Double stranded oligonucleotide compositions and methods relating thereto

CA3322009A1Pending Publication Date: 2025-09-04WAVE LIFE SCIENCES INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CA3322009
Authority / Receiving Office
CA · CA
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-30
Filing Date
2025-03-03
Publication Date
2025-09-04

AI Technical Summary

Technical Problem

Existing gene-targeting oligonucleotides are susceptible to nucleases and lack optimal properties for therapeutic, diagnostic, and research applications, necessitating improved double-stranded oligonucleotides with controlled structural elements.

Method used

Development of double-stranded oligonucleotides with specific chemical modifications, stereochemistry, and ligand conjugations, including backbone phosphoryl guanidine chiral centers and lipid or non-lipid ligands, to enhance properties such as RNA interference, thermal stability, and cellular delivery.

Benefits of technology

The modified ds oligonucleotides exhibit enhanced target-specific RNA interference, improved stability, and efficient cellular delivery, addressing the limitations of existing oligonucleotides.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure provides double stranded oligonucleotides, compositions, and methods relating thereto wherein the oligonucleotides comprise modifications of internucleotidic linkages. The present disclosure encompasses the recognition that structural elements of double stranded oligonucleotides, such as base modifications, as well as base sequence, chemical modifications (e.g., modifications of sugar and / or internucleotidic linkages) or patterns thereof, and / or stereochemistry, e.g., stereochemistry of chiral internucleotidic linkages, and / or patterns thereof, can have significant impact on oligonucleotide properties, e.g., RNA interference activity. The present disclosure also provides methods for treatment of diseases, e.g., hepatic diseases, central nervous system diseases, etc., using the provided double stranded oligonucleotide compositions.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] DOUBLE STRANDED OLIGONUCLEOTIDE COMPOSITIONS AND METHODS RELATING THERETO

[0002] RELATED APPLICATIONS

[0003] This application claims priority to U.S. Provisional Application No. 63 / 560,561, filed March 1, 2024, U.S. Provisional Application No. 63 / 636,435, filed April 19, 2024, U.S. Provisional Application No. 63 / 691,219, filed September 5, 2024, and U.S. Provisional Application No. 63 / 714,071, filed October 30, 2024.

[0004] This application is related to and incorporates herein by reference in their entireties U.S. Provisional Application No. 63 / 560,561, filed March 1, 2024, U.S. Provisional Application No. 63 / 636,435, filed April 19, 2024, U.S. Provisional Application No. 63 / 691,219, filed September 5, 2024, U.S. Provisional Application No. 63 / 714,071, filed October 30, 2024, WO 2021 / 234459, WO 2023 / 049218, WO 2024 / 182749, and PCT / US2025 / 013253, filed January 27, 2025.

[0005] BACKGROUND

[0006] Gene-targeting oligonucleotides are useful in various applications, e.g., therapeutic, diagnostic, research and nanomaterials applications. The use of naturally-occurring nucleic acids (e.g., unmodified DNA or RNA) in such applications can be limited by, for example, their susceptibility to endo- and exo-nucleases. As such, various synthetic counterparts have been developed to circumvent these shortcomings. These include synthetic oligonucleotides that contain chemical modifications, e.g., base modifications, sugar modifications, backbone modifications. There remains, however, a need in the art for double-stranded (ds) oligonucleotides with improved properties for use in connection with the above-described applications.

[0007] SUMMARY

[0008] The present disclosure is directed, in part, to the recognition that controlling structural elements of the oligonucleotides of a double-stranded (ds) oligonucleotide can have a significant impact on the ds oligonucleotide’s properties and / or activity. In certain embodiments, such structural elements include one or more of (1) chemical modifications (e.g, modifications of a sugar, base and / or internucleotidic linkage) and patterns thereof; and (2) alterations in stereochemistry (e.g., stereochemistry of a backbone chiral internucleotidic linkage) and patterns thereof. One or more of such structural elements can, in certain embodiments, be independently present in one or both oligonucleotides of a ds oligonucleotide. In certain embodiments, the properties and / or activities impacted by such structural elements include, but are not limited to, participation in, direction of a decrease in expression, activity or level of a gene or a gene product thereof, mediated, for example, by RNA interference (RNAi interference), RNase H-mediated knockdown, steric hindrance of translation, etc. Moreover, in certain embodiments, the properties and / or activities impacted by such structural elements include, but are not limited to, participation in, Ago2 loading, thermal stability, in vivo stability, delivery to tissues and into cells, among others.

[0009] In certain embodiments, the present disclosure demonstrates that compositions comprising ds oligonucleotides (e.g., dsRNAi oligonucleotides, also referred to as dsRNAi agents) with controlled structural elements provide unexpected properties and / or activities.

[0010] In certain embodiments, the present disclosure encompasses the recognition that stereochemistry, e.g., stereochemistry of backbone chiral centers, can unexpectedly maintain or improve properties of ds oligonucleotides. For example, but not by way of limitation, the instant disclosure relates, in part, to ds oligonucleotides comprising a guide strand comprising backbone phosphoryl guanidine chiral centers in the Sp configuration.

[0011] In certain embodiments, one or both of the guide strand and the passenger strand comprise a lipid ligand. In certain embodiments, one or both of the guide strand and the passenger strand comprise a non-lipid ligand.

[0012] In a first aspect, the invention relates to a double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent comprising a guide strand and a passenger strand, wherein: the guide strand is complementary or substantially complementary to a target RNA sequence; the guide strand comprises a seed region at its 5’- end region that is capable of mediating the initial recognition of the target RNA sequence, e.g., nucleotides at positions 2-6, at positions 2-7, or at positions 2-8, relative to the 5 ’-end of the guide strand; the guide strand comprises a backbone phosphoryl guanidine (PN) chiral center comprising the structure of, the Sp configuration, in the seed region, e.g., between the third (+3) nucleotide and the immediately downstream (+4) nucleotide, relative to its 5’ terminal nucleotide; and one or both of the guide strand and the passenger strand comprise a lipid ligand and / or a non-lipid ligand. In an exemplary embodiment, only the passenger strand comprises one or more lipid ligands conjugated to the 5 ’-end and / or the 3 ’-end thereof, and / or one or more intemucleotidic linkages thereof. In an exemplary embodiment, only the passenger strand comprises one lipid ligand conjugated to one intemucleotidic linkage thereof. In an exemplary embodiment, the passenger strand comprises one or more backbone PN chiral centers, e.g., independently between the +7 nucleotide and the +8 nucleotide, and / or between the +15 nucleotide and the +16 nucleotide thereof. In an exemplary embodiment, the passenger strand comprises one backbone PN chiral center between the +7 nucleotide and the +8 nucleotide thereof, e.g., in the Rp configuration. In an exemplary embodiment, one or more backbone PN chiral centers, e.g., of the passenger strand, is / are modified with one or two of the lipid ligand, e.g., a saturated or unsaturated, linear or branched Ce, Cs, Cio, C12, C14, Ci6, Cis, C20, C22, C24, C26, or C28 chain, thereby constituting a “backbone PN-lipid ligand”. In an exemplary embodiment, the backbone PN-lipid ligand is selected from the group consisting of: a mono PN-lipid, a bis PN-lipid, a mono PN-PEG lipid, a bis PN-PEG lipid, n003 having or comprising the structure n009 having or comprising the structure n029 having or comprising the structure n033 having or comprising the structure of n039 having or comprising the structure n076 having or comprising the structure of n083 having or comprising the structure n084 having or comprising the structure of n086 having or comprising the structure of n087 having or comprising the structure of n088 having or comprising the structure of n089 having or comprising the structure of n090 having or comprising the structure of n091 having or comprising the structure of n092 having or comprising the structure of and a PN-lipid having or comprising the structure of

[0013] In an exemplary embodiment, the mono PN-lipid is or comprises the structure of, e.g.,

[0014] In an exemplary embodiment, the bis PN-lipid is or comprises the structure of, e.g., In an exemplary embodiment, the mono PN-PEG lipid is or comprises the structure of, e.g.,

[0015] In an exemplary embodiment, the bis PN-PEG lipid is or comprises the structure of, e.g.,

[0016] In an exemplary embodiment, the passenger strand further comprises a backbone phosphorothioate (PS) chiral center independently between the 5’ terminal (+1) nucleotide and the immediately downstream (+2) nucleotide, and / or a backbone phosphorothioate (PS) chiral center between the 3 ’ terminal (N) nucleotide and the penultimate

[0017] (N-l) nucleotide. In an exemplary embodiment, the passenger strand comprises backbone PS chiral centers, e.g., independently between the +1 nucleotide and the +2 nucleotide, and between the 3’ terminal (N) nucleotide and the penultimate (N-l) nucleotide, thereof, e.g., in the Sp configuration. In an exemplary embodiment, the guide strand further comprises a backbone PN chiral center, e.g., independently between the +7 nucleotide and the +8 nucleotide, and / or a backbone PN chiral center between the +18 nucleotide and the +19 nucleotide, thereof. In an exemplary embodiment, the guide strand comprises backbone PN chiral centers comprising the structure of, e.g (nOOl), e.g., independently between the +7 nucleotide and the +8 nucleotide, and between the +18 nucleotide and the +19 nucleotide thereof, e.g., in the Sp configuration. In an exemplary embodiment, the guide strand comprises a backbone phosphorothioate (PS) chiral center between the 3’ terminal (N) nucleotide and the penultimate (N-l) nucleotide, between the +21 nucleotide and the +22 nucleotide, between the +20 nucleotide and the +21 nucleotide, and / or between the +19 nucleotide and the +20 nucleotide. In an exemplary embodiment, the backbone phosphorothioate (PS) chiral center between the 3 ’ terminal (N) nucleotide and the penultimate (N-l) nucleotide, between the +21 nucleotide and the +22 nucleotide, between the +20 nucleotide and +21 nucleotide, and / or between the +19 nucleotide and the +20 nucleotide, of the guide strand, is / are in the Sp configuration.

[0018] In an exemplary embodiment of the first aspect of the invention, the guide strand comprises a PS chiral center between the 3’ terminal (N) nucleotide and the penultimate (N-l) nucleotide in the Sp configuration, between the +21 nucleotide and the +22 nucleotide in the Sp configuration, between the +20 nucleotide and the +21 nucleotide, and between the +19 nucleotide and the +20 nucleotide in the Sp configuration, and the passenger strand comprises a backbone PN chiral center comprising the structure of,

[0019] (n009) between the +7 nucleotide and the +8 nucleotide.

[0020] In an exemplary embodiment of the first aspect of the invention, the guide strand comprises a PS chiral center between the 3’ terminal (N) nucleotide and the penultimate (N-l) nucleotide in the Sp configuration, between the +21 nucleotide and the +22 nucleotide in the Sp configuration, between the +20 nucleotide and the +21 nucleotide, and between the +19 nucleotide and the +20 nucleotide in the Sp configuration, and the passenger strand comprises a backbone PN chiral center comprising the structure of, e.g (n039) between the +7 nucleotide and the +8 nucleotide.

[0021] In an exemplary embodiment of the first aspect of the invention, the passenger strand comprises only one PN chiral center comprising the structure of, e.g., n040 in the Rp configuration between the +7 nucleotide and the +8 nucleotide, n077 in the Rp configuration between the +7 nucleotide and the +8 nucleotide, n082 in the Rp configuration between the +7 nucleotide and the +8 nucleotide, n083 in the Rp configuration between the +7 nucleotide and the +8 nucleotide, n084 in the Rp configuration between the +7 nucleotide and the +8 nucleotide, n086 in the Rp configuration between the +7 nucleotide and the +8 nucleotide, n087 in the Rp configuration between the +7 nucleotide and the +8 nucleotide, n088 in the Rp configuration between the +7 nucleotide and the +8 nucleotide, n089 in the Rp configuration between the +7 nucleotide and the +8 nucleotide, n090 in the Rp configuration between the +7 nucleotide and the +8 nucleotide, n091 in the Rp configuration between the +7 nucleotide and the +8 nucleotide, or n092 in the Rp configuration between the +7 nucleotide and the +8 nucleotide.

[0022] In an exemplary embodiment of the first aspect of the invention, the passenger strand comprises two PN chiral centers comprising the structure of, e.g., n082 in the Rp configuration between the +7 nucleotide and the +8 nucleotide and, e.g., n082 in the Rp configuration between the +15 nucleotide and the +16 nucleotide.

[0023] In an exemplary embodiment of the first aspect of the invention, the passenger strand comprises two PN chiral centers comprising the structure of, e.g., n009 in the Rp configuration between the +7 nucleotide and the +8 nucleotide and, e.g., n009 in the Rp configuration between the +15 nucleotide and the +16 nucleotide.

[0024] In an exemplary embodiment of the first aspect of the invention, the passenger strand comprises two PN chiral centers comprising the structure of, e.g., n083 in the Rp configuration between the +7 nucleotide and the +8 nucleotide and, e.g., n083 in the Rp configuration between the +15 nucleotide and the +16 nucleotide.

[0025] In an exemplary embodiment of the first aspect of the invention, the passenger strand comprises two PN chiral centers comprising the structure of, e.g., n033 in the Rp configuration between the +7 nucleotide and the +8 nucleotide and, e.g., n033 in the Rp configuration between the +15 nucleotide and the +16 nucleotide.

[0026] In an exemplary embodiment of the first aspect of the invention, the passenger strand comprises two PN chiral centers comprising the structure of, e.g., n084 in the Rp configuration between the +7 nucleotide and the +8 nucleotide and, e.g., n084 in the Rp configuration between the +15 nucleotide and the +16 nucleotide.

[0027] In an exemplary embodiment of the first aspect of the invention, the passenger strand comprises two PN chiral centers comprising the structure of, e.g., n077 in the Rp configuration between the +7 nucleotide and the +8 nucleotide and, e.g., n077 in the Rp configuration between the +15 nucleotide and the +16 nucleotide.

[0028] In an exemplary embodiment of the first aspect of the invention, the passenger strand comprises two PN chiral centers comprising the structure of, e.g., n039 in the Rp configuration between the +7 nucleotide and the +8 nucleotide and, e.g., n039 in the Rp configuration between the +15 nucleotide and the +16 nucleotide.

[0029] In an exemplary embodiment of the first aspect of the invention, the passenger strand comprises two PN chiral centers comprising the structure of, e.g., n003 in the Rp configuration between the +7 nucleotide and the +8 nucleotide and, e.g., n003 in the Rp configuration between the +15 nucleotide and the +16 nucleotide.

[0030] In a second aspect, the invention relates to the dsRNAi agent according to the first aspect, wherein one or both of the guide strand and the passenger strand comprise a non-lipid ligand, e.g., a carbohydrate, a protein, a peptide, a polyamine, a peptide mimic, a receptor ligand, or a combination thereof, conjugated to the 5 ’-end and / or the 3 ’-end, and / or one or more internucleotidic linkages, of one or both of the guide strand and the passenger strand. In an exemplary embodiment, only the passenger strand comprises a non-lipid ligand conjugated to its 5 ’-end, optionally via a linker comprising, e.g., 6-aminohexanoyl (nC6o) moiety. In an exemplary embodiment, the linker further comprises a Cs chain.

[0031] In an exemplary embodiment of the second aspect, the non-lipid ligand is a receptor ligand, e.g., an integrin receptor ligand, receptor ligand), e.g., a mono-OMe-integrin receptor ligand, a bis-OMe-integrin receptor ligand, or a tri-OMe-integrin receptor ligand, wherein the tri-OMe-integrin receptor ligand conjugated to, e.g., the passenger strand comprises the structure of, e.g., -integrin receptor ligand), e.g., a mono-Me-integrin receptor ligand, a bis-Me-integrin receptor ligand, or a tri-Me-integrin receptor ligand, wherein the tri-Me-integrin receptor ligand conjugated to, e.g., the passenger strand comprises the structure of, e.g.,

[0032] p p - g ceptor ligand). In an exemplary embodiment, the receptor ligand is a serotonin receptor ligand, e.g., a serotonin receptor ligand comprising the structure of, e.g., In an exemplary embodiment, the peptide-integrin receptor ligand conjugated to, e.g., the passenger strand comprises the structure of, e.g., exemplary embodiment, the backbone phosphoryl guanidine (PN) chiral centers, e.g., the backbone PN-lipid ligands, e.g., independently between the +7 nucleotide and the +8 nucleotide, and between the +15 nucleotide and the +16 nucleotide, of the passenger strand, comprise the structure of, In an exemplary embodiment of the second aspect, the non-lipid ligand is a carbohydrate, e.g., a mono-GalNAc, a bis-GalNAc, a tri-GalNAc, a mannose derivative, a galactose derivative, a glucose sugar derivative, other saccharide derivatives or combinations thereof. In an exemplary embodiment, the carbohydrate is a tri-GalNAc. In an exemplary embodiment, the guide strand comprises a lipid ligand, e.g., a PN-lipid ligand, conjugated to its 5 ’-end (5 ’-end PN-lipid ligand) and / or its 3 ’-end (3 ’-end PN-lipid ligand), and / or one or more internucleotidic linkages thereof. In an exemplary embodiment, the passenger strand comprises a lipid ligand, e.g., a PN-lipid ligand, conjugated to its 3 ’-end (3 ’-end PN-lipid ligand), and / or one or more internucleotidic linkages thereof. In an exemplary embodiment, the guide strand comprises a PN-lipid ligand conjugated to its 5’-end (5’-end PN-lipid ligand).

[0033] In an exemplary embodiment, the PN-lipid ligand comprises one or two saturated or unsaturated, linear or branched Ce, Cs, Cio, C12, C14, Ci6, Cis, C20, C22, C24, C26, or C28 chain.

[0034] In an exemplary embodiment, the 5 ’-end PN-lipid ligand of the guide strand comprises the In an exemplary embodiment, the guide strand further comprises a backbone PN chiral center comprising the structure of, e.g., between the +10 nucleotide and the +11 nucleotide thereof, e.g., in the Rp configuration.

[0035] In a third aspect, the invention relates to the dsRNAi agent according to the first aspect, wherein one or both of the guide strand and the passenger strand comprise one or more lipid ligands conjugated to the 5 ’-end and / or the 3 ’-end thereof, and / or one or more internucleotidic linkages thereof. In an exemplary embodiment, the lipid ligand is conjugated to the 5 ’-end and / or the 3 ’-end of the passenger strand via a linker comprising, e.g., 6 -ami nohexanol (nC6o). In an exemplary embodiment, the lipid ligand is conjugated to the 5 ’-end of the passenger strand. In an exemplary embodiment, the lipid ligand comprises a saturated or unsaturated, linear or branched Ce, Cs, Cio, C12, C14, Ci6, Cis, C20, C22, C24, C26, or C28 chain, cholesterol or a lipophilic cholesterol derivative, palmitoyl moiety, octadecanoyl moiety, linoleoyl moiety, turbinaric acid moiety, 2 -hexyl decanoy 1 moiety, 20-oxoicosanoyl moiety, or a combination thereof. In an exemplary embodiment, the lipid comprises the structure of, e.g.,

[0036] . In an exemplary embodiment, the lipid ligand comprises an octadecanoyl (Cl 8) moiety. In a fourth aspect, the invention relates to the dsRNAi agent according to the first aspect, wherein one or both of the guide strand and the passenger strand comprise one or more modified sugar moieties, e.g., 2’-modified ribose moiety, at one or more positions 1-7 relative to the 5 ’-end of, e.g., the passenger strand. In an exemplary embodiment, the modified sugar moiety comprises a 2’-lipid modification, 2’-F modification, 2’-OH modification, 2’-0Me modification, 2’-O-alkyl modification (e.g., 2’-O-C16 lipid modification or 2’-O-C18 lipid modification), 2’-M0E modification, DNA, LNA, UNA, GNA, a homo-DNA, or a combination thereof. In an exemplary embodiment, the 2 ’-modification is ~L~, wherein L connects C2 and C4 of the sugar moiety. In an exemplary embodiment, the modified sugar moiety comprises a 2 ’-lipid modification, e.g., a 2 ’ -lipid modified ribose moiety, comprising a saturated or unsaturated, linear or branched Cg, Cs, Cio, C12, C14, Ci6, Cis, C20, C22, C24, C26, or C28 chain. In an exemplary embodiment, the 2’-lipid modified ribose moiety comprises the structure of, e.g.,

[0037] In an exemplary embodiment, the

[0038] 2 ’-lipid modification comprises 2 '-0 -hexadecyl moiety, e.g., at the +7 nucleotide of the passenger. In an exemplary embodiment, the passenger comprises, e.g., nOOl, n009 or n033 between, e.g., the +7 nucleotide and the +8 nucleotide thereof. In an exemplary embodiment, the passenger comprises, e.g., n009 or n033, e.g., between the +7 nucleotide and the +8 nucleotide thereof, and the 2 ’-lipid modification, e.g., 2’-O-hexadecyl moiety, e.g., at the +7 nucleotide thereof. In a fifth aspect, the invention relates to the dsRNAi agent according to the first aspect, wherein one or both of the guide strand and the passenger strand comprise a phosphoryl guanidine-lipid (PN-lipid) ligand at the 5’-end or the 3’-end thereof, wherein the PN-lipid ligand comprises, e.g., one or two saturated or unsaturated Ce, Cs, Cio, C12, C14, Ci6, Cis, C20, C22, C24, C26, or C28 chains, and wherein the PN-lipid ligand further comprises a non-cleavable linker. In an exemplary embodiment, the PN-lipid ligand comprising the non-cleavable linker is conjugated to the 5 ’-end of the passenger strand. In an exemplary embodiment, the non- cleavable linker is, e.g. , , wherein n = 0-24,

[0039] (0C60). In an exemplary embodiment, the non-cleavable linker is conjugated to the PN-lipid ligand via a phosphoester bond. In an exemplary embodiment, the PN-lipid ligand comprising the non-cleavable linker comprises the structure of, e.g., In an exemplary embodiment, the PN-lipid ligand comprising the non-cleavable linker comprises the structure of, e.g.,

[0040]

[0041] In a sixth aspect, the invention relates to the dsRNAi agent according to the first aspect, wherein one or both of the guide strand and the passenger strand comprise one or more backbone phosphoryl guanidine (PN) chiral centers each independently comprising the structure non-lipid variation (non-lipid PN variation) thereof. In an exemplary embodiment, one or both of the guide strand and the passenger strand comprise at least one non-lipid PN variation of nOOl. In an exemplary embodiment, the guide strand comprises at least one non-lipid PN variation of nOOl . In an exemplary embodiment, the guide strand further comprises a PN chiral center, e.g., between the +10 nucleotide and the +11 nucleotide thereof, e.g., in the Rp configuration. In an exemplary embodiment, the guide strand comprises at least one non-lipid PN variation of nOOl, e.g., independently between the +3 nucleotide and the +4 nucleotide, and between the +10 nucleotide and the +11 nucleotide thereof. In an exemplary embodiment, the guide strand comprises a non-lipid PN variation of nOOl, e.g., independently between the +3 nucleotide and the +4 nucleotide, and between the

[0042] +10 nucleotide and the +11 nucleotide thereof. In an exemplary embodiment, the non-lipid PN-variation of nOOl comprises the structure of, e.g., the passenger strand comprises a backbone PS chiral center, e.g., independently between the +1 nucleotide and the +2 nucleotide, and / or between the 3’ terminal (N) nucleotide and the penultimate (N-l) nucleotide thereof, e.g., in the rip configuration. In an exemplary embodiment, the passenger strand comprises backbone PS chiral centers, e.g., independently between the +1 nucleotide and the +2 nucleotide, and between the 3’ terminal (N) nucleotide and the penultimate (N-l) nucleotide thereof, e.g., in the rip configuration.

[0043] In a seventh aspect, the invention relates to the dsRNAi agent according to the first aspect, wherein one or both of the guide strand and the passenger strand comprise a hydrophilic or amphiphilic ligand conjugated to, e.g., the 5’-end and / or the 3’-end thereof, and / or one or more internucleotidic linkages. In an exemplary embodiment, one or both of the guide strand and the passenger strand comprise a hydrophilic or amphiphilic ligand conjugated to the 5’- end thereof via a linker. In an exemplary embodiment, the passenger strand comprise a hydrophilic or amphiphilic ligand conjugated to its 5’-end via a linker comprising, e.g., 6- aminohexanol (nC6o). In an exemplary embodiment, the hydrophilic or amphiphilic ligand

[0044]

[0045] In an eighth aspect, the invention relates to the dsRNAi agent according to the sixth aspect, wherein one or both of the guide strand and the passenger strand comprise a hydrophilic or amphiphilic ligand conjugated to a backbone phosphoryl guanidine (PN) chiral center. In an exemplary embodiment, the passenger strand comprises one or more hydrophilic or amphiphilic ligand conjugated to one or more backbone PN chiral center. In an exemplary embodiment, the backbone PN chiral center is, e.g., between the +7 nucleotide and the +8 nucleotide of the passenger strand, e.g., in the Rp configuration. In an exemplary embodiment, the backbone PN chiral center comprising a hydrophilic or amphiphilic ligand conjugated thereto comprises the structure of, e.g., In an exemplary embodiment of the various aspect of the invention (e.g., the first, the second, the third, the fourth, the fifth, the sixth, the seventh, or the eighth aspect of the invention), the guide strand further comprises a 5’ terminal modification selected from, e.g., the group consisting of, e.g.:

[0046]

[0047] 10 , wherein the base is A, C, G, T, U, abasic, or a modified nucleobase;

[0048] R1is selected from H, OH, O-alkyl, ( -m ethyl (O-Me), F, O-methoxyethyl (MOE), and 2’- 0,4’C-methylene-bridged or locked nucleic acid (2’,4’-BNA or LNA); and R2is selected from alkyl, methyl, ethyl, isopropyl, propyl, cyclohexyl, benzyl, phenyl, tolyl, xylyl, aryl, and arene group. In an exemplary embodiment, the 5’ terminal modification is triazolyl phosphonate or methyl phosphonate. In an exemplary embodiment, the 5’ terminal modification is triazolyl phosphonate.

[0049] In certain embodiments, the guide strand comprises a backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction. In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, further comprise one or a plurality of modified sugars.

[0050] In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, comprise a modified sugar at: the 5’ terminal (+1) nucleotide, second (+2) nucleotide, third (+3) nucleotide, fourth (+4) nucleotide, fifth (+5) nucleotide, sixth (+6) nucleotide, seventh (+7) nucleotide, eighth (+8) nucleotide, ninth (+9) nucleotide, tenth (+ 10), twelfth (+12) nucleotide, sixteenth (+16) nucleotide, seventeenth (+17) nucleotide, eighteenth (+18) nucleotide, nineteenth (+19) nucleotide, twentieth (+20) nucleotide, twenty-first (+21) nucleotide, twenty-second (+22), and / or twenty -third (+23), the 3’ terminal, nucleotide. In certain embodiments, the modified sugar comprises a 2’-F modification, 2’-H modification, 2 ’-OH modification, 2’-O-alkyl modification, e.g., 2’-O-methyl (OMe) modification, 2 ’-methoxy ethyl (MOE) modification, 5 ’-alkyl modification, e.g., 5’-(R)-methyl or 5’-(S)-methyl DNA, locked nucleic acid (LNA), unlocked nucleic acid (UNA), glycol nucleic acid (GNA), or Homo-DNA

[0051] In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3 ’ direction, comprise a 2’-F modification of the 5’ terminal (+1) nucleotide, second (+2) nucleotide, third (+3) nucleotide, fourth (+4) nucleotide, fifth (+5) nucleotide, sixth (+6) nucleotide, seventh (+7) nucleotide, eighth (+8) nucleotide, ninth (+9) nucleotide, tenth (+ 10), twelfth (+12) nucleotide, sixteenth (+16) nucleotide, seventeenth (+17) nucleotide, eighteenth (+18) nucleotide, nineteenth (+19) nucleotide, twentieth (+20) nucleotide, twenty-first (+21) nucleotide, twenty-second (+22), and / or twenty -third (+23), the 3’ terminal, nucleotide.

[0052] In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, comprise a Homo-DNA modification of the 5’ terminal (+1) nucleotide, sixth (+6) nucleotide, ninth (+9) nucleotide, tenth (+ 10), twelfth (+12) nucleotide, sixteenth (+16) nucleotide, seventeenth (+17) nucleotide, eighteenth (+18) nucleotide, nineteenth (+19) nucleotide, twentieth (+20) nucleotide, twenty-first (+21) nucleotide, twenty-second (+22), and / or twenty -third (+23), the 3’ terminal, nucleotide.

[0053] In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, comprise a LNA modification of the 5’ terminal (+1) nucleotide, second (+2) nucleotide, third (+3) nucleotide, fourth (+4) nucleotide, fifth (+5) nucleotide, sixth (+6) nucleotide, seventh (+7) nucleotide, and / or eighth (+8) nucleotide.

[0054] In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, comprise a 2’-O-alkyl modification of the 5’ terminal (+1) nucleotide, second (+2) nucleotide, third (+3) nucleotide, fourth (+4) nucleotide, fifth (+5) nucleotide, sixth (+6) nucleotide, seventh (+7) nucleotide, and / or eighth (+8) nucleotide.

[0055] In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, comprise a 5 ’-alkyl modification of the 5’ terminal (+1) nucleotide, second (+2) nucleotide, third (+3) nucleotide, fourth (+4) nucleotide, fifth (+5) nucleotide, sixth (+6) nucleotide, seventh (+7) nucleotide, and / or eighth (+8) nucleotide.

[0056] In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, comprise a GNA modification of the 5’ terminal (+1) nucleotide, second (+2) nucleotide, third (+3) nucleotide, fourth (+4) nucleotide, fifth (+5) nucleotide, sixth (+6) nucleotide, seventh (+7) nucleotide, and / or eighth (+8) nucleotide.

[0057] In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, comprise a (s)-GNA modification of the 5’ terminal (+1) nucleotide, second (+2) nucleotide, third (+3) nucleotide, fourth (+4) nucleotide, fifth (+5) nucleotide, sixth (+6) nucleotide, seventh (+7) nucleotide, and / or eighth (+8) nucleotide.

[0058] In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, further comprises one or more of:

[0059] (1) a guide strand comprising backbone phosphorothioate chiral centers in Sp configuration between the 3’ terminal nucleotide and the penultimate (N-l) nucleotide and as between the penultimate (N-l) nucleotide and the immediately upstream, i.e., in the 5’ direction, (N-2) nucleotide;

[0060] (2) a guide strand comprising backbone phosphorothioate chiral centers in Rp, Sp, or alternating configurations between the 5’ terminal (+1) nucleotide and the immediately downstream, i.e., in the 3’ direction, (+2) nucleotide and between the +2 nucleotide and the immediately downstream (+3) nucleotide;

[0061] (3) a guide strand comprising one or more backbone phosphorothioate chiral centers upstream, i.e., in the 5’ direction, relative to backbone phosphorothioate chiral centers in Sp configuration between the 3’ terminal nucleotide and the penultimate (N-l) nucleotide and as between the penultimate (N-l) nucleotide and the immediately upstream (N-2) nucleotide, where the upstream backbone phosphorothioate chiral centers are in Rp or Sp configuration; (4) a guide strand comprising one or more backbone phosphorothioate chiral centers in Rp or Sp configuration between the 5’ terminal (+1) nucleotide and the immediately downstream (+2) nucleotide; and between the +2 nucleotide and the immediately downstream (+3) nucleotide;

[0062] (5) a guide strand comprising one or more backbone phosphorothioate chiral centers in Rp or Sp configuration where linkage occurs between any two adjacent nucleotides between the penultimate 3 ’ nucleotide of the guide strand, where N is the 3 ’ terminal nucleotide, and the upstream N-10 nucleotide;

[0063] (6) a guide strand comprising one or more backbone phosphoryl guanidine chiral centers in the Sp configuration between the +7 and the immediately downstream (+8), i.e., in the 3’ direction.

[0064] (7) a guide strand comprising a 5’ terminal modification;

[0065] (8) a passenger strand in combination with one or more of the aforementioned guide strands, comprising one or more backbone chiral centers in Rp or Sp configuration;

[0066] (9) a passenger strand in combination with one or more of the aforementioned guide strands, comprising a non-negatively charged backbone intemucleotidic linkage between the +7 nucleotide and the immediately downstream (+8) nucleotide, i.e., in the 3’ direction;

[0067] (10) a passenger strand in combination with one or more of the aforementioned guide strands, comprising a non-negatively charged backbone intemucleotidic linkage between the +15 nucleotide and the immediately downstream (+16) nucleotide, i.e., in the 3 ’ direction; and

[0068] (11) a passenger strand in combination with one or more of the aforementioned guide strands, comprising backbone phosphorothioate chiral centers in the Sp configuration between the 5’ terminal (+1) nucleotide and the immediately downstream, i.e., in the 3’ direction, (+2) nucleotide and between the 3 ’ terminal nucleotide and the penultimate (N-l) nucleotide; wherein the ds oligonucleotide further comprises one or more of:

[0069] (1) a guide strand where one or both of the 5’ and 3’ terminal dinucleotides are not linked by a Rp, Sp, or stereorandom non-negatively charged intemucleotidic linkages, i.e., the guide strand comprises one or more Rp, Sp, or stereorandom non-negatively charged intemucleotidic linkages downstream, i.e., in the 3’ direction, relative to the linkage between the 5’ terminal dinucleotide and / or upstream, i.e., in the 5’ direction, relative to the linkage between the 3’ terminal dinucleotide;

[0070] (2) a guide strand where one or more Rp, Sp, or stereorandom non-negatively charged intemucleotidic linkage occurs between any two adjacent nucleotides between the second (+2) nucleotide relative to the 5 ’ terminal nucleotide of the guide strand and the penultimate 3’ (N-l) nucleotide of the guide strand, where N is the 3’ terminal nucleotide;

[0071] (3) a guide strand where an Rp, Sp, or stereorandom non-negatively charged intemucleotidic linkage occurs between the tenth (+10) and eleventh (+11) nucleotides, relative to the 5 ’ terminal nucleotide;

[0072] (4) a guide strand where an Rp, Sp, or stereorandom non-negatively charged intemucleotidic linkage occurs between the seventh (+7) and eighth (+8) nucleotides, relative to the 5 ’ terminal nucleotide;

[0073] (5) a guide strand comprising one or more backbone phosphorothioate chiral centers in Rp or Sp configuration where linkage occurs between any two adjacent nucleotides between the penultimate 3’ nucleotide of the guide strand, where N is the 3’ terminal nucleotide, and the upstream N-10 nucleotide;

[0074] (6) a passenger strand where one or more Rp, Sp, or stereorandom non-negatively charged intemucleotidic linkage occurs upstream, i.e., in the 5’ direction, relative to the central nucleotide of the passenger strand; and

[0075] (7) a passenger strand where one or more Rp, Sp, or stereorandom non-negatively charged intemucleotidic linkage occurs downstream, i.e., in the 3’ direction, relative to the central nucleotide of the passenger strand.

[0076] (8) a passenger strand where one or more backbone phosphorothioate chiral centers in Rp or Sp configuration intemucleotidic linkage occurs upstream, i.e., in the 5 ’ direction, relative to the central nucleotide of the passenger strand;

[0077] (9) a passenger strand where one or more backbone phosphorothioate chiral centers in Rp or Sp configuration intemucleotidic linkage intemucleotidic linkage occurs downstream, i.e., in the 3’ direction, relative to the central nucleotide of the passenger strand; and (10) a passenger strand comprising one or more modified sugars, e.g. Homo-DNA, between the 5’ terminal (+1) nucleotide and the penultimate (N-l) nucleotide.

[0078] In certain embodiments, the ds oligonucleotide further comprises a 2’ modification, e.g., a 2’ F modification, of the 3’ nucleotide of a nucleotide pair linked by a Rp, Sp, or stereorandom non-negatively charged intemucleotidic linkage. In certain embodiments the 2’ modification is selected from, a 2’-F modification, a 2’-H modification, a 2’-OH modification, and a 2’-O- alkyl modification, e.g., 2’-O-methyl (OMe) modification, a 2 ’-methoxy ethyl (MOE) modification. In certain embodiments, the ds oligonucleotide further comprises a modification selected from 5 ’-alkyl modifications, e.g., 5’-(R)-methyl or 5’-(S)-methyl DNA, locked nucleic acids (LNA), unlocked nucleic acids (UNA), glycol nucleic acids (GNA), and Homo-DNA. In certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged intemucleotidic linkage incorporated into the guide or passenger strand is an Rp non-negatively charged intemucleotidic linkage. In certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged intemucleotidic linkage is an Sp non-negatively charged intemucleotidic linkage. In certain embodiments, the one or more Rp, Sp, or stereorandom non- negatively charged intemucleotidic linkage is a stereorandom non-negatively charged intemucleotidic linkage. In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, further comprise one or a plurality of modified sugars. In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, comprise a modified sugar at the 5’ terminal (+1) nucleotide, second (+2) nucleotide, third (+3) nucleotide, fourth (+4) nucleotide, fifth (+5) nucleotide, sixth (+6) nucleotide, seventh (+7) nucleotide, eighth (+8), ninth (+9) nucleotide, tenth (+ 10), twelfth (+12) nucleotide, sixteenth (+16) nucleotide, seventeenth (+17) nucleotide, eighteenth (+18) nucleotide, nineteenth (+19) nucleotide, twentieth (+20) nucleotide, twenty-first (+21) nucleotide, twenty-second (+22), and / or twenty -third (+23), the 3’ terminal, nucleotide.

[0079] In certain embodiments, the present disclosure encompasses the recognition that stereochemistry, e.g., stereochemistry of chiral centers at a 5’ terminal modification of guide strands, can unexpectedly maintain or improve properties of the ds oligonucleotides described herein. For example, but not by way of limitation, the instant disclosure relates, in part, to ds oligonucleotides comprising a guide stranding comprising one or more of (1) a backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide; (2) a phosphorothioate chiral center in Rp or Sp configuration; (3) an Rp, Sp, or stereorandom non-negatively charged intemucleotidic linkage where the 3’ nucleotide of a nucleotide pair linked by an Rp, Sp, or stereorandom non- negatively charged intemucleotidic linkage comprises a 2’ modification, e.g., a 2’ F or a 2’- OMe; (4) a modified sugar selected from a 2’-F modification, 2’-H modification, 2’-OH modification, 2’-O-alkyl modification, e.g., 2’-O-methyl (OMe) modification, 2’- methoxyethyl (MOE) modification, 5 ’-alkyl modification, e.g., 5’-(R)-methyl or 5’-(S)-methyl DNA, locked nucleic acid (LNA), unlocked nucleic acid (UNA), glycol nucleic acid (GNA), or Homo-DNA; and (5) a 5’ terminal modification selected from:

[0080] (a) 5’ PO modifications, such as, but not limited to:

[0081] (b) 5’ VP modifications, such as, but not limited to: (c) 5’ MeP modifications, such as, but not limited to:

[0082] (d) 5’ PN and 5’ Triazole-P modifications, such as, but not limited to:

[0083] wherein Base is selected from A, C, G, T, U, abasic and modified nucleobases; R1is selected from an alkyl, methyl, ethyl, isopropyl, propyl, cyclohexyl, benzyl, phenyl, tolyl, xylyl, aryl, or arene group.

[0084] R2is selected from H, OH, O-alkyl, O-Me, F, MOE, locked nucleic acid (LNA) bridges and bridged nucleic acid (BNA) bridges to the 4’ C, such as, but not limited to: , an . In certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage incorporated into the guide strand is an Rp non-negatively charged internucleotidic linkage. In certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage is an Sp non-negatively charged internucleotidic linkage. In certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage is a stereorandom non- negatively charged internucleotidic linkage.

[0085] In certain embodiments, the guide strand comprises, a backbone phosphorothioate chiral center in Sp configuration between the 5’ terminal (+1) nucleotide and the immediately downstream, i.e., in the 3’ direction, (+2) nucleotide, and a backbone phosphorothioate chiral center in the Rp configuration between the +2 nucleotide and the immediately downstream

[0086] (+3) nucleotide. In certain embodiments, the 5 ’ terminal modification is

[0087] . In some embodiments, the 5 ’ terminal modification i certain embodiments, the 5 ’ terminal modification i certain embodiments, the guide strand comprises a 5’ terminal modification selected from, but not limited to, 5’ MeP modifications and 5’ Triazole-P modifications. In certain embodiments, the guide strand comprises the 5’

[0088] MeP modification a backbone phosphorothioate chiral center in Sp configuration between the 5’ terminal (+1) nucleotide and the immediately downstream, i.e., in the 3’ direction, (+2) nucleotide, and a backbone phosphorothioate chiral center in the Rp configuration between the +2 nucleotide and the immediately downstream (+3) nucleotide. In certain other embodiments, the present disclosure encompasses the recognition that stereochemistry, e.g., stereochemistry of chiral centers at the 5’ terminal nucleotide of guide strands, can unexpectedly maintain or improve properties of ds oligonucleotides wherein the guide strand of the ds oligonucleotide also comprises a phosphorothioate chiral center in Rp or Sp configuration. For example, but not by way of limitation, the instant disclosure relates, in part, to ds oligonucleotides comprising a guide stranding comprising: (1) a phosphorothioate chiral center in Rp or Sp configuration; (2) an Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage where the 3’ nucleotide of a nucleotide pair linked by an Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage comprises a 2’ modification, e.g., a 2’ F or a 2’-0Me; and (3) a 5’ terminal modification selected from: (a) 5’ PO nucleotides, such as, but not limited to:

[0089] (b) 5’ VP nucleotides, such as, but not limited to:

[0090] (c) 5’ MeP nucleotides, such as, but not limited to:

[0091] (d) 5’ PN and 5’ Triazole-P nucleotides, such as, but not limited to:

[0092] (e) 5’ abasic VP and 5’ abasic MeP nucleotides, such as, but not limited to: certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage incorporated into the guide strand is an Rp non-negatively charged internucleotidic linkage. In certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage is an Sp non-negatively charged internucleotidic linkage. In certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage is a stereorandom non- negatively charged internucleotidic linkage.

[0093] In certain other embodiments, the present disclosure encompasses the recognition that stereochemistry, e.g., stereochemistry of chiral centers at the 5’ terminal nucleotide of guide strands, can unexpectedly maintain or improve properties of ds oligonucleotides wherein the guide strand of the ds oligonucleotide also comprises a phosphorothioate chiral center in Rp or Sp configuration. For example, but not by way of limitation, the instant disclosure relates, in part, to ds oligonucleotides comprising a guide stranding comprising: (1) a backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide; (2) a backbone phosphoryl guanidine chiral center in the Rp configuration between the +7 nucleotide and the immediately downstream (+8) nucleotide; (3) a phosphorothioate chiral center in Rp or Sp configuration; and (4) a protected phosphonate selected from: certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage incorporated into the guide strand is an Rp non-negatively charged internucleotidic linkage. In certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage is an Sp non-negatively charged internucleotidic linkage. In certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage is a stereorandom non-negatively charged internucleotidic linkage.

[0094] In certain embodiments, the present disclosure encompasses the recognition that non- naturally occurring internucleotidic linkages, e.g., neutral internucleotidic linkages, can, in certain embodiments, be used to link one or more molecules to the double-stranded oligonucleotides described herein. In certain embodiments, such linked molecules can facilitate targeting and / or delivery of the double-stranded oligonucleotide. For example, but not limitation, such linked molecules an include lipophilic molecules. In certain embodiments, the linked molecule is a molecule comprising one or more GalNAc moieties. In certain embodiments, the linked molecule is a receptor. In certain embodiments, the linked molecule is a receptor ligand.

[0095] In certain embodiments, the present disclosure provides technologies for incorporating various additional chemical moieties into ds oligonucleotides. In certain embodiments, the present disclosure provides, for example, reagents and methods for introducing additional chemical moieties through nucleobases e.g., by covalent linkage, optionally via a linker, to a site on a nucleobase).

[0096] In certain embodiments, the present disclosure provides technologies, e.g., ds oligonucleotide compositions and methods thereof, that achieve allele-specific suppression, wherein transcripts from one allele of a particular target gene is selectively knocked down relative to at least one other allele of the same gene.

[0097] Among other things, the present disclosure provides structural elements, technologies and / or features that can be incorporated into ds oligonucleotides and can impart or tune one or more properties thereof (e.g., relative to an otherwise identical ds oligonucleotide lacking the relevant technology or feature). In certain embodiments, the present disclosure documents that one or more provided technologies and / or features can usefully be incorporated into ds oligonucleotides of various sequences.

[0098] In certain embodiments, the present disclosure demonstrates that certain provided structural elements, technologies and / or features are particularly useful for ds oligonucleotides that participate in and / or direct RNAi mechanisms (e.g., RNAi agents). Regardless, however, the teachings of the present disclosure are not limited to ds oligonucleotides that participate in or operate via any particular mechanism. In certain embodiments, the present disclosure pertains to any ds oligonucleotide, useful for any purpose, which operates through any mechanism, and which comprises any sequence, structure or format (or portion thereof) described herein. In certain embodiments, the present disclosure provides a ds oligonucleotide, useful for any purpose, which operates through any mechanism, and which comprises any sequence, structure or format (or portion thereof) described herein, comprising a guide strand comprising backbone phosphoryl guanidine chiral centers in Sp configuration.

