Methods and compositions for treating metabolic disorders
Patent Information
- Application Number
- CA3320545
- Authority / Receiving Office
- CA · CA
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-01
- Filing Date
- 2025-02-27
- Publication Date
- 2025-09-04
AI Technical Summary
The molecular identities of enzymes mediating the metabolism of taurine to taurine-containing metabolites, such as N-acetyltaurine, are not well established, limiting the understanding and modulation of metabolic pathways related to taurine metabolism, which is crucial for treating metabolic disorders.
Modulating N-acetyltaurine metabolism by administering N-acetyltaurine or its derivatives, salts, or prodrugs, and/or PTER modulating agents, such as inhibitors or silencing agents, to increase N-acetyltaurine levels and affect metabolic processes.
This approach effectively reduces food intake, body weight, and adipose tissue mass, providing therapeutic benefits for metabolic disorders like obesity and diabetes by altering N-acetyltaurine levels.
Abstract
Description
[0001] METHODS AND COMPOSITIONS FOR TREATING METABOLIC DISORDERS
[0002] GOVERNMENT RIGHTS
[0003] This invention was made with Government support under contracts DK124265 and DK136526 awarded by the National Institutes of Health. The Government has certain rights in the invention. EFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0004] The contents of the electronic sequence listing (STAN-2170WO_SEQ_LIST.xml; Size: 7,087 bytes; and Date of Creation: February 27, 2025) is herein incorporated by reference in its entirety.
[0005] CROSS-REFERENCE TO RELATED APPLICATION
[0006] Pursuant to 35 U.S.C. § 1 19 (e), this application claims priority to the filing date of U.S. Provisional Patent Application No. 63 / 560,294, filed March 1 , 2024, which application is incorporated herein by reference in its entirety.
[0007] INTRODUCTION
[0008] Taurine is a conditionally essential micronutrient and very abundant amino sulfonic acid that is found in mammalian tissues and many foods29. Levels of taurine are especially high in excitable tissues such as the heart, eyes, brain, and muscles5. Taurine has been described to have pleiotropic cellular and physiologic functions, particularly in the context of mitochondrial function and whole-body metabolism9-11. Genetic reduction of tissue taurine levels leads to muscle atrophy12 13, decreased exercise capacity14, and mitochondrial dysfunction in multiple tissues12 15. Conversely, taurine supplementation has been reported to reduce mitochondrial redox stress9, enhance exercise performance16and suppress body weight17.
[0009] The biochemistry and enzymology of taurine metabolism has attracted considerable research interest. In the endogenous taurine biosynthesis pathway, cysteine is metabolized via CDO and CSAD to generate hypotaurine18 19, which is subsequently oxidized by FMO1 to produce taurine20. In addition, cysteine can undergo an alternative pathway via cysteamine and ADO21. Downstream of taurine itself are several taurine- containing derivatives that include taurocholate, taurocyamine, taurocyamine phosphate, and N-acetyltaurine4. The only enzyme known to catalyze one of these downstream pathways is BAAT, which conjugates taurine to bile acyl-CoAs to produce taurocholate and other bile salts22. Beyond BAAT as the sole example, the molecular identities of the additional enzymes that mediate the metabolism of taurine to taurine-containing metabolites have not yet been established.
[0010] The biochemical interconversion of taurine and N-acetyltaurine is of particular interest for several reasons. First, N-acetyltaurine is an abundant endogenous metabolite whose levels are dynamically regulated by diverse physiologic perturbations that increase taurine and / or acetate flux, including endurance exercise7 17, alcohol consumption623, and nutritional taurine supplementation17. Second, N-acetyltaurine exhibits chemical structural similarities with signaling molecules including the neurotransmitter acetylcholine24and the glucoregulatory long-chain N-fatty acyl taurines25. Third, a taurine N-acetyltransferase biochemical activity has been detected in cells6 7, demonstrating that the production of N-acetyltaurine is not simply a byproduct of taurine metabolism, but rather an enzymatically regulated biochemical transformation.
[0011] SUMMARY
[0012] Provided are methods of treating metabolic disorders. Aspects of the methods include modulating N-acetyltaurine metabolism in a subject, e.g., by administering to the subject an effective amount of N-acetyltaurine (or a derivative, salt or prodrug thereof) and / or a PTER modulating agent. Also provided are pharmaceutical compositions. In some embodiments, the pharmaceutical composition comprises N-acetyltaurine (or a derivative, salt or prodrug thereof). In some embodiments, the pharmaceutical composition comprises a PTER modulating agent. In some embodiments, the pharmaceutical composition comprises both N-acetyltaurine (or a derivative, salt or prodrug thereof) and a PTER modulating agent. BRIEF DESCRIPTION OF THE FIGURES
[0013] FIGS. 1A-1O: Activity-guided biochemical fractionation and proteomics identifies PTER as a taurine N-acetyltransferase / hydrolase. (FIG. 1A) Chemical structures of taurine and N-acetyltaurine. (FIGS. 1 B-1 D) Rate of N-acetyltaurine synthesis (FIGS. 1 B, 1 C) or hydrolysis (FIG. 1 D) activity by the indicated mouse whole tissue homogenate. Tissues were collected from 10 to 14-week-old male C57BL / 6J mice (N=3 / tissue). Reactions were conducted using 100 pg tissue homogenates at 37 °C for 1 hr with 10 mM acetate and 10 mM taurine (FIG. 1 B), 10 mM acetyl-CoA and 10 mM taurine (FIG. 1 C), or 100 pM N-acetyltaurine (FIG. 1 D). (FIGS. 1 E, 1 F) Relative N-acetyltaurine synthesis (traces labeled “production”), hydrolysis (traces labeled “hydrolysis”), and protein concentrations (traces labeled “protein”) by the indicated fraction following anion exchange chromatography (FIG. 1 E) or size exclusion chromatography (FIG. 1 F). (FIG. 1G) Byonic P-values of proteins identified in fraction 20 following size exclusion chromatography. (FIGS. 1H, 11) Anti-PTER immunoreactivity in each of the fractions isolated following anion exchange (FIG. 1 H) or size exclusion (FIG. 1 1) chromatography. (FIG. 1J) Western blot using an anti-Flag (top) or anti- -actin (bottom) antibody of HEK293T cells lysates transfected with indicated plasmids. (FIGS. 1 K-1 N) Rate of N- acetyltaurine synthesis (FIGS. 1 K, 1 M) or hydrolysis (FIGS. 1 L, 1 N) activity from HEK293T cell lysates after transfection with the indicated plasmids (FIGS. 1 K, 1 L) or from control and PTER-KO cell lysates (FIGS. 1 M, 1 N). Reactions were conducted with 100 pg cell lysates at 37 °C for 1 hr with 10 mM acetate and 10 mM taurine (FIGS. 1 K, 1 M) or 100 pM N-acetyltaurine (FIGS. 1 L, 1 N). N=3 / group. In (FIG. 1 M), a Western blot using an anti-PTER (top) or anti-|3-actin (bottom) antibody is also shown. (FIG. 10) Schematic of revised taurine metabolic pathway showing the role of PTER as a bidirectional taurine N- acetyltransferase / hydrolase. For (FIGS. 1 B-1 D) and (FIGS. 1 K-1 N), data are shown as mean ± SEM. In (FIG. 1 C), P-value were calculated by Student’s t-test. In (FIGS. 1 K-1 N), P-values were calculated from two-tailed unpaired t-tests. All experiments were repeated twice and similar results were obtained.
[0014] FIGS. 2A-2J: Enzymological characteristics and mutagenesis studies of recombinant mouse PTER in vitro. (FIG. 2A) Time-dependent formation of N- acetyltaurine following incubation of purified recombinant mPTER (100 ng) with 10 mM acetate and 10 mM taurine at 37°C. N=3 / group. (FIGS. 2B-2D) Rate of N-acetyltaurine production (FIGS. 2B, 2C) or hydrolysis (FIG. 2D) following incubation of purified recombinant mPTER with the indicated concentration of acetate and 10 mM taurine (FIG. 2B), the indicated concentration of taurine and 10 mM acetate (FIG. 2C), or the indicated concentration of N-acetyltaurine (FIG. 2D) at 37°C for 1 hr. N=3 / group. (FIGS. 2E-2G) Rate of synthesis (FIGS. 2E, 2F) or hydrolysis (FIG. 2G) following incubation of purified recombinant mPTER (100 ng) with 10 mM acetate and 10 mM of indicated amino acid head group (FIG. 2E), 100 mM taurine and 10 or 1 mM of indicated acid (FIG. 2F) or 100 pM of the indicated substrate (FIG. 2G) at 37°C for 1 hr. For (FIG. 2F), long chain fatty acids were used at 1 mM and the other acids were used at 10 mM. N=3 / group. (FIG. 2H) Molecular docking of mPTER and N-acetyltaurine. Individual amino acid residues, two zinc ions and one water molecule were highlighted. (FIGS. 21, 2J) Rate of N-acetyltaurine synthesis (FIG. 2I) or hydrolysis (FIG. 2J) for total BL21 bacterial lysates overexpressing the indicated mPTER mutant and Western blot using an anti-6xHIS antibody (FIG. 2I, bottom) of total bacterial lysates following induction of protein expression. Reactions were performed with 10 mM acetate and 10 mM taurine (FIG. 2I) or 100 pM N-acetyltaurine (FIG. 2J) at 37°C for 1 hr. N=3 / group. For (FIGS. 2A-2G) and (FIGS. 2I-2J), data are shown as mean ± SEM. Data were fitted to Michaelis-Menten kinetics (solid line) using GraphPad Prism. All experiments were repeated twice and similar results were obtained.
[0015] FIGS. 3A-3E: Biochemical characterization of global PTER-KO mice. (FIG. 3A) Anti-PTER blotting (top) and Ponceaus staining (bottom) of the indicated total tissue lysate from 4-week-old WT or PTER-KO mouse. 100 ng recombinant mPTER proteins was used as a positive control. (FIGS. 3B, 3C) Rate of N-acetyltaurine production (FIG. 3B) or hydrolysis (FIG. 3C) following incubation of the indicated WT or PTER-KO total tissue lysate (100 pg) with 10 mM acetate and 10 mM taurine (FIG. 3B) or 100 pM N- acetyltaurine (FIG. 3C) at 37 °C for 1 hr. N=3 / group. (FIG. 3D) Absolute quantitation of endogenous N-acetyltaurine levels in the indicated tissue from 4-week-old WT (left bar in each tissue) or PTER-KO mice (right bar in each tissue). N=3 / group. (FIG. 3E) Relative fold change (FC) of the indicated metabolites from the indicated tissue of 4-week-old WT or PTER-KO mice. N=3 / group. In (FIGS. 3B-3D), data are shown as Mean ± SEM. In (FIGS. 3B-3E), P-values were calculated from two-tailed unpaired t-tests. In (FIG. 3E), * < 0.05, “ < 0.01 and *** < 0.001 .
[0016] FIGS. 4A-4L: Body weight and adiposity phenotype of PTER-KO mice. (FIGS. 4A- 4F) Change in body weight (FIG. 4A), cumulative food intake (FIG. 4B), tissue weights (FIG. 4C), representative adipose tissues (FIG. 4D), plasma taurine levels (FIG. 4E) and plasma N-acetyltaurine levels (FIG. 4F) from 13 to 14-week-old male WT or PTER-KO mice on high fat diet and after taurine water supplementation (2.5% w / v). N=10 / group. In (FIG. 4G), WT is the left bar and KO is the right bar for each tissue. (FIGS. 4G-4L) Change in body weight (FIG. 4G), cumulative food intake (FIG. 4H), tissue weights (FIG. 4I), representative adipose tissues (FIG. 4J), plasma taurine levels (FIG. 4K), and plasma N- acetyltaurine levels (FIG. 4L) from 13 to 14-week-old male WT or PTER-KO mice on high fat diet and subjected to a chronic treadmill exercise training protocol (see Methods). N=8 for WT, N=10 for PTER-KO. In (FIG. 4I), WT is the left bar and KO is the right bar for each tissue. For (FIGS. 4E, 4F) and (FIGS. 4K, 4L) plasma metabolites were measured at the end of the experiment (FIGS. 4E, 4F) or immediately after the final bout of treadmill exercise (FIGS. 4K, 4L). Data are shown as mean ± SEM. In (FIGS. 4C, 4E, 4F, 4I, 4K and 4L), P-values were calculated from two-tailed unpaired t-tests. In (FIGS. 4A, 4B, 4G and 4H), P-values were calculated from two-way ANOVA with post hoc Sidak’s multiple comparisons test.
[0017] FIGS. 5A-5E: Effect of N-acetyltaurine administration to diet-induced obese mice. (FIGS. 5A, 5B) Change in body weight (FIG. 5A) and cumulative food intake (FIG. 5B) of 26 to 28-week-old male DIO C57BL / 6J mice following 7 days of treatment with the indicated dose of N-acetyltaurine (intraperitoneal injection). N=5 / group for vehicle, 1 , and 5 mg / kg / day; N=6 / group for 15 and 50 mg / kg / day. (FIGS. 5C, 5D) Change in body weight (FIG. 5C) and cumulative food intake (FIG. 5D) of 19 to 21 -week-old male DIO C57BL / 6J mice following treatment with the indicated metabolite at a dose of 15 mg / kg / day (IP) N=5 per group. (FIG. 5E) Tissue weights of 17 to 19-week-old male DIO C57BL / 6J mice following a 7 day treatment with the indicated metabolite (15 mg / kg / day). For each tissue, bars for saline, taurine and N-acetyltaurine are shown from left to right. N=9 per group. Data are shown as mean ± SEM. In (FIGS. 5A, 5B and 5E), P-values were calculated from two-tailed unpaired t-tests. In (FIGS. 5C, 5D), P-values were calculated from two- way ANOVA with post hoc Sidak’s multiple comparisons test.
[0018] FIGS. 6A-6D: Additional characterization of N-acetyltaurine synthesis and hydrolysis activity in vitro. (FIGS. 6A, 6B) Rate of N-acetyltaurine synthesis (FIG. 6A) or hydrolysis (FIG. 6B) in the indicated kidney fraction. N=4 for N-acetyltaurine synthesis and N=5 for N-acetyltaurine hydrolysis. (FIGS 6C, 6D) N-acetyltaurine concentration (FIG. 60) and taurine concentration (FIG. 6D) from HEK293T cell lysates. For (FIGS. 6A- 6D), all reactions were performed with 100 pg of the indicated protein and incubated at 37°C for 1 hr using 10 mM acetate and 10 mM taurine (FIGS. 6A, 6C) or 100 pM N- acetyltaurine (FIGS. 6B, 6D) as substrates. N=3 / group. Data are shown as mean ± SEM. P-values for all comparisons were calculated from two-tailed unpaired t-tests.
[0019] FIGS. 7A, 7B: Additional characterization of recombinant mPTER proteins. (FIG. 7 A) Ponceaus staining (left) and anti-PTER blotting (right) of 100 ng purified recombinant mPTER proteins (see Methods). (FIG. 7B) AlphaFold-modeled PTER protein structure with N-acetyltaurine docked in the active site (see Methods).
