Inhibitors of expression and / or function
Patent Information
- Application Number
- CA3323637
- Authority / Receiving Office
- CA · CA
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-20
- Filing Date
- 2025-03-28
- Publication Date
- 2025-10-02
AI Technical Summary
Current therapeutic approaches for diseases related to the NR3C2 gene, such as heart failure and ischemic heart diseases, lack effective inhibitors that can specifically target and modulate its expression or function.
Development of nucleic acid compounds, particularly siRNA oligomers, designed to inhibit the expression of the NR3C2 gene by forming duplex regions with complementary strands, optionally conjugated with ligand moieties like GalNAc, to treat and prevent conditions such as heart failure and myocardial infarction.
The siRNA oligomers effectively inhibit NR3C2 expression, providing therapeutic benefits in treating heart failure and reducing infarct size and reperfusion arrhythmias post-myocardial infarction, offering a targeted and specific treatment modality.
Abstract
Description
INHIBITORS OF EXPRESSION AND / OR FUNCTIONTECHNICAL FIELD
[0001] The disclosure relates generally to biology and medicine, and more particularly it provides inhibitors, such as nucleic acid compounds, such as siRNA, suitable for therapeutic use. Such use is the inhibition, reduction, or beneficial modulation certain gene(s). Additionally, the present invention provides methods of making these compounds, as well as methods of using such compounds for the treatment of various diseases and conditions.BACKGROUND OF THE INVENTION
[0002] Inhibitors, such as oligonucleoside / oligonucleotide compounds which are inhibitors of gene expression and / or expression or function of other targets such as LNCRNAs, can have important therapeutic applications in medicine. Oligonucleotides / oligonucleosides can be used to silence genes that are responsible for a particular disease, condition or related disorder. Gene-silencing prevents formation of a protein by inhibiting translation. Importantly, gene-silencing agents are a promising alternative to traditional small, organic compounds that inhibit the function of the protein linked to the disease. siRNA, antisense RNA, and micro-RNA are oligonucleoside / oligonucleotides that prevent the formation of proteins by gene-silencing.
[0003] A number of modified siRNA compounds in particular have been developed in the last two decades for diagnostic and therapeutic purposes, including siRNA / RNAi therapeutic agents for the treatment of various diseases including liver diseases, central-nervous-system diseases, inflammatory diseases, metabolic disorders, oncology, infectious diseases, and ocular diseases.
[0004] The present invention relates to inhibitors, such oligomers e.g., nucleic acids, e.g., oligonucleoside / oligonucleotide compounds, and their use in the treatment and / or prevention of disease.
[0005] The present invention relates to nucleic acid compounds that inhibit the expression of the gene NR3C2, for use in the treatment and / or prevention of disease.
[0006] In humans the NR3C2 gene is located on chromosome 4 at q31.23 and encodes the nuclear receptor subfamily 3 group C member 2 protein, also known as mineralocorticoid receptor. The protein functions as a ligand-dependent transcription factor that mediates the effects of aldosterone in a variety of target tissues, including the distal parts of the nephron, the distal colon, the cardiovascular and central nervous systems, and brown adipose tissue. In addition, the target tissues include the heart and liver.STATEMENTS OF INVENTION
[0007] The invention is defined as in the claims and relates to, inter alia'.
[0008] In one aspect (Aspect A), there is provided a nucleic acid for inhibiting expression of NR3C2, comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the NR3C2 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand sequences as listed in Table 2.
[0009] In a further aspect (Aspect B), there is provided a nucleic acid for inhibiting expression of NR3C2, comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the NR3C2 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand modified sequences as listed in Table 3.
[0010] In a further aspect, there is provided a nucleic acid as described herein, wherein the first strand comprises nucleosides 2-18 of any one of the sequences according to the above Aspect A or Aspect B of the present invention, in particular wherein the first strand comprises nucleosides 2-18 of any one of the sequences defined in Tables 2 or 3.
[0011] In a further aspect, there is provided a nucleic acid according to the above Aspect A of the present invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand sequences as listed in Table 2, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.
[0012] In a further aspect, there is provided a nucleic acid according to the above Aspect B of the present invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand modified sequences as listed in Table 4, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.
[0013] In a further aspect, there is provided a nucleic acid according to the above Aspect A of the present invention, wherein the first strand comprises any one of the first strand sequences as listed in Table 2.
[0014] In a further aspect, there is provided a nucleic acid according to the above Aspect B of the present invention, wherein the first strand comprises any one of the first strand modified sequences as listed in Table 3.
[0015] In a further aspect, there is provided a nucleic acid according to the above Aspect A of the present invention, wherein the second strand comprises any one of the second strand sequences as listed in Table 2.
[0016] In a further aspect, there is provided a nucleic acid according to the above Aspect B of the present invention, wherein the second strand comprises any one of the second strand modified sequences as listed in Table 4.
[0017] In a further aspect, there is provided a nucleic acid according to the invention, wherein the first strand has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides.
[0018] In a further aspect, there is provided a nucleic acid according to the invention, wherein the second strand has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 or 23 nucleosides.
[0019] In a further aspect, there is provided a nucleic acid according to the invention, wherein the duplex region of the nucleic acid is between 17 and 30 nucleosides in length, more preferably is 19 or 21 or 23 nucleosides in length.
[0020] In a further aspect, there is provided a nucleic acid according to the invention, wherein the region of complementarity between the first strand and the portion of RNA transcribed from the NR3C2 gene is between 17 and 30 nucleosides in length.
[0021] In a further aspect, there is provided a nucleic acid according to the invention, wherein the nucleic acid further comprises one or more single -stranded nucleoside overhangs, optionally wherein the overhang is present on the first or second strand, preferably at the 3 ’ terminus of the first or second strand, and / or wherein the overhang comprises 1 to 4 nucleosides, more preferably 2 nucleosides.
[0022] In a further aspect, there is provided a nucleic acid according to the invention, wherein the nucleic acid is an siRNA oligonucleoside.
[0023] In a further aspect, there is provided a nucleic acid according to the invention, wherein the second strand comprises 2 consecutive abasic nucleosides in the 5 ’ terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 5 ’ terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 5’ terminal region of the second strand, wherein:(a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 5’ near terminal region through a reversed intemucleoside linkage; and(b) the reversed linkage is a 5-5’ reversed linkage; and(c) the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.
[0024] In a further aspect, there is provided a nucleic acid according to the invention, wherein:(i) the first strand and the second strand each has a length of 23 nucleosides;(ii) two phosphorothioate intemucleoside linkages are respectively between three consecutive positions in said 5 ’ near terminal region of the second strand, wherein a first phosphorothioate intemucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 5 ’ near terminal region of the second strand, and a second phosphorothioate intemucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 5’ near terminal region of the second strand;(iii) two phosphorothioate intemucleoside linkages are respectively between three consecutive positions in both 5 ’ and 3 ’ terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5’ and 3’ terminal regions of said first strand is each attached to a respective 5’ and 3’ adjacent penultimate nucleoside by a phosphorothioate intemucleoside linkage, and each first 5 ’ and 3 ’ penultimate nucleoside is attached to a respective 5’ and 3’ adjacent antepenultimate nucleoside by a phosphorothioate intemucleoside linkage; and(iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 3’ terminal region of the second strand.
[0025] In a further aspect, there is provided a nucleic acid according to the invention, wherein the 2 consecutive inverted abasic nucleosides in the 5’ terminal region of the second strand present as the following 5 ’ terminal motif:wherein:T represents a 2’Me ribose modification,B represents the nucleoside bases of the first two basic nucleosides in the 5' terminal region of the second strand, andZ represents the remaining 19 contiguous basic nucleosides of said second strand.
[0026] In a further aspect, there is provided a nucleic acid according to the invention, wherein the nucleic acid is conjugated directly or indirectly to one or more ligand moieties, optionally wherein said ligand moiety is present at a terminal region of the second strand, preferably at the 3 ’ terminal region thereof.
[0027] In a further aspect, there is provided a nucleic acid according to the invention, wherein the ligand moiety comprises:(i) one or more N-acetyl galactosamine (GalNAc) ligands, and / or(ii) one or more N-acetyl galactosamine (GalNAc) ligand derivatives.
[0028] In a further aspect, there is provided a nucleic acid according to the invention, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5’ or 3’ terminal region of the second strand of the nucleic acid, preferably at the 3’ terminal region thereof.
[0029] In a further aspect, there is provided a nucleic acid according to the invention, comprising the structure:wherein:R1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl;R2 is selected from the group consisting of hydrogen, hydroxy, -OCl-3alkyl, -C(=O)OCl-3alkyl, halo and nitro;XI and X2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that:(i) q and r cannot both be 0 at the same time; and(ii) s, t, and v cannot all be 0 at the same time;Z is an oligonucleoside moiety.
[0030] In a further aspect, there is provided a nucleic acid according to the invention, comprising the structure:wherein oligonucleotide represents the contiguous nucleosides of the second strand.
[0031] In a further aspect, there is provided a nucleic acid according to the invention, comprising the structure:wherein: r and s are independently an integer selected from 1 to 16; andZ is an oligonucleoside moiety.
[0032] In a further aspect, there is provided a nucleic acid according to the invention, comprising the structure:wherein oligonucleotide represents the contiguous nucleosides of the second strand.
[0033] In a further aspect, there is provided a nucleic acid according to the invention, wherein the structure is conjugated to the 3’ terminal region of the second strand.
[0034] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 290, SEQ ID NO: 270, SEQ ID NO: 238, SEQ ID NO: 245, SEQ ID NO: 283, SEQ ID NO: 235, SEQ ID NO: 226, SEQ ID NO: 335, SEQ ID NO: 228 or SEQ ID NO: 410.
[0035] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 290, SEQ ID NO: 270, SEQ ID NO: 238, SEQ ID NO: 245 or SEQ ID NO: 283.
[0036] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises SEQ ID NO: 290.
[0037] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises SEQ ID NO: 270.
[0038] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 736, SEQ ID NO: 716, SEQ ID NO: 684, SEQ ID NO: 691, SEQ ID NO: 729, SEQ ID NO: 681, SEQ ID NO: 672, SEQ ID NO: 781, SEQ ID NO: 674 or SEQ ID NO: 856.
[0039] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 736, SEQ ID NO: 716, SEQ ID NO: 684, SEQ ID NO: 691 or SEQ ID NO: 729.
[0040] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises SEQ ID NO: 736.
[0041] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises SEQ ID NO: 716.
[0042] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 513, SEQ ID NO: 493, SEQ ID NO: 461, SEQ ID NO: 468, SEQ ID NO: 506, SEQ ID NO: 458, SEQ ID NO: 449, SEQ ID NO: 558, SEQ ID NO: 451 or SEQ ID NO: 633.
[0043] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 513, SEQ ID NO: 493, SEQ ID NO: 461, SEQ ID NO: 468 or SEQ ID NO: 506.
[0044] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises SEQ ID NO: 513.
[0045] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises SEQ ID NO: 493.
[0046] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 959, SEQ ID NO: 939, SEQ ID NO: 907, SEQ ID NO: 914, SEQ ID NO: 952, SEQ ID NO: 904, SEQ ID NO: 895, SEQ ID NO: 1004, SEQ ID NO: 897, SEQ ID NO: 897 or SEQ ID NO: 1079.
[0047] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 959, SEQ ID NO: 939, SEQ ID NO: 907, SEQ ID NO: 914 or SEQ ID NO: 952.
[0048] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises SEQ ID NO: 959.
[0049] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises SEQ ID NO: 939.
[0050] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0051] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0052] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:
[0053] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:
[0054] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0055] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0056] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:
[0057] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:
[0058] In a further aspect, there is provided a conjugate for inhibiting expression of NR3C2 target gene in a cell, said conjugate comprising a nucleic acid as disclosed herein and one or more ligand moieties.
[0059] In a further aspect, there is provided a pharmaceutical composition comprising a nucleic acid as disclosed herein, in combination with a pharmaceutically acceptable excipient or carrier.
[0060] In a further aspect, there is provided a nucleic acid or pharmaceutical composition, for use in therapy.
[0061] In a further aspect, there is provided a nucleic acid or pharmaceutical composition, for use in the treatment of heart failure with reduced ejection fraction (HFrEF), such as an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof, and / or for use in the treatment of heart failure with preserved ejection fraction (HFpEF) and / or symptoms thereof.
[0062] In a further aspect, there is provided a nucleic acid or pharmaceutical composition as disclosed herein, wherein the nucleic acid or the pharmaceutical composition is administered after myocardial infarction.
[0063] In one aspect, the invention relates to an inhibitor of expression and / or function of NR3C2, wherein said inhibitor is conjugated to one or more ligand moieties.
[0064] In a further aspect, the invention relates to an inhibitor according to the invention, wherein said inhibitor is an siRNA oligomer.
[0065] In another aspect, the invention relates to an inhibitor of expression and / or function of NR3C2, wherein said inhibitor is an siRNA oligomer.
[0066] In a further aspect, the invention relates to an inhibitor according to the invention, wherein said inhibitor comprises an siRNA oligomer conjugated to one or more ligand moieties.