[0099] In certain embodiments, the guide strand comprises a backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction.

[0100] In certain embodiments, the ds oligonucleotides comprising a guide strand backbone phosphoryl guanidine chiral center in the Sp configuration between the +3 nucleotide and the immediately downstream (+4) nucleotide, i.e., in the 3’ direction, further comprise a phosphoryl guanidine chiral center in the Sp configuration between the +7 and the immediately downstream (+8) nucleotide, between the +10 nucleotide and the immediately downstream (+11) nucleotide, between the +18 nucleotide and the immediately downstream (+19) nucleotide, or combinations thereof.

[0101] In certain embodiments, the provided ds oligonucleotides may participate in (e.g., direct) RNAi mechanisms. In certain embodiments, provided ds oligonucleotides may participate in RNase H (ribonuclease H) mechanisms. In certain embodiments, provided ds oligonucleotides may act as translational inhibitors (e.g., may provide steric blocks of translation).

[0102] In certain embodiments, the one or more Rp, Sp, or stereorandom non -negatively charged intemucleotidic linkage incorporated into the guide strand is an Rp non-negatively charged intemucleotidic linkage. In certain embodiments, the one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage is an Sp non-negatively charged internucleotidic linkage. In certain embodiments, the one or more Rp, Sp, or stereorandom non- negatively charged internucleotidic linkage is a stereorandom non-negatively charged internucleotidic linkage. In certain further embodiments, the passenger strand comprises an Sp backbone phosphorothioate chiral center between the 5’ terminal (+1) nucleotide and the immediately downstream (+2) nucleotide and an Sp backbone phosphorothioate chiral center between the penultimate (N-l) nucleotide and the 3’ terminal (N) nucleotide.

[0103] Unless otherwise noted, all sequences (including, but not limited to base sequences and patterns of chemistry, modification, and / or stereochemistry) are presented in 5’ to 3’ order, with the 5’ terminal nucleotide identified as the “+1” position and the 3’ terminal nucleotide identified either by the number of nucleotides of the full sequence or by “N”, with the penultimate nucleotide identified, e.g., as “N-l”, and so on.

[0104] In certain embodiments, the present disclosure provides compositions and methods related to an oligonucleotide which is specific to a target and which has any format, structural element or base sequence of any oligonucleotide disclosed herein.

[0105] In certain embodiments, the present disclosure provides compositions and methods related to an oligonucleotide which is specific to a target and which has or comprises the base sequence of any oligonucleotide disclosed herein, or a region of at least 15 contiguous nucleotides of the base sequence of any oligonucleotide disclosed herein, wherein the first nucleotide of the base sequence or the first nucleotide of the at least 15 contiguous nucleotides can be optionally replaced by T or DNA T.

[0106] In certain embodiments, the present disclosure provides compositions and methods for RNA interference directed by a RNAi agent (also referred to as a RNAi oligonucleotides). In certain embodiments, oligonucleotides of such compositions can have a format, structural element or base sequence of an oligonucleotide disclosed herein.

[0107] In certain embodiments, the present disclosure provides compositions and methods for RNase H-mediated knockdown of a target gene RNA directed by an oligonucleotide e.g., an antisense oligonucleotide).

[0108] Provided oligonucleotides and oligonucleotide compositions can have any format, structural element or base sequence of any oligonucleotide disclosed herein. In certain embodiments, a structural element is a 5 ’-end structure, 5 ’-end region, 5 ’-nucleotide, seed region, post-seed region, 3 ’-end region, 3 ’-terminal dinucleotide, 3 ’-end cap, or any portion of any of these structures, GC content, long GC stretch, and / or any modification, chemistry, stereochemistry, pattern of modification, chemistry or stereochemistry, or a chemical moiety (e.g., including but not limited to, a targeting moiety, a lipid moiety, a GalNAc moiety, a carbohydrate moiety, etc.), any component, or any combination of any of the above.

[0109] In certain embodiments, the present disclosure provides compositions and methods of use of an oligonucleotide.

[0110] In certain embodiments, an oligonucleotide directing a particular event or activity participates in the particular event or activity, e.g., a decrease in the expression, level or activity of a target gene or a gene product thereof. In certain embodiments, an oligonucleotide is deemed to “direct” a particular event or activity when presence of the oligonucleotide in a system in which the event or activity can occur correlates with increased detectable incidence, frequency, intensity and / or level of the event or activity.

[0111] In certain embodiments, provided ds oligonucleotides, compositions and methods can be delivered to the endocrine, respiratory, circulatory, or urinary system, = In certain embodiments, provided ds oligonucleotides, compositions and methods can be delivered to various regions of the endocrine, respiratory, circulatory, or urinary system without conjugation to a targeting ligand (e.g., peptide, sugar, etc.), without a delivery system (e.g., lipid nanoparticles, etc.), or combinations thereof.

[0112] In certain embodiments, a provided oligonucleotide comprises any one or more structural elements of an oligonucleotide as described herein, e.g., abase sequence (or a portion thereof of at least 15 contiguous bases); a pattern of intemucleotidic linkages (or a portion thereof of at least 5 contiguous intemucleotidic linkage); a pattern of stereochemistry of intemucleotidic linkages (or a portion thereof of at least 5 contiguous intemucleotidic linkages); a 5’-end structure; a 5’-end region; a first region; a second region; and a 3’-end region (which can be a 3 ’-terminal dinucleotide and / or a 3 ’-end cap); and an optional additional chemical moiety; and, in certain embodiments, at least one structural element comprises a chirally controlled chiral center. In certain embodiments, a 3 ’-terminal dinucleotide can comprise two total nucleotides. In certain embodiments, an oligonucleotide further comprises a chemical moiety selected from, as non-limiting examples, a targeting moiety, a carbohydrate moiety, a GalNAc moiety, a lipid moiety, and any other chemical moiety described herein or known in the art. In certain embodiments, a moiety that binds APGR is a moiety of GalNAc, or a variant, derivative or modified version thereof, as described herein and / or known in the art. In certain embodiments, an oligonucleotide is a RNAi agent. In certain embodiments, a first region is a seed region. In certain embodiments, a second region is a post-seed region.

[0113] In certain embodiments, a provided oligonucleotide comprises any one or more structural elements of a RNAi agent as described herein, e.g., a 5 ’-end structure; a 5 ’-end region; a seed region; a post-seed region (the region between the seed region and the 3 ’-end region); and a 3 ’-end region (which can be a 3 ’-terminal dinucleotide and / or a 3 ’-end cap); and an optional additional chemical moiety; and, in certain embodiments, at least one structural element comprises a chirally controlled chiral center. In certain embodiments, a 3 ’-terminal dinucleotide can comprise two total nucleotides. In certain embodiments, an oligonucleotide further comprises a chemical moiety selected from, as non-limiting examples, a targeting moiety, a carbohydrate moiety, a GalNAc moiety, and a lipid moiety. In certain embodiments, a moiety that binds APGR is any GalNAc, or variant, derivative or modification thereof, as described herein or known in the art.

[0114] In certain embodiments, a provided oligonucleotide comprises any one or more structural elements of an oligonucleotide as described herein, e.g., a 5 ’-end structure, a 5 ’-end region, a first region, a second region, a 3 ’-end region, and an optional additional chemical moiety, wherein at least one structural element comprises a chirally controlled chiral center. In certain embodiments, the oligonucleotide comprises a span of at least 5 total nucleotides without 2’-modifications. In certain embodiments, the oligonucleotide further comprises an additional chemical moiety selected from, as non-limiting examples, a targeting moiety, a carbohydrate moiety, a GalNAc moiety, and a lipid moiety. In certain embodiments, a provided oligonucleotide is capable of directing RNA interference. In certain embodiments, a provided oligonucleotide is capable of directing RNase H-mediated knockdown. In certain embodiments, a provided oligonucleotide is capable of directing both RNA interference and RNase H-mediated knockdown. In certain embodiments, a first region is a seed region. In certain embodiments, a second region is a post-seed region.

[0115] In certain embodiments, a nucleotide is a natural nucleotide. In certain embodiments, a nucleotide is a modified nucleotide. In certain embodiments, a nucleotide is a nucleotide analog. In certain embodiments, a base is a modified base. In certain embodiments, a base is protected nucleobase, such as a protected nucleobase used in oligonucleotide synthesis. In certain embodiments, a base is a base analog. In certain embodiments, a sugar is a modified sugar. In certain embodiments, a sugar is a sugar analog. In certain embodiments, an internucleotidic linkage is a modified internucleotidic linkage. In certain embodiments, a nucleotide comprises a base, a sugar, and an internucleotidic linkage, wherein each of the base, the sugar, and the internucleotidic linkage is independently and optionally naturally-occurring or non-naturally occurring. In certain embodiments, a nucleoside comprises a base and a sugar, wherein each of the base and the sugar is independently and optionally naturally-occurring or non-naturally occurring. Non-limiting examples of nucleotides include DNA (2 ’-deoxy) and RNA (2’-OH) nucleotides; and those which comprise one or more modifications at the base, sugar and / or intemucleotidic linkage. Non-limiting examples of sugars include ribose and deoxyribose; ribose and deoxyribose with 2 ’-modifications, including but not limited to 2’-F, LNA, 2’-0Me, 2’-O-C16 lipid, and 2 ’-MOE modifications; and ribose and deoxyribose with 5 ’-modifications, including, but not limited to 5 ’-alkyl modifications. In certain embodiments, an intemucleotidic linkage is a moiety which does not a comprise a phosphorus but serves to link two natural or non-natural sugars.

[0116] In certain embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides which share:

[0117] 1) a common base sequence;

[0118] 2) a common pattern of backbone linkages;

[0119] 3) common stereochemistry independently at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, or 50 chiral intemucleotidic linkages (“chirally controlled intemucleotidic linkages”); which composition is chirally controlled in that level of the first plurality of oligonucleotides in the composition is predetermined.

[0120] II. DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

[0121] Technologies of the present disclosure may be understood more readily by reference to the following detailed description of certain embodiments.

[0122] Definitions

[0123] As used herein, the following definitions shall apply unless otherwise indicated. For purposes of this disclosure, the elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. Additionally, general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith, M.B. and March, J., John Wiley & Sons, New York: 2001.

[0124] As used herein, the terms “aliphatic”, “alkenyl”, “alkyl”, “alkynyl”, “analog”, “animal”, “aryl", “chiral control”, “chirally controlled oligonucleotide composition”, “cycloaliphatic,” “heteroaliphatic”, “heteroalkyl”, “heteroaryl”, “heteroatom", “heterocycle”, “identity”, “intemucleotidic linkage”, “in vitro”, “in vivo”, “ligand”, “linkage phosphorus”, “lipid” "modified nucleobase", "modified base", "modified nucleoside", “modified nucleotide”, “modified sugar”, “nucleic acid”, “nucleobase”, “nucleoside”, “nucleotide”, "oligonucleotide", “oligonucleotide type”, “substituted”, “optionally substituted”, “stable”, “P- modification”, “partially unsaturated”, “pharmaceutical composition”, “pharmaceutically acceptable”, “pharmaceutically acceptable carrier”, “pharmaceutically acceptable salt”, “predetermined”, “protecting group”, “subject”, “test subject”, “substantially”, “sugar”, “susceptible to”, “therapeutic agent”, “therapeutically effective amount”, “treatment”, “treating”, and "unsaturated", “wild-type” have their art-understood meaning as would be appreciated by those of ordinary skill in the art, and as specifically defined in WO 2024 / 182749, at pages 147-179, the contents of which are incorporated herein by reference in their entirety.

[0125] As those skilled in the art will appreciate, methods and compositions described herein relating to provided compounds (e.g., oligonucleotides) generally also apply to pharmaceutically acceptable salts of such compounds.

[0126] 1. Description of Certain Embodiments

[0127] As examples, certain dsRNAi oligonucleotides comprising certain example base sequences, nucleobase modifications and patterns thereof, sugar modifications and patterns thereof, internucleotidic linkages and patterns thereof, linkage phosphorus stereochemistry and patterns thereof, linkers, and / or additional chemical moieties are presented in Table 1 (e.g., Tables IB, 1C, ID, and IE), below. Among other things, ds oligonucleotides, e.g., those in Table 1, may be utilized to target a transcript, e.g., to reduce the level of a transcript and / or a product thereof.

[0128] Table IB. Example Oligonucleotides that target TTR

[0129] Table 1C. Example Oligonucleotides

[0130] Table ID. Example Guide Strand Oligonucleotides

[0131] Table IE. Example Passenger Strand Oligonucleotides

[0132] Table IF. Example Oligonucleotides

[0133]

[0134] Table 1H

[0135]

[0136] Table II

[0137] Notes:

[0138] HELM Description and Base Sequence, due to their length, may be divided into multiple lines in Table 1 (e.g., Tables 1A, IB, 1C, and ID). Unless otherwise specified, all oligonucleotides in Table 1 are single-stranded. As appreciated by those skilled in the art, nucleoside units are unmodified and contain unmodified nucleobases and 2’-deoxy sugars unless otherwise indicated (e.g., with m, [fl2r], etc.); linkages, unless otherwise indicated, are natural phosphate linkages; and acidic / basic groups may independently exist in their salt forms. If a sugar is not specified, the sugar is a natural DNA sugar; and if an internucleotidic linkage is not specified, the internucleotidic linkage is a natural phosphate linkage. A natural DNA sugar may also be indicated with “d” as in d(G), d(A), d(C), d(T), etc., and a natural phosphate linkage may be indicated with “p” in Table (e.g., Tables IB 1C,1D, and IE). Oligonucleotides in Table 1 are described using the Hierarchical Editing Language for Macromolecules (HELM), which is described in, e.g., Zhang, T. et al. J Chem Inf Model. 2012 Oct 22;52(10):2796-806 and Milton, J. et al. J Chem Inf Model. 2017 Jun 26;57(6): 1233-1239, which are incorporated herein by reference. As described in Zhang et al., 2012 and Milton et al., 2017, connections between oligonucleotides, linker moieties, GalNAc moieties, etc. may be indicated in HELM, for example, as the following: CHEM1,RNA1,1 :R1-1 :R1, wherein CHEMI is, e.g., a first linker or moiety, RNA1 is an oligonucleotide, and 1 :R1-1 :R1 indicates that CHEMI is linked via a first attachment point to a first attachment point on a first monomer of RNA1, as described herein (see, e.g., below). A double-stranded oligonucleotide may be indicated in HELM, for example, as the following: RNA1, wherein RNA1 is, e.g., a first oligonucleotide strand of a double-stranded oligonucleotide, and RNA2, wherein RNA2 is, e.g., a second oligonucleotide strand of the double-stranded oligonucleotide. Various moieties and modifications (e.g., internucleotidic linkages, sugars, nucleobases, etc.) are described in the present disclosure including the below: m: 2’-0Me or 2-(9-methylribose;

[0139] [f!2r]: 2’-F or 2-fluororibose;

[0140] PO or p: phosphodiester (phosphate);

[0141] PS or [sp] : phosphorothioate;

[0142] Ap or [Rsp]: phosphorothioate in the Rp configuration; Sp or [Ssp] : phosphorothioate or phosphoryl guanidine in the Sp configuration; -dimethylimidazolidin-2-ylidene)phosphoramidate;

[0143] [nOOIR]: nOOl in Rp configuration;

[0144] [nOOlS]: nOOl in Sp configuration; -dimethylimidazolidin-2-ylidene)phosphoramidate;

[0145] [n003R]: n003 in Rp configuration;

[0146] [n003S]: n003 in Sp configuration; (di(morpholin- l -yl)methylene)phosphoramidate;

[0147] [n008R]: n008 in Rp configuration;

[0148] [n008S]: n008 in Sp configuration; -docecyl-3-methylimidazolidin-2- ylidene)phosphoramidate; [n009R]: n009 in Rp configuration;

[0149] [n009S]: n009 in Sp configuration; -dimethyltetrahydropyrimidin-2(lH)- ylidene)phosphoramidate;

[0150] [nO25R]: n025 in Rp configuration;

[0151] [nO25S]: n025 in Sp configuration; dimethylamino-butyl)-3-methylimidazolidin-2- ylidene)phosphoramidate;

[0152] [nO29R]: n029 in Rp configuration;

[0153] [nO29S]: n029 in Sp configuration; -hexyl-3-methylimidazolidin-2- ylidene)phosphoramidate;

[0154] [n031R]: n031 in Rp configuration;

[0155] [n03 IS]: n031 in Sp configuration; -hexadecyl-3 - methylimidazolidin-2-ylidene)phosphoramidate;

[0156] [n033R]: n033in Rp configuration;

[0157] [n033S]: n033 in Sp configuration; -dihexylimidazolidin-2- ylidene)phosphoramidate;

[0158] [nO37R]: n037in Rp configuration;

[0159] [nO37S] : n037 in Sp configuration; didodecylimidazolidin-2-ylidene)phosphoramidate;

[0160] [nO39R]: n039 in Rp configuration;

[0161] [nO39S]: n039 in Sp configuration; (l,3-dihexadecylimidazolidin-2-ylidene)phosphoramidate;

[0162] [n040R]: n040in Rp configuration;

[0163] [n040S]: n040 in Sp configuration; ( 1,3 -di(2 -methoxy ethyl)imidazolidin-2- ylidene)phosphoramidate; [nO43R]: n043 in Rp configuration;

[0164] [nO43S]: n043 in Sp configuration; -pent-2-en-l-yl]imidazolidin-2- ylidene)phosphoramidate; [nO46R]: n046in Rp configuration;

[0165] [nO46S]: n046 in Sp configuration; -pent-2-en-l-yl]imidazolidin-2- ylidene)phosphoramidate; [nO47R]: n047in Rp configuration;

[0166] [nO47S]: n047 in b'p configuration; -dirnethyl- l ,3-dihydro-27 / -benzo[d]irnidazol-2- ylidene)phosphoramidate;

[0167] [nO65R]: n065 in Rp configuration; [nO65S]: n065 in Sp configuration; aminopropyl)-3-methylimidazolidin-2- ylidene)phosphoramidate;

[0168] [nO69R]: n069 in Rp configuration;

[0169] [nO69S]: n069 in Sp configuration; l ,3, dimethyl octahydro-27 / -benzo[d]imidazol-

[0170] 2ylidene)phosphoramidate;

[0171] [n070R]: n070 in Rp configuration;

[0172] [n070S]: n070 in Sp configuration; benzo[d]imidazol-

[0173] 2ylidene)phosphoramidate;

[0174] [nO71R]: n071 in Rp configuration;

[0175] [nO71S]: n071 in Sp configuration;

[0176] [nO76R]: n076in Rp configuration;

[0177] [nO76S]: n076 in Sp configuration; dimethylimidazolidin-2-ylidene)phosphoramidate;

[0178] [nO77R]: n077in Rp configuration;

[0179] [nO77S]: n077 in Sp configuration; (disub phosphoryl)-! -decyl-3 - methylimidazolidin-2-imine;

[0180] [nO82R]: n082in Rp configuration;

[0181] [nO82S]: n082 in Sp configuration; (disub phosphoryl)- 1- tetradecyl -3-methylimidazolidin-2-imine;

[0182] [nO83R]: n083in Rp configuration;

[0183] [nO83S]: n083 in Sp configuration; (disub phosphoryl)-! -octadecyl-3-methylimidazolidin-2-imine;

[0184] [nO84R]: n084in Rp configuration;

[0185] [nO84S]: n084 in Sp configuration; linoleic acid;

[0186] [nO86R]: n086 in Rp configuration;

[0187] [nO86S]: n086 in Sp configuration; hexyldecanoic acid;

[0188] [nO87R]: n087 in Rp configuration;

[0189] [nO87S]: n087 in Sp configuration; oleic acid;

[0190] [nO88R]: n088 in Rp configuration;

[0191] [nO88S]: n088 in Sp configuration;

[0192] (l-(3-stearamidopropyl)-methyl-3-methylimidazoli din-2 -ylidene)phosphoramidate; [nO89R]: n089 in Rp configuration;

[0193] [nO89S]: n089 in Sp configuration; orN-(l-(3-palmitoleamidopropyl)-methyl-3-methylimidazolidin-2-ylidene)phosphoramidate;

[0194] [n090R]: n090 in Rp configuration; [n090S]: n090 in Sp configuration; palmitamidopropyl)-methyl-3-methylimidazolidin-2-ylidene)phosphoramidate;

[0195] [nO91R]: n091 in Rp configuration;

[0196] [nO91S]: n091 in Sp configuration; orN-(l-(3-turbinaramidopropyl)-methyl-3-methylimidazolidin-2-ylidene)phosphoramid;

[0197] [nO92R]: n092 in Rp configuration;

[0198] [nO92S]: n092 in Sp configuration; [ptz] : ( l / / - l ,2,3-triazol-4-yl)phosphonate;

[0199] [Rm5d5m]: 5-(A)-methyl-5-deoxy-2-(9-methylribose;

[0200] [vped5m] : 5-(E)-vinylphosphonate-5-deoxy-2-methylribose;

[0201] [d25r]: 2,5-deoxyribose;

[0202] [Rm5m]: 5-(A)-methyl-2-O-methylribose;

[0203] [Rm5fl2r]: 5-(A)-methyl-2-fluororibose;

[0204] [Sm5fl2r] : 5-(5)-methyl-2-fluororibose;

[0205] [Sgna]: 5-propanetriol;

[0206] [Mucin3C5oyl]: triantennary mucin 5 AC inhibitor with a C5 linker;

[0207] [hexdec2r]: 2-O-hexadecylribose;

[0208] [C16oyl]: palmitic acid;

[0209] [Cl 8oyl]: octadecanoic acid (stearic acid);

[0210] [lin] : linoleic acid;

[0211] [turb]: turbinaric acid;

[0212] [chol3o]: cholesterol-3 -ester;

[0213] [2hexC10oyl]: 2-hexyldecanoic acid;

[0214] [Hexa3C12oyl]: triantennary hexanoic acid with C12 linker;

[0215] [Bam3C5oyl]: triantennary benzamide with C5 linker;

[0216] [oylC20oyl]: 20-oxoicosanoic acid;

[0217] [Muco]: E,E-muconic acid;

[0218] [oylZ58C13oyl]: Z,Z-tridec-5,8-dienedioic acid;

[0219] [SrllCl loyl]: 5-chloro-l,4-dihydro-4-methyl-2-quinazolinamine, Cl loyl linker;

[0220] [Citr] : L-citruline;

[0221] [Phodec]: 10-(4-(2-carboxyethyl)phenoxy)decanoic acid;

[0222] [EPhodec]: (E')-10-(4-(2-carboxyvinyl)phenoxy)decanoic acid;

[0223] [Bardoyl]: bardoxolone (acid-linked);

[0224] [anis3C5oyl]: A-A-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate;

[0225] [thpyr]: 2,3-dideoxy-beta-D-glucopyranose;

[0226] [Int3C5oyl_l]: trientenary AVB6 (integrin) receptor ligand-1 with C5 linker;

[0227] [Alkyn3C5oyl]: triantennary alkyne v2 with C5 linker;

[0228] [GlulC5oyl]: mono glucose, C5oyl linker;

[0229] [bManlC5oyl]: mono beta mannose, C5oyl linker;

[0230] [AmheptC3oyl]: aminoheptanedioic acid with a C3 linker;

[0231] [GalNAclpyr]: mono GalNAc C5-amino-C6-pyrrolidine [GalNAc3C12oyl]: triantennary GalNAc with C12 linker or

[0232] [GalNAc3C12oyl][nC6o] conjugated to the 5’-end of an oligonucleotide:

[0233] = oligonucleotide chain nC6o or [nC6o]: -NH-(CH2)e_linker (C6 linker, C6 amine linker or C6 amino linker), connected to one moiety, e.g., CHEM2, through -NH- (e.g., forming an amide group - C(O)-NH-), and, in various cases, the 5 ’-end of the oligonucleotide chain through a linkage (e.g., if the 5 ’-end of an oligonucleotide contains p, through a phosphate linkage (PO or p); if the 5 ’-end of an oligonucleotide contains [sp], through a phosphorothioate linkage (PS or [sp]), e.g., [nC6o] : 6-aminohexanol or -NH-(CH2)e_linker (C6 linker, C6 amine linker or C6 amino linker), connected to, e.g., the 5 ’-end of the oligonucleotide chain through a phosphate linkage as the chemical structure above for [GalNAc3C12oyl][nC6o] indicates.

[0234] Double Stranded Oligonucleotide Lengths

[0235] As appreciated by those skilled in the art, ds oligonucleotides can be of various lengths to provide desired properties and / or activities for various uses. Many technologies for assessing, selecting and / or optimizing ds oligonucleotide length are available in the art and can be utilized in accordance with the present disclosure. As demonstrated herein, in certain embodiments, dsRNAi oligonucleotides are of suitable lengths to hybridize with their targets and reduce levels of their targets and / or an encoded product thereof. In certain embodiments, a ds oligonucleotide is long enough to recognize a target nucleic acid (e.g., a target mRNA). In certain embodiments, a ds oligonucleotide is sufficiently long to distinguish between a target nucleic acid and other nucleic acids (e.g., a nucleic acid having a base sequence which is not a target sequence) to reduce off-target effects. In certain embodiments, a dsRNAi oligonucleotide is sufficiently short to reduce complexity of manufacture or production and to reduce cost of products.

[0236] Internucleotidic Linkages

[0237] In certain embodiments, ds oligonucleotides comprise base modifications, sugar modifications, and / or internucleotidic linkage modifications. Various internucleotidic linkages can be utilized in accordance with the present disclosure to link units comprising nucleobases, e.g., nucleosides. In certain embodiments, provided ds oligonucleotides comprise both one or more modified internucleotidic linkages and one or more natural phosphate linkages. As widely known by those skilled in the art, natural phosphate linkages are widely found in natural DNA and RNA molecules; they have the structure of -OP(O)(OH)O-, connect sugars in the nucleosides in DNA and RNA, and may be in various salt forms, for example, at physiological pH (about 7.4), natural phosphate linkages are predominantly exist in salt forms with the anion being -OP(O)(O )O-. A modified internucleotidic linkage, or a non-natural phosphate linkage, is an internucleotidic linkage that is not natural phosphate linkage or a salt form thereof. Modified internucleotidic linkages, depending on their structures, may also be in their salt forms. For example, as appreciated by those skilled in the art, phosphorothioate internucleotidic linkages which have the structure of -OP(O)(SH)O- may be in various salt forms, e.g., at physiological pH (about 7.4) with the anion being -OP(O)(S")O-.

[0238] Without wishing to be bound by any particular theory, the present disclosure notes that a neutral intemucleotidic linkage can be more hydrophobic than a phosphorothioate internucleotidic linkage (PS), which can be more hydrophobic than a natural phosphate linkage (PO). Typically, unlike a PS orPO, a neutral internucleotidic linkage bears less charge. Without wishing to be bound by any particular theory, the present disclosure notes that incorporation of one or more neutral intemucleotidic linkages into a ds oligonucleotide may increase the ds oligonucleotides’ ability to be taken up by a cell and / or to escape from endosomes. Without wishing to be bound by any particular theory, the present disclosure notes that incorporation of one or more neutral internucleotidic linkages can be utilized to modulate melting temperature of duplexes formed between a ds oligonucleotide and its target nucleic acid.

[0239] Without wishing to be bound by any particular theory, the present disclosure notes that incorporation of one or more non-negatively charged internucleotidic linkages, e.g., neutral internucleotidic linkages, into a ds oligonucleotide may be able to increase the ds oligonucleotide’s ability to mediate a function such as target adenosine editing.

[0240] In some embodiments, an oligonucleotide comprises a modified intemucleotidic linkage (e.g., a modified internucleotidic linkage having the structure of Formula I, I-a, I-b, or I-c, I-n-1, I-n-2, I-n-3, I-n-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, etc., or a salt form thereof) as described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020 / 0056173, US 2018 / 0216107, US 2019 / 0127733, US 10450568, US 2019 / 0077817, US 2019 / 0249173, US 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, and / or WO 2019 / 032612 the internucleotidic linkages (e.g., those of Formula I, I-a, I-b, or I- c, I-n-1, I-n-2, I-n-3, I-n-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, etc.,) of each of which are independently incorporated herein by reference. In some embodiments, a modified intemucleotidic linkage is a non-negatively charged intemucleotidic linkage. In some embodiments, provided oligonucleotides comprise one or more non-negatively charged internucleotidic linkages. In some embodiments, a non-negatively charged internucleotidic linkage is a positively charged internucleotidic linkage. In some embodiments, a non- negatively charged internucleotidic linkage is a neutral internucleotidic linkage. In some embodiments, the present disclosure provides oligonucleotides comprising one or more neutral internucleotidic linkages. In some embodiments, a non-negatively charged intemucleotidic linkage or a neutral internucleotidic linkage (e.g., one of Formula I-n-1, 1-n-2, 1-n-3, 1-n-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, etc.) is as described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020 / 0056173, US 2018 / 0216107, US 2019 / 0127733, US 10450568, US 2019 / 0077817, US 2019 / 0249173, US 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, and / or WO 2019 / 032612. In some embodiments, a non- negatively charged internucleotidic linkage or neutral internucleotidic linkage is one of Formula I-n-1, I-n-2, I-n-3, I-n-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II- d-2, etc. as described in WO 2018 / 223056, WO 2019 / 032607, WO 2019 / 075357, WO 2019 / 032607, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, and / or WO 2019 / 032612, such internucleotidic linkages of each of which are independently incorporated herein by reference.

[0241] As appreciated by those skilled in the art, many other types of internucleotidic linkages may be utilized in accordance with the present disclosure, for example, those described in U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,177,195; 5,023,243; 5,034,506; 5,166,315; 5,185,444; 5,188,897; 5,214,134; 5,216,141; 5,235,033; 5,264,423; 5,264,564; 5,276,019;

[0242] 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,938; 5,405,939; 5,434,257; 5,453,496;

[0243] 5,455,233; 5,466,677; 5,466,677; 5,470,967; 5,476,925; 5,489,677; 5,519,126; 5,536,821;

[0244] 5,541,307; 5,541,316; 5,550,111; 5,561,225; 5,563,253; 5,571,799; 5,587,361; 5,596,086;

[0245] 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,625,050; 5,633,360; 5,64,562; 5,663,312; 5,677,437; 5,677,439; 6,160,109; 6,239,265; 6,028,188; 6,124,445; 6,169,170;

[0246] 6,172,209; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035;

[0247] 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; or RE39464. In certain embodiments, a modified internucleotidic linkage is one described in US 9982257, US 20170037399, US 20180216108, WO 2017192664, WO 2017015575, WO2017062862, WO 2018067973, WO 2017160741, WO 2017192679, WO 2017210647, WO 2018098264, PCT / US 18 / 35687, PCT / US18 / 38835, or PCT / US18 / 51398, the nucleobases, sugars, internucleotidic linkages, chiral auxiliaries / reagents, and technologies for oligonucleotide synthesis (reagents, conditions, cycles, etc.) of each of which is independently incorporated herein by reference.

[0248] In certain embodiments, a ds oligonucleotide comprises one or more internucleotidic linkages that improve one or more pharmaceutical properties and / or activities of the oligonucleotide. It is well documented in the art that certain oligonucleotides are rapidly degraded by nucleases and exhibit poor cellular uptake through the cytoplasmic cell membrane (Poijarvi-Virta et al., Curr. Med. Chem. (2006), 13(28);3441-65; Wagner et al., Med. Res. Rev. (2000), 20(6):417-51; Peyrottes et al., Mini Rev. Med. Chem. (2004), 4(4):395-408; Gosselin et al., (1996), 43(1): 196-208; Bologna et al., (2002), Antisense & Nucleic Acid Drug Development 12:33-41). Vives et al. (Nucleic Acids Research (1999), 27(20):4071-76) reported that tert-butyl SATE pro-oligonucleotides displayed markedly increased cellular penetration compared to the parent oligonucleotide under certain conditions.

[0249] Various types of internucleotidic linkages may be utilized in combination of other structural elements, e.g., sugars, to achieve desired ds oligonucleotide properties and / or activities. For example, the present disclosure routinely utilizes modified internucleotidic linkages and modified sugars, optionally with natural phosphate linkages and natural sugars, in designing ds oligonucleotides. In certain embodiments, the present disclosure provides a ds oligonucleotide comprising one or more modified sugars. In certain embodiments, the present disclosure provides a ds oligonucleotide comprising one or more modified sugars and one or more modified internucleotidic linkages, one or more of which are natural phosphate linkages.

[0250] Double Stranded Oligonucleotide Compositions

[0251] Among other things, the present disclosure provides various ds oligonucleotide compositions. In certain embodiments, the present disclosure provides ds oligonucleotide compositions of ds oligonucleotides described herein. In certain embodiments, a ds oligonucleotide composition, e.g., a dsRNAi oligonucleotide composition, comprises a plurality of a ds oligonucleotide described in the present disclosure. In certain embodiments, a ds oligonucleotide composition, e.g., a dsRNAi oligonucleotide composition, is chirally controlled. In certain embodiments, a ds oligonucleotide composition, e.g., a dsRNAi oligonucleotide composition, is not chirally controlled (stereorandom).

[0252] In certain embodiments, the present disclosure encompasses technologies for designing and preparing chirally controlled ds oligonucleotide compositions. In certain embodiments, a chirally controlled ds oligonucleotide composition comprises a controlled / pre-determined (not random as in stereorandom compositions) level of a plurality of ds oligonucleotides, wherein the ds oligonucleotides share the same linkage phosphorus stereochemistry at one or more chiral internucleotidic linkages (chirally controlled internucleotidic linkages). In certain embodiments, ds oligonucleotides of a plurality share the same pattern of backbone chiral centers (stereochemistry of linkage phosphorus). In certain embodiments, a pattern of backbone chiral centers is as described in the present disclosure. In certain embodiments, ds oligonucleotides of a plurality share a common constitution. In certain embodiments, they are structurally identical.

[0253] For example, in certain embodiments, the present disclosure provides a ds oligonucleotide composition comprising a plurality of ds oligonucleotides, wherein ds oligonucleotides of the plurality share:

[0254] 1) a common base sequence, and

[0255] 2) the same linkage phosphorus stereochemistry independently at one or more (e.g., about 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more) chiral internucleotidic linkages (“chirally controlled internucleotidic linkages”); wherein level of ds oligonucleotides of the plurality in the composition is non-random (e.g., controlled / pre- determined as described herein).

[0256] Common patterns of backbone chiral centers, as appreciated by those skilled in the art, comprise at least one Rp or at least one Sp. Certain patterns of backbone chiral centers are illustrated in, e.g., Table 1.

[0257] In certain embodiments, a chirally controlled ds oligonucleotide composition is enriched, relative to a substantially racemic preparation of ds oligonucleotides share the same common base sequence and a common pattern of backbone linkages, for ds oligonucleotides of the particular ds oligonucleotide type.

[0258] In certain embodiments, ds oligonucleotides of a plurality, e.g., a particular ds oligonucleotide type, have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In certain embodiments, ds oligonucleotides of a plurality have a common pattern of sugar modifications. In certain embodiments, ds oligonucleotides of a plurality have a common pattern of base modifications. In certain embodiments, ds oligonucleotides of a plurality have a common pattern of nucleoside modifications. In certain embodiments, ds oligonucleotides of a plurality have the same constitution. In certain embodiments, ds oligonucleotides of a plurality are identical. In certain embodiments, ds oligonucleotides of a plurality are of the same ds oligonucleotide (as those skilled in the art will appreciate, such ds oligonucleotides may each independently exist in one of the various forms of the ds oligonucleotide, and may be the same, or different forms of the ds oligonucleotide). In certain embodiments, ds oligonucleotides of a plurality are each independently of the same ds oligonucleotide or a pharmaceutically acceptable salt thereof.

[0259] In certain embodiments, a chirally controlled ds oligonucleotide composition is chirally pure (or stereopure, stereochemically pure) ds oligonucleotide composition, wherein the ds oligonucleotide composition comprises a plurality of ds oligonucleotides, wherein the ds oligonucleotides are independently of the same stereoisomer (including that each chiral element of the ds oligonucleotides, including each chiral linkage phosphorus, is independently defined (stereodefined)). A chirally pure (or stereopure, stereochemically pure) ds oligonucleotide composition of a ds oligonucleotide stereoisomer does not contain other stereoisomers (as appreciated by those skilled in the art, one or more unintended stereoisomers may exist as impurities from, e.g., preparation, storage, etc.).

[0260] Sugars

[0261] Various sugars, including modified sugars, can be utilized in accordance with the present disclosure. In certain embodiments, the present disclosure provides sugar modifications and patterns thereof optionally in combination with other structural elements (e.g., internucleotidic linkage modifications and patterns thereof, pattern of backbone chiral centers thereof, etc.) that when incorporated into oligonucleotides can provide improved properties and / or activities.

[0262] The most common naturally occurring nucleosides comprise ribose sugars (e.g., in RNA) or deoxyribose sugars (e.g., in DNA) linked to the nucleobases adenosine (A), cytosine (C), guanine (G), thymine (T) or uracil (U). In certain embodiments, a sugar, e.g., various sugars in many oligonucleotides in Table 1 (unless otherwise notes), is a natural DNA sugar

[0263] (in DNA nucleic acids or oligonucleotides, having the structure wherein a nucleobase is attached to the 1 ’ position, and the 3’ and 5’ positions are connected to internucleotidic linkages (as appreciated by those skilled in the art, if at the 5 ’-end of a ds oligonucleotide, the 5’ position may be connected to a 5 ’-end group (e.g., -OH), and if at the 3’-end of a ds oligonucleotide, the 3’ position may be connected to a 3’-end group (e.g., -OH). In certain embodiments, a sugar is a natural RNA sugar (in RNA nucleic acids or oligonucleotides, having the structure wherein a nucleobase is attached to the 1 ’ position, and the 3’ and 5’ positions are connected to internucleotidic linkages (as appreciated by those skilled in the art, if at the 5 ’-end of a ds oligonucleotide, the 5’ position may be connected to a 5’-end group (e.g., -OH), and if at the 3’-end of a ds oligonucleotide, the 3’ position may be connected to a 3 ’-end group (e.g., -OH). In certain embodiments, a sugar is a modified sugar in that it is not a natural DNA sugar or a natural RNA sugar. Among other things, modified sugars may provide improved stability. In certain embodiments, modified sugars can be utilized to alter and / or optimize one or more hybridization characteristics. In certain embodiments, modified sugars can be utilized to alter and / or optimize target recognition. In certain embodiments, modified sugars can be utilized to optimize Tm. In certain embodiments, modified sugars can be utilized to improve oligonucleotide activities.

[0264] Sugars can be bonded to internucleotidic linkages at various positions. As non-limiting examples, internucleotidic linkages can be bonded to the 2’, 3’, 4’ or 5’ positions of sugars. In certain embodiments, as most commonly in natural nucleic acids, an internucleotidic linkage connects with one sugar at the 5 ’ position and another sugar at the 3 ’ position unless otherwise indicated.

[0265] In certain embodiments, a sugar is an optionally substituted natural DNA or RNA sugar.

[0266] In certain embodiments, a sugar is optionally substituted certain embodiments, the 2’ position is optionally substituted. In certain embodiments, a sugar certain embodiments, a sugar has the structure wherein each of Rls, R2s, R3s, R4s, and R5sis independently -H, a suitable substituent or suitable sugar modification (e.g., those described in US 9394333, US 9744183, US 9605019, US 9982257, US 20170037399, US 20180216108, US 20180216107, US 9598458, WO 2017 / 062862, WO

[0267] 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264,

[0268] WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO

[0269] 2018 / 237194, WO 2019 / 032607, WO2019 / 032612, WO 2019 / 055951, and / or WO 2019 / 075357, the substituents, sugar modifications, descriptions of Rls, R2s, R3s, R4s, and R5s, and modified sugars of each of which are independently incorporated herein by reference). In certain embodiments, a sugar has the structure certain embodiments, R4sis -H. In certain embodiments, a sugar has the structure wherein R2sis -H, halogen, or -OR, wherein R is optionally substituted Ci-6 aliphatic. In certain embodiments, R2Sis -H. In certain embodiments, R2sis -F. In certain embodiments, R2sis -OMe. In certain embodiments, R2sis -OCH^CItOMe.

[0270] Various additional sugars useful for preparing oligonucleotides or analogs thereof are known in the art and may be utilized in accordance with the present disclosure.

[0271] Nucleobases

[0272] Various nucleobases may be utilized in provided ds oligonucleotides in accordance with the present disclosure. In certain embodiments, a nucleobase is a natural nucleobase, the most commonly occurring ones being A, T, C, G and U. In certain embodiments, a nucleobase is a modified nucleobase in that it is not A, T, C, G or U. In certain embodiments, a nucleobase is optionally substituted A, T, C, G or U, or a substituted tautomer of A T, C, G or U. In certain embodiments, a nucleobase is optionally substituted A, T, C, G or U, e.g., 5mC, 5- hydroxymethyl C, etc. In certain embodiments, a nucleobase is alkyl -substituted A, T, C, G or U. In certain embodiments, a nucleobase is A. In certain embodiments, a nucleobase is T. In certain embodiments, a nucleobase is C. In certain embodiments, a nucleobase is G. In certain embodiments, a nucleobase is U. In certain embodiments, a nucleobase is 5mC. In certain embodiments, a nucleobase is substituted A, T, C, G or U. In certain embodiments, a nucleobase is a substituted tautomer of A, T, C, G or U. In certain embodiments, substitution protects certain functional groups in nucleobases to minimize undesired reactions during oligonucleotide synthesis. Suitable technologies for nucleobase protection in oligonucleotide synthesis are widely known in the art and may be utilized in accordance with the present disclosure. In certain embodiments, modified nucleobases improves properties and / or activities of ds oligonucleotides. For example, in many cases, 5mC may be utilized in place of C to modulate certain undesired biological effects, e.g., immune responses. In certain embodiments, when determining sequence identity, a substituted nucleobase having the same hydrogenbonding pattern is treated as the same as the unsubstituted nucleobase, e.g., 5mC may be treated the same as C [e.g., a ds oligonucleotide having 5mC in place of C (e.g., AT5mCG) is considered to have the same base sequence as a ds oligonucleotide having C at the corresponding location(s) (e.g., ATCG)]. In certain embodiments, a modified nucleobase is a modified nucleobase known in the art, e.g., WO2017 / 210647. In certain embodiments, modified nucleobases are expanded-size nucleobases in which one or more aryl and / or heteroaryl rings, such as phenyl rings, have been added.

[0273] In certain embodiments, a nucleobase is one described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020 / 0056173, US 2018 / 0216107, US 2019 / 0127733, US 10450568, US 2019 / 0077817, US 2019 / 0249173, US 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, and / or WO 2019 / 032612, the nucleobases of each of which is incorporated herein by reference.

[0274] Additional Chemical Moi eties

[0275] In certain embodiments, a ds oligonucleotide comprises one or more additional chemical moieties. Various additional chemical moieties, e.g., targeting moieties, carbohydrate moieties, lipid moieties, etc. are known in the art and can be utilized in accordance with the present disclosure to modulate properties and / or activities of provided oligonucleotides, e.g., stability, half-life, activities, delivery, pharmacodynamics properties, pharmacokinetic properties, etc. In certain embodiments, certain additional chemical moieties facilitate delivery of oligonucleotides to desired cells, tissues and / or organs. In certain embodiments, certain additional chemical moieties facilitate internalization of oligonucleotides. In certain embodiments, certain additional chemical moieties increase oligonucleotide stability. In certain embodiments, the present disclosure provides technologies for incorporating various additional chemical moieties into oligonucleotides.

[0276] In certain embodiments, a ds oligonucleotide comprises an additional chemical moiety demonstrates increased delivery to and / or activity in a tissue compared to a reference oligonucleotide, e.g., a reference oligonucleotide which does not have the additional chemical moiety but is otherwise identical.

[0277] In certain embodiments, non-limiting examples of additional chemical moieties include carbohydrate moieties, targeting moieties, etc., which, when incorporated into oligonucleotides, can improve one or more properties. In certain embodiments, an additional chemical moiety is selected from: glucose, GluNAc (N-acetyl amine glucosamine) and anisamide moieties. In certain embodiments, a provided ds oligonucleotide can comprise two or more additional chemical moieties, wherein the additional chemical moieties are identical or non-identical, or are of the same category (e.g., carbohydrate moiety, sugar moiety, targeting moiety, etc.) or not of the same category.

[0278] In certain embodiments, an additional chemical moiety is a targeting moiety. In certain embodiments, an additional chemical moiety is or comprises a carbohydrate moiety. In certain embodiments, an additional chemical moiety is or comprises a lipid moiety. In certain embodiments, an additional chemical moiety is or comprises a ligand moiety for, e.g., cell receptors such as a sigma receptor, an asialoglycoprotein receptor, etc. In certain embodiments, a ligand moiety is or comprises an anisamide moiety, which may be a ligand moiety for a sigma receptor. In certain embodiments, a ligand moiety is or comprises a GalNAc moiety, which may be a ligand moiety for an asialoglycoprotein receptor. In certain embodiments, an additional chemical moiety facilitates delivery to liver.

