Ceramide, and preparation method therefor and use thereof

CA3320523A1Pending Publication Date: 2026-09-21SHENZHEN DIKEMAN BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CA3320523
Authority / Receiving Office
CA · CA
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-07
Filing Date
2024-12-02
Publication Date
2026-09-21

AI Technical Summary

Technical Problem

The prior art is difficult to produce functional ceramides with similar structures to those in the skin on a large scale, and the traditional synthesis process is complex and expensive, which cannot meet market demand.

Method used

The ceramide with the structure of Formula I is synthesized by one pot method using cheap and easy-to-get 10-hydroxysanolic acid and acid chloride compounds as raw materials, simplifying the synthesis route, avoiding the use of expensive reagents, and suitable for industrial production.

Benefits of technology

Synthetic ceramides are significantly better than existing ceramides in tissue repair, moisturizing, antioxidant, anti-photoaging, soothe and anti-allergicity, and improve skin elasticity and toughness. The synthesis route is simple and low-cost.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention belongs to the technical field of biomedicine. Disclosed is a ceramide, which has a structure as shown in formula (I), wherein m=1-4, and n=4-10. Further disclosed in the present invention are a method for preparing the ceramide and the use thereof. According to the present invention, naturally derived and easily available 10-hydroxycarboxylic acid is used as a starting raw material to construct the ceramide with a new structure. The synthetic route is simple and convenient, and is suitable for scaled-up production. The obtained ceramide exhibits more excellent effects in tissue repair and moisturizing than existing ceramide, demonstrates unique efficacy not found in other ceramides in terms of anti-oxidation, anti-photoaging, soothing and anti-allergy, and improving skin elasticity and toughness, and can be used in the fields of health care products, cosmetics and drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Ceramide, preparation method and application thereof Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to ceramide and a preparation method and application thereof. Background Art

[0002] Ceramide (also known as molecular nail) is naturally present in the skin and is a crucial component of the skin barrier (stratum corneum), with a content of up to 40-50% by weight. Chemically, ceramide is a sphingolipid composed of a long-chain sphingosine base and fatty acids. The carbon chain length, degree of unsaturation, and number of hydroxyl groups in the sphingosine and fatty acid moieties can vary, so ceramide molecules are not unique; they refer to a class of compounds.

[0003] Ceramides are particularly widespread in the skin. Currently, there are nine known natural ceramides, and different types of ceramides are used in skincare products. Ceramides exhibit excellent properties in regulating skin barrier function, restoring skin moisture, and enhancing adhesion between keratinocytes.

[0004] A reduction in the amount of ceramides will lead to dryness of the skin, loss of the skin's surface defense function, making it easier for foreign substances to invade and cause secondary infection of the skin, thereby causing skin rejection. Specifically, invaders cause the release of cytokines from surface cells such as keratinocytes, Langerhans cells, and melanocytes, causing inflammatory phenomena, etc. Therefore, in order to maintain and improve the skin barrier, moisturizing the skin is important, and compared with ordinary moisturizers, physiological lipid mixtures containing ceramide compounds can promote the recovery of damaged skin barrier function. Clinical trial results show that it has similar effects to moderate and above topical steroid preparations in improving symptoms in patients with atopic dermatitis.

[0005] Due to the importance of ceramides, many cosmetics and pharmaceutical companies are researching and developing corresponding products. However, large-scale production of natural ceramides is difficult due to factors such as the difficulty of extraction and high cost, making them unsuitable for commercialization. Some companies are working to develop ceramides with structures similar to those found in the skin and that can provide the same functional effects.

[0006] Therefore, considering the widespread demand for functional ceramides in the market, it is very necessary to quickly synthesize ceramides using naturally derived and readily available short-chain fragments to solve the problem of insufficient supply and enhance their efficacy. Summary of the Invention

[0007] The purpose of the present invention is to provide a ceramide with a novel structure.

[0008] Another object of the present invention is to provide a method for synthesizing ceramide, which utilizes inexpensive and readily available acyl chloride compounds and 10-hydroxydecanoic acid as raw materials to obtain the target ceramide through a one-pot process. Compared with traditional synthesis processes, the new process has a simpler synthesis route, avoids the use of expensive reagents, and is suitable for industrial production.

[0009] Another object of the present invention is to provide uses of ceramide.

[0010] In order to achieve one of the above purposes, the present invention adopts the following technical solutions:

[0011] A ceramide having the structure of Formula I:

[0012] M=1~4, n=4~10.

[0013] Furthermore, m is 1 or 4, and n is 4, 7, 8 or 10.

[0014] Furthermore, ceramide is one of the following structures:

[0015] The synthesis method of ceramide comprises the following steps:

[0016] Compound A, 10-hydroxydecanoic acid and sphingosine react to obtain ceramide.