[0020] FIGS. 8A-8E: Additional characterization of PTER-KO mice. (FIG. 8A) Human genetic evidence (HuGE) score of phenotype associations for the PTER gene locus from the Type 2 Diabetes Knowledge Portal. (FIGS. 8B, 8C) Body weights (FIG. 8B) and cumulative food intake (FIG. 8C) of 12 to 13-week-old male PTER-KO mice (N=10) or WT mice (N=14) subjected to a high-fat diet feeding alone for a period of 8 weeks. (FIGS. 8D, 8E) Body weights (FIG. 8D) and cumulative water intake (FIG. 8E) of 13 to 14-week- old male WT or PTER-KO mice on high fat diet and after taurine water supplementation (2.5% w / v). N=10 / group. Data are shown as mean ± SEM. In (FIGS. 8B-8E), P-values were calculated from two-way ANOVA with post hoc Sidak’s multiple comparisons test.
[0021] FIGS. 9A-9I: Additional characterization of PTER-KO mice. (FIGS. 9A-9I) Body weights (FIG. 9A), food intake (FIG. 9B), oxygen consumption (FIG. 9C), carbon dioxide production (FIG. 9D), respiratory exchange ratio (RER) (FIG. 9E), ambulatory activity (FIG. 9F), plasma GFP-1 (FIG. 9G), plasma Leptin (FIG. 9H) and plasma GDF-15 (FIG. 9I) of 10 to 12-week-old male PTER-KO and WT mice (N=9 / group) were supplemented with 2.5% (w / v) taurine water and fed on a high-fat diet for 4 weeks. Data are shown as mean ± SEM. P-values were calculated from two-tailed unpaired t-tests. FIGS. 10A-10D: Additional characterization of PTER-KO mice. (FIGS. 10A-10C) Running distance (FIG. 10A), running time (FIG. 10B) and maximum speed (FIG. 10C) of 8 to 9-week-old male PTER-KO mice (N=10) or WT mice (N=9) subjected to a single bout of treadmill exercise running. (FIG. 10D) Body weights of 13 to 14-week-old male WT or PTER-KO mice on high fat diet and subjected to a chronic treadmill exercise training protocol (see Methods). N=8 for WT, N=10 for PTER-KO mice. Data are shown as mean ± SEM. In (FIGS. 10A-10C), P-values were calculated from two-tailed unpaired t-tests. In (FIG. 10D), P-values were calculated from two-way ANOVA with post hoc Sidak’s multiple comparisons test.
[0022] FIGS. 11 A, 11 B: Additional characterization of N-acetyltaurine administration to DIO mice. (FIGS. 11 A, 11 B) Blood plasma concentrations of N-acetyltaurine (FIG. 1A) and taurine (FIG. 11 B) from 26 to 28-week-old male DIO C57BL / 6J mice after intraperitoneal injection with indicated doses of N-acetyltaurine. N=5-6 / group. Data are shown as mean ± SEM. P-values were calculated from two-way ANOVA with post hoc Sidak’s multiple comparisons test.
[0023] DETAILED DESCRIPTION
[0024] Provided are methods of treating metabolic disorders. Aspects of the methods include modulating N-acetyltaurine metabolism in a subject. In some instances, modulation of N-acetyltaurine metabolism increases N-acetyltaurine levels in a subject. Aspects of embodiments of the methods include administering to the subject an effective amount of N-acetyltaurine (or a derivative, salt or prodrug thereof) and / or a PTER modulating agent. In some instances, the PTER modulating agent is a PTER inhibitor or PTER silencing agent. In some instances, the method results in reduced food intake, reduced body weight, and / or reduced adipose tissue mass in a subject. Also provided are pharmaceutical compositions. In some instances, the pharmaceutical composition comprises N-acetyltaurine or a derivative, salt or prodrug thereof. In some instances, the pharmaceutical composition comprises a PTER modulating agent. In some embodiments, the pharmaceutical composition comprises both N-acetyltaurine (or a derivative, salt or prodrug thereof) and a PTER modulating agent. Before the present invention is described in greater detail, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
[0025] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0026] Certain ranges are presented herein with numerical values being preceded by the term "about." The term "about" is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.
[0027] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative illustrative methods and materials are now described.
[0028] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
[0029] It is noted that, as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
[0030] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.
[0031] While the apparatus and method has or will be described for the sake of grammatical fluidity with functional explanations, it is to be expressly understood that the claims, unless expressly formulated under 35 U.S.C. §1 12, are not to be construed as necessarily limited in any way by the construction of "means" or "steps" limitations, but are to be accorded the full scope of the meaning and equivalents of the definition provided by the claims under the judicial doctrine of equivalents, and in the case where the claims are expressly formulated under 35 U.S.C. §1 12 are to be accorded full statutory equivalents under 35 U.S.C. §1 12.
[0032] METHODS
[0033] As summarized above, aspects of the invention include methods of treating a subject for a metabolic disorder, where the methods include modulating N-acetyltaurine metabolism in the subject in a manner effective to treat the subject for the metabolic disorder. Metabolic disorders include disorders that affect the ability of the subject (i.e., the body of the subject) to break down, use or store energy from food. Metabolic disorders include, but are not limited to, obesity (e.g., morbid obesity), obesity-related disorders (e.g., Type 2 diabetes, cardiovascular diseases, metabolic syndrome, non-alcoholic fatty liver disease (NAFLD), arthritis, gout, joint pain, sleep apnea, asthma, etc.), diabetes (e.g., Type 1 diabetes, Type 2 diabetes, gestational diabetes) and hormonal disorders (e.g., thyroid disorders, such as hypothyroidism, hyperthyroidism, Cushing’s syndrome, etc.).
[0034] In some embodiments, the metabolic disorder is obesity or an obesity-related disorder. Obesity is defined as an excess of body fat relative to lean body mass, and is a serious contributor to increased morbidity and mortality. Obesity, which is most commonly caused by excessive food intake coupled with limited energy expenditure and / or lack of physical exercise, often accompanies various glucose metabolism disorders. A subject is generally defined as obese if the subject has a body mass index of 30 kg / m2or greater. Obesity increases the likelihood of various disorders. Obesity-related disorders may include, but are not limited to, hypertension, dyslipidemia, mellitus, atherosclerosis, gout, rheumatism, arthritis, type 2 diabetes, coronary heart disease, stroke, gallbladder disease, liver disease, sleep apnea and pain. Obesity is often associated with psychological and medical morbidities, the latter of which includes increased joint problems, vascular diseases such as coronary artery disease, hypertension, stroke, and peripheral vascular disease. Obesity also causes metabolic abnormalities such as insulin resistance and Type II diabetes (non-insulin-dependent diabetes mellitus (NIDDM)), hyperlipidemia, and endothelial dysfunction.
[0035] By modulating N-acetyltaurine metabolism, it is meant changing the rate of production and / or consumption of N-acetyltaurine in the body of the subject. In other words, modulating N-acetyltaurine metabolism changes (e.g., increases or decreases) the levels of N-acetyltaurine in a subject. In some embodiments, modulating N- acetyltaurine metabolism increases N-acetyltaurine levels in a subject. In some cases, the N-acetyltaurine levels in a subject may be increased relative to baseline N- acetyltaurine levels. By baseline N-acetyltaurine levels, it is meant the N-acetyltaurine levels in the subject prior to the modulation. In some embodiments, the N-acetyltaurine levels in the subject are increased by 1% or more (e.g., 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 500%), including, e.g., 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 100% or more, 200% or more, 500% or more and 1000% or more.
[0036] N-acetyltaurine levels in a subject may be measured by obtaining a blood (e.g., plasma, whole blood), urine and / or tissue sample from the subject. As N-acetyltaurine is produced during metabolic processes, it may be referred to as a metabolite. Any method appropriate for measuring a metabolite may be used to quantify N-acetyltaurine levels including, but not limited to, mass spectrometry (e.g., liquid chromatography-mass spectrometry (LC-MS), gas chromatography-mass spectrometry (GC-MS), ion chromatography-mass spectrometry (IC-MS)) and nuclear magnetic resonance (NMR) spectroscopy. For more details on measuring metabolite levels see, e.g., Chen, Y, et al. Metabolites. 2022. 12:357, the disclosure of which is herein incorporated by reference. In some embodiments, N-acetyltaurine levels are measured using LC-MS.
[0037] Subjects to be treated according to the methods of the disclosure may vary. The terms “subject,” “individual” and “patient,” are used interchangeably herein, and generally refer to a mammal, including, but not limited to, murines (e.g., rats, mice), non-human primates, humans, canines, felines, ungulates (e.g., equines, bovines, ovines, porcines, caprines), lagomorphs, etc. In some cases, the subject is a human. In some cases, the subject is a non-human primate. In some cases, the subject is a rodent, e.g., a rat or a mouse. In some cases, the subject is a lagomorph, e.g., a rabbit. Where the subject is a human, the subject may be a human of any age including, e.g., a juvenile human (i.e., a human less than 18 years old) or an adult human (i.e., a human 18 years or older). Subjects may be female or male.
[0038] As used herein, the terms "treatment," "treating," “treat” and the like, refer to obtaining a desired pharmacologic and / or physiologic effect and / or a response related to the treatment. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or can be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. "Treatment," as used herein, covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which can be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.
[0039] In certain embodiments, N-acetyltaurine levels are increased by administering a therapeutically effective amount of N-acetyltaurine or a derivative, salt or prodrug thereof. In some embodiments, N-acetyltaurine levels are increased by administering a therapeutically effective amount of N-acetyltaurine. In some embodiments, N- acetyltaurine levels are increased by administering a therapeutically effective amount of a derivative of N-acetyltaurine. In some embodiments, N-acetyltaurine levels are increased by administering a therapeutically effective amount of a prodrug of N- acetyltaurine. In some embodiments, N-acetyltaurine levels are increased by administering a therapeutically effective amount of a salt of N-acetyltaurine. Salts of N- acetyltaurine include, but are not limited to, N-acetyltaurine sodium salt, N-acetyltaurine potassium salt, N-acetyltaurine lithium salt, N-acetyltaurine magnesium salt and N- acetyltaurine calcium salt. Details on salts of N-acetyltaurine may be found in, e.g., U.S. Patent No. 4,199,601 , the disclosure of which is herein incorporated by reference.
[0040] In some embodiments, N-acetyltaurine or a derivative, salt or prodrug is administered at a dose of at least about 0.1 mg / kg, at least about 0.5 mg / kg, at least about 1 mg / kg, at least about 5 mg / kg, at least about 10 mg / kg, at least about 20 mg / kg, at least about 50 mg / kg, at least about 100 mg / kg, in some embodiments the effective dose is from about 1 to 50 mg / kg.
[0041] In certain embodiments, N-acetyltaurine levels are increased by administering a therapeutically effective amount of a phosphotriesterase-related (PTER) modulating agent. A PTER modulating agent is an agent that modulates the function of the enzyme PTER. The PTER enzyme is a protein that is encoded by the PTER gene. PTER is a mammalian homolog of the bacterial phosphotriesterase (PTE) enzyme that hydrolyzes phosphotriester-containing organophosphates. In humans, PTER is encoded by human chromosome 10p12. In mammals (e.g., humans), PTER is related to body mass index (e.g., related to obesity, such as early-onset obesity and morbid obesity).
[0042] In some embodiments, administering a therapeutically effective amount of the PTER modulating agent to the subject increases N-acetyltaurine levels in the subject. In some cases, the administration of the PTER modulating agent increases N-acetyltaurine levels in the subject relative to baseline N-acetyltaurine levels. By baseline N- acetyltaurine levels, it is meant the N-acetyltaurine levels in the subject prior to administration of the PTER modulating agent. In some embodiments, administering a therapeutically effective amount of the PTER modulating agent increases N-acetyltaurine levels in the subject by 1% or more (e.g., 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 500%), including, e.g., 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 100% or more, 200% or more, 500% or more and 1000% or more. N-acetyltaurine levels may be measured by any of the methods discussed above.
[0043] PTER modulating agents include PTER inhibitors and PTER silencing agents. In some embodiments, the PTER modulating agent is a PTER inhibitor. By PTER inhibitor is meant an agent that inhibits the PTER enzyme. PTER inhibitors include antibody inhibitors (including, e.g., antibody fragments), peptide inhibitors, nucleic acid inhibitors (e.g., aptamers) and small molecule inhibitors. In some embodiments, the PTER inhibitor is an antibody or a peptide. In some embodiments, the PTER inhibitor is a nucleic acid. In some embodiments, the PTER inhibitor is a small molecule. Antibodies, i.e., anti-PTER antibodies include, e.g., polyclonal anti-PTER antibodies (e.g., Invitrogen, Catalog No. PA5-20750; Proteintech, Catalog No. 11 191 -1 -AP; GeneTex, Catalog No. GTX102860; Sigma-Aldrich, Catalog No. HPA038045; Sigma-Aldrich, Catalog No. HPA038044; Abeam, Catalog No. ab106526; Origene, Catalog No. TA306783) and monoclonal anti- PTER antibodies (e.g., OriGene, Catalog No. CF813177).
[0044] In some embodiments, the PTER modulating agent is a PTER silencing agent. By PTER silencing agent, it is meant an agent that silences the PTER gene. In some embodiments, the PTER silencing agent includes a nucleic acid (e.g., RNA, DNA or a combination thereof). In embodiments where the PTER silencing agent includes a nucleic acid, the nucleic acid may contain modified, i.e., non-natural nucleotides or modifications, including for example, LNA, FANA, 2’-O-Me RNA, 2’-fluoro RNA, or the like, linkage modifications (e.g., phosphorothioates, 3’-3’ and 5’-5’ reversed linkages), 5’ and / or 3’ end modifications (e.g., 5’ and / or 3’ amino, biotin, DIG, phosphate, thiol, dyes, quenchers, etc.), one or more fluorescently labeled nucleotides, or any other feature that provides a desired functionality to the nucleic acid. PTER silencing agents may include nucleic acids that are 6 to 10, 10 to 20, 21 to 30, 31 to 40, 41 to 50, 51 to 60, 61 to 70, 71 to 80, 80 to 100, 100 to 150 or 150 to 200, up to 500 or more nucleotides in length, for example.
[0045] Nucleic acid PTER silencing agents include, but are not limited to, antisense oligonucleotides, siRNA, shRNA, miRNA and CRISPR / Cas guide RNA. In embodiments where a CRISPR / Cas guide RNA is used as a silencing agent, the guide RNA may be used in conjunction with an enzyme (e.g., an enzyme of the Cas family, such as Cas9) to silence the gene (e.g., the PTER gene). In some embodiments, the CRISPR / Cas guide RNA comprises the sequence GATGGAACCAGTATCAAGTG (SEQ ID NO: 1 ).
[0046] In some embodiments, N-acetyltaurine levels are increased by administering a therapeutically effective amount of both N-acetyltaurine (or a derivative, salt or prodrug thereof) and a PTER modulating agent. In some embodiments, a combination of two or more agents (e.g., N acetyltaurine, or a derivative, salt or prodrug thereof, PTER modulating agent) may be administered in a therapeutically effective amount to increase N-acetyltaurine levels in the subject.
