpEF rats by decreasing circulating TGs levels, 15 reducing TG content in heart and reducing the development of diastolic dysfunction. It is hypothesized that targeting ANGPTL3 mRNA and consequently silencing hepatic ANGPTL3 gene expression with Conjugate 2, or any other siRNA agent for inhibition of ANGPTL3, will enhance LPL enzymatic activity, promote hydrolysis of TG-rich lipoproteins, decrease circulating TG and improve cardiac and renal outcomes. 20 Example 6 Therapeutic effects of Conjugate 1 in cynomolgus macaques (Macaca fascicularis) with HFpEF. The intention of this study was to investigate the chronic effects of the target inhibition of the25Conjugate 1 on cardiac-renal functional measures and markers in the most relevant animal model that reflects the intended human population. The cynomolgus monkey was selected as the test species of choice over other lower mammalian species for more meaningful and translatable results because it is closely related to humans, both phylogenetically and physiologically. The chronic efficacy of Conjugate 1 in the treatment of heart failure was30explored in the cynomolgus monkey model with heart failure with preserved ejection fraction (HFpEF) which closely approximates the adult human HFpEF phenotype. 201286 69 Study Design Group 1: Age-matched normal healthy control (4 subjects) Group 2: HFpEF PBS control (10 subjects) 5 Group 3: HFpEF Conjugate 1 s.c. dose 3 mg / kg (10 subjects) Group 4: HFpEF Empagliflozin p.o. dose 3 mg / kg (10 subjects) Dosing was administered on day 1 of week 1 and day 84 of week 12. This was then followed by a 12 week post-dose observation / washout period.10Diet and Water The monkeys were provided 3 meals per day consisting of 100.0 g of standard monkey formula feed (extruded pellets) in the morning 9:00-10:00 AM, one regular apple (150 g) in the afternoon 14:00-15:00 PM, and 100 g of high-fat diet (HFD) in the evening 16:00-17:00 PM. Water was provided ad libitum. All the monkeys were fasted overnight. After each 15 feeding time, all remaining food was withdrawn, and food intake determined by weighing the left-over food. Two-Dimensional (2D) Echocardiography Two-dimensional echocardiography (2D echo) was performed using the Mindray M9CV 20 Echocardiography System (Mindray, Shenzhen China) with SP5-1s (1.1-4.4MHz) phased array transducer under ketamine sedation administered intramuscularly (IM) at 10 mg / kg. Animals were fasted for 4-6 hours to minimize the risk of vomiting and lung aspiration during anaesthesia induction and recovery. Nevertheless, unlimited access to drinking water was provided during the fasting period. Ketamine was administered intramuscularly at 10 mg / kg25and the hairs on the animal’s left chest was shaved thoroughly using an electric clipper and a shaving blade. The monkey were appropriately positioned on the exam table or surgical bed that has been cleaned by wiping with 70% alcohol and covered with sterile disposable drape. The animal was be kept warm on a heating pad / blanket during the entire procedure. Typically, the echocardiogram was performed with the animal in the left lateral decubitus.30MRI Scan Preparations Prior to each scan, the monkey was fasted overnight or for a minimum of 6 hours prior to 201286 70 imaging. Ketamine (5-10 mg / kg, IM) was injected intramuscularly to induce sedation and atropine hydrochloride (0.02-0.04 mg / kg, IM) was administered to inhibit respiratory spasm and salivation. Endotracheal intubation was then carried out, an intravenous (IV) line was inserted 5 into a peripheral vein, and the ECG leads were attached to the animal’s chest wall. The animal was then transferred to the MRI bed for ECG and vital signs monitoring. It was connected to the mechanical ventilator and Isoflurane (1-3%) in medical air was used to induce and maintain anesthesia. The animal was positioned supine, head first on the MRI bed and an abdominal coil was used to image the heart. Each scan session did not exceed four (4)10hours. The animal was kept warm during the scan. The heart rate, blood oxygenation level, noninvasive blood pressure, respiratory rate, end-tidal C02 level and temperature was recorded / monitored during the entire scan session to ensure adequate level of anesthesia. ECG monitoring was continuously carried out. 15 MRI Procedures All animals underwent CMR using a 3.0 Tesla magnetic resonance imaging system (Magnetom Prisma; Siemens Healthineers, Erlangen, Germany) with a 32-channel phasearray body coil. The following MRI Scan Sequences was carried out twice during the entire study (at baseline and on Week 25): Proton density fat fraction (PDFF) Imaging; 20 Regadenoson Stress Perfusion Imaging; and Extracellular volume (ECV) Scan. The pulse sequence parameters were documented and described in the MRI report. The animals were mechanically ventilated at 20-30 breaths per min during the scan. Inspiratory breath holding was carried out to mitigate the effect of respiration on the