[0067] In a further aspect, the invention relates to an inhibitor according to the invention, for use in prevention or treatment of an ischaemic heart disease, such as myocardial infarction.
[0068] In a particular aspect of the invention, the inhibitor according to the invention is for use in the treatment of an ischaemic heart disease, such as myocardial infarction, whereby the inhibitor alleviates symptoms of an ischaemic heart disease, in particular myocardial infarction, more particularly an acute myocardial infarction. Within the present invention, the inhibitor of the invention may be administered after myocardial infarction, in particular for cardioprotection, for reducing infarct size and / or reducing reperfusion arrhythmias.
[0069] In a particular aspect of the invention, the inhibitor according to the invention is for use in the treatment of heart failure with reduced ejection fraction (HFrEF) and / or heart failure with preserved ejection fraction (HFpEF).
[0070] In a further aspect, the invention relates to an inhibitor according to the invention, wherein said one or more ligand moieties comprise one or more GalNAc ligands or comprise one or more GalNAc ligand derivatives.
[0071] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein said one or more ligand moieties comprise one or more GalNAc ligand derivatives.
[0072] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the target of the inhibitor is NR3C2.
[0073] In a further aspect (Aspect C), there is provided a nucleic acid for inhibiting expression of NR3C2, comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the NR3C2 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand sequences as listed in Table 2.
[0074] In a further aspect (Aspect D), there is provided a nucleic acid for inhibiting expression of NR3C2, comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the NR3C2 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand modified sequences as listed in Table 3.
[0075] In a further aspect, there is provided a nucleic acid as described herein, wherein the first strand comprises nucleosides 2-18 of any one of the sequences according to the above Aspect C or Aspect D of the present invention.
[0076] In a further aspect, there is provided a nucleic acid according to the above Aspect C of the present invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand sequences as listed in Table 2, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.
[0077] In a further aspect, there is provided a nucleic acid according to the above Aspect C of the present invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand sequences as listed in Table 2, and wherein the duplex region comprises at least 14, 15, 16 or 17 complementary base pairs.
[0078] In a further aspect, there is provided a nucleic acid according to the above Aspect D of the present invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand modified sequences as listed in Table 4, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.
[0079] In a further aspect, there is provided a nucleic acid according to the above further Aspect D of the present invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand modified sequences as listed in Table 4, and wherein the duplex region comprises at least 14, 15, 16 or 17 complementary base pairs.
[0080] In a further aspect, there is provided a nucleic acid according to the above Aspect C of the present invention, wherein the first strand comprises any one of the first strand sequences as listed in Table 2.
[0081] In a further aspect, there is provided a nucleic acid according to the above Aspect D of the present invention, wherein the first strand comprises any one of the first strand modified sequences as listed in Table 3.
[0082] In a further aspect, there is provided a nucleic acid according to the above Aspect C of the present invention, wherein the second strand comprises any one of the second strand sequences as listed in Table 2.
[0083] In a further aspect, there is provided a nucleic acid according to the above Aspect D of the present invention, wherein the second strand comprises any one of the second strand modified sequences as listed in Table 4.
[0084] In a further aspect, there is provided a conjugate for inhibiting expression of NR3C2 target gene in a cell, said conjugate comprising a nucleic acid as disclosed herein and one or more ligand moieties.
[0085] In a further aspect, there is provided a pharmaceutical composition comprising a nucleic acid as disclosed herein, in combination with a pharmaceutically acceptable excipient or carrier.
[0086] In a further aspect, there is provided a nucleic acid or pharmaceutical composition, for use in therapy.
[0087] In a further aspect, there is provided a nucleic acid or pharmaceutical composition, for use in the treatment of an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof.
[0088] In a further aspect, there is provided a nucleic acid or pharmaceutical composition, for use in the treatment of heart failure with reduced ejection fraction (HFrEF) and / or heart failure with preserved ejection fraction (HFpEF). In a further aspect, there is provided a nucleic acid or pharmaceutical composition asdisclosed herein, wherein the nucleic acid or the pharmaceutical composition is administered after myocardial infarction.
[0089] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA oligomer having a first and a second strand wherein: i) the first strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25; even more preferably 23; and / or ii) the second strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 21 nucleosides.
[0090] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the second sense strand further comprises one or more abasic nucleosides in a terminal region of the second strand, and wherein said abasic nucleoside(s) is / are connected to an adjacent nucleoside through a reversed intemucleoside linkage.
[0091] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the second strand comprises: i) 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or ii) 2, or more than 2, abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand; and / or iii) 2, or more than 2, abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or iv) 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside; and / or v) 2, or more than 2, consecutive abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or vi) a reversed intemucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or vii) a reversed intemucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5 ’ or 3 ’ terminal region of the second strand; and / or viii) an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / orix) abasic nucleosides as the 2 terminal nucleosides connected via a 5’-3’ linkage when reading the strand in the direction towards that terminus; and / or x) abasic nucleosides as the 2 terminal nucleosides connected via a 3 ’-5’ linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; and / or xi) abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5’ reversed linkage or a 3 ’-3’ reversed linkage; and / or xii) abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either(1) the reversed linkage is a 5-5’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or(2) the reversed linkage is a 3-3’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5’3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.
[0092] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the reversed intemucleoside linkage is at a terminal region which is distal to the 5 ’ terminal region of the second strand, or at a terminal region which is distal to the 3 ’ terminal region of the second strand.
[0093] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the reversed intemucleoside linkage is a 3’3 reversed linkage.
[0094] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the reversed intemucleoside linkage is a 5’5 reversed linkage.
[0095] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein one or more nucleosides on the first strand and / or the second strand is / are modified, to form modified nucleosides.
[0096] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the modification is a modification at the 2 ’-OH group of the ribose sugar, optionally selected from 2'-Me or 2’-F modifications.
[0097] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the first strand comprises a 2’-F at any of position 14, position 2, position 6, or any combination thereof, counting from position 1 of said first strand.
[0098] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the second strand comprises a 2’-F modification at position 7 and / or 9, and / or 11 and / or 13, counting from position 1 of said second strand.
[0099] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the first and second strand each comprise 2'-Me and 2’-F modifications.
[0100] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA, wherein the siRNA comprises at least one thermally destabilizing modification, suitably at one or more of positions 1 to 9 of the first strand counting from position 1 of the first strand, and / or at one or more of positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the destabilizing modification is selected from a modified unlocked nucleic acid (IMUNA) and a glycol nucleic acid (GNA), preferably a glycol nucleic acid.
[0101] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the siRNA comprises at least one thermally destabilizing modification at position 7 of the first strand, counting from position 1 of the first strand.
[0102] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA, wherein the siRNA comprises 3 or more 2’-F modifications at positions 7 to 13 of the second strand, such as 4, 5, 6 or 7 2’-F modifications at positions 7 to 13 of the second strand, counting from position 1 of said second strand.
[0103] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA, wherein said second strand comprises at least 3, such as 4, 5 or 6, 2 ’-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand.
[0104] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA, wherein said first strand comprises at least 5 2 ’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region, or at least within 1 or 2 nucleosides from the terminal nucleoside at the 3’ terminal region.
[0105] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA wherein said first strand comprises 7 2 ’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region.
[0106] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the siRNA oligomer further comprises one or more phosphorothioate intemucleoside linkages.
[0107] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein said one or more phosphorothioate intemucleoside linkages are respectively between at least three consecutive positions in a 5 ’ or 3 ’ near terminal region of the second strand, whereby said near terminal region is preferably adjacent said terminal region wherein said one or more abasic nucleosides of said second strand is / are located as defined herein.
[0108] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein said one or more phosphorothioate intemucleoside linkages are respectively between at least three consecutive positions in a 5 ’ and / or 3 ’ terminal region of the first strand, whereby preferably a terminal position at the 5’ and / or 3’ terminal region of said first strand is attached to its adjacent position by a phosphorothioate intemucleoside linkage.
[0109] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the oligomer is an siRNA and the second strand of the siRNA is conjugated directly or indirectly to one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3 ’ terminal region thereof.
[0110] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the ligand moiety comprises i) one or more GalNAc ligands; and / or ii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands and / or GalNAc ligand derivatives conjugated to said siRNA through a linker.[oni] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5’ or 3’ terminal region of the second strand of the siRNA oligomer, preferably at the 3’ terminal region thereof.
[0112] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the ligand moiety comprises:
[0113] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, having the structure:wherein:Ri at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl;R2 is selected from the group consisting of hydrogen, hydroxy, -OCi-salkyl, -C(=O)OCi-3alkyl, halo and nitro;Xi and X2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that:(i) q and r cannot both be 0 at the same time; and(ii) s, t, and v cannot all be 0 at the same time;Z is an oligomer.
[0114] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, having the structure:wherein: r and s are independently an integer selected from 1 to 16; andZ is an oligomer.
[0115] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, formulated as a pharmaceutical composition with an excipient and / or carrier.
[0116] In another aspect, the invention relates to a pharmaceutical composition comprising an inhibitor according to one or more preceding claims, in combination with a pharmaceutically acceptable excipient or carrier.
[0117] In a further aspect, the invention relates to a pharmaceutical composition comprising an inhibitor according to the invention, in combination with a pharmaceutically acceptable excipient or carrier, for use in the treatment of an ischaemic heart disease, such as myocardial infarction. In a particular aspect of the invention, the pharmaceutical composition according to the invention is for use in the treatment of an ischaemic heart disease, such as myocardial infarction, whereby the pharmaceutical composition alleviates symptoms of an ischaemic heart disease, in particular myocardial infarction, more particularly an acute myocardial infarction. Within the present invention, the pharmaceutical composition of the invention may be administered after myocardial infarction, in particular for cardioprotection, for reducing infarct size and / or reducing reperfusion arrhythmias.
[0118] In another aspect, the invention relates to the use of NR3C2 as a target for identifying one or more therapeutic agents for the treatment of an ischaemic heart disease, such as myocardial infarction.
[0119] In another aspect, the invention relates to a method of treating or preventing a disease or disorder related to an ischaemic heart disease, such as myocardial infarction, which comprises administering to a patient an inhibitor of NR3C2, such as an inhibitor as defined according to one or more preceding aspects.
[0120] In another aspect, the invention relates to NR3C2 for use as a biomarker of heart failure with reduced ejection fraction (HFrEF) and associated conditions such as ischaemic heart disease, such as myocardial infarction.
[0121] In another aspect, the invention relates to NR3C2 for use as a biomarker of heart failure with preserved ejection fraction (HFpEF).
[0122] In another aspect, the invention relates to NR3C2 for use in an in vivo method of predicting susceptibility to an ischaemic heart disease, such as myocardial infarction, typically by monitoring the sequence and / or level of expression and / or function of NR3C2 in a sample obtained from a patient.
[0123] In another aspect, the invention relates to a method of predicting susceptibility to an ischaemic heart disease, such as myocardial infarction, and optionally treating an ischaemic heart disease, such as myocardial infarction, in a patient, said method comprising:(a) obtaining a sample from the patient,(b) detecting the sequence and / or expression and / or function of NR3C2 in said sample obtained from the patient,(c) predicting susceptibility to an ischaemic heart disease, such as myocardial infarction, based on the sequence and / or expression and / or function of NR3C2 in said sample obtained from the patient,(d) preferably administering to the diagnosed patient an effective amount of an inhibitor of NR3C2.
[0124] In another aspect, the invention relates to an inhibitor or composition according to the invention, in the preparation of a medicament for use in the treatment of an ischaemic heart disease, such as myocardial infarction.
[0125] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 228, SEQ ID NO: 238, SEQ ID NO: 243, SEQ ID NO: 235, SEQ ID NO: 245 and SEQ ID NO: 250.
[0126] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises SEQ ID NO: 238.
[0127] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises SEQ ID NO: 245.
[0128] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 674, SEQ ID NO: 684, SEQ ID NO: 689, SEQ ID NO: 681, SEQ ID NO: 691 and SEQ ID NO: 696.
[0129] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises SEQ ID NO: 684.
[0130] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises SEQ ID NO: 691.
[0131] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 451, SEQ ID NO: 461, SEQ ID NO: 466, SEQ ID NO: 458, SEQ ID NO: 468 and SEQ ID NO: 473.
[0132] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises SEQ ID NO: 461.
[0133] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises SEQ ID NO: 468.
[0134] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 897, SEQ ID NO: 907, SEQ ID NO: 912, SEQ ID NO: 904, SEQ ID NO: 914, and SEQ ID NO: 919.
[0135] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises SEQ ID NO: 907.
[0136] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises SEQ ID NO: 914.
[0137] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0138] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0139] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0140] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0141] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0142] In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0143] In one aspect, the invention relates to an inhibitor of expression and / or function of NR3C2, for use in the treatment of heart failure with preserved ejection fraction (HFpEF).
[0144] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein said inhibitor is an siRNA oligomer.
[0145] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein said one or more ligand moieties comprise one or more GalNAc ligands or comprise one or more GalNAc ligand derivatives.