[0017] Furthermore, the molar ratio of compound A, 10-hydroxydecanoic acid, and sphingosine is 1:(1-3):(0.5-1.2).

[0018] Furthermore, the reaction solvent is DCM.

[0019] Furthermore, pyridine is added into the reaction, and the molar ratio of pyridine to compound A is (3-5):1.

[0020] Furthermore, pivaloyl chloride is added into the reaction, and the molar ratio of pivaloyl chloride to compound A is (1-2):1.

[0021] Furthermore, DMAP was added into the reaction, and the molar ratio of DMAP to compound A was (1-2):1.

[0022] Ceramide can be used in cosmetics, health products or pharmaceuticals.

[0023] First, ceramide has a tissue repair effect. When the concentration of ceramide is 3.90625 mg / L, the cell viability is above 133.03%, when the concentration of ceramide is 7.8125 mg / L, the cell viability is above 131.75%, when the concentration of ceramide is 15.625 mg / L, the cell viability is above 128.87%, when the concentration of ceramide is 31.25 mg / L, the cell viability is above 130.02%, when the concentration of ceramide is 62.5 mg / L, the cell viability is above 120.44%, when the concentration of ceramide is 125 mg / L, the cell viability is above 114.78%, and when the concentration of ceramide is 250 mg / L, the cell viability is above 110.16%.

[0024] Secondly, ceramide has a moisturizing effect. The principle is that it increases the expression of AQP3 water channel protein. When the concentration of ceramide is 0.4mmol / L, the expression of AQP3 water channel protein is more than 147% compared with the negative control group. When the concentration of ceramide is 0.8mmol / L, the expression of AQP3 water channel protein is more than 179% compared with the negative control group. When the concentration of ceramide is 1.6mmol / L, the expression of AQP3 water channel protein is more than 202% compared with the negative control group.

[0025] Thirdly, ceramide has an antioxidant effect. When the concentration of ceramide is 31.25 mg / L, the CAT activity is more than 2.1 times that of the model group; when the concentration of ceramide is 62.5 mg / L, the CAT activity is more than 2.55 times that of the model group; when the concentration of ceramide is 125 mg / L, the CAT activity is more than 2.65 of the model group; when the concentration of ceramide is 250 mg / L, the CAT activity is more than 2.7 times that of the model group.

[0026] Fourthly, ceramide has anti-photoaging effects. For UVA, when the concentration of ceramide is 7.8125 mg / L, the expression level of MMP1 is less than 0.83 times that of the model group, when the concentration of ceramide is 15.625 mg / L, the expression level of MMP1 is less than 0.69 times that of the model group, and when the concentration of ceramide is 31.25 mg / L, the expression level of MMP1 is less than 0.66 times that of the model group; for UVB, when the concentration of ceramide is 7.8125 mg / L, the expression level of MMP1 is less than 0.77 times that of the model group, when the concentration of ceramide is 15.625 mg / L, the expression level of MMP1 is less than 0.71 times that of the model group, and when the concentration of ceramide is 31.25 mg / L, the expression level of MMP1 is less than 0.64 times that of the model group.

[0027] Fifthly, ceramide has a soothing and anti-allergic effect. When the concentration of ceramide is 62.5 mg / L, the TRPV1 factor level is less than 0.94 times that of the capsaicin model group. When the concentration of ceramide is 125 mg / L, the TRPV1 factor level is less than 0.78 times that of the capsaicin model group. When the concentration of ceramide is 250 mg / L, the TRPV1 factor level is less than 0.34 times that of the capsaicin model group.

[0028] Sixth, ceramide has the effect of improving the elasticity and toughness of the skin. When the concentration of ceramide is 15.625 mg / L, the relative expression of Col-1 is more than 115% of that of the blank control group. When the concentration of ceramide is 31.25 mg / L, the relative expression of Col-1 is more than 124% of that of the blank control group. When the concentration of ceramide is 62.5 mg / L, the relative expression of Col-1 is more than 137% of that of the blank control group.

[0029] A composition comprises ceramide, its isomers, its pharmaceutically acceptable salts, its hydrates or solvates as an active ingredient, and has tissue repair and moisturizing effects.

[0030] As used herein, the compound of "the structure of formula I" has two chiral centers and thus includes chiral compounds of the structure, i.e., enantiomers and diastereomers, such as linolenic acid EOS including

[0031] As used herein, "pharmaceutically acceptable salt" means a salt of one aspect of the present invention that is pharmaceutically acceptable and has the desired pharmacological activity of the parent compound. Such salts include: (1) acid addition salts formed with inorganic acids or organic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, and organic acids such as acetic acid, propionic acid, hexanoic acid, cyclopentylpropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, hydroxysuccinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1, 2-ethanedisulfonic acid, 2-hydroxyethylsulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2,2,2]-oct-2-ene-1-carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, tert-butylacetic acid, dodecylsulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid and muconic acid; or (2) salts formed when the acidic proton present in the parent compound is substituted.