vascular image quality. This was done only by switching the ventilator off for no more than2510 seconds while running the pulse sequence. The oxygen flow during breath holds (when the ventilator is off) was maintained. Proton-Density Fat Fraction (PDFF) Imaging Myocardial proton density fat fraction (mPDFF) was measured by using a 2D, ECGtriggered,30multi-echo segmented gradient-echo sequence. The ECG trigger delay was to ensure data acquisition occurring at the quiescent period of cardiac cycle to minimize cardiac motion. The respiratory motion was controlled by a single breath-hold. The mPDFF was measured using 201286 71 the software, VivoQuant (V2.5), by placing region-of-interest (ROI) at different myocardial locations. Regadenoson Stress Perfusion Imaging and Extracellular volume (ECV) Scan 5 To perform stress imaging, a rest first-pass perfusion imaging was first be initialized with a bolus injection of MRI contrast agent (0.075 mmol / kg of Gadoteric Acid Meglumine Salt Injection; 15ml: 5.654g (a sterile solution containing 377mg / ml gadoteric acid meglumine salt; Jiangsu Hengrui Pharmaceutical Co., Ltd.). The perfusion sequence was a 2D saturation recovered single-shot gradient-echo sequence with 70 repetitions. A total of 3 slices as those10in pre-contrast T1 mapping were scanned with a temporal resolution of one RR-interval (~500 msec). Cine images along 2-, 3-, and 4-chambers were then acquired after the perfusion images. Approximately 15 min later, Regadenoson (5 μg / kg; Nanjing HaiRong Pharmaceutical LTD) was injected in a bolus to induce vasodilation and another first-pass perfusion imaging (0.075 mmol / kg of Gadoteric Acid Meglumine Salt Injection) was 15 performed at 1 min after the injection of Regadenoson for stress perfusion imaging. Ten minutes after the second contrast injection, post-contrast MOLLI T1 mapping was acquired with a scheme of 4(1)3(1) in the same three short-axis slices that are used for the pre-contrast T1 scans. Late gadolinium enhancement images were obtained using an electrocardiogram-gated breath-hold inversion recovery Turbo FLASH at 15 min after 20 contrast injection. All CMR images were prospectively analyzed. A blood sample was obtained from all monkeys immediately before each CMR study for hematocrit (Hct) measurements. Cine images were analyzed by Medis software (Medis Medical Imaging Systems BV, Leiden, Netherlands). Based on the pre-contrast and post-contrast T1 maps, which were automatically generated25with a prototype inline process function from the MRI system, global or regional ECV values were calculated using Hct values. If there was motion between the pre- and post-T1 series, the pre- and post-MOLLI was registered manually. The first-pass perfusion imaging was analyzed by using another custom-made software Perfusion Imaging Toolkit (PIT). Quantitative perfusion maps in 3 slices were generated for both rest and stress conditions.30Myocardial perfusion reserves were then calculated as the ratio of stress perfusion over resting perfusion. 201286 72 Blood Sampling for Pharmacokinetic (PK) profiling, Target Biomarkers and Other Exploratory Pharmacodynamic (PD) Biomarkers Approximately 6 mL of whole blood samples was collected from a peripheral vein of the non-sedated / alert monkeys directly into K2EDTA tubes for the following target biomarkers. 5 EDTA plasma was separated by centrifugation at 2,500 x g for 10 minutes at 4 °C. The collected plasma was aliquoted into cryotubes. The samples were stored frozen at -80 °C. The cryotubes were marked with study number, animal number group number, experimental day number and time after dose. One aliquot for PK was analyzed by KBI and one was stored frozen at -80 °C as10backup. Samples for target engagement biomarkers, ANGPTL3, TG were stored and analyzed. Proton-Density Fat Fraction (PDFF) Imaging As seen in Figure 13, animals treated with Conjugate 1(ANGPTL3 SiRNA inhibition) had 15 signific reduction in heart fat fraction. Similar results were observed with the positive control SGLT2 inhibitor (Empaglifozin) as expected. Extracellular volume (ECV) Scan As seen in Figure 14, ANGPTL3 inhibtion significantly reduced extracellular volume. This 20 parameter has been associated with survival rate in heart failure patients. Left atria volume index Left atria volume index (LAVi) is a critical parameter for the diagnosis of HfpEF and predicts poor prognosis in these patients (J Cardiovasc Med (Hagerstown).2018 Jun;19(6):304-309).25As seen in Figure 15, ANGPTL3 inhibition, but not SGLT2 inhibition, resulted in a significant decrese of LAVi. Plasma ANGPTL3 levels As seen in Figure 16, ANGPTL3 circulating levels decreased significantly with treatment.30Plasma triglyceride (TG) levels 201286 73 As a consequense of ANGPTL3 inhibition, TG circulating levels were significantly decreased as seen in Figure 17. Treatment with SGLT2 inhibitor Empaglifozin did not have any effects in reduction of TG circulating levels. 5