[0047] A “therapeutically effective amount” or “efficacious amount” refers to the amount of an agent (e.g., N-acetyltaurine, PTER modulating agent), or combined amounts of two agents, that, when administered to a mammal or other subject for treating a disease, is sufficient to effect such treatment for the disease. The “therapeutically effective amount” will vary depending on the agent(s), the disease and its severity and the age, weight, etc., of the subject to be treated.
[0048] Dosage and frequency of dosing may vary depending on the half-life of the agent in the patient. It will be understood by one of skill in the art that such guidelines will be adjusted for the molecular weight of the active agent, the clearance from the blood, the mode of administration, and other pharmacokinetic parameters. The dosage may also be varied for localized administration, e.g., intranasal, inhalation, etc., or for systemic administration, e.g., i.m., i.p., i.v., oral, and the like.
[0049] An active agent can be administered by any suitable means, including topical, oral, parenteral, intrapulmonary, and intranasal. Parenteral infusions include intramuscular, intravenous (bolus or slow drip), intraarterial, intraperitoneal, intrathecal or subcutaneous administration. An agent can be administered in any manner which is medically acceptable. This may include injections, by parenteral routes such as intravenous, intravascular, intraarterial, subcutaneous, intramuscular, intratumor, intraperitoneal, intraventricular, intraepidural, or others as well as oral, nasal, ophthalmic, rectal, or topical. Sustained release administration is also specifically included in the disclosure, by such means as depot injections or erodible implants.
[0050] In certain embodiments, therapeutically effective doses are administered according to a daily dosing regimen, or intermittently. In certain embodiments, therapeutically effective doses are administered daily. In some embodiments, a therapeutically effective dose is administered once. In some embodiments, a therapeutically effective dose is administered for two or more consecutive days, e.g., for two consecutive days, for three consecutive days, for four consecutive days, for five consecutive days, for six consecutive days, for seven consecutive days, for eight consecutive days, for nine consecutive days, for ten consecutive days or more, for 20 consecutive days or more, for 50 consecutive days or more, for 100 consecutive days or more. In certain embodiments, therapeutically effective doses are administered intermittently. For example, a therapeutically effective dose can be administered, one day a week, two days a week, three days a week, four days a week, or five days a week, and so forth, or, for example, every other day, every two days, every three days, once a week, once every two weeks, once every three weeks, once a month, and so forth. For example, in some embodiments, the composition is administered once every two to four weeks for an extended period of time, such as for 1 , 2, 3, 4, 5, 6, 7, 8, 10, 15, 24 months, and so forth. By "twice-weekly" or "two times per week" is intended that two therapeutically effective doses of the agent in question is administered to the subject within a 7 day period, beginning on day 1 of the first week of administration, with a minimum of 72 hours, between doses and a maximum of 96 hours between doses. By "thrice weekly" or "three times per week" is intended that three therapeutically effective doses are administered to the subject within a 7 day period, allowing for a minimum of 48 hours between doses and a maximum of 72 hours between doses. For purposes of the present invention, this type of dosing is referred to as "intermittent" therapy. In accordance with the methods of the present invention, a subject can receive intermittent therapy for one or more weekly or monthly cycles until the desired therapeutic response is achieved. The agents can be administered by any acceptable route of administration as noted above. Effective doses may likewise be administered according to any of the dosing regimens listed above.
[0051] A therapeutically effective dose may be in the form of a unit dosage, where the term "unit dosage form," refers to physically discrete units suitable as unitary dosages for subjects (e.g., human subjects), each unit containing a predetermined quantity of active agent in an amount calculated sufficient to produce the desired effect in association with an acceptable diluent, carrier or vehicle. The specifications for the unit dosage forms of the present invention depend on the particular complex employed and the effect to be achieved, and the pharmacodynamics associated with each complex in the host.
[0052] In some embodiments, a therapeutically effective dose (e.g., unit dose) is at least about 1 mg / kg, at least about 5 mg / kg, at least about 10 mg / kg, at least about 20 mg / kg, at least about 30 mg / kg, at least about 40 mg / kg, at least about 50 mg / kg, at least about 60 mg / kg, at least about 70 mg / kg, at least about 80 mg / kg, at least about 90 mg / kg, at least about 100 mg / kg, at least about 250 mg / kg, at least about 500 mg / kg in some embodiments the effective dose is from about 1 to 100 mg / kg.
[0053] In some embodiments, methods of treating a subject for a metabolic disorder result in a reduced food intake by the subject. In some embodiments, the food intake of the subject is reduced compared to food intake by the subject before (i.e., prior to) administration of an agent (e.g., N-acetyltaurine or a derivative, salt or prodrug thereof or a PTER modulating agent). The food intake of the subject may be reduced by 1% or more (e.g., 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40% or 50%) including e.g., 3% or more, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 40% or more and 50% or more. In some cases, the food intake of the subject is reduced by 1% to 99%, including, e.g., 1 % to 50%, such as 5% to 50%.
[0054] In some instances, food intake may be measured by counting the number of calories consumed by the subject over a certain time period. This may be referred to as a caloric food intake. In some cases, the caloric food intake may be a daily caloric food intake, i.e., the number of calories consumed by the subject in one day. In some cases, the caloric food intake may be an average daily caloric food intake, i.e., the average number of calories consumed by the subject per day over the course of a certain time period (e.g., multiple days, such as two or more days, three or more days, four or more days, five or more days, six or more days, 1 week or more, 2 weeks or more or 1 month or more).
[0055] In some instances, food intake may be measured by weighing the mass of the food consumed by the subject over a certain time period. This may be referred to as a mass food intake. In some cases, the mass food intake may be a daily mass food intake, i.e., the weight of the food consumed by the subject in one day. In some cases, the mass food intake may be an average daily mass food intake, i.e., the average weight of the food consumed by the subject per day over the course of a certain time period (e.g., multiple days, such as two or more days, three or more days, four or more days, five or more days, six or more days, 1 week or more, 2 weeks or more or 1 month or more).
[0056] In some instances, the food intake (e.g., daily food intake (e.g., daily caloric food intake, daily mass food intake), average daily food intake (e.g., average daily caloric food intake, average daily mass food intake)) of the subject prior to administering the agent (e.g., N-acetyltaurine or a derivative, salt or prodrug thereof or a PTER modulating agent) may be compared to the food intake of the subject after administering the agent. In cases where the food intake of the subject after administration of the agent (e.g., N-acetyltaurine or a derivative, salt or prodrug thereof or a PTER modulating agent) is reduced compared to food intake of the subject prior to administration of the agent (i.e., the initial food intake), the percent reduction in food intake may be calculated using the following formula: (initial food intake - food intake after administration) I initial food intake * 100.
[0057] In some instances, the food intake is a cumulative food intake. By cumulative food intake, it is meant the total amount of food (e.g., caloric or mass food intake) consumed by the subject over a time period of a certain length (e.g., 3 days, 5 days, 1 week, 2 weeks). In some embodiments, cumulative food intake of a subject for a certain time period prior to administration of the agent may be compared to cumulative food intake of the subject over the same time period after administration of the agent. In other embodiments, cumulative food intake a first subject for a certain time period after administration of the agent may be compared to cumulative food intake of a second subject for the same time period that is not administered the agent. Percent reduction in cumulative food intake may be calculated as described above. In some embodiments, methods of treating a subject for a metabolic disorder result in a reduction of the body weight of the subject. In some embodiments, the body weight of the subject is reduced compared to body weight of the subject before (i.e., prior to) treatment. The body weight of the subject may be reduced by 1% or more (e.g., 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40% or 50%) including e.g., 3% or more, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 40% or more and 50% or more. In some cases, the body weight of the subject is reduced by 1 % to 99%, including, e.g., 1% to 50%, such as 5% to 50%.
[0058] In some embodiments, methods of treating a subject for a metabolic disorder result in a reduction of adipose tissue mass of a subject. Adipose tissue (i.e., body fat or fat) is a tissue composed mostly of adipocytes. In some embodiments, adipose tissue mass is reduced compared to adipose tissue mass in the subject before treatment. In some embodiments, adipose tissue mass is reduced by 1 % to 99%, e.g., 5% to 95%, 10% to 90%, 10% to 70%, 10% to 50%, 20% to 50%, 30% to 50%, 15% to 40%, etc. In some embodiments, adipose tissue mass is reduced by at least 1%, e.g., at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, etc.
[0059] The adipose tissue may be white adipose tissue or brown adipose tissue. White adipose tissue stores energy and each white adipocyte contains a single lipid droplet, while brown adipose tissue generates body heat and each brown adipocyte contains numerous lipid droplets. In some embodiments, the method reduces white adipose tissue (i.e., white fat) in the subject. In some embodiments, white adipose tissue is reduced by 1 % to 99%, e.g., 5% to 95%, 10% to 90%, 10% to 70%, 10% to 50%, 20% to 50%, 30% to 50%, 15% to 40%, etc. In some embodiments, white adipose tissue is reduced by at least 1%, e.g., at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, etc. In some embodiments, the method reduces brown adipose tissue (i.e., brown fat) in the subject. In some embodiments, brown adipose tissue is reduced by 1 % to 99%, e.g., 5% to 95%, 10% to 90%, 10% to 70%, 10% to 50%, 20% to 50%, 30% to 50%, 15% to 40%, etc. In some embodiments, brown adipose tissue is reduced by at least 1 %, e.g., at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, etc.
[0060] Types of white adipose tissue include inguinal white adipose tissue (iWAT) and epididymal white adipose tissue (eWAT). In some embodiments, the iWAT of the subject may be reduced by 1% or more (e.g., 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40% or 50%) including e.g., 3% or more, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 40% or more and 50% or more. In some cases, the iWAT of the subject is reduced by 1 % to 99%, including, e.g., 1 % to 50%, such as 5% to 50%. In some embodiments, the eWAT of the subject may be reduced by 1 % or more (e.g., 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40% or 50%) including e.g., 3% or more, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 40% or more and 50% or more. In some cases, the eWAT of the subject is reduced by 1 % to 99%, including, e.g., 1 % to 50%, such as 5% to 50%. In some embodiments, the combination of iWAT and eWAT of the subject may be reduced by 1% or more (e.g., 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40% or 50%) including e.g., 3% or more, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 40% or more and 50% or more. In some cases, the combination of iWAT and eWAT of the subject is reduced by 1 % to 99%, including, e.g., 1% to 50%, such as 5% to 50%.
[0061] In embodiments where a PTER modulating agent is administered to the subject, the administration of the PTER modulating agent may reduce the N-acetyltaurine synthesis activity in a subject. N-acetyltaurine synthesis (i.e., N-acetyltransferase activity) is the process of making N-acetyltaurine. In other words, the administration of the PTER modulating agent decreases the amount and / or rate of N-acetyltaurine synthesis. In some embodiments, the reduction of N-acetyltaurine synthesis activity may occur throughout the body of the subject. In some embodiments, the reduction of N-acetyltaurine synthesis activity is specific to a particular organ or sub-organ in a subject. In some embodiments, the reduction of N-acetyltaurine synthesis activity occurs in the kidney and / or liver. The N-acetyltaurine synthesis activity may be reduced by 1 % or more (e.g., 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 75%, 100%, 200%, 500% or 1000%) including e.g., 3% or more, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 40% or more, 50% or more 100% or more, 500% or more or 1000% percent or more.
[0062] N-acetyltaurine synthesis activity may be measured by measuring the N- acetyltaurine levels in a subject. N-acetyltaurine levels in a subject may be measured as described above.
[0063] In embodiments where a PTER modulating agent is administered to the subject, the administration of the PTER modulating agent may reduce the N-acetyltaurine hydrolysis activity in a subject. N-acetyltaurine hydrolysis activity is the process of hydrolyzing N-acetyltaurine into taurine and acetate. In other words, hydrolyzing N- acetyltaurine means breaking down N-acetyltaurine into taurine and acetate products. In some embodiments, the administration of the PTER modulating agent decreases the amount and / or rate that N-acetyltaurine is hydrolyzed. In some embodiments, the reduction of N-acetyltaurine hydrolysis activity may occur throughout the body of the subject. In some embodiments, the reduction of N-acetyltaurine hydrolysis activity is specific to a particular organ or sub-organ in a subject. In some embodiments, the reduction of N-acetyltaurine hydrolysis activity occurs in the kidney and / or liver. In some embodiments, the N-acetyltaurine hydrolysis activity may be reduced by 1 % or more (e.g., 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 75%, 100%, 200%, 500% or 1000%) including e.g., 3% or more, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 40% or more, 50% or more 100% or more, 500% or more or 1000% percent or more.
[0064] N-acetyltaurine hydrolysis activity may be measured by measuring the taurine levels in a subject. Taurine levels in a subject may be measured by obtaining a blood (e.g., plasma, whole blood), urine and / or tissue sample (e.g., sample (e.g., biopsy) from the liver or kidney) from the subject. As taurine is produced during metabolic processes, it may be referred to as a metabolite. Any method appropriate for measuring a metabolite may be used to quantify taurine levels including, but not limited to, mass spectrometry (e.g., liquid chromatography-mass spectrometry (LC-MS), gas chromatography-mass spectrometry (GC-MS), ion chromatography-mass spectrometry (IC-MS)) and nuclear magnetic resonance (NMR) spectroscopy. For more details on measuring metabolite levels see, e.g., Chen, Y, et al. Metabolites. 2022. 12:357, the disclosure of which is herein incorporated by reference. In some embodiments, taurine levels are measured using LC-MS.
[0065] In some embodiments, the administration of the PTER modulating agent may reduce the N-acetyltaurine synthesis activity and the N-acetyltaurine hydrolysis activity in a subject. In such embodiments, the N-acetyltaurine hydrolysis activity may be reduced by a greater magnitude (e.g., 1.5x or more (e.g., 2x, 3x, 4x, 5x or 10x), such as 2x or more, 3x or more, or 5x or more) than the N-acetyltaurine synthesis activity.
[0066] In embodiments where a PTER modulating agent is administered to the subject, the administration of the PTER modulating agent may increase the N-acetyltaurine levels in the subject. In some embodiments, the N-acetyltaurine levels are increased by 1 .5x or more (e.g., 1 .5x, 2x, 2.5x, 3x, 4x, 5x) including e.g., 2x or more, 2.5x or more, 3x or more, 4x or more and 5x or more. N-acetyltaurine levels in a subject may be measured as described above (e.g., by using LC-MS).
[0067] In some instances, administration of N-acetyltaurine (or a derivative, salt or prodrug thereof) is carried out in combination with administration of a PTER modulating agent (e.g., a PTER inhibitor or a PTER silencing agent) for treating the metabolic disorder.