[0146] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the target of the inhibitor is NR3C2.
[0147] In a further aspect (Aspect E), there is provided a nucleic acid for inhibiting expression of NR3C2, for use in the treatment of heart failure with preserved ejection fraction (HFpEF), comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the NR3C2 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand sequences as listed in Table 2.
[0148] In a further aspect (Aspect F), there is provided a nucleic acid for inhibiting expression of NR3C2, for use in the treatment of heart failure with preserved ejection fraction (HFpEF), comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the NR3C2 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand modified sequences as listed in Table 3.
[0149] In a further aspect, there is provided a nucleic acid for use as described herein, wherein the first strand comprises nucleosides 2-18 of any one of the sequences according to the above Aspect E or Aspect F of the present invention.
[0150] In a further aspect, there is provided a nucleic acid for use according to the above Aspect E of the present invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand sequences as listed in Table 2, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.
[0151] In a further aspect, there is provided a nucleic acid for use according to the above Aspect E of the present invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand sequences as listed in Table 2, and wherein the duplex region comprises at least 14, 15, 16 or 17 complementary base pairs.
[0152] In a further aspect, there is provided a nucleic acid for use according to the above Aspect F of the present invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand modified sequences as listed in Table 4, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.
[0153] In a further aspect, there is provided a nucleic acid for use according to the above further Aspect F of the present invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand modifiedsequences as listed in Table 4, and wherein the duplex region comprises at least 14, 15, 16 or 17 complementary base pairs.
[0154] In a further aspect, there is provided a nucleic acid for use according to the above Aspect E of the present invention, wherein the first strand comprises any one of the first strand sequences as listed in Table 2.
[0155] In a further aspect, there is provided a nucleic acid for use according to the above Aspect F of the present invention, wherein the first strand comprises any one of the first strand modified sequences as listed in Table 3.
[0156] In a further aspect, there is provided a nucleic acid for use according to the above Aspect E of the present invention, wherein the second strand comprises any one of the second strand sequences as listed in Table 2.
[0157] In a further aspect, there is provided a nucleic acid for use according to the above Aspect F of the present invention, wherein the second strand comprises any one of the second strand modified sequences as listed in Table 4.
[0158] In a further aspect, there is provided a conjugate for inhibiting expression of NR3C2 target gene in a cell, for use in the treatment of heart failure with preserved ejection fraction (HFpEF), said conjugate comprising a nucleic acid as disclosed herein and one or more ligand moieties.
[0159] In a further aspect, there is provided a pharmaceutical composition comprising a nucleic acid for use as disclosed herein, in combination with a pharmaceutically acceptable excipient or carrier.
[0160] In a further aspect, there is provided a nucleic acid or pharmaceutical composition, for use in the treatment of heart failure with preserved ejection fraction (HFpEF) and / or symptoms thereof.
[0161] In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA oligomer having a first and a second strand wherein: i) the first strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25; even more preferably 23; and / or ii) the second strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 21 nucleosides.
[0162] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second sense strand further comprises one or more abasic nucleosides in a terminal region of the second strand, and wherein said abasic nucleoside(s) is / are connected to an adjacent nucleoside through a reversed intemucleoside linkage.
[0163] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second strand comprises: i) 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or ii) 2, or more than 2, abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand; and / or iii) 2, or more than 2, abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or iv) 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside; and / or v) 2, or more than 2, consecutive abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or vi) a reversed intemucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or vii) a reversed intemucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5 ’ or 3 ’ terminal region of the second strand; and / or viii) an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / or ix) abasic nucleosides as the 2 terminal nucleosides connected via a 5’-3’ linkage when reading the strand in the direction towards that terminus; x) abasic nucleosides as the 2 terminal nucleosides connected via a 3 ’-5’ linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; xi) abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5’ reversed linkage or a 3 ’-3’ reversed linkage; xii) abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either(1) the reversed linkage is a 5-5’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or(2) the reversed linkage is a 3-3’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5’3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.
[0164] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the reversed intemucleoside linkage is at a terminal region which is distal to the 5 ’ terminal region of the second strand, or at a terminal region which is distal to the 3’ terminal region of the second strand.
[0165] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the reversed intemucleoside linkage is a 3’3 reversed linkage.
[0166] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the reversed intemucleoside linkage is a 5’5 reversed linkage.
[0167] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein one or more nucleosides on the first strand and / or the second strand is / are modified, to form modified nucleosides.
[0168] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the modification is a modification at the 2 ’-OH group of the ribose sugar, optionally selected from 2'-Me or 2’-F modifications.
[0169] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the first strand comprises a 2’-F at any of position 14, position 2, position 6, or any combination thereof, counting from position 1 of said first strand.
[0170] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second strand comprises a 2’-F modification at position 7 and / or 9, and / or 11 and / or 13, counting from position 1 of said second strand.
[0171] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the first and second strand each comprise 2'-Me and 2’-F modifications.
[0172] In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA, wherein the siRNA comprises at least one thermally destabilizing modification, suitably at one or more of positions 1 to 9 of the first strand counting from position 1 of the first strand, and / or at one or more of positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the destabilizing modification is selected from a modified unlocked nucleic acid (IMUNA) and a glycol nucleic acid (GNA), preferably a glycol nucleic acid.
[0173] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the siRNA comprises at least one thermally destabilizing modification at position 7 of the first strand, counting from position 1 of the first strand.
[0174] In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA, wherein the siRNA comprises 3 or more 2’-F modifications at positions 7 to 13 of the second strand, such as 4, 5, 6 or 7 2’-F modifications at positions 7 to 13 of the second strand, counting from position 1 of said second strand
[0175] In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA, wherein said second strand comprises at least 3, such as 4, 5 or 6, 2’-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand.
[0176] In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA, wherein said first strand comprises at least 5 2’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region, or at least within 1 or 2 nucleosides from the terminal nucleoside at the 3’ terminal region.
[0177] In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA wherein said first strand comprises 7 2’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region.
[0178] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the siRNA oligomer further comprises one or more phosphorothioate intemucleoside linkages.
[0179] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein said one or more phosphorothioate intemucleoside linkages are respectively between at least three consecutive positions in a 5’ or 3’ near terminal region of the second strand, whereby said near terminal region is preferably adjacent said terminal region wherein said one or more abasic nucleosides of said second strand is / are located as defined herein.
[0180] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein said one or more phosphorothioate intemucleoside linkages are respectively between at least three consecutive positions in a 5 ’ and / or 3 ’ terminal region of the first strand, whereby preferably a terminal position at the 5’ and / or 3’ terminal region of said first strand is attached to its adjacent position by a phosphorothioate intemucleoside linkage.
[0181] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the oligomer is an siRNA and the second strand of the siRNA is conjugated directly or indirectly to one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3 ’ terminal region thereof.
[0182] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the ligand moiety comprises: i) one or more GalNAc ligands; and / or ii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands and / or GalNAc ligand derivatives conjugated to said siRNA through a linker.
[0183] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5 ’ or 3 ’ terminal region of the second strand of the siRNA oligomer, preferably at the 3 ’ terminal region thereof.
[0184] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the ligand moiety comprises:
[0185] In a further aspect, the invention relates to an inhibitor for use according to the invention, having the structure:wherein:Ri at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl;R2 is selected from the group consisting of hydrogen, hydroxy, -OCi-salkyl, -C(=O)OCi-3alkyl, halo and nitro;Xi and X2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that:(i) q and r cannot both be 0 at the same time; and(ii) s, t and v cannot all be 0 at the same time;Z is an oligomer.
[0186] In a further aspect, the invention relates to an inhibitor for use according to the invention, having the structure:wherein: r and s are independently an integer selected from 1 to 16; andZ is an oligomer.
[0187] In a further aspect, the invention relates to an inhibitor for use according to the invention, formulated as a pharmaceutical composition with an excipient and / or carrier.
[0188] In another aspect, the invention relates to a pharmaceutical composition comprising an inhibitor according to the invention, in combination with a pharmaceutically acceptable excipient or carrier, for use in the treatment of heart failure with preserved ejection fraction (HFpEF).
[0189] In another aspect, the invention relates to the use of NR3C2 as a target for identifying one or more therapeutic agents for the treatment of heart failure with preserved ejection fraction (HFpEF).
[0190] In another aspect, the invention relates to a method of treating or preventing a disease or disorder related to heart failure with preserved ejection fraction (HFpEF), which comprises administering to a patient an inhibitor of NR3C2, such as an inhibitor as defined according to the invention.
[0191] In another aspect, the invention relates to NR3C2 for use as a biomarker of heart failure with preserved ejection fraction (HFpEF) and associated conditions such as restrictive and hypertrophic cardiomyopathies of any etiology, constrictive pericarditis, and valvular heart disease.
[0192] In another aspect, the invention relates to NR3C2 for use in an in vivo method of predicting susceptibility to HFpEF, typically by monitoring the sequence and / or level of expression and / or function of NR3C2 in a sample obtained from a patient.
[0193] In another aspect, the invention relates to a method of predicting susceptibility to HFpEF, and optionally treating HFpEF, in a patient, said method comprising:(a) obtaining a sample from the patient,(b) detecting the sequence and / or expression and / or function of NR3C2 in said sample obtained from the patient,(c) predicting susceptibility to HFpEF based on the sequence and / or expression and / or function of NR3C2 in said sample obtained from the patient,(d) preferably administering to the diagnosed patient an effective amount of an inhibitor of NR3C2.
[0194] In another aspect, the invention relates to an inhibitor or composition according to the invention, in the preparation of a medicament for use in the treatment of HFpEF.
[0195] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 228, SEQ ID NO: 238, SEQ ID NO: 243, SEQ ID NO: 235, SEQ ID NO: 245 and SEQ ID NO: 250.
[0196] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the first strand comprises SEQ ID NO: 238.
[0197] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the first strand comprises SEQ ID NO: 245.
[0198] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 674, SEQ ID NO: 684, SEQ ID NO: 689, SEQ ID NO: 681, SEQ ID NO: 691 and SEQ ID NO: 696.
[0199] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the first strand comprises SEQ ID NO: 684.
[0200] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the first strand comprises SEQ ID NO: 691.
[0201] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 451, SEQ ID NO: 461, SEQ ID NO: 466, SEQ ID NO: 458, SEQ ID NO: 468 and SEQ ID NO: 473.
[0202] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second strand comprises SEQ ID NO: 461.
[0203] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second strand comprises SEQ ID NO: 468.
[0204] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 897, SEQ ID NO: 907, SEQ ID NO: 912, SEQ ID NO: 904, SEQ ID NO: 914, and SEQ ID NO: 919.
[0205] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second strand comprises SEQ ID NO: 907.
[0206] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second strand comprises SEQ ID NO: 914.
[0207] In a further aspect, the invention relates to an inhibitor for use according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0208] In a further aspect, the invention relates to an inhibitor for use according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0209] In a further aspect, the invention relates to an inhibitor for use according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0210] In a further aspect, the invention relates to an inhibitor for use according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0211] In a further aspect, the invention relates to an inhibitor for use according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0212] In a further aspect, the invention relates to an inhibitor for use according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0213] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 290, SEQ ID NO: 270, SEQ ID NO: 238, SEQ ID NO: 245, SEQ ID NO: 283, SEQ ID NO: 235, SEQ ID NO: 226, SEQ ID NO: 335, SEQ ID NO: 228 or SEQ ID NO: 410.
[0214] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 290, SEQ ID NO: 270, SEQ ID NO: 238, SEQ ID NO: 245 or SEQ ID NO: 283.
[0215] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the first strand comprises SEQ ID NO: 290.
[0216] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the first strand comprises SEQ ID NO: 270.
[0217] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 736, SEQ ID NO: 716, SEQ ID NO: 684, SEQ ID NO: 691, SEQ ID NO: 729, SEQ ID NO: 681, SEQ ID NO: 672, SEQ ID NO: 781, SEQ ID NO: 674 or SEQ ID NO: 856.
[0218] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 736, SEQ ID NO: 716, SEQ ID NO: 684, SEQ ID NO: 691 or SEQ ID NO: 729.
[0219] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the first strand comprises SEQ ID NO: 736.
[0220] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the first strand comprises SEQ ID NO: 716.
[0221] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 513, SEQ ID NO: 493, SEQ ID NO: 461, SEQ ID NO: 468, SEQ ID NO: 506, SEQ ID NO: 458, SEQ ID NO: 449, SEQ ID NO: 558, SEQ ID NO: 451 or SEQ ID NO: 633.
[0222] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 513, SEQ ID NO: 493, SEQ ID NO: 461, SEQ ID NO: 468 or SEQ ID NO: 506.
[0223] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the second strand comprises SEQ ID NO: 513.
[0224] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the second strand comprises SEQ ID NO: 493.
[0225] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 959, SEQ ID NO: 939, SEQ ID NO: 907, SEQ ID NO: 914, SEQ ID NO: 952, SEQ ID NO: 904, SEQ ID NO: 895, SEQ ID NO: 1004, SEQ ID NO: 897, SEQ ID NO: 897 or SEQ ID NO: 1079.