Claims

201286 74 CLAIMS 1. An ANGPTL3 siRNA agent comprising (i) a first (sense) strand having the sequence: [M]-mC mU mA mC mA mU fA fU fA mA mA mC mU mA mC mA mA (ps) mG (ps) mU 5 (SEQ ID NO: 11), and (ii) a second (antisense) strand having the sequence: mA (ps) fC (ps) mU fU mG fU mA fG mU fU mU fA mU fA mU fG mU (ps) fA (ps) mG10(SEQ ID NO: 5), where [M] is a triantennary ligand moiety linked to the 5’ end of the first strand and having the structure:201286 75or a pharmaceutically acceptable salt thereof. 5 2. An ANGPTL3 siRNA agent according to claim 1, or a pharmaceutically acceptable salt thereof, for use as a medicament.

3. A pharmaceutical composition comprising an ANGPTL3 siRNA agent according to claim 1, or a pharmaceutically acceptable salts thereof, optionally in admixture with a10pharmaceutically acceptable adjuvant, diluents or carrier.

4. A method of treating, or reducing the risk of, cardiovascular disease or metabolic conditions which comprises administering to a person suffering from or at risk of, said201286 76 disease or condition, a therapeutically effective amount of an ANGPTL3 siRNA agent according to Claim 1, or a pharmaceutically acceptable salt thereof.

5. The method according to claim 1, wherein said disease is hypertriglyceridemia, 5 obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis type I diabetes mellitus. cardiovascular disease, coronary artery disease, non alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia or statin resistant hypercholesterolemia.

106. A compound according to claim 1, or a pharmaceutically acceptable salt thereof, for use as a medicament.

7. A compound according to claim 1, or a pharmaceutically acceptable salt thereof, for use as in the treatment of hypertriglyceridemia, obesity, hyperlipidemia, abnormal 15 lipid and / or cholesterol metabolism, atherosclerosis type I diabetes mellitus. cardiovascular disease, coronary artery disease, non alcoholic steatohepatitis, non- alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia or statin resistant hypercholesterolemia. 20 8. The use of a compound according to claim 1, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament, for the treatment or prophylaxis of cardiovascular disease or metabolic conditions.