[0279] In certain embodiments, a provided ds oligonucleotide can comprise one or more linkers and additional chemical moieties (e.g., targeting moieties), and / or can be chirally controlled or not chirally controlled, and / or have a bases sequence and / or one or more modifications and / or formats as described herein.

[0280] Various linkers, carbohydrate moieties and targeting moieties, including many known in the art, can be utilized in accordance with the present disclosure. In certain embodiments, a carbohydrate moiety is a targeting moiety. In certain embodiments, a targeting moiety is a carbohydrate moiety.

[0281] In particular embodiments, an additional chemical moiety is or comprises a tri- antennary ASGPR ligand with three such moieties. In certain embodiments a tri-antennary ASGPR ligand comprises:

[0282]

[0283] Certain additional chemical moieties (e.g., lipid moieties, targeting moieties, carbohydrate moieties), and various linkers for connecting additional chemical moieties to ds oligonucleotide chains, are described in WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO2019032612, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, and / or WO 2019 / 032612, the additional chemical moieties and linkers of each of which are independently incorporated herein by reference, and can be utilized in accordance with the present disclosure. In certain embodiments, an additional chemical moiety is digoxigenin or biotin or a derivative thereof.

[0284] In certain embodiments, an additional chemical moiety is one described in WO 2012 / 030683. In certain embodiments, a provided ds oligonucleotide comprise a chemical structure (e.g., a linker, lipid, solubilizing group, and / or targeting ligand) described in WO 2012 / 030683.

[0285] In certain embodiments, a provided ds oligonucleotide comprises an additional chemical moiety and / or a modification (e.g., of nucleobase, sugar, intemucleotidic linkage, etc.) described in: U.S. Pat. Nos. 5,688,941; 6,294,664; 6,320,017; 6,576,752; 5,258,506;

[0286] 5,591,584; 4,958,013; 5,082,830; 5,118,802; 5,138,045; 6,783,931; 5,254,469; 5,414,077;

[0287] 5,486,603; 5,112,963; 5,599,928; 6,900,297; 5,214,136; 5,109,124; 5,512,439; 4,667,025;

[0288] 5,525,465; 5,514,785; 5,565,552; 5,541,313; 5,545,730; 4,835,263; 4,876,335; 5,578,717; 5,580,731; 5,451,463; 5,510,475; 4,904,582; 5,082,830; 4,762,779; 4,789,737; 4,824,941;

[0289] 4,828,979; 5,595,726; 5,214,136; 5,245,022; 5,317,098; 5,371,241; 5,391,723; 4,948,882;

[0290] 5,218,105; 5,112,963; 5,567,810; 5,574,142; 5,578,718; 5,608,046; 4,587,044; 4,605,735;

[0291] 5,585,481; 5,292,873; 5,552,538; 5,512,667; 5,597,696; 5,599,923; 7,037,646; 5,587,371;

[0292] 5,416,203; 5,262,536; 5,272,250; or 8,106,022.

[0293] In certain embodiments, an additional chemical moiety, e.g., a Mod, is connected via a linker. Various linkers are available in the art and may be utilized in accordance with the present disclosure, for example, those utilized for conjugation of various moieties with proteins (e.g., with antibodies to form antibody-drug conjugates), nucleic acids, etc. Certain useful linkers are described in US 9982257, US 20170037399, US 20180216108, US 20180216107, US 9598458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 223056, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, and / or WO 2019 / 032612, the linker moieties of each which are independently incorporated herein by reference.

[0294] Pharmaceutical Compositions

[0295] When used as therapeutics, a provided ds oligonucleotide, e.g., a dsRNAi oligonucleotide, or ds oligonucleotide composition thereof is typically administered as a pharmaceutical composition. In certain embodiments, the present disclosure provides pharmaceutical compositions comprising a provided compound, e.g., a ds oligonucleotide, or a pharmaceutically acceptable salt thereof, and a pharmaceutical carrier. In certain embodiments, for therapeutic and clinical purposes, ds oligonucleotides of the present disclosure are provided as pharmaceutical compositions. As appreciated by those skilled in the art, ds oligonucleotides of the present disclosure can be provided in their acid, base or salt forms. In certain embodiments, ds oligonucleotides can be in acid forms, e.g., for natural phosphate linkages, in the form of -OP(O)(OH)O-; for phosphorothioate internucleotidic linkages, in the form of -OP(O)(SH)O-; etc. In certain embodiments, dsRNAi oligonucleotides can be in salt forms, e.g., for natural phosphate linkages, in the form of -OP(O)(ONa)O- in sodium salts; for phosphorothioate internucleotidic linkages, in the form of -OP(O)(SNa)O- in sodium salts; etc. Unless otherwise noted, ds oligonucleotides of the present disclosure can exist in acid, base and / or salt forms.

[0296] In certain embodiments, the present disclosure provides salts of ds oligonucleotides and pharmaceutical compositions thereof. In certain embodiments, a salt is a pharmaceutically acceptable salt. In certain embodiments, a pharmaceutical composition comprises a ds oligonucleotide, optionally in its salt form, and a sodium salt. In certain embodiments, a pharmaceutical composition comprises a ds oligonucleotide, optionally in its salt form, and sodium chloride. In certain embodiments, each hydrogen ion of a ds oligonucleotide that may be donated to a base (e.g., under conditions of an aqueous solution, a pharmaceutical composition, etc.) is replaced by a non-H+cation. For example, in certain embodiments, a pharmaceutically acceptable salt of a ds oligonucleotide is an all-metal ion salt, wherein each hydrogen ion (for example, of -OH, -SH, etc.) of each internucleotidic linkage (e.g., a natural phosphate linkage, a phosphoryl guanidine internucleotidic linkage, a phosphorothioate internucleotidic linkage, etc.) is replaced by a metal ion. Various suitable metal salts for pharmaceutical compositions are widely known in the art and can be utilized in accordance with the present disclosure. In certain embodiments, a pharmaceutically acceptable salt is a sodium salt. In certain embodiments, a pharmaceutically acceptable salt is magnesium salt. In certain embodiments, a pharmaceutically acceptable salt is a calcium salt. In certain embodiments, a pharmaceutically acceptable salt is a potassium salt. In certain embodiments, a pharmaceutically acceptable salt is an ammonium salt (cation N(R) ). In certain embodiments, a pharmaceutically acceptable salt comprises one and no more than one types of cation. In certain embodiments, a pharmaceutically acceptable salt comprises two or more types of cation. In certain embodiments, a cation is Li+, Na+, K+, Mg2+or Ca2+. In certain embodiments, a pharmaceutically acceptable salt is an all-sodium salt. In certain embodiments, a pharmaceutically acceptable salt is an all-sodium salt, wherein each internucleotidic linkage which is a natural phosphate linkage (acid form -O-P(O)(OH)-O-), if any, exists as its sodium salt form (-O-P(O)(ONa)-O-), and each internucleotidic linkage which is a phosphorothioate or a phosphoryl guanidine internucleotidic linkage (acid form -O-P(O)(SH)-O-), if any, exists as its sodium salt form (-O-P(O)(SNa)-O-).

[0297] In certain embodiments, dsRNAi oligonucleotides are formulated in pharmaceutical compositions described in WO 2005 / 060697, WO 2011 / 076807 or WO 2014 / 136086.

[0298] In certain embodiments, a composition comprising a ds oligonucleotide is lyophilized. In certain embodiments, a composition comprising a ds oligonucleotide is lyophilized, and the lyophilized ds oligonucleotide is in a vial. In certain embodiments, the vial is back filled with nitrogen. In certain embodiments, the lyophilized ds oligonucleotide composition is reconstituted prior to administration. In certain embodiments, the lyophilized ds oligonucleotide composition is reconstituted with a sodium chloride solution prior to administration. In certain embodiments, the lyophilized ds oligonucleotide composition is reconstituted with a 0.9% sodium chloride solution prior to administration. In certain embodiments, reconstitution occurs at the clinical site for administration. In certain embodiments, in a lyophilized composition, a ds oligonucleotide composition is chirally controlled or comprises at least one chirally controlled internucleotidic linkage and / or the ds oligonucleotide targets.

[0299] III. EXEMPLIFICATION

[0300] Various technologies can be utilized to assess properties and activities of the provided oligonucleotides and compositions thereof. Some such technologies are described in this Example. Those skilled in the art appreciate that many other technologies can be readily utilized.

[0301] EXAMPLE 1. Oligonucleotide Synthesis

[0302] Various technologies for preparing oligonucleotides and oligonucleotide compositions (both stereorandom and chirally controlled) can be utilized in accordance with the present disclosure, including, for example, methods and reagents described in U.S. 9,394,333, U.S. 9,744,183, U.S. 9,605,019, U.S. 9,598,458, U.S. 9,982,257, U.S. 10,160,969, U.S. 10,479,995, U.S. 2020 / 0056173, U.S. 2018 / 0216107, U.S. 2019 / 0127733, U.S. 10,450,568, U.S. 2019 / 0077817, U.S. 2019 / 0249173, U.S. 2019 / 0375774, U.S. 2017 / 0037399, U.S. 2018 / 0216108, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO

[0303] 2019 / 217784, WO 2019 / 032612, WO 2020 / 191252, WO 2021 / 071858, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO

[0304] 2018 / 098264, WO 2022 / 099159, W02023 / 201095, and WO 2024 / 182749. The methods and reagents of each of which are incorporated herein by reference. Stereorandom and chirally controlled guide strand sequences were prepared utilizing the synthetic procedures as exemplified in above mentioned disclosures. Respective passenger strands were designed to have covalently linked GalNAc moiety as delivery vehicle at either end of sequences. Oligonucleotides with 5 ’-GalNAc modifications were synthesized by coupling C6-amino modifier linker at the 5 ’-end of sequence. Oligonucleotides with 3 ’-GalNAc moiety as delivery vehicle were synthesized by utilizing 3’-C6 amino modified support. The single strand was cleaved from CPG by using deprotection condition as exemplified in earlier disclosures. The resulting amino group containing crude oligonucleotide was purified by ion exchange chromatography on AKTA pure system using a sodium chloride gradient. Desired product was desalted and further used for conjugation with GalNAc acid. After conjugation reaction was found to be complete the material was further purified by ion exchange chromatography and desalted to achieve desired material. For introduction of PN linkages in guide and passenger strands, specific PN coupling cycles were introduced at desired positions in oligonucleotide sequence utilizing the conditions as exemplified in WO2019 / 200185.

[0305] In certain embodiments, oligonucleotides were prepared using suitable chiral auxiliaries, e.g., DPSE and PSM chiral auxiliaries. Various oligonucleotides, e.g., those in Table 1 and Table If, and compositions thereof, were prepared in accordance with the present disclosure.

[0306] Various technologies can be utilized to assess properties and / or activities of provided oligonucleotides and compositions thereof. Some such technologies are described in this Example. Those skilled in the art appreciate that many other technologies can be readily utilized. As demonstrated herein, provided oligonucleotides and compositions, among other things, can be highly active, e.g., in reducing levels of their target nucleic acids.

[0307] Abbreviation

[0308] IX reagent: TEA-3HF : TEA : H2O : DMSO = 5.0 : 1.8 : 15.5 : 77.7 (v / v / v / v)

[0309] ADIH: 2-azido-l,3-dimethylimidazolium hexafluorophosphate

[0310] CMIMT: N-cyanomethylimidazolium tritiate

[0311] CPG: controlled pore glass

[0312] DCM: dichloromethane, CH2Q2

[0313] DIPEA: diisopropylethylamine

[0314] DMSO: dimethylsulfoxide

[0315] DMTr: 4,4'-dimethoxytrityl

[0316] GalNAc: V-acetylgalactosamine

[0317] HF: hydrogen fluoride

[0318] HATU: l-[bis(dimethylamino)methylene]-lJ7-l,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate

[0319] IBN: isobutyronitrile

[0320] MeCN: acetonitrile

[0321] Melm: N-methylimidazole

[0322] TCA: trichloroacetic acid

[0323] TEA: triethylamine

[0324] XH: xanthane hydride General procedure for the synthesis of chiral-olisos (25 umol scale}:

[0325] The automated solid-phase synthesis of chiral-oligos was performed according to the cycles shown in Table 2 (regular amidite cycle, for PO linkages), Table 3 (regular amidite cycle, for stereo-random PS linkages), Table 4 (DPSE amidite cycle, for chiral PS linkages), and Table 5 (PSM amidite cycle, for chiral PN linkages).

[0326] Table 2. Regular Amidite Synthetic Cycle for PO linkages waiting step operation reagents and solvent volume time

[0327] 1 detritylation 3% TCA / DCM 10 mL 65 s 0 2M monomer / 20% IBN-MeCN 0 5 mL

[0328] Table 3. Regular Amidite Synthetic Cycle for stereo-random PS linkages waiting step operation reagents and solvent volume time

[0329] 1 detritylation 3% TCA / DCM 10 mL 65 s

[0330] 0 2M monomer / 20% IBN-MeCN 0 5 mL

[0331] Table 4. DPSE Amidite Synthetic Cycle for chiral PS linkages step operation reagents and solvent volume

[0332] 1 detritylation 3% TCA / DCM 10 mL 65 s

[0333] 0.2M monomer / 20% IBN-MeCN 0.5 mL

[0334] 2 coupling 8 min

[0335] 0.5M CMIMT / MeCN 1.0 mL

[0336] 20% AC2O, 30% 2,6-lutidine /

[0337] 3 cap-1 2.0 mL 2 min MeCN 4 sulfurization 0.2M XH / pyridine 2.0 mL 6 min

[0338] 20% AC2O, 30% 2,6-lutidine / 1.0 mL

[0339] 3 cap-2 MeCN 20% MeIm / MeCN 1.0 mL

[0340] Table 5. PSM Amidite Synthetic Cycle for chiral PN linkages waiting step operation reagents and solvent volume time

[0341] 1 detritylation 3% TCA / DCM 10 mL 65 s

[0342] 0.2M monomer / 20% IBN-MeCN 0.5 mL

[0343] 2 coupling 8 min

[0344] 0.5M CMIMT / MeCN 1.0 mL

[0345] 20% AC2O 30% 2 6-lutidine /

[0346] After completion of the synthesis, the CPG solid support was dried and transferred into 50 mL plastic tube. The CPG was treated with IX reagent (2.5 mL; 100 p.L / umol) for 3 h at 28°C, then added cone. NH3 (5.0 mL; 200 pL / umol) for 24 h at 37°C. The reaction mixture was cooled to room temperature and the CPG was separated by membrane filtration, washed with 15 mL of H2O. The crude material (filtrate) was analyzed by LTQ and RP-UPLC.

[0347] General procedure for the purification conditions:

[0348] The crude sense and antisense strands were purified separately by AEX chromatography. The purification run was performed using sodium hydroxide eluents. A sodium chloride gradient was used to elute the oligonucleotide from the column. The elution profile was monitored by UV spectrophotometry, and the selected fraction pool (sense or antisense strand) was then concentrated and diafiltered against purified water to remove the purification buffer by TFF. The UF / DF process proceeded as follows, the selected pool of fractions was neutralized with sodium phosphate monobasic solution and then concentrated to a target concentration. The concentrated oligonucleotide was diafiltered against purified water before final concentration to the target concentration and collected. General procedure for the annealins to form duplex:

[0349] The duplex was formed by combining equal molar quantities of the sense and antisense strands with mixing in an appropriately sized vessel. The formation of the duplex was confirmed by UPLC that there was no excess of single strands. The duplex oligonucleotide solution was filtered through a 0.2-micron filter and then placed in freeze drying tray for lyophilization. After lyophilization, the duplex was isolated as a white to off-white solid powder.

[0350] Into a plastic tube, tri-GalNAc (2.0 eq.), HATU (1.9 eq.), and DIPEA (10 eq.) were dissolved in anhydrous MeCN (0.5 mL). The mixture was stirred for 10 min at room temperature, then the mixture was added into the amino-oligo (1 pmol) in H2O (1 mL) and stirred for 1 h at 37 °C. The reaction was monitored by LC-MS and RP-UPLC. After the reaction was completed, the resultant GalN Ac-conjugated oligo was treated with cone. NH3 (2 mL) for 1 h at 37 °C. The solution was concentrated under vacuum to remove MeCN and cone. NH3. The residue was then dissolved in H2O (10 mL) for reversed phase purification.

[0351] While various embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described in the present disclosure, and each of such variations and / or modifications is deemed to be included. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be example and that the actual parameters, dimensions, materials, and / or configurations may depend upon the specific application or applications for which the teachings of the present disclosure is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the embodiments of the present disclosure. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, claimed technologies may be practiced otherwise than as specifically described and claimed. In addition, any combination of two or more features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the scope of the present disclosure.

[0352] In some embodiments, preparations include one or more DPSE and / or PSM cycles. A number of oligonucleotide compositions were synthesized and assessed, including, e.g., those in the Tables.

[0353] As described and confirmed herein, technologies of the present disclosure are useful for preparing various compositions of oligonucleotides comprising various structural features at various scales (e.g., 1 umol, 5 umol, or 50 umol). It is understood that certain parameters will be modified based on the scale, e.g., volumes or equivalents.

[0354] The resulting oligonucleotides can undergo an annealing step to form a duplex.

[0355] Example IB. Example procedure for preparation of oligonucleotide compositions (1 pmol scale)

[0356] Certain stereopure oligonucleotides were synthesized at 1 pmol scale using a MerMadel92 synthesizer and universal CPG. In some embodiments, an amidite approach was used to incorporate GalNAc on the 5 ’ end. Generally, cyanoethyl amidites were used to prepare the PO linkages, DPSE amidites for the PS linkages, and PSM amidites for the PN linkages. A typical MerMadel92, 1 pmol cycle is outlined in the table below:

[0357] The first step of deprotection was performed on the synthesizer. 200 pL of 20% diethylamine in ACN was added to the column for 3 x 6 min followed by washing with ACN and drying. CPG was transferred to a container and 250 pL of fluoride solution was added. The fluoride solution consisted of dimethylformamide, water, triethylamine trihydrofluoride, and triethylamine (15.5 / 3.1 / 1.0 / 1.8 volume ratio). After about 4 hours at room temperature, approximately 375 pL of 30% ammonium hydroxide was added, and the reaction incubated at 37 °C overnight. The CPG was filtered and washed with water and the filtrate collected. The oligonucleotides were purified by anion exchange purification at room temperature. The oligonucleotide was loaded onto a column packed with Source QI 5 resin after equilibration with a 20 mM sodium hydroxide in 20% acetonitrile mobile phase. The purified oligonucleotide was eluted using a mobile phase of 20 mM sodium hydroxide and 2.5 M sodium chloride in 20% acetonitrile. The desired fraction was desalted using a G-25 Sephadex column against water for injection. Desalted samples were dried, reconstituted and analyzed.

[0358] A useful protocol for GalNAc conjugation is described below as an example.

[0359] For example, pre-conjugation oligo sequence can be represented by the following structure.

[0360] The tri-antennary GalNAc acid (hydroxyl groups protected as -OAc) can be represented by the following structure

[0361] The tri-antennary GalNAc acid (hydroxyl groups protected as -OAc) and HATU were weighed out in a 50 mL plastic tube and dissolved in anhydrous acetonitrile then DIEA was added into the tube. The resulting mixture was stirred for 10 min at 37 °C. Lyophilized preconjugation oligo sequence was reconstituted in water in a separate tube and the GalNAc mixture was added to the oligonucleotide solution and stirred for 60 min at 37 °C. The reaction was monitored by RP-UPLC. Reaction was complete in 1 hr. The reaction mixture was concentrated under vacuum to remove the acetonitrile and the resultant GalN Ac-conjugated oligonucleotides is treated with cone, ammonia for 2 hr at 37°C. The formation of final product was confirmed by mass spectrometry and RP-UPLC. The conjugated material was purified by anion exchange chromatography and desalted using tangential flow filtration (TFF) to obtain the final product.

[0362] Additional chemical moi eties can also be installed by coupling with phosphoramidites comprising such additional chemical moieties (and optional linkers), e.g., phosphoramidites comprising GalNAc such as those described in Example 1C. Additional technologies for preparing oligonucleotides are illustrated below as examples.

[0363] Example 1C. Example procedure for preparation of oligonucleotide compositions (50 pmol scale)

[0364] Certain stereopure oligonucleotides were synthesized at 50 pmol scale using a MerMadel2 synthesizer and standard CPG. In some embodiments, an amidite approach was used to incorporate GalNAc on the 5 ’ end. Generally, cyanoethyl amidites were used to prepare the PO linkages, DPSE amidites for the PS linkages and PSM amidites for the PN linkages. A typical MerMadel2, 50 pmol cycle is outlined in the table below:

[0365] _ , , , , Approx.

[0366] Step Operation Reagents and Solvent Volume TotalTime

[0367] 1 Detritylation 3% dichloroacetic acid in toluene 4x4.5 mL 4-5 min

[0368] 2 Single 0.15M phosphoramidite in combinations of 1.5 mL / 6-12 min Coupling ACN / IBN / PC and 0.5M CMIMT in ACN 2.25 mL

[0369] _ 80% THF / 10% 2,6-lutidine / 10% acetic _ , . . _

[0370] 3 Cap 1 , , . , 5 mL 1-1.5 mm anhydride

[0371] Oxidation 0.02M iodine in 70% THF / 20% pyridine / 10% _ , „A

[0372] 6 mL 2-4 mm

[0373] (PO) water

[0374] 4 Sulfurization 0.1 M xanthane hydride in 50% pyridine / 50% „ , „ .

[0375] 6 mL 6 mm

[0376] (PS) ACN

[0377] PN 0.3M ADIH in ACN 6 mL

[0378] „ 80% THF / 10% 2,6-lutidine / 10% acetic 2.5 mL / anhydride and 16% n-methylimidazole in THF mL

[0379] CMIMT: N-cyanomethylimidazolium triflate; ACN: acetonitrile; IBN: isobutyronitrile; ADIH: 2-azido-4,5-dihydro-l,3-dimethyl-lH-imidazolium hexafluorophosphate; THF: tetrahydrofuran; PC: propylene carbonate. The cycles were performed multiple times until the desired length was achieved.

[0380] In some embodiments, an amidite approach was used to incorporate GalNAc on the 5’ end. The GalNAc amidite, or , or tri-antennary GalNAc-acetyl derivative C6 phosphoramidite, can be represented by the following structure. The synthesis is disclosed in W02023201095 (Paragraph [001468])

[0381] The GalNAc amidite was coupled either as a single 10-15 min or a two x 10 min procedure. For each coupling, 1.5 mL of 0.2M GalNAc amidite and 3 mL of CMIMT in ACN were added. The first step of deprotection was performed on the synthesizer. 6 mL of 20% di ethylamine in ACN was added to the column for 10 min followed by washing with ACN and drying. CPG was transferred to a tube and 5 mL of fluoride solution was added. The fluoride solution consisted of dimethylsulfoxide, water, triethylamine trihydrofluoride, and triethylamine (15.5 / 3.1 / 1.0 / 1.8 volume ratio). After about 1 hour at room temperature, approximately 10 mL of 30% ammonium hydroxide was added, and the reaction incubated at 37°C overnight. The CPG was filtered off and washed with water and the filtrate collected.

[0382] The oligonucleotides were purified by anion exchange purification at room temperature. The oligonucleotide was loaded onto a column packed with Source QI 5 resin after equilibration with a 20 mM sodium hydroxide in water or 20 mM sodium hydroxide with 20% acetonitrile in water mobile phase. The purified oligonucleotide was eluted as fractions by gradient elution with a mobile phase of 20 mM sodium hydroxide and 2.5 M sodium chloride in water or 20 mM sodium hydroxide and 2.5 M sodium chloride with 20% acetonitrile in water. Fractions were analyzed, pooled to the desired purity and desalted using a G-25 Sephadex column against water for injection. Desalted samples were dried, reconstituted and sterile filtered prior to final analysis including UPLC, LC-MS and UV-Vis.

[0383] EXAMPLE 2. Provided Oligonucleotides and Compositions Are Active in vivo

[0384] All animal procedures were performed under IACUC guidelines. Male 8-9 weeks of age C57BL / 6 mice underwent surgery for the implantation of intracerebroventricular cannulas. At 10-11 weeks of age the same mice were dosed 100 pg on Day 0 by intracerebroventricular injection. After 8 weeks animals in groups 1-5 were euthanized by CO2 asphyxiation followed by thoracotomy. After cardiac perfusion with PBS brain samples were taken from both hemispheres (cortex, striatum, hippocampus, cerebellum, and brain stem) and flash frozen on dry ice. After 12 weeks animals in groups 6-10 were euthanized by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS brain samples were taken from both hemispheres (cortex, striatum, hippocampus, cerebellum, brain stem, and spinal cord) and flash frozen on dry ice. After 16 weeks animals in groups 11-15 were euthanized by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS brain samples were taken from both hemispheres (cortex, striatum, hippocampus, cerebellum, brain stem, and spinal cord) and flash frozen on dry ice. One animals from each group had the right hemisphere of their brain placed in buffered 10% formalin. Total RNA from different CNS regions was extracted using RNeasy 96 kit (Qiagen), after tissue lysis with TRIzol and chloroform. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For mouse APP mRNA, the following qPCR assay were utilized: Thermofisher Taqman qPCR assay ID Mm01344172_ml. Mouse HPRT was used as normalizer (Forward 5’CAAACTTTGCTTTCCCTGGTT3’, Reverse 5’TGGCCTGTATCCAACACTTC3’, Probe

[0385] 575HEX / ACCAGCAAG / Zen / CTTGCAACCTTAACC / 3IABkFQ / 3 ’ . Thermofisher Taqman qPCR assay ID for Calbl: Mm00486647_ml, Grid2: Mm00515047_ml, Pcp2: Mm00435514_ml, Gfap: Mm01253033_ml, Aifl : Mm00479862_gl. Thermofisher Taqman qPCR assay ID Mouse Tubb3 which was used as normalizer: Mm00727586_sl. Oligonucleotide accumulation in CNS regions was determined by sandwich ELISA.

[0386] To evaluate the safety of siRNAs used , serum NfL levels were measured at 4-, 6-, and 8-weeks following administration. Monoclonal antibody UDI (Uman Diagnostics) was covalently coupled to MagPlex-C Microspheres #12 (MCI 0012-01, Luminex) using xMAP Antibody Coupling Kit (#40-50016, Luminex). Serum samples from mice were diluted as 1 :4 with Specimen Diluent Buffer (Quidel #A3670) and incubated with UDI coupled microspheres (2500 beads / well) in a 96-well plate for 18-20 hours at 4C on an orbital plated shaker. Following three washes with Wash Buffer (EMD Millipore #L-WB), the wells were subjected to an incubation step with 25uL of Detection antibody (1 :500, UD3, Uman Diagnostics) on a plate shaker for 2 hours at ambient temperature. 25uL of Streptavidin-Phycoerthrin (EMD Millipore #LB-SAPE10) was introduced into each well, followed by an incubation period of 30 minutes with continuous agitation. Following three rounds of washing, 150 microliters of Sheath Fluid PLUS (EMD Millipore #40-50021) was introduced, and subsequently, the beads were resuspended on a plate shaker for a duration of 5 minutes. The fluorescence intensity signal of the beads was measured using FLEXMAP 3D (Luminex) instrument with xPONENT software (Luminex). The analyses were conducted in duplicate to ensure accuracy and reliability. The standard NfL protein (Progen # RPC20469 ) was used to prepare five standards at the concentration from 30 to 200,000 pg / ml in Assay buffer (EMD Millipore #L-AB ) Unspiked assay buffer was used as blank. Standard curves were fitted using 5 -Parameter Logistic regression analysis by XPONENT software. Average NfL concentration of each group was calculated and plotted using GraphPad Prism. Minimal changes in the serum levels of NfL were observed in the mice treated with siRNA, in comparison to the group treated with PBS. There was no statistically significant difference observed between the groups.

[0387] Cerebellum total RNA extracted from mice treated with PBS, DSR-0103432, DSR- 0103299, DSR-0103300, and DSR-0103301 (3 animals from each group) were RNA- sequenced and Fastq’s were obtained fromNovogene. nf-core / maseq (version 3.10.1) pipeline was used to process the data, with the specific packages following. Adapters were trimmed using Trim Galore! (Version 0.6.7 & cutadapt version 3.4) then aligned using STAR (version 2.7.9a) and transcript counts quantified using Salmon (version 1.9.0). Aligned bam files were processed using R (version 4.3.0) and differential expression results calculated using DEseq2 (version 1.40.2) and plotted using Enhanced Volcano (version 1.18.0) with cutoffs greater than |log2foldChange| > 1 and padj (Benjamini-Hochberg) less than 0.01.

[0388] Ago2 immunoprecipitation assay: Tissues were lysed in lysis buffer 50 mM Tris-HCl at pH 7.5, 200mM NaCl, 0.5% Triton X-100, 2 mM EDTA, 1 mg / mL heparin) with protease inhibitor (Sigma-Aldrich). Lysate concentration was measured with a protein BCA kit (Pierce BCA protein assay kit or Bradford protein assay kit). Anti-Ago2 antibody was purchased from Wako Chemicals. Control mouse IgG was from eBioscience. Dynabeads (Invitrogen) were used to precipitate antibodies. Ago2-associated siRNA and endogenous miR-124 were measured by Stem-Loop RT followed by TaqMan PCR analysis using Taqman miRNA and siRNA assay kit (Thermo Fisher) based on manufacturer’s methods.

[0389] The contents of Tables 27, 28, and 29 of WO 2021 / 234459, and Tables 8-126R and 127-183 of WO 2024 / 182749, along with the corresponding experimental protocol descriptions, are incorporated herein by reference in their entirety.

[0390] Table 6. shows Ago 2 loading of guide strand relative to miR-124 in cortex 8 weeks, 12 weeks and 16 weeks post dose. N=3.

[0391] EXAMPLE 3. Provided Oligonucleotides and Compositions Are Active in vitro

[0392] All animal procedures were performed under IACUC guidelines. To evaluate the potency and liver exposure of provided oligonucleotides and compositions, male 8-10 weeks of age C57BL / 6 mice were dose at 5 mg / kg on Day 0 by subcutaneous administration. Animals were euthanized on Day 14 or 28 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, various tissue samples were harvested and flash-frozen in dry ice. Total RNA was extracted using RNeasy 96 kit (Qiagen), after tissue lysis with TRIzol and chloroform. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad for mouse SOD1 mRNA, the following qPCR assay were utilized: mouse Sodl from IDT (Integrated DNA Technologies) qPCR assay ID Mm. PT.58.12368303. Mouse HPRT was used as normalizer (Forward 5’CAAACTTTGCTTTCCCTGGTT3’, Reverse 5’TGGCCTGTATCCAACACTTC3’, Probe

[0393] 575HEX / ACCAGCAAG / Zen / CTTGCAACCTTAACC / 3IABkFQ / 3 ’ . Oligonucleotide accumulation was determined by sandwich ELISA. Table 7. shows % mouse SOD1 mRNA remaining relative to PBS control in the quad 2- and 4-weeks post dosing. N = 5.

[0394] Table 8. shows % mouse SOD1 mRNA remaining relative to PBS control in the liver 2- and 4-weeks post dosing. N = 5.

[0395] Table 9. shows % mouse SOD1 mRNA remaining relative to PBS control in the brown adipose 2- and 4-weeks post dosing. N = 5.

[0396] Table 10. shows % mouse SOD1 mRNA remaining relative to PBS control in the white adipose

[0397] 2- and 4-weeks post dosing. N = 5. N.D.: Not determined.

[0398] Table 11. shows % mouse SOD1 mRNA remaining relative to PBS control in the lung 2- and 4-weeks post dosing. N = 5. Table 12. shows % mouse SOD1 mRNA remaining relative to PBS control in the diaphragm

[0399] 2- and 4-weeks post dosing. N = 5.

[0400] Table 13. shows % mouse SOD1 mRNA remaining relative to PBS control in the heart 2- and

[0401] 4-weeks post dosing. N = 5. Table 14. shows % mouse SOD1 mRNA remaining relative to PBS control in the kidney 2- and 4-weeks post dosing. N = 5.

[0402] Table 15. shows the accumulation of antisense strand in the liver at 2 weeks and 4 weeks post dosing. N = 5. Table 16 shows the accumulation of antisense strand in the white adipose at 2 weeks and 4 weeks post dosing. N = 5.

[0403] Table 17. shows the accumulation of antisense strand in the brown adipose at 2 weeks and 4 weeks post dosing. N = 5.

[0404] EXAMPLE 4. Provided Oligonucleotides and Compositions Are Active in vitro in Mouse Primary Hepatocytes

[0405] Various siRNAs for mouse TTR were designed and constructed. A number of siRNAs were tested in vitro in mouse primary hepatocytes at one or a range of concentrations. Example protocol for in vitro determination of siRNA activity in mouse primary hepatocytes: For determination of siRNAs activity, siRNAs at specific concentration were gymnotically delivered to mouse primary hepatocytes plated at 96-well plates, with 10,000 cells / well. Following 48 hours treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For mouse TTR mRNA, the following qPCR assay was utilized: IDT PrimeTime predesigned qPCR Assay Mm. PT.58.11922308. Mouse HPRT was used as normalizer (IDT, Mm.PT.39a.22214828). mRNA knockdown levels were calculated as %mRNA remaining relative to mock treatment. Table 18. shows % mouse TTR mRNA remaining (at 500, 150 and 50 pM siRNA treatment) in primary mouse hepatocytes relative to mouse HPRT control. N = 2.

[0406]

[0407] Table 19. shows % mouse TTR mRNA remaining (at 500pM, 150pM and 50pM siRNA treatment) in primary mouse hepatocyte relative to mouse HPRT control. N = 2.

[0408] EXAMPLE 5. Provided Oligonucleotides and Compositions Are Active in vitro in human iCell GABA neurons Various siRNAs for human APP were designed and constructed. A number of siRNAs were tested in vitro in human iCell GABA neurons at one or a range of concentrations.

[0409] Example protocol for in vitro determination of siRNA activity in human iCell GABA neurons: For determination of siRNAs activity, siRNAs at specific concentration were gymnotically delivered to human iCell GABA neurons plated at 96-well plates, with 40,000 cells / well. Following 5 days treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High- Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (BioRad). For human APP mRNA, the following qPCR assay was utilized: Thermofisher Taqman qPCR assay ID Hs00169098_ml. Human SFRS9 was used as normalizer (Forward, 5’- TGGAATATGCCCTGCGTAAA-3’; Reverse, 5’- TGGTGCTTCTCTCAGGATAAAC-3’, Probe, 5’- TGGATGACACCAAATTCCGCTCTCA-3’. mRNA knockdown levels were calculated as %mRNA remaining relative to mock treatment. Table 20. shows % human APP mRNA remaining (at 3 and 1 uM siRNA treatment) in iCell

[0410] GABA neurons relative to human SFRS9 control. N = 2.

[0411] Table 21. shows % human APP mRNA remaining (at 3 and 1 uM siRNA treatment) in iCell

[0412] GABA neurons relative to human SFRS9 control. N = 2.

[0413]

[0414] Table 22. shows % human APP mRNA remaining (at 3 and 1 uM siRNA treatment) in iCell

[0415] GABA neurons relative to human SFRS9 control. N = 2.

[0416] Table 23. shows % IC50 of knocking down human APP mRNA in human iCell GABA neurons.

[0417] EXAMPLE 6. Provided Oligonucleotides and Compositions Are Active in vitro in Normal

[0418] Human Bronchial Epithelium Cells

[0419] Various siRNAs for human APP were designed and constructed. A number of siRNAs were tested in vitro in human bronchial epithelium (NHBE) cells at a range of concentrations.

[0420] Example protocol for in vitro determination of siRNA activity in human NHBE cells: For determination of siRNAs activity, siRNAs at specific concentration were gymnotically delivered to NHBE cells plated at 96-well plates, with 5,000 cells / well. Following 48 hours treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For human APP mRNA, the following qPCR assay were utilized: Thermofisher Taqman qPCR assay ID Hs00169098_ml. Human hSFRS9 was used as normalizer (Forward 5’ TGGAATATGCCCTGCGTAAA’, Reverse 5’ TGGTGCTTCTCTCAGGATAAAC 3’, Probe 575HEX / TGGATGACA / Zen / CCAAATTCCGCTCTCA / 3IABkFQ / 3’. mRNA knockdown levels were calculated as %mRNA remaining relative to mock treatment. Table 24. shows % human APP mRNA remaining (at 30, 10, 3 and 1 uM siRNA treatment) in NHBE cells relative to human SFRS9 control. N = 2.

[0421] Table 25. shows % human APP mRNA remaining (at 10, 3, 1, and 0.3 uM siRNA treatment) in NHBE cells relative to human SFRS9 control. N = 2. | 0103301 |

[0422] Table 26. shows % human APP mRNA remaining (at 10, 3 and 1 uM siRNA treatment) in

[0423] NHBE cells relative to human SFRS9 control. N = 2. N.D.: Not determined

[0424] Table 27. shows % human APP mRNA remaining (at 10, 3 and 1 uM siRNA treatment) in

[0425] NHBE cells relative to human SFRS9 control. N = 2. N.D.: Not determined

[0426] Table 28. shows % human APP mRNA remaining (at 10, 3 and 1 uM siRNA treatment) in

[0427] NHBE cells relative to human SFRS9 control. N = 2. N.D.: Not determined

[0428] Table 29. shows % human APP mRNA remaining (at 10, 3 and 1 uM siRNA treatment) in

[0429] NHBE cells relative to human SFRS9 control. N = 2. N.D.: Not determined

[0430] Table 30. shows % human APP mRNA remaining (at 10, 3 and 1 uM siRNA treatment) in

[0431] NHBE cells relative to human SFRS9 control. N = 2. N.D.: Not determined

[0432] Table 31. shows % IC50 of knocking down human APP mRNA in normal human bronchial epithelia cells. N.D.: Not determined EXAMPLE 7. Provided Oligonucleotides and Compositions Are Active in vitro in HEK293T Cells

[0433] Various siRNAs for human APP were designed and constructed. A number of siRNAs were tested in vitro in HEK293T cells at a range of concentrations. Example protocol for in vitro determination of siRNA activity in human HEK293T: For determination of siRNAs activity, siRNAs at specific concentration were gymnotically delivered to Human HEK293T cells plated at 96-well plates, with 30,000 cells / well. Following 48 hours treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For human APP mRNA, the following qPCR assay was utilized: Thermofisher Taqman qPCR assay ID Hs00169098_ml. Human SFRS9 was used as normalizer (Forward, 5’- TGGAATATGCCCTGCGTAAA-3’; Reverse, 5’- TGGTGCTTCTCTCAGGATAAAC-3’, Probe, 5’- TGGATGACACCAAATTCCGCTCTCA-3’. mRNA knockdown levels were calculated as %mRNA remaining relative to mock treatment.

[0434] Table 32. shows % human APP mRNA remaining (at 30, 10, 3 and 1 uM siRNA treatment) in HEK293T cells relative to human SFRS9 control. N = 2. 002-001

[0435] EXAMPLE 8. Provided Oligonucleotides and Compositions Are Active in vitro in 3T3- L1 Cells

[0436] Various siRNAs for mouse APP were designed and constructed. A number of siRNAs were tested in vitro in 3T3-L1 cells at a range of concentrations.

[0437] Example protocol for in vitro determination of siRNA activity in 3T3-L1 cells: For determination of siRNAs activity, siRNAs at specific concentration were gymnotically delivered to mouse 3T3-L1 s plated at 96-well plates, with 3,000 cells / well. Following 48 hours treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For mouse APP mRNA, the following qPCR assay was utilized: Thermofisher Taqman qPCR assay ID Mm01344172_ml. Mouse HPRT was used as normalizer (IDT, Mm.PT.39a.22214828). mRNA knockdown levels were calculated as %mRNA remaining relative to mock treatment.

[0438] Table 33. shows % mouse APP mRNA remaining (at 30, 10, 3 and 1 uM siRNA treatment) in 3T3-L1 cells relative to mouse HPRT control. N = 2.

[0439] EXAMPLE 9. Provided Oligonucleotides and Compositions Are Active in vitro in Human

[0440] Renal Proximal Tubule Cells

[0441] Various siRNAs for human APP were designed and constructed. A number of siRNAs were tested in vitro in human renal proximal tubule cells at a range of concentrations.

[0442] Example protocol for in vitro determination of siRNA activity in human renal proximal convoluted tubule: For determination of siRNAs activity, siRNAs at specific concentration were gymnotically delivered to Human renal proximal convoluted tubule cells plated at 96- well plates, with 10,000 cells / well. Following 48 hours treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For human APP mRNA, the following qPCR assay were utilized: Thermofisher Taqman qPCR assay ID Hs00169098_ml. Human SFRS9 was used as normalizer (Forward, 5’- TGGAATATGCCCTGCGTAAA-3’; Reverse, 5’- TGGTGCTTCTCTCAGGATAAAC-3 ’, Probe, 5’-

[0443] TGGATGACACCAAATTCCGCTCTCA-3’. mRNA knockdown levels were calculated as %mRNA remaining relative to mock treatment.

[0444] Table 34. shows % human APP mRNA remaining (at 30, 10, 3 and 1 uM siRNA treatment) in human renal proximal tubule cells relative to human SFRS9 control. N = 2.

[0445] EXAMPLE 10. Provided Oligonucleotides and Compositions Are Active in vitro in Human Adipocytes

[0446] Various siRNAs for human APP were designed and constructed. A number of siRNAs were tested in vitro in Human adipocytes at a range of concentrations.

[0447] Example protocol for in vitro determination of siRNA activity in human adipocytes: Preadipocyte was plated at 96-well plates with 10,000 cells / well for differentiation. For determination of siRNAs activity, siRNAs at specific concentration were gymnotically delivered to human adipocyte 6 days after differentiation initiation. Following 5 days treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For human APP mRNA, the following qPCR assay was utilized: Thermofisher Taqman qPCR assay ID Hs00169098_ml. Human SFRS9 was used as normalizer (Forward, 5’- TGGAATATGCCCTGCGTAAA-3’; Reverse, 5’- TGGTGCTTCTCTCAGGATAAAC-3’, Probe, 5’-

[0448] TGGATGACACCAAATTCCGCTCTCA-3’. mRNA knockdown levels were calculated as %mRNA remaining relative to mock treatment.

[0449] Table 35. shows % human APP mRNA remaining (at 30, 10, 3 and 1 uM siRNA treatment) in human adipocytes relative to human SFRS9 control. N = 2.

[0450] Table 36. shows % human APP mRNA remaining (at 10, 3 and 1 uM siRNA treatment) in human adipocytes relative to human SFRS9 control. N = 2.

[0451] Table 37. shows % human APP mRNA remaining (at 10, 3 and 1 uM siRNA treatment) in human adipocytes relative to human SFRS9 control. N = 2.

[0452] Table 38. shows % human APP mRNA remaining (at 10, 3 and 1 uM siRNA treatment) in human adipocytes relative to human SFRS9 control. N = 2.

[0453] Table 39. shows % human APP mRNA remaining (at 10, 3 and 1 uM siRNA treatment) in human adipocytes relative to human SFRS9 control. N = 2.

[0454] Table 40. shows % human APP mRNA remaining (at 10, 3 and 1 uM siRNA treatment) in human adipocytes relative to human SFRS9 control. N = 2. EXAMPLE 11. Provided Oligonucleotides and Compositions Are Active in vitro in Human Primary Hepatocytes

[0455] Various siRNAs for human APP were designed and constructed. A number of siRNAs were tested in vitro in human primary hepatocytes at one or a range of concentrations.

[0456] Example protocol for in vitro determination of siRNA activity in human primary hepatocytes: For determination of siRNAs activity, siRNAs at specific concentration were gymnotically delivered to primary hepatocytes plated at 96-well plates, with 10,000 cells / well. Following 48 hours treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For human APP mRNA, the following qPCR assay was utilized: Thermofisher Taqman qPCR assay ID Hs00169098_ml. Human hSFRS9 was used as normalizer (Forward 5’ TGGAATATGCCCTGCGTAAA’, Reverse 5’ TGGTGCTTCTCTCAGGATAAAC 3’, Probe 575HEX / TGGATGACA / Zen / CCAAATTCCGCTCTCA / 3IABkFQ / 3’. mRNA knockdown levels were calculated as %mRNA remaining relative to mock treatment.

[0457] Table 41. Shows % human APP mRNA remaining (at 3,1, and 0.3 uM siRNA treatment) in primary human hepatocyte relative to human SFRS9 control. N = 2.

[0458]

[0459] Table 42. Shows % human APP mRNA remaining (at 3,1, and 0.3 uM siRNA treatment) in primary human hepatocyte relative to human SFRS9 control. N = 2.

[0460]

[0461] Table 43. Shows % human APP mRNA remaining (at 3,1, and 0.3 uM siRNA treatment) in primary human hepatocyte relative to human SFRS9 control. N = 2.

[0462]

[0463] Table 44. Shows % human APP mRNA remaining (at 3,1, and 0.3 uM siRNA treatment) in primary human hepatocyte relative to human SFRS9 control. N = 2.