[0032] As used herein, "hydrate" refers to a compound that is bound to water. The binding between the compound and water includes non-covalent binding.

[0033] As used herein, "solvate" means a complex formed by solute molecules or ions and solvent molecules or ions.

[0034] The "isomer" used herein means that the compound of the present invention or a salt thereof has the same chemical formula or molecular formula but different optical properties or steric properties, including enantiomers and diastereomers.

[0035] Unless otherwise indicated, the term "compound of the present invention" or "ceramide" includes the compound itself, its pharmaceutically acceptable salts, its hydrates, its solvates, and its isomers.

[0036] The present invention has the following beneficial effects:

[0037] 1. The ceramide of the present invention has a novel structure. Through experiments, the present invention unexpectedly discovered that it is significantly superior to existing ceramides in terms of tissue repair (promoting cell proliferation) and moisturizing effects, both of which are more than 30% higher, with unexpected technical effects. Moreover, in terms of anti-oxidation, anti-photoaging, soothing and anti-allergic effects, and improving skin elasticity and toughness, the EOS-type ceramide of the present invention exhibits unique effects not possessed by other ceramides.

[0038] 2. The synthetic route of the present invention is simple, and the product can be obtained in one step, avoiding the use of expensive reagents and lengthy chemical production processes. Compared with the existing technology, the process is greatly simplified and suitable for industrial scale-up production.

[0039] 3. The present invention uses 10-hydroxycarboxylic acid, acyl chloride compounds and the like which are of natural origin, commercially available and inexpensive as starting materials, thereby reducing production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figures 1 and 2 are bar graphs of the cell proliferation activity test results in Example 2;

[0041] Figures 3 and 4 are bar graphs of the moisturizing efficacy test results of Example 3;

[0042] FIG5 is a bar graph of the antioxidant test results of Example 4;

[0043] Figures 6 and 7 are bar graphs of the anti-light aging test results of Example 5;

[0044] FIG8 is a bar graph showing the soothing and anti-allergic efficacy test results of Example 6;

[0045] FIG9 is a bar graph showing the collagen activity detection results in Example 7. DETAILED DESCRIPTION

[0046] The present invention will be further described below with reference to specific embodiments.

[0047] All reactions were carried out under a nitrogen atmosphere. Unless otherwise stated, chemicals were purchased from commercial products and were not further purified. Dichloromethane, pyridine, and N,N-dimethylformamide used in the experiments were all anhydrous solvents. Thin layer chromatography (TLC) used 60F254 silica gel plates. Silica gel column chromatography used Qingdao Marine silica gel (particle size 0.040-0.063 mm). TLC color development used UV light (254 nm) or iodine. NMR spectra were characterized using a Bruker DPX 400 nuclear magnetic resonance instrument. 1 H NMR was measured at 400 MHz, with deuterated chloroform as the solvent and tetramethylsilane (TMS) as the internal standard. The units of chemical shifts are ppm, and the units of coupling constants are Hz. 1 In HNMR, δ represents chemical shift, s represents singlet, d represents doublet, t represents triplet, q represents quartet, and m represents multiplet. DCM refers to dichloromethane, PivCl refers to pivaloyl chloride, DMAP refers to 4-dimethylaminopyridine, and Py. refers to pyridine.

[0048] Example 1

[0049] Synthesis of ceramide

[0050] Dissolve 1.5 eq (150 mmol) of 10-hydroxydecanoic acid and 4.0 eq (400 mmol) of pyridine in 150 mL of DCM, cool in an ice bath, and slowly add dropwise 1.0 eq (100 mmol) of linoleoyl chloride (previously dissolved in 50 mL of DCM). After the addition is complete, continue the reaction in an ice bath until the reaction of the raw materials is complete as detected by TLC.

[0051] 1.5 eq (150 mmol) of pivaloyl chloride was added to the above reaction solution, and the reaction was continued under ice bath for 4 h. 1.5 eq (150 mmol) of DMAP and 0.8 eq (80 mmol) of sphingosine were added to the above reaction solution, and the reaction was heated to room temperature and stirred until TLC detection showed that the reaction of the sphingosine raw material was complete.

[0052] Post-treatment: Wash twice with 150 mL of water and once with 150 mL of saturated NaCl. Add anhydrous Na2SO4 to dry the organic phase, filter, and concentrate in vacuo. The residue obtained is recrystallized to obtain the ceramide product linoleic acid EOS (yield 60%).