[0226] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 959, SEQ ID NO: 939, SEQ ID NO: 907, SEQ ID NO: 914 or SEQ ID NO: 952.
[0227] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the second strand comprises SEQ ID NO: 959.
[0228] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, wherein the second strand comprises SEQ ID NO: 939.
[0229] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0230] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0231] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:
[0232] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:
[0233] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0234] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
[0235] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:
[0236] In a further aspect, the invention relates to an inhibitor for use in the treatment of HFpEF, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:BRIEF DESCRIPTION OF THE DRAWINGSFIGURES
[0237] Figure 1: Linker and ligand portions of constructs suitable for use according to the present invention including tether la. While Figure 1 depicts the linker to be conjugated to an oligonucleotide, it is to be understood that the present invention also encompasses conjugates of the same linker with an oligonucleoside as disclosed herein.
[0238] It should also be understood that while Figure 1 depicts as a product molecules based on the linker and ligand portions as specifically depicted in Figure 1 attached to an oligonucleoside moiety as also depicted herein, this product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in Figure 1 attached to an oligonucleoside moiety but having the F substituent as shown in Figure 1 on the cyclo-octyl ring replaced by a substituent, which could occur as a result of hydrolytic displacement, such as an OH substituent, or the OH substituent could be synthesized as a linker in its own right. In this way, (a) tether la constructs can consist essentially of molecules having linker and ligand portions specifically as depicted in Figure 1, with a F substituent on the cyclo-octyl ring; or (b) tether la constructs can consist essentially of molecules having linker and ligand portions essentially as depicted in Figure 1 but having the F substituent as shown in Figure 1 on the cyclooctyl ring replaced by an OH substituent, or (c) tether la constructs can comprise a mixture of molecules as defined in (a) and / or (b).
[0239] Figure 2: Linker and ligand portions of constructs suitable for use according to the present invention including tether lb. While Figure 2 depicts the linker to be conjugated to an oligonucleotide, it is to be understood that the present invention also encompasses conjugates of the same linker with an oligonucleoside as disclosed herein.
[0240] The comments made in relation to Figure 1 and the possible replacement of the F substituent as shown in Figure 1 on the cyclo-octyl ring replaced by a substituent, which could occur as a result of hydrolytic displacement, such as an OH substituent, or the OH substituent could be synthesized as a linker in its own right, apply equally to tether lb constructs. In this way, (a) tether lb constructs can consist essentially of molecules having linker and ligand portions specifically as depicted in Figure 2, with a F substituent on the cyclo-octyl ring; or (b) tether lb constructs can consist essentially of molecules havinglinker and ligand portions essentially as depicted in Figure 2 but having the F substituent as shown in Figure 2 on the cyclo-octyl ring replaced by an OH substituent, or (c) tether lb constructs can comprise a mixture of molecules as defined in (a) and / or (b).
[0241] Figure 3: Linker and ligand portions of constructs suitable for use according to the present invention including tether 2a. While Figure 3 depicts the linker to be conjugated to an oligonucleotide, it is to be understood that the present invention also encompasses conjugates of the same linker with an oligonucleoside as disclosed herein.
[0242] Figure 4: Linker and ligand portions of constructs suitable for use according to the present invention including tether 2b. While Figure 4 depicts the linker to be conjugated to an oligonucleotide, it is to be understood that the present invention also encompasses conjugates of the same linker with an oligonucleoside as disclosed herein.
[0243] Figure 5: Relevant formulae.
[0244] Figure 6: Further formulae.
[0245] Figures 7a and 7b: Inverted abasic constructs that can be used with nucleic acid sequences according to the present invention as described herein. For Figure 7a, a GalNAc linker is attached to the 5’ end region of the sense strand in use (not depicted in Figure 7a). For Figure 7b, a GalNAc linker is attached to the 3’ end region of the sense strand in use (not depicted in Figure 7b).
[0246] iaia as shown at the 3’ end region of the sense strand in Figure 7a represents (i) two abasic nucleosides provided as the penultimate and terminal nucleosides at the 3’ end region of the sense strand, (ii) wherein a 3 ’-3 ’ reversed linkage is provided between the antepenultimate nucleoside (namely at position 21 of the sense strand, wherein position 1 is the terminal 5’ nucleoside of the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleosides is 5 ’-3’ when reading towards the 3’ end region comprising the terminal and penultimate abasic nucleosides.
[0247] iaia as shown at the 5’ end region of the sense strand in Figure 7b represents (i) two abasic nucleosides provided as the penultimate and terminal nucleosides at the 5’ end region of the sense strand, (ii) wherein a 5 ’-5 ’ reversed linkage is provided between the antepenultimate nucleoside (namely at position 1 of the sense strand, not including the iaia motif at the 5’ end region of the sense strand in the nucleoside position numbering on the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleosides is 3 ’-5’ when reading towards the 5’ end region comprising the terminal and penultimate abasic nucleosides.
[0248] Figures 8a and 8b: Duplex constructs according to Table 5.
[0249] Figure 9: The correlation between predicted and experimentally determined siRNA efficacy values i.e. maximum RNA knockdown where 1 represents maximum knockdown and 0 is no reduction in mRNA levels. Data displayed are for the test dataset in the best performing siRNAdesignR model.
[0250] Figure 10: Performance metrics for the best performing siRNAdesignR model in the test data set and also the validation dataset. In both cases the model scored above 0.5 in the Precision@20 metric, and the best performing siRNA (experimentally determined) was in the top 20 predictions of the model (nSiRNAsForBest).
[0251] Figure 11: siRNAdesignR ranking for 276 siRNAs. These rankings were tested in an in vitro model (Huh7 cells) demonstrating strong correlation (Spearman correlation coefficient 0.743).
[0252] Figure 12: A dose response curve of SLC25A5 mRNA knockdown following 24-hour exposure to siRNA. Cells were tested in triplicate repeats on two separate days (replicates 1 and 2). Data are mean + / - standard deviation with knockdown normalised to untreated wells.
[0253] Figure 13: Change in SLC25A5 mRNA knockdown over 28 days following one subcutaneous dose of siRNA at day 0. As mRNA measurements are taken from liver tissue measurements are taken from different mice at each time point. Data are mean + / - standard deviation from 16 mice per timepoint per dose, normalised to saline control.
[0254] Figure 14: Change in SLC25A5 protein expression over 28 days following one subcutaneous dose of siRNA at day 0. As mRNA measurements are taken from liver tissue measurements are taken from different mice at each time point. Data are mean + / - standard deviation from 16 mice per timepoint per dose, normalized to saline control.
[0255] Figure 15a shows an exemplary linear configuration for a conjugate.
[0256] Figure 15b shows an exemplary branched configuration for a conjugate.
[0257] Figures 16-19 show preferred oligomer - linker - ligand constructs of the invention.
[0258] Figure 20: Hepatic target mRNA knockdown in mice following injection of GalNAc-siRNA.
[0259] Figure 21: No change in markers of liver health following injection of GalNAc-siRNAs.
[0260] Figure 22: Hepatic knockdown and trend towards increased FGF21 levels with ETXM-2590 treatment.
[0261] Figure 23: No treatment effects on survival, body weight or food intake in the MI mouse model.
[0262] Figure 24: Improvements in main parameters of cardiac function and structure post-MI in mice treated with GalNAc-siRNA to reduce hepatic NR3C2 expression.
[0263] Figure 25: Reduced hepatic expression of human NR3C2 in a hydrodynamic injection (HDI) mouse model injected with GalNAc siRNAs.
[0264] Figure 26: Results of an in vitro screen showing siRNA activity against NR3C2 in primary human hepatocytes. O.OlnM and l.OnM siRNA were transfected into Primary Human Hepatocytes for 48 hours. Relative expression levels (mean + / - SEM) of NR3C2 were determined via qPCR using b-actin as a housekeeping gene.
[0265] Figure 27: Overview of the hydrodynamic injection (HDI) study in mice.
[0266] Figure 28: Results of an siRNA molecule screen targeting the expression of human NR3C2 following hydrodynamic injection in BALB / c mice. Mice were injected with a single subcutaneous 0.5 mg / kg of each of the 54 siRNAs followed by HDI with the plasmid containing the human NR3C2 cDNA. Numerous siRNAs resulted in statistically significant knockdown of NR3C2. Statistical significance relative to vehicle control *p< 0.05, ***p < 0.001, ****p < 0.0001.
[0267] Figure 29: Serum levels of FGF21 (pg / ml) at termination of experiment.
[0268] Figure 30: Left ventricle (LV) geometry assessed by echocardiography after 6 weeks of treatments with vehicle or ETX-M00002590 at 10 mg / kg or eplerenone at 1 g / kg diet or empagliflozin at lOmg / kg in mice. A, B) posterior wall thickness in diastole and systole (LVPWd and LVPWs), C, D) anterior wall thickness in diastole and systole (LVAWd and LVAWs). Statistical significance relative to vehicle *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
[0269] Figure 31: Left ventricle (LV) diastolic function assessed after 6 weeks of treatments with vehicle or ETX-M00002590 at 10 mg / kg or eplerenone at Ig / kg diet or empagliflozin at lOmg / kg in mice. A) E7A’ ratio, B) E / E’ ratio, C) Diastolic Arterial Pressure, D) Systolic Arterial Pressure E) Mean Arterial Pressure F) LV End-Diastolic Pressure G) Min dP / dT H) Max dP / dT I) Relaxation Index Tau (ms). Statistical significance relative to vehicle control *p<0.05, **p<0.0I, ***p<0.00I, ****p<0.000I.
[0270] Figure 32: Plasma biomarkers in mice treated with vehicle or siRNA at 10 mg / kg or eplerenone at 1 g / kg diet or empagliflozin at 10 mg / kg in mice. A) serum potassium (mmol / 1, mean + / - SEM). B) Serum glucose (mmol / 1, mean + / - SEM). Statistical significance relative to vehicle control **p<0.0I, ***p<0.00I.
[0271] Figure 33: Liver weight to tibia length ratio (g / mm mean + / - SEM) 17 weeks after diet induction in mice treated with vehicle or siRNA at 10 mg / kg or eplerenone at 1 g / kg diet or empagliflozin at 10 mg / kg in mice. Statistical significance relative to vehicle control **p<0.0I.DETAILED DESCRIPTION
[0272] The present invention, inter alia, provides inhibitors, for example oligomers such as nucleic acids, such as inhibitory RNA molecules (which may be referred to as iRNA or siRNA), and compositions containing the same which can affect expression of a target, for example by binding to mRNA transcribed from a gene. The target may be within a cell, e.g., a cell within a subject, such as a human. The inhibitors can be used to prevent and / or treat medical conditions associated with the e.g., the expression of a target gene.
[0273] The present invention identifies inhibitors of NR3C2 as useful in the prevention and / or treatment of an ischaemic heart disease, such as myocardial infarction and / or the disorder or diseases as a symptom of myocardial infarction.
[0274] In particular, the present invention identifies inhibitors of NR3C2 as useful in the prevention and / or treatment of heart failure with preserved ejection fraction (HFpEF) and / or heart failure with reduced ejection fraction (HFrEF).
[0275] The mineralocorticoid receptor (MR or NR3C2) is a protein / receptor that belongs to the nuclear receptor family. As such, binding of the ligand to NR3C2 affects specific gene expression in the nucleus of human cells. In humans, NR3C2 is encoded by the NR3C2 gene (ENSG00000151623).
[0276] The inhibition disclosed herein may be of the gene or protein resulting from expression of the gene and reference to NR3C2 hereby explicitly incorporates a reference to inhibition of the expression or function of the gene and, separately, of the protein product.
[0277] Ischemic heart disease is the primary etiology of heart failure with reduced ejection fraction (HFrEF). The present invention extends equally to other indications associated with, or resulting from, HFrEF or ischemic heart disease. References herein to ischemic heart disease can be applied equally to HFrEF and associated indications.
[0278] Other etiologies of HFrEF include valvular disease, hypertension, and cardiomyopathies. The present invention also extends equally to such other etiologies of HFrEF. References herein to ischemic heart disease can be applied equally to these.
[0279] Heart failure with preserved ejection fraction (HFpEF) is a heterogeneous clinical syndrome with diverse phenotypes. Approximately 50% of patients with heart failure are classified as having HFpEF or associated disorders including restrictive and hypertrophic cardiomyopathies of any etiology, constrictive pericarditis, and valvular heart disease. The present invention extends equally to other indications associated with, or resulting from, HFpEF. References herein to HFpEF can be applied equally to such associated indications.DEFINITIONS
[0280] The “first strand”, also called the antisense strand or guide strand herein and which can be used interchangeably herein, refers to the nucleic acid strand, e.g., the strand of an siRNA, e.g., a dsiRNA, which includes a region that is substantially complementary to a target sequence, e.g., to an mRNA. As used herein, the term "region of complementarity" refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. In some embodiments, a double stranded nucleic acid e.g., an siRNA agent of the invention includes a nucleotide mismatch in the antisense strand.