[0464]

[0465] Table 45. Shows % human APP mRNA remaining (at 3,1, and 0.3 uM siRNA treatment) in primary human hepatocyte relative to human SFRS9 control. N = 2.

[0466] EXAMPLE 12. Provided Oligonucleotides and Compositions Are Active in vitro in Mouse Primary Hepatocytes

[0467] Various siRNAs for mouse SOD1 were designed and constructed. A number of siRNAs were tested in vitro in mouse primary hepatocytes at one or a range of concentrations. Some siRNAs were also tested in mice (e.g., C57BL6 wild type mice).

[0468] Example protocol for in vitro determination of siRNA activity in mouse primary hepatocytes: For determination of siRNAs activity, siRNAs at specific concentration were gymnotically delivered to mouse primary hepatocytes plated at 96-well plates, with 10,000 cells / well. Following 48 hours treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High- Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (BioRad). For mouse SOD1 mRNA, the following qPCR assay was utilized: IDT PrimeTime predesigned qPCR Assay Mm. PT.58.12368303. Mouse HPRT was used as normalizer (IDT, Mm.PT.39a.22214828). mRNA knockdown levels were calculated as %mRNA remaining relative to mock treatment.

[0469] Table 46. shows % mouse SOD1 mRNA remaining (at 0.1, 0.03 and 0.01 uM siRNA treatment) in primary mouse hepatocytes relative to mouse HPRT control. N = 2. Table 47. shows % mouse SOD1 mRNA remaining (at 0.1, 0.03 and 0.01 uM siRNA treatment) in primary mouse hepatocytes relative to mouse HPRT control. N = 2.

[0470] Table 48. shows % IC50 of knocking down mouse SOD1 mRNA in primary mouse hepatocytes Table 49. shows % mouse SOD1 mRNA remaining (at 0.3, 0.1 and 0.03 uM siRNA treatment) in primary mouse hepatocytes relative to mouse HPRT control. N = 2.

[0471] Table 50. shows % mouse SOD1 mRNA remaining (at 0.1, 0.03 and 0.01 uM siRNA treatment) in primary mouse hepatocytes relative to mouse HPRT control. N = 2

[0472]

[0473] EXAMPLE 13. Provided Oligonucleotides and Compositions Are Active in vivo

[0474] All animal procedures were performed under IACUC guidelines. To evaluate the potency and tissue exposure of provided oligonucleotides and compositions, male 8-10 weeks of age C57BL / 6 mice were dose at 5 mg / kg on Day 0 by subcutaneous administration.

[0475] Animals were euthanized on Day 28 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, various tissue samples were harvested and flash-frozen in dry ice. Total RNA was extracted using RNeasy 96 kit (Qiagen), after tissue lysis with TRIzol and chloroform. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad for mouse APP mRNA, the following qPCR assay was utilized: mouse Sodl from IDT (Integrated DNA Technologies) qPCR assay ID Mm. PT.58.12368303. Mouse HPRT was used as normalizer (IDT, Mm.PT.39a.22214828). Oligonucleotide accumulation was determined by sandwich ELISA.

[0476] Table 51. shows % mouse SOD1 mRNA remaining relative to PBS control in the kidney 28 days post dosing. N = 5.

[0477] Table 52. shows the accumulation of antisense strand in the kidney at 28 days post the first dosing. N = 5. N.D.: Not determined

[0478] EXAMPLE 14. Provided Oligonucleotides and Compositions Are Active in vivo

[0479] All animal procedures were performed under IACUC guidelines. To evaluate the potency and tissue exposure of provided oligonucleotides and compositions, male 8-10 weeks of age C57BL / 6 mice were dose at 5 mg / kg on Day 0, 2, and 4 by subcutaneous administration. Animals were euthanized on Dayl4 and 28 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, various tissue samples were harvested and flash -frozen in dry ice. Total RNA was extracted using RNeasy 96 kit (Qiagen), after tissue lysis with TRIzol and chloroform. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad for mouse APP mRNA, the following qPCR assay were utilized: mouse Sodl from IDT (Integrated DNA Technologies) qPCR assay ID Mm. PT.58.12368303. Mouse HPRT was used as normalizer (IDT, Mm.PT.39a.22214828). Oligonucleotide accumulation was determined by sandwich ELISA.

[0480] Table 53. shows % mouse SOD1 mRNA remaining relative to PBS control in the brown adipose tissue 14 and 28 days post the first dosing. N = 5.

[0481]

[0482] Table 54. shows % mouse SOD1 mRNA remaining relative to PBS control in the heart 14 and

[0483] 28 days post the first dosing. N = 5.

[0484]

[0485] Table 55. shows % mouse SOD1 mRNA remaining relative to PBS control in the pancreas 14 and 28 days post the first dosing. N = 5. N.D.: Not Determined. Table 56. shows % mouse SOD1 mRNA remaining relative to PBS control in the white adipose tissue 14 and 28 days post the first dosing. N = 5. N.D.: Not determined Table 57. shows % mouse SOD1 mRNA remaining relative to PBS control in the liver 14 and

[0486] 28 days post the first dosing. N = 5.

[0487]

[0488] Table 58. shows % mouse SOD1 mRNA remaining relative to PBS control in the diaphragm

[0489] 14 and 28 days post the first dosing. N = 5.

[0490] Table 59. shows % mouse SOD1 mRNA remaining relative to PBS control in the lung 14 and 28 days post the first dosing. N = 5. Table 60. shows % mouse SOD1 mRNA remaining relative to PBS control in the quad 14 and

[0491] 28 days post the first dosing. N = 5.

[0492]

[0493] Table 61. shows % mouse SOD1 mRNA remaining relative to PBS control in the sciatic nerve

[0494] 14 and 28 days post the first dosing. N = 5.

[0495]

[0496] Table 62. shows % mouse SOD1 mRNA remaining relative to PBS control in the kidney 14 and 28 days post the first dosing. N = 5. Table 63. shows the accumulation of antisense strand in the lung at 14 days and 28 days post the first dosing. N = 5. N.D.: Not determined Table 64. shows the accumulation of antisense strand in the quadriceps at 14 days and 28 days post the first dosing. N = 5. N.D.: Not determined.

[0497] EXAMPLE 15. Provided Oligonucleotides and Compositions Are Active in vivo

[0498] All animal procedures were performed under IACUC guidelines. To evaluate the potency and tissue exposure of provided oligonucleotides and compositions, male 8-10 weeks of age C57BL / 6 mice were dose at 5 mg / kg on Day 0 by subcutaneous administration. Animals were euthanized on Day 28 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, various tissue samples were harvested and flash- frozen in dry ice. Total RNA was extracted using RNeasy 96 kit (Qiagen), after tissue lysis with TRIzol and chloroform. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (BioRad for mouse SOD1 mRNA, the following qPCR assay were utilized: mouse Sodl from IDT (Integrated DNA Technologies) qPCR assay ID Mm. PT.58.12368303. Mouse HPRT was used as normalizer (IDT, Mm.PT.39a.22214828). Oligonucleotide accumulation was determined by sandwich ELISA.

[0499] Table 65. shows % mouse SOD1 mRNA remaining relative to PBS control in the liver 28 days post dosing. N = 5.

[0500] Table 66. shows % mouse SOD1 mRNA remaining relative to PBS control in the white adipose tissue 28 days post dosing. N = 5. N.D.: Not determined Table 67. shows % mouse SOD1 mRNA remaining relative to PBS control in the lung 28 days post dosing. N = 5.

[0501]

[0502] Table 68. shows % mouse SOD1 mRNA remaining relative to PBS control in the quad 28 days post dosing. N = 5.

[0503] Table 69. shows % mouse SOD1 mRNA remaining relative to PBS control in the heart 28 days post dosing. N = 5. Table 70. shows % mouse SOD1 mRNA remaining relative to PBS control in the sciatic nerve 28 days post dosing. N = 5.

[0504]

[0505] Table 71. shows % mouse SOD1 mRNA remaining relative to PBS control in the kidney 28 days post dosing. N = 5. EXAMPLE 16. Provided Oligonucleotides and Compositions Are Active in vivo

[0506] All animal procedures were performed under IACUC guidelines. To evaluate the potency and tissue exposure of provided oligonucleotides and compositions, male 8-10 weeks of age C57BL / 6 mice were dose at 5 mg / kg on Day 0 and 7 by subcutaneous administration. Animals were euthanized on Day 28 and 56 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, various tissue samples were harvested and flash -frozen in dry ice. Total RNA was extracted using RNeasy 96 kit (Qiagen), after tissue lysis with TRIzol and chloroform. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad for mouse APP mRNA, the following qPCR assay was utilized: mouse Sodl from IDT (Integrated DNA Technologies) qPCR assay ID Mm.PT.58.12368303. Mouse HPRT was used as normalizer (IDT, Mm.PT.39a.22214828). Oligonucleotide accumulation was determined by sandwich ELISA. Table 72. shows % mouse SOD1 mRNA remaining relative to PBS control in the liver 28 and

[0507] 56 days post dosing. N = 5.

[0508] Table 73. shows % mouse SOD1 mRNA remaining relative to PBS control in the white adipose tissue 28 and 56 days post dosing. N = 5.

[0509]

[0510] Table 74. shows % mouse SOD1 mRNA remaining relative to PBS control in the quad tissue

[0511] 28 and 56 days post dosing. N = 5.

[0512]

[0513] Table 75. shows % mouse SOD1 mRNA remaining relative to PBS control in the diaphragm tissue 28 and 56 days post dosing. N = 5.

[0514]

[0515] Table 76. shows % mouse SOD1 mRNA remaining relative to PBS control in the lung tissue 28 and 56 days post dosing. N = 5.

[0516]

[0517] Table 77. shows % mouse SOD1 mRNA remaining relative to PBS control in the sciatic nerve tissue 28 and 56 days post dosing. N = 5.

[0518]

[0519] Table 78. shows % mouse SOD1 mRNA remaining relative to PBS control in the pancreas tissue 28 and 56 days post dosing. N = 5.

[0520]

[0521] EXAMPLE 17. Provided Oligonucleotides and Compositions Are Active in vivo

[0522] All animal procedures were performed under IACUC guidelines. To evaluate the potency and tissue exposure of provided oligonucleotides and compositions, male 8-10 weeks of age C57BL / 6 mice were dose at 5 mg / kg on Day 0 by subcutaneous administration. Animals were euthanized on Day 28, 56, and 84 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, various tissue samples were harvested and flash -frozen in dry ice. Total RNA was extracted using RNeasy 96 kit (Qiagen), after tissue lysis with TRIzol and chloroform. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad for mouse APP mRNA, the following qPCR assay was utilized: mouse Sodl from IDT (Integrated DNA Technologies) qPCR assay ID Mm. PT.58.12368303. Mouse HPRT was used as normalizer (IDT, Mm.PT.39a.22214828). Oligonucleotide accumulation was determined by sandwich ELISA.

[0523] Table 79. shows % mouse SOD1 mRNA remaining relative to PBS control in the liver 28 days post dosing. N = 5.

[0524] Table 80. shows % mouse SOD1 mRNA remaining relative to PBS control in the white adipose tissue 28 days post dosing. N = 5. N.D.: Not determined

[0525] Table 81. shows % mouse SOD1 mRNA remaining relative to PBS control in the quad 28 days post dosing. N = 5. Table 82. shows % mouse SOD1 mRNA remaining relative to PBS control in the heart 28 days post dosing. N = 5.

[0526] Table 83. shows % mouse SOD1 mRNA remaining relative to PBS control in the diaphragm

[0527] 28 days post dosing. N = 5. Table 84. shows % mouse SOD1 mRNA remaining relative to PBS control in the kidney 28 days post dosing. N = 5.

[0528] Table 85. shows % mouse SOD1 mRNA remaining relative to PBS control in the lung 28 days post dosing. N = 5.

[0529] Table 86. shows % mouse SOD1 mRNA remaining relative to PBS control in the pancreas

[0530] 28 days post dosing. N = 5. Table 87. shows % mouse SOD1 mRNA remaining relative to PBS control in the liver 56 days post dosing. N = 5.

[0531] Table 88. shows % mouse SOD1 mRNA remaining relative to PBS control in the white adipose tissue 56 days post dosing. N = 5.

[0532] Table 89. shows % mouse SOD1 mRNA remaining relative to PBS control in the quad 56 days post dosing. N = 5. Table 90. shows % mouse SOD1 mRNA remaining relative to PBS control in the heart 56 days post dosing. N = 5.

[0533] Table 91 % mouse SOD1 mRNA remaining relative to PBS control in the diaphragm 56 days post dosing. N = 5.

[0534] EXAMPLE 18. Provided Oligonucleotides and Compositions Are Active in vivo

[0535] All animal procedures were performed under IACUC guidelines. To evaluate the potency and tissue exposure of provided oligonucleotides and compositions, male 8-10 weeks of age C57BL / 6 mice were dose at 5 mg / kg on Day 0 by subcutaneous administration. Animals were euthanized on Day 28, 56, and 84 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, various tissue samples were harvested and flash-frozen in dry ice. Total RNA was extracted using RNeasy 96 kit (Qiagen), after tissue lysis with TRIzol and chloroform. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad for mouse APP mRNA, the following qPCR assay was utilized: mouse Sodl from IDT (Integrated DNA Technologies) qPCR assay ID Mm.PT.58.12368303. Mouse HPRT was used as normalizer (IDT, Mm.PT.39a.22214828). Oligonucleotide accumulation

[0536] was determined by sandwich ELISA.

[0537] Table 92. shows % mouse SOD1 mRNA remaining relative to PBS control in the liver 84 days post dosing. N = 5.

[0538] Table 93. shows % mouse SOD1 mRNA remaining relative to PBS control in the white adipose tissue 84 days post dosing. N = 5.

[0539] Table 94. shows % mouse SOD1 mRNA remaining relative to PBS control in the quad 84 days post dosing. N = 5. Table 95. shows % mouse SOD1 mRNA remaining relative to PBS control in the heart 84 days post dosing. N = 5.

[0540] Table 96. shows % mouse SOD1 mRNA remaining relative to PBS control in the diaphragm 84 days post dosing. N = 5.

[0541] EXAMPLE 19. Provided Oligonucleotides and Compositions Are Active in vivo

[0542] All animal procedures were performed under IACUC guidelines. To evaluate the potency and tissue exposure of provided oligonucleotides and compositions, male 8-10 weeks of age C57BL / 6 mice were dose at 10 mg / kg on Day 0 by subcutaneous administration. Animals were euthanized on Day 14 and 28 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, various tissue samples were harvested and flash-frozen in dry ice. Total RNA was extracted using RNeasy 96 kit (Qiagen), after tissue lysis with TRIzol and chloroform. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad for mouse APP mRNA, the following qPCR assay was utilized: mouse Sodl from IDT (Integrated DNA Technologies) qPCR assay ID Mm.PT.58.12368303. Mouse HPRT was used as normalizer (IDT, Mm.PT.39a.22214828). Oligonucleotide accumulation was determined by sandwich ELISA.

[0543] Table 97. shows % mouse SOD1 mRNA remaining relative to PBS control in the sciatic nerve 14 and 28 days post dosing. N = 5.

[0544]

[0545] Table 98. shows % mouse SOD1 mRNA remaining relative to PBS control in the liver 14 and 28 days post dosing. N = 5 or 7.

[0546] Table 99. shows % mouse SOD1 mRNA remaining relative to PBS control in the white adipose tissue 14 and 28 days post dosing. N = 5 or 7. Table 100. shows % mouse SOD1 mRNA remaining relative to PBS control in the quad 14 and 28 days post dosing. N = 5 or 7. Table 101. shows % mouse SOD1 mRNA remaining relative to PBS control in the kidney 14 and 28 days post dosing. N = 5 or 7. EXAMPLE 20. Provided Oligonucleotides and Compositions Are Active in vitro in 3T3-

[0547] L1 Cells

[0548] Various siRNAs for mouse SOD1 were designed and constructed. A number of siRNAs were tested in vitro in 3T3-L1 cells at a range of concentrations. Example protocol for in vitro determination of siRNA activity in 3T3-L1 cells: For determination of siRNAs activity, siRNAs at specific concentration were gymnotically delivered to mouse 3T3-L1 cells plated in 96-well plates, with 3,000 cells / well. Following 48 hours treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For mouse SOD1 mRNA, the following qPCR assay was utilized: mouse Sodl from IDT (Integrated DNA Technologies) qPCR assay ID Mm.PT.58.12368303. Mouse HPRT was used as normalizer (IDT, Mm.PT.39a.22214828). mRNA knockdown levels were calculated as %mRNA remaining relative to mock treatment.

[0549] Table 102. shows % mouse SOD1 mRNA remaining (at 3 and 1 uM siRNA treatment) in 3T3- L1 cells relative to mouse HPRT control. N = 2.

[0550] EXAMPLE 21: Synthesis and deprotection of stereopure oligonucleotide sequences containing 5’-Phosphonate General procedure for the 5’ -phosphonate deprotection conditions (25 pmole):

[0551] To prepare TMSI solution for 5 ’-phosphonate deprotection, pyridine (0.5 mL) was added to DCM (23.9 mL) and the resulting solution was cooled in ice-bath for 15 minutes. After that TMSI reagent (0.6 mL) was added to the mixture to get a bright yellow solution (total volume 25.0 mL). TMSI quenching solution (50 mL) was prepared by adding 2- Dodecane thiol (12.0 mL) and TEA (18.0 mL) in acetonitrile (18.0 mL).

[0552] After completion of the synthesis, the CPG solid support was dried and transferred into 50 mL plastic tube. Minimum amount of DCM was added to 5 ’-Phosphonate containing oligonucleotide on CPG and the CPG was vortexed to get a homogenous slurry. To this homogenous slurry, the TMSI solution (10.0 mL) was added slowly and mixed well. After the addition of total TMSI solution the color of the reaction mixture turns yellow indicating excess of TMSI solution. The resulting reaction mixture was stirred for 30 minutes at room temperature. After 30 min. the support was promptly washed using excess of acetonitrile followed by addition of quenching solution (10.0 mL) and this process was repeated three times (Total quenching volume 30.0 mL). The total time of exposure was limited to 20 min. The CPG was rinsed thoroughly using acetonitrile and drying under vacuum. Afterwards, CPG was subjected to standard cleavage and deprotection condition.

[0553] General procedure for the C&D conditions (25 fimol scale):

[0554] After completion of the synthesis and 5 ’-phosphonate deprotection, the CPG solid support was dried and transferred into 50 mL plastic tube. The CPG was treated with DS1 reagent (2.5 mL; 100 uL / umol) for 3 h at 27 °C, then added cone. NH3 (5.0 mL; 200 umol / umol) for 24 h at 37 °C. The reaction mixture was cooled to room temperature and the CPG was separated by membrane filtration, washed with 15 mL of H2O. The crude material (filtrate) was analyzed by LTQ and RP-UPLC.

[0555] The contents of pages 724-932 of WO 2024 / 182749 are incorporated herein by reference in their entirety, wherein the synthesis of the following compounds is described: WV- NU-017, WV-NU-010, WV-NU-10-CNE, WV-NU-128, WV-NU-128-CNE, WV-NU-038, WV- NU-037, WV-NU-037A, WV-NU-037, WV-NU-040, WV-NU-042, WV-RA-009, WV-RA- 009-CNE, WV-RA-010, WV-RA-010-CNE, 5’-(R)-C-M’-5'-ODMT’-2'-F-dU, 5’-(R)-C-M’- 5'-ODMT’-2'-F-dU-CNE phosphoramidite, 5'-(S)-C-Me-5'-ODMTr-2'-F-dU, of 5'-(R)-C-Me- 5'-ODMTr-2'-OMe-U, 5'-(S)-C-Me-5'-ODMTr-2'-OMe-U, 5'-(R)-C-Me-5'-ODMTr-dT, 5'- (S)-C-Me-5'-0DMTr-dT, L-DPSE-C1, (3’-L-DPSE-WV-NU-010), 3’-L-DPSE-WV-NU-017, 3’-L-DPSE-WV-NU-040, 3’-L-DPSE-WV-NU-037, 3’-L-DPSE-WV-NU-037A, L-DPSE-5’- ODMTr-5’-(R)-Me-2’F-dU amidite, L-DPSE-5’-ODMTr-5’-(S)-Me-2’F-dU amidite, 3’-L- DPSE-WV-RA-009, D-DPSE-C1, 3’-D-DPSE-5’-ODMTr-5’-(R)-Me-dT amidite, 3’-D- DPSE-5’-ODMTr-5’-(S)-Me-dT amidite, 3’-D-DPSE-5'-ODMTr-5’-(R)-Me-2'F-dU amidite, 3 ’-D-DPSE-5'-ODMTr-5 ’-(S)-Me-2'F-dU amidite, 3 ’-D-DPSE-5 ’-P0(0Et)2

[0556] Vinylphosphonate-dT amidite, 3 ’-D-DPSE-5 ’-(R)-Me-PO(OEt)2-dT amidite, 3 ’-D-DPSE-5 ’- (S)-Me-PO(OEt)2-dT amidite, WV-NU-231, WV-NU-306, WV-NU-299, WV-NU-301, L- DPSE-2’-OMe-5 ’-(R)-Me-P0(0Et)2-uridine amidite, L-DPSE-2’-OMe-5 ’-triazole- PO(OEt)2-uridine amidite, D-DPSE-2’-OMe-5’-triazole-PO(OEt)2-2’OMe-uridine amidite, L-DPSE-2 ’ -OMe-5 ’ -vinyl-PO(OEt)2-uridine amidite, D-DPSE-2 ’-OMe-5 ’ -vinyl-PO(OEt)2- uridine amidite, L-PSM-2’-O-C16 lipid-5’-ODMTr-uridine amidite, D-PSM-2’-O-C16 lipids’ -ODMTr-uridine amidite, 5’-(R)-C-Me-5’-ODMTr-2’OMe-A(Bz)-D-PSM, 5’-(S)-C-Me-5’- 0DMTr-2’0Me-A(Bz)-D-PSM, 2’0-C16-U-L-PSM, 2’0-C16-U-D-PSM, 2’-OMe-5’- triazole-PO(OEt)2-3’-CNE uridine amidite, 2’-O-C16 lipid-5’-ODMTr-3’-CNE Uridine amidite, 5 ’ -(R)-C-Me-5 ’ -ODMTr-2 ’ OMe- A(Bz)-CNE, 5 ’ -(R)-C-Me-5 ’ -ODMTr-2 ’ Fd- A(Bz)- CNE, 5’-(R)-C-Me-5’-ODMTr-2’Fd-U-CNE, 5’-0DMTr-(S)-GNA-G(iBu)-CNE, 5’- (DDMTr-(S)-GNA-T-CNE, 5’-triazole-PO(OEt)2-2’OMe-U-CNE, 2’0-C16-U-CNE, WV- NU-332, WV-NU-306, WV-NU-336, 5’-triazole-PO(OEt)2-2’OMe-U-L-DPSE, 5’-triazole- PO(OEt)2-2’OMe-U-D-DPSE, 5’-vinyl-PO(OEt)2-2’OMe-U-L-DPSE, 5’-vinyl-PO(OEt)2- 2’0Me-U-D-DPSE, WV-NU-223, WV-NU-286, WV-NU-287, WV-NU-288, WV-DL-045 (n009), SOPL-WLS-41 (n033), SOPL-WLS-97 (n039), SOPL-WLS-42 (n040), SOPL-WLS- 70, SOPL-WLS-96 (n071), SOPL-WLS-95, and SOPL-WLS-94 (n069).

[0557] Synthesis SOPL-WLS-98 (n077) Azide.

[0558] / . Preparation of l-methylinudazolidin-2-one (SOPL-WLS-98A)

[0559] SOPL-WLS-98A

[0560] To an ice cool solution of 2-Imidazolidone (25 g, 0.290 mol) in dry 1,4 dioxane (325 mL, 13 vol.) was added sodium hydride (60% dispersion in mineral oil) (19 g, 0.494 mol.) portionwise over a period of 15 min. then the solution was allowed to heat to 65 °C for 2 h. After that the mixture was again cool to 0°C and methyl iodide (33.49 mL, 0.537 mol) was added dropwise over a period of 30 mins and stirred at rt for 24 h. Progress of the reaction was monitored by TLC. Then reaction mixture was diluted with ice water (100 mL) and extracted with ethyl acetate (2 x 200 mL), washed with brine (1 x 150 mL), dried over Na2SO4 and concentrated under reduced pressure. The crude material was purified by column chromatography over silica-gel (230-400 mesh) eluted in 2% MeOH / DCM afforded SOPL- WLS-98A as a off white solid (9 g, 31%). TLC Mobile phase details: 7% MeOH in DCM.

[0561] 2. Preparations of l-docosyl-3-methylinudazolidin-2-one (SOPL-WLS-98-04)

[0562] SOPL-WLS-98-04

[0563] To a stirred solution of (SOPL-WLS-98A) (9 g, 0.0918 mol) in dry toluene (180 mL, 20 vol.) was added KOH powder (20.5 g, 0.3673 mol.), anhydrous free flow K2CO3 (2.53 g, 0.0183 mol.), followed by TBAB (1.47 g, 0.0183 mol.) at rt. Then reaction mixture was further stirred at rt for 20 min. Then added 1 -bromodocosane (70 mL, 0.183 mol) dropwise over a period of 30 mins at OoC and further stirred at 8O0C for 18 h. Progress of the reaction was monitored by TLC. The crude was diluted ice water (150 mL), extracted with DCM (100 mL x 3), washed with water (80 mL x 1), dried over aNnad2S cOo4ncentrated under reduced pressure. The crude was purified by column chromatography over silica-gel (230-400 mesh) eluted in 4% MeOH / DCM to get an off white solid (SOPL-WLS-98A) (25.3 g, 68%). TLC Mobile phase details: 7% MeOH in DCM.1H NMR (400 MHz, CDCI3): 8 in ppm = 3.27 (s, 4H), 3.16 (t, 2H, JI = 7.2 Hz), 2.78 (s, 3H), 1.48 (t, 2H, JI = 6.9 Hz), 1.28-1.25 (m, 42H), 0.88 (t, 3H, JI = 6.9 Hz). MS: m / z calcd for C26H52N2O, 408.7; found 409.66 [M+H]+.

[0564] 3. Preparations of 2-chloro-l-docosyl-3-methyl-4,5-dihydro-lH-inudazol-3-ium chloride (SOPL-WLS-98-05)

[0565] To a stirred solution of (SOPL-WLS-98-04) (20 g, 0.049 mol) in dry toluene (400 mL, 20 vol.) was added Oxalyl chloride (63 mL, 0.735 mol) dropwise over a period for 30 min, at 0°C. Then reaction mixture was further stirred at 60°C for 3 days. Progress of the reaction was monitored by TLC. Then reaction mixture was concentrated under reduced pressure. The crude was washed with diethyl ether (100 mL x 2), dried under vacuum afforded a yellowish syrup. (SOPL-WLS-98-05) (25 g, crude). TLC Mobile phase details: 7% MeOH in DCM.1H NMR (400 MHz, CDC13): 8 in ppm = 6.01 (s, 4H), 4.34 (t, 2H, JI = 9.6 Hz), 4.25 (t, 2H, JI = 10.0 Hz), 3.61 = 7.6 Hz), 3.33 (s, 3H), 3.18 (t, 1H, JI = 7.2 Hz), 2.81 (s, 1H), 1.66 (s, 2H),

[0566] 1.47 (t, 1H, JI = 7.2 Hz), 1.29-1.26 (m, 51H), 0.86 (t, 4H, JI = 6.9 Hz). MS: m / z calcd for C26H52CI2N2, 428.2; found 428.87 [M+]+.

[0567] 4. Preparations of 2-chloro-l-docosyl-3-methyl-4,5-dihydro-lH-inudazol-3-ium hexafluoro phosphate(V) (SOPL-WLS-98-06)

[0568] SOPL-WLS-98-06

[0569] To a stirred solution of (SOPL-WLS-98-05) (25 g, 0.0539 mol) in DCM (150 mL, 6 vol.) was added a solution of KPFe (9.9 g, 0.0539 mol.) in water (87.5 mL, 3.5 vol.) dropwise over a period of 30 mins at 0°C. Above reaction mixture was stirred at rt for 3 h. Progress of the reaction was monitored by TLC. Then the mixture was filtered through a celite bed washed with DCM (2 x 60 mL) and organic layer washed with water (2 x 60 mL), dried over Na2SO4 and concentrated under reduced pressure. The crude was washed with diethyl ether (100 ml x 3) and dried under vacuum afforded SOPL-WLS-98-06 as off white solid ( (23 g, 74%). TLC Mobile phase details: 7% MeOH in DCM.1H NMR (400 MHz, CDCI3): 8 in ppm = 4.16-4.02 (m, 4H), 3.53 (t, 2H, JI = 7.6 Hz), 3.24 (s, 3H), 1.65-1.62 (m, 2H), 1.2 (d, 40H, JI = 24.9 Hz), 0.86 (t, 3H, JI = 6.8 Hz). MS: m / z calcd for C24H52C1F6N2P, 428.2; found 428.2 [M+],

[0570] 5. Preparations of 2-azido-l-docosyl-3-methyl-4,5-dihydro-lH-inudazol-3- iumhexafluoro phosphate(V)) (SOPL-WLS-98)

[0571] SOPL-WLS-98

[0572] To a stirred solution of (SOPL-WLS-98-06) (23 g, 0.0401 mol) in dry acetonitrile (230 mL, 10 vol.) was added sodium azide (3.91 g, 0.0602 mol.) portion-wise over a period of 10 mins at 0°C and further stirred at rt for 3 h. Progress of the reaction was monitored by TLC. Then reaction mixture was filtered through a celite bed washed with acetonitrile (2 x 50 mL) and concentrated under reduced pressure. The crude was washed with diethyl ether (100 ml x 2) and dried under vacuum afforded SOPL-WLS-98 as an off white solid (18 g, 77%). TLC Mobile phase details: 7% MeOH in DCM. 'H NMR (400 MHz, CDC13): 8 in ppm = 3.99-3.84 (m, 4H), 3.40 (t, 2H, JI = 7.6 Hz), 3.21 (s, 3H), 1.61 (t, 2H, JI = 6.9 Hz), 1.27 (d, 38H, JI = 16.9 Hz), 0.88 (t, 3H, JI = 6.8 Hz). MS: m / z calcd for C26H52F6N5P; 434.7; found 435.0 [M+H]+. IR: 2176.27.

[0573] Synthesis of WV-DL-85 (n082) Azide.

[0574] To a stirred solution of (WV-DL-85A) (10 g, 0.1 mol) in dry THF (300 mL, 30 vol.) was added KOH powder (22.44 g, 0.4 mol.), K2CO3 (2.76 g, 0.02 mol.), followed by TBAB (1.61 g, 0.005 mol) at rt. Then reaction mixture was further stirred at rt for 20 min. Then added 1- bromodecane (41.3 mL, 0.2 mol) dropwise over a period of 30 mins at 0°C and stirred at 65°C for 18 h. Progress of the reaction was monitored by TLC. The crude was diluted with ice water (100 mL), extracted with EtOAc (100 mL x 2), washed with water (70 mL x 2), dried over Na2SO4 and concentrated under reduced pressure. The crude compound was purified by column chromatography over silica-gel (230-400 mesh) eluted in 4% MeOH in DCM concentrated under reduced pressure afforded WV-DL-85B as Oily liquid (20 g, 74%). TLC Mobile phase details: 5% MeOH in DCM.

[0575] 'H NMR (500 MHz, CDC13): 8 in ppm = 3.26 (s, 4H), 3.16 (t, 2H, JI = 7.6 Hz), 2.77 (s, 3H), 1.48 (q, 2H, JI = 7.3 Hz), 1.27 (d, 14H, Jl= 17.9 Hz), 0.87 (t, 3H, JI = 6.9 Hz). MS: m / z calcd for C14H28N2O, 240.4; found 241.43 [M+H] +.

[0576] 2. Preparations of 2-chloro-l-decyl-3-methyl-4,5-dihydro-lH-inudazol-3-iumchloride

[0577] (WV-DL-85C)

[0578] To a stirred solution of (WV-DL-85B).) (18 g, 0.075 mol) in dry toluene (360 mL, 20 vol) was added oxalyl chloride (96 mL, 1.13 mol) dropwise over a period for 30 min, at 0°C. Then reaction mixture was further stirred at 60°C for 3 days. Progress of the reaction was monitored by TLC. Then reaction mixture was concentrated under reduced pressure. The crude was codistilled with toluene (100 ml x 2). The crude was washed with diethyl ether (100 mL x 2), dried under vacuum to give a brown solid (WV- DL-85C) (19 g, crude). TLC Mobile phase details: 7% MeOH in DCM. 'H NMR (500 MHz, CDCh): 8 in ppm = 10.26 (s, 2H), 4.35 (m, 2H), 4.26 (m, 2H), 3.61 (t, 2H, JI = 7.6 Hz), 3.34 (s, 3H), 1.68 (s, 2H, Jl= 7.2 Hz) , 1.29 (m, 14H), 0.88 (t, 3H, JI = 6.9 Hz). MS: m / z calcd for Ci4H28Cl2N2, 295.3; found 260.24 [M-Cl],

[0579] 3. Preparations of 2-chloro-l-decyl-3-methyl-4,5-dihydro-lH-inudazol-3-ium hexafluoro p hasp hat e(V) (WV-DL-85D)

[0580] WV-DL-85D

[0581] To a stirred solution of crude (WV-DL-85Q (18.5 g, 0.063 mol) in DCM (110 mL, 6 vol) was added a solution of KPFe (11.5 g, 0.063 mol.) in water (64.7 mL, 3.5 vol) drop wise over a period of 30 mins at 0°C. Above reaction mixture was stirred at rt for 4 h. Progress of the reaction was monitored by TLC. To the above reaction mixture was added DCM (90 ml) and H2O (45 ml), separate two layers, organic layer washed with water (2 x 90 mL), dried over Na2SC>4 and concentrated under reduced pressure. The crude was washed with diethyl ether (90 ml x 3) and dried under vacuum and obtain WV-DL-85D an off white solid (18g, 71%). TLC Mobile phase details: 5% MeOH in DCM. 'H NMR (500 MHz, CDCh): 8 in ppm = 4.0 (m, 4H), 3.49 (m, 2H), 3.21 (s, 3H), 1.65 (m, 2H), 1.25 (m, 14H), 0.88 (t, 3H, JI = 7.2 Hz). MS: m / z calcd for Ci^sClFe , 404.8; found 259.8 [M+],

[0582] 4. Preparations of 2-azido-l-decyl-3-methyl-4,5-dihydro-lH-inudazol-3- iumhexafluorophosphate (V) (WV-DL-85)

[0583] WV-DL-85

[0584] To a stirred solution of (WV-DL-85D) (19 g, 0.044 mol) in acetonitrile (180 mL, 10 vol) was added sodium azide (4.34 g, 0.066 mol) portion-wise over a period of 20 mins at 0°C and further stirred at rt for 5 h. Progress of the reaction was monitored by TLC. Then reaction mixture was filtered through a celite bed, washed with acetonitrile (2 x 80 mL) and concentrated under reduced pressure to afford a yellowish solid .The solid was washed with diethyl ether (100 ml x 4) and dried under vacuum to give an off white solid (WV-DL-85) (16 g, 82%). TLC Mobile phase details: 100% EtOAc. ' H NMR (500 MHz, CDCl3): 8 in ppm = 3.96 (m, 2H), 3.86 (m, 2H), 3.38 (t, 2H, JI = 7.6 Hz), 3.20 (s, 3H), 1.63 (t, 2H, JI = 7.2 Hz), 1.28 (m, 14H), 0.88 (t, 3H), MS: m / z calcd for C14H28F6N5P; 266.4; found 266.53([M+]).

[0585] Synthesis of WV-DL-86 (n083) Azide.

[0586] WV-DL-86B

[0587] To a stirred solution of (WV-DL-86A) (8 g, 0.08 mol) in dry THF (240 mL, 30 vol) was added KOH powder (17.9 g, 0.32 mol), K2CO3 (2.2 g, 0.016 mol), followed by TBAB (1.28 g, 0.004 mol) at rt. Then reaction mixture was further stirred at rt for 20 min. Then added 1- bromotetradecane (47.6 mL, 0.16 mol) dropwise over a period of 40 mins at 0°C and stirred at 65°C for 22 h. Progress of the reaction was monitored by TLC. The crude was diluted with ice water (100 mL), extracted with EtOAc (100 mL x 2), washed with water (100 mL x 1), dried over Na2SO4 and concentrated under reduced pressure. The crude compound was purified by column chromatography over silica-gel (230-400 mesh) eluted in 4% MeOH in DCM concentrated under reduced pressure afforded WV-DL-86B as a liquid (18 g, 76%). TLC Mobile phase details: 5% MeOH in DCM.1H NMR (500 MHz, CDC13): 8 in ppm = 3.25 (s, 4H), 3.14 (t, 2H, JI = 7.6 Hz), 2.76 (s, 3H), 1.46 (t, 2H, JI = 6.9 Hz), 1.27 (s, 7H), 1.23 (s, 15H), 0.88 (t, 3H, JI = 6.9 Hz). MS: m / z calcd for C18H36N2O, 296.5; found 297.56 [M+H] +.

[0588] 2. Preparations of 2-chloro-l-tetradecyl-3-methyl-4,5-dihydro-lH-inudazol-3-ium chloride (WV-DL-86C)

[0589] WV-DL-86C

[0590] To a stirred solution of (WV-DL-86B) (14 g, 0.047 mol) in dry toluene (280 mL, 20 vol) was added oxalyl chloride (60 mL, 0.71 mol) dropwise over a period for 30 min, at 0°C. Then the reaction mixture was further stirred at 60°C for 80 h. Progress of the reaction was monitored by TLC. Then reaction mixture was concentrated under reduced pressure. The crude was co-distilled with toluene (100 ml x 2). The crude was washed with diethyl ether (100 mL x 2), dried under vacuum to give brown solid (WV-DL-86C) (18 g, crude). TLC Mobile phase details: 7% MeOH in DCM. 'H NMR (500 MHz, CDCh): 8 in ppm = 4.31 (ddd, 4H, JI = 44.8 Hz, J2 = 11.7 Hz), 3.62 (t, 2H, JI = 7.6 Hz), 3.35 (s, 3H), 1.69 (d, 2H, JI = 6.9 Hz) , 1.29 (m, 22H), 0.88 (t, 3H, JI = 6.9 Hz). MS: m / z calcd for Ci8H36Cl2N2, 351.4; found 316.34 [M-CI],

[0591] 3. Preparations of 2-chloro-l-tetradecyl-3-methyl-4,5-dihydro-lH-inudazol-3-ium hexafluoro p hasp hat e(V) (WV-DL-86D)

[0592] WV-DL-86D

[0593] To a stirred solution of crude (WV-DL-86Q (16 g, 0.0455 mol) in DCM (96 mL, 6 vol) was added a solution of KPFe (8.3 g, 0.046mol.) in water (56 mL, 3.5 vol.) drop wise over a period of 30 mins at 0°C. Above reaction mixture was stirred at rt for 4 h. Progress of the reaction was monitored by TLC. To the above reaction mixture was added DCM (100 ml) and H2O (50 ml), separate two layers, organic layer washed with water (2 x 100 mL), dried over Na2SO4 and concentrated under reduced pressure. The crude was washed with diethyl ether (100 ml x 3) and dried under vacuum afforded WV-DL-86D an off white solid (16g, 76%). TLC Mobile phase details: 5% MeOH in DCM. 'H NMR (500 MHz, CDCl3): 8 in ppm = 4.10 (m, 4H), 3.53 (t, 2H, JI = 7.6 Hz), 3.24 (s, 3H), 1.66 (d, 2H, Jl=6.9 Hz), 1.28 (t, 22H, JI = 13.4 Hz), 0.88 (t, 3H, JI = 7.2 Hz). MS: m / z calcd for CI8H36C1F6N2P, 315.9; found 316.37 [M+],

[0594] 4. Preparations of 2-azido-l-tetradecyl-3-niethyl-4,5-dihydro-lH-inudazol-3- iumhexafluoro phosphate (V) (WV-DL-86)

[0595] WV-DL-86

[0596] To a stirred solution of (WV-DL-86D) (16 g, 0.0326 mol) in acetonitrile (160 mL, 10 vol) was added sodium azide (3.37 g, 0.049 mol) portion-wise over a period of 20 mins at 0°C and further stirred at rt for 4 h. Progress of the reaction was monitored by TLC. Then reaction mixture was filtered through a celite bed, washed with acetonitrile (2 x 60 mL) and concentrated under reduced pressure to afford a yellowish solid .The solid was washed with diethyl ether (100 ml x 4) and dried under vacuum to furnish an off white solid. (WV-DL-86) (14 g, 86%). TLC Mobile phase details: 100% EtOAc. ’H NMR (500 MHz, CDC13): 8 in ppm = 3.96 (m, 2H), 3.86 (m, 2H), 3.39 (t, 2H, JI = 7.6 Hz), 3.20 (s, 3H), 1.62 (q, 2H, JI = 7.1 Hz), 1.28 (d, 22H), 0.88 (t, 3H, JI = 6.9 Hz) MS: m / z calcd for C18H36F6N5P; 322.5; found: 322.74([M+]).

[0597] Synthesis of WV-DL-90 (n084) Azide

[0598] / . Preparation of l-octadecyl-3-methylinudazolidin-2-one (WV-DL-90B) To a stirred solution of (WV-DL-90A) (10 g, 0.1 mol) in dry THF (300 mL, 30 vol) was added KOH powder (22.4 g, 0.4 mol), K2CO3 (2.76 g, 0.02 mol), followed by TBAB (1.61 g, 0.005 mol) at rt. Then the reaction mixture was further stirred at rt for 30 min. after that was added 1 -bromooctadecane (68.3 mL, 0.2 mol) dropwise over a period of 30 mins at 0°C and stirred at 65°C for 21 h. Progress of the reaction was monitored by TLC. The crude was diluted with ice water (100 mL), extracted with EtOAc (100 mL x 3), washed with water (80 mL x 2), dried over Na2SO4 and concentrated under reduced pressure. The crude compound was purified by column chromatography over silica-gel (230-400 mesh) eluted in 4% MeOH in DCM concentrated under reduced pressure to give WV-DL-90B as a liquid material (22 g, 62%). TLC Mobile phase details: 5% MeOH in DCM.1H NMR (400 MHz, CDC13): 8 in ppm = 3.27 (s, 4H), 3.16 (t, 2H, JI = 7.4 Hz), 2.78 (s, 3H), 1.49 (q, 2H, JI = 7.0 Hz), 1.27 (d, 30H, JI = 14.4 Hz), 0.88 (m, 3H). MS: m / z cal cd for C22H44N2O, 352.6; found 353.71 [M+H] +.

[0599] 2. Preparation of 2-chloro-l-octadecyl-3-methyl-4,5-dihydro-lH-inudazol-3-ium chloride (WV-DL-90C)

[0600] WV-DL-90C

[0601] To a stirred solution of (WV-DL-90B) (10 g, 0.28 mol) in dry toluene (200 mL, 20 vol) was added oxalyl chloride (36.6 mL, 0.43 mol) dropwise over a period for 30 min, at 0°C. Then reaction mixture was further stirred at 60°C for 3days. Progress of the reaction was monitored by TLC. Then reaction mixture was concentrated under reduced pressure. The crude was co-distilled with toluene (100 ml x2). The crude was washed with diethyl ether (100 mL x 2), dried under vacuum to give WV-DL-90C as brown solid (12 g, crude). TLC Mobile phase details: 7% MeOH in DCM. 'HNMR (500 MHz, CDCh): 8 in ppm = 4.31 (dt, 2H, JI = 4.7 Hz), 3.62 (t, 2H, JI = 7.6 Hz), 3.35 (s, 3H), 1.67 (s, 2H) , 1.29 (d, 33H, Jl= 31.0 Hz), 0.88 (t, 3H, JI = 6.9 Hz). MS: m / z calcd for C22H44CI2N2, 406.7; found 372.7 [M- Cl],

[0602] 3. Preparation of 2-chloro-l-octadecyl-3-methyl-4,5-dihydro-lH-inudazol-3-ium hexafluoro p hasp hat e(V) (WV-DL-90D)

[0603] WV-DL-90D

[0604] To a stirred solution of (WV-DL-89Q (12 g, 0.029 mol) in DCM (72 mL, 6 vol) was added a solution of KPFe (5.4 g, 0.029 mol) in water (42 mL, 3.5 vol) drop wise over a period of 30 mins at 0°C. Above reaction mixture was stirred at rt for 4 h. Progress of the reaction was monitored by TLC. To the above reaction mixture added DCM (100 ml) and H2O (50 ml), separate two layers, organic layer washed with water (2 x 100 mL), dried over Na2SO4 and concentrated under reduced pressure. The crude was washed with diethyl ether (100 ml x 3) and dried under vacuum to afforded WV-DL-89D as off white solid (11 g, 79%). TLC Mobile phase details: 5% MeOH in DCM. 'H NMR (500 MHz, CDCL): 8 in ppm = 4.10 (m, 4H), 3.52 (t, 2H, JI = 7.6 Hz), 3.24 (s, 3H), 1.65 (t, 2H, Jl=6.9 Hz), 1.28 (t, 30H, JI = 13.8 Hz), 0.88 (t, 3H, JI = 6.9 Hz). MS: m / z calcd for C22H44CIF6N2P, 372.1; found 372.45 [M+],

[0605] 4. Preparation of 2-azido-l-hexadecyl-3-methyl-4,5-dihydro-lH-inudazol-3- iumhexafluo rophosphate (V) (WV-DL-90)

[0606] To a stirred solution of (WV-DL-89D) (11 g, 0.021 mol) in acetonitrile (110 mL, 10 vol) was added sodium azide (2.1 g, 0.032 mol) portion-wise over a period of 20 mins at 0°C and further stirred at rt for 4 h. Progress of the reaction was monitored by TLC. Then reaction mixture was filtered through a celite bed washed with acetonitrile (2 x 100 mL) and concentrated under reduced pressure to afford a light yellow solid. The solid was washed with diethyl ether (100 ml x 4) and dried under vacuum to give WV-DL-89 as an off white solid (10 g, 89%). TLC Mobile phase details: 100% EtoAc.1H NMR (500 MHz, CDCI3): 8 in ppm = 3.96 (m, 2H), 3.86 (m, 2H), 3.39 (t, 2H, JI = 7.6 Hz), 3.20 (s, 3H), 1.61 (t, 2H, JI = 7.6 Hz), 1.28 (m, 30H), 0.88 (t, 3H, JI = 6.9 Hz), MS: m / z calcd for C22H44F6N5P; 378.6; found 379.05 M+]).