[0053] 1H NMR(400MHz,Chloroform-d)δ6.47(d,J=7.6Hz,1H),5.76(dt,J=14.2,6.7Hz,1H),5.51(dd, J=15.4,6.3Hz,1H),5.35(qt,J=11.5,5.9Hz,4H),4.26(t,J=4.9Hz,1H),4.05(t,J=6.8Hz,2 H),3.96–3.59(m,5H),2.77(t,J=6.4Hz,2H),2.29(t,J=7.5Hz,2H),2.21(t,J=7.6Hz,2H),2 .05(q,J=6.8Hz,6H),1.61(p,J=6.6Hz,6H),1.42–1.12(m,50H),0.88(td,J=6.7,3.9Hz,6H).

[0054] Referring to the above steps, the amounts of linoleoyl chloride, 10-hydroxydecanoic acid, and sphingosine were adjusted to 100 mmol, 220 mmol, and 100 mmol, respectively, while other conditions remained unchanged, resulting in a yield of 63%.

[0055] Referring to the above steps, the amounts of linoleoyl chloride, 10-hydroxydecanoic acid, and sphingosine were adjusted to 100 mmol, 130 mmol, and 60 mmol, respectively, while other conditions remained unchanged, and the yield was 55%.

[0056] Referring to the above steps, the amount of pyridine was adjusted to 500 mmol, and other conditions remained unchanged, and the yield was 60%.

[0057] Referring to the above steps, the amount of pivaloyl chloride was adjusted to 110 mmol, the amount of DMAP was adjusted to 120 mmol, and other conditions remained unchanged, and the yield was 56%.

[0058] Referring to the above steps, the amount of pivaloyl chloride was adjusted to 180 mmol, the amount of DMAP was adjusted to 180 mmol, and other conditions remained unchanged. The yield was 62%.

[0059] Referring to the above steps, linoleoyl chloride was replaced with erucyl chloride to obtain erucic acid EOS (yield 61%).

[0060] 1H NMR(400MHz,Chloroform-d)δ6.50(d,J=7.8Hz,1H),5.70(dt,J=15.4,6.8Hz,1H),5.51(ddt,J=15.4,7.4,1.4Hz ,1H),5.36(t,J=4.9Hz,2H),4.20(t,J=7.4Hz,1H),4.12(ddd,J=7.4,5.5,4.1Hz,1H),4.07(t,J=6.8Hz,2H),3.8 6(dd,J=11.3,5.5Hz,1H),3.79(dd,J=11.3,4.2Hz,1H),2.30(t,J=7.6Hz,2H),2.23(t,J=7.6Hz,2H),2.03(q,J= 6.4Hz, 4H), 1.99 (dq, J = 15.0, 7.6, 7.1Hz, 2H), 1.79–1.40 (m, 6H), 1.29 (d, J = 15.1Hz, 60H), 0.90 (t, J = 6.6Hz, 6H).

[0061] Referring to the above steps, linoleoyl chloride was replaced with ceramide chloride to obtain nervonic acid EOS (yield 66%).

[0062] 1 H NMR(400MHz,Chloroform-d)δ6.53(d,J=7.6Hz,1H),5.82(dt,J=15.4,6.8Hz,1H),5.63(m,1H) ,5.39(t,J=4.9Hz,2H),4.31(t,J=7.2Hz,1H),4.16(m,1H),3.96(t,J=6.8Hz,2H),3.74(dd,J=1 1.2,5.6Hz,1H),3.64(dd,J=11.2,4.4Hz,1H),2.43(t,J=7.6Hz,2H),2.28(t,J=7.6Hz,2H),2. 05(q,J=6.4Hz,4H),1.92(m,2H),1.65–1.44(m,6H),1.22–1.18(m,64H),0.88(t,J=6.6Hz,6H).

[0063] Referring to the above steps, linoleoyl chloride was replaced with linolenoyl chloride to obtain linolenic acid EOS (yield 59%).

[0064] 1H NMR(400MHz,Chloroform-d)δ6.63(d,J=7.6Hz,1H),δ5.42–5.22(m,6H),5.72(dt,J=15.2,6.8Hz,1H),5 .54(ddt,J=15.2,7.4,1.4Hz,1H),4.22(t,J=7.2Hz,1H),4.15(m,1H),4.07(t,J=6.8Hz,2H),3.81(dd,J= 11.2,5.5Hz,1H),3.73(dd,J=11.2,4.2Hz,1H),2.80(t,J=6.0Hz,4H),2.22(t,J=7.5Hz,4H),2.12–2.04( m,4H),1.96(m,2H),1.67–1.52(m,2H),1.33–1.25(m,44H),0.93(t,J=7.6Hz,3H),0.87(t,J=7.6Hz,3H).