[0281] The “second strand” (also called the sense strand or passenger strand herein, and which can be used interchangeably herein), refers to the strand of a nucleic acid e.g., siRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.
[0282] In the context of molecule comprising a nucleic acid provided with a ligand moiety, optionally also with a linker moiety, the nucleic acid of the invention may be referred to as an oligonucleotide moiety or oligonucleoside moiety.
[0283] Oligonucleotides are short nucleic acid polymers. Whilst oligonucleotides contain phosphodiester bonds between the nucleoside component thereof (base plus sugar), the present invention is not limited to oligonucleotides always joined by such a phosphodiester bond between adjacent nucleosides, and other oligomers of nucleosides joined by bonds which are bonds other than a phosphate bond are contemplated. For example, a bond between nucleotides may be a phosphorothioate bond. Therefore, the term “oligonucleoside” herein covers both oligonucleotides and other oligomers of nucleosides. An oligonucleoside which is a nucleic acid having at least a portion which is an oligonucleotide is preferred according to the present invention. An oligonucleoside having one or more, or a majority of, phosphodiester backbone bonds between nucleosides is also preferred according to the present invention. An oligonucleoside having one or more, or a majority of, phosphodiester backbone bonds between nucleosides, and having one or more phosphorothioate backbone bonds between nucleosides (typically in a terminal region of the first and / or second strands) is also preferred according to the present invention.
[0284] It is preferred herein that the nucleic acid according to the invention is a double stranded oligonucleoside comprising one or more phosphorothioate backbone bonds between nucleosides. Accordingly, in all instances in which the present application refers to an oligonucleotide, particularly in the chemical structures disclosed herein, the oligonucleotide may equally be an oligonucleoside as defined herein.
[0285] In some embodiments, a double stranded nucleic acid e.g., siRNA agent of the invention includes a nucleoside mismatch in the sense strand. In some embodiments, the nucleoside mismatch is, for example, within 5, 4, 3, 2, or 1 nucleosides from the 3 '-end of the nucleic acid e.g., siRNA.
[0286] In another embodiment, the nucleoside mismatch is, for example, in the 3'- terminal nucleoside of the nucleic acid e.g., siRNA.
[0287] A "target sequence" (which may be called a target RNA or a target mRNA) refers to a contiguous portion of the nucleoside sequence of an mRNA molecule formed during the transcription of a gene, including mRNA that is a product of RNA processing of a primary transcription product, or can be a contiguous portion of the nucleotide sequence of any RNA molecule such as a LNCRNA which it is desired to inhibit.
[0288] The target sequence may be from about 10-35 nucleosides in length, e.g., about 15-30 nucleosides in length. For example, the target sequence can be from about 15-30 nucleosides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18- 28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20- 21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleosides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.
[0289] The term “ribonucleoside” or “nucleoside” can also refer to a modified nucleoside as further detailed below.
[0290] A nucleic acid can be a DNA or an RNA and can comprise modified nucleosides. RNA is a preferred nucleic acid.
[0291] The terms "iRNA", “siRNA”, "RNAi agent," "iRNA agent," and "RNA interference agent" as used interchangeably herein, refer to an agent that contains RNA, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. siRNA directs the sequencespecific degradation of mRNA through RNA interference (RNAi).
[0292] A double stranded RNA is referred to herein as a "double stranded siRNA (dsiRNA) agent", "double stranded siRNA (dsiRNA) molecule", "double stranded RNA (dsRNA) agent", "double stranded RNA (dsRNA) molecule", "dsiRNA agent", "dsiRNA molecule", or "dsiRNA", which refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations with respect to a target RNA.
[0293] The majority of nucleosides of each strand of the nucleic acid, e.g., a dsRNA molecule, are preferably ribonucleosides, but in that case each or both strands can also include one or more non-ribonucleosides, e.g., a deoxyribonucleoside or a modified ribonucleoside. In addition, as used in this specification, an "siRNA" may include ribonucleosides with chemical modifications.
[0294] The term "modified nucleoside" refers to a nucleoside having, independently, a modified sugar moiety, a modified intemucleoside linkage, or modified nucleobase, or any combination thereof. Thus, the term modified nucleoside encompasses substitutions, additions, or removal of, e.g., a functional group or atom, to intemucleoside linkages, sugar moieties, or nucleobases. Any such modifications, as used in a siRNA type molecule, are encompassed by "iRNA" or "RNAi agent" or “siRNA” or “siRNA agent” for the purposes of this specification and claims.
[0295] The duplex region of a nucleic acid of the invention e.g., a dsRNA may range from about 9 to 40 base pairs in length such as 9 to 36 base pairs in length, e.g., about 15- 30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15- 21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18- 27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18- 20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20- 27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21- 30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length.
[0296] The two strands forming the duplex structure may be different portions of one larger molecule, or they may be separate molecules e.g., RNA molecules.
[0297] The term "nucleoside overhang" refers to at least one unpaired nucleoside that extends from the duplex structure of a double stranded nucleic acid. A ds nucleic acid can comprise an overhang of at least one nucleoside; alternatively, the overhang can comprise at least two nucleosides, at least three nucleosides, at least four nucleosides, at least five nucleosides, or more. A nucleoside overhang can comprise or consist of a nucleoside analog, including a deoxynucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the / nucleoside(s) of an overhang can be present on the 5'-end, 3'-end, or both ends of either an antisense or sense strand.
[0298] In certain embodiments, the antisense strand has a 1-10 nucleoside, e.g., 0-3, 1-3, 2-4, 2-5, 4-10, 5- 10, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleoside overhangs at the 3'-end or the 5'-end.
[0299] "Blunt" or "blunt end" means that there are no unpaired nucleosides at that end of the double stranded nucleic acid, i.e., no nucleoside overhang. The nucleic acids of the invention include those with no nucleoside overhang at one end or with no nucleoside overhangs at either end.
[0300] Unless otherwise indicated, the term "complementary," when used to describe a first nucleoside sequence in relation to a second nucleoside sequence, refers to the ability of an oligonucleoside comprising the first nucleoside sequence to hybridize and form a duplex structure under certain conditions with an oligonucleoside or polynucleoside comprising the second nucleoside sequence, as will be understood bythe skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press).
[0301] Complementary sequences within nucleic acid e.g., a dsiRNA, as described herein, include basepairing of the oligonucleoside or polynucleoside comprising a first nucleoside sequence to an oligonucleoside or polynucleoside comprising a second nucleoside sequence over the entire length of one or both nucleoside sequences. Such sequences can be referred to as "fully complementary" with respect to each other herein. However, where a first sequence is referred to as "substantially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more mismatched base pairs, such as 2, 4, or 5 mismatched base pairs, but preferably not more than 5, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g. , inhibition of gene expression via a RISC pathway. Overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a nucleic acid e.g., dsRNA comprising one oligonucleoside 17 nucleosides in length and another oligonucleoside 19 nucleosides in length, wherein the longer oligonucleoside comprises a sequence of 17 nucleosides that is fully complementary to the shorter oligonucleoside, can yet be referred to as "fully complementary".
[0302] "Complementary" sequences, as used herein, can also include, or be formed entirely from, non- Watson-Crick base pairs or base pairs formed from non-natural and modified nucleosides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.
[0303] The terms "complementary," "fully complementary" and "substantially complementary" herein can be used with respect to the base matching between the sense strand and the antisense strand of a nucleic acid e.g., dsiRNA, or between the antisense strand of a double stranded nucleic acid e.g., siRNA agent and a target sequence.
[0304] Within the present invention, the second strand of the nucleic acid according to the invention, in particular a dsiRNA for inhibiting expression of NR3C2, is at least partially complementary to the first strand of said nucleic acid. In certain embodiments, a first and second strand of a nucleic acid according to the invention are partially complementary if they form a duplex region having a length of at least 17 base pairs and comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs.
[0305] In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 19 base pairs and comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 21 base pairs comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs.
[0306] Alternatively, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of at least 17 base pairs, wherein at least 14, 15, 16 or 17 of said base pairs are complementary base pairs, in particular Watson-Crick base pairs.
[0307] In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 19 base pairs, wherein at least 14, 15, 16, 17, 18 or all 19 base pairs are complementary base pairs, in particular Watson-Crick base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 21 base pairs, wherein at least 16, 17, 18, 19, 20 or all 21 base pairs are complementary base pairs, in particular Watson-Crick base pairs.
[0308] As used herein, a nucleic acid that is "substantially complementary” to at least part of a messenger RNA (mRNA) refers to a polynucleoside that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding a gene). For example, a polynucleoside is complementary to at least a part of an mRNA of a gene of interest if the sequence is substantially complementary to a noninterrupted portion of an mRNA encoding that gene.
[0309] Accordingly, in some preferred embodiments, the antisense oligonucleosides as disclosed herein are fully complementary to the target gene sequence.
[0310] In other embodiments, the antisense oligonucleosides disclosed herein are substantially complementary to a target RNA sequence and comprise a contiguous nucleoside sequence which is at least about 80% complementary over its entire length to the equivalent region of the target RNA sequence, such as at least about 85%, 86%, 87%, 88%, 89%, about 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary or 100% complementary.
[0311] In certain embodiments, the first (antisense) strand of a nucleic acid according to the invention is partially or fully complementary to a contiguous portion of RNA transcribed from the NR3C2 gene. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of at least 17 nucleosides of the NR3C2 mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of 17, 18, 19, 20, 21, 22 or 23 nucleosides of the NR3C2 mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of 17, 18, 19, 20, 21, 22 or 23 nucleosides of any one of the sequences as listed in Table 1, i.e., any one of SEQ ID NOs: 1-223.
[0312] In certain embodiments, the first (antisense) strand of the nucleic acid according to the invention is partially complementary to a contiguous portion of the NR3C2 mRNA if it comprises a contiguous nucleoside sequence of at least 17 nucleosides, wherein at least 14, 15, 16 or 17 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of the NR3C2 mRNA. Incertain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of at least 17 nucleosides, wherein at least 14, 15, 16 or 17 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 1-223. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of 19 nucleosides, wherein at least 14, 15, 16, 17, 18 or all 19 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 1-223. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of 23 nucleosides, wherein at least 18, 19, 20, 21, 22 or all 23 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 1-223.
[0313] In some embodiments, a nucleic acid e.g, an siRNA of the invention includes a sense strand that is substantially complementary to an antisense polynucleoside which, in turn, is complementary to a target gene sequence and comprises a contiguous nucleoside sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleoside sequence of the antisense strand, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary.
[0314] In some embodiments, a nucleic acid e.g., an siRNA of the invention includes an antisense strand that is substantially complementary to the target sequence and comprises a contiguous nucleoside sequence which is at least 80% complementary over its entire length to the target sequence such as about 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary.
[0315] As used herein, a "subject" is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), or a non-primate or a bird that expresses the target gene, either endogenously or heterologously, when the target gene sequence has sufficient complementarity to the nucleic acid e.g., iRNA agent to promote target knockdown. In certain preferred embodiments, the subject is a human.
[0316] The terms "treating" or "treatment" refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms associated with gene expression. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. Treatment can include prevention of development of co-morbidities. As used herein, the term “treatment”, in particular treatment of myocardial infarction, HFrEF and / or HFpEF, encompasses the treatment of consequences / symptoms of myocardial infarction, HFrEF and / or HFpEF respectively, such as damage of heart muscle tissue. As such, the inhibitors of the invention, have cardioprotective effect and, inter alia, reduce infarct size and / or reperfusion arrythmias.
[0317] The terms “prevent” or “prevention” as used herein are defined as eliminating or reducing the likelihood of occurrence of one or more symptoms of a disease or disorder. For example, the inhibitor disclosed herein can be used to prevent the occurrence of ischaemic heart diseases, in particular myocardial infarction, and / or symptoms thereof, HFrEF and / or symptoms thereof and / or HFpEF and / or symptoms thereof.
[0318] "Therapeutically effective amount", as used herein, is intended to include the amount of a nucleic acid e.g., an iRNA that, when administered to a patient for treating a subject having disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease or its related comorbidities).
[0319] The phrase "pharmaceutically acceptable" is employed herein to refer to compounds, materials, compositions, or dosage forms which are suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.
[0320] The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically- acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated.
[0321] Where a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.
[0322] The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article.
[0323] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to".
[0324] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or", unless context clearly indicates otherwise. For example, "sense strand or antisense strand" is understood as "sense strand or antisense strand or sense strand and antisense strand".
[0325] The term "about" is used herein to mean within the typical ranges of tolerances in the art. For example, "about" can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that "about" can modify each of the numbers in the series or range.
[0326] The term "at least" prior to a number or series of numbers is understood to include the number adjacent to the term "at least", and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleosides of a 21-nucleoside nucleic acid molecule" means that 18, 19, 20, or 21 nucleosides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range.
[0327] As used herein, "no more than" or "less than" is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of "no more than 2 nucleosides" has a 2, 1, or 0 nucleoside overhang. When "no more than" is present before a series of numbers or a range, it is understood that "no more than" can modify each of the numbers in the series or range.