[0607] EXAMPLE 22. Synthesis of WV-NU-347

[0608]

[0609] WV-NU-347

[0610] 2'-Fluoro-5'-PO(POM)2-Triazolyl Phosphonate Uridine (WV-NU-347)

[0611] (((1-(((2R,3 / ?,4RI5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-fluoro-3- hydroxytetrahydrofuran-2-yl)methyl)-1 H-1 ,2,3-triazol-4- yl)phosphoryl)bis(oxy))bis(methylene) bis(2,2-dimethylpropanoate)

[0612] General Scheme:

[0613] WV-NU-347

[0614] 2,-Fluoro-5'-PO(ROM)2-Triazolyl Phosphonate Uridine (WV-NU-347)

[0615] Experimental Procedure: / . Preparation of compound 2C :

[0616] 1C 2C

[0617] For three batches: To a solution of compound 1C (36 g, 249.15 mmol) in THF (400 mL) was added bromo(ethynyl)magnesium (0.5 M, 498.29 mL) under N2. The mixture was stirred at 0- 25 °C for 2 hr. TLC indicated compound 1C was consumed completely and one new spot formed. Each reaction mixture was quenched by addition NH4CI lOOmL at 0 °C, and then diluted with water 300 mL and extracted with EtOAc (100 mL * 3). The combined organic layers were dried over Na2S,O f4iltered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 10: 1 to 0: 1). Compound 2C (28.5 g, 28.44% yield) was obtained as a yellow oil. TLC: Petroleum ether : Ethyl acetate = 0: 1, Rf = 0.35

[0618] 2. Preparation of compound 5 A

[0619] For three batches: To a solution of compound 2C (9.5 g, 70.86 mmol) in ACN (500 mL) was added 4A MS (3 g, 70.86 mmol), iodomethyl 2,2-dimethylpropanoate (68.61 g, 283.43 mmol). The mixture was stirred at 82 °C for 15 hr. TLC indicated Reactant 1 was consumed completely and two new spots formed. The reaction mixture was filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 10: 1 tol : 1). Compound 5A (45 g, 63.32% yield) was obtained as a colorless oil.

[0620] ’H NMR (400 MHz, CHLOROFORM-d) 8 = 5.72 (d, J = 1.2 Hz, 2H), 5.68 (s, 2H), 3.04 (d, J = 14.3 Hz, 1H), 1.22 (s, 18H)

[0621] 31P NMR (162 MHz, CHLOROFORM-d) 8 = -10 36 (s, IP)

[0622] TLC: Petroleum ether : Ethyl acetate = 3:1, Rf = 0.38

[0623] 3. Preparation of compound 2:

[0624] For three batches. To a solution of compound 1 (15 g, 60.93 mmol) in THF (210 mL) was added imidazole (10.78 g, 158.41 mmol), I2 (24.74 g, 97.48 mmol) and PPI13 (25.57 g, 97.48 mmol) at 0 °C. The mixture was stirred at 25 °C for 4 hr. LCMS showed compound 1 was consumed completely and the desired mass was detected. Three batches with together. The reaction was quenched by 10% aqueous sodium thiosulfate solution (100 ml). After removing the solvent and volatiles under reduced pressure, the residue was extracted into EtOAc (50 mL * 5) and washed with saturated aqueous NaHCCL solution. The organic layer was separated, dried over anhydrous Na2,S fOi4ltered and concentrated. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1 to Dichloromethane: Methanol =1 : 0 to 3 : 1). The crude product was purified by re-crystallization from Ethyl acetate (100 mL) and Methanol (10 mL) at 15 °C. Compound 2 (43 g (total three batches), 66.15% yield,) was obtained as a yellow solid.

[0625] ’H NMR (400 MHz, DMSO-d6) 8 = 11.46 (br s, 1H), 7.66 (d, J = 8.0 Hz, 1H), 5.94 - 5.79 (m, 2H), 5.66 (d, J = 8.0 Hz, 1H), 5.33 - 5.13 (m, 1H), 4.10 - 3.98 (m, 1H), 3.77 (dt, J = 3.4, 7.2 Hz, 1H), 3.60 (dd, J = 3.6, 11.0 Hz, 1H), 3.41 (dd, J = 6.8, 11.0 Hz, 1H)

[0626] 19F NMR (376 MHz, DMSO-d6) 5 = - 199.11 (s, IF)

[0627] LCMS (M+H+): 356.9, purity: 95.16%

[0628] TLC: Dichloromethane: Methanol = 10: 1 Rf =0.45

[0629] 4. Preparation of compound 3:

[0630] 2 3

[0631] For two batches. To a solution of compound 2 (10 g, 28.08 mmol) in 1, 2-dimethoxyethane (100 mL) and H2O (20 mL) was added NaNs (1.83 g, 28.08 mmol) at 0 °C under N2. The mixture was stirred at 90 °C for 12 hr. LCMS showed compound 2 was remained and the desired mass was detected. Two batches with together. The reaction was quenched by H2O (50 mL), and extracted with Ethyl acetate (100 mL*3). The combined organic layers were washed with saturated aqueous NaCl 50 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1). The crude product was purified by recrystallization from Ethyl acetate (100 mL) at 20 °C. Compound 3 (28 g, 85.63% yield) was obtained as a white solid.

[0632] 1H NMR (400 MHz, DMSO-d6) 8 = 11.45 (br s, 1H), 7.67 (d, J = 8.0 Hz, 1H), 5.90 - 5.81 (m, 1H), 5.75 (br s, 1H), 5.66 (d, J = 8.0 Hz, 1H), 5.29 - 5.10 (m, 1H), 4.31 - 4.17 (m, 1H), 3.94- 3.93 (m, 1H), 3.79 - 3.48 (m, 2H)

[0633] 19F NMR (376 MHz, DMSO-d6) 8 = -198 74 (s, IF)

[0634] LCMS: (M+H+): 272.0, purity: 92.29%

[0635] TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.45

[0636] 5. Preparation of WV-NU-347: - -

[0637] 2'-Fluoro-5'-(POM)2-Triazolyl Phosphonate Uridine (WV-NU-347)

[0638] For two batches. To a solution of compound 3 (5 g, 18.44 mmol) and compound 5A (7.40 g, 22.12 mmol) in H2O (25 mL) and THF (25 mL) was degassed and purged with N2 for 3 times, CUSO4.5H2O (5.52 g, 22.12 mmol), sodium ascorbate (4.38 g, 22.12 mmol) was added. The mixture was stirred at 65 °C for 3 hr under N2 atmosphere. LCMS showed compound 3 was consumed completely and the desired mass was detected. Two batches with together. The reaction mixture was extracted with Ethyl acetate (30mL*3). The combined organic layers were washed with saturated aqueous NaCl 20 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate=l :O to 0: 1 to Ethyl acetate: Methanol=l :0 to 2: 1). Compound WV-NU-347 (14.5 g, 65.91% yield) was obtained as a yellow solid.

[0639] ’H NMR (400 MHz, DMSO-d6) 8 = 11.42 (d, J = 1.6 Hz, 1H), 8.71 (s, 1H), 7.56 (d, J = 8.2 Hz, 1H), 5.91 (d, J = 6.0 Hz, 1H), 5.87 - 5.78 (m, 1H), 5.69 (d, J = 13.8 Hz, 4H), 5.62 (dd, J = 2.0, 8.1 Hz, 1H), 5.31 - 5.09 (m, 1H), 4.91 - 4.71 (m, 2H), 4.30 - 4.16 (m, 2H), 1.08 (s, 18H)

[0640] 31P NMR (162 MHz, DMSO-d6) 8 = 7.04 (s, IP)

[0641] 19F NMR (376 MHz, DMSO-d6) 8 = -199.16 (s, IF)

[0642] LCMS (M+H+): 606.2, purity: 98.32%

[0643] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.55

[0644] EXAMPLE 23. Synthesis of WV-NU-348

[0645] WV-NU-348

[0646] 2,-OMOE-5,-RO(POM)2-Triazolyl Phosphonate Uridine (WV-NU-348) (((l-(((2R,3R,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-l(2H)-yl)-3-hydroxy-4-(2- methoxy ethoxy )tetrahy drofuran-2 -yl)methyl)- 1H- 1 ,2,3 -triazol-4- yl)phosphoryl)bis(oxy))bis(methylene) bis(2,2-dimethylpropanoate) (WV-NU-348) General Scheme:

[0647] WV-NU-348

[0648] Experimental Procedure:

[0649] / . Preparation of compound 2C :

[0650] 1C 2C

[0651] For four batches: To a solution of compound 1C (36 g, 249.15 mmol, 26.87 mL) in THF (400 mL) was added bromo(ethynyl)magnesium (0.5 M, 498.29 mL) under N2. The mixture was stirred at 0 ~ 25 °C for 2 h. TLC indicated compound 1C was consumed completely and one new spot formed. Four batches with together, the each reaction mixture was quenched by addition NH4CI 100 mL at 0 °C, and then diluted with water 300 mL and extracted with EtOAc (100 mL * 3). The combined organic layers were dried over , filterNa2SO4 concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 10: 1 to 0: 1). Compound 2C (23 g, 17.21% yield) was obtained as a yellow oil

[0652] 'II NMR (400 MHz, CHLOROFORM-d) 8 = 3.82 (s, 3H), 3 80 (s, 3H), 2 96 (d, J = 13.4 Hz, 1H)

[0653] 31P NMR (162 MHz, CHLOROFORM-d) 8 = -5 07 - -5 22 (m, IP) TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.31

[0654] 2. Preparation of compound 5 A :

[0655] For two batches: To a solution of compound 2C (11.5 g, 85.78 mmol) in ACN (500 mL) was added 4A MS (5 g, 85.78 mmol), iodomethyl 2,2-dimethylpropanoate (83.05 g, 343.10 mmol). The mixture was stirred at 82 °C for 15h. TLC indicated compound 2C was consumed completely and two new spots formed. The reaction mixture was filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 10: 1 to 0: 1). Compound 5A (33 g, 57.89% yield) was obtained as a colorless liquid.

[0656] 'll NMR (400 MHz, CHLOROFORM-d) 6 = 5 70 (d, J = 1 5 Hz, 2H), 5 66 (d, J = 0.8

[0657] Hz, 2H), 3.06 (d, J = 14.3 Hz, 1H), 1.20 (s, 18H)

[0658] 31P NMR (162 MHz, CHLOROFORM-d) 6 = -10 31 (s, IP)

[0659] TLC: Petroleum ether: Ethyl acetate = 3: 1, Rf = 0.38

[0660] 3. Preparation of compound 2 :

[0661] Two batches were carried out in parallel: To a solution of compound 2 (17.5 g, 57.89 mmol) in THF (400 mL) was added imidazole (10.25 g, 150.52 mmol), I2 (23.51 g, 92.63 mmol, 18.66 mL) and PPI13 (24.30 g, 92.63 mmol) at 0 °C. The mixture was stirred at 20 °C for 12 h. LCMS showed compound 2 was consumed completely and one main peak with desired mass was detected. Two reactions were combined for work up. The reaction mixture was quenched by addition 10% Na2S20s aq. 100 mL at 25 °C, and then concentrated under reduced pressure to remove THF, diluted with H2O (700 mL) and extracted with EtOAc (500 mL * 2). The combined organic layers were washed with brine (600 mL), dried over , filtereNda2 aSnOd4 concentrated under reduced pressure to give a residue. The crude product was used directly for the next step without purification. Compound 2 (48 g, crude) was obtained as a yellow oil.

[0662] LCMS: (M+H+): 412.9.

[0663] 4. Preparation of compound 3 :

[0664] For two batches: To a solution of compound ! (22 g, 53.38 mmol) in DMF (250 mL) was added NaNs (3.09 g, 47.53 mmol) at 0 °C under N2. The mixture was stirred at 90 °C for 12 h. LCMS showed compound 2 was consumed completely and desired mass was detected. The reaction was quenched by H2O (500 mL), and extracted with Ethyl acetate (500mL * 3). The combined organic dried overNa2SO4 , filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography ( Si O2, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1). Compound 3 (34 g, crude) was obtained as a yellow oil.

[0665] ’H NMR (400 MHz, DMSO-d6) 6 = 11.40 (s, 1H), 7.70(d, J = 8.2 Hz, 1H), 5.82 (d, J = 4.5 Hz, 1H), 5.68 (d, J = 7.8 Hz, 1H), 5.26 (d, J = 5.6 Hz, 1H), 4.10 - 4.02 (m, 2H), 3.92 (q, J = 4.8 Hz, 1H), 3.74 - 3.67 (m, 1H), 3.66 - 3.57 (m, 3H), 3.47 - 3.42 (m, 2H), 3.25 - 3.20 (m, 3H) LCMS: (M+H+): 328.2

[0666] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.34

[0667] 5. Preparation of compound WV-NU-348 :

[0668] 3 WV-NU-348

[0669] 2'-OMOE-5'-PO(POM)2-Triazolyl Phosphonate Uridine (WV-NU-348)

[0670] To a solution of compound 3 (11.5 g, 35.14 mmol) and compound 5A (15.27 g, 45.68 mmol) in THF (50 mL) and H2O (50 mL) was added sodium ascorbate (8.35 g, 42.16 mmol) and CUSO4.5H2O (10.53 g, 42.16 mmol). The mixture was stirred at 65 °C for 6 h. LCMS showed compound 3 was consumed completely and desired mass was detected. The mixture was concentrated, the reaction mixture was extracted with EtOAc (50 mL * 3) and H2O 50 mL. Then the combined organic layers were dried over Na2SO4, filtered and concentrated. The residue was purified by column chromatography ( Si O2, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1). Compound WV-NU-348 (10.7 g, 45.48% yield, 97.77% purity) was obtained as a yellow solid.

[0671] 1HNMR (400 MHz, DMSO-d6) 6 = 11.45 - 11.36 (m, 1H), 8.70 (s, 1H), 7.62 (d, J = 8.2 Hz, 1H), 5.80 (d, J = 4.6 Hz, 1H), 5.70 (s, 2H), 5.68 - 5.64 (m, 3H), 5.40 (d, J = 5.6 Hz, 1H), 4.85 - 4.71 (m, 2H), 4.21 - 4.17 (m, 1H), 4.14 - 4.08 (m, 2H), 3.75 - 3.67 (m, 1H), 3.67 - 3.59 (m, 1H), 3.46 (t, J = 4.8 Hz, 2H), 3.22 - 3.22 (m, 1H), 3.22 (s, 2H), 1.08 (s, 18H)

[0672] 31PNMR (162 MHz, DMSO-d6) 6 = 7 08 (s, IP)

[0673] LCMS: (M+H+): 662.2, LCMS purity: 97.77%

[0674] TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.32

[0675] EXAMPLE 24. Synthesis of WV-NU-349

[0676] WV-NU-349

[0677] 2,-LNA-5,-PO(ROM)2-Triazolyl Phosphonate Uridine (WV-NU-349)

[0678] (((l-(((lS,3R,4R,7S)-3-(2,4-dioxo-3,4-dihydropyrimidin-l(2H)-yl)-7-hydroxy-2,5- dioxabicyclo[2.2.1]heptan-l-yl)methyl)-lH-l,2,3-triazol-4- yl)phosphoryl)bis(oxy))bis(methylene) bis(2,2-dimethylpropanoate) (WV-NU-349)

[0679] General Scheme: WV-NU-349

[0680] Experimental Procedure:

[0681] / . Preparation of compound 2C:

[0682] 1C 2C

[0683] To a solution of compound 1C (36 g, 249.15 mmol) in THF (400 mL) was added bromo (ethynyl) magnesium (0.5 M, 498.29 mL) under N2. The mixture was stirred at 0 - 25 °C for 2 hr. TLC indicated compound 1C was consumed completely and one new spot formed. The each reaction mixture was quenched by addition NH4CI lOOmL at 0 °C. And then diluted with water 300 mL and extracted with EtOAc (100 mL * 3). The combined organic layers were dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 10: 1 to 0: 1). Compound 2C (23 g, 17.21% yield) was obtained as a yellow oil

[0684] ’H NMR (400 MHz, CHLOROFORM-d) 8 = 3.82 (s, 3H), 3.79 (s, 3H), 2.97 (d, J =13.4 Hz, 1H)

[0685] 31P NMR (162 MHz, CHLOROFORM-d) 8 = -5 07 - -5.22 (m, IP)

[0686] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.31 2. Preparation of compound 5 A:

[0687] For two batches: To a solution of compound 2C (11.5 g, 85.78 mmol) in ACN (500 mL) was added 4A MS (5 g, 85.78 mmol), iodomethyl 2,2-dimethylpropanoate (83.05 g, 343.10 mmol). The mixture was stirred at 82 °C for 15 hr. TLC indicated compound 2C was consumed completely and two new spots formed. The reaction mixture was filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 10: 1 to 0: 1). Compound 5A (33 g, 57.89% yield) was obtained as a colorless.

[0688] ’H NMR (400 MHz, CHLOROFORM-d) 8 = 5.70 (d, J = 1.5 Hz, 2H), 5.66 (d, J = 0.8Hz, 2H), 3.06 (d, J = 14.3 Hz, 1H), 1.20 (s, 18H)

[0689] 31P NMR (162 MHz, CHLOROFORM-d) 8 = -10 31 (s, IP)

[0690] TLC: Petroleum ether: Ethyl acetate = 3: 1, Rf = 0.38

[0691] 3. Preparation of compound 2:

[0692] For two batches: to a solution of compound 1 (50 g, 161.11 mmol) in DCM (800 mL) was added pyridine (82.84 g, 1.05 mol) and the mixture was cooled to 0 °C, then MsCl (46.18 g, 403.14 mmol) was slowly added the mixture. The mixture was stirred at 0 - 20 °C for 12 hr. LCMS showed compound 1 was consumed completely and desired mass was detected. The mixture was cooled to 0 °C, the mixture of 100 mL ice water and aqueous NaHCCL 100 mL was dropped to the mixture under N2, and stirred for 5 min. Then two batches with together, the organic layer was separated and washed with saturated aqueous NaHCCL (300 ml *2) and with water. The combined organic phases were dried over MgSCh and the solvent was removed under reduced pressure. The crude product was used into the next step without further purification. Compound 2 (150 g, crude) was obtained as a yellow oil.

[0693] ’H NMR (400 MHz, CHLOROFORM-d) 8 = 7.41 - 7.35 (m, 5H), 5.79 (d, I = 3.8 Hz, 1H), 4.88 (d, 1 = 12.0 Hz, 1H), 4.77 (d, I = 11.6 Hz, 1H), 4.68 - 4.63 (m, 1H), 4.57 (d, I = 11.6 Hz, 1H), 4.41 (d, I = 12.0 Hz, 1H), 4.32 (d, I = 11.0 Hz, 1H), 4.22 - 4.12 (m, 2H), 3.08 (s, 3H), 2.98 (s, 3H), 1.68 (s, 3H), 1.34 (s, 3H)

[0694] LCMS (M+Na+): 489

[0695] 4. Preparation of compound 3:

[0696] For three batches: to a solution of compound 2 (50 g, 107.18 mmol) was added TFA (250 mL) and H2O (62.5 mL). The mixture was stirred at 20 °C for 12 hr. LCMS showed compound 2 was consumed completely and desired mass was detected. Three batches with together. The reaction mixture was concentrated under reduced pressure to remove TFA. The residue was diluted with NaHCO3 (500 mL) and extracted with DCM (300 mL * 2). The combined organic layers were washed with brine 500 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The crude product was used into the next step without further purification. Compound 3 (137 g, crude) was obtained as a yellow oil.

[0697] ’H NMR (400 MHz, CHLOROFORM-d) 8 = 8.64 (br d, J = 4.6 Hz, 1H), 7.48 - 7.45 (m, 1H), 7.41 - 7.30 (m, 5H), 5.39 - 5.34 (m, 1H), 4.66 - 4.59 (m, 2H), 4.35 -4.33 (m, 1H), 4.31 - 4.20 (m, 1H), 4.19 - 4.14 (m, 1H), 4.11 (d, J = 5.0 Hz, 1H), 3.05 - 2.97 (m, 6H)

[0698] LCMS (M+Na+): 449.1

[0699] 5. Preparation of compound 4:

[0700] For two batches: to a solution of compound 3 (65 g, 152.42 mmol) in PYRIDINE (600 mL) was added AC2O (57.57 g, 563.95 mmol). The mixture was stirred at 20 °C for 12 hr. LCMS showed compound 3 was consumed completely and desired mass was detected. Two batches with together. The reaction mixture was diluted with NaHCCh (1000 mL) and extracted with EtOAc (500 mL *2). The combined organic layers were washed with brine 800 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 0: 1 to 1 : 1). Compound 4 (155 g, crude) was obtained as a yellow oil.

[0701] ’H NMR (400 MHz, CHLOROFORM-d) 8 = 7.42 - 7.33 (m, 5H), 6.18 (s, 1H), 5.38 (d, J = 4.8 Hz, 1H), 4.65 - 4.60 (m, 1H), 4.55 - 4.48 (m, 2H), 4.43 (d, J = 4.8 Hz, 1H), 4.31 - 4.28 (m, 1H), 4.23 - 4.17 (m, 2H), 3.02 (d, J = 2.0 Hz, 6H), 2.16 (s, 3H), 2.11 (s, 3H)

[0702] LCMS (M+Na+):533.1

[0703] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.5

[0704] 6. Preparation of compound 5:

[0705] For three batches: to a solution of compound 4 (50 g, 97.94 mmol) and uracil (21.95 g, 195.87 mmol) in ACN (700 mL) was added BSA (69.73 g, 342.78 mmol) at 80 °C for 1 hr. Then TMSOTf (54.42 g, 244.84 mmol) was added to the mixture. The mixture was stirred at 60 °C for 12 hr. LCMS showed compound 4 was consumed completely and desired mass was detected. The reaction mixture was cooled to 0 °C, and added to NaHCOs (800 mL). Three batches with together. The residue was extracted with EtOAc (500 mL * 3). The combined organic layers were washed with brine 500 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 5 (78 g, 47.27% yield) and 78 g (crude) was obtained as a white solid.

[0706] ’H NMR (400 MHz, DMSO-d6) 8 = 1 1.46 (br s, 1H), 7.71 (d, J = 8.0 Hz, 1H), 7.39 - 7.29 (m, 5H), 5.98 (d, J = 4.6 Hz, 1H), 5.68 (d, J = 8.0 Hz, 1H), 5.55 - 5.50 (m, 1H), 4.65 - 4.53 (m, 3H), 4.45 - 4.37 (m, 3H), 4.36 - 4.30 (m, 1H), 3.26 (s, 3H), 3.19 (s, 3H), 2.05 (s, 3H) LCMS (M+Na+): 585.1, purity: 92.5%

[0707] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.5 7. Preparation of compound 6:

[0708] For two batches: To a solution of compound 5 (41.5 g, 73.77 mmol) in dioxane (100 mL) and H2O (100 mL) was added NaOH (2 M, 221.31 mL). The mixture was stirred at 20 °C for 12 hr. LCMS showed compound 5 was consumed completely and one main peak with desired mass was detected. Two batches with together. The reaction mixture was washed with 10% AcOH (300 mL). The residue was diluted with H2O (500 mL) and extracted with DCM (300 mL * 3). The combined organic layers were washed with NaHCCL (200 mL) and brine (200 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The crude product was triturated with EtOAc at 20 °C for 5 min. The mixture was filtered and the cake was concentrated under reduced pressure to give product. Compound 6 (50 g, 79.85% yield) was obtained as a white solid.

[0709] ’H NMR (400 MHz, DMSO-d6) 8 = 11.42 (br s, 1H), 7.62 (d, J = 8.0 Hz, 1H), 7.37 - 7.25 (m, 5H), 5.60 (d, J = 8.0 Hz, 1H), 5.56 (s, 1H), 4.83 (d, J = 12.0 Hz, 1H), 4.63 (d, J = 3.0 Hz, 2H), 4.61 - 4.56 (m, 2H), 4.03 - 3.97 (m, 2H), 3.84 (d, J = 8.0 Hz, 1H), 3.27 (s, 3H) LCMS (M+H+): 425.0, purity: 92.4%

[0710] TLC: Petroleum ether: Ethyl acetate = 0: 1 Rf = 0.4

[0711] 8. Preparation of compound 7:

[0712] To a solution of compound 6 (20 g, 47.12 mmol) in DMF (200 mL) was added NaNs (3.17 g, 48.76 mmol). The mixture was stirred at 60 °C for 12 hr. LCMS showed compound 6 was consumed completely and desired mass was detected. The reaction was quenched by H2O (100 mL), and extracted with Ethyl acetate (200 mL*3). The combined organic was dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The crude product was triturated with Petroleum ether: Ethyl acetate = 10: 1, at 20 °C for 5 min. Then the mixture was filtered, the cake was washed with Petroleum ether, concentrated under reduced pressure to give product. Compound 7 (15.5 g, 88.58% yield) was obtained as a white solid.

[0713] ’H NMR (400 MHz, DMSO-d6) 8 = 11.42 (s, 1H), 7.60 (d, J = 8.2 Hz, 1H), 7.37 - 7.27 (m, 5H), 5.65 (d, J = 8.2 Hz, 1H), 5.54 (s, 1H), 4.66 - 4.57 (m, 2H), 4.54 (s, 1H), 4.01 (d, J = 14.0 Hz, 1H), 3.94 - 3.89 (m, 2H), 3.87 - 3.77 (m, 2H)

[0714] LCMS (M+H+): 372.0

[0715] 9. Preparation of compound 8:

[0716] To a solution of compound 7 (10 g, 26.93 mmol) and compound 5A (10.80 g, 32.31 mmol) in THF (100 mL) and H2O (100 mL) was added copper; sulfate; pentahydrate (8.07 g, 32.31 mmol) and sodium; (2R)-2-[(lS)-l,2-dihydroxyethyl]-4-hydroxy-5-oxo-2H-furan-3-olate (6.40 g, 32.31 mmol). The mixture was stirred at 65 °C for 6 hr. TLC indicated compound 7 was consumed completely and one new spot formed. The reaction mixture was concentrated under reduced pressure to remove THF. The residue was diluted with H2O (50 mL) and extracted with EtOAc (100 mL * 2). The combined organic layers were dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 8 (18 g, 94.72% yield) was obtained as a white solid.

[0717] 1H NMR (400 MHz, DMSO-d6) 5 =11.39 (s, 1H), 8.78 (s, 1H), 7.36 (d, J = 4.2 Hz, 4H), 7.33 - 7.26 (m, 2H), 5.73 (s, 2H), 5.69 (s, 2H), 5.52 (br d, J = 8.0 Hz, 1H), 5.47 (s, 1H), 5.28 (br d, J = 15.0 Hz, 1H), 5.02 (br d, J = 15.0 Hz, 1H), 4.66 (s, 2H), 4.57 (s, 1H), 4.11 (d, J = 8.0 Hz, 1H), 3.58 (br d, J = 8.2 Hz, 2H), 1.10 (s, 18H)

[0718] 31P NMR (162 MHz, DMSO-d6) 8 = 6.73 (s, IP)

[0719] LCMS (M+H+): 706.3, purity: 94.7% TLC: Petroleum ether: Ethyl acetate = 0:1, Rf = 0.3

[0720] / 0. Preparation of WV-NU-349:

[0721] 2'-LNA-5'-PO(POM)2-Triazolyl Phosphonate Uridine (WV-NU-349)

[0722] For two batches: to a solution of compound 8 (9 g, 12.75 mmol) in AcOH (100 mL) was added Pd / C (1.36 g, 1.28 mmol, 10% purity). The mixture was stirred at 30 °C for 12 hr under H2 (15 Psi). LCMS showed compound 8 was consumed completely and desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1, Ethyl acetate: Methanol = 1 :0 to 10: 1). Compound WV-NU-349 (7.49 g, 49.93% yield) was obtained as a white solid.

[0723] 1H NMR (400 MHz, DMSO-d6) 8 = 11.38 (s, 1H), 8.78 (s, 1H), 7.29 (d, J = 8.0 Hz, 1H), 6.11 (br d, J = 4.0 Hz, 1H), 5.72 (br d, J = 13.8 Hz, 3H), 5.51 (d, J = 8.0 Hz, 1H), 5.39 (s, 1H), 5.22 (d, J = 15.0 Hz, 1H), 4.96 (d, J = 15.0 Hz, 1H), 4.25 (s, 1H), 4.07 (d, J = 8.0 Hz, 1H), 3.86 (d, J = 3.6 Hz, 1H), 3.50 (d, J = 8.0 Hz, 1H), 1.11 (s, 18H)

[0724] 31P NMR (162 MHz, DMSO-ck) 8 = 6.75 (s, IP)

[0725] LCMS (M-H+): 616.2, purity: 98.88%

[0726] TLC: Ethyl acetate: Methanol = 10: 1, Rf = 0.3

[0727] EXAMPLE 25. Synthesis of WV-NU-350

[0728]

[0729] WV-NU-350

[0730] 2,-OMe-5,-PS(OEt)2-Triazolyl Thiophosphonate Uridine (WV-NU-350)

[0731] 0,0-di ethyl (l-(((2R,3R,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-l(2H)-yl)-3-hydroxy-4- methoxytetrahydrofuran-2-yl)methyl)-lH-l,2,3-triazol-4-yl)phosphonothioate (WV-NU-

[0732] 350).

[0733] General Scheme:

[0734] WV-NU-350

[0735] Experimental Procedure:

[0736] / . Preparation of compound 2 A :

[0737] For three batches. To a solution of compound 1A (9.3 g, 59.41 mmol) in THF (100 mL) was added bromo (ethynyl) magnesium (0.5 M, 120.00 mL) at 0 °C under N2. The resulting mixture was stirred at 0-15 °C for 2 hr. TLC indicated compound 1A was consumed completely and two new spots formed. The reaction was clean according to TLC. Three batches with together. The mixture was quenched by addition sat. NH4CI (aq. 150 mL) at 0 °C, then diluted with H2O (100 mL) and extracted with DCM (200 mL*3). The combined organic layers were dried over Na2SO4, filtered to get the crude. Without purification. Compound 2A (26 g, crude) was obtained as a brown oil.

[0738] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.95

[0739] 2. Preparation of compound 3 A :

[0740] For two batches. To a solution of compound 2A (13 g, 88.97 mmol) in DCM (150 mL) was added S (5.40 g, 168.41 mmol). The mixture was stirred at 15 °C for 2 hr. TLC indicated compound 2A was consumed completely and one new spot formed. The reaction was clean according to TLC. Two batches with together. The reaction mixture was cooled to 0 °C and quenched by addition H2O 80 mL, and then diluted with H2O 50 mL and extracted with DCM 150 mL (50 mL * 3). The combined organic layers were dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1). Compound 3A (14 g, 44.16% yield) was obtained as a yellow oil.

[0741] ’H NMR (400 MHz, CHLOROFORM-d) 8 = 4.16 (qd, J = 7.2, 10.3 Hz, 4H), 3.12 (d, J = 12.4 Hz, 1H), 1.34 (t, J = 7.2 Hz, 6H)

[0742] 31P NMR (162 MHz, CHLOROFORM-d) 8 = 51.30 (s, IP)

[0743] LCMS (M+H+): 179.1

[0744] TLC: Petroleum ether: Ethyl acetate = 5: 1, Rf = 0.7

[0745] 3. Preparation of compound 2:

[0746] For five batches. To a solution of compound 1 (30 g, 116.18 mmol) in THF (420 mL) was added imidazole (20.56 g, 302.06 mmol), b (47.18 g, 185.88 mmol) and PPF13 (48.75 g, 185.88 mmol) at 0 °C. The mixture was stirred at 25 °C for 6 hr. TLC indicated compound 1 was consumed completely and two new spots formed. The reaction was clean according to TLC. Five batches with together. The reaction was quenched by 10% aqueous sodium thiosulfate solution (800 ml). After removing the solvent and volatiles under reduced pressure, the residue was extracted into Dichloromethane (200 mL * 3) and washed with saturated aqueous NaHCCL solution. The organic layer was separated, dried over anhydrous Na2SO4 , filtered and concentrated. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1 to Dichloromethane: Methanol = 1 : 0 to 3: 1). The crude product was purified by re-crystallization from Ethyl acetate (100 mL), Dichloromethane (300 mL) and Methanol (50 mL) at 15 °C. Compound 2 (200 g, 93.55% yield) was obtained as a purple solid. ’H NMR (400 MHz, DMSO-d6) 8 = 11.43 (s, 1H), 7.68 (d, J = 8.2 Hz, 1H), 5.87 (d, J = 5.6 Hz, 1H), 5.70-5.68 (m, 1H), 5.46 (d, J = 6.0 Hz, 1H), 4.05-4.01 (m, 1H), 4.00-3.95 (m, 1H), 3.88-3.82 (m, 1H), 3.54-3.53 (m, 1H), 3.42-3.40 (m, 1H), 3.34 (s, 3H)

[0747] LCMS (M+H+): 369.0

[0748] TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.45

[0749] 4. Preparation of compound 3:

[0750] 2 3

[0751] For five batches. To a solution of compound 2 (24 g, 65.20 mmol) in 1, 2-dimethoxy ethane (300 mL) and H2O (60 mL) was added NaNs (3.66 g, 56.30 mmol) at 0 °C under N2. The mixture was stirred at 90 °C for 12 hr. LCMS showed compound 2 was remained and the desired mass was detected. Five batches with together. The reaction was quenched by H2O (500 mL), and extracted with Ethyl acetate (400 mL*3). The combined organic layers were washed with saturated aqueous NaCl 300 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1). The crude product was triturated with Ethyl acetate (50 mL) at 15 °C for 10 min. Compound 3 (49 g, 85.51% yield) was obtained as a white solid.

[0752] ’H NMR (400 MHz, DMSO-d6) 8 = 11.48 - 10.91 (m, 1H), 7.70 (d, J = 8.2 Hz, 1H), 5.83 (d, J = 4.8 Hz, 1H), 5.68 (d, J = 8.0 Hz, 1H), 5.36 (br d, J = 5.8 Hz, 1H), 4.07 (q, J = 5.2 Hz, 1H), 3.95 - 3.89 (m, 2H), 3.61 (d, J = 4.8 Hz, 2H), 3.36 (s, 3H) LCMS: (M+H+): 284.0, purity: 90.16%

[0753] TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.45

[0754] 5. Preparation of WV-NU-350:

[0755] 3 WV-NU-350

[0756] 2'-OMe-5,-PS(OEt)2-Triazolyl Thiophosphonate Uridine (WV-NU-350)

[0757] To a solution of compound 3 (8 g, 28.24 mmol) and compound 3A (5.54 g, 31.07 mmo) in THF (80 mL) was degassed and purged with N2 for 3 times, then DIEA (7.30 g, 56.49 mmol), Cui (10.76 g, 56.49 mmol) was added. The mixture was stirred at 20 °C for 4 hr under N2 atmosphere. LCMS showed compound 3 was remianed and the desired mass was detected. The reaction mixture was concentrated under reduced pressure to give product. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1). Compound WV-NU-350 (10 g, 76.92% yield) was obtained as a yellow solid.

[0758] Hl NMR (400 MHz, DMSO-d6) 8 = 11.41 (d, J = 1.6 Hz, 1H), 8.58 (s, 1H), 7.53 (d, J = 8.2 Hz, 1H), 5.80 (d, J = 4.8 Hz, 1H), 5.64 - 5.62 (m, 1H), 5.49 (d, J = 6.2 Hz, 1H), 4.84 - 4.78 (m, 1H), 4.77 - 4.69 (m, 1H), 4.21 (td, J = 4.8, 7.8 Hz, 1H), 4.17 - 4.07 (m, 5H), 3.91 (t, J = 5.2 Hz,

[0759] 1H), 3.36 (s, 3H), 1.24 (t, J = 7.0 Hz, 6H)

[0760] 31P NMR (162 MHz, DMSO-d6) 8 = 69.85 (s, IP)

[0761] LCMS (M+H+): 462.1, purity: 98.75% TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.25

[0762] EXAMPLE 26. Synthesis of WV-NU-352

[0763] WV-NU-352

[0764] 2,-OMe-5'-PO(OEt)2-Triazolyl methyl phosphonate Uridine (WV-NU-352) diethyl ((4-((2R,3R,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-l(2H)-yl)-3-hydroxy-4- methoxytetrahydrofuran-2-yl)-lH-l,2,3-triazol-l-yl)methyl)phosphonate (WV-NU-352)

[0765] General Scheme:

[0766] Experimental Procedure:

[0767] 1. Preparation of compound 2:

[0768] For two batches: To a solution of compound 1 (50 g, 193.63 mmol) in DMF (1000 mL) was added imidazole (52.73 g, 774.51 mmol) and TBSCI (87.55 g, 580.88 mmol). The mixture was stirred at 20 °C for 12 hr. TLC indicated compound 1 was consumed completely and one new spot formed. The reaction mixture was concentrated under reduced pressure to remove DMF. The residue was diluted with H2O 1500 mL and extracted with EtOAc 500 mL*3. The combined organic layers were washed with brine 1500 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. Compound 2 (188 g, crude) was obtained as a colorless oil.

[0769] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.7

[0770] 2. Preparation of compound 3:

[0771] For four batches: To a solution of compound 2 (94 g, 193.12 mmol) in THF (1000 mL) at 0 °C under N2, and then added mixture of TFA (383.75 g, 3.37 mol) and H2O (250.00 g, 13.88 mol) slowly. The mixture was stirred at 0 °C for 3 hr. TLC indicated compound 2 was consumed completely and one new spot formed. The reaction mixture was quenched with NH3.H2O (230 mL *4) at 0 °C. Four batches with together. The residue was diluted with H2O 500 mL and extracted with DCM (1000 mL * 3). The combined organic layers were washed with brine 1000 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography ( Si O2, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 3 (230 g, 79.93% yield) was obtained as a white solid.

[0772] ’H NMR (400 MHz, DMSO-d6) 5 = 11.36 (s, 1H), 7.92 (d, J = 8.0 Hz, 1H), 5.83 (d, J = 5.0 Hz, 1H), 5.66 (d, J = 8.0 Hz, 1H), 5.21 (t, J = 5.0 Hz, 1H), 4.30 (t, J = 4.8 Hz, 1H), 3.87 - 3.81 (m, 2H), 3.70 - 3.61 (m, 1H), 3.55 - 3.51 (m, 1H), 3.34 (s, 3H), 0.88 (s, 9H), 0.09 (s, 6H) LCMS (M+H+): 373.1, purity: 100%

[0773] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.6

[0774] 3. Preparation of compound 4:

[0775] 3 4

[0776] To a solution of compound 3 (25 g, 67.12 mmol) in DCM (500 mL) was added DMP (28.47 g, 67.12 mmol). The mixture was stirred at 0-25 °C for 3 hr. TLC indicated compound 3 was consumed completely and one new spot formed. The reaction mixture of three batches were diluted with NaHCCh 500 mL and extracted with DCM 500 mL*3. The combined organic layers were washed with Sat. NaCl 100 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to get crude product. The crude product was used into the next step without further purification. Compound 4 (24 g, crude) was obtained as a white solid.

[0777] Hl NMR (400 MHz, DMSO-d6) 8 = 11.59 - 11.25 (m, 1H), 7.92 - 7.89 (m, 1H), 5.94 (d, J = 7.7 Hz, 1H), 5.73 - 5.68 (m, 1H), 4.90 (d, J = 3.0 Hz, 1H), 4.46 (d, J = 4.6 Hz, 1H), 3.87 - 3.85 (m, 1H), 3.72 (d, J = 2.6 Hz, 1H), 3.61 - 3.58 (m, 3H), 0.90 - 0.88 (m, 9H), 0.10 (s, 6H) TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.45

[0778] 4. Preparation of compound 5:

[0779] For two batches: to a solution of compound 4 (22 g, 59.38 mmol) and 1-diazo-l- dimethoxyphosphoryl-propan-2-one (11.41 g, 59.38 mmol) in MeOH (400 mL) was added K2CO3 (16.41 g, 118.77 mmol) at 0 °C under N2. The mixture was stirred at 0-20 °C for 12 hr. LCMS showed compound 4 was consumed completely and one main peak with desired mass was detected. Two batches with together. The reaction mixture was concentrated under reduced pressure to remove MeOH. The residue was diluted with H2O 300 mL and extracted with DCM 200 mL * 3. The combined organic layers were dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 5 (25 g, 57.44% yield) was obtained as a white solid.

[0780] ’H NMR (400 MHz, DMSO-d6) 8 = 11.43 (s, 1H), 7.58 (d, J = 8.2 Hz, 1H), 5.82 (d, J = 4.4 Hz, 1H), 5.75 (d, J = 8.0 Hz, 1H), 4.49 - 4.46 (m, 1H), 4.44 (d, J = 4.6 Hz, 1H), 4.04 - 4.01 (m, 1H), 3.87 (d, J = 1.4 Hz, 1H), 3.36 (s, 3H), 0.89 (s, 9H), 0.13 (d, J = 3.2 Hz, 6H) LCMS (M-H+):367.1; purity: 95.3%

[0781] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.4

[0782] 5. Preparation of compound 2 A:

[0783] To a solution of compound 1A (30 g, 107.90 mmol) in DMF (300 mL) was added NaNs (7.27 g, 111.83 mmol. The mixture was stirred at 90 °C for 12hr. TLC indicated compound 1A was consumed completely and one new spot formed. The reaction was cooled to 0 °C, and quenched by H2O (300 mL), and extracted with Ethyl acetate (200 mL*3). The combined organic dried over Na2S,O f4iltered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 2A (12 g, 57.58% yield) was obtained as a colorless oil. ’H NMR (400 MHz, DMSO-d6) 8 = 4.25 - 4.14 (m, 4H), 3.46 (d, J = 11.8 Hz, 1H), 3.03 (d, J

[0784] = 10.4 Hz, 1H), 1.39 - 1.32 (m, 6H)

[0785] LCMS (M-H+): 194.1

[0786] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.25

[0787] 6. Preparation of compound 6 :

[0788] To a solution of compound 5 (10 g, 27.29 mmol) and compound 2A (6.85 g, 35.47 mmol) in THF (50 mL) and H2O (50 mL) was added copper; sulfate; pentahydrate (8.18 g, 32.74 mmol) and sodium; (2R)-2-[(lS)-l,2-dihydroxyethyl]-4-hydroxy-5-oxo-2H-furan-3-olate (6.49 g, 32.74 mmol). The mixture was stirred at 65 °C for 6 hr. TLC indicated compound 5 was consumed completely and one new spot formed. The reaction mixture was concentrated under reduced pressure to remove THF. The residue was diluted with H2O 100 mL and extracted with EtOAc (100 mL * 2). The combined organic layers were washed with brine 100 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 6 (9.7 g, 63.52% yield) was obtained as a white solid.

[0789] ’H NMR (400 MHz, DMSO-d6) 8 = 1 1.42 (s, 1H), 8.21 (s, 1H), 7.95 (d, J = 8.0 Hz, 1H), 5.90 (d, J = 3.4 Hz, 1H), 5.72 - 5.69 (m, 1H), 5.12 (br d, J = 13.0 Hz, 2H), 5.01 (d, J = 6.0 Hz, 1H), 4.60 - 4.54 (m, 1H), 4.12 - 4.03 (m, 5H), 3.43 (s, 3H), 1.24 - 1.18 (m, 6H), 0.80 (s, 9H), 0.00 (s, 3H), -0.11 (s, 3H)

[0790] 31P NMR (162 MHz, DMSO-d6) 8 = 17.19 (s, IP)

[0791] LCMS (M-H+):560.3; purity: 96.99%

[0792] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.3

[0793] 7. Preparation of compound WV-NU-352:

[0794] WV-NU-352

[0795] 2'-OMe-5'-PO(OEt)2-Triazolyl methyl phosphonate Uridine (WV-NU-352)

[0796] To a solution of compound 6 (9 g, 16.08 mmol) in THF (95 mL) was added N,N- diethylethanamine; trihydrofluoride (10.37 g, 64.33 mmol). The mixture was stirred at 40 °C for 12 hr. TLC indicated compound 6 was consumed completely and one new spot formed. The reaction mixture was concentrated under reduced pressure to remove THF. The residue was purified by column chromatography (SiCE, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1, Ethyl acetate: Methanol = 1 :0 to 5: 1). Compound WV-NU-352 (4.3 g, 60.04% yield) was obtained as a white solid.