[0065] Referring to the above steps, linoleoyl chloride was replaced with oleoyl chloride to obtain oleic acid EOS (yield 62%).

[0066] 1 H NMR(400MHz,Chloroform-d)δ6.61(d,J=7.8Hz,1H),5.74(dt,J=15.4,6.8Hz,1H),5.41(ddt,J=15.4,7.4 ,1.4Hz,1H),5.36(t,J=4.9Hz,2H),4.16(t,J=7.4Hz,1H),4.09(ddd,J=7.4,5.5,4.1Hz,1H),4.01(t,J=6. 8Hz,2H),3.77(dd,J=11.3,5.5Hz,1H),3.69(dd,J=11.3,4.2Hz,1H),2.38(t,J=7.6Hz,2H),2.27(t,J=7.6 Hz,2H),2.13(q,J=6.4Hz,4H),2.02(m,2H),1.71–1.45(m,6H),1.29–1.21(m,52H),0.86(t,J=6.6Hz,6H).

[0067] Referring to the above steps, linoleoyl chloride was replaced with pentadecanoyl chloride to obtain pentadecanoic acid EOS (yield 63%).

[0068] 1H NMR(400MHz,THF-d8)δ6.92(d,J=8.1Hz,1H),5.77(dt,J=15.4,6.8Hz,1H),5.47(m,1H) ,4.15(d,J=5.9Hz,1H),4.10(t,J=5.5Hz,1H),3.97–3.85(m,1H),3.75(d,J=6.3Hz,1H) ,3.61(dt,J=10.9,4.8Hz,1H),3.52(dt,J=10.8,5.4Hz,1H),2.14(t,J=7.4Hz,2H),2.0 3(t,J=7.4Hz,2H),2.01(m,2H),1.47(m,6H),1.24–1.18(m,54H),0.78(t,J=6.6Hz,6H).

[0069] Example 2

[0070] MTT assay to detect cell proliferation activity: Fibroblast L929 cells were cultured at a rate of 1×10 4 Cells were seeded at a density of 100 μL / well in a 96-well plate and incubated overnight in an incubator. After 24 hours, the supernatant was discarded and 100 μL of culture medium containing different concentrations of sample (linoleic acid EOS) or blank was added (three groups were set up in parallel for each concentration). After another 24 hours of incubation, the culture medium was removed and 100 μL of thiazolyl blue (MTT) was added to each well. The absorbance at 450 nm was measured and the cell survival rate was calculated as A. 给药孔 / A 空白孔 × 100%. Ceramide EOP was used as a control to test its effect on the proliferation activity of fibroblast L929 cells.

[0071] Table 1

[0072] Table 2

[0073] The results, as shown in Tables 1 and 2, and Figures 1 and 2, showed that cell viability reached 133.03% at a concentration of 3.90625 mg / L of EOS, 131.75% at 7.8125 mg / L, 128.87% at 15.625 mg / L, 130.02% at 31.25 mg / L, 120.44% at 62.5 mg / L, 114.78% at 125 mg / L, and 110.16% at 250 mg / L. These findings demonstrate a significant effect on promoting cell proliferation and potential for tissue repair. Furthermore, the EOS showed no cytotoxicity within a concentration range of up to 250 mg / L, demonstrating good biosafety.

[0074] Compared with EOS linoleic acid and EOP, at various concentrations in the experiment, the ceramide of the present invention has stronger cell proliferation activity on fibroblast L929 cells. At higher concentrations, the cell proliferation activity of EOS linoleic acid is more than 10% higher than that of EOP, and at lower concentrations, the cell proliferation activity of EOS linoleic acid is more than 30% higher than that of EOP.

[0075] Example 3

[0076] AQP3 cell assay to detect moisturizing efficacy

[0077] Aquaporin 3 (AQP3) is a transporter protein on cell membranes responsible for the transport of substances such as water, glycerol, and urea. It is primarily expressed in keratinocytes and skin fibroblasts. AQP3 not only participates in skin hydration and barrier function, but also plays a vital role in skin damage, repair, and healing, ensuring the maintenance of normal skin morphology and function.

[0078] HaCat cells were cultured at a density of 1×10 4 Cells were seeded in 96-well plates at 100 μg / well and allowed to adhere overnight in an incubator. After 24 hours, the supernatant was discarded and 100 μL of linolenic acid (EOS) diluted in DMEM medium at varying concentrations was added. A negative control group was treated with drug-free DMEM medium. Each group was plated in triplicate and incubated in an atmosphere of 5% CO₂ and 37°C. Two hours after drug administration, 10 μg / mL LPS was added to the lipopolysaccharide model group and the experimental group and incubated for 24 hours. After the reaction, 50 μL of the cell supernatant was collected and assayed for intracellular AQP3 gene expression using an AQP3 assay kit. Ceramide (EOP) was also used as a control to test its moisturizing properties.