[0328] The terminal region of a strand is the last 5 nucleotides from the 5’ or the 3’ end.
[0329] A nucleobase sequence is the sequence of the bases of the nucleic acid in an oligomer.
[0330] Various embodiments of the invention can be combined as determined appropriate by one of skill in the art.TARGET
[0331] A target for inhibition disclosed herein may be, without limitation, an mRNA, polypeptide, protein, or gene.
[0332] These targets are a target the inhibition of which helps in the prevention or treatment of an ischaemic heart disease such as myocardial infarction. These targets are a target the inhibition of which helps in the prevention or treatment of HFpEF and / or HFrEF.
[0333] The target for inhibition is NR3C2, and inhibition may be effected by inhibition of expression or function of the NR3C2 gene or protein or both.DISEASE / CONDITIONS
[0334] The invention relates to an inhibitor suitable for use, or for use, in treatment of an ischaemic heart disease, in particular myocardial infarction.
[0335] The invention relates to an inhibitor suitable for use, or for use, in treatment of heart failure with preserved ejection fraction (HFpEF).
[0336] The invention relates to an inhibitor suitable for use, or for use, in treatment of heart failure with reduced ejection fraction (HFrEF).
[0337] Inhibitors disclosed herein, including the specific oligonucleotide sequences disclosed herein, may be used in the treatment of any of the diseases disclosed herein, included HFrEF and HFpEF.INHIBITORS
[0338] Inhibitors of the invention include nucleic acids such as siRNAs, antibodies, and antigen binding fragments thereof, e.g., monoclonal antibodies, polypeptides, antibody-drug conjugates, and small molecules. Preferred are nucleic acids such as siRNA.
[0339] Certain preferred features of inhibitors of the invention, where these are oligonucleosides such as siRNA, are given below.
[0340] In certain embodiments, the nucleic acid comprises a first strand comprising a sequence that is at least partially complementary to a portion of RNA transcribed from the NR3C2 gene (SEQ ID NO: 1116). In a preferred embodiment, the nucleic acid comprises a first strand comprising a sequence that is at least partially complementary to a NR3C2 mRNA.
[0341] In certain embodiments, the nucleic acid for inhibiting expression of NR3C2 comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to a portion of RNA transcribed from the NR3C2 gene.
[0342] In certain embodiments, the nucleic acid for inhibiting expression of NR3C2 comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to a portion of RNA transcribed from the NR3C2 gene.ABASIC NUCLEOTIDES
[0343] The invention specifically contemplates the use of abasic nucleosides as disclosed in PCT / US22 / 74223 (WO 2023 / 059948). In particular, it specifically contemplates the use of abasic nucleosides as described in paragraphs
[0141] -
[0165] (pages 34 - 40) of the published PCT specification, the disclosure of which is hereby incorporated by reference.
[0344] Preferably a nucleic acid according to the present invention comprises one or more abasic nucleosides, optionally wherein the one or more abasic nucleosides are in a terminal region of the second strand, and / or wherein at least one abasic nucleoside is linked to an adjacent basic nucleoside through a reversed intemucleoside linkage.
[0345] Typically, the second strand comprises 2 consecutive abasic nucleosides in the 5 ’ terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 5 ’ terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 5 ’ terminal region ofthe second strand, wherein: (a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 5’ near terminal region through a reversed intemucleoside linkage; and (b) the reversed linkage is a 5-5’ reversed linkage; and (c) the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. More typically, (i) the first strand and the second strand each has a length of 23 nucleosides; (ii) two phosphorothioate intemucleoside linkages are respectively between three consecutive positions in said 5 ’ near terminal region of the second strand, wherein a first phosphorothioate intemucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 5 ’ near terminal region of the second strand, and a second phosphorothioate intemucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 5’ near terminal region of the second strand; (iii) two phosphorothioate intemucleoside linkages are respectively between three consecutive positions in both 5 ’ and 3 ’ terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5 ’ and 3 ’ terminal regions of said first strand is each attached to a respective 5’ and 3’ adjacent penultimate nucleoside by a phosphorothioate intemucleoside linkage, and each first 5’ and 3’ penultimate nucleoside is attached to a respective 5’ and 3’ adjacent antepenultimate nucleoside by a phosphorothioate intemucleoside linkage; and (iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 3 ’ terminal region of the second strand.
[0346] Alternatively the second strand comprises 2 consecutive abasic nucleosides preferably in an overhang in the 3 ’ terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 3 ’ terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 3’ terminal region of the second strand, wherein: (a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 3’ near terminal region through a reversed intemucleoside linkage; and (b) the reversed linkage is a 3-3’ reversed linkage; and (c) the linkage between the terminal and penultimate abasic nucleosides is 5 ’-3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. More typically, (i) the first strand and the second strand each has a length of 23 nucleosides; (ii) two phosphorothioate intemucleoside linkages are respectively between three consecutive positions in said 3’ near terminal region of the second strand, wherein a first phosphorothioate intemucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 3’ near terminal region of the second strand, and a second phosphorothioate intemucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 3’ near terminal region of the second strand; (iii) two phosphorothioate intemucleoside linkages are respectively between three consecutive positions in both 5’ and 3’ terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5’ and 3’ terminal regions of said first strand is each attached to a respective 5’ and 3’ adjacent penultimate nucleoside by a phosphorothioate intemucleoside linkage, and each first 5 ’ and 3 ’ penultimate nucleoside is attached to a respective 5’ and 3’ adjacent antepenultimate nucleoside by a phosphorothioateintemucleoside linkage; and (iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 5’ terminal region of the second strand.
[0347] In some embodiments, the second (sense) strand of the nucleic acid according to the invention comprises 2 consecutive abasic nucleosides in the 5’ terminal region as shown in the following 5’ terminal motif:5' terminal motifwherein:B represents a nucleoside base,T represent H, OH or a 2’ ribose modification,Z represents the remaining nucleosides of said second strand.
[0348] In some embodiments, the second (sense) strand of the nucleic acid according to the invention comprises 2 consecutive abasic nucleosides in the 5’ terminal region as shown in the following 5’ terminal motif:wherein:B represents a nucleoside base,T represents H, OH or a 2’ ribose modification (preferably a 2’ ribose modification, more preferably a 2’Me or 2’F ribose modification),V represents O or S (preferably O),R represents H or Cl -4 alkyl (preferably H),Z represents the remaining nucleosides of said second strand, more preferably the following 5 ’ terminal motif:wherein:B represents a nucleoside base,T represents a 2’ ribose modification (preferably a 2’Me or 2’F ribose modification),Z represents the remaining nucleosides of said second strand.
[0349] The reversed bond is preferably located at the end of the nucleic acid e.g., RNA which is distal to a ligand moiety, such as a GalNAc containing portion, of the molecule.
[0350] GalNAc-siRNA constructs with a 5 ’-GalNAc on the sense strand can have a reversed linkage on the opposite end of the sense strand.
[0351] GalNAc-siRNA constructs with a 3 ’-GalNAc on the sense strand can have a reversed linkage on the opposite end of the sense strand.
[0352] In a preferred embodiment, the second (sense) strand of the nucleic acid according to the invention comprises 2 consecutive abasic nucleosides in the 5’ terminal region as shown in the following 5’ terminal motif:wherein:B represents a nucleoside base,T represent H, OH or a 2’ ribose modification (preferably a 2’ ribose modification, more preferably a 2’Me or 2’F ribose modification),V represent O or S (preferably O),R represent H or Cl -4 alkyl (preferably H),Z comprises 11 to 26 contiguous nucleosides, preferably 15 to 21 contiguous nucleosides, and more preferably 19 contiguous nucleosides, more preferably the following 5’ terminal motif:wherein:B represents a nucleoside base,T represents a 2’ ribose modification (preferably a 2’Me or 2’F ribose modification),Z comprises 19 contiguous nucleosides.NUCLEIC ACID LENGTHS
[0353] In one aspect i) the first strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides; and / or ii) the second strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 nucleosides.
[0354] Typically, the duplex region of the nucleic acid is between 17 and 30 nucleosides in length, more preferably is 19 or 21 nucleosides in length. Similarly, the region of complementarity between the first strand and the portion of RNA transcribed from the NR3C2 gene is between 17 and 30 nucleosides in length.
[0355] Generally, the duplex structure of the nucleic acid e.g., an iRNA is about 15 to 30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17,18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27,19-26, 19-25, 19-24, 19- 23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23,20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.
[0356] Similarly, the region of complementarity of an antisense sequence to a target sequence and / or the region of complementarity of an antisense sequence to a sense sequence is about 15 to 30 nucleosides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17,18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27,19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20- 24,20-23,20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleosides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.
[0357] In certain preferred embodiments, the region of complementarity of an antisense sequence to a target sequence and / or the region of complementarity of an antisense sequence to a sense sequence is at least 17 nucleosides in length. For example, the region of complementarity between the antisense strand and the target is 19 to 21 nucleosides in length, for example, the region of complementarity is 21 nucleosides in length.
[0358] In preferred embodiments, each strand is no more than 30 nucleosides in length.
[0359] In certain preferred embodiments, the duplex structure of the nucleic acid e.g., an siRNA is 19 or 21 base pairs in length. In a particularly preferred embodiment, the duplex may have one of the following structures:A 3V V V V V w V V V V V V V V V V V V V5
[0360] A nucleic acid e.g., a dsRNA as described herein can further include one or more single -stranded nucleoside overhangs e.g., 1-4, 2-4, 1-3, 2-3, 1, 2, 3, or 4 nucleosides. A nucleoside overhang can comprise or consist of a nucleoside / nucleoside analog, including a deoxynucleoside / nucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleoside(s) of an overhang can be present on the 5'-end, 3'- end, or both ends of an antisense or sense strand of a nucleic acid e.g., a dsRNA.
[0361] In certain preferred embodiments, at least one strand comprises a 3' overhang of at least 1 nucleoside, e.g., at least one strand comprises a 3' overhang of at least 2 nucleosides. The overhang is suitably on the antisense / guide strand and / or the sense / passenger strand.NUCLEIC ACID MODIFICATIONS
[0362] In certain embodiments, the nucleic acid e.g., an RNA of the invention e.g., a dsiRNA, does not comprise further modifications, e.g., chemical modifications or conjugations known in the art and described herein.
[0363] In other preferred embodiments, the nucleic acid e.g., RNA of the invention, e.g., a dsiRNA, is further chemically modified to enhance stability or other beneficial characteristics.
[0364] In certain embodiments of the invention, substantially all of the nucleosides are modified.
[0365] The nucleic acids featured in the invention can be synthesized or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al. ((Eds.), John Wiley & Sons, Inc., New York, NY, USA), which is hereby incorporated herein by reference.
[0366] The invention specifically contemplates the use of nucleic acid modifications as disclosed in PCT / US22 / 74223 (WO 2023 / 059948). In particular, it specifically contemplates the use of nucleic acid modifications as described in paragraphs
[0175] -
[0188] and
[0225] -
[0236] (pages 41 - 43 and 50 - 51) of the published PCT specification, the disclosure of which is hereby incorporated by reference.
[0367] Preferred modifications that can be used with sequences according to the present invention can be as follows:Modification 1:First strand modification:NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’)Second strand modification:iaiaNmsNmsNmNmNmNmNfNfNfNfNfNmNmNmNmNmNmNmNfNmNm (5’ to 3’)Modification 2:First strand modification:NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNfNfNmNfNfNfNfNmNmNmNmNmNmNmNmNm (5’ to 3’)Modification 3 :First strand modification:NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNm (5’ to 3’)Modification 4:First strand modification:NmsNfsNmNfNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNm (5’ to 3’)Modification 5 :First strand modification:NmsNfsNmNmNmNfNmNmNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’)Modification 6:First strand modification:NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNfNmNmNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’)Modification 7 :First strand modification:NmsNfsNmNmNmNyNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’)Modification 8:First strand modification:NmsNfsNmNmNmNyNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’)Modification 9:First strand modification:NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmNfNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’)Modification 10:First strand modification:NmsNfsNmNfNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’)Modification 11 :First strand modification:NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNniNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’)Modification 12:First strand modification:NmsNfsNmNmNmNfNmNfNfNmNmNmNmNfNmNfNmNfNmNmNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’)Modification 13:First strand modification:NmsNfsNmNmNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNfNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’) wherein in each of the above modifications: ia represents an inverted abasic nucleoside;Nm represents a 2’Me ribose modified nucleoside;Nf represents a 2’F ribose modified nucleoside;Ny represents a nucleoside with a thermally destabilizing modification, preferably wherein the destabilizing modification is selected from a modified unlocked nucleic acid (UNA) and a glycol nucleic acid (GNA), more preferably a glycol nucleic acid, most preferably an (S)-glycol nucleic acid; s represents a phosphorothioate intemucleoside bond.
[0368] In a preferred embodiment, the nucleic acid according to the invention has the following modification pattern:Modification 13:First strand modification:NmsNfsNmNmNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNfNmsNmsNm (5’ to 3’)Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’).