[0068] The N-acetyltaurine (or a derivative, salt or prodrug thereof) and the PTER modulating agent may be administered concurrently, e.g., where they may be administered simultaneously, e.g., in discrete compositions or combined in a single composition. Alternatively, N-acetyltaurine (or a derivative, salt or prodrug thereof) and the PTER modulating agent may be administered sequentially, e.g., where the N- acetyltaurine (or a derivative, salt or prodrug thereof) is administered before the PTER modulating agent or the PTER modulating agent is administered after the N-acetyltaurine (or a derivative, salt or prodrug thereof) and the PTER modulating agent. In embodiments, N-acetyltaurine (or a derivative, salt or prodrug thereof) and the PTER modulating agent can be administered at the same time, e.g., as two separate formulations, or combined into a single composition. Alternately, the N-acetyltaurine (or a derivative, salt or prodrug thereof) and the PTER modulating agent can be administered sequentially to the subject in different formulations. Regardless of whether the N-acetyltaurine (or a derivative, salt or prodrug thereof) and the PTER modulating agent are administered sequentially or simultaneously, or any effective variation thereof, the agents and additional therapies are considered to be administered together or in combination for purposes of the present invention.
[0069] In some instances, administration of N-acetyltaurine (or a derivative, salt or prodrug thereof) and / or administration of a PTER modulating agent (e.g., a PTER inhibitor or a PTER silencing agent) is carried out in combination with administration of one or more additional therapies for treating the metabolic disorder. Additional therapies include, but are not limited to, additional drug therapies (e.g., GLP-1 agonists), putting the subject on a low-calorie diet, increasing physical activity of the subject, surgical intervention, use of a weight loss device, or a combination thereof.
[0070] In some embodiments, the additional therapy is an additional drug therapy. Drug therapies of interest include GLP-1 agonists or other weight loss drugs such as phentermine (e.g., Lomaira™, Adipex-P®), phentermine-topiramate (e.g., Qsymia®, Qsiva®), naltrexone-bupropion (e.g., Contrave®), setmelanotide (e.g., Imcivree®) and orlistat (e.g., Xenical®, Alli®).
[0071] In some embodiments, the additional drug therapy is a glucagon-like peptide-1 (GLP-1 ) agonist. GLP-1 agonists activate the GLP-1 receptor. GLP-1 agonists may be selective GLP-1 agonists, GLP-1 / GIP dual agonists or GLP-1 / glucagon dual agonists. GLP-1 agonists include, but are not limited to, liraglutide (e.g., Saxenda®, Victoza®), taspoglutide, semaglutide (e.g., Wegovy®, Ozempic®, Rybelsus®), albiglutide, dulaglutide(e.g., Trulicity®), exenatide (e.g., Byetta®, Bydureon®), lixisenatide (e.g., Adlyxin™, Lyxumia®) and tirzepatide (e.g., Zepbound®, Mounjaro®).
[0072] In some embodiments, the additional therapy includes putting the subject on a low- calorie diet. Putting the subject on a low-calorie diet means decreasing the daily caloric intake of the subject. A low-calorie diet may mean the subject consumes a reduced number of calories compared to the subject’s initial caloric consumption (i.e., the caloric consumption of the subject prior to administering the additional therapy). In some cases, the subject may consume 1% to 30% less calories (e.g., 5% to 25% or 10% to 20% less calories) than the subject’s initial caloric consumption. In embodiments where the subject is a human, putting the subject on a low calorie diet may mean that the subject consumes 1 ,200 to 2,000 calories per day (e.g., 1 ,200 to 1 ,500 calories per day, 1 ,500 to 1 ,800 calories per day, 1 ,600 to 2,000 calories per day, etc.).
[0073] In some embodiments, the additional therapy includes increasing the physical activity of the subject. Increasing the physical activity of the subject means increasing the frequency, duration and / or intensity of the physical activity of the subject. The physical activity of the subject may be increased compared to the initial physical activity of the subject (i.e., the physical activity prior to administering the additional therapy). The physical activity of the subject may be measured by measuring the number of calories burned by the subject during the physical activity. For example, the number of calories burned during physical activity (e.g., exercise) may be tracked using a device (e.g., a smart watch, a smart phone, a device including a calorie calculator, etc.).
[0074] In some embodiments, the additional therapy includes a surgical intervention. Surgical interventions include, but are not limited to, bariatric surgery (e.g., sleeve gastrectomy, Roux-en-Y gastric bypass surgery, biliopancreatic diversion with duodenal switch, gastric plication, adjustable gastric band surgery, intragastric balloon surgery, implantable gastric stimulation surgery).
[0075] In some embodiments, the additional therapy includes use of a weight loss device. Weight loss devices include, but are not limited to, gastric bands, gastric balloon systems, endoscopic suturing devices, oral bite limiting devices, and stomach space-occupying devices (e.g., Plenity®).
[0076] The one or more agent (e.g., N-acetyltaurine or a derivative, salt or prodrug thereof, or PTER modulating agent) and the one or more additional therapy (e.g., one or more additional drug therapy (e.g., GLP-1 agonist, weight loss drug), putting the subject on a low-calorie diet, increasing physical activity of the subject, surgical intervention, use of a weight loss device) may be administered concurrently, e.g., where they may be administered simultaneously. Alternatively, the one or more agent and the one or more additional therapy may be administered sequentially, e.g., where the agent (e.g., N- acetyltaurine or a derivative, salt or prodrug thereof, or PTER modulating agent) is administered before the additional therapy or the additional therapy is administered after the agent (e.g., N-acetyltaurine or a derivative, salt or prodrug thereof, or PTER modulating agent). Regardless of whether the agents and additional therapies are administered sequentially or simultaneously, or any effective variation thereof, the agents and additional therapies are considered to be administered together or in combination for purposes of the present invention.
[0077] In some embodiments, agents described herein (e.g., N-acetyltaurine or a derivative, salt or prodrug thereof, or PTER modulating agent) may be administered to a subject in need thereof, e.g., a subject identified as having a metabolic disorder or a subject identified as being at risk of having a metabolic disorder. Identifying a subject as having a metabolic disorder (e.g., obesity or an obesity-related disorder) may include diagnosing the subject as having the metabolic disorder. Metabolic disorders, such as obesity, may be diagnosed using a combination of one or more of: a physical exam, calculating body mass index (BMI), measuring waist size, checking for high blood pressure and / or high cholesterol and checking for diabetes.
[0078] Aspects of the methods described herein may further include assessment of the disease conditions in a subject, e.g., monitoring a subject’s response to administering an agent described herein (e.g., N-acetyltaurine or a derivative, salt or prodrug thereof, or PTER modulating agent) or monitoring changes in biological indicators that indicate a subject is a responder or non-responder to an agent described herein (e.g., N- acetyltaurine or a derivative, salt or prodrug thereof, or PTER modulating agent). For example, in embodiments where the disease is obesity, monitoring the subject’s response to an agent may include measuring body mass index (BMI), weight, food intake, adipose tissue mass, or measuring other biological indicators, such as N-acetyltaurine synthesis activity and / or N-acetyltaurine synthesis activity.
[0079] COMPOSITIONS
[0080] Aspects of the invention include pharmaceutical compositions. In some embodiments, the pharmaceutical composition includes N-acetyltaurine or a derivative, salt or prodrug thereof and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition includes a PTER modulating agent and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition includes N-acetyltaurine or a derivative, salt or prodrug thereof and a PTER modulating agent.
[0081] As discussed above, PTER modulating agents include PTER inhibitors and PTER silencing agents. In some embodiments, the PTER modulating agent is a PTER inhibitor. In some embodiments, the PTER inhibitors are antibodies, peptides or small molecules. In some embodiments, the PTER modulating agent is a PTER silencing agent. In some embodiments, the PTER silencing agent is a nucleic acid (e.g., an antisense oligonucleotide, siRNA, shRNA, miRNA or CRISPR / Cas guide RNA). In some embodiments, the PTER silencing agent is a CRISPR / Cas guide RNA, and the CRISPR / Cas guide RNA comprises the sequence GATGGAACCAGTATCAAGTG (SEQ ID NO: 1 ).
[0082] An agent (e.g., N-acetyltaurine or derivatives thereof, PTER modulating agents) can be formulated with an a pharmaceutically acceptable carrier (one or more organic or inorganic ingredients, natural or synthetic, with which a subject agent is combined to facilitate its application). A suitable carrier includes sterile saline although other aqueous and non-aqueous isotonic sterile solutions and sterile suspensions known to be pharmaceutically acceptable are known to those of ordinary skill in the art. An "effective amount" refers to that amount which is capable of ameliorating or delaying progression of the diseased, degenerative or damaged condition. An effective amount can be determined on an individual basis and will be based, in part, on consideration of the symptoms to be treated and results sought. An effective amount can be determined by one of ordinary skill in the art employing such factors and using no more than routine experimentation.
[0083] An agent can be administered as a pharmaceutical composition comprising a pharmaceutically acceptable excipient. The preferred form depends on the intended mode of administration and therapeutic application. The compositions can also include, depending on the formulation desired, pharmaceutically-acceptable, non-toxic carriers or diluents, which are defined as vehicles commonly used to formulate pharmaceutical compositions for animal or human administration. The diluent is selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, physiological phosphate-buffered saline, Ringer's solutions, dextrose solution, and Hank's solution. In addition, the pharmaceutical composition or formulation may also include other carriers, adjuvants, or nontoxic, nontherapeutic, nonimmunogenic stabilizers and the like.
[0084] A carrier may bear the agents in a variety of ways, including covalent bonding either directly or via a linker group, and non-covalent associations. Suitable covalent- bond carriers include proteins such as albumins, peptides, and polysaccharides such as aminodextran, each of which have multiple sites for the attachment of moieties. The nature of the carrier can be either soluble or insoluble for purposes of the invention.
[0085] Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyidimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3- pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG). Formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
[0086] Compositions may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared. The preparation also can be emulsified or encapsulated in liposomes or micro particles such as polylactide, polyglycolide, or copolymer for enhanced adjuvant effect, as discussed above. Langer, Science 249: 1527, 1990 and Hanes, Advanced Drug Delivery Reviews 28: 97-119, 1997. The agents of this invention can be administered in the form of a depot injection or implant preparation which can be formulated in such a manner as to permit a sustained or pulsatile release of the active ingredient. The pharmaceutical compositions are generally formulated as sterile, substantially isotonic and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.
[0087] Compositions may be prepared as an oral preparation. For oral preparations, the one or agents can be used alone or in combination with appropriate additives to make tablets, powders, granules or capsules, for example, with conventional additives, such as lactose, mannitol, corn starch or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators, such as corn starch, potato starch or sodium carboxymethylcellulose; with lubricants, such as talc or magnesium stearate; and if desired, with diluents, buffering agents, moistening agents, preservatives and flavoring agents.
[0088] Oral preparations compatible for use with the agents (e.g., N-acetyltaurine or a derivative, salt or prodrug thereof, or PTER modulating agent) of the present invention may include components or excipients, as well as other non-reusable materials that may be considered either as an ingredient or packaging. Oral preparations include liquid, solid, and semi-solid dosage forms. Types of oral preparations include, but are not limited to, a pill, a tablet, a capsule, a gel, a paste, a drink, and a syrup. In some instances, an oral preparation is provided that is designed and configured to achieve delayed release of the agents (e.g., N-acetyltaurine or a derivative, salt or prodrug thereof, or PTER modulating agent) in the small intestine of the subject.
[0089] EXPERIMENTAL
[0090] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.
[0091] General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001 ); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference. Reagents, cloning vectors, cells, and kits for methods referred to in, or related to, this disclosure are available from commercial vendors such as BioRad, Agilent Technologies, Thermo Fisher Scientific, Sigma-Aldrich, New England Biolabs (NEB), Takara Bio USA, Inc., and the like, as well as repositories such as e.g., Addgene, Inc., American Type Culture Collection (ATCC), and the like.
[0092] Taurine is a conditionally essential micronutrient and one of the most abundant amino acids in humans1-3. In endogenous taurine metabolism, dedicated enzymes are involved in biosynthesis of taurine from cysteine as well as the downstream metabolism of taurine into taurine-containing metabolites45. One such downstream taurine metabolite is N-acetyltaurine, an amidated conjugate of taurine and acetate6. While taurine N- acetyltransferase activity has been previously detected in mammalian cells6 7, the molecular identity of this enzyme, and its potential physiologic relevance, have remained unknown. Here it is shown that the body mass index-associated orphan enzyme PTER8(phosphotriesterase-related) is the principal mammalian taurine N- acetyltransferase / hydrolase. In vitro, recombinant PTER catalyzes bidirectional taurine N-acetylation with free acetate, as well as the reverse N-acetyltaurine hydrolysis reaction. Genetic ablation of PTER in mice results in complete loss of taurine N- acetyltransferase / hydrolysis activities and concomitant >2-10-fold elevation of N- acetyltaurine levels across tissues. Upon dietary or physiologic stimuli that increase taurine levels, PTER-KO mice exhibit lower body weight and reduced adiposity. These phenotypes can also be recapitulated by administration of N-acetyltaurine to wild-type mice. Together, these data define a PTER-dependent pathway of taurine metabolism linked to energy balance. These studies uncover enzymatic regulation of a previously enigmatic pathway of taurine metabolism. A unifying biochemical mechanism to explain the genetic association between PTER and body mass index is provided. Lastly, this PTER-dependent taurine pathway highlights an under-appreciated role for taurine metabolites in the physiologic effects of taurine.
[0093] Example 1 - Biochemical purification of a taurine N-acetyltransferase / hydrolase activity from kidney
[0094] To identify the enzyme(s) that mediates interconversion of taurine and N- acetyltaurine, an in vitro enzyme activity-guided approach was used to detect and purify a taurine N-acetyltransferase / hydrolase activity from mouse tissues (FIG. 1A). Total tissue homogenates were prepared from 13 diverse mouse tissues. In the presence of taurine (10 mM) and acetate (10 mM) as substrates, tissue homogenates were assayed for the enzymatic formation of N-acetyltaurine by liquid chromatography-mass spectrometry (LC-MS). Most tissues had minimal or undetectable enzyme activity (FIG. 1 B). By contrast, robust taurine N-acetyltransferase activity was observed in the kidney (200 nmol / min / mg), and, to a lower extent, the liver and the quadriceps muscle (20-80 nmol / min / mg) (FIG. 1B). The observed activity in the kidney was higher using sodium acetate as a substrate, rather than acetyl-CoA (FIG. 1C). Lastly, because the formation of the amide bond of N-acetyltaurine is reversible, tissue homogenates were also tested for the reverse N-acetyltaurine hydrolysis activity. FIG. 1 D shows that once again the kidney was the tissue where the highest N-acetyltaurine hydrolysis activity was observed. In addition, low levels of N-acetyltaurine hydrolysis was observed across multiple other tissue lysates. Thus, kidney tissues exhibit a robust taurine N-acetyltransferase / hydrolase biochemical activity.
[0095] Next, the enzyme with renal taurine N-acetyltransferase / hydrolase activity was purified. Towards this end, fractionation of kidney tissues into a supernatant, cytosolic fraction and a 100,000 x g membrane fraction revealed concomitant enrichment of N- acetyltaurine synthesis and hydrolysis activities in the supernatant fraction (FIGS. 6A, 6B). The supernatant fraction was subjected to sequential anion exchange and size exclusion chromatography. In anion exchange, a single peak of taurine N- acetyltransferase activity could be detected that peaked in fractions #15-20; the reverse N-acetyltaurine hydrolysis activity exhibited an identical elution profile (FIG. 1 E). Next, the fractions with peak activity (#17-19 inclusive) were pooled and subjected to size exclusion chromatography. Once again, a single peak of activity was observed that centered around fraction #20 in both synthesis and hydrolysis directions (FIG. 1 F). These data suggest that the same renal enzyme, rather than two distinct enzymes, catalyzes both taurine N- acetyltransferase and N-acetyltaurine hydrolysis activities.