[0797] ’H NMR (400 MHz, DMSO-d6) 8 = 11.41 (br s, 1H), 8.18 (s, 1H), 7.89 - 7.87 (m, 1H), 5.96 (d, J = 3.8 Hz, 1H), 5.69 (d, J = 8.0 Hz, 1H), 5.54 -5.52 (m, 1H), 5.11 (br d, J = 13.0 Hz, 2H), 5.01 (d, J = 4.6 Hz, 1H), 4.40 (q, J = 5.0 Hz, 1H), 4.12 - 4.01 (m, 5H), 3.42 (d, J = 1.0 Hz, 3H), 1.21 (t, J = 7.0 Hz, 6H)

[0798] 31P NMR (162 MHz, DMSO-d6) 8 = 17.28 (s, IP)

[0799] LCMS (M-H+): 446.1; purity: 96.79%

[0800] TLC: Ethyl acetate: Methanol = 8: 1, Rf = 0.25

[0801] EXAMPLE 28. Synthesis of WV-NU-362

[0802] WV-NU-362

[0803] 2'-OMe-5'-(3-PO(OEt)2-pyrrolidinyl) phosphonate Uridine (WV-NU-362) diethyl (1-(((2R,3R,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-1 (2 / 7)-yl)-3-hydroxy-4- methoxytetrahydrofuran-2-yl)methyl)pyrrolidin-3-yl)phosphonate (WV-NU-362) General Scheme:

[0804] WV-NU-362 Preparation of diethyl (l-benzylpyrrolidin-3-yl)phosphonate (WV-NU-362-A) :

[0805] To a stirred solution of N-benzyl-l-methoxy-N-((trimethylsilyl)methyl) methenamine (12 g, 0.05063 mol) and diethyl vinylphosphonate (8.3 g, 0.05063) in dry ACN (120 mL, 10 vol), was added TFA (3.9 mL, 0.0563 mol) dropwise over a period for 10 min at 0°C. The resulting mixture was stirred at rt for 6 h. Progress of the reaction was monitored by TLC. Then reaction mixture was concentrated under reduced pressure. The crude compound was purified by column chromatography over silica-gel (230- 400 mesh) eluted in 40% acetone in hexane to get a yellow oil (WV-NU-362-A) (6 g, 40%), TLC Mobile phase details: 50% Acetone in Hexane. 'H NMR (400 MHz, CDCL): 8 in ppm = 7.30 (m, 4H), 7.25 (m, lH), 4.10 (m, 4H), 3.63 (s, 2H), 2.98 (m, 1H), 2.83 (m, 1H), 2.49 (m, 3H), 2.11 (m, 2H), 1.31 (t, 6H, JI = 7.1 Hz). MS: m / z calcd for C15H24NO3P, 297.3; found 298.52, [M+H]+.

[0806] Preparation of diethyl pyrrolidin-3-ylphosphonate (WV-NU-362-B):

[0807] WV-NU-362-B

[0808] To a stirred solution of (WV-NU-362-A) (6 g, 0.02289 mol) in dry MeOH (120 mL, 20 vol) was added Ammonium formate (2.16 g, 0.03434 mol) and Pd / C (1.8 g, 30 mol %) portion wise at rt. The resulting mixture was stirred 40°C and kept for 1.5 h. Progress of the reaction was monitored by TLC. After completion as monitored by TLC, the reaction mixture was filtered through celite bed, washed with MeOH (2 x 50 mL) and concentrated under reduced pressure to afford light yellow oil (WV-NU-362-B) (3.2 g, crude), TLC Mobile phase details: 10% MeOH in DCM.1H NMR (400 MHz, CDC13): 8 in ppm = 4.12 (m, 4H), 3.44 (s, 2H), 3.13 (m, 2H), 2.91 (m, 1H), 2.36 (m, 1H), 2.01 (m, 2H), 1.33 (t, 6H, JI = 7.1 Hz. MS: m / z calcd for C8HI8NO3P, 207.2; found 208.24 [M-H]+.

[0809] Preparation of (2S,3S,4R,5R)-3-((tert-butyldimethylsilyl)oxy)-5-(2,4-dioxo-3,4-dihydro pyrinudin-l(2H)-yl)-4-methoxytetrahydrofuran-2-carbaldehyde (WV-NU-362-02):

[0810] WV-NU-362-02

[0811] To a stirred solution of (WV-NU-362-01) (5 g, 0.0134 mol) in dry DCM (125 mL, 25 vol) was added Dess-Martin Periodinane (7.4 g, 0.0174 mol) portion wise over a period of 20 min at 0°C. The reaction mixture was allowed to stirr at rt for 2.5 h. Progress of the reaction was monitored by TLC. After completion, the reaction was quenched with a solution (1 : 1 ratio of Na2S2O3: NaHCO3(80 mL), extracted with DCM (2 x 60 mL), dried over Na2SO4 and concentrated under reduced pressure to afford off white solid (WV-NU-362-02) (4.6 g, crude), TLC Mobile phase details: 70% EtOAc in Hexane. 'H NMR (500 MHz, CDC13): 8 in ppm = 9.78 (s, 1H), 8.58 (s, 1H), 7.63 (d, 1H, JI = 7.6 Hz), 5.80 (t, 2H, JI = 5.9 Hz), 4.54 (d, 1H, JI = 4.1 Hz), 4.43 (t, 1H, JI = 4.1 Hz), 3.93 (t, 1H, JI = 4.8 Hz), 3.46 (m, 4H), 0.92 (m, 9H), 0.12 (m, 8H). MS: m / z calcd for Ci6H26N2O6Si, 370.05; found 371.32. [M-H]+.

[0812] Preparation of diethyl (l-(((2R,3R,4R,5R)-3-((tert-butyldimethylsilyl)oxy)-5-(2,4-dioxo-3,4- dihydropyrinudin-l(2H)-yl)-4-methoxytetrahydrofuran-2- yl)methyl)pyrrolidin3yl)phosphonate (WV-NU-362-03):

[0813] WV-NU-362-03

[0814] To a stirred solution of (WV-NU-362-B) (9 g, 0.0434 mol) in dry DCM (225 mL, 25 vol), (WV-NU-362-02) (15 g, 0.04086 mol) at rt. was added Na (OAc)3BH (8.9 g, 0.06173 mol) portion wise over a period of 10 min, at 0°C. Then reaction mixture was stirred to 20°C for 8 h. Progress of the reaction was monitored by TLC. The reaction was quenched with saturated aqueous NaHCCL (50 mL) at 0°C and extracted with DCM (2 x 100 mL), dried over Na2SO4 and concentrated under reduced pressure to afford light yellow semi syrup. (WV-NU-362-03) (14.6 g, crude), TLC Mobile phase details: 10% MeOH in DCM. ' H NMR (500 MHz, CDC13): 8 in ppm = 9.32 (s, 1H), 7.56 (dd, 1H, JI = 45.4 Hz, J2 = 7.6 Hz), 5.81 (m, 1H), 5.72 (m, 1H), 4.11 (m, 6H), 3.96 (m, 1H), 3.64 (td, 1H, JI = 5.9 Hz, J2 = 1.4 Hz), 3.51 (m, 3H), 3.38 (m, 1H), 3.00 (m, 2H), 2.79 (m, 2H), 2.55 (m, 3H), 2.05 (m, 2H), 1.31 (m, 7H), 0.91 (td, 11H, JI = 6.7 Hz, J2 = 3.7 Hz), 0.79 (m, 6H). MS: m / z calcd for C^^NsOsPSi, 561.7; found 362-59. [M-H]+.

[0815] Preparation of diethyl (l-(((2R,3R,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrinudin-l(2H)-yl)-3- hydroxy-4-niethoxytetrahydrofuran-2-yl)inethyl)pyrrolidin-3-yl)phosphonate (WV-NU-

[0816] 362):

[0817] WV-NU-362

[0818] 2'-OMe-5,-PO(OEt)2-Pyrrolidinyl phosphonate Uridine (WV-NU-362) To a stirred solution of (WV-NU-362-03) (14.6 g, 0.0260 mol) in H2O (73 mL, 5 vol), was added formic acid (73 mL, 5 vol) at 0°C. Then the reaction mixture was allowed to stirr at rt for 24 h. Progress of the reaction was monitored by TLC. After completion, the reaction mixture was concentrated under reduced pressure and the crude mass was codistilled with toluene (50 ml x3). The crude compound was purified by column chromatography over silica- gel (230-400 mesh) eluted in 6% MeOH in DCM to afford brown solid (WV-NU-362) (6.6 g, 56%), TLC Mobile phase details: 10% MeOH in DCM. 'H NMR (500 MHz, D2O): 8 in ppm = 7.65 (d, 1H, JI = 8.3 Hz), 5.87 (t, 2H, JI = 3.4 Hz), 4.16 (m, 6H), 4.07 (q, 1H, JI = 3.1 Hz), 3.49 (s, 3H), 3.32 (m, 1H), 3.06 (m, 3H), 2.76 (m, 3H), 2.18 (d, 1H, JI = 7.6 Hz), 2.06 (dt, 1H JI = 14.0 Hz, J2 = 6.0 Hz), 1.31 (m, 6H). MS: m / z calcd for CisHsoNsOsP, 447.4; found 449.7. [M-H]+.

[0819] EXAMPLE 29. Synthesis of WV-NU-343 ate Ikidirw (VW-NU443)

[0820] Diethyl (l-(((2R,3R,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-l(2H)-yl)-3-hydroxy-4- methoxytetrahydrofuran-2-yl)methyl)-lH-l,2,3-triazol-5-yl)phosphonate (WV-NU-343)

[0821] General Scheme:

[0822]

[0823] Experimental Procedure:

[0824] / . Preparation of compound 2 A :

[0825] For three batches. To a solution of compound 1A (11 g, 70.27 mmol) in THF (150 mL) was added bromo (ethynyl) magnesium (0.5 M, 140.53 mL) at 0 °C under N2. The resulting mixture was stirred at 15 °C for 2 hr. TLC indicated compound 1A was consumed completely and two new spots formed. The reaction was clean according to TLC. Three batches with together. The reaction mixture was quenched by sat. aq. NH4CI (150 mL) at 0 °C, then extracted with DCM (100 mL*3). The combined organic layers were dried over , filteNrae2dSO to4 get the crude. Without purification. Compound 2A (1.87 g, crude) was obtained as a brown oil.

[0826] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.95

[0827] 2. Preparation of compound 3 A : For two batches. To a solution of compound 2A (16 g, 109.50 mmol) in DCM (400 mL) was added m-CPBA (44.46 g, 218.99 mmol) at 0 °C. The mixture was stirred at 0-15 °C for 2 hr. TLC indicated compound 2A was consumed completely and two new spots formed. The reaction was clean according to TLC. Two batches with together. The reaction mixture was quenched by sat. aq. Na2 (S3O040 mL) and NaHCCL (300mL), then extracted with DCM (200 mL * 3). The combined organic layers were washed with brine (100 mL * 2), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1). Compound 3A (35 g, 50.72% yield) was obtained as a yellow oil.

[0828] ’H NMR (400 MHz, CHLOROFORM-d) 5 = 4.17 (quin, J = 7.6 Hz, 4H), 2.92 (d, J = 13.4 Hz, 1H), 1.36 (t, J = 7.2 Hz, 6H)

[0829] 31P NMR (162 MHz, CHLOROFORM-d) 8 = -8 41 (s, IP), -8 41 (s, IP)

[0830] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.4

[0831] 3. Preparation of compound 2 :

[0832] For five batches. To a solution of compound 1 (30 g, 116.18 mmol) in THF (420 mL) was added imidazole (20.56 g, 302.06 mmol), L (47.18 g, 185.88 mmol) and PPF13 (48.75 g, 185.88 mmol) at 0 °C. The mixture was stirred at 25 °C for 6 hr. TLC indicated compound 1 was consumed completely and two new spots formed. The reaction was clean according to TLC. Five batches with together. The reaction was quenched by 10% aqueous sodium thiosulfate solution (800 ml). After removing the solvent and volatiles under reduced pressure, the residue was extracted into Dichloromethane (200 mL * 3) and washed with saturated aqueous NaHCCL solution. The organic layer was separated, dried over anhydrous Na2SO4, filtered and concentrated. The residue was purified by column chromatography (Si O2, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1 to Dichloromethane: Methanol =1 : 0 to 3: 1). The crude product was purified by re-crystallization from Ethyl acetate (100 mL), Dichloromethane (300 mL) and Methanol (50 mL) at 15 °C. Compound 2 (200 g, 93.55% yield) was obtained as a purple solid. ’H NMR (400 MHz, DMSO-d6) 8 = 11.43 (s, 1H), 7.68 (d, J = 8.2 Hz, 1H), 5.87 (d, J = 5.6 Hz, 1H), 5.70-5.68 (m, 1H), 5.46 (d, J = 6.0 Hz, 1H), 4.05-4.01 (m, 1H), 4.00-3.95 (m, 1H), 3.88-3.82 (m, 1H), 3.54-3.53 (m, 1H), 3.42-3.40 (m, 1H), 3.34 (s, 3H)

[0833] LCMS (M+H+): 369.0

[0834] TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.45

[0835] 4. Preparation of compound 3 :

[0836] 2 3

[0837] For five batches. To a solution of compound 2 (24 g, 65.20 mmol) in 1, 2-dimethoxy ethane (300 mL) and H2O (60 mL) was added NaNs (3.66 g, 56.30 mmol) at 0 °C under N2. The mixture was stirred at 90 °C for 12 hr. LCMS showed compound 2 was remained and the desired mass was detected. Five batches with together. The reaction was quenched by H2O (500 mL), and extracted with Ethyl acetate (400 mL*3). The combined organic layers were washed with saturated aqueous NaCl 300 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1). The crude product was triturated with Ethyl acetate (50 mL) at 15 °C for 10 min. Compound 3 (49 g, 85.51% yield) was obtained as a white solid.

[0838] ’H NMR (400 MHz, DMSO-d6) 8 = 11.48 - 10.91 (m, 1H), 7.70 (d, J = 8.2 Hz, 1H), 5.83 (d, J = 4.8 Hz, 1H), 5.68 (d, J = 8.0 Hz, 1H), 5.36 (br d, J = 5.8 Hz, 1H), 4.07 (q, J = 5.2 Hz, 1H), 3.95 - 3.89 (m, 2H), 3.61 (d, J = 4.8 Hz, 2H), 3.36 (s, 3H) LCMS: (M+H+): 284.0, purity: 90.16%

[0839] TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.45

[0840] 5. Preparation of WV-NU-343:

[0841] For four batches. To a solution of compound 3 (10 g, 35.31 mmol) and compound 3A (11.45 g, 70.61 mmol) in Tol. (100 mL) was added chlororuthenium; cyclopentane; triphenylphosphane (3.61 g, 4.94 mmol). The mixture was stirred at 90 °C for 12 hr. LCMS showed compound 3 was remained and the desired mass was detected. Four batches with together. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (FA condition; column: Phenomenex luna cl 8 250mm*100mm*15um; mobile phase: [H2O (0.02%FA)-ACN]; gradient: 5%-25% B over 25.0 min). Compound WV-NU-343 (1.2 g, 1.91% yield) was obtained as a yellow solid. Compound WV-NU-306 (22 g, 34.98% yield) was obtained as a pale yellow solid.

[0842] WV-NU-343:

[0843] ’H NMR (400 MHz, DMSO-d6) 8 = 11.42 (d, J = 1.6 Hz, 1H), 8.21 (s, 1H), 7.68 (d, J = 8.0 Hz, 1H), 5.79 (d, J = 5.0 Hz, 1H), 5.66-5.64 (m, 1H), 5.49 (d, J = 6.0 Hz, 1H), 4.89 (d, J = 6.0 Hz, 2H), 4.31 - 4.22 (m, 2H), 4.13 - 4.03 (m, 4H), 4.02 - 3.97 (m, 1H), 3.37 (s, 3H), 1.23 (q, J = 7.1 Hz, 6H)

[0844] 31P NMR (162 MHz, DMSO-d6) 8 = 3.10 (s, IP)

[0845] LCMS (M+H+): 446.1, purity: 97.53%

[0846] WV-NU-306:

[0847] ’H NMR (400 MHz, DMSO-d6) 8 = 11.41 (d, J = 1.6 Hz, 1H), 8.62 (s, 1H), 7.55 (d, J = 8.2 Hz, 1H), 5.80 (d, J = 4.8 Hz, 1H), 5.65-5.63 (m, 1H), 5.49 (d, J = 6.0 Hz, 1H), 4.87 - 4.69 (m, 2H), 4.21 (td, J = 4.6, 7.8 Hz, 1H), 4.15 (q, J = 5.6 Hz, 1H), 4.12 - 4.03 (m, 4H), 3.93 (t, J = 5.0 Hz, 1H), 3.37 (s, 3H), 1.24 (t, J = 7.0 Hz, 6H)

[0848] 31P NMR (162 MHz, DMSO-d6) 8 = 7.16 (s, IP)

[0849] LCMS (M+H+): 446.1, purity: 94.23%

[0850] EXAMPLE 30. Synthesis of WV-NU-342

[0851] 4 5 WV-NU-342 Experimental Procedures:

[0852] / . Preparation of compound 2 A:

[0853] Compound 1A (30 g, 217.23 mmol) was added to a stirred mixture of pyrrolidine-2-carboxylic acid (37.51 g, 325.85 mmol) in Tol. (150 mL) at 110°C. Benzaldehyde (34.58 g, 325.85 mmol) was then added to the reaction mixture in small portions over 3 h. TLC indicated compound 1A was consumed completely and three new spots formed. The reaction was clean according to TLC. The resultant solution was portioned to H2O (500 mL), and extracted with EtOAc (2 X1000 mL). The organic layer was washed with brine (300 mL) and dried over ISfeSCU The filtrate was evaporated in vacuo. The residue was purified by column chromatography (SiO2, Petroleum ether / Ethyl acetate = 100: 1 to 1 :1). Compound 2A (55 g, 85.15% yield) was obtained as a yellow oil.

[0854] 'll NMR (400 MHz, CHLOROFORM-d, 25°C): 8 = 7.16-7 30 (m, 5H), 5 22 (s, 1H), 4 37 (d, J = 13.0 Hz, 1H), 4.02-4.23 (m, 4H), 3.34 (d, J = 13.0 Hz, 1H), 2.91 (dd, J = 9.8, 5.8 Hz, 1H), 2.86 (ddd, J = 9.0, 6.5, 2.8 Hz, 1H), 2.16 (td, J = 9.4, 6.7 Hz, 1H), 1.97-2.10 (m, 2H), 1.61-1.77 (m, 2H), 1.27 ppm (td, J = 7.0, 4.6 Hz, 6H)

[0855] 31P NMR (162 MHz, CHLOROFORM-d, 25°C): 8 = 27.13 ppm (s, IP)

[0856] TLC: Petroleum ether: Ethyl acetate = 1 : 1; Rf = 0.5

[0857] 2. Preparation of compound 3 A:

[0858] For two batches: To a solution of compound 2A (25 g, 84.08 mmol), AcOH (7.57 g, 126.12 mmol) in EtOH (250 mL) was added Pd (OH)2 (2.5 g, 20% purity) under N2 atmosphere. The suspension was degassed and purged with H2 for 3 times. The mixture was stirred under H2 (15 Psi) at 25 °C for 12 hr. TLC indicated compound 2A was consumed completely and one new spot formed. The reaction was clean according to TLC. Filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Dichloromethane: Methanol = 100: 1 to 13: 1). Compound 3A (31 g, 88.97% yield) was obtained as a yellow oil.

[0859] 1H NMR (400 MHz, CHLOROFORM-d, 25°C): 8 = 4.04-4.16 (m, 4H), 3.33 (td, J = 8.0, 6.3 Hz, 1H), 2.96-3.05 (m, 1H), 2.85-2.96 (m, 1H), 1.97-2.06 (m, 1H), 1.77-1.94 (m, 2H), 1.66- 1.76 (m, 1H), 1.27 ppm (t, J = 7.0 Hz, 6H)

[0860] TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.15

[0861] 3. Preparation of compound 2:

[0862] To a solution of compound 1 (50 g, 193.63 mmol) in DMF (500 mL) was added imidazole (65.91 g, 968.14 mmol) and TBSC1 (116.73 g, 774.51 mmol). The mixture was stirred at 25 °C for 3hr. TLC indicated compound 1 was consumed completely and one new spot formed. The reaction was clean according to TLC. The reaction mixture was partitioned between Ethyl acetate (3L) and H2O (IL). The organic phase was separated, washed with brine (500 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 100: 1 to 0: 1). Compound 2 (94 g, 99.74% yield) was obtained as a yellow oil.

[0863] 1H NMR (400 MHz, CHLOROFORM-d, 25°C): 8 = 8.63 (br s, 1H), 7.96 (d, J = 8.0 Hz, 1H), 5.83 (d, J = 1.6 Hz, 1H), 5.57 (dd, J = 8.0, 2.0 Hz, 1H), 4.13 (dd, J = 7.0, 4.9 Hz, 1H), 3.91-3.97 (m, 2H), 3.63-3.70 (m, 1H), 3.50 (dd, J = 4.8, 1.7 Hz, 1H), 3.45 (s, 3H), 0.82 (d, J = 13.0 Hz, 18H), -0.04-0.03 ppm (m, 12H)

[0864] LCMS: (M+H+) = 487.4

[0865] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.48

[0866] 4. Preparation of compound 3:

[0867] 2 3

[0868] For 2 batches: To a solution of compound 2 (60 g, 123.27 mmol) in H2O (300 mL) / TFA (300 mL) / THF (600 mL). The mixture was stirred at 0 °C for 3hr. TLC indicated compound 2 was consumed completely and one new spot formed. The reaction was clean according to TLC. 2 reactions were combined for workup. After completion of reaction, the resulting mixture was added con.NH3*H2O (IL) to pH = 7, and then extracted with ethyl acetate (2 L) washed with brine 500 mL dried over Na2S,O f4iltered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography ( Si O2, Petroleum ether: Ethyl acetate = 100: 1 to 0;l). Compound 3 (60 g, 65.34% yield) was obtained as a white solid.

[0869] 1H NMR (400 MHz, CHLOROFORM-d, 25°C): 8 = 9.38 (s, 1H), 7.72 (d, J = 8.0 Hz, 1H), 5.67-5.76 (m, 2H), 4.36 (t, J = 5.4 Hz, 1H), 3.94-4.08 (m, 3H), 3.75 (br d, J = 12.2 Hz, 1H), 3.49 (s, 3H), 2.87 (br s, 1H), 0.92 (s, 9H), 0.11 ppm (d, J = 5.0 Hz, 6H)

[0870] TLC: Petroleum ether: Ethyl acetate = 1 :2, Rf = 0.28

[0871] 5. Preparation of compound 4:

[0872] 3 4

[0873] DMP (22.77 g, 53.69 mmol) was added to a stirred and cooled 0 °C solution of compound 3 (20 g, 53.69 mmol) in anhydrous DCM (300 mL) under argon atmosphere. The cooling bath was removed, and the mixture was stirred at 25°C for 3hr. TLC indicated compound 3 was consumed completely and one new spot formed. The reaction was clean according to TLC. The mixture was cooled to 0 °C and poured to a vigorously stirred mixture of 10% solution of sodium thiosulfate (100 mL) and saturated solution of sodium bicarbonate (100 mL). After stirring at room temperature for 45 minutes significant precipitation occurred. The precipitate was filtered off and the solids where washed with DCM (200 mL x 2). The filtrate was placed in a separator funnel, the organic phase was separated and dried over anhydrous sodium sulfate. Without further purification. Compound 4 (19 g, crude) was obtained as a white solid.

[0874] TLC: (Petroleum ether: Ethyl acetate = 0: 1), Rf = 0.58

[0875] 6. Preparation of compound 5:

[0876] To a solution of compound 3 A (15.94 g, 76.93 mmol) compound 4 (19 g, 51.29 mmol) in MeOH (200 mL) was added NaBH (OAc)s (43.48 g, 205.14 mmol). The mixture was stirred at 15 °C for 12 hr. TLC indicated compound 4 was consumed completely and two new spots formed. The reaction was clean according to TLC. Concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 100: 1 to 0; 1). Compound 5 (13 g, 45.13% yield) was obtained as a white solid. 1H NMR (400 MHz, DMSO-d6, 28°C): 8 = 11.36 (dd, J = 8.4, 1.7 Hz, 1H), 7.59-7.85 (m, 1H), 5.81 (dd, J = 17.6, 5.1 Hz, 1H), 5.57-5.72 (m, 1H), 4.31 (t, J = 4.2 Hz, 1H), 3.97-4.16 (m, 4H), 3.78-3.96 (m, 2H), 3.30-3.35 (m, 3H), 3.17-3.27 (m, 1H), 3.01-3.11 (m, 1H), 2.89 (ddd, J = 14.6, 9.8, 5.3 Hz, 1H), 2.53-2.70 (m, 1H), 2.20-2.38 (m, 1H), 1.92-2.08 (m, 1H), 1.79-1.84 (m 1H), 1.61-1.78 (m, 2H), 1.15-1.28 (m, 6H), 0.88 (d, J = 2.3 Hz, 9H), 0.09 ppm (s, 6H) TLC: Petroleum ether: Ethyl acetate = 0: 1, Rfi = 0.18; Rfz = 0.10

[0877] 7. Preparation of compound WV-NU-342:

[0878] 5 WV-NU-342

[0879] 2,-OMe-5'-(2-PO(OEt)2-pyrrolidinyl) phosphonate Uridine (WV-NU-342)

[0880] To a solution of compound 5 (11.5 g, 20.47 mmol) in THF (130 mL) was added TBAF (1 M, 24.57 mL). The mixture was stirred at 25 °C for 0.5 hr. TLC indicated compound 5 was consumed completely and one new spot formed. The reaction was clean according to TLC. Concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Dichloromethane: Methanol = 100 / 1 to 10 / 1). Compound WV-NU- 342 (7.5 g, 77.63% yield, 94.82% purity) was obtained as a yellow solid.

[0881] ’H NMR (400 MHz, DMSO-d6, 25°C): 8 = 11.34 (br d, J = 3.9 Hz, 1H), 7.58-7.83 (m, 1H), 5.76-5.82 (m, 1H), 5.55-5.67 (m, 1H), 5.17 (dd, J = 10.8, 6.1 Hz, 1H), 3.94-4.08 (m, 5H), 3.85- 3.92 (m, 1H), 3.74-3.82 (m, 1H), 3.34 (d, J = 10.7 Hz, 3H), 3.12-3.24 (m, 1H), 3.05 (br s, 1H), 2.90 (dd, J = 10.0, 5.1 Hz, 1H), 2.54-2.72 (m, 1H), 2.22-2.36 (m, 1H), 1.89-2.05 (m, 1H), 1.80 (ddt, J = 17.2, 8.6, 4.2 Hz, 1H), 1.61-1.74 (m, 2H), 1.15-1.26 ppm (m, 6H)

[0882] 31P NMR (162 MHz, DMSO-ck, 26°C): 8 = 26.47-26.81 ppm (m, IP) LCMS: (M+H+) = 448.1, purity: 94.82%

[0883] TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.33

[0884] EXAMPLE 31. Synthesis of WV-NU-345

[0885] WV-NU-345

[0886] 2'-OMe-5'-Sufonylamindo Triazolyl Uridine (WV-NU-345)

[0887] 1-(((2R,3R,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-3-hydroxy-4-methoxytetrahydrofuran-

[0888] 2-yl)methyl)-A / -methyl-1 H-1 ,2,3-triazole-4-sulfonamide (WV-NU-345)

[0889] General Scheme:

[0890] WV-NU-345 Experimental Procedure:

[0891] / . Preparation of compound 2 A:

[0892] For two batches: To a solution compound 1A (20 g, 203.63 mmol) in THF (285 mL) was added n-BuLi (2.5 M, 81.45 mL) dropwise at -78 °C and the reaction was allowed to warm up to -20 °C during 2 h before it was re-cooled to -78°C. Then S (6.60 g, 205.71 mmol) was added in portions and the solution was warmed to 0°C and treated with BnBr (35.18 g, 205.66 mmol, 24.43 mL), which was stirred at 25 °C for 12 hr. TLC indicated compound 1A was consumed completely and one new spot formed. The reaction was clean according to TLC. 2 reactions were combined for workup. The reaction was quenched with saturated aqueous NH4CI (1000 mL). The aqueous layer was extracted with Petroleum ether (2000 mL) and the combined organic layer was washed sequentially with water (500 mL) and brine (500 mL), dried over anhydrousNa2SO4 The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 100: 0 to 40: 1). Compound 2A (80 g, 89.12% yield) was obtained as a yellow oil.

[0893] 1H NMR (400 MHz, CHLOROFORM-d, 25°C): 8 = 7.12-7 25 (m, 5H), 3 80 (s, 2H), -0 02 (S, 9H)

[0894] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.67

[0895] 2. Preparation of compound 3 A:

[0896] For two batches: To a solution of compound 2A (40 g, 181.48 mmol) in THF (800 mL) was added TBAF (1 M, 217.72 mL). The mixture was stirred at 25 °C for 12 hr. TLC indicated compound 2A was consumed completely and one new spot formed. The reaction was clean according to TLC. Two reactions were combined for workup. The reaction mixture was partitioned between H2O (1000 mL) and Ethyl acetate (1000 mL). The organic phase was separated, washed with brine (300 mL), dried overNa2SO4 , filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 100: 1 to 10: 1). Compound 3A (50 g, 92.94% yield) was obtained as a yellow oil.

[0897] 1H NMR (400 MHz, CHLOROFORM-d, 25°C): 8 = 7.21-7 31 (m, 5H), 3 89 (s, 2H), 2 74 ppm (s, 1H)

[0898] TLC: Petroleum ether: Ethyl acetate = 1 :0, Rf = 0.52

[0899] 3. Preparation of compound 2:

[0900] 1 2

[0901] For two batches: To a solution of compound 1 (50 g, 193.63 mmol) in THF (700 mL) was added IMIDAZOLE (34.27 g, 503.43 mmol), I2(78.63 g, 309.80 mmol) and PPh3(81.26 g, 309.80 mmol) at 0 °C. The mixture was stirred at 25 °C for 12 hr. TLC indicated compound 1 was consumed completely and one new spot formed. The reaction was clean according to TLC. Two reactions were combined for workup. The reaction was quenched by 10% aqueous sodium thiosulfate solution (500 mL). After removing the solvent and volatiles under reduced pressure, the residue was extracted into EtOAc (1000 mL*3) and washed with saturated aqueous NaHCCL solution (500 mL). The organic layer was separated, dried over anhydrous Na2SO4, filtered and concentrated. The residue was purified by column chromatography (SiO2, Dichloromethane: Methanol = 100: 1 to 10: 1). Compound 2(140 g, 98.59% yield) was obtained as a white solid.

[0902] 1H NMR (400 MHz, DMSO-d6, 25°C): 8 = 11.42 (s, 1H), 7.68 (d, J = 8.0 Hz, 1H), 5.86 (d, J = 5.4 Hz, 1H), 5.69 (d, J = 8.0 Hz, 1H), 5.45 (d, J = 6.0 Hz, 1H), 3.95-4.00 (m, 1H), 3.82- 3.88 (m, 1H), 3.55 (dd, J = 10.6, 5.4 Hz, 1H), 3.40 (dd, J = 10.6, 6.9 Hz, 1H), 3.34 ppm (s, 3H) TLC: (Dichloromethane: Methanol = 10:1), Rf = 0.48

[0903] 4. Preparation of compound 3:

[0904] For 4 batches: To a solution of compound 2 (25 g, 67.91 mmol) in 1, 2-dimethoxyethane (500 mL) and H2O (70 mL) was added NaNs (4.27 g, 65.64 mmol) at 0 °C under N2. The mixture was stirred at 90 °C for 12hr. LCMS showed compound 2 was remained and the desired mass was detected. Four batches with together. The reaction was quenched by H2O (1000 mL) and extracted with Ethyl acetate (1500 mL*3). The combined organic layers were washed with saturated aqueous NaCl (500 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Dichloromethane: Methanol = 100: 1 to 0: 1). Compound 3 (65 g, 87.25% yield) was obtained as a white solid.

[0905] 1H NMR (400 MHz, DMSO-d6, 25°C): 8 = 11.40 (s, 1H), 7.63-7.77 (m, 1H), 5.83 (d, J = 4.9 Hz, 1H), 5.68 (d, J = 8.1 Hz, 1H), 5.35 (d, J = 6.3 Hz, 1H), 4.05-4.12 (m, 1H), 3.88-3.96 (m, 2H), 3.61 (d, J = 4.9 Hz, 2H), 3.36 ppm (s, 3H)

[0906] LCMS: (M+ H +) = 284

[0907] TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.45

[0908] 5. Preparation of compound 4:

[0909] For 2 batches: To a solution of compound 3A (15.39 g, 103.80 mmol) and compound 3 (24.5 g, 86.50 mmol) in DMF (115 mL) and THF (230 mL) was degassed and purged with N2 for 3 times, then DIEA (22.36 g, 173.00 mmol), Cui (32.95 g, 173.00 mmol) was added. The mixture was stirred at 25 °C for 12 hr under N2 atmosphere. LCMS showed compound 3 was consumed completely and the desired mass was detected. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 100: 0 to 0: 1). Compound 4 (74.64 g, crude) was obtained as a yellow solid.

[0910] LCMS: (M+H+) = 432.1

[0911] TLC: Petroleum ether: Ethyl acetate = 1 :3, Rf = 0.42

[0912] 6. Preparation of compound 5:

[0913] To a solution of compound 4 (74 g, 171.51 mmol) in Py (700 mL) was added AC2O (26.26 g, 257.26 mmol). The mixture was stirred at 15 °C for 12hr. TLC indicated compound 4 was consumed completely and one new spot formed. The reaction was clean according to TLC. Concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether / Ethyl acetate = 100: 1 to 0: 1). Compound 5 (50 g, 61.57% yield) was obtained as a white solid.

[0914] 1H NMR (400 MHz, DMSO-d6, 25°C): 8 = 11.44-11.61 (m, 1H), 8.04 (s, 1H), 7.70 (d, J = 8.0 Hz, 1H), 7.13-7.32 (m, 5H), 5.81 (d, J = 5.7 Hz, 1H), 5.71 (dd, J = 8.0, 2.0 Hz, 1H), 5.23- 5.31 (m, 1H), 4.65-4.79 (m, 2H), 4.34-4.44 (m, 1H), 4.28 (t, J = 5.7 Hz, 1H), 4.11 (s, 2H), 3.29 (s, 3H), 2.09 ppm (s, 3H)

[0915] LCMS: (M+H+) = 474.4

[0916] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.42

[0917] 7. Preparation of compound 6:

[0918] 5 6

[0919] NCS (30.46 g, 228.09 mmol) was added to a solution of compound 5 (40 g, 84.48 mmol) in AcOH (400 mL) and Water (200 mL) and the mixture stirred at 15 °C for Ihr. TLC indicated compound 5 was consumed completely and one new spot formed. The reaction was clean according to TLC. Water (500 mL) was added and the mixture was extracted with ethyl acetate (1000 mL). The organic phase was washed sequentially with a saturated aqueous sodium hydrogen carbonate solution (3 x 300 mL) and brine (400 mL), then dried (MgSCh), concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether / Ethyl acetate = 100: 1 to 0: 1). Compound 6 (30 g, 78.95% yield) was obtained as a white solid.

[0920] 1H NMR (400 MHz, DMSO-d6, 27°C): 8 = 11.50 (br s, 1H), 8.16 (d, J = 3.1 Hz, 1H), 7.65 (dd, J = 8.0, 4.5 Hz, 1H), 5.87 (d, J = 5.8 Hz, 1H), 5.77 (dd, J = 8.0, 2.0 Hz, 1H), 5.29-5.38 (m, 1H), 4.83 (br d, J = 6.0 Hz, 2H), 4.45-4.54 (m, 1H), 4.26 (td, J = 5.7, 2.5 Hz, 1H), 3.34 (d, J = 2.0 Hz, 3H), 2.14 ppm (d, J = 2.0 Hz, 3H)

[0921] LCMS: (M+H+) = 450.2

[0922] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.72

[0923] 8. Preparation of compound WV-NU-345:

[0924] 6 WV-NU-345

[0925] 2'-OMe-5'-Sufonylamindo Triazolyl Uridine (WV-NU-345)

[0926] A mixture of compound 6 (10 g, 22.23 mmol) in MeNH2 (2 M, THF 100 mL) was degassed and purged with N2 for 3 times, and then the mixture was stirred at 15 °C for 12hr under N2 atmosphere. LCMS showed compound 6 was consumed completely and one main peak with desired m / z. Concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Dichloromethane: Methanol= 100 / 1 to 0 / 1). Compound WV-NU-345 (7 g, 16.60 mmol, 74.65% yield, 95.56% purity) was obtained as a white solid. 1H NMR (400 MHz, DMSO-d6, 27°C): 8 = 8.69 (s, 1H), 7.66-7.91 (m, 1H), 7.58 (d, J = 8.0 Hz, 1H), 5.81 (d, J = 4.8 Hz, 1H), 5.66 (d, J = 8.0 Hz, 1H), 5.51 (br d, J = 5.8 Hz, 1H), 4.79- 4.88 (m, 1H), 4.70-4.78 (m, 1H), 4.20-4.27 (m, 1H), 4.16 (q, J = 5.0 Hz, 1H), 3.95 (t, J = 5.0 Hz, 1H), 3.37-3.39 (m, 3H), 3.18 (d, J = 3.1 Hz, 1H), 2.54 ppm (s, 3H)

[0927] LCMS: (M+H+) = 403, purity: 95.56%

[0928] TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.28

[0929] EXAMPLE 32. Synthesis of WV-NU-365

[0930] WV-NU-365

[0931] 2,-OMe-5'-PO(OEt)2-Aziridinyl Phosphonate Uridine (WV-NU-365) diethyl (1 -(((2R,3R,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-1 (2H)-yl)-3-hydroxy-4- methoxytetrahydrofuran-2-yl)methyl)aziridin-2-yl)phosphonate (WV-NU-365)

[0932] General Scheme:

[0933] Experimental Procedures:

[0934] / . Preparation of compound 2 A:

[0935] Compound 1A (20 g, 121.85 mmol) was added into a pre-dried three necked flask and was dissolved in DCM (200 mL) and the reaction mixture cooled to 0°C, Br2 (27.26 g, 170.59 mmol) was added to this solution, after 25 °C stirring at 0.5 hr. TLC indicated compound 1A was consumed completely and one new spot formed. The reaction was clean according to TLC. The reaction mixture concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 100: 1 to 1 : 1). Compound 2A (30 g, 76.00% yield) was obtained as a yellow oil.1H NMR (400 MHz, CHLOROFORM-d, 25°C): 8 = 4.27 (quind, J = 7.3, 4.4 Hz, 4H), 4.00-

[0936] 4.11 (m, 2H), 3.60-3.72 (m, 1H), 1.39 ppm (t, J = 7.1 Hz, 6H)

[0937] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.5

[0938] 2. Preparation of compound 4:

[0939] To a solution of compound 3 (15 g, 52.96 mmol) in MeOH (150 mL) was added Pd / C (1.5 g, 1.41 mmol, 10% purity) under N2 atmosphere. The suspension was degassed and purged with H2 for 3 times. The mixture was stirred under H2 (5 Psi) at 25 °C for 12hr. TLC indicated compound 3 was consumed completely and one new spot formed. The reaction was clean according to TLC. Filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Dichloromethane: Methanol =100: 1 to 20: 1). Compound 4 (13 g, 95.43% yield) was obtained as a white solid.

[0940] 1H NMR (400 MHz, DMSO-d6, 25°C): 8 = 7.93 (d, J = 8.0 Hz, 1H), 5.83 (d, J = 5.0 Hz, 1H), 5.61-5.69 (m, 1H), 4.09 (t, J = 4.8 Hz, 1H), 3.85 (br t, J = 5.2 Hz, 1H), 3.78 (q, J = 4.8 Hz, 1H), 3.34-3.37 (m, 3H), 2.75-2.87 ppm (m, 2H)

[0941] LCMS: (M+H+) = 258.0

[0942] TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.2

[0943] 3. Preparation of compound WV-NU-365:

[0944] 2'-OMe-5'-PO(OEt)2-Aziridinyl Phosphonate Uridine (WV-NU-365)

[0945] Compound 2A (22.67 g, 69.97 mmol) was weighed into a pre-dried three necked flask and dissolved by adding MeOH (230 mL). After adding TEA (14.16 g, 139.95 mmol) at 25°C for 0.5 h. Then the compound 4 (12 g, 46.65 mmol) was added and the resulting mixture was refluxed at 70 °C for 12 hr. LCMS showed compound 4 was consumed completely and one main peak with desired m / z. Concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (column: Welch Xtimate Cl 8 250*100mm#10um; mobile phase: [H2O (10mMNH4HCO3)-ACN]; gradient: 0%-30% B over 18.0 min). Compound WV- NU-365 (14.5 g, 70.55% yield, 95.18 % purity) was obtained as a yellow solid.

[0946] ’H NMR (400 MHz, DMSO-d6, 25°C): 5 = 11.28-11.47 (m, 1H), 7.81-8.21 (m, 1H), 5.85 (t, J = 4.6 Hz, 1H), 5.60 (dd, J = 13.8, 8.0 Hz, 1H), 5.17-5.32 (m, 1H), 4.10-4.22 (m, 1H), 3.97- 4.09 (m, 4H), 3.88-3.96 (m, 1H), 3.85 (td, J = 4.8, 1.8 Hz, 1H), 3.38 (d, J = 3.6 Hz, 3H), 2.74- 2.97 (m, 1H), 2.19-2.43 (m, 1H), 1.92-2.00 (m, 1H), 1.82-1.91 (m, 1H), 1.67-1.82 (m, 1H), 1.19-1.32 ppm (m, 6H)

[0947] 31P NMR (162 MHz, DMSO-ck, 25°C): 8 = 22.94 ppm (d, J= 77.3 Hz, IP)

[0948] LCMS: (M+H+) = 420.1, purity: 95.18 %

[0949] EXAMPLE 33. Synthesis of WV-NU-426

[0950] To a solution of compound 1 (50 g, 193.63 mmol) in DMF (1000 mL) was added imidazole (52.73 g, 774.51 mmol) and TBSCI (87.55 g, 580.88 mmol). The mixture was stirred at 20 °C for 12 hr. LCMS showed that compound 1 was consumed completely and the desired mass was detected. The reaction mixture was concentrated under reduced pressure to remove DMF. The residue was diluted with H2O 1500 mL and extracted with EtOAc 500 mL*3. The combined organic layers were washed with brine 1500 mL, dried over , filtered Na2SO4 and concentrated under reduced pressure to give a residue. Compound 2 (188 g, crude) was obtained as a yellow oil.

[0951] LCMS (M+H+): 487.4, LCMS purity: 99%

[0952] To a solution of compound 2 (94 g, 193.12 mmol) in THF (1000 mL) was added TFA (383.75 g, 3.37 mol) and H2O (250.00 g, 13.88 mol). The mixture was stirred at 0 °C for 3 hr. TLC indicated compound 2 was consumed completely and one new spot formed. The reaction mixture was quenched with NH3.H2O (230 mL *4) at 0 °C. The residue was diluted with H2O 500 mL and extracted with DCM (1000 mL * 3). The combined organic layers were washed with brine 1000 mL, dried over , fiNltae2rSeOd4 and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCE, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 3 (45 g, 62.56% yield) was obtained as a white solid.

[0953] ’H NMR (400 MHz, DMSO-d6) 5 = 11.36 (br s, 1H), 7.93 (d, J = 8.0 Hz, 1H), 5.83 (d, J = 4.8 Hz, 1H), 5.66 (d, J = 8.1 Hz, 1H), 5.20 (br t, J = 4.6 Hz, 1H), 4.29 (t, J = 4.6 Hz, 1H), 3.87 - 3.81 (m, 2H), 3.70 - 3.62 (m, 1H), 3.57 - 3.50 (m, 1H), 3.34 (s, 3H), 0.88 (s, 9H), 0.09 (s, 6H)

[0954] LCMS (M+H+): 373.2, LCMS purity: 97%

[0955] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.6

[0956] 3. Preparation of compound 4.