[0369] In certain embodiments, the nucleic acid comprises a 5’ vinylphosphonate (5 ’VP) modification. The 5 ’VP modification is preferably on the antisense strand, but can be on the sense strand as well, or instead. Preferably, the 5 ’VP modification is a 5’-(E)-vinylphosphonate (5’-(E)-VP) modification.
[0370] A 5 '-VP modification is a stable phosphate mimic added at the 5' end of an oligonucleoside. It is a modification in which the 5' carbon forms a double bond to a 6' carbon linked to the phosphorus. Such modifications are described in Haraszti et al 2017 (Haraszti et al., 5 ' -Vinylphosphonate improves tissue accumulation and efficacy of conjugated siRNAs in vivo. NUCLEIC ACIDS RES. 2017 Jul 27;45( 13):7581- 7592. doi: 10.1093 / nar / gkx507. PMID: 28591791; PMCID: PMC5570069).CONJUGATION OF NUCLEIC ACID TO LIGAND
[0371] Another modification of a nucleic acid e.g. , RNA e.g. , an siRNA of the invention involves linking the nucleic acid e.g., the siRNA to one or more ligand moieties e.g., to enhance the activity, cellular distribution, or cellular uptake of the nucleic acid e.g., siRNA e.g., into a cell.
[0372] In some embodiments, the ligand moiety described can be attached to a nucleic acid e.g., an siRNA oligonucleoside, via a linker that can be cleavable or non-cleavable. The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound.
[0373] The ligand can be attached to the 3' or 5’ end of the sense strand.
[0374] The ligand is preferably conjugated to 3’ end of the sense strand of the nucleic acid e.g., an siRNA agent.
[0375] The invention therefore relates in a further aspect to a conjugate for inhibiting expression of a target e.g., a target gene, in a cell, said conjugate comprising a nucleic acid portion and one or more ligand moieties, said nucleic acid portion comprising a nucleic acid as disclosed herein.
[0376] In one aspect the second strand of the nucleic acid is conjugated directly or indirectly (e.g., via a linker) to the one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3 ’ terminal region thereof.
[0377] In certain embodiments, the ligand moiety comprises a GalNAc or GalNAc derivative attached to the nucleic acid e.g., dsiRNA through a linker.
[0378] Therefore, the invention relates to a conjugate wherein the ligand moiety comprises i) one or more GalNAc ligands; and / or ii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands conjugated to said nucleic acid through a linker.
[0379] Said GalNAc ligand may be conjugated directly or indirectly to the 5 ’ or 3 ’ terminal region of the second strand of the nucleic acid, preferably at the 3 ’ terminal region thereof.
[0380] GalNAc ligands are well known in the art and described in, inter alia, EP3775207A1.
[0381] In some embodiments, the GalNAc ligand is comprised in any one of the linkers shown in Figures 1 to 4 or Figure 5 (Formula XI), wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Accordingly, the "oligonucleotide" may comprise other bonds than a phosphodiester bond, such as one or more phosphorothioate bonds. Preferably, the nucleic acid according to the invention is a double stranded oligonucleoside as defined herein and the linker is conjugated to the second strand, more preferably to the 3' terminal region of the second strand, via a phosphodiester bond.
[0382] In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 3, wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Accordingly, the "oligonucleotide" may comprise other bonds than a phosphodiester bond, such as one or more phosphorothioate bonds. Preferably, the nucleic acid according to the invention is a double stranded oligonucleoside as defined herein and the linker is conjugated to the second strand, more preferably to the 3' terminal region of the second strand, via a phosphodiester bond.
[0383] In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 5 (Formula XI), wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Accordingly, the "oligonucleotide" may comprise other bonds than a phosphodiester bond, such as one or more phosphorothioate bonds. Preferably, the nucleic acid according to the invention is a double stranded oligonucleoside as defined herein and the linker is conjugated to the second strand, more preferably to the 3' terminal region of the second strand, via a phosphodiester bond.
[0384] In some embodiments, the GalNAc ligand is comprised in any one of the linkers shown in Figures 1 to 4 or Figure 5 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:447 to SEQ ID NO:669, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:447 to SEQ ID NO:669, via a phosphodiester bond.
[0385] In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 3, wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:447 to SEQ ID NO:669, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:447 to SEQ ID NO:669, via a phosphodiester bond.
[0386] In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 5 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:447 to SEQ ID NO:669, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one SEQ ID NO:447 to SEQ ID NO:669, via a phosphodiester bond.
[0387] In some embodiments, the GalNAc ligand is comprised in any one of the linkers shown in Figures 1 to 4 or Figure 5 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:893 to SEQ ID NO: 1115, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:893 to SEQ ID NO: 1115, via a phosphodiester bond.
[0388] In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 3, wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:893 to SEQ ID NO: 1115, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:893 to SEQ ID NO: 1115, via a phosphodiester bond.
[0389] In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 5 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:893 to SEQ ID NO: 1115, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:893 to SEQ ID NO: 1115, via a phosphodiester bond.
[0390] In some embodiments, the GalNAc ligand is comprised in the linker shown in Figures 1 to 4 or Figure 5 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:893 to SEQ ID NO: 1115, preferably of any one of SEQ ID NO: 897,SEQ ID NO: 907, SEQ ID NO: 912, SEQ ID NO: 904, SEQ ID NO: 914, and SEQ ID NO: 919, more preferably SEQ ID NO: 907 or SEQ ID NO: 914, wherein the second strand has the following structure:wherein:T represents a 2’Me ribose modification,B represents the nucleoside bases of the first two basic nucleosides in the 5 ’ terminal region of any one of SEQ ID NO:893 to SEQ ID NO: 1115, preferably of any one of SEQ ID NO: 897, SEQ ID NO: 907, SEQ ID NO: 912, SEQ ID NO: 904, SEQ ID NO: 914, and SEQ ID NO: 919, more preferably SEQ ID NO: 907 or SEQ ID NO: 914, andZ represents the remaining 19 contiguous basic nucleosides of any one of SEQ ID NO:893 to SEQ ID NO: 1115, preferably of any one of SEQ ID NO: 897, SEQ ID NO: 907, SEQ ID NO: 912, SEQ ID NO: 904, SEQ ID NO: 914, and SEQ ID NO: 919, more preferably SEQ ID NO: 907 or SEQ ID NO: 914.
[0391] In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 5 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one ofSEQ ID NO:893 to SEQ ID NO: 1115, preferably of any one of SEQ ID NO: 897, SEQ ID NO: 907, SEQ ID NO: 912, SEQ ID NO: 904, SEQ ID NO: 914, and SEQ ID NO: 919, more preferably SEQ ID NO: 907 or SEQ ID NO: 914, wherein the second strand has the following structure:wherein:T represents a 2’Me ribose modification,B represents the nucleoside bases of the first two basic nucleosides in the 5' terminal region of any one of SEQ ID NO:893 to SEQ ID NO: 1115, preferably of any one of SEQ ID NO: 897, SEQ ID NO: 907, SEQ ID NO: 912, SEQ ID NO: 904, SEQ ID NO: 914, and SEQ ID NO: 919, more preferably SEQ ID NO: 907 or SEQ ID NO: 914, andZ represents the remaining 19 contiguous basic nucleosides of any one of SEQ ID NO:893 to SEQ ID NO: 1115, preferably of any one of SEQ ID NO: 897, SEQ ID NO: 907, SEQ ID NO: 912, SEQ ID NO: 904, SEQ ID NO: 914, and SEQ ID NO: 919, more preferably SEQ ID NO: 907 or SEQ ID NO: 914.
[0392] In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 3, wherein the “oligonucleotide” represents a nucleic acid according to the invention, wherein the nucleic acidaccording to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:893 to SEQ ID NO: 1115, wherein the second strand has the following structure:wherein:T represents a 2’Me ribose modification,B represents the nucleoside bases of the first two basic nucleosides in the 5' terminal region of any one of SEQ ID NO:893 to SEQ ID NO: 1115, andZ represents the remaining 19 contiguous basic nucleosides of any one of SEQ ID NO:893 to SEQ ID NO: 1115, respectively.
[0393] In some embodiments, the ligand moiety comprises one or more ligands.
[0394] In some embodiments, the ligand moiety comprises one or more carbohydrate ligands.
[0395] In some embodiments, the one or more carbohydrates can be a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and / or polysaccharide.
[0396] In some embodiments, the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-AcetylGalactosamine moieties, and / or one or more mannose moieties.
[0397] In some embodiments, the one or more carbohydrates comprise one or more N-Acetyl- Galactosamine moieties.
[0398] In some embodiments, the compounds as described anywhere herein comprise two or three N- AcetylGalactosamine moieties.
[0399] In some embodiments, the one or more ligands are attached in a linear configuration, or in a branched configuration, for example each configuration being respectively attached to a branch point in an overall linker.
[0400] Exemplary linear configurations and Exemplary branched configurations are shown in Figures 15a and 15b:
[0401] In Fig 15a, (linear), (a) and / or (b) can typically represent connecting bonds or groups, such as phosphate or phosphorothioate groups.
[0402] In Fig 15b, (branched), in some embodiments, the one or more ligands are attached as a biantennary or triantennary branched configuration. Typically, a triantennary branched configuration can be preferred, such as an N-AcetylGalactosamine triantennary branched configuration.LINKER
[0403] Exemplary compounds of the invention comprise a Tinker moiety’, such as that as depicted in Formula (I), that is part of an overall ‘linker’.Formula Iwherein:Ri at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl;R2 is selected from the group consisting of hydrogen, hydroxy, -OCi-salkyl, -C(=O)OCi.3alkyl, halo and nitro;Xi and X2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that:(i) q and r cannot both be 0 at the same time; and(ii) s, t, and v cannot all be 0 at the same time;Z is an oligonucleoside moiety.
[0404] As will be further understood in the art, exemplary compounds of the invention comprise an overall linker that is located between the oligonucleoside moiety and the ligand moiety of these compounds. The overall linker, thereby ‘links’ the oligonucleoside moiety and the ligand moiety to each other.
[0405] The overall linker is often notionally envisaged as comprising one or more linker building blocks. For example, there is a linker portion that is depicted as the Tinker moiety’ as represented in Formula (I) positioned adjacent the ligand moiety and attaching the ligand moiety, typically via a branch point, directly or indirectly to the oligonucleoside moiety. The linker moiety as depicted in Formula (I) can also often be referred to as the ‘ligand arm or arms’ of the overall linker. There can also, but not always, be a further linker portion between the oligonucleoside moiety and the branch point, which is often referred to as the ‘tether moiety’ of the overall linker, ‘tethering’ the oligonucleoside moiety to the remainder of the conjugated compound. Such ‘ligand arms’ and / or ‘linker moieties’ and / or ‘tether moieties’ can be envisaged by reference to the linear and / or branched configurations as set out above.
[0406] As can be seen from the claims, and the reminder of the patent specification, the scope of the present invention extends to linear or branched configurations, and with no limitation as to the number of individual ligands that might be present. Furthermore, the addressee will also be aware that there are many structures that could be used as the linker moiety, based on the state of the art and the expertise of an oligonucleoside chemist.
[0407] The remainder of the overall linker (other than the linker moiety) as set out in the claims, and the remainder of the patent specification, is shown by its chemical constituents in Formula (I), which the inventors consider to be particularly unique to the current invention. In more general terms, however, these chemical constituents could be described as a ‘tether moiety’ as hereinbefore described, wherein the ‘tether moiety’ is that portion of the overall linker which comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety as depicted in Formula (I).Tether moiety of Formula I
[0408] In relation to Formula (I), the ‘tether moiety’ comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety.
[0409] In some embodiments, Ri is hydrogen at each occurrence. In some embodiments, Ri is methyl. In some embodiments, Ri is ethyl.
[0410] In some embodiments, R2 is hydroxy. In some embodiments, R2 is halo. In some embodiments, R2 is fluoro. In some embodiments, R2 is chloro. In some embodiments, R2 is bromo. In some embodiments, R2 is iodo. In some embodiments, R2 is nitro.
[0411] In some embodiments, Xi is methylene. In some embodiments, Xi is oxygen. In some embodiments, Xi is sulfur.
[0412] In some embodiments, X2 is methylene. In some embodiments, X2 is oxygen. In some embodiments, X2 is sulfur.
[0413] In some embodiments, m = 3.
[0414] In some embodiments, n = 6.
[0415] In some embodiments, Xi is oxygen and X2is methylene. In some embodiments, both Xi and X2are methylene.
[0416] In some embodiments, q = 1, r = 2, s = 1, t = 1, v = 1. In some embodiments, q = 1, r = 3, s = 1, t = l, v = 1.
[0417] In some embodiments, Ri is hydrogen at each occurrence, n = 6, m = 3, R2 is fluoro, X2 is methylene, v = 1, t = 1, s = 1, Xi is methylene, q = 1 and r = 2.
[0418] Thus, in some embodiments, exemplary compounds of the invention comprise the following structure:Formula (IV)
[0419] In some embodiments, Ri is hydrogen at each occurrence, n = 6, m = 3, R2is fluoro, X2is methylene, v = 1, t = 1, s = 1, Xi is oxygen, q = 1 and r = 2.