[0096] The active fraction #20 was analyzed by shotgun proteomics. In total, 247 proteins with at least 1 peptide match were identified (data not shown). FIG. 1G shows the ranking of these proteins by Byonic P-values which measures the likelihood of a protein identification by random chance. The highest-ranking enzymes within this list were EST2C (CES2C, rank #2), CNDP2 (rank #3) and PTER (rank #6). EST2C (acylcarnitine hydrolase) is a serine hydrolase that catalyzes the hydrolysis of hydrophobic small molecules including acylcarnitines and triglycerides26. CNDP2 (carnosine dipeptidase 2) is an in vitro dipeptidase and in vivo biosynthetic enzyme for signaling metabolite N- lactoyl-phenylalanine27’28. PTER (phosphotriesterase-like) is annotated as a putative metal-dependent hydrolase of unknown enzymatic activity or function.
[0097] Example 2 - PTER is a bidirectional taurine N-acetyltransferase / hydrolase
[0098] PTER was a high priority enzyme candidate for the taurine N- acetyltransferase / hydrolase activity because PTER protein, as detected using an anti- PTER antibody, co-eluted with the chromatographic activity (FIGS. 1H, 11). By primary amino acid sequence, mouse PTER exhibits homology with other bacterial phosphotriesterases (PTEs) whose in vitro substrates include organophosphate compounds2930. To determine whether mouse PTER can catalyze taurine N- acetyltransferase / hydrolase activity, HEKT293T cells were transfected with epitopetagged PTER cDNA. As controls, HEKT293T cells were transfected with epitope-tagged cDNAs for the other two candidates identified by shotgun proteomics, EST2C and CNDP2. Following validation of protein expression by Western blot (FIG. 1J), transfected cell lysates were assayed for enzyme activity by LC-MS. Cell lysates from cells transfected with PTER exhibited dramatically increased N-acetyltaurine levels following incubation with acetate and taurine (FIG. 1 K). By contrast, a similar taurine N- acetyltransferase activity was not observed in cell lysates following EST2C or CNDP2 transfection. In the hydrolysis direction, PTER-transfected cell lysates also exhibited robust production of taurine following incubation with N-acetyltaurine (FIG. I L); once again, this activity was absent in EST2C- and CNDP2-transfected cell lysates. PTER protein co-elutes with the kidney taurine N-acetyltransferase / hydrolase activity. In addition, cell lysates from PTER-transfected cells exhibit both taurine N-acetyltransferase and N-acetyltaurine hydrolysis activities in vitro.
[0099] In the course of the cellular experiments in HEK293T cells, it was observed that GFP-transfected cells exhibited a basal taurine N-acetyltransferase / hydrolase activity that was greater than the background signal (e.g., heat-inactivated GFP-transfected lysates, FIGS. 6C, 6D). To directly test if basal enzyme activity observed in this cell line may be due to its endogenous expression of human PTER, Cas9 / CRISPR was used to generate PTER-KO HEK293T cells. Ablation of PTER in the pool was confirmed using an anti-hPTER polyclonal antibody (FIG. 1M). Cell lysates prepared from PTER-KO cells also exhibited complete loss of taurine N-acetyltransferase / hydrolase activity compared to control cells (FIGS. 1M, 1 N). These loss-of-function studies demonstrate that PTER is also necessary for the endogenous taurine N-acetyltransferase / hydrolase activity in HEK293T. Based on these data, FIG. 10 shows the new biochemical assignment of PTER as a taurine N-acetyltransferase / hydrolase within the context of the endogenous pathways of taurine metabolism.
[0100] Example 3 - Enzymology and mutagenesis of recombinant PTER
[0101] To determine if the entire N-acetyltransferase / hydrolase activity is encoded solely by the PTER polypeptide, or whether additional protein co-factors might be required, purified recombinant mouse PTER were generated by heterologous expression in bacteria. Recombinant mPTER was >95% pure as evaluated by SDS-PAGE (FIG. 7A). Next, LC-MS was used to measure the enzyme activity of recombinant PTER. First, the equilibrium constant (K) of the reversible taurine N-acetyltransferase / hydrolase reaction was determined. The equilibrium constant was measured to be 0.12 M-1(FIG. 2A) which is comparable to equilibrium constants measured in other reversible amidase reactions31. Next, kinetic studies with the recombinant PTER enzyme were performed. Substrate concentration-dependent formation of N-acetyltaurine with Km of 1 1 and 64 mM and Kcat of 1000 s’1and 5900 s-1was observed for acetate and taurine, respectively (FIGS. 2B, 2C). In the reverse hydrolysis direction, a comparable catalytic activity (Kcat = 2500 s-1) was measured. The affinity between PTER and N-acetyltaurine was significantly higher (Km = 400 pM) than that previously observed between PTER and either acetate or taurine (FIG. 2D). Therefore, recombinant PTER polypeptide alone is sufficient to produce a functional taurine N-acetyltransferase / hydrolase enzyme without the need for additional protein co-factors. In addition, recombinant PTER exhibits kinetic characteristics similar to previously reported amidase-type enzymes.
[0102] Next, the substrate specificity of recombinant PTER was evaluated using a panel of amino acid and organic acid substrates. On the amino acid side, taurine was the substrate used when incubated with PTER and acetate (FIG. 2E). Little to no activity was observed when other amino acids were tested (FIG. 2E). On the N-acyl donor side, high PTER specificity for acetate was observed (FIGS. 2E, 2F). PTER did not catalyze taurine N-acylation with butyrate, longer chain fatty acids, or sterol-based acyl donors as substrates (FIG. 2F). Lastly, the substrate specificity of PTER in the hydrolysis direction was tested. As shown in FIG. 2G, PTER catalyzed robust N-acetyltaurine hydrolysis. PTER also catalyzed the hydrolysis of several other N-acetyl amino acids but at much lower rates (<20%) compared to N-acetyltaurine. No activity was observed for the vast majority of other substrates tested, including long chain N-fatty acyl taurines. These data demonstrate that PTER exhibits high substrate specificity for taurine, acetate, and N- acetyltaurine, but not other related acyl donors or amino acid head groups.
[0103] To determine the active site residues important for PTER enzyme activity and bidirectionality, N-acetyltaurine was docked into an Alphafold-modeled PTER32(FIG. 7B). The predicted protein structure revealed a single entry to the buried active site cavity with a narrow opening (diameter < 3 A). For these docking and modeling purposes, zinc was selected as the divalent metal cation. Several active site residues with potential interactions with N-acetyltaurine (e.g., H300, R233, R204), the metal cation (e.g., H26, H28, E169), as well as other active site residues that were proximal to the substrate (e.g., L255, Y65, T258) were identified (FIG. 2H). To determine the contribution of these active site side chain interactions to PTER enzyme catalysis, a total of 15 bacterial recombinant mouse PTER proteins with point mutations in these residues were generated. These recombinant enzymes were then assayed for taurine N-acetyltransferase / hydrolase activity in vitro (FIGS. 2I, 2J). In general, the expression of all of these point mutants, with the exception of R233A, was comparable to that of WT PTER (FIG. 21). An H28F completely abolished both synthesis and hydrolysis activity; this histidine corresponds with a residue that is predicted to chelate divalent metal cations in the active site. Interestingly, several mutants, exemplified by R304K and Y263F, that maintained a moderate residual activity (~20-60%) in the synthesis direction, but had completely abolished hydrolytic activity were identified (FIGS. 21, 2J). In conclusion, mutagenesis of specific active site residues, including H28, is sufficient to completely ablate PTER enzyme activity, while mutagenesis of others leads to functional dissociation of PTER- dependent N-acetyltaurine synthesis and hydrolysis activities.
[0104] Example 4 - PTER is a physiologic N-acetvItaurine hydrolase in mice
[0105] Global PTER-KO mice were obtained to determine the potential physiologic relevance of PTER-dependent taurine N-acetyltransferase / hydrolase activities. These animals were produced by the International Mouse Phenotyping Consortium (IMPC) but had not been previously studied. Overall, PTER-KO mice were born in the expected Mendelian ratios and overtly normal in their home cage behavior. Using an anti-PTER antibody, the highest PTER protein levels were detected in liver and kidney tissues of WT mice (FIG. 3A), which corresponds exactly with the same tissues where high taurine N- acetyltransferase / hydrolase activity were originally detected (FIG. 1 B). As expected, complete loss of PTER protein was observed in these two tissues from PTER-KO mice (FIG. 3A). Next, taurine N-acetyltransferase / hydrolase activities was measured in WT and PTER-KO kidney and livers. In the synthesis direction, PTER-KO mice exhibited complete loss of taurine N-acetyltransferase activity in both tissues (FIG. 3B). Similarly, the PTER- KO mice exhibited a dramatic reduction of N-acetyltaurine hydrolysis activity in both tissues (FIG. 3C). Therefore, PTER is the principal enzyme responsible for tissue taurine N-acetyltransferase / hydrolase activities in vivo.
[0106] Next, it was determined whether genetic PTER deficiency alters N-acetyltaurine levels in vivo and, if so, the directionality of the effect. Because other bidirectional amidases have been shown to be both physiologic synthetases as well as degradases2831’33, depending on the specific substrate, it initially remained unclear whether the N-acetyltransferase or hydrolase activity of PTER would be biochemically dominant in a complex physiologic setting. Therefore, targeted metabolomics was used to measure endogenous N-acetyltaurine levels across multiple tissues. As shown in FIG. 3D, in every tissue examined from PTER-KO an elevation of N-acetyltaurine was observed which, by magnitude, ranged from 2-fold (in spleen) to >10-fold (in blood). Therefore, PTER predominantly functions as an N-acetyltaurine hydrolase in vivo.
[0107] To understand if the elevation of N-acetyltaurine in PTER-KO mice might also result in changes to taurine levels and / or other taurine pathway metabolites, targeted metabolomics was used to measure tissue levels of taurine as well as several taurine pathway metabolites (hypotaurine, cysteine sulfinic acid, and cysteic acid) in tissues from WT and PTER-KO mice. Levels of taurine itself did not exhibit any significant genotypedependent changes in any tissue examined (FIG. 3E). Both hypotaurine and cysteine sulfinic acid also in general did not exhibit any changes across tissues from PTER-KO mice, although specific tissues were identified where levels of hypotaurine (epididymal white fat) or cysteine sulfinic acid (heart, brown fat) exhibited modest genotypedependent changes. Finally, cysteic acid could be detected in a subset of tissues and its levels were unaltered in PTER-KO mice.
[0108] Lastly, because PTER also exhibited modest hydrolysis activity in vitro for four additional N-acetyl amino acid including N-acetylleucine, isoleucine, methionine, and valine, targeted metabolomics was used to measure the levels of these N-acetylated amino acids in WT and PTER-KO mice. As shown in FIG. 3E, levels of N- acetylmethionine were largely unaltered in PTER-KO tissues, except for a small reduction of N-acetylmethionine in the spleen. Levels of N-acetylvaline, N-acetylleucine and N- acetylisoleucine were also unchanged in PTER-KO mice across all tissues examined. In conclusion, genetic PTER deficiency results in broad changes in N-acetyltaurine levels across all tissues, and more minor and tissue-specific changes in select taurine pathway metabolites and N-acetylmethionine.
[0109] Example 5 - Reduced body weight, adiposity, and food intake in PTER-KQ mice
[0110] Next, after establishing PTER as the principal taurine N- acetyltransferase / hydrolase in mice, the potential functions of the downstream biochemical pathway of taurine metabolism were investigated. Previously, Meyre et al. identified a polymorphism near the human PTER gene linked to early-onset and morbid adult obesity in N=14,000 European subjects8. Further substantiating these initial associations, in the Type 2 Diabetes Knowledge Portal the PTER gene exhibits a very strong Human Genetic Evidence (HuGE) score linked to with body mass index (BMI) (FIG. 8A). These genetic data, and the prior literature of taurine supplementation associated with energy balance and metabolism, suggested that the PTER pathway might be involved in body weight and / or energy balance regulation.
[0111] To test the hypothesis that PTER controls energy balance, a cohort of PTER-KO and WT littermates were placed on a high fat diet and monitored body weights and food intake over an eight-week period. After 8 weeks, food intake in PTER-KO mice was significantly reduced by a modest magnitude (~7%) and body weights trended lower, but did not reach statistical significance (FIGS. 8B, 8C). Because taurine is a substrate for the PTER-catalyzed reaction, taurine flux was increased to investigate whether these trends in body weight and food intake in PTER-KO mice might be more robustly revealed. New cohorts of WT and PTER-KO mice were placed on a high-fat diet and also supplemented taurine in the drinking water (2.5% w / v). Under these taurine- supplemented conditions, body weights and food intake of PTER-KO mice exhibited a more marked and more significant divergence from WT mice. After 8 weeks, PTER-KO mice had -20% lower body weight increase mice as well as a concomitant -20% reduction of food intake compared to WT littermates (mean ± SEM; body weight: WT +23.9 ± 0.7g, PTER-KO +18.9 ± 0.9g, P = 0.018; food intake: WT +160.2 ± 4.6g, PTER- KO +140.2 ± 1.4g, P = 0.049) (FIGS. 4A, 4B and 8D). Importantly, water intake was equivalent between genotypes (mean ± SEM; WT +165.0 ± 5.7g, PTER-KO +164.9 ± 4.7g, P = 0.431 ) (FIG. 8E), demonstrating that the reduced food intake in PTER-KO mice was specific for nutrients rather than all ingestion behaviors. Dissection of tissues at the end of the experiment revealed that the difference in body weight was due entirely to reduction of fat mass in PTER-KO mice (FIGS. 4C, 4D), including lower inguinal and epididymal white adipose tissue (iWAT and eWAT, respectively), with no changes in lean mass detected. Lastly, LC-MS confirmed that the taurine-supplementation protocol did indeed increase circulating taurine levels equivalently in both WT and PTER-KO mice (FIG. 4E). In addition, levels of plasma N-acetyltaurine in PTER-KO mice after taurine- supplemented water were elevated to a level higher than that observed in both WT, taurine-supplemented levels as well as PTER-KO levels without taurine supplementation (FIG. 4F).
[0112] Next, metabolic chambers were used to measure parameters of whole-body energy intake and expenditure in a new cohort of PTER-KO and WT mice on taurine- supplemented water. Importantly, the metabolic analysis was performed at a time point prior to the divergence in body weights (4 weeks) (FIG. 9A). As expected, PTER-KO mice once again exhibited reduced food intake (FIG. 9B). Changes were not observed for any other measured parameter including VO2, VCO2, respiratory exchange ratio or ambulatory movement (FIGS. 9C-9F). Lastly, changes in circulating levels of leptin, ghrelin, or GDF15 in PTER-KO mice were not observed (FIGS. 9G-9I), demonstrating that the reduced food intake observed in these animals is not associated with concomitant changes in polypeptide hormones previously linked to feeding regulation.