9. A method of treating, or reducing the risk of, heart failure which comprises25administering to a person suffering from or at risk of heart failure a therapeutically effective amount of a double-stranded siRNA comprising an antisense strand comprising a nucleobase sequence that is at least 80% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, or a pharmaceutically acceptable salt thereof.3010. The method according to claim 9, wherein the double-stranded siRNA comprise an antisense strand comprising a nucleobase sequence that is at least 90% complementary201286 77 to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, or a pharmaceutically acceptable salt thereof. 5 11. The method according to claim 9, wherein the double-stranded siRNA comprise an antisense strand comprising a nucleobase sequence that is at 100% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, or a pharmaceutically acceptable salt thereof.1012. The method according to claim 9, wherein the double-stranded siRNA is an ANGPTL3 siRNA agent comprising (i) a first (sense) strand having the sequence: [M]-mC mU mA mC mA mU fA fU fA mA mA mC mU mA mC mA mA (ps) mG (ps) mU (SEQ ID NO: 11),15and (ii) a second (antisense) strand having the sequence: mA (ps) fC (ps) mU fU mG fU mA fG mU fU mU fA mU fA mU fG mU (ps) fA (ps) mG (SEQ ID NO: 5), 20 where [M] is a triantennary ligand moiety linked to the 5’ end of the first strand and having the structure:201286 78or a pharmaceutically acceptable salt thereof. 5 13. The method according to claim 9, wherein the double-stranded siRNA is an ANGPTL3 siRNA agent comprising (i) a first (sense) strand having the sequence: NAG-invAb (ps) mG mC mU mC mA mA mC mA fU fA fU mU mU mG mA mU 10 mC mA mG mU mA (ps) invAb (SEQ ID NO: 10), and (ii) a second (antisense) strand having the sequence: mU (ps) fA (ps) mC (ps) fU mG fA mU fC mA fA mA fU mA fU mG fU mU fG mA15fG (ps) mC (SEQ ID NO: 3),201286 79 where NAG is a triantennary ligand moiety linked to the 5’ end of the first strand and having the structure:;5 14. A method of treating, or reducing the risk of, chronic kidney disease which comprises administering to a person suffering from or at risk of chronic kidney disease a therapeutically effective amount of of a double-stranded siRNA comprising an10antisense strand comprising a nucleobase sequence that is at least 80% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, or a pharmaceutically acceptable salt thereof.201286 80 15. The method according to claim 14, wherein the double-stranded siRNA comprise an antisense strand comprising a nucleobase sequence that is at least 90% complementary to an equal length portion of a ANGPTL3 nucleic acid having the nucleobase 5 sequence of SEQ ID NO: 1, and a sense strand, or a pharmaceutically acceptable salt thereof.

16. The method according to claim 14, wherein the double-stranded siRNA comprise an antisense strand comprising a nucleobase sequence that is at 100% complementary to10an equal length portion of a ANGPTL3 nucleic acid having the nucleobase sequence of SEQ ID NO: 1, and a sense strand, or a pharmaceutically acceptable salt thereof.

17. The method according to claim 14, wherein the double-stranded siRNA is an ANGPTL3 siRNA agent comprising (i) a first (sense) strand having the sequence: 15 NAG-invAb (ps) mG mC mU mC mA mA mC mA fU fA fU mU mU mG mA mU mC mA mG mU mA (ps) invAb (SEQ ID NO: 10), and (ii) a second (antisense) strand having the sequence: 20 mU (ps) fA (ps) mC (ps) fU mG fA mU fC mA fA mA fU mA fU mG fU mU fG mA fG (ps) mC (SEQ ID NO: 3), where NAG is a triantennary ligand moiety linked to the 5’ end of the first strand and25having the structure:201286 81;18. The method according to claim 14, wherein the double-stranded siRNA is an 5 ANGPTL3 siRNA agent comprising (i) a first (sense) strand having the sequence: NAG-invAb (ps) mG mC mU mC mA mA mC mA fU fA fU mU mU mG mA mU mC mA mG mU mA (ps) invAb (SEQ ID NO: 10),10and (ii) a second (antisense) strand having the sequence:201286 82 mU (ps) fA (ps) mC (ps) fU mG fA mU fC mA fA mA fU mA fU mG fU mU fG mA fG (ps) mC (SEQ ID NO: 3), where NAG is a triantennary ligand moiety linked to the 5’ end of the first strand and 5 having the structure:;10