[0079] Table 3

[0080] Table 4

[0081] The results, as shown in Tables 3 and 4, and Figures 3 and 4, show that the ceramide of the present invention effectively increased the expression of AQP3 aquaporin in a concentration-dependent manner. At concentrations of 0.4, 0.8, and 1.6 mmol / L, the expression levels were 1.47, 1.79, and 2.02 times that of the negative control group, respectively.

[0082] Compared with EOS linoleic acid, EOS linolenic acid and EOP, at various concentrations in the experiment, the ceramide of the present invention has better moisturizing effect, and EOS linoleic acid and EOS linolenic acid are more than 30% higher than EOP.

[0083] Although EOS ceramides and EOP are similar in structure, in terms of biological activity, the data from Examples 2 and 3 show that EOS ceramides are significantly more effective than EOP, which is an unexpected discovery of the present application.

[0084] Example 4

[0085] Antioxidant test

[0086] HFF-1 cells were cultured at a rate of 1×10 6 Cells were seeded at a density of 100 μL / well in a 6-well plate and incubated overnight in a 5% CO2, 37°C incubator. After 24 hours, the supernatant was discarded and 100 μL of culture medium containing varying concentrations of EOS was added. A blank control group consisted of drug-free DMEM. 24 hours after drug administration, the model group, positive control (50 mg / L VC), and experimental group were incubated with 8 mM / L H2O2 for 2 hours, with three replicates per group. After a 4-hour incubation, total protein was extracted, the cells were lysed, and the supernatant was collected. Protein concentration was measured using a BCA protein concentration assay kit, and CAT (catalase) activity was tested. Antioxidant enzymes such as CAT can scavenge free radicals and reactive oxygen species produced by the body. With aging, antioxidant enzyme activity decreases, leading to an excess of free radicals and reactive oxygen species, which can cause the body to gradually age.

[0087] The results are shown in Figure 5. The relative CAT activity of the blank control group was set to 1, the CAT activity of the model group was 0.20, and the activity of the positive control group was 0.74. When the concentration of EOS erucic acid was 31.25 mg / L, the CAT activity was 0.42, when it was 62.5 mg / L, the CAT activity was 0.51, when it was 125 mg / L, the CAT activity was 0.53, and when it was 250 mg / L, the CAT activity was 0.54. When the concentrations of ceramide were 31.25 mg / L, 62.5 mg / L, 125 mg / L, and 250 mg / L, the CAT activity was 2.1, 2.55, 2.65, and 2.7 times that of the model group, respectively. The results show that EOS erucic acid can increase CAT expression, thereby inhibiting the overexpression of intracellular free radicals. The higher the concentration of EOS erucic acid, the more significant the increase in CAT activity and the more obvious the inhibition of overexpressed free radicals in cells.

[0088] Example 5

[0089] Light aging test

[0090] MMP1, also known as interstitial collagenase or matrix metalloproteinase, belongs to the matrix metalloproteinase family. Its primary substrate is fibrillar collagen, degrading collagen fibers and gelatin within the extracellular matrix and altering the cellular microenvironment. MMP1 plays a crucial role in elastin production. Inhibiting MMP1 can enhance collagen and elastin synthesis in fibroblasts, while reducing MMP activity can increase the rate of collagen synthesis.

[0091] HFF-1 cells were cultured at 1×10 5 Cells were seeded at a density of 100 μL / well in a 96-well plate and incubated overnight in an incubator. After 24 hours, the supernatant was discarded and 100 μL of culture medium containing different concentrations of EOS (no drug was added to the model group). The negative control group was a drug-free DMEM culture medium. Each group had 3 replicates. After incubation for 2 hours in a 5% CO2, 37°C environment, UVA or UVB ultraviolet rays were irradiated. The distance between the ultraviolet radiation source and the cells was 15 cm, and the UVA or UVB intensity was 200 mJ / cm 2 The irradiation time was 1.0 h. After the irradiation, the cells were incubated in the incubator for 24 h. The expression of MMP-1 gene in the cells was detected using an MMP-1 ELISA kit.

[0092] The results of UVA-induced inhibition of MMP-1 overexpression are shown in Figure 6. The MMP1 expression level in the negative control group was set to 1, while that in the model group was 2.03. At a concentration of 7.8125 mg / L, the expression level of MMP1 was 1.68. At a concentration of 15.625 mg / L, the expression level of MMP1 was 1.41. At a concentration of 31.25 mg / L, the expression level of MMP1 was 1.34. The higher the concentration, the more significant the inhibitory effect on MMP1. At concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the expression levels of MMP1 were 0.83, 0.69, and 0.66 times that of the model group.