[0957] To a solution of compound 3 (25 g, 67.12 mmol) in ACN (300 mL) was added IBX (37.59 g, 134.23 mmol) at 0 °C. The mixture was stirred at 70 °C for 3 hr. TLC indicated compound 3 was consumed completely and one new spot formed. The reaction mixture was filtered and concentrated under reduced pressure to get crude product. The crude product was used into the next step without further purification. Compound 4 (49 g, crude) was obtained as a white solid.

[0958] ’H NMR (400 MHz, DMSO-d6) 8 = 11.44 - 11.24 (m, 2H), 7.82 - 7.78 (m, 1H), 5.85 - 5.81 (m, 1H), 5.67 - 5.61 (m, 1H), 4.36 - 4.31 (m, 1H), 3.89 - 3.85 (m, 1H), 3.77 - 3.73 (m, 1H), 3.21 - 3.17 (m, 3H), 0.82 - 0.79 (m, 9H), 0.00 - -0.02 (m, 6H) TLC: Commercial hexanes: Ethyl acetate = 1 : 1, Rf = 0.18 To a solution of methyl (triphenyl) phosphonium;bromide (141.74 g, 396.79 mmol) and potassium;2-methylpropan-2-olate (44.52 g, 396.79 mmol) in THF (500 mL) was added compound 4 (49 g, 132.26 mmol) in THF (500 mL). The mixture was stirred at 0 - 20 °C for 12 hr. LCMS showed compound 4 was consumed completely and desired mass was detected. The mixture was diluted with DCM (200 mL) and organic layer was washed with saturated NH4CI solution (200 mL). Organic layer then separated, dried over anhydrous Na2SO4, filtered and the filtrate was evaporated to dryness. The residue was purified by column chromatography (SiO2, Commercial hexanes: Ethyl acetate = 1 :0 to 1 : 1). Compound 5 (30 g, 61.55% yield) was obtained as a white solid.

[0959] ’H NMR (400 MHz, DMSO-d6) 8 = 11.40 (s, 1H), 7.64 (d, J = 8.1 Hz, 1H), 5.98 (ddd, J = 7.0, 10.2, 17.2 Hz, 1H), 5.78 (d, J = 3.7 Hz, 1H), 5.66 (dd, J = 1.7, 8.0 Hz, 1H), 5.35 (d, J = 17.0 Hz, 1H), 5.27 (d, J = 10.3 Hz, 1H), 4.20 - 4.12 (m, 2H), 3.91 - 3.87 (m, 1H), 3.36 (s, 3H), 0.87 (s, 9H), 0.07 (d, J = 4.9 Hz, 6H) LCMS (M+H+): 369.2

[0960] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.4

[0961] To a solution of compound 5 (8 g, 21.71 mmol) in THF (80 mL) was added N,N- diethylethanamine; trihydrofluoride (10.50 g, 65.13 mmol). The mixture was stirred at 40 °C for 6 hr. TLC indicated compound 5 was consumed completely and one new spot formed. The reaction mixture was concentrated under reduced pressure to remove THF. The residue was purified by column chromatography (SiCL, Commercial hexanes: Ethyl acetate = 1 :0 to 0: 1). Compound 6 (5 g, 90.59% yield) was obtained as a white solid.

[0962] LCMS (M+H+): 255.1, LCMS purity: 94%

[0963] TLC: Commercial hexanes: Ethyl acetate = 0: 1, Rf = 0.2

[0964] 6. Preparation of compound WV-NU-426:

[0965] 6 WV-NU-426

[0966] To a solution of compound 6 (5 g, 19.67 mmol,) and [l,3-bis(2,4,6- trimethylphenyl)imidazolidin-2-ylidene]-dichloro-[(2- isopropoxyphenyl)methylene]ruthenium (2.46 g, 3.93 mmol) in DCM (200 mL) was added 4,4,5,5-tetramethyl-2-vinyl-l,3,2-dioxaborolane (6.06 g, 39.33 mmol) under N2. The mixture was stirred at 39 °C for 12 hr. LCMS showed 16% of Reactant 1 remained. Several new peaks were shown on LCMS and 17% of desired compound was detected. The reaction mixture was concentrated under reduced pressure to remove DCM. The residue was purified by column chromatography (SiO2, Commercial hexanes: Ethyl acetate = 1 :0 to 0: 1). The crude product was purified by normal-phase HPLC column: Welch Ultimate XB-CN 250*50* lOum; mobile phase: [Heptane-DCM: CAN = 2: 1]; gradient: 0%-46% B over 20.0 min. WV-NU-426 (0.7 g, 58.33% yield) was obtained as a white solid.

[0967] ’H NMR (400 MHz, DMSO-d6) 5 = 11.37 (br s, 1H), 7.62 (d, J = 8.1 Hz, 1H), 6.58 (dd, J = 6.3, 18.0 Hz, 1H), 5.81 (d, J = 4.0 Hz, 1H), 5.66 (d, J = 8.0 Hz, 1H), 5.61 (dd, J = 1.1, 18.0 Hz, 1H), 5.36 (d, J = 6.8 Hz, 1H), 4.23 (dt, J = 1.0, 6.2 Hz, 1H), 4.01 (q, J = 6.3 Hz, 1H), 3.89 - 3.83 (m, 1H), 3.38 (s, 3H), 1.21 (s, 12H) LCMS (M+H+): 381.1, LCMS purity: 90%

[0968] TLC: Commercial hexanes: Ethyl acetate = 0: 1, Rf = 0.3

[0969] EXAMPLE 34. Synthesis of WV-NU-344

[0970] WV-NU-344

[0971] General Scheme:

[0972] Experimental Procedure:

[0973] / . Preparation of compound 2 A:

[0974] 1A 2A

[0975] To a solution compound 1A (20 g, 203.63 mmol) in THF (285 mL) was added n-BuLi (2.5 M, 81.45 mL) dropwise at -78 °C and the reaction was allowed to warm up to -20 °C during 2 h before it was re-cooled to -78 °C. Then S (6.60 g, 205.71 mmol) was added in portions and the solution was warmed to 0 °C and treated with BnBr (35.18 g, 205.66 mmol, 24.43 mL), which was stirred at 25 °C for 12 h. TLC indicated compound 1A was consumed completely and one new spot formed. The reaction was clean according to TLC. Two reactions were combined for workup. The reaction was quenched with saturated aqueous NH4CI (1000 mL). The aqueous layer was extracted with Petroleum ether (2000 mL) and the combined organic layer was washed sequentially with water (500 mL) and brine (500 mL), dried over anhydrous ISfeSC The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 100: 0 to 40: 1). Compound 2A (40 g, 89.12% yield) was obtained as a yellow oil.

[0976] ’H NMR (400 MHz, CHLOROFORM-d, 25°C): 8 = 7.12-7 25 (m, 5H), 3 80 (s, 2H), -0 02 (S, 9H) TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.67

[0977] 2.Preparation of compound 3A:

[0978] 2A 3A

[0979] To a solution of compound 2A (40 g, 181.48 mmol) in THF (800 mL) was added TBAF (1 M, 217.72 mL). The mixture was stirred at 25 °C for 12 h. TLC indicated compound 2A was consumed completely and one new spot formed. The reaction was clean according to TLC. Two reactions were combined for workup. The reaction mixture was partitioned between H2O (1000 mL) and Ethyl acetate (1000 mL). The organic phase was separated, washed with brine (300 mL), dried over , N fial2tSerOe4d and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 100: 1 to 10: 1). Compound 3A (25 g, 92.94% yield) was obtained as a yellow oil.

[0980] 'II NMR (400 MHz, CHLOROFORM-d, 25°C) 8 = 7.21-7 31 (m, 5H), 3 89 (s, 2H), 2 74 ppm (s, 1H)

[0981] TLC: Petroleum ether: Ethyl acetate = 1 : 0, Rf = 0.52

[0982] 3. Preparation of compound 4:

[0983] To a solution of compound 3A (15.39 g, 103.80 mmol) and compound 3 (24.5 g, 86.50 mmol) in DMF (115 mL) and THF (230 mL) was degassed and purged with N2 for 3 times, then DIEA (22.36 g, 173.00 mmol), Cui (32.95 g, 173.00 mmol) was added. The mixture was stirred at 25 °C for 12 h under N2 atmosphere. LCMS showed compound 3 was consumed completely and the desired mass was detected. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 100: 0 to 0: 1). Compound 4 (37.64 g, crude) was obtained as a yellow solid.

[0984] LCMS: (M+H+) = 432.1

[0985] TLC: Petroleum ether: Ethyl acetate = 1 : 3, Rf = 0.42

[0986] 4. Preparation of compound 5:

[0987] To a solution of compound 4 (74 g, 171.51 mmol) in Py (700 mL) was added AC2O (26.26 g, 257.26 mmol). The mixture was stirred at 15 °C for 12 h. TLC indicated compound 4 was consumed completely and one new spot formed. The reaction was clean according to TLC. Concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 100: 1 to 0: 1). Compound 5 (50 g, 61.57% yield) was obtained as a white solid.

[0988] ’H NMR (400 MHz, DMSO-d6, 25°C) 8 = 11.44-11.61 (m, 1H), 8.04 (s, 1H), 7.70 (d, J = 8.1 Hz, 1H), 7.13-7.32 (m, 5H), 5.81 (d, J = 5.7 Hz, 1H), 5.71 (dd, J = 8.0, 2.0 Hz, 1H), 5.23- 5.31 (m, 1H), 4.65-4.79 (m, 2H), 4.34-4.44 (m, 1H), 4.28 (t, J = 5.7 Hz, 1H), 4.11 (s, 2H), 3.29 (s, 3H), 2.09 ppm (s, 3H) LCMS: (M+H+) = 474.4

[0989] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.42

[0990] 5. Preparation of compound 6:

[0991] 5 6

[0992] NCS (30.46 g, 228.09 mmol) was added to a solution of compound 5 (40 g, 84.48 mmol) in AcOH (400 mL) and Water (200 mL) and the mixture stirred at 15 °C for 1 h. TLC indicated compound 5 was consumed completely and one new spot formed. The reaction was clean according to TLC. Water (500 mL) was added and the mixture was extracted with ethyl acetate (1000 mL). The organic phase was washed sequentially with a saturated aqueous sodium hydrogen carbonate solution (300 mL * 3) and brine (400 mL), then dried (MgSCh), concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 100: 1 to 0: 1). Compound 6 (30 g, 78.95% yield) was obtained as a white solid.

[0993] ’H NMR (400 MHz, DMSO-d6, 27°C) 8 = 11.50 (br s, 1H), 8.16 (d, J = 3.1 Hz, 1H), 7.65 (dd, J = 8.0, 4.5 Hz, 1H), 5.87 (d, J = 5.8 Hz, 1H), 5.77 (dd, J = 8.0, 2.0 Hz, 1H), 5.29-5.38 (m, 1H), 4.83 (br d, J = 6.0 Hz, 2H), 4.45-4.54 (m, 1H), 4.26 (td, J = 5.7, 2.5 Hz, 1H), 3.34 (d, J = 2.0 Hz, 3H), 2.14 ppm (d, J = 2.0 Hz, 3H) LCMS: (M+H+) = 450.2

[0994] TLC: (Petroleum ether: Ethyl acetate = 0: 1), Rf = 0.72

[0995] 6. Preparation of compound 7:

[0996] To a solution of compound 6 (17 g, 37.79 mmol) in isobutanol (70 mL) was added DIEA (9.77 g, 75.59 mmol, 13.17 mL) .The mixture was stirred at 60 °C for 12 h. LCMS showed compound 6 was consumed completely and desired mass was detected. The mixture was concentrated. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1). Compound 7 (3 g, 16.28% yield) was obtained as a yellow oil. ’H NMR (400 MHz, DMSO-d6) 6 = 11.48 (s, 1H), 9.04 (s, 1H), 7.80 - 7.71 (m, 1H), 5.80 (d, J = 5.8 Hz, 1H), 5.70 (dd, J = 1.8, 8.0 Hz, 1H), 5.28 (t, J = 4.9 Hz, 1H), 4.95 - 4.80 (m, 2H), 4.53 - 4.46 (m, 1H), 4.42 - 4.30 (m, 1H), 3.98 (d, J = 6.4 Hz, 2H), 3.28 (s, 3H), 2.08 (s, 3H), 1.88 (quind, J = 6.5, 13.1 Hz, 1H), 0.87 - 0.79 (m, 6H)

[0997] LCMS: (M+H+) = 488.1

[0998] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.31 7. Preparation of compound WV-NU-344: To a solution of compound 7 (3 g, 6.15 mmol) in MeOH (4 mL) H2O (1 mL) was added TEA (9 mL). The mixture was stirred at 25 °C for 12 h. LCMS showed compound 7 was consumed completely and desired mass was detected. The mixture was concentrated. The residue was purified by prep-HPLC (column: Waters Xbridge BEH C18 250 * 50mm * lOum; mobile phase: [H2O (10mM NH4HCO3]; gradient: 10% - 50% B over 10.0 min). Compound WV-NU-344 (0.37 g, 12.17% yield) was obtained as a white solid.

[0999] ’H NMR (400 MHz, DMSO-d6) 6 = 11.40 (s, 1H), 9.00 (s, 1H), 7.62 (d, J = 8.1 Hz, 1H), 5.80 (d, J = 4.9 Hz, 1H), 5.70 - 5.61 (m, 1H), 5.50 (d, J = 6.1 Hz, 1H), 4.90 - 4.74 (m, 2H), 4.27 - 4.14 (m, 2H), 4.01 - 3.95 (m, 3H), 3.38 (s, 3H), 1.90 (quind, J = 6.6, 13.2 Hz, 1H), 0.84 (d, J = 6.6 Hz, 6H) LCMS: (M+H+) = 446.1, purity: 90.17%

[1000] EXAMPLE 35. Synthesis of WV-NU-371

[1001] WV-NU-371

[1002] General Scheme:

[1003] 3 4

[1004] To a solution of compound 3 (20 g, 70.61 mmol) in DMF (200 mL) was added dropwise SEM- CI (35.32 g, 211.83 mmol, 37.49 mL) at 0 °C for 1 h. Then NaH (7.06 g, 176.53 mmol, 60% purity) was added dropwise at 0 °C. The resulting mixture was stirred at 25 °C for 10 h. TLC indicated compound 3 was consumed completely and new spot formed. The reaction mixture was quenched by aq. NH4CI (50 ml) at 0 °C and then the mixture was extracted with EtOAc (50 mL * 3), the combined organic layers were washed with aq. NaCl 50 mL * 3, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 : 0 to 1 : 1). Compound 4 (30 g, 78.13% yield) was obtained as a yellow oil.

[1005] ’H NMR (400 MHz, DMSO-d6) 6 = 7.83 (d, J = 8.1 Hz, 1H), 5.91 - 5.86 (m, 2H), 5.25 (s, 2H), 4.78 - 4.72 (m, 2H), 4.21 - 4.10 (m, 3H), 3.72 - 3.60 (m, 6H), 3.43 - 3.40 (m, 3H), 0.96 - 0.85 (m, 4H), 0.06 - 0.04 (m, 9H), 0.01 - -0.01 (m, 9H) TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.86

[1006] 2. Preparation of compound 5:

[1007] To a solution of compound 4 (30 g, 55.17 mmol) prop-2-yn-l-ol (6.45 g, 115.05 mmol, 6.80 mL) in t-BuOH (150 mL) and H2O (150 mL) was added CUSO4.5H2O (13.78 g, 55.17 mmol) and sodium ascorbate (10.93 g, 55.17 mmol). The mixture was stirred at 25 °C for 12 h. TLC indicated compound 4 was consumed completely and new spot formed. The reaction mixture was extracted with EtOAc (200 mL * 3) and H2O 200 mL, then the combined organic layers were dried over Na2SO4, filtered and concentrated. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1). Compound 5 (18 g, 54.39% yield) was obtained as a yellow oil.

[1008] ’H NMR (400 MHz, DMSO-d6) 6 = 8.02 (br s, 1H), 7.73 - 7.68 (m, 1H), 7.68 - 7.63 (m, 1H), 7.49 (br d, J = 7.4 Hz, 1H), 5.91 - 5.70 (m, 2H), 5.19 (br s, 3H), 4.71 (br s, 3H), 4.52 (br s, 2H), 4.32 (br s, 1H), 4.24 - 4.11 (m, 3H), 3.69 - 3.53 (m, 4H), 3.36 (s, 3H), 1.71 - 1.56 (m, 2H), 1.37 (qd, J = 7.4, 14.8 Hz, 2H), 0.90 (s, 4H), 0.86 - 0.81 (m, 2H), -0.02 (d, J = 18.8 Hz, 18H)

[1009] LCMS: (M+H+): 328.2

[1010] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.17

[1011] 3. Preparation of compound 6:

[1012] To a solution of compound 5 (18 g, 30.01 mmol) in DCM (400 mL) was added CB (11.94 g, 36.01 mmol) and PPhs (11.81 g, 45.01 mmol) at 0 °C. The mixture was stirred at 0 °C for 1 h. LCMS showed compound 5 was consumed completely and desired mass was detected. The mixture was concentrated. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 3: 0 to 0: 1). Compound 6 (12 g, 60.34% yield) was obtained as a yellow oil. ’H NMR (400 MHz, DMSO-d6) 6 = 7.73 - 7.70 (m, 1H), 7.68 - 7.65 (m, 1H), 7.59 (s, 1H), 5.86 - 5.77 (m, 2H), 5.19 (s, 1H), 4.83 - 4.67 (m, 4H), 4.22 (t, J = 6.5 Hz, 3H), 3.57 (br t, J = 7.9 Hz, 3H), 3.36 (br s, 4H), 1.68 - 1.60 (m, 2H), 1.41 - 1.33 (m, 2H), 0.85 - 0.81 (m, 2H), 0.00 (d, J = 1.5 Hz, 9H), -0.05 (s, 9H) LCMS: (M+H+): 662.2

[1013] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.75

[1014] 4. Preparation of compound 7:

[1015] To a solution of compound 6 (12 g, 18.11 mmol) in ACN (120 mL) was added triethyl phosphite (15.82 g, 95.21 mmol, 16.33 mL). The mixture was stirred at 80°C for 2 h. LCMS showed compound 6 was consumed completely and desired mass was detected. The mixture was concentrated. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 : 0 to 0: 1). Compound 7 (6 g, 46.03% yield) was obtained as a yellow oil.

[1016] ’H NMR (400 MHz, DMSO-d6) 6 = 7.92 (d, J = 2.3 Hz, 1H), 7.58 (d, J = 8.1 Hz, 1H), 5.87 - 5.78 (m, 2H), 5.18 (s, 2H), 4.78 - 4.67 (m, 4H), 4.35 - 4.26 (m, 1H), 4.16 (t, J = 5.5 Hz, 1H), 4.00 - 3.93 (m, 4H), 3.68 - 3.54 (m, 4H), 3.36 (s, 4H), 3.32 (s, 1H), 3.28 (s, 1H), 1.19 - 1.15 (m, 6H), 0.90 - 0.88 (m, 2H), 0.86 - 0.80 (m, 2H), 0.00 (s, 9H), -0.03 - -0.07 (m, 9H)31P NMR (162 MHz, DMSO-d6) 6 = 25 03 (s, IP)

[1017] LCMS: (M+H+): 720.4

[1018] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.16

[1019] 5. Preparation of compound WV-NU-371:

[1020]

[1021] To a solution of compound 7 (6 g, 8.33 mmol) in DCM (60 mL) was added TFA (9.50 g, 83.34 mmol, 6.19 mL). The mixture was stirred at 25 °C for 2 h. LCMS showed compound 7 was consumed completely and desired mass was detected. The mixture was concentrated.

[1022] The residue was purified by column chromatography (SiO2, Petroleum ether : Ethyl acetate = 1 : 0 to 1 : 1). Compound WV-NU-371 (2.9 g, 71.93% yield, 94.96% purity) was obtained as a yellow oil.

[1023] 1H NMR (400 MHz, DMSO-d6) 8 = 11.46 - 11.38 (m, 1H), 7.88 (d, J = 2.3 Hz, 1H), 7.56 (d, J = 8.1 Hz, 1H), 5.80 (d, J = 5.3 Hz, 1H), 5.68 - 5.65 (m, 1H), 5.50 (d, J = 5.8 Hz, 1H),

[1024] 4.78 - 4.60 (m, 2H), 4.16 - 4.09 (m, 2H), 4.03 - 3.92 (m, 4H), 3.82 (t, J = 5.0 Hz, 1H), 3.34 (s,

[1025] 3H), 3.33 - 3.27 (m, 2H), 1.19 - 1.15 (m, 6H)

[1026] 31P NMR (162 MHz, DMSO-d6) 8 = 25.08 (s, IP)

[1027] LCMS: (M+H+): 460.1, purity: 94.97% TLC: Dichloromethane: Methanol = 10: 1, Rf = 0.26

[1028] EXAMPLE 36. Synthesis of WV-NU-395

[1029] WV-NU-395

[1030] General Scheme:

[1031] 1. Preparation of compound 3 A:

[1032] To a solution of compound IB (30 g, 352.33 mmol) in THF (500 mL) was added dropwise n- BuLi (2.5 M, 140.93 mL) at -78 °C under N2. After addition, the mixture was stirred at this temperature for 10 min, and then 2,2,2-trifluoro-l-phenyl-ethanone (73.62 g, 422.80 mmol) was added dropwise at -78 °C, the mixture was stirred at this temperature for 10 min, 1- ethoxyphosphonoyloxyethane (72.99 g, 528.50 mmol) was added dropwise at -78 °C. The resulting mixture was stirred at 25°C for 12h. TLC indicated no of compound IB was remained, and one major new spot with larger polarity was detected. The each reaction mixture was added dropwise NH4CI 250 mL at 0 °C, and then diluted with water 1500 mL and extracted with EtOAc (400 mL * 3). The combined organic layers were dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 330 g SepaFlash® Silica Flash Column, Eluent of 0-10% Dichloromethane: Methanol @ 150 mL / min). (Plate 1, Dichloromethane : Methanol = 10: 1, Rf = 0.23). Compound 3A (7.3 g, 9.34% yield, 95% purity) was obtained as a yellow oil.

[1033] ’H NMR (400 MHz, CHLOROFORM-d) 6 = 4.12 - 4.05 (m, 5H), 3.13 - 2.99 (m, 1H), 2.93 (br s, 1H), 2.59 - 2.45 (m, 1H), 1.96 - 1.96 (m, 1H), 1.98 (s, 1H), 2.01 - 1.94 (m, 1H), 1.87 - 1.70 (m, 4H), 1.58 - 1.37 (m, 3H), 1.29 - 1.25 (m, 6H) TLC: Dichloromethane : Methanol = 10: 1, Rf = 0.23 2. Preparation of compound 2:

[1034] To a solution of compound 1 (100 g, 387.26 mmol) in DMF (1000 mL) was added IMIDAZOLE (131.82 g, 1.94 mol) then added TBSC1 (233.47 g, 1.55 mol) the reaction mixture was stirred at 25 °C for 2h. LCMS showed that compound 2 was consumed completely and the desired mass was detected. The reaction mixture was partitioned between Ethyl acetate (3L) and H2O (IL). The organic phase was separated, washed with brine (500 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. Compound 2 (188 g, crude) was obtained as a white solid.

[1035] LCMS(M+H+): 487.2

[1036] 3. Preparation of compound 3:

[1037] To a solution of compound 2 (188 g, 386.24 mmol) in THF (1200 mL) was added H2O (399 mL) and TFA (399 mL), the mixture was stirred at 0 °C for 4 h. TLC showed the product was detected. The reaction mixture was added NaHCCL IL then extracted with EtOAc 3000 mL (lOOOmL * 3), the combined organic layers were washed with H2O 3000 mL (1000 mL * 3), dried over Na2SO,4 filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 10: 1 to 0: 1). Compound 3 (79 g, 54.91% yield) was obtained as a white solid.

[1038] ’H NMR (400 MHz, CHLOROFORM-d) 8 = 9.56 (br s, 1H), 7.74 (d, J = 8.1 Hz, 1H), 5.79 - 5.68 (m, 2H), 4.35 (t, J = 5.3 Hz, 1H), 4.09 - 4.03 (m, 1H), 4.02 - 3.92 (m, 2H), 3.75 (dd, J = 2.0, 12.3 Hz, 1H), 3.49 (s, 3H), 0.91 (s, 9H), 0.11 (d, J = 5.0 Hz, 6H)

[1039] TLC: Petroleum ether : Ethyl acetate = 1 : 1, Rf = 0.38

[1040] 4. Preparation of compound 4:

[1041] A mixture of compound 3 (12.5 g, 33.56 mmol), IBX (18.79 g, 67.12 mmol) in ACN (100 mL) was degassed and purged with N2 for 3 times, and then the mixture was stirred at 50 °C for 6 h under N2 atmosphere. LCMS showed compound 3 was consumed completely desired mass was detected. The mixture was filtered to remove the insoluble. The filter liquor was concentrated in vacuum. Compound 4 (13 g, crude) was obtained as a yellow solid.

[1042] ’H NMR (400 MHz, CHLOROFORM-d) 8 = 9.70 - 9.62 (m, 1H), 7.96 - 7.88 (m, 1H), 7.57 (br d, J = 8.1 Hz, 1H), 5.71 - 5.62 (m, 2H), 4.45 - 4.39 (m, 1H), 4.32 - 4.26 (m, 1H), 3.86 - 3.79 (m, 1H), 3.78 - 3.74 (m, 1H), 3.35 - 3.30 (m, 3H), 0.82 - 0.79 (m, 10H), 0.03 - -0.01 (m, 6H)

[1043] LCMS(M+H+): 371.2

[1044] 5. Preparation of compound 5:

[1045] To a solution of compound 4 (10 g, 45.20 mmol) in MeOH (400 mL) was added dropwise AcOH (2.71 g, 45.20 mmol) and Cpd.3A (16.75 g, 45.20) at 20 °C, then NaBH3CN (4.26 g, 67.80 mmol) was added at 20 °C. The resulting mixture was stirred at 20 °C for 2 hr. LCMS showed compound 4 was consumed completely desired mass was detected. The reaction mixture was added dropwise H2O 200 mL at 0 °C, and then diluted with water 200 mL and extracted with EtOAc (200 mL * 3). The combined organic layers were dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (ISCO®; 330 g SepaFlash® Silica Flash Column, Eluent of 50- 100% Ethyl acetate: Petroleum ether gradient @ 150 mL / min) (Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.2). Compound 5 (5.5 g, 20.75% yield, 90% purity) was obtained as a yellow solid.

[1046] ’H NMR (400 MHz, DMSO-d6) 8 = 11.53 - 11.28 (m, 1H), 7.79 - 7.58 (m, 1H), 5.82 - 5.76 (m, 1H), 5.70 - 5.64 (m, 1H), 4.24 - 4.14 (m, 1H), 4.06 - 3.98 (m, 6H), 3.93 - 3.87 (m, 1H), 3.86 - 3.79 (m, 1H), 3.31 - 3.29 (m, 1H), 3.34 - 3.29 (m, 4H), 3.17 - 2.98 (m, 2H), 2.95 - 2.91 (m, 1H), 1.87 - 1.59 (m, 3H), 1.57 - 1.36 (m, 3H), 1.33 - 1.19 (m, 7H), 0.88 (d, J = 1.5 Hz, 9H), 0.11 - 0.07 (m, 6H), -1.56 - -1.83 (m, 1H) LCMS (M+H+): 576.4

[1047] 6. Preparation of WV-NU-395:

[1048] A mixture of compound 5 (10 g, 17.37 mmol), TBAF (1 M, 34.74 mL), and in THF (10 mL) was degassed and purged with N2 for 3 times, and then the mixture was stirred at 20 °C for 2h under N2 atmosphere. LCMS showed compound 5 was consumed completely desired mass was detected. The mixture was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (neutral condition; WePure Biotech XP tC18 150*40*7um;mobile phase: [EEO OmM NH4HCO3)-ACN]; gradient: 15%-55% B over 8.0 min ). WV-NU-395 (2.7 g, 32% yield, 95% purity) was obtained as a yellow solid.

[1049] Hl NMR (400 MHz, DMSO-d6) 8 = 11.45 - 11.31 (m, 1H), 7.88 - 7.59 (m, 1H), 5.88 - 5.72 (m, 1H), 5.69 - 5.60 (m, 1H), 5.20 - 5.12 (m, 1H), 4.06 - 3.97 (m, 5H), 3.87 - 3.77 (m, 2H), 3.39 - 3.35 (m, 3H), 3.13 - 2.89 (m, 3H), 3.00 - 2.87 (m, 1H), 1.84 - 1.63 (m, 3H), 1.63 - 1.46 (m, 3H), 1.27 - 1.19 (m, 7H)

[1050] 31P NMR (400 MHz, DMSO-d6) 8 = 27.24 - 27.18 (m, IP), 27.13 - 27.05 (m, IP)

[1051] LCMS (M+H+): 462.2, purity: 91.97% EXAMPLE 37. Synthesis of WV-NU-418

[1052] WV-NU-418

[1053] 1. Preparation of compound 1A: diethyl phosphonate

[1054] A mixture of compound A (20 g, 103.11 mmol), PPI13 (8.11 g, 30.93 mmol) and Pd (O Ac)2 (2.31 g, 10.31 mmol) in EtOH (200 mL) was degassed and purged with N2 for 3 times, then 1-ethoxyphosphonoyloxy ethane (31.33 g, 226.84 mmol) and TEA (20.87 g, 206.21 mmol) was added to the mixture. The mixture was stirred at 78 °C for 12 hr under N2 atmosphere. LCMS showed compound A was consumed completely and one main peak with desired mass was detected. The reaction mixture was quenched with Sat.NH-tCl (200 mL), and extracted with EtOAc 300 mL * 4. The combined organic layers were washed with brine 300 mL * 3, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1, Ethyl acetate: Methanol = 1 :0 to 10: 1). Compound 1A (9.17 g, 43.56% yield) was obtained as a white solid.

[1055] ’H NMR (400 MHz, CHLOROFORM-d) 8 = 11.22 (br d, J = 2.0 Hz, 1H), 7.90 (d, J = 1.2 Hz, 2H), 4.18 - 4.00 (m, 4H), 1.32 (t, J = 7.0 Hz, 6H)

[1056] 31P NMR (162 MHz, CHLOROFORM-d) 8 = 15.00 (s, IP)

[1057] LCMS (M+H+): 205.0

[1058] TLC: Ethyl acetate: Methanol = 10: 1, Rf = 0.5

[1059] To a solution of compound 1 (40 g, 154.90 mmol) in Pyridine (1000 mL) was added DMTC1 (57.73 g, 170.39 mmol). The mixture was stirred at 20 °C for 2 hr. TLC indicated compound 1 was consumed completely and one new spot formed. The reaction mixture was diluted with H2O 1500 mL and extracted with EtOAc 800 mL * 2. The combined organic layers were washed with brine 500 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 2 (58 g, 66.79% yield) was obtained as a yellow solid.

[1060] ’H NMR (400 MHz, DMSO-d6) 5 = 11.39 (s, 1H), 7.74 (d, J = 8.0 Hz, 1H), 7.40 - 7.36 (m, 2H), 7.32 (t, J = 7.6 Hz, 2H), 7.26 - 7.24 (m, 5H), 6.91 (d, J = 8.4 Hz, 4H), 5.82 (d, J = 3.4 Hz, 1H), 5.30 (d, J = 8.0 Hz, 1H), 5.23 (d, J = 7.0 Hz, 1H), 4.25 - 4.18 (m, 1H), 3.99 - 3.93 (m, 1H), 3.83 - 3.81 (m, 1H), 3.74 (s, 6H), 3.41 (s, 3H), 3.32 - 3.28 (m, 1H), 3.26 - 3.21 (m, 1H)

[1061] LCMS (M-H+): 559.2, LCMS purity: 97%

[1062] TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.6

[1063] To a solution of compound 2 (56 g, 99.89 mmol) in DMF (800 mL) was added NaH (9.19 g, 229.76 mmol, 60% purity) at 0 °C under N2 for 1 h, and SEM-C1 (38.31 g, 229.76 mmol) was added to the mixture at 0 °C under N2. The mixture was stirred at 0-25 °C for 11 h. LCMS showed compound 2 was consumed completely. The reaction mixture was diluted with NH4CI 500 mL. The residue was diluted with H2O 1000 mL extracted with EtOAc 500 mL *3. The combined organic layers were dried over , Na2SO4 concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCL, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 3 (60 g, 73.15% yield) was obtained as a yellow oil.

[1064] ’H NMR (400 MHz, DMSO-d6) 8 = 7.88 (d, J = 8.2 Hz, 1H), 7.39 - 7.35 (m, 2H), 7.32 (t, J = 7.6 Hz, 2H), 7.25 - 7.23 (m, 5H), 6.90 (d, J = 8.6 Hz, 4H), 5.84 (d, J = 2.6 Hz, 1H), 5.37 (d, J = 8.0 Hz, 1H), 5.19 (s, 2H), 4.69 - 4.66 (m, 2H), 4.30 - 4.25 (m, 1H), 4.12 - 4.09 (m, 1H), 4.00 - 3.98 (m, 1H), 3.74 (s, 6H), 3.61 - 3.58 (m, 2H), 3.57 - 3.48 (m, 3H), 3.41 (s, 3H), 0.87 - 0.80 (m, 5H), -0.04 (d, J = 2.0 Hz, 18H)

[1065] TLC: Petroleum ether: Ethyl acetate = 3: 1, Rf = 0.5

[1066] 3. Preparation of compound 4:

[1067] To a solution of compound 3 (60 g, 73.07 mmol) in MeOH (600 mL) was added AcOH (413.79 g, 6.89 mol) and H2O (103.45 g, 5.74 mol). The mixture was stirred at 20 °C for 2 hr. TLC indicated compound 3 was consumed completely and one new spot formed. The reaction mixture was concentrated under reduced pressure to remove MeOH. The residue was diluted with H2O 200 mL and extracted with EtOAc 100 mL * 3. The combined organic layers were washed with brine 100 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 4 (26 g, 68.59% yield) was obtained as a yellow oil.

[1068] ’H NMR (400 MHz, DMSO-d6) 8 = 8.09 (d, J = 8.2 Hz, 1H), 5.85 (d, J = 3.8 Hz, 1H), 5.80 (d, J = 8.0 Hz, 1H), 5.28 (t, J = 4.8 Hz, 1H), 5.20 (s, 2H), 4.70 (d, J = 1.0 Hz, 2H), 4.17 - 4.12 (m, 1H), 4.02 - 3.99 (m, 1H), 3.92 (t, J = 4.2 Hz, 1H), 3.76 - 3.70 (m, 1H), 3.68 - 3.62 (m, 1H), 3.61 - 3.54 (m, 4H), 3.39 (s, 3H), 0.91 - 0.81 (m, 4H), 0.00 (s, 9H), -0.04 (s, 9H) TLC: Petroleum ether: Ethyl acetate = 1 : 1, Rf = 0.4

[1069] To a solution of compound 4 (29 g, 55.90 mmol) in Pyridine (300 mL) was added DMAP (682.96 mg, 5.59 mmol) and TosCl (15.99 g, 83.86 mmol). The mixture was stirred at 30 °C for 12 hr. LCMS showed compound 4 was consumed completely. The reaction mixture was concentrated under reduced pressure to remove pyridine. The residue was diluted with H2O 500 mL and extracted with EtOAc 300 mL * 3. The combined organic layers were washed with brine 300 mL, dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 5 (26 g, 69.11% yield) was obtained as a yellow oil. ’H NMR (400 MHz, CHLOROFORM-d) 8 = 7.82 - 7.78 (m, 2H), 7.54 (d, J = 8.3 Hz, 1H), 7.38 (d, J = 8.1 Hz, 2H), 5.87 (s, 1H), 5.62 (d, J = 8.1 Hz, 1H), 5.40 - 5.37 (m, 1H), 5.36 - 5.32 (m, 1H), 4.71 (s, 2H), 4.46 - 4.41 (m, 1H), 4.36 - 4.32 (m, 1H), 4.30 - 4.26 (m, 1H), 4.00 (dd, J = 4.9, 8.7 Hz, 1H), 3.86 (d, J = 4.5 Hz, 1H), 3.75 - 3.71 (m, 1H), 3.71 - 3.67 (m, 2H), 3.66 (s, 1H), 3.60 (s, 3H), 2.47 (s, 3H), 1.00 - 0.96 (m, 2H), 0.96 - 0.91 (m, 2H), 0.03 - 0.01 (m, 9H), 0.00 (s, 9H)

[1070] TLC: Petroleum ether: Ethyl acetate = 3: 1, Rf =0.55

[1071] To a solution of compound 5 (26 g, 38.64 mmol) and 4-diethoxyphosphoryl-lH-pyrazole (9.15 g, 44.82 mmol) in DMF (200 mL) was added CS2CO3 (25.18 g, 77.27 mmol). The mixture was stirred at 80 °C for 12 hr. LCMS showed compound 5 was consumed completely and desired mass was detected. The reaction mixture was diluted with H2O 800 mL and extracted with EtOAc 300 mL * 3. The combined organic layers were washed with brine 500 mL *2, dried overNa2SO4 , filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography ( Si O2, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1). Compound 6 (20 g, 73.44% yield) was obtained as a colorless oil. ’H NMR (400 MHz, CHLOROFORM-d) 8 = 7.84 (d, J = 2.0 Hz, 1H), 7.75 (s, 1H), 6.31 (d, J = 8.4 Hz, 1H), 5.83 (d, J = 1.2 Hz, 1H), 5.65 (d, J = 8.0 Hz, 1H), 5.33 (q, J = 9.6 Hz, 2H), 4.89 - 4.85 (m, 1H), 4.82 - 4.78 (m, 1H), 4.61 - 4.55 (m, 1H), 4.54 - 4.48 (m, 1H), 4.41 - 4.35 (m, 1H), 4.15 - 4.09 (m, 4H), 4.00 (dd, J = 5.3, 8.6 Hz, 1H), 3.78 - 3.72 (m, 2H), 3.69 - 3.62 (m, 3H), 3.55 (s, 3H), 1.37 - 1.30 (m, 6H), 1.00 - 0.91 (m, 4H), 0.03 - 0.00 (m, 9H), - 0.01 - -0.04 (m, 9H)

[1072] 31P NMR (162 MHz, CHLOROFORM-d) 8 = 13.01 (s, IP)

[1073] LCMS (M+H+): 705.2, LCMS purity: 97%

[1074] TLC: Petroleum ether: Ethyl acetate = 0: 1, Rf = 0.25 - U- 8

[1075] To a solution of compound 6 (20 g, 28.37 mmol) in DCM (300 mL) was added TFA (32.35 g, 283.73 mmol, 21.08 mL). The mixture was stirred at 20 °C for 12 hr. LCMS showed compound 6 was consumed completely and desired mass was detected. The reaction mixture was concentrated under reduced pressure to remove DCM. The residue was purified by column chromatography (SiO2, Petroleum ether: Ethyl acetate = 1 :0 to 0: 1, Ethyl acetate: Methanol = 1 :0 to 8: 1). WV-NU-418 (10.74 g, 85.18% yield) was obtained as a white solid. ’H NMR (400 MHz, DMSO-d6) 8 = 11.40 (s, 1H), 8.15 (d, J = 1.9 Hz, 1H), 7.75 (s, 1H), 7.43 (d, J = 8.1 Hz, 1H), 5.80 (d, J = 5.0 Hz, 1H), 5.62 (d, J = 8.0 Hz, 1H), 5.44 (d, J = 5.8 Hz, 1H), 4.54 - 4.42 (m, 2H), 4.14 (qd, J = 5.0, 9.8 Hz, 2H), 4.00 - 3.92 (m, 4H), 3.80 (t, J = 4.9 Hz, 1H), 3.35 (s, 3H), 1.21 (dt, J = 1.7, 7.0 Hz, 6H)

[1076] 31P NMR (162 MHz, CHLOROFORM-d) 8 = 13.34 (s, IP)

[1077] LCMS (M+H+): 445.1, LCMS purity: 96.64% TLC: Ethyl acetate: Methanol = 10: 1, Rf = 0.3

[1078] EXAMPLE 38. Synthesis of WV-NU-380

[1079] WV-NU-380

[1080] Synthetic Scheme for (WV-NU-380)

[1081] WV-NU-380

[1082] Preparation ofN-(9-((2R,3R,4S,5S)-4-hydroxy-5-(iodomethyl)-3-methoxytetrahydrofuran- 2-yl)-9H-purin-6-yl)benzannde (WV-NU-380.02) :

[1083] To a stirred solution ofWV-NU-380.01 (10 g, 0.0259 mol) inN- Methyl -2- pyrrolidone (100 mL, 10 vol.), was added iodine (19.7 g, 0.07793 mol), PPhs (20 g, 0.07792 mol.) and imidazole (10.5 g 0.1558 mol.) at 25°C. Then resulting mixture was stirred at rt for 4 h. Progress of the reaction was monitored by TLC. After completion, the reaction was quenched with saturated sodium thiosulfate (100 mL), extracted with EtOAc (2 x 100 mL), washed with cold brine (2 X 80 mL), dried over Na2SO4 concentrated under reduced pressure. The crude material was purified by column chromatography over silica-gel (230-400 mesh) eluted in 4% MeOH in DCM to get an off white solid (WV-NU-380.02) (7.3 g, 57%), TLC Mobile phase details: 7% MeOH in DCM.1H NMR (400 MHz, DMSO-d6): 8 in ppm = 11.26 (s, 1H), 8.79 (s, 1H), 8.75 (s, 1H), 8.05 (m, 2H), 7.66 (t, 1H, JI = 7.4 Hz), 7.56 (m, 2H), 6.19 (d, 1H, JI = 5.8 Hz), 5.64 (d, 1H, JI = 5.6 Hz), 4.68 (t, 1H, JI = 5.4 Hz), 4.43 (dd, 1H, JI = 8.9 Hz, J2 = 5.2 Hz), 4.07 (m, 1H), 3.65 (dd, 1H, JI = 10.5 Hz, J2 = 6.0 Hz), 3.52 (dd, 1H, JI = 10.5 Hz, J2 =6.9 Hz), 3.36 (s, 3H). MS: m / z calcd for CI8HI8IN5O4, 495.3; found 496.5, [M+H]+.

[1084] Preparation of N-(9-((2R,3R,4R,5R)-5-(azidomethyl)-4-hydroxy-3- niethoxytetrahydrofuran-2-yl)-9H-purin-6-yl)benzamide (WV-NU-362-B):

[1085] To a stirred solution of (WV-NU-380.02) (18 g, 0.0363 mol) in dry DMF (288 mL, 16 vol.) was added sodium azide (2.36 g, 0.03634 mol) at 0°C. The resulting mixture was stirred at 40°C and kept for 4 h. Progress of the reaction was monitored by TLC. After that reaction was quenched with ice water (100 mL), extracted with EtOAc (3 x 80 mL), washed with cold brine (2 X 70 mL), dried over Na2SO4 and concentrated under reduced pressure. The crude was purified by column chromatography over silica-gel (230-400 mesh) eluted in 2% MeOH in DCM to get off white solid (WV-NU-380.03) (10.5 g, 70%) TLC Mobile phase details: 7% MeOH in DCM.1H NMR (500 MHz, DMSO-d6): 8 in ppm = 11.24 (s, 1H), 8.79 (s, 1H), 8.74 (s, 1H), 8.05 (m, 2H, JI = 7.6 Hz), 7.65 (t, 1H, JI = 7.6 Hz), 7.56 (t, 2H, JI = 7.6 Hz), 6.19 (d, 1H, JI = 5.5 Hz), 5.53 (d, 1H, JI = 5.5 Hz), 4.60 (t, 1H, JI = 5.2 Hz), 4.44 (q, 1H, JI = 5.0 Hz), 4.12 (m, 1H), 3.72 (q, 1H, JI = 6.7 Hz), 3.61 (dd, 1H, JI = 13.4 Hz, J2 =3.8 Hz), 3.38 (s, 3H). MS: m / z calcd for CI8HI8N8O4, 410.4; found 411.6 [M+H]+.

[1086] Preparation of (((!-(( (2R,3R, 4R, 5R) -5-(6-benzanudo-9H-purin-9-yl)-3-hydroxy-4-methoxy tetrahydrofuran-2-yl)methyl)-lH-l,2,3-triazol-4-yl)phosphoryl)bis(oxy))bis(methylene) bis(2,2dimethylpropanoate) (WV-NU-380):

[1087] The compound (WV-NU-380.03) (10 g, 0.0243 mol) and 5A (12.2 g, 0.0243 mol) was dissolved in a mixture of solvent (THF: Water) (1 : 1) (50 mL, 5 vol.) and water (50 mL, 5 vol.). Then the solution was degassed with nitrogen for 30 minutes at rt. After that sodium ascorbate (0.965 g, 0.00487 mol), CUSO4.5H2O (0.64 g, 0.00256 mol) was added to the solution. Then reaction mixture was allowed to 65°C for 6 h. Progress of the reaction was monitored by TLC. The reaction mass was diluted with EtOAc (80 mL), washed with water (2 x 30 mL), dried over Na2SO4 and concentrated under reduced pressure. The crude mass was purified by column chromatography over silica-gel (230-400 mesh) eluted in 2% MeOH in EtOAC to get light green solid (WV-NU-380) (9.2 g, 50%) TLC Mobile phase details: 7% MeOH in DCM. ' H NMR (500 MHz, DMSO-d6): 8 in ppm = 11.24 (s, 1H), 8.76 (d, 2H, JI = 19.3 Hz), 8.67 (s, 1H), 8.05 (d, 2H, JI = 7.6 Hz), 7.66 (t, 1H, JI = 7.2 Hz), 7.56 (t, 2H, JI = 7.6 Hz), 6.18 (d, 1H, JI = 4.8 Hz), 5.66 (m, 5H), 4.92 (m, 2H), 4.55 (td, 2H, JI = 9.6 Hz, JI = 4.6 Hz), 4.39 (m, 1H), 3.39 (s, 3H), 1.02 (s, 18H). MS: m / z calcd for C32H4IN80IIP, 744.7; found 745.9 [M+H]+calcd for C14H23O7P, 334.3; found 335.1 [M+H]+.