[0113] As a second and independent test of the stimulus-dependent body weight phenotype in PTER-KO mice, a new cohort of WT and PTER-KO mice were subjected to a combined high fat diet and treadmill running protocol. Treadmill exercise was selected as a second and physiologic stimulus because of its previously reported effects to increase taurine levels7 17(see Methods). No differences were observed in running speed or distance in WT and PTER-KO mice (FIGS. 10A-10C). It was once again observed that PTER-KO mice gained less weight and had lower food intake compared to WT mice (mean ± SEM; body weight: WT +14.8 ± 0.5g, PTER-KO +1 1 .2 ± 0.5g, P = 0.002; food intake: WT +116.1 ± 1.1 g, PTER-KO +98.6 ± 0.7g, P = 0.022) (FIGS. 4G, 4H and 10D), which was a similar phenotype to that observed in the experiment with taurine supplementation in water. Dissection of tissues also revealed that the weight difference is once again largely due to reductions in adipose tissue mass (FIGS. 4I-4J). Lastly, with the treadmill running protocol, taurine levels increased by ~2-fold in both WT and PTER- KO mice (FIG. 4K); once again, plasma N-acetyltaurine levels in the PTER-KO / exercise mice reached a level much higher than that of WT mice (with or without exercise) or even sedentary PTER-KO mice (FIG. 4L). In conclusion, PTER-KO mice have reduced adiposity, body weight, and food intake in a stimulus-dependent manner and specifically under physiologic conditions that result in increased taurine levels.
[0114] Example 6 - N-acetyltaurine administration to obese mice recapitulates the energy balance phenotype of PTER-KO mice
[0115] Next, as it was shown that the accumulation of N-acetyltaurine is the major metabolite difference between WT and PTER-KO mice, it was investigated whether N- acetyltaurine administration alone was sufficient to reproduce aspects of the energy balance phenotype in PTER-KO mice. N-acetyltaurine was administered to diet-induced obese (DIO) mice (1 -50 mg / kg / day, intraperitoneally). After a single administration of N- acetyltaurine, plasma N-acetyltaurine levels robustly increased and peaked at a concentration of ~30 pM (at the 15 mg / kg dose) and ~60 pM (at the 50 mg / kg dose) one hour after dosing (FIG. 11 A) without any changes to plasma taurine levels (FIG. 11 B). Upon chronic daily dosing, DIO mice treated with N-acetyltaurine exhibited dosedependent reduction of both body weight (FIG. 5A) and food intake (FIG. 5B). At the end of the 1 -week experiment, mice treated at the 15 and 50 mg / kg dose exhibited a -1.2 ± 0.2 g and -2.7+ / -0.5 g (mean ± SEM), reduction of body weight respectively, whereas vehicle treated mice gained a small amount of weight over the same time (+0.3 ± 0.2g, mean + / - SEM). A similar trend was observed for the cumulative food intake, where the 15 and 50 mg / kg doses resulted in -12% and -25% reduction, respectively, compared to vehicle-treated mice.
[0116] To determine if the effect of N-acetyltaurine required the intact amidated conjugate, head-to-head comparisons of the effects of N-acetyltaurine with either acetate alone or taurine alone were performed. All compounds were dosed all at the same dose (15 mg / kg / day). Once again, N-acetyltaurine-treated mice exhibited reduced food intake and body weight, whereas mice treated with either acetate alone or taurine alone were indistinguishable from vehicle-treated mice (FIGS. 5C, 5D). Dissection of tissues at the end of this experiment once again revealed lower iWAT and eWAT mass in N- acetyltaurine-treated mice without any changes in the mass of the other organs (FIG. 5E). In conclusion, administration of N-acetyltaurine to wild-type, DIO mice is sufficient to reduce body weight, adiposity, and food intake.
[0117] Materials and methods
[0118] Cell line cultures. HEK293T cell line was obtained from the American Type Culture Collection (ATCC) and grown at 37 °C with 5% CO2. The culture medium consists of Dulbecco’s modified Eagle’s medium (Corning, 10-017-CV) with 10% FBS (Corning, 3501 OCV) and 1 :1000 penicillin-streptomycin (Gibco, 15140-122). For transient transfection, cells were transfected in 10 cm2at ~60% confluency using PolyFect (Qiagen, 301107) and washed with complete culture medium 6 h later. The HEK293T cells were negative following testing for mycoplasma contamination.
[0119] Generation of PTER-KO cells. The pLentiCRISPRv2 system was used to generate PTER- KO HEK293T cells. The single guide RNA (sgRNA) used was 5'- GATGGAACCAGTATCAAGTG-3' (SEQ ID NO: 1 ). The following oligonucleotides were used to clone the sgRNA into the plentiCRISPRv2 vector: forward, 5'- CACCGGATGGAACCAGTATCAAGTG-3' (SEQ ID NO: 2); reverse, 5'- AAACCACTTGATACTGGTTCCATCC-3' (SEQ ID NO: 3). Lentiviral particles were produced in the HEK293T cell line using Polyfect for the co-transfection of the cloned plentiCRISPRv2 plasmid with the viral packing psPAX2 plasmid and the viral envelope pMD2.G plasmid. A plentiCRISPRv2 plasmid without any sgRNA insert was used as a negative control. Medium containing lentivirus was collected 48 h after transfection and filtered through a 0.45-pM filter. The supernatant was then mixed in a 1 :1 ratio with polybrene (Sigma, TR-1003-G) to a final concentration of 8 pg / ml polybrene. The viral mixture was added to HEK293T cells at 40-50% confluence in 6-well plates. Transduced cells were transferred to a 10 cm2plate and subjected to puromycin selection for a period of 3-6 days. Surviving cells were then trypsinized, resuspended and plated at a 10,000x dilution to a new 10 cm2plate. Two weeks later, individually distinguishable colonies were visually identified and then transferred to a 96-well plate using a sterile pipette tip. Finally, single HEK293T cell clones exhibiting complete loss of endogenous PTER protein were confirmed via Western blotting using a polyclonal anti-PTER antibody (Invitrogen, TR- 1003-G).
[0120] Western blotting. For analyzing samples from cell culture, cells were collected and lysed by probe sonication. Cell lysates were centrifuged at 13,000 rpm for 10 min at 4 °C. The supernatant was collected, boiled for 10 min at 95 °C in 4x NuPAGE LDS Sample Buffer (ThermoFisher, NP0008) supplemented with 100 mM DTT (Sigma, D0632-1 G). For analyzing samples of mice, blood was obtained through submandibular bleeding using a 21 G needle (BD, 305129) into lithium heparin tubes (BD, 365985). Blood was subsequently spun down at 5,000 rpm for 5 min at 4 °C to retrieve the supernatant plasma fractions. All tissues were dissected, weighed on a scale, collected into Eppendorf tubes, and immediately frozen on dry ice and stored at -80 °C. Adipose tissues were preserved in 4% paraformaldehyde (FisherScientific, AAJ19943K2) for histology analysis. Tissues were then mixed with 0.5 ml of cold RIPA buffer and homogenized using a Benchmark BeadBlaster Homogenizer at 4 °C. The mixture was spun down at 13,000 rpm for 10 min at 4 °C to pellet the insoluble materials. The supernatant was quantified using a tabletop Nanodrop One and analyzed by western blot. Proteins were separated on NuPAGE 4- 12% Bis-Tris gels and transferred to nitrocellulose membranes. Equal loading was ensured by staining blots with Ponceau S solution. Blots were then incubated with Odyssey blocking buffer for 30 min at room temperature and incubated with primary antibodies (1 :1000 dilution rabbit anti-PTER antibody (Invitrogen, PA5-20750), 1 :5000 dilution rabbit anti-p-actin antibody (Abeam, ab8227), 1 :5000 dilution mouse anti-Flag antibody (Sigma, F1804-200UG), 1 :1000 dilution rabbit anti-6xHis antibody (Abeam, ab9108)) in blocking buffer overnight at 4 °C. Blots were washed three times with PBST (0.05% Tween-20 in PBS) and stained with species-matched secondary antibodies (1 :10000 dilution goat anti-rabbit IRDye 800RD (LI-COR, 925-68070) and 1 :10000 dilution goat anti-mouse IRDye 680RD (LI-COR, 925-68070)) at room temperature for 1 h. Blots were further washed three times with PBST and imaged with the Odyssey CLx Imaging System.
[0121] Generation of recombinant mPTER proteins. mPTER gene (Uniprot Q60866) was codon optimized to ensure bacterial expression and was synthesized as gBIocks with IDT. The gene fragment was then inserted into the pET-20b vector containing a C- terminal hexa- Histidine (His) tag. DNA sequences encoding a Strep tag were cloned into the N-terminus of mPTER for Strep-Tactin-based purification. BL21 competent bacteria (ThermoScientific, EC0114) were used to transform pET-20b-mPTER plasmids and subsequently cultured in LB medium with ampicillin at 37 °C on a shaker overnight. BL21 cells were then transferred to autoinduction medium, which consisted of the following components: 10 g tryptone (FisherScientific, BP1421 -500), 5 g yeast extract (FisherScientific, BP1422-500), 2 ml MgSO4 (1 M), 1 ml metal solution (0.05 M Feccir citrate, 0.02 M CaCk, 0.02 M ZnSO4, 2 pM C0CI2, 2 pM CuSC , 2 pM NiCh, 2 pM Na2MoO4, 2 pM Boric acid), 20 ml salt solution (167.5g Na2HPO4, 85g KH2PO4, 53.4g NH4CI and 17.8g Na2SO4 in 500 ml water in total) and 20 ml sugar solution (125 g glycerol, 12.5 g glucose and 50 g a-lactose in 500 ml water in total) in a total volume of 1 L. The bacteria were cultured until the optical density value reached a range of 0.5 to 0.7. Bacteria were subsequently incubated at 15 °C overnight before being spun down at 8,000 rpm for 30 min at 4 °C. Bacteria were then lysed in PBS through probe sonication on ice to release cytosolic proteins. Soluble fractions were isolated via high-speed centrifugation at 15,000 rpm for 30 min at 4 °C. And they were run down a Nickel column using an AKTA pure™ chromatography system. The elution was performed from 0 mM to 300 mM NaCI in PBS over a gradient involving 60 column volumes. Fractions containing mPTER proteins were pooled together before undergoing another round of purification. This step involved running fractions down columns loaded with Strep-Tactin resins (IBA, 2-1208-002), following the manufacturer’s instructions. The bound mPTER proteins were eluted by 2.5 mM D-Desthiobiotin before passing through a HiPrep 16 / 60 Sephacryl S-200 size-exclusion column (Sigma, GE17-1 166-01 ) in buffer containing 25 mM Tris and 100 mM NaCI. Finally fractions containing monomeric mPTER recombinant proteins were pooled together and subjected to SDS-PAGE gel electrophoresis to ensure >95% purity was achieved. The recombinant proteins were aliquoted and stored at -80 °C for subsequent enzymatic assays.
[0122] Enzymatic assays. A total of 100 pg of proteins derived from cell or tissue lysates, or 100 ng of recombinant mPTER proteins, or 50 pl of chromatography fractions were subjected to incubation in a 50 pl PBS solution at 37°C for 1 hour. For assays using kidney membrane and soluble fractions, total kidney homogenates were transferred into ultracentrifuge inserts and spun at 100,000 x g on a Beckman Centrifuge I8-70M for 1 hr at 4°C. The supernatant was quantified as the kidney soluble fraction and the pellet was resuspended thoroughly in PBS and measured using a using a tabletop Nanodrop One. 10 mM taurine (Sigma, T0625-100G) and 10 mM acetate (Sigma, S2889-250G) were added for N-acetyltaurine synthesis. 100 pM N-acetyltaurine (Cayman, 35169) was added for assaying hydrolysis. For assays testing the substrate scope of mPTER synthesis, 10 mM L-isoleucine (Sigma, 12752-1 G), L-methionine (Sigma, M5308-25G), L-leucine (Sigma, L8000-25G), L-valine (Sigma, V-0500), L-phenylalanine (Alfa Aesar, A13238), L-tyrosine (ThermoScientific, A11 141 .22), L-serine (Aldrich Chemical Company Inc, S260-0), L-proline (Sigma, P0380-100G), L-threonine (Sigma, T8625-1 G), L-alanine (Sigma, A7627-1 G), p-alanine (Sigma, 05160-50G), L-arginine (Sigma, A5006-100G), L- cysteine (Sigma, 168149-25G), L-glutamic acid (Sigma, 49621 -250G), L-glutamine (Sigma, G-3126), L-histidine (Sigma, H-8000), L-tryptophan (Sigma, T0254-5G), glycine (FisherChemical, G48-212), L-asparagine (Sigma, A0884-25G), L-lysine (Sigma, L5501 - 5G), L-aspartic acid (United States Biochemical Corporation, 11625) were individually incubated with 10 mM acetate; 10 mM butyrate (Sigma, B5887-1 G) was incubated with 10 mM taurine; 1 mM palmitate (Sigma, P9767-5G), oleate (Sigma, 07501 -1 G), stearate (Sigma, S3381 -5G), arachidonate (Sigma, 10931 ), lithocholate (Cayman, 20253), a- muricholate (Cayman, 20291 ) and taurocholate (Cayman, 16215) were individually incubated with 100 mM taurine. For assays testing the substrate scope of mPTER hydrolysis, 100 pM N-acetyl-L-isoleucine (Alfa Aesar, H66771 ), N-acetyl-L-methionine (Sigma, 01310-5G), N-acetyl-L-leucine (Sigma, 441511 -25G), N-acetyl-L-valine (Alfa Aesar, H66943), N-acetyl-L-phenylalanine (Sigma, 857459-5G), N-acetyl-L-tyrosine (Sigma, PHR1 173-1 G), N-acetyl-L-serine (Sigma, A2638-1G), N-acetyl-L-proline (Sigma, A0783-1 G), N-acetyl-L-threonine (CHEM-IMPEX INT’L INC, 03262), N-acetyl-L-alanine (Sigma, A4625-1 G), N-acetyl-[3-alanine (ThermoScientific, H50208.03), N-acetyl-L- arginine (Sigma, A3133-5G), N-acetyl-L-cysteine (Sigma, A7250-25G), N-acetyl-L- glutamic acid (Sigma, 855642-25G), N-acetyl-L-glutamine (Sigma, A9125-25G), N- acetyl-L-histidine (Alfa Aesar, J65657), N-acetyl-L-tryptophan (Sigma, A6376-10G), N- acetyl-glycine (Sigma, A16300-5G), N-acetyl-L-asparagine (Sigma, 441554-1 G), N- acetyl-L-lysine (Sigma, A2010-1 G), N-acetyl-L-aspartic acid (Sigma, 00920-5G), N- butyryl-taurine (Acme, AB 38328), N-palmitoyl-taurine (Cayman, 1000561 1 ), N-oleoyl- taurine (Cayman, 10005609), N-stearoyl-taurine (Cayman, 10005610), N-arachidonoyl- taurine (Cayman, 10005537), taurolithocholic acid (Cayman, 17275), tauro-a-muricholic acid (Cayman, 20288) and taurocholic acid (Cayman, 16215) were used. Reactions were then quenched and metabolites were extracted by 150 pl of a 2:1 mixture of acetonitrile:methanol. The mixture was spun down at 15,000 rpm for 30 min at 4 °C. The supernatant was subsequently transferred to mass spec vials and ready for LC-MS analysis.