[0093] The results of UVB-induced inhibition of MMP-1 overexpression are shown in Figure 7. The MMP1 expression level in the negative control group was set to 1, while the expression level in the model group was 2.46. At a concentration of 7.8125 mg / L EOS, the expression level of MMP1 was 1.90, 1.74 at 15.625 mg / L, and 1.58 at 31.25 mg / L. The higher the concentration, the more significant the inhibitory effect on MMP1. At 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L EOS, the expression levels of MMP1 were 0.77, 0.71, and 0.64 times that of the model group, respectively.

[0094] After UV radiation, keratinocytes promote increased expression of MMP-1 in fibroblasts, leading to degradation of the skin's extracellular matrix and collagen, resulting in photoaging. These results suggest that EOS can inhibit UV-induced MMP-1 production in fibroblasts, potentially playing a role in preventing photoaging. Compared to the model group, EOS significantly inhibited UV-induced MMP-1 overexpression, demonstrating a clear dose-dependent effect.

[0095] Example 6

[0096] TRPV1 inhibition assay to detect soothing and anti-allergic effects

[0097] HaCaT cells were cultured at a density of 1×10 4 Cells were seeded in 96-well plates and placed in an incubator overnight to adhere. After 24 hours, the supernatant was discarded and 100 μL of sample (oleic acid EOS) diluted in DMEM medium at varying concentrations was added. The negative control group consisted of DMEM medium without sample, and the positive control group was treated with 0.4% trans-tetra-tert-butylcyclohexanol. Three replicates were added to each group and incubated in a 5 wt % CO 2 , 37°C environment. Two hours after administration, 50 μmol / L capsaicin was added to the experimental group and incubated for 24 hours. After the reaction, cellular RNA was extracted, reverse transcribed, and TRPV1 mRNA levels were measured using a fluorescence quantitative PCR instrument. Data were processed and analyzed using the 2^-ΔCp method.

[0098] The results are shown in Figure 8. Under stimulation with capsaicin at a working concentration of 50 μmol / L, TRPV1 levels were 5.61 times higher than basal levels. The TRPV1 factor level in the positive control group (0.4% trans-tetra-tert-butylcyclohexanol) was 1.95 times higher than that in the capsaicin model group, demonstrating the reliability of the method. Under the action of EOS oleate at concentrations of 62.5 mg / L, 125 mg / L, and 250 mg / L, TRPV1 factor levels were significantly reduced, reaching 0.94, 0.78, and 0.34 times that of the capsaicin model group, respectively. TRPV1, a member of the transient receptor potential (TRP) superfamily, is the switch for burning and stinging skin and is closely related to the occurrence of skin sensitivity and stinging. It can achieve soothing and anti-allergic effects by inhibiting the overexpression of TRPV1 receptors in sensitive skin, helping the skin build tolerance. Compared to the model group, co-incubation of cells with EOS oleate significantly reduced TRPV1 expression, with a clear dose-dependent effect. This demonstrates that EOS oleate has a good soothing effect and can soothe sensitive skin.

[0099] Example 7

[0100] Collagen Col-1 activity detection

[0101] HFF-1 cells were cultured at a rate of 1×10 6 Cells were seeded at a density of 100 μL / well in a 6-well plate and incubated overnight in a 5% CO2, 37°C incubator. After 24 hours, the supernatant was discarded and 100 μL of culture medium containing varying concentrations of EOS pentadecanoate was added. The blank control group consisted of drug-free DMEM medium, and the positive control was 15 mg of EGCG. Twenty-four hours after administration, total RNA was extracted from three replicate wells in each group, reverse transcribed into cDNA, and quantified by fluorescence quantitative PCR.

[0102] Primer sequences:

[0103] Col1a1-F:CGATGGATTCCCGTTCGAGT

[0104] Col1a1-R:GAGGCCTCGGTGGACATTAG

[0105] The results are shown in Figure 9. The relative mRNA expression of Col-1 in the blank control group was set to 1, while the expression in the positive control group was 1.86. The relative expression of Col-1 at 15.625 mg / L of EOS pentadecanoate was 1.15, 1.24 at 31.25 mg / L, and 1.37 at 62.5 mg / L. At concentrations of 15.625 mg / L, 31.25 mg / L, and 62.5 mg / L, the relative expression of Col-1 was 115%, 124%, and 137% of that in the blank control group. The content of collagen Col-1 is closely related to the elasticity and toughness of the skin. EOS pentadecanoate can increase Col-1 expression and improve the elasticity and toughness of the skin in a dose-dependent manner. The higher the concentration of EOS pentadecanoate, the more significant the increase in Col-1 content, and the more obvious the improvement in skin elasticity and toughness.