[1088] EXAMPLE 39. Synthesis of WV-NU-381

[1089] WV-NU-381

[1090] Synthetic Scheme for (WV-NU-381)

[1091] WV-NU-381

[1092] Preparation ofN-(l-((2R,3R,4S,5S)-4-hydroxy-5-(iodomethyl)-3-methoxytetrahydrofuran- 2-yl)-2-oxo-l,2-dihydropyrinudin-4-yl)acetanude (WV-NU-381-02) :

[1093] To a stirred solution of WV-NU-380-01 (20 g, 0.0668 mol) in dry THF (300 mL, 15 vol.), was added iodine (33.8 g, 0.1337 mol), PPI13 (35 g, 0.1337 mol.) and imidazole (27.2 g 0.4016 mol.) at 20°C. Then resulting mixture was stirred at rt for 20 h. Progress of the reaction was monitored by TLC. After completion, the reaction was quenched with saturated sodium thiosulfate (200 mL), extracted with EtOAc (2 x 150 mL), washed with brine (1 x 100 mL), dried over Na2SO4 and concentrated under reduced pressure. The crude compound was purified by column chromatography over silica-gel (230-400 mesh) eluted in 3% MeOH in DCM to get an off white solid (WV-NU-381-02) (17 g, 63%), TLC Mobile phase details: 5% MeOH in DCM. 'H NMR (500 MHz, DMSO-d6): 8 in ppm = 10.96 (s, 1H), 8.11 (d, 1H, JI = 7.6 Hz), 7.25 (s, 1H), 5.90 (d, 1H, JI = 2.8 Hz), 3.91 (t, 3H, JI = 3.1 Hz), 3.59 (dd, 1H, JI

[1094] = 10.3 Hz, J2 = 3.4 Hz), 3.49 (m, 1H), 3.11 (s, 3H), 2.11 (s, 3H). MS: m / z calcd for C12H16IN3O5, 409.18; found 410.1, [M+H]+. Preparation of N-(l-((2R,3R,4R,5R)-5-(azidomethyl)-4-hydroxy-3- methoxytetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl) acetamide (WV-NU-381- 03):

[1095] To a stirred solution of (WV-NU-381-02) (17 g, 0.0415 mol) in dry DMF (272 mL, 16 vol.) was added sodium azide (3.2 g, 0.0498 mol) at 0°C. Then resulting mixture was stirred at 40°C for 5 h. Progress of the reaction was monitored by TLC. Then reaction was quenched with ice water (150 mL), extracted with EtOAc (2 x 150 mL), washed with cold brine (2 X 100 mL), dried over Na2SO an4d concentrated under reduced pressure. The crude mass was purified by column chromatography over silica-gel (230-400 mesh) eluted in 3% MeOH in DCM to get off white solid (WV-NU-381-03) (9 g, 66%) TLC Mobile phase details: 7% MeOH in DCM. 'H NMR (500 MHz, DMSO-d6): 8 in ppm = 11.94 (s, 1H), 8.11 (t, 1H, JI = 7.2 Hz), 7.25 (q, 1H, JI = 4.1 Hz ), 5.88 (dd, 1H, JI = 15.1 Hz, J2 = 2.8 Hz), 5.39 (dd, 1H, JI = 41.0 Hz, J2 = 5.9 Hz), 3.98 (d, 2H, JI = 2.8 Hz), 3.91 (t, 1H, JI = 2.8 Hz), 3.83 (q, 1H, JI = 2.5 Hz), 3.66 (m, 2H), 3.43 (d, 3H, JI = 13.1 Hz), 2.11 (s, 3H). MS: m / z calcd for C12H16N6O5, 324.3; found 325.36 [M+H]+.

[1096] Preparation of (((l-(((2R,3R,4R,5R)-5-(4-acetamido-2-oxopyrimidin-l (2H)-yl)-3-hydroxy- 4-methoxytetrahydrofuran-2-yl)methyl)-lH-l,2,3-triazol-4-yl)phosphoryl)bis(oxy))bis- (methylene) bis(2,2-dimethylpropanoate) (WV-NU-381):

[1097] To a stirred solution of (WV-NU-381-03) (9 g, 0.0227 mol) and (WV-NU-380-B) (13.9 g 0.0416 mol) in mixture of solvent (1 : 1) THF (45 mL, 5 vol.), water (45 mL, 5 vol.) was degassed with nitrogen atmosphere for 25 minutes. Then added sodium ascorbate (0.1.09 g, 0.0055 mol), CUSO4.5H2O (0.69 g, 0.00277 mol) at rt. The reaction mixture was stirred at 65°C for 6 h. Progress of the reaction was monitored by TLC. The reaction mixture was cooled to rt and concentrated under reduced pressure The crude mass was purified by column chromatography over silica-gel (230-400 mesh) eluted in 3% MeOH in EtOAC to get light green solid (WV-NU-381) (9.2 g, 50%) TLC Mobile phase details: 7% MeOH in DCM. 'H NMR (400 MHz, DMSO-d6): 8 in ppm = 10.95 (s, 1H), 8.74 (s, 1H), 8.04 (d, 1H, JI = 7.6 Hz), 7.26 (d, 1H, JI = 6.9 Hz), 5.80 (d, 1H, JI = 2.8 Hz), 5.70 (s, 2H), 5.67 (s, 2H), 5.51 (d, 1H, JI = 6.9 Hz), 4.85 (m, 2H), 4.24 (m, 1H), 4.07 (d, 1H, JI = 6.2 Hz), 3.88 (m, 1H, JI = 3.4 Hz), 3.44 (s, 3H), 2.11 (s, 3H), 1.06 (s, 18H). MS: m / z calcd for C26H39N6O12P, 658.6; found 660.0 [M+H]+. EXAMPLE 40. Synthesis of WV-NU-382

[1098] Preparation ofN-(9-((2R,3R,4S,5S)-4-hydroxy-5-(iodomethyl)-3-methoxytetrahydrofuran- 2-yl)-6-oxo-6,9-dihydro-lH-purin-2-yl)isobutyramide (WV-NU-382-02) :

[1099] To a stirred solution of WV-NU-380-01 (25 g, 0.0681 mol) in dry THF (375 mL, 15 vol.), was added iodine (34.4 g, 0.1362 mol), PP i (35.6 g, 0.1362 mol.) and imidazole (27.8 g 0.4087 mol.) at 25°C. Then resulting mixture was stirred at rt for 20 h. Progress of the reaction was monitored by TLC. After completion, the reaction was quenched with saturated sodium thiosulfate (150 mL), extracted with EtOAc (2 x 150 mL), washed with brine (1 x 100 mL), dried over Na2SO4 and concentrated under reduced pressure. The crude compound was purified by column chromatography over silica-gel (230-400 mesh) eluted in 5% MeOH in DCM to get off white solid (WV-NU-382-02) (20 g, 61%), TLC Mobile phase details: 7% MeOH in DCM. 'H NMR (500 MHz, DMSO-d6): 8 in ppm = 12.08 (s, 1H), 11.64 (s, 1H), 8.29 (s, 1H), 5.93 (d, 1H, JI = 6.2 Hz), 5.57 (d, 1H, JI = 5.5 Hz), 4.47 (t, 1H, JI = 5.9 Hz), 4.32 (q, 1H, JI = 3.9 Hz), 4.02 (td, 1H, JI = 6.7 Hz, J2 = 3.0 Hz), 3.58 (dd, 1H, JI = 10.3 Hz, J2 = 6.9 Hz), 3.44 (dd, 1H, JI = 10.3 Hz, J2 = 6.9 Hz), 3.34 (s, 3H), 2.76 (m, 1H), 1.13 (d, 6H, JI = 6.2 Hz), MS: m / z calcd for C15H20IN5O5, 477.26; found 478.48, [M+H]+.

[1100] Preparation of N-(9-((2R,3R,4R,5R)-5-(azidomethyl)-4-hydroxy-3- methoxytetrahydrofuran-2-yl)-6-oxo-6,9-dihydro-lH-purin-2-yl)isobutyramide (WV-NU- 382-03):

[1101] To a stirred solution of (WV-NU-380-02) (20 g, 0.0417 mol) in dry DMF (320 mL, 16 vol.) was added sodium azide (3.28 g, 0.0503 mol) at 0°C. The resulting mixture was stirred 50°C and kept for 5 h. Progress of the reaction was monitored by TLC. Then reaction was quenched with ice water (200 mL), extracted with EtOAc (2 x 100 mL), washed with cold brine (2 X 100 mL), dried over Na2SO4 and concentrated under reduced pressure. The crude mass was purified by column chromatography over silica-gel (230-400 mesh) eluted in 3% MeOH in DCM to get off white solid (WV-NU-382-03) (11.5 g, 70%) TLC Mobile phase details: 7% MeOH in DCM. 'HNMR ^O MHz, DMSO-d6): 8 in ppm = 12.10 (s, 1H), 11.63 (s, 1H), 8.30 (s, 1H), 5.93 (d, 1H, JI = 6.2 Hz), 5.47 (d, 1H, JI = 5.1 Hz), 4.39 (dd, 1H, JI = 6.0 Hz, J2 = 5.2 Hz), 4.30 (dd, 1H, JI = 8.6 Hz, J2 = 4.9 Hz), 4.05 (m, 1H), 3.67 (q, 1H, JI = 6.6 Hz), 3.58 (dd, 1H, JI = 13.2 Hz, J2 = 4.1 Hz), 3.35 (s, 3H), 2.77 (m, 1H), 1.13 (dd, 6H, JI = 6.9 Hz, JI = 0.8 Hz), MS: m / z calcd for C15H20N8O5, 392.38; found 393.5, [M+H]+.

[1102] Preparation of (((l-(((2R,3R,4R,5R)-3-hydroxy-5-(2-isobutyranudo-6-oxo-l, 6-dihydro-9H- purin-9-yl)-4-methoxytetrahydrofuran-2-yl)methyl)-lH-l,2,3-triazol-4-yl)phosphoryl) bis(oxy))bis(methylene) bis(2,2-dimetbylpropanoate) (WV-NU-382):

[1103] To a stirred solution of (WV-NU-380-03) (11.5 g, 0.0293 mol) and (WV-NU-380-B) (14.6 g, 0.044 mol. ) in mixture of solvent (1 : 1) THF (57.5 mL, 5 vol.), water (57.5 mL, 5 vol.) was degassed with nitrogen atmosphere for 35 minutes. Then added sodium ascorbate (1.11 g, 0.0.00561 mol), CUSO4.5H2O (0.73 g, 0.00293 mol) at rt. The reaction mixture was stirred at 65°C for 6 h. Progress of the reaction was monitored by TLC. The reaction mixture was cooled to rt and concentrated under reduced pressure The crude mass was purified by column chromatography over silica-gel (230-400 mesh) eluted in 3% MeOH in EtOAC to get light green solid (WV-NU-382) (13.1 g, 61%) TLC Mobile phase details: 7% MeOH in DCM. 'H NMR (500 MHz, DMSO-d6): 8 in ppm = 12.10 (s, 1H), 11.60 (s, 1H), 8.66 (s, 1H), 8.29 (s, 1H), 5.93 (d, 1H, JI = 5.5 Hz), 5.65 (m, 5H), 4.84 (m, 2H), 4.46 (q, 1H, JI = 4.1 Hz), 4.36 (t, = 5.5 Hz), 4.32 (m, 1H), 3.36 (s, 3H), 2.75 (m, 1H), 1.1 l(d, 6H, JI = 6.9 Hz), 1.02

[1104] (s, 18H). MS: m / z calcd for C29H43N8O12P, 726.68; found 725.8 [M-H]+. EXAMPLE 41. Synthesis of WV-NU-389

[1105] Preparation of (2R,3R,3aS,9aR)-3-hydroxy-2-(hydroxymethyl)-2,3,3a,9a-tetrahydro- 6H-furo[2',3':4,5] oxazolo[3,2-c]pyrimidine-6,8(7H)-dione (WV-NU-302-02) :

[1106] To a stirred solution of Uridine (30 g, 0.122 mol) and diphenyl carbonate (26 g, 0.1229 mol.) in dry DMF (36 mL, 1.2 vol.) was added sodium bicarbonate (258 mg, 0.00307 mol) stirred at 130°C for 3 h. Progress of the reaction was monitored by TLC. Then reaction mixture was cooled to rt, precipitated product was observed, filtered and washed with cold methanol (2 x 15 mL), dried under vacuum to get as off white solid (WV-NU-301-02) (21 g, 70%). TLC Mobile phase details: 15% MeOH in DCM.1H NMR (500 MHz, DMSO-d6): 8 in ppm =7.83 (d, 1H, JI = 6.9 Hz), 6.30 (d, 1H, JI = 6.2 Hz), 5.88(s, 1H), 5.84 (d, 1H, JI = 6.9 Hz), 5.19 (d, 1H, JI = 5.5 Hz), 4.98 (t, 1H, JI = 5.2 Hz), 4.38 (s, 1H), 4.07 (t, 1H, JI = 4.5 Hz), 3.28 (m, 1H) 3.18 (m, 1H).

[1107] Preparation of (2R,3R,3aS,9aR)-2-(((tert-butyldiphenylsilyl)oxy)methyl)-3-hydroxy- 2,3,3a, 9a- tetrahydro-6H-furo[2',3':4,5]oxazolo[3,2-c]pyrimidine-6,8(7H)-dione(WV-

[1108] NU-301-03): To a stirred solution of (WV-NU-301-02) (40 g, 0.165 mol) and DMAP (2 g, 0.0165 mol.) in anhydrous pyridine (200 mL, 5 vol.) was added TBDPSC1 (63 mL, 0.247 mol.) dropwise over a period of 30 mins, at 0°C. Above reaction mixture was stirred at rt for 30 h. Progress of the reaction was monitored by TLC. The reaction was diluted with cold sat.NaHCO3 (150 mL) and extracted with DCM (2 x 200 mL), washed with brine (1 x 150 mL) solution, dried over Na2SO4 and concentrated under reduced pressure. The crude compound was purified by column chromatography over silica-gel...

Claims

CLAIMS1. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent comprising a guide strand and a passenger strand, wherein: the guide strand is complementary or substantially complementary to a target RNA sequence; the guide strand comprises a seed region at its 5 ’-end region that is capable of mediating the initial recognition of the target RNA sequence; the guide strand comprises a backbone phosphoryl guanidine (PN) chiral center in the seed region; and one or both of the guide strand and the passenger strand comprise a lipid ligand and / or a non-lipid ligand.

2. The dsRNAi agent of claim 1, wherein the seed region comprises nucleotides at positions 2-6, at positions 2-7, or at positions 2-8, relative to the 5 ’-end of the guide strand.

3. The dsRNAi agent of claim 1 or 2, wherein the backbone phosphoryl guanidine (PN) chiral center in the seed region of the guide strand is between the third (+3) nucleotide and the immediately downstream (+4) nucleotide, relative to the 5’ terminal nucleotide of the guide strand.

4. The dsRNAi agent of any of claims 1-3, wherein the backbone phosphoryl guanidine (PN) chiral center in the seed region of the guide strand is in the Sp configuration.

5. The dsRNAi agent of any of claims 1-4, wherein the backbone phosphoryl guanidine i i)=N— P=0 N 6(PN) chiral center in the seed region of the guide strand comprises the structure of1 ?(nOOl).

6. The dsRNAi agent of any of claims 1-5, wherein the passenger strand comprises a lipid ligand.

7. The dsRNAi agent of claim 6, wherein the passenger strand comprises one or more backbone phosphoryl guanidine (PN) chiral centers.

8. The dsRNAi agent of claim 7, wherein the passenger strand comprises a backbonephosphoryl guanidine (PN) chiral center between the +7 nucleotide and the immediately downstream (+8) nucleotide, and / or a backbone phosphoryl guanidine (PN) chiral center between the +15 nucleotide and the immediately downstream (+16) nucleotide.

9. The dsRNAi agent of claim 8, wherein the backbone phosphoryl guanidine (PN) chiral center between the +7 nucleotide and the +8 nucleotide, and / or the backbone phosphoryl guanidine (PN) chiral center between the +15 nucleotide and the +16 nucleotide, of the passenger strand, is / are in the Rp configuration.

10. The dsRNAi agent of any of claims 7-9, wherein said one or more backbone phosphoryl guanidine (PN) chiral centers is / are modified with one or two of the lipid ligand (backbone PN- lipid ligand).

11. The dsRNAi agent of any of claims 6-10, wherein the lipid ligand comprises a saturated or unsaturated, linear or branched Ce, Cs, Cio, C12, C14, Ci6, Cis, C20, C22, C24, C26, or C28 chain.

12. The dsRNAi agent of claim 10 or 11, wherein the backbone PN-lipid ligand is selected from the group consisting of: a mono PN-lipid, a bis PN-lipid, a mono PN-PEG lipid, a bis PN- PEG lipid, n003 comprising the structuren009 comprising the structuren029 comprising the structuren033 comprising the structuren039 comprising the structuren076 comprising the structuren077 comprising the structuren082 comprisingn083 comprising the structuren084 comprising the structuren086 comprising the structure ofn087 comprising the structuren088 comprising the structure ofn089 comprising the structure ofn090 comprising the structure ofn091 comprising the structure ofn092 comprising the structure ofand a PN-lipid comprising the structure of13. The dsRNAi agent of claim 12, wherein the mono PN-lipid comprises the structure of15. The dsRNAi agent of claim 12, wherein the mono PN-PEG lipid comprises the structure17. The dsRNAi agent of any of claims 1-16, wherein the passenger strand further comprises a backbone phosphorothioate (PS) chiral center between the 5’ terminal (+1) nucleotide and the immediately downstream (+2) nucleotide, and / or a backbone phosphorothioate (PS) chiral center between the 3 ’ terminal (N) nucleotide and the penultimate (N-l) nucleotide.

18. The dsRNAi agent of claim 17, wherein the backbone phosphorothioate (PS) chiral center between the 5’ terminal (+1) nucleotide and the immediately downstream (+2) nucleotide, and / or the backbone phosphorothioate (PS) chiral center between the 3’ terminal (N) nucleotide and the penultimate (N-l) nucleotide, of the passenger strand, is / are in the Sp configuration.

19. The dsRNAi agent of any of claims 1-18, wherein the guide strand further comprises a backbone phosphoryl guanidine (PN) chiral center between the +7 nucleotide and the +8 nucleotide, and / or a backbone phosphoryl guanidine (PN) chiral center between the +18 nucleotide and the +19 nucleotide.

20. The dsRNAi agent of claim 19, wherein the backbone phosphoryl guanidine (PN) chiral center between the +7 nucleotide and the +8 nucleotide, and / or the backbone phosphoryl guanidine (PN) chiral center between the +18 nucleotide and the +19 nucleotide, of the guide strand, is / are in the Sp configuration.

21. The dsRNAi agent of claim 19 or 20, wherein the backbone phosphoryl guanidine (PN) chiral center between the +7 nucleotide and the +8 nucleotide, and / or the backbone phosphorylguanidine (PN) chiral center between the +18 nucleotide and the +19 nucleotide, of the guide strand, comprises the structure22. The dsRNAi agent of any of claims 1-21, wherein the guide strand further comprises a backbone phosphorothioate (PS) chiral center between the 3’ terminal (N) nucleotide and the penultimate (N-l) nucleotide, between the +21 nucleotide and the +22 nucleotide, between the +20 nucleotide and the +21 nucleotide, and / or between the +19 nucleotide and the +20 nucleotide.

23. The dsRNAi agent of claim 22, wherein the backbone phosphorothioate (PS) chiral center between the 3’ terminal (N) nucleotide and the penultimate (N-l) nucleotide, between the +21 nucleotide and the +22 nucleotide, between the +20 nucleotide and +21 nucleotide, and / or between the +19 nucleotide and the +20 nucleotide, of the guide strand, is / are in the Sp configuration.

24. The dsRNAi agent of any of claims 1-23, wherein the guide strand further comprises a 5 ’ terminal modification.

25. The dsRNAi agent of claim 24, wherein the 5’ terminal modification is selected from the group consisting of:the base is A, C, G, T, U, abasic, or a modified nucleobase;R1is selected from H, OH, O-alkyl, (9-m ethyl (O-Me), F, O-methoxyethyl (MOE), and 2’-O,4’C-methylene-bridged or locked nucleic acid (2’,4’-BNA or LNA); andR2is selected from alkyl, methyl, ethyl, isopropyl, propyl, cyclohexyl, benzyl, phenyl, tolyl, xylyl, aryl, and arene group.

26. The dsRNAi agent of claim 25, wherein the 5’ terminal modification is triazolyl phosphonate or methyl phosphonate.

27. The dsRNAi agent of any of claims 1-26, wherein one or both of the guide strand and the passenger strand comprise a non-lipid ligand.

28. The dsRNAi agent of claim 27, wherein the non-lipid ligand is conjugated to the 5 ’-end and / or the 3 ’-end of one or both of the guide strand and the passenger strand.

29. The dsRNAi agent of claim 28, wherein the non-lipid ligand is conjugated to the 5 ’-end and / or the 3 ’-end of one or both of the guide strand and the passenger strand via a linker.

30. The dsRNAi agent of claim 28 or 29, wherein the non-lipid ligand is conjugated to the 5 ’-end of the passenger strand.

31. The dsRNAi agent of claim 29 or 30, wherein the linker comprises 6-aminohexanoyl (nC6o) moiety.

32. The dsRNAi agent of any of claims 29-31, wherein the linker further comprises a Cs chain.

33. The dsRNAi agent of any of claims 27-32, wherein the non-lipid ligand is a carbohydrate, a protein, a peptide, a polyamine, a peptide mimic, a receptor ligand, or a combination thereof.

34. The dsRNAi agent of claim 33, wherein the non-lipid ligand is a receptor ligand.

35. The dsRNAi agent of claim 34, wherein the receptor ligand is an integrin receptor ligand.

36. The dsRNAi agent of claim 35, wherein the integrin receptor ligand comprises the structure of(peptide-integrin receptor ligand).

37. The dsRNAi agent of claim 34, wherein the receptor ligand is a serotonin receptor ligand.

38. The dsRNAi agent of claim 37, wherein the serotonin receptor ligand comprises the structure39. The dsRNAi agent of claim 36, wherein the OMe-integrin receptor ligand is a mono- OMe-integrin receptor ligand, a bis-OMe-integrin receptor ligand, or a tri -OMe-integrin receptor ligand.

40. The dsRNAi agent of claim 36, wherein the Me-integrin receptor ligand is a mono-Me- integrin receptor ligand, a bis-Me-integrin receptor ligand, or a tri-Me-integrin receptor ligand.

41. The dsRNAi agent of claim 39, wherein the tri-OMe-integrin receptor ligand conjugated to the guide strand or the passenger strand comprises the structure of42. The dsRNAi agent of claim 40, wherein the tri-Me-integrin receptor ligand conjugated to the guide strand or the passenger strand comprises the structure of43. The dsRNAi agent of claim 36, wherein the peptide-integrin receptor ligand conjugated to the guide strand or the passenger strand comprises the structure of44. The dsRNAi agent of any of claims 27-43, wherein the backbone PN-lipid ligand between the +7 nucleotide and the +8 nucleotide, and / or the backbone phosphoryl guanidine(PN) chiral center between the +15 nucleotide and the +16 nucleotide, of the passenger strand, comprises the structurewhich is optionally in theRp configuration..

45. The dsRNAi agent of claim 33, wherein the non-lipid ligand is a carbohydrate.

46. The dsRNAi agent of claim 44, wherein the carbohydrate is a mono-GalNAc, a bis-GalNAc, a tri-GalNAc, a mannose derivative, a galactose derivative, a glucose sugar derivative, other saccharide derivatives or combinations thereof.

47. The dsRNAi agent of claim 46, wherein the carbohydrate is a tri-GalNAc.

48. The dsRNAi agent of any of claims 1-47, wherein the guide strand comprises a lipid ligand.

49. The dsRNAi agent of claim 48, wherein the lipid ligand is a phosphoryl guanidine-lipidligand (PN-lipid ligand).

50. The dsRNAi agent of claim 49, wherein the PN-lipid ligand is conjugated to the 5 ’-end of the guide strand (5 ’-end PN-lipid ligand) and / or the 3 ’-end of the guide strand (3 ’-end PN- lipid ligand).

51. The dsRNAi agent of claim 50, wherein the 5’-end PN-lipid ligand or the 3’-end PN- lipid ligand comprises one or two saturated or unsaturated, linear or branched C6, C8, C10, C12, C14, C16, C18, C20, C22, C24, C26, or C28 chain.

52. The dsRNAi agent of claim 51, wherein the 5’-end PN-lipid ligand or the 3’-end PN- lipid ligand comprises the structure53. The dsRNAi agent of any of claims 45-50, wherein the guide strand comprises a backbone phosphoryl guanidine (PN) chiral center between the +10 nucleotide and the +11 nucleotide thereof, and wherein the backbone guanidine (PN) chiral center between the +10 nucleotide and the +11 nucleotide of the guide strand optionally comprises the structure of54. The dsRNAi agent of claim 53, wherein the backbone phosphoryl guanidine (PN) chiral center between the +10 nucleotide and the +11 nucleotide of the guide strand is in the Rp configuration.

55. The dsRNAi agent of any of claims 6-26, wherein the passenger strand comprises a lipid ligand conjugated to its 5 ’-end and / or its 3 ’-end, and / or one or more intemucleotidic linkages thereof.

56. The dsRNAi agent of claim 55, wherein the lipid ligand is conjugated to the 5’-end and / or the 3 ’-end of the passenger strand via a linker.

57. The dsRNAi agent of claim 56, wherein the lipid ligand is conjugated to the 5 ’-end of the passenger strand, and wherein the linker comprises 6-aminohexanol (nC6o).

58. The dsRNAi agent of any of claims 55-57, wherein the lipid ligand comprises a saturated or unsaturated, linear or branched Ce, Cs, Cio, C12, C14, Ci6, Cis, C20, C22, C24, C26, or C28 chain, cholesterol or a lipophilic cholesterol derivative, palmitoyl moiety, octadecanoyl moiety, linoleoyl moiety, turbinaric acid moiety, 2-hexyldecanoyl moiety, 20-oxoicosanoyl moiety, or a combination thereof.

59. The dsRNAi agent of claim 58, wherein the lipid comprises the structure of60. The dsRNAi agent of claim 59, wherein the lipid ligand comprises an octadecanoyl (Cl 8) moiety.

61. The dsRNAi agent of any of claims 1-26, wherein one or both of the guide strand and the passenger strand comprise a modified sugar moiety.

62. The dsRNAi agent of claim 61, wherein the modified sugar moiety comprises a 2 ’ -lipid modification, 2’-F modification, 2’-OH modification, 2’-OMe modification, 2’-O-alkyl modification, 2’-M0E modification, DNA, LNA, UNA, GNA, or a homo-DNA.

63. The dsRNAi agent of claim 61 or 62, wherein the modified sugar moiety is at one or more positions.

64. The dsRNAi agent of any of claims 61-63, wherein the modified sugar is at one or more of: position +1, position +2, position + 3, position + 4, position +5, position +6, and position +7, relative to the 5 ’-end of the passenger strand.

65. The dsRNAi agent of any of claims 62-64, wherein the 2 ’-modification is ~L~, wherein L connects C2 and C4 of the sugar moiety.

66. The dsRNAi agent of any of claims 61-64, wherein the modified sugar moiety comprises a 2 ’-lipid modification.

67. The dsRNAi agent of claim 66, wherein the passenger strand comprises a modified sugar moiety comprising a 2 ’-lipid modification.

68. The dsRNAi agent of claim 66 or 67, wherein the modified sugar moiety comprising a 2 ’ -lipid modification is a 2 ’ -lipid modified ribose moiety.

69. The dsRNAi agent of any of claims 66-68, wherein the 2 ’-lipid modification comprises a saturated or unsaturated, linear or branched Ce, Cs, Cio, C12, C14, Ci6, Cis, C20, C22, C24, C26, or C28 chain.

70. The dsRNAi agent of claim 69, wherein the 2 ’ -lipid modified ribose moiety comprises71. The dsRNAi agent of claim 70, wherein the 2’-lipid modified ribose moiety comprisesthe structure of72. The dsRNAi agent of claim 70, wherein the 2 ’ -lipid modified ribose moiety comprisesthe structure of73. The dsRNAi agent of any of claims 66-72, wherein the 2’-lipid modification comprises2 ’-O-h exadecyl moiety.

74. The dsRNAi agent of any of claims 66-73, wherein the +7 nucleotide of the passenger strand comprises the 2 ’-lipid modification.

75. The dsRNAi agent of claim 74, wherein the passenger strand comprises nOOl, n009 or n033 between the +7 nucleotide and the +8 nucleotide thereof.

76. The dsRNAi agent of any of claims 1-26, wherein one or both of the guide strand and the passenger strand comprise a phosphoryl guanidine-lipid (PN-lipid) ligand at the 5 ’-end or the 3 ’-end thereof, wherein the PN-lipid ligand further comprises a non-cleavable linker.

77. The dsRNAi agent of claim 76, wherein the PN-lipid ligand comprising the non- cleavable linker is conjugated to the 5 ’-end of the passenger strand.

78. The dsRNAi agent of claim 76 or 77, wherein the PN-lipid ligand comprises one or two saturated or unsaturated Ce, Cs, Cio, C12, C14, Ci6, Cis, C20, C22, C24, C26, or C28 chains.

79. The dsRNAi agent of any of claims 76-77, wherein the non-cleavable linker is81. The dsRNAi agent of any of claims 76-80, wherein the non-cleavable linker is conjugated to the PN-lipid ligand via a phosphoester bond.

82. The dsRNAi agent of claim 81, wherein the PN-lipid ligand comprising the non- cleavable linker comprises the structure83. The dsRNAi agent of claim 82, wherein the PN-lipid ligand comprising the non- cleavable linker comprises the structure of84. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent comprising a guide strand and a passenger strand, wherein: the guide strand is complementary or substantially complementary to a target RNA sequence; and one or both of the guide strand and the passenger strand comprise one or more backbone phosphoryl guanidine (PN) chiral centers each independently comprising the structure ofnon-lipid variation (non-lipid PN variation) of.

85. The dsRNAi agent of claim 84, wherein one or both of the guide strand and the passenger strand comprise at least one non-lipid PN variation of nOOl.

86. The dsRNAi agent of claim 85, wherein the guide strand comprises at least one non-lipid PN variation of nOOl.

87. The dsRNAi agent of any of claims 84-86, wherein the guide strand further comprises a backbone phosphoryl guanidine (PN) chiral center between the +10 nucleotide and the +11 nucleotide thereof.

88. The dsRNAi agent of claim 87, wherein the backbone phosphoryl guanidine (PN) chiral center between the +10 nucleotide and the +11 nucleotide in the guide strand is in the Ap configuration.

89. The dsRNAi agent of claim 87 or 88, wherein the guide strand comprises at least one nonlipid PN variation of nOOl between the +3 nucleotide and the +4 nucleotide, and between the +10 nucleotide and the +11 nucleotide thereof.

90. The dsRNAi agent of any of claims 84-89, wherein the non-lipid PN-variation of nOOl91. The dsRNAi agent of any of claims 84-80-, wherein the passenger strand comprises a backbone phosphorothioate (PS) chiral center between the 5’ terminal (+1) nucleotide and the +2 nucleotide, and / or a backbone phosphorothioate (PS) chiral center between the 3’ terminal (N) nucleotide and the penultimate (N-l) nucleotide.

92. The dsRNAi agent of claim 91, wherein the PS chiral center between the 5’ terminal (+1) nucleotide and the +2 nucleotide, and / or between the 3’ terminal (N) nucleotide and the penultimate (N-l) nucleotide, of the passenger strand, is / are in the Sp configuration.

93. The dsRNAi agent of any of claims 84-92, wherein the guide strand further comprises a 5’ terminal modification selected from the group consisting ofthe base is A, C, G, T, U, abasic, or a modified nucleobase;R1is selected from H, OH, (9-alkyl, (9-methyl (O-Me), F, (9-methoxyethyl (MOE), and 2’-O,4’C-methylene-bridged or locked nucleic acid (2’,4’-BNA or LNA); andR2is selected from alkyl, methyl, ethyl, isopropyl, propyl, cyclohexyl, benzyl, phenyl, tolyl, xylyl, aryl, and arene group.

94. The dsRNAi agent of claim 93, wherein the 5’ terminal modification is triazolyl phosphonate or methyl phosphonate.

95. The dsRNAi agent of any of claims 1-26, wherein one or both of the guide strand and thepassenger strand comprise a hydrophilic or amphiphilic ligand.

96. The dsRNAi agent of claim 95, wherein one or both of the guide strand and the passenger strand comprise a hydrophilic or amphiphilic ligand conjugated to the 5’-end and / or the 3’-end thereof, and / or one or more internucleotidic linkages.

97. The dsRNAi agent of claim 95 or 96, wherein one or both of the guide strand and the passenger strand comprise a hydrophilic or amphiphilic ligand conjugated to the 5 ’-end thereof via a linker.

98. The dsRNAi agent of claim 97, wherein the linker comprises 6-aminohexanol (nC6o).

99. The dsRNAi agent of any of claims 95-98, wherein the hydrophilic or amphiphilic ligand is conjugated to the 5 ’-end of the passenger strand.

100. The dsRNAi agent of any of claims 95-98, wherein the hydrophilic or amphiphilic ligand101. The dsRNAi agent of any of claims 95-100, wherein one or both of the guide strand and the passenger strand comprise a hydrophilic or amphiphilic ligand conjugated to a backbone phosphoryl guanidine (PN) chiral center.

102. The dsRNAi agent of claim 101, wherein the passenger strand comprises a hydrophilic or amphiphilic ligand conjugated to a backbone PN chiral center.

103. The dsRNAi agent of claim 101 or 102 wherein the backbone PN chiral center is between the +7 nucleotide and the +8 nucleotide of the passenger strand.

104. The dsRNAi agent of claim 103, wherein the backbone PN chiral center between the +7 nucleotide and the +8 nucleotide of the passenger strand is in the Ap configuration.

105. The dsRNAi agent of any of claims 101-104, wherein the backbone PN chiral center comprising a hydrophilic or amphiphilic ligand conjugated thereto comprises the structure of106. The dsRNAi agent of any of the preceding claims, wherein the guide strand further comprises backbone PS chiral centers in Sp configuration between the 3’ terminal nucleotide and the penultimate (N-l) nucleotide and between the penultimate (N-l) nucleotide and the immediately upstream (N-2) nucleotide.

107. The dsRNAi agent of any of the preceding claims, wherein the guide strand further comprises a backbone PN chiral center in the Rp configuration between the +10 nucleotide and the +11 nucleotide.

108. The dsRNAi agent of any of the preceding claims, wherein the guide strand comprises one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage occurs between any two adjacent nucleotides between the second (+2) nucleotide relative to the 5’ terminal nucleotide of the guide strand and the penultimate 3’ (N-l) nucleotide of the guide strand, where N is the 3’ terminal nucleotide.

109. The dsRNAi agent of any of the preceding claims, wherein the guide strand comprises a 2’ modification, of the 3 ’ nucleotide of a nucleotide pair linked by an Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage.

110. The dsRNAi agent of any of the preceding claims, wherein the guide strand comprises an Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage between the tenth (+10) and eleventh (+11) nucleotides, relative to the 5’ terminal nucleotide.

111. The dsRNAi agent of any of the preceding claims, wherein the guide strand comprises an Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage between the seventh (+7) and eighth (+8) nucleotides, relative to the 5’ terminal nucleotide.

112. The dsRNAi agent of any of the preceding claims, wherein the guide strand comprises one or more backbone phosphorothioate chiral centers in Rp or Sp configuration where linkage occurs between any two adjacent nucleotides between the penultimate 3’ nucleotide of the guide strand, where N is the 3’ terminal nucleotide, and the upstream N-10 nucleotide.

113. The dsRNAi agent of any of the preceding claims, wherein the passenger strand comprises one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage occurs upstream, i.e., in the 5’ direction, relative to the central nucleotide of the passenger strand.

114. The dsRNAi agent of any of the preceding claims, wherein the passenger strand comprises one or more Rp, Sp, or stereorandom non-negatively charged internucleotidic linkage occurs downstream, i.e., in the 3’ direction, relative to the central nucleotide of the passenger strand.

115. The dsRNAi agent of any of the preceding claims, wherein the passenger strand comprises one or more backbone phosphorothioate chiral centers in Rp or Sp configuration internucleotidic linkage occurs upstream, i.e., in the 5’ direction, relative to the central nucleotide of the passenger strand.

116. The dsRNAi agent of any of the preceding claims, wherein the passenger strand comprises one or more backbone phosphorothioate chiral centers in Rp or Sp configuration internucleotidic linkage internucleotidic linkage occurs downstream, i.e., in the 3’ direction, relative to the central nucleotide of the passenger strand.

117. The dsRNAi agent of any of the preceding claims, wherein the passenger strand in combination with one or more of the aforementioned guide strands, comprises one or more modified sugars between the 5’ terminal (+1) nucleotide and the penultimate (N-l) nucleotide.

118. The dsRNAi agent of any of the preceding claims, wherein the passenger strand comprises one or more of:0-n Rp, Sp, or stereorandom non-negatively charged internucleotidic linkages, where n is about 1 to 49; one or more backbone chiral centers in Rp or Sp configuration; one or more backbone phosphoryl guanidine chiral centers in the Rp configuration between the +7 nucleotide and the immediately downstream (+8) nucleotide, i.e., in the 3’ direction; one or more backbone phosphoryl guanidine chiral centers in the Rp configuration between the +15 nucleotide and the immediately downstream (+16) nucleotide, i.e., in the 3’ direction; and / or backbone phosphorothioate chiral centers in the Sp configuration between the 5’ terminal (+1) nucleotide and the immediately downstream, i.e., in the 3’ direction, (+2) nucleotide and between the 3’ terminal nucleotide and the penultimate (N-l) nucleotide.

119. The dsRNAi agent of any of the preceding claims, wherein each strand of the dsRNAi agent independently has a length of about 15 to about 49 nucleotides.

120. The dsRNAi agent of any of the preceding claims, wherein the Rp, Sp, or stereorandom non-negatively charged backbone internucleotidic linkages have neutral charge.

121. The dsRNAi agent of claim 120, wherein the neutral backbone internucleotidic linkagewherein n is about 0 to 49 and m is about 0 to 49.

122. The dsRNAi agent of claim 121, wherein the guide strand comprises a linkage having the following structurebetween the third (+3) and fourth (+4) nucleotides of the guide strand, between the tenth (+10) and eleventh (+11) nucleotides of the guide strand, or both.

123. The dsRNAi agent of claim 121, wherein the guide strand comprises a linkage having the following structurebetween the third (+3) and fourth (+4) nucleotides of the guide strand, between the seventh (+7) and eighth (+8) nucleotides of the guide strand, between the tenth (+10) and eleventh (+11) nucleotides of the guide strand, between the eighteenth (+18) and nineteenth (+19) nucleotides of the guide strand, or combinations thereof.

124. The dsRNAi agent of claim 121, wherein the passenger strand comprises a linkage having the following structureabout 0 to 49 and m is about 0 to 49, at 5’ to the central nucleotide of the passenger strand, 3’ to the central nucleotide of the passenger strand, or both.

125. The dsRNAi agent of claim 121, wherein the passenger strand comprises a linkagehaving the following structure, wherein n is about 11 to 49 and m is 0.

126. The dsRNAi agent of claim 125, wherein n is 11 or 15.

127. The dsRNAi agent of any of the preceding claims, wherein the passenger strand comprises: i. a non-negatively charged backbone internucleotidic linkage in the Rp configuration between the +7 nucleotide and the +8 nucleotide; ii. a non-negatively charged backbone internucleotidic linkage in the Rp configuration between the +15 nucleotide and the +16 nucleotide; and / or iii. backbone phosphorothioate chiral centers in the Sp configuration between the 5’ terminal (+1) nucleotide and the +2 nucleotide and between the 3’ terminal nucleotide and the penultimate (N-l) nucleotide.

128. The dsRNAi agent of any of the preceding claims, wherein the passenger strand comprises:the Rp configuration between the +7 nucleotide and the +8 nucleotide; ii.the Rp configuration between the +15 nucleotide and the +16 nucleotide; and iii. backbone phosphorothioate chiral centers in the Sp configuration between the +1 nucleotide and the +2 nucleotide and between the 3 ’ terminal nucleotide and the penultimate (N-l) nucleotide.

129. The dsRNAi agent of any of the preceding claims, wherein the passenger strand comprises:in the Rp configuration between the +7 nucleotide and the +8 nucleotide; and ii. backbone phosphorothioate chiral centers in the Sp configuration between the +1 nucleotide and the +2 nucleotide and between the 3 ’ terminal nucleotide and the penultimate (N-l) nucleotide.

130. A method for reducing level and / or activity of a transcript or a protein encoded thereby in a cell of a first tissue and a cell of a second tissue, comprising administering to the cells expressing the transcript a dsRNAi agent of any of the preceding claims, wherein the guide strand of the dsRNAi agent comprises a targeting-binding sequence that is completely complementary to a target sequence in the transcript.

131. The method of claim 131 wherein the cell is a liver cell, kidney cell, heart cell, white adipose cell, brown adipose cell, muscle cell, diaphragm cell, lung cell, sciatic nerve cell, pancreas cell, central nervous system cell, or spleen cell.

132. A method for allele-specific suppression of a transcript from a nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of: contacting a sample comprising transcripts of the target nucleic acid sequence with a dsRNAi agent of any of the preceding claims, wherein the guide strand of the dsRNAi agent comprises a targeting-binding sequence that is identical or completely complementary to a target sequence in the nucleic acid sequence, which target sequence comprises a characteristic sequence element that defines a particular allele, andwherein when the guide strand of the dsRNAi agent is contacted with a cell comprising transcripts of both the target allele and another allele of the same nucleic acid sequence, transcripts of the particular allele are suppressed at a greater level than a level of suppression observed for another allele of the same nucleic acid sequence.

133. A method for allele-specific suppression of a transcript from a nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of: administering to a subject comprising transcripts of the target nucleic acid sequence with a dsRNAi agent of any of the preceding claims, wherein the guide strand of the dsRNAi agent comprises a targeting-binding sequence that is identical or completely complementary to a target sequence in the nucleic acid sequence, which target sequence comprises a characteristic sequence element that defines a particular allele, and wherein when the guide strand of the dsRNAi agent is contacted with a cell comprising transcripts of both the target allele and another allele of the same nucleic acid sequence, transcripts of the particular allele are suppressed at a greater level than a level of suppression observed for another allele of the same nucleic acid sequence.

134. The method of any of claims 130-133, wherein when the dsRNAi agent is contacted with a cell comprising transcripts of both the target allele and another allele of the same nucleic acid sequence, it shows suppression of transcripts of the particular allele at a level that is: greater than when the dsRNAi agent is absent; greater than a level of suppression observed for another allele of the same nucleic acid sequence; or both greater than when the dsRNAi agent is absent, and greater than a level of suppression observed for another allele of the same nucleic acid sequence.

135. The method of claim 133, wherein the cell is a liver cell, kidney cell, heart cell, white adipose cell, brown adipose cell, muscle cell, diaphragm cell, lung cell, sciatic nerve cell, pancreas cell, central nervous system cell, or spleen cell.

136. The method of any of claims 131-135, wherein suppression of transcripts of the particular allele is at a level that is both greater than when the dsRNAi agent is absent, and greater than a level of suppression observed for another allele of the same nucleic acid sequence.

137. The method of claim 130 further comprising reducing level and / or activity of a transcript or a protein encoded thereby in a cell of a third tissue and a fourth tissue, comprising administering to the cells of the first, second, third, and fourth tissues expressing the transcript a dsRNAi agent of any of the preceding claims, wherein the guide strand of the dsRNAi agent comprises a targeting-binding sequence that is completely complementary to a target sequence in the transcript.

138. The method of claim 137, wherein the cell of a third and a fourth tissue is a liver cell, kidney cell, heart cell, white adipose cell, brown adipose cell, muscle cell, diaphragm cell, lung cell, sciatic nerve cell, pancreas cell, central nervous system cell, or spleen cell.