[0123] Molecular docking. The AlphaFold-predicted structure of murine PTER (AF- Q60866-F1 ) was used to search for proteins with structural or sequence homology, using FoldSeek and Blast respectively. The top-predicted structural match from the PDB as identified by FoldSeek was PDB 3K2G, a Resiniferatoxin-binding protein isolated from Rhodobacter sphaeroides. This crystal structure, along with annotation in uniprot, and metal binding-site prediction using MIB2, all indicated the presence of 2 zinc ions in the active site of PTER. Molecular docking was performed with CB-Dock2, an online docking server using curvature-based cavity prediction followed by AutoDock Vina-based molecular docking. The substrate compounds N-acetyltaurine was prepared as a SDF file, and the AlphaFold-predicted protein structure for PTER was prepared as a PDB file. Ligand-receptor docking was performed using CB-Dock2 following the standard procedure. Ligand-receptor docking results were evaluated visually for biochemical feasibility and docking results with the lowest Vina score were accepted. The predicted docking poses were evaluated using pymol3.7, and the predicted active site resides were identified for mutation. mPTER mutagenesis. A Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) was used to introduce mutations in amino acid residues predicted to play a role in stabilizing zinc ions, interacting with N-acetyltaurine, or spatially constraining the active site of mPTER. The introduced mutations were subsequently verified through plasmid sequencing conducted by Genewiz.
[0124] Activity-guided fractionation. 6 kidneys from 10 to 14-week-old male C57BL / 6J mice were homogenized homogenized using a Benchmark BeadBlaster Homogenizer at 4 °C. The cytosolic fraction was obtained using high-speed centrifugation at 15,000 rpm for 30 min at 4 °C. Then the mixture was concentrated using 3 kDa filter tubes (Millipore, UFC900324) by spinning down at 4,000 rpm for 1 h. The concentrated sample was diluted 50x into buffer containing 20 mM Tris pH 7.5 prior to anion exchange on a 1 -ml HiTrap Q column (Cytiva, GE29-0513-25). The elution was performed from 0 mM to 500 mM NaCI in 20 mM Tris pH 7.5 over a gradient involving 30 column volumes. Following anion exchange, each fraction was evaluated for N-acetyltaurine synthesis and hydrolysis activities as described above. 3 fractions with the highest enzymatic activities were combined, concentrated and subjected to size exclusion on a Superose 6 Increase 10 / 300 GL column (Cytiva, GE29-0915-96). Each fraction from size exclusion was again evaluated for N-acetyltaurine synthesis and hydrolysis activity. The most active fraction was subjected to LC-MS analysis at the Vincent Coates Foundation Mass Spectrometry laboratory, Stanford University Mass Spectrometry.
[0125] Shotgun proteomics. Samples were reduced with 10 mM dithiothreitol (DTT) for 20 minutes at 55 degrees Celsius, cooled to room temperature and then alkylated with 30 mM acrylamide for 30 minutes. They were then acidified to a pH ~1 with 2.6 ul of 27% phosphoric acid, dissolved in 165 uL of S-trap loading buffer (90% methanol / 10% 1 M triethylammonium bicarbonate (TEAB)) and loaded onto S-trap microcolumns (Protifi, C02-micro-80). After loading, the samples were washed sequentially with 150 ul increments of 90% methanol / 10% 100mM TEAB, 90% methanol / 10% 20 mM TEAB, and 90% methanol / 10% 5 mM TEAB solutions, respectively. Samples were digested at 47 °C for two hours with 600 ng of mass spectrometry grade Trypsin / LysC mix (Promega, V5113). The digested peptides were then eluted with two 35 pl increments of 0.2% formic acid in water and two more 40uL increments of 80% acetonitrile with 0.2% formic acid in water. The four elutions were consolidated in 1 .5 ml S-trap recovery tubes and dried via SpeedVac (Thermo Scientific, San Jose CA). Finally, the dried peptides were reconstituted in 2% acetonitrile with 0.1 % formic acid in water for LC-MS analysis.
[0126] Mass spectrometry experiments were performed using an Orbitrap Exploris 480 mass spectrometer (Thermo Scientific, San Jose, CA) attached to an Acquity M-Class UPLC system (Waters Corporation, Milford, MA). The UPLC system was set to a flow rate of 300 nl / min, where mobile phase A was 0.2% formic acid in water and mobile phase B was 0.2% formic acid in acetonitrile. The analytical column was prepared in-house with an I.D. of 100 microns pulled to a nanospray emitter using a P2000 laser puller (Sutter Instrument, Novato, CA). The column was packed with Dr. Maisch 1.9 micron C18 stationary phase to a length of approximately 25 cm. Peptides were directly injected onto the column with a gradient of 3-45% mobile phase B, followed by a high-B wash over a total of 80 minutes. The mass spectrometer was operated in a data-dependent mode using HCD fragmentation for MS / MS spectra generation.
[0127] RAW data were analyzed using Byonic v4.4.1 (Protein Metrics, Cupertino, CA) to identify peptides and infer proteins. A concatenated FASTA file containing Uniprot Mus musculus proteins and other likely contaminants and impurities was used to generate an in silico peptide library. Proteolysis with Trypsin / LysC was assumed to be semi-specific allowing for N-ragged cleavage with up to two missed cleavage sites. Both precursor and fragment mass accuracies were held within 12 ppm. Cysteine modified with propionamide was set as a fixed modification in the search. Variable modifications included oxidation on methionine, histidine and tryptophan, dioxidation on methionine and tryptophan, deamidation on glutamine and asparagine, and acetylation on protein N-terminus. Proteins were held to a false discovery rate of 1% using standard reverse-decoy technique. 247 proteins with at least 1 peptide match were found in total (data not shown). PTER ranked #6 on the list.
[0128] Preparation of mouse tissues for LC-MS analysis. 50 pl plasma were mixed with 150 pl of a 2:1 mixture of acetonitrile:methanol and vortex for 30 s. The mixture was centrifuged at 15,000 rpm for 10 min at 4 °C and the supernatant was transferred to a LC- MS vial. For other mouse tissues, 50 pg samples were mixed with 150 pl of a 2:1 mixture of acetonitrile:methanol and homogenized using a Benchmark BeadBlaster Homogenizer at 4 °C. The mixture was spun down at 13,000 rpm for 10 min at 4 °C to pellet the insoluble materials. The supernatant was then transferred to a LC-MS vial.
[0129] Measurements of metabolites by LC-MS. Metabolite measurements were performed using an Agilent 6520 Quadrupole time-of-flight LC-MS instrument as previously described28. MS analysis was performed using electrospray ionization (ESI) in negative mode. The dual ESI source parameters were configured as follows: the gas temperature was maintained at 250 °C with a drying gas flow of 12 l / min and the nebulizer pressure at 20 psi; the capillary voltage was set to 3,500 V; and the fragmentor voltage set to 100 V. The separation of polar metabolites was conducted using a Luna 5 pm NH2 100 A LC column (Phenomenex 00B-4378-E0) with normal phase chromatography. Mobile phases were as follows: buffer A, 95:5 water:acetonitrile with 0.2% ammonium hydroxide and 10 mM ammonium acetate; buffer B, acetonitrile. The LC gradient initiated at 100% B with a flow rate of 0.2 ml / min from 0 to 2 min. The gradient was then linearly increased to 50% A / 50% B at a flow rate of 0.7 ml / min from 2 to 20 min. From 20 to 25 min, the gradient was maintained at 50% A / 50% B at a flow rate of 0.7 ml / min. N-acetyltaurine (Cayman, 35169) eluted around 12 min and taurine (sigma, T0625-500G) eluted around 13 min under the above conditions.
[0130] General animal information. All animal experiments were performed according to protocols approved by the Stanford University Administrative Panel on Laboratory Animal Care. Mice were maintained in 12-h light-dark cycles at 22 °C and about 50% relative humidity and fed a standard irradiated rodent chow diet. Where indicated, a high-fat diet (D12492, Research Diets 60% kcal from fat) was used. Male C57BL / 6J (stock number 000664) and male C57BL / 6J DIO mice (stock number 380050) were purchased from the Jackson Laboratory. Whole-body PTER-KO mice (catalogue number C57BL / 6N(Jax)- Pterem1(IMPC)Bay) were obtained from the Baylor KOMP2 group of International Mouse Phenotyping Consortium (IMPC). For intraperitoneal injections of mice with compounds, compounds were dissolved in saline (Teknova, S5825). Compounds were administered to mice every day by intraperitoneal injections at 10 pl / g body weight at the indicated doses. For chronic injection experiments, mice were mock injected with saline for 3 to 5 days until body weights were stabilized. Unless specified, compounds were intraperitoneally injected around 6 pm. For measuring known feeding-regulating polypeptide hormones, blood plasma was collected at 9 am and ELISA kits were used following manufacturer’s instructions (Leptin: Crystal Chem, 90030; GLP-1 : Sigma, EZGLP1T-36K; GDF-15: R&D Systems, MGD150).
[0131] Breeding and genotyping of PTER-KO mice. PTER-KO and WT animals were generated through heterozygous breeding crosses and weaned around postnatal day 21 . Genotyping was performed using the following procedures: tail clippings were collected from littermates and boiled for 30 min at 95 °C in 100 pl of 50 mM NaOH to extract genomic DNA. The solution was neutralized by adding 42 pl of 0.5 M Tris (pH 7.5). PCRs were performed by using primers for either the PTER WT allele (forward, 5'- TCATGTCCCACCTTGACAGGTAAGCGGGTC-3' (SEQ ID NO: 4).; reverse, 5'- CAGTTGTAGCAGCCATGAACA CTATTGTGC-3’ (SEQ ID NO: 5)) or PTER KO allele (forward, 5'- GGGTAATATACTTGTCAAACCATGCT-3' (SEQ ID NO: 6); reverse, 5'- CAGTTGTAGCAGCCATGAACA-3' (SEQ ID NO: 7)). Promega GoTaq master mix (Promega, PRM7123) was used for the PGR reaction. Each 25 pl reaction consisted of 12.5 pl of the Promega master mix, 2.5 pl of a 10 pM mixture of forward and reverse primers, 2 pl of genomic DNA and 8 pl of ultrapure water. The thermocycling program on a Bio-Rad C1000 Touch Thermo Cycler began with an initial 90 s at 98 °C, followed by cycles of 30 s at 98 °C, 30 s at 58 °C for KO primers and 50 °C for WT primers and 30 s at 72 °C, followed by 5 min at 72 °C and finally held at 4 °C. PCRs for WT primers consisted of 41 cycles, whereas PCRs for KO primers consisted of 35 cycles. Samples were run on a 1.5% agarose gel with 0.1 mg / ml ethidium bromide. WT alleles are expected to yield a PCR product of 699 base pairs in size whereas KO alleles are expected to yield PCR products that are 479 base pairs in size.
[0132] Taurine water supplement. 2.5% (w / v) taurine (sigma, T0625-500G) was dissolved in mouse drinking water and supplemented to 4-week-old male PTER-KO and WT mice. Taurine water was freshly prepared every 3 days while mice were on a high-fat diet (D12492, Research Diets 60% kcal from fat). Body weights, food intake and water consumption were measured every 3 days. No adverse effects were observed in mice fed with taurine water.
[0133] Indirect calorimetry and physiological measurements. 10 to 12-week-old male PTER-KO and WT mice (N=9 / group) were supplemented with 2.5% (w / v) taurine water and fed on a high-fat diet for 4 weeks. Taurine water was freshly prepared every 3 days when body weights and food intake were measured. Before the body weights of PTER- KO mice started to be significantly different from WT mice (4 weeks on taurine water), metabolic parameters including oxygen consumption, carbon dioxide production, respiratory exchange ratio (RER), food intake and ambulatory movement of mice were measured using the environment-controlled home-cage CLAMS system (Columbus Instruments) at the Stanford Diabetes Center. Mice were housed in the metabolic chambers for 36 h prior to the start of experiment. Data collected during a complete 24- hour day-night cycle were used for analysis. Energy expenditure calculations were normalized for body weight. P-values were calculated from two-tailed unpaired t-tests.
[0134] Mouse exercise training protocols. A Columbus Instrument animal treadmill with six lanes (Columbus, 1055-SRM-D65) was employed for the treadmill running experiments. Prior to commencing the treadmill running, mice were given a 5-minute acclimation period. The initial treadmill running phase began at a speed of 7.5 m / min with a 4° incline, following the procedure as previously described28. At intervals of 3 minutes, both the speed and incline were incrementally increased by 2.5 m / min and 2°, respectively. Once the maximum parameters of 40 m / min in speed and a 30° incline were attained, they remained constant until the mice reached a state of exhaustion, defined as when the mice remained on the shocker at the rear of the treadmill for longer than 5 seconds. PTER-KO and WT mice were exercised every other day, while on a high-fat diet (60% kcal from fat) for a whole duration of 6 weeks. Running was performed in the midmorning for all experiments. Body weights and food intake were measured right before each exercise training session.
[0135] References
[0136] 1 Lourengo, R. & Camilo, M. E. Taurine: a conditionally essential amino acid in humans? An overview in health and disease. Nutr Hosp 17, 262-270 (2002).
[0137] 2 Ripps, H. & Shen, W. Review: taurine: a "very essential" amino acid. Mol Vis 18, 2673-2686 (2012).