[0106] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by a person skilled in the art within the technical scope disclosed in the present invention should be included in the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be based on the scope of protection of the claims.

Claims

1. A ceramide having a structure of Formula I or an enantiomer or diastereomer thereof: m=1~4, n=4~10.

2. The ceramide according to claim 1, characterized in that m is 1 or 4, and n is 4, 7, 8 or 10.

3. The ceramide according to claim 2, characterized in that It is one of the following structures:

4. The method for synthesizing ceramide according to any one of claims 1 to 3, comprising the following steps: Compound A, 10-hydroxydecanoic acid and sphingosine react to obtain ceramide.

5. The synthesis method according to claim 4, characterized in that The molar ratio of the compound A, 10-hydroxydecanoic acid and sphingosine is 1: (1-3): (0.5-1.2).

6. Use of the ceramide according to any one of claims 1 to 3 in cosmetics, health products or medicines.

7. The use according to claim 6, characterized in that The ceramide has at least one of the following effects: tissue repair, moisturizing, anti-oxidation, anti-photoaging, soothing and anti-allergic, and improving skin elasticity and toughness.

8. The use according to claim 7, characterized in that The ceramide has a tissue repair effect; when the ceramide is at a concentration of 3.90625 mg / L, the cell viability is above 133.03%; when the ceramide is at a concentration of 7.8125 mg / L, the cell viability is above 131.75%; when the ceramide is at a concentration of 15.625 mg / L, the cell viability is above 128.87%; when the ceramide is at a concentration of 31.25 mg / L, the cell viability is above 130.02%; and when the ceramide is at a concentration of 62.5 mg / L, the cell viability is above 120.44%.

9. The use according to claim 7, characterized in that The ceramide has a moisturizing effect; when the ceramide is at a concentration of 0.4 mmol / L, the expression level of AQP3 water channel protein is more than 147% compared with the negative control group; when the ceramide is at a concentration of 0.8 mmol / L, the expression level of AQP3 water channel protein is more than 179% compared with the negative control group; when the ceramide is at a concentration of 1.6 mmol / L, the expression level of AQP3 water channel protein is more than 202% compared with the negative control group.

10. The use according to claim 7, characterized in that The ceramide has an antioxidant effect; when the ceramide is at a concentration of 31.25 mg / L, the CAT activity is more than 2.1 times that of the model group; when the ceramide is at a concentration of 62.5 mg / L, the CAT activity is more than 2.55 times that of the model group; when the ceramide is at a concentration of 125 mg / L, the CAT activity is more than 2.65 of the model group; and when the ceramide is at a concentration of 250 mg / L, the CAT activity is more than 2.7 times that of the model group.

11. The use according to claim 7, characterized in that The ceramide has an anti-photoaging effect; for UVA, when the ceramide concentration is 7.8125 mg / L, the expression amount of MMP1 is less than 0.83 times that of the model group, when the ceramide concentration is 15.625 mg / L, the expression amount of MMP1 is less than 0.69 times that of the model group, and when the ceramide concentration is 31.25 mg / L, the expression amount of MMP1 is less than 0.66 times that of the model group; for UVB, when the ceramide concentration is 7.8125 mg / L, the expression amount of MMP1 is less than 0.77 times that of the model group, when the ceramide concentration is 15.625 mg / L, the expression amount of MMP1 is less than 0.71 times that of the model group, and when the ceramide concentration is 31.25 mg / L, the expression amount of MMP1 is less than 0.64 times that of the model group.

12. The use according to claim 7, characterized in that The ceramide has a soothing and anti-allergic effect; when the ceramide concentration is 62.5 mg / L, the TRPV1 factor level is less than 0.94 times that of the capsaicin model group; when the ceramide concentration is 125 mg / L, the TRPV1 factor level is less than 0.78 times that of the capsaicin model group; when the ceramide concentration is 250 mg / L, the TRPV1 factor level is less than 0.34 times that of the capsaicin model group.

13. The use according to claim 7, characterized in that The ceramide has the effect of improving the elasticity and toughness of the skin; when the ceramide is at a concentration of 15.625 mg / L, the relative expression amount of Col-1 is more than 115% of that of the blank control group; when the ceramide is at a concentration of 31.25 mg / L, the relative expression amount of Col-1 is more than 124% of that of the blank control group; when the ceramide is at a concentration of 62.5 mg / L, the relative expression amount of Col-1 is more than 137% of that of the blank control group. 14 . A composition comprising the ceramide according to claim 1 , its isomer, its pharmaceutically acceptable salt, its hydrate or its solvate as an active ingredient.