[0138] 3 Lambert, I. H., Kristensen, D. M., Holm, J. B. & Mortensen, O. H. Physiological role of taurine-from organism to organelle. Acta Physiol (Oxf) 213, 191 -212 (2015). https: / / doi.org / 10-111 1 / apha.12365
[0139] 4 Stipanuk, M. H. Metabolism of sulfur-containing amino acids. Annu Rev Nutr 6, 179-209 (1986). https: / / doi.org / 10.1 146 / annurev.nu.06.070186.001 143
[0140] 5 Jacobsen, J. G. & Smith, L. H. Biochemistry and physiology of taurine and taurine derivatives. Physiol Rev 48, 424-511 (1968). https: / / doi.Org / 10.1152 / physrev.1968.48.2.424 Shi, X., Yao, D. & Chen, C. Identification of N-acetyltaurine as a novel metabolite of ethanol through metabolomics-guided biochemical analysis. J Biol Chem 287, 6336-6349 (2012). https: / / doi.org / 10.1074 / jbc.M1 1 1.312199 Miyazaki, T. et al. Increased N-Acetyltaurine in the Skeletal Muscle After Endurance Exercise in Rat. Adv Exp Med Biol 975 Pt 1 , 403-411 (2017). https: / / doi.Org / 10.1007 / 978-94-024-1079-2_33 Meyre, D. et al. Genome-wide association study for early-onset and morbid adult obesity identifies three new risk loci in European populations. Nat Genet 41 , 157- 159 (2009). https: / / doi.org / 10.1038 / ng.301 Jong, C. J., Sandal, P. & Schaffer, S. W. The Role of Taurine in Mitochondria Health: More Than Just an Antioxidant. Molecules 26 (2021 ). https: / / d0i.0rg / l 0.3390 / molecules26164913 Jia, F. et al. Taurine is a potent activator of extrasynaptic GABA(A) receptors in the thalamus. J Neurosci 28, 106-115 (2008). https: / / doi.org / 10.1523 / JNEUROSCI.3996-07.2008 Huxtable, R. J. Physiological actions of taurine. Physiol Rev 72, 101 -163 (1992). https: / / doi.Org / 10.1152 / physrev.1992.72.1.101 Ito, T. etal. Taurine depletion caused by knocking out the taurine transporter gene leads to cardiomyopathy with cardiac atrophy. J Mol Cell Cardiol 44, 927-937 (2008). https: / / doi.org / 10.1016 / j-yjmcc.2008.03.001 Warskulat, U. et al. Taurine transporter knockout depletes muscle taurine levels and results in severe skeletal muscle impairment but leaves cardiac function uncompromised. FASEB J 18, 577-579 (2004). https: / / doi.org / 10.1096 / fj.03- 0496fje Ito, T., Yoshikawa, N., Schaffer, S. W. & Azuma, J. Tissue taurine depletion alters metabolic response to exercise and reduces running capacity in mice. J Amino Acids 2014, 964680 (2014). https: / / doi.Org / 10.1 155 / 2014 / 964680 Warskulat, U. et al. Chronic liver disease is triggered by taurine transporter knockout in the mouse. FASEB J2Q, 574-576 (2006). https: / / doi.org / 10.1096 / fj.05- 5016fje 16 Waldron, M., Patterson, S. D., Tallent, J. & Jeffries, O. The Effects of an Oral Taurine Dose and Supplementation Period on Endurance Exercise Performance in Humans: A Meta-Analysis. Sports Med 48, 1247-1253 (2018). https: / / doi.Org / 10.1007 / S40279-018-0896-2
[0141] 17 Singh, P. et al. Taurine deficiency as a driver of aging. Science 380, eabn9257 (2023). https: / / d0i.0rg / l 0.1126 / science.abn9257
[0142] 18 Park, E. etal. Cloning of murine cysteine sulfinic acid decarboxylase and its mRNA expression in murine tissues. Biochim Biophys Acta 1574, 403-406 (2002). https: / / doi.Org / 10.1016 / S0167-4781 (01 )00364-5
[0143] 19 McCoy, J. G. etal. Structure and mechanism of mouse cysteine dioxygenase. Proc
[0144] Natl Acad Sci U S A 103, 3084-3089 (2006). https: / / d0i.0rg / l 0.1073 / pnas.0509262103
[0145] 20 Veeravalli, S. etal. Flavin-Containing Monooxygenase 1 Catalyzes the Production of Taurine from Hypotaurine. Drug Metab Dispos 48, 378-385 (2020). https: / / d0i.0rg / l 0.1124 / dmd.1 19.089995
[0146] 21 Dominy, J. E. et al. Discovery and characterization of a second mammalian thiol dioxygenase, cysteamine dioxygenase. J Biol Chem 282, 25189-25198 (2007). https: / / doi.Org / 10.1074 / jbc.M703089200
[0147] 22 Falany, C. N., Johnson, M. R., Barnes, S. & Diasio, R. B. Glycine and taurine conjugation of bile acids by a single enzyme. Molecular cloning and expression of human liver bile acid CoA:amino acid N-acyltransferase. J Biol Chem 269, 19375- 19379 (1994).
[0148] 23 Luginbuhl, M., Rutjens, S., Konig, S., Furrer, J. & Weinmann, W. N-Acetyltaurine as a novel urinary ethanol marker in a drinking study. Anal Bioanal Chem 408, 7529-7536 (2016). https: / / doi.org / 10.1007 / s00216-016-9855-7
[0149] 24 Hasselmo, M. E. The role of acetylcholine in learning and memory. Curr Opin Neurobiol 16, 710-715 (2006). https: / / doi.Org / 10.1016 / j.conb.2006.09.002
[0150] 25 Grevengoed, T. J. et al. -acyl taurines are endogenous lipid messengers that improve glucose homeostasis. Proc Natl Acad Sci USA Q, 24770-24778 (2019). https: / / d0i.0rg / l 0.1073 / pnas.1916288116 Chalhoub, G. et al. Carboxylesterase 2 proteins are efficient diglyceride and monoglyceride lipases possibly implicated in metabolic disease. J Lipid Res 62, 100075 (2021 ). https: / / doi.Org / 10.1016 / j.jlr.2021.100075 Kim, J. T., Li, V. L., Terrell, S. M., Fischer, C. R. & Long, J. Z. Family-wide Annotation of Enzymatic Pathways by Parallel In Vivo Metabolomics. Cell Chem Biol 26, 1623-1629.e1623 (2019). https: / / doi.Org / 10.1016 / j.chembiol.2019.09.009 Li, V. L. et al. An exercise-inducible metabolite that suppresses feeding and obesity. Nature 606, 785-790 (2022). https: / / doi.org / 10.1038 / s41586-022-04828-5 Dumas, D. P., Caldwell, S. R., Wild, J. R. & Raushel, F. M. Purification and properties of the phosphotriesterase from Pseudomonas diminuta. J Biol Chem 264, 19659-19665 (1989). Raushel, F. M. Bacterial detoxification of organophosphate nerve agents. Curr Opin Microbiol 5, 288-295 (2002). https: / / doi.org / 10.1016 / s1369-5274(02)00314-4 Jansen, R. S. etal. N-lactoyl-amino acids are ubiquitous metabolites that originate from CNDP2-mediated reverse proteolysis of lactate and amino acids. Proc Natl Acad SCI USA V12, 6601 -6606 (2015). https: / / doi.org / 10.1073 / pnas.1424638112 Varadi, M. et al. AlphaFold Protein Structure Database: massively expanding the structural coverage of protein-sequence space with high-accuracy models. Nucleic Acids Res 50, D439-D444 (2022). https: / / doi.org / 10.1093 / nar / gkab1061 Long, J. Z. etal. The Secreted Enzyme PM20D1 Regulates Lipidated Amino Acid
[0151] Uncouplers of Mitochondria. Cell 166, 424-435 (2016). https: / / doi.Org / 10.1016 / j.celL2016.05.071 Saghatelian, A., McKinney, M. K., Bandell, M., Patapoutian, A. & Cravatt, B. F. A FAAH-regulated class of N-acyl taurines that activates TRP ion channels. Biochemistry 45, 9007-9015 (2006). https: / / doi.org / 10.1021 / bi0608008 Wei, B. Q., Mikkelsen, T. S., McKinney, M. K., Lander, E. S. & Cravatt, B. F. A second fatty acid amide hydrolase with variable distribution among placental mammals. J Biol Chem 281 , 36569-36578 (2006). https: / / doi.Org / 10.1074 / jbc.M606646200 36 Van Coster, R. N. et al. Aminoacylase I deficiency: a novel inborn error of metabolism. Biochem Biophys Res Commun 338, 1322-1326 (2005). https: / / doi.Org / 10.1016 / j.bbrc.2005.10.126
[0152] 37 Sass, J. O. et al. Mutations in ACY1 , the gene encoding aminoacylase 1 , cause a novel inborn error of metabolism. Am J Hum Genet 78, 401-409 (2006). https: / / doi.Org / 10.1086 / 500563
[0153] 38 Kim, J. T. et al. Cooperative enzymatic control of N-acyl amino acids by PM20D1 and FAAH. Elite 9 (2020). https: / / doi.org / 10.7554 / eLife.5521 1
[0154] 39 Kim, J. T. et al. A Plasma Protein Network Regulates PM20D1 and N-Acyl Amino
[0155] Acid Bioactivity. Cell Chem Biol 27, 1130-1139.e1 134 (2020). https: / / d0i.0rg / l 0.1016 / j.chembiol.2020.04.009
[0156] 40 Bouza, C., Angeles, M., Munoz, A. & Amate, J. M. Efficacy and safety of naltrexone and acamprosate in the treatment of alcohol dependence: a systematic review. Addiction 99, 81 1 -828 (2004). https: / / doi.Org / 10.1 1 11 / j.1360-0443.2004.00763.X
[0157] In at least some of the previously described embodiments, one or more elements used in an embodiment can interchangeably be used in another embodiment unless such a replacement is not technically feasible. It will be appreciated by those skilled in the art that various other omissions, additions and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and changes are intended to fall within the scope of the subject matter, as defined by the appended claims.
[0158] It will be understood by those within the art that, in general, terms used herein, and especially in the appended claims (e.g., bodies of the appended claims) are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). It will be further understood by those within the art that if a specific number of an introduced claim recitation is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation no such intent is present. For example, as an aid to understanding, the following appended claims may contain usage of the introductory phrases “at least one” and “one or more” to introduce claim recitations. However, the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles “a” or “an” limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation, even when the same claim includes the introductory phrases “one or more” or “at least one” and indefinite articles such as “a” or “an” (e.g., “a” and / or “an” should be interpreted to mean “at least one” or “one or more”); the same holds true for the use of definite articles used to introduce claim recitations. In addition, even if a specific number of an introduced claim recitation is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number (e.g., the bare recitation of “two recitations,” without other modifiers, means at least two recitations, or two or more recitations). Furthermore, in those instances where a convention analogous to “at least one of A, B, and C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “ a system having at least one of A, B, and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). In those instances where a convention analogous to “at least one of A, B, or C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “ a system having at least one of A, B, or C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or “B” or “A and B.”
[0159] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group. As will be understood by one skilled in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a nonlimiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1 -3 articles refers to groups having 1 , 2, or 3 articles. Similarly, a group having 1 -5 articles refers to groups having 1 , 2, 3, 4, or 5 articles, and so forth.
[0160] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
[0161] Accordingly, the preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. Moreover, nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the claims.
[0162] The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims. In the claims, 35 ll.S.C. §1 12(f) or 35 ll.S.C. §1 12(6) is expressly defined as being invoked for a limitation in the claim only when the exact phrase "means for" or the exact phrase "step for" is recited at the beginning of such limitation in the claim; if such exact phrase is not used in a limitation in the claim, then 35 U.S.C. § 112 (f) or 35 U.S.C. §1 12(6) is not invoked.
Claims
CLAIMSWHAT IS CLAIMED IS:1 . A method of treating a subject for a metabolic disorder, the method comprising modulating N-acetyltaurine metabolism in the subject in a manner effective to treat the subject for the metabolic disorder.
2. The method of claim 1 , wherein the modulating increases N-acetyltaurine levels in the subject.
3. The method of claim 2, wherein N-acetyltaurine levels are increased by administering a therapeutically effective amount of N-acetyltaurine or a derivative, salt or prodrug thereof.
4. The method of claim 3, wherein food intake by the subject is reduced compared to food intake by the subject before treatment.
5. The method of claim 4, wherein food intake is reduced by 1 % to 50%.
6. The method of any one of claims 3-5, wherein body weight of the subject is reduced compared to body weight of the subject before treatment.
7. The method of claim 6, wherein body weight is reduced by 1 % to 50%.
8. The method of any one of claims 3-7, wherein adipose tissue mass is reduced compared to adipose tissue mass in the subject before treatment.
9. The method of claim 8, wherein the adipose tissue is inguinal white adipose tissue (iWAT).
10. The method of claims 8 or 9, wherein the adipose tissue is epididymal white adipose tissue (eWAT).1 1 . The method of any one of claims 3-10, wherein the administering is carried out in combination with administration of one or more additional therapies for treating the metabolic disorder.
12. The method of claim 11 , wherein the one or more additional therapies comprise putting the subject on a low-calorie diet, increasing physical activity of the subject, surgical intervention, use of a weight loss device, or a combination thereof.
13. The method of claim 2, wherein N-acetyltaurine levels are increased by administering a therapeutically effective amount of a PTER modulating agent.
14. The method of claim 13, wherein the PTER modulating agent is a PTER inhibitor.
15. The method of claim 14, wherein the PTER inhibitor is an antibody or peptide.
16. The method of claim 14, wherein the PTER inhibitor is a small molecule.
17. The method of claim 13, wherein the PTER modulating agent is a PTER silencing agent.
18. The method of claim 17, wherein the PTER silencing agent is a nucleic acid.
19. The method of claim 18, wherein the nucleic acid is selected from an antisense oligonucleotide, siRNA, shRNA, miRNA and CRISPR / Cas guide RNA.
20. The method of claim 19, wherein the CRISPR / Cas guide RNA comprises the sequence GATGGAACCAGTATCAAGTG (SEQ ID NO: 1 ).21 . The method of any one of claims 13-20, wherein the administering reduces N- acetyltaurine synthesis activity.
22. The method of claim 21 , wherein the reduction of N-acetyltaurine synthesis activity occurs in the kidney or liver.
23. The method of any one of claims 13-22, wherein the administering reduces N- acetyltaurine hydrolysis activity.
24. The method of claim 23, wherein the reduction of N-acetyltaurine hydrolysis activity occurs in the kidney or liver.
25. The method of any one of claims 13-24, wherein N-acetyltaurine levels are increased by 2x or more.
26. The method of any one of claims 13-25, wherein food intake by the subject is reduced compared to food intake by the subject before treatment.
27. The method of claim 26, wherein food intake is reduced by 1 % to 50%.
28. The method of any one of claims 13-27, wherein body weight of the subject is reduced compared to body weight of the subject before treatment.
29. The method of claim 28, wherein body weight is reduced by 1% to 50%.
30. The method of any one of claims 13-29, wherein adipose tissue mass is reduced compared to adipose tissue mass in the subject before treatment.31 . The method of claim 30, wherein the adipose tissue is inguinal white adipose tissue (iWAT).
32. The method of claims 30 or 31 , wherein the adipose tissue is epididymal white adipose tissue (eWAT).
33. The method of any one of claims 13-32, wherein the administering is carried out in combination with administration of one or more additional therapies for treating the metabolic disorder.
34. The method of claim 33, wherein the one or more additional therapies comprise putting the subject on a low-calorie diet, increasing physical activity of the subject, surgical intervention, use of a weight loss device, or a combination thereof.
35. The method of any of the preceding claims, wherein the metabolic disorder is obesity or an obesity-related metabolic disorder.
36. A pharmaceutical composition comprising N-acetyltaurine or a derivative, salt or prodrug thereof and a pharmaceutically acceptable excipient.
37. A pharmaceutical composition comprising a PTER modulating agent and a pharmaceutically acceptable excipient.
38. The composition of claim 37, wherein the PTER modulating agent is a PTER inhibitor.
39. The composition of claim 38, wherein the PTER inhibitor is an antibody or peptide.
40. The composition of claim 38, wherein the PTER inhibitor is a small molecule.
41. The composition of claim 37, wherein the PTER modulating agent is a PTER silencing agent.
42. The composition of claim 41 , wherein the PTER silencing agent is a nucleic acid.
43. The composition of claim 42, wherein the nucleic acid is selected from an antisense oligonucleotide, siRNA, shRNA, miRNA and CRISPR / Cas guide RNA.
44. The composition of claim 43, wherein the CRISPR / Cas guide RNA comprises the sequence GATGGAACCAGTATCAAGTG (SEQ ID NO: 1 ).