[0420] Thus, in some embodiments, exemplary compounds of the invention comprise the following structure:Formula (II)Alternative tether moieties
[0421] During the synthesis of compounds of the present invention, alternative tether moiety structures may arise. In some embodiments, alternative tether moieties have a change of one or more atoms in the tether moiety of the overall linker compared to tether moieties described anywhere herein.
[0422] In some embodiments, the alternative tether moiety is a compound of Formula (I) as described anywhere herein, wherein R2 is hydroxy.
[0423] In some embodiments, Ri is hydrogen at each occurrence, n = 6, m = 3, R2 is hydroxy, X2 is methylene, v = 1, t = 1, s = 1, Xi is methylene, q = 1 and r = 2.
[0424] Thus, in some embodiments, compounds of the invention comprise the following structure:Formula (V)
[0425] In some embodiments, Ri is hydrogen at each occurrence, n = 6, m = 3, R2 is hydroxy, X2 is methylene, v = 1, t = 1, s = 1, Xi is oxygen, q = I and r = 2.
[0426] Thus, in some embodiments, compounds of the invention comprise the following structure:Formula (III)Linker moiety
[0427] In relation to Formula (I), the ‘linker moiety’ as depicted in Formula (I) comprises the group of atoms located between the tether moiety as described anywhere herein, and the ligand moiety as described anywhere herein.
[0428] In some embodiments:as depicted in Formula (I) as described anywhere herein is any of Formulae (Via), (VIb) or (Vic), preferably Formula (Via):Formula (Via) wherein:Ai is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and b is an integer of 2 to 5; orFormula (VIb) wherein:Ai is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and c and d are independently integers of 1 to 6; orFormula (Vic) wherein:Ai is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and e is an integer of 2 to 10.
[0429] In some embodiments, the moiety:as depicted in Formula (I) is Formula (Via):Formula (Via) wherein:Ai is hydrogen, or a suitable hydroxy protecting group; a is 3; and b is an integer of 3.
[0430] In some embodiments, the moiety:as depicted in Formula (I) as described anywhere herein is Formula (VII):Formula (VII) wherein:Ai is hydrogen; a is an integer of 2 or 3, preferably 3.
[0431] Other exemplary compounds of the invention comprise a ‘linker moiety’, as depicted in Formula (I*), that is part of an overall ‘linker’.Formula I*Where: r and s are independently an integer selected from 1 to 16; andZ is an oligonucleoside moiety.
[0432] As will be further understood in the art, exemplary compounds of the invention comprise an overall linker that is located between the oligonucleoside moiety and the ligand moiety of these compounds. The overall linker, thereby ‘links’ the oligonucleoside moiety and the ligand moiety to each other.
[0433] The overall linker is often notionally envisaged as comprising one or more linker building blocks. For example, there is a linker portion that is depicted as the ‘linker moiety’ as represented in Formula (I*) positioned adjacent the ligand moiety and attaching the ligand moiety, typically via a branch point, directly or indirectly to the oligonucleoside moiety. The linker moiety as depicted in Formula (I*) can also often be referred to as the ‘ligand arm or arms’ of the overall linker. There can also, but not always, be a further linker portion between the oligonucleoside moiety and the branch point, which is often referred to as the ‘tether moiety’ of the overall linker, ‘tethering’ the oligonucleoside moiety to the remainder of the conjugated compound. Such ‘ligand arms’ and / or ‘linker moieties’ and / or ‘tether moieties’ can be envisaged by reference to the linear and / or branched configurations as set out above.
[0434] As can be seen from the claims, and the reminder of the patent specification, the scope of the present invention extends to linear or branched configurations, and with no limitation as to the number of individual ligands that might be present. Furthermore, the addressee will also be aware that there are many structures that could be used as the linker moiety, based on the state of the art and the expertise of an oligonucleoside chemist.
[0435] The remainder of the overall linker (other than the linker moiety) as set out in the claims, and the remainder of the patent specification, is shown by its chemical constituents in Formula (I), which the inventors consider to be particularly unique to the current invention. In more general terms, however, these chemical constituents could be described as a ‘tether moiety’ as hereinbefore described, wherein the ‘tether moiety’ is that portion of the overall linker which comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety as depicted in Formula (I).Tether moiety
[0436] In relation to Formula (I*), the ‘tether moiety’ comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety.
[0437] In some embodiments, s is an integer selected from 4 to 12. In some embodiments, s is 6.
[0438] In some embodiments, r is an integer selected from 4 to 14. In some embodiments, r is 6. In some embodiments, r is 12.
[0439] In some embodiments, r is 12 and s is 6.
[0440] Thus, in some embodiments, exemplary compounds of the invention comprise the following structure:Formula (II*)
[0441] In some embodiments, r is 6 and s is 6.
[0442] Thus, in some embodiments, exemplary compounds of the invention comprise the following structure:Formula (III*)Linker moiety
[0443] In relation to Formula (I*), the Tinker moiety’ as depicted in Formula (I) comprises the group of atoms located between the tether moiety as described anywhere herein, and the ligand moiety as described anywhere herein.
[0444] In some embodiments, the moiety:as depicted in Formula (I*) as described anywhere herein is any of Formulae (IV*), (V*) or (VI*), preferably Formula (IV*):Formula (IV*) wherein:Ai is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and b is an integer of 2 to 5; orFormula (V*) wherein:Ai is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and c and d are independently integers of 1 to 6; orFormula (VI*) wherein:Ai is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and e is an integer of 2 to 10.
[0445] In some embodiments, the moiety:as depicted in Formula (I) is Formula (Via*):Formula (Via*) wherein:Ai is hydrogen, or a suitable hydroxy protecting group; a is 3; andb is an integer of 3.
[0446] In some embodiments, the moiety:Linker LigandMoiety Moietyas depicted in Formula (I) as described anywhere herein is Formula (VII*):Formula (VII*) wherein:Ai is hydrogen; a is an integer of 2 or 3.
[0447] In some embodiments, a = 2. In some embodiments, a = 3. In some embodiments, b = 3.VECTOR AND CELL
[0448] In one aspect, the invention provides a cell containing a nucleic acid, such as inhibitory RNA [RNAi] as described herein.
[0449] In one aspect, the invention provides a cell comprising a vector as described herein.
[0450] In one aspect the invention provides a vector comprising an oligonucleotide inhibitor, e.g., an iRNA e.g., siRNA.PHARMACEUTICALLY ACCEPTABLE COMPOSITIONS
[0451] In one aspect, the invention provides a pharmaceutical composition for inhibiting expression of a target gene, the composition comprising an inhibitor such as an oligomer such as a nucleic acid as disclosed herein.
[0452] The pharmaceutically acceptable composition may comprise an excipient and or carrier.
[0453] Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen- free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or poly anhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as semm albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations.
[0454] Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fdlers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, com starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).
[0455] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.
[0456] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non- parenteral administration which do not deleteriously react with nucleic acids can be used.
[0457] In one embodiment, the nucleic acid or composition is administered in an unbuffered solution. In certain embodiments, the unbuffered solution is saline or water. In other embodiments, the nucleic acid e.g., RNAi agent is administered in a buffered solution. In such embodiments, the buffer solution can comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. For example, the buffer solution can be phosphate buffered saline (PBS).DOSAGES
[0458] The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a gene or modify the expression or function of a target. In general, where the composition comprising a nucleic acid, a suitable dose of a nucleic acid e.g., an siRNA of the invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. Typically, a suitable dose of a nucleic acid e.g., an siRNA of the invention will be in the range of about 0. 1 mg / kg to about 5.0 mg / kg, e.g., about 0.3 mg / kg and about 3.0 mg / kg.
[0459] A repeat-dose regimen may include administration of a therapeutic amount of a nucleic acid e.g., siRNA on a regular basis, such as every other day or once a year. In certain embodiments, the nucleic acid e.g., siRNA is administered about once per month to about once per quarter (i.e., about once every three months).
[0460] In the present invention, in particular regarding the treatment of myocardial infarction and / or symptoms thereof, it is preferred that the first administration of the inhibitor is shortly after the myocardial infarction occurred. In particular, the inhibitor of the invention may preferably first be administered at the time a myocardial infarction occurs or within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 hours after myocardial infarction occurred. It is also provided herein that the inhibitor of the invention is first administered within 1 day, 2, 3, 4, 5, 6, 7, 8, 9 or 10 days after myocardial infarction.
[0461] In various embodiments, the nucleic acid e.g., siRNA agent is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg. In some embodiments, the nucleic acid e.g., siRNA agent is administered at a dose of about 10 mg / kg to about 30 mg / kg. In certain embodiments, the nucleic acid e.g., siRNA agent is administered at a dose selected from about 0.5 mg / kg 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg. In certain embodiments, the nucleic acid e.g., siRNA agent is administered about once per week, once per month, once every other two months, or once a quarter (i.e., once every three months) at a dose of about 0.1 mg / kg to about 5.0 mg / kg. In certain embodiments, the nucleic acid e.g., siRNA agent is administered to the subject once a week. In certain embodiments, the nucleic acid e.g., siRNA agent is administered to the subject once a month. In certain embodiments, the nucleic acid e.g., siRNA agent is administered once per quarter (i.e., every three months).
[0462] After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration weekly or biweekly for three months, administration can be repeated once per month, for six months, or a year; or longer.
[0463] The pharmaceutical composition can be administered once daily, or administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the nucleic acid e.g., siRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the nucleic acid e.g., siRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as could be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.
[0464] In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at not more than 3-, 4-, or 5 -day intervals, or at not more than 1, 2, 3, or 4 week intervals. In some embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered once per week. In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered bimonthly. In certain embodiments, the siRNA is administered about once per month to about once per quarter (i.e., about once every three months), or even every 6 months or 12 months.
[0465] Estimates of effective dosages and in vivo half-lives for the individual nucleic acid e.g., siRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as known in the art.
[0466] The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal, and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular administration. In certain preferred embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection.
[0467] In one embodiment, the nucleic acid e.g., siRNA agent is administered to the subject subcutaneously.
[0468] The inhibitor e.g., nucleic acid e.g., siRNA can be delivered in a manner to target a particular tissue (e.g., in particular heart cells).METHODS FOR INHIBITING GENE EXPRESSION OR INHIBITION OF TARGET EXPRESSION OR FUNCTION
[0469] The present invention also provides methods of inhibiting expression of a gene in a cell and methods for inhibiting expression and / or function of other target molecules. The methods include contacting a cell with a nucleic acid of the invention e.g., siRNA agent, such as double stranded siRNA inan amount effective to inhibit expression of the gene in the cell, thereby inhibiting expression of the gene in the cell. In a preferred embodiment, the gene is NR3C2.
[0470] The present invention also provides methods of inhibiting expression of NR3C2 gene in a cell.
[0471] It is to be noted that a nucleic acid “for inhibiting the expression of NR3C2” is a nucleic acid that is capable of inhibiting NR3C2 expression, preferably as described herein below.
[0472] Contacting of a cell with the inhibitor e.g., the nucleic acid e.g., an siRNA, such as a double stranded siRNA agent, may be done in vitro or in vivo. Contacting a cell in vivo with the inhibitor nucleic acid e.g., siRNA includes contacting a cell or group of cells within a subject, e.g., a human subject, with the nucleic acid e.g., siRNA. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand moiety, including any ligand moiety described herein or known in the art. In preferred embodiments, the targeting ligand moiety is a carbohydrate moiety, e.g., a GalNAc3 ligand, or any other ligand moiety that directs the siRNA agent to a site of interest.
[0473] The term "inhibiting," as used herein, is used interchangeably with "reducing," "silencing," "downregulating", "suppressing", and other similar terms, and includes any level of inhibition.
[0474] In some embodiments of the methods of the invention, expression or activity of a gene or an inhibition target is inhibited by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay. In certain embodiments, the methods include a clinically relevant inhibition of expression of a target gene e.g., as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to reduce the expression of the gene and / or activity of the target.
[0475] In some embodiments, when transfected into the cells, the nucleic acid of the invention inhibits expression of the NR3C2 gene with an EC50 value lower than 2500 pM, 2400 pM, 2300 pM, 2200 pM, 2100 pM, 2000 pM, 1900 pM, 1800 pM, 1700 pM, 1600 pM, 1500 pM, 1400 pM, 1300 pM, 1200 pM, 1100 pM, 1000 pM, 900 pM, 800 pM, 700 pM, 600 pM, 500 pM, 400 pM, 300 pM, 200 pM or 100 pM, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.
[0476] In a preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the NR3C2 gene with an EC50 value lower than 2500 pM. In a more preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the NR3C2 gene with an EC50 value lower than 1000 pM. In an even more preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the NR3C2 gene with an EC50 value lower than 500 pM. In a most preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the NR3C2 gene with an EC50 value lower than 100 pM.
[0477] Alternatively, or in addition, a pEC50 value may be calculated to quantify and or compare the inhibitory potential of the siRNAs according to the invention.
[0478] In some embodiments, when transfected into the cells, the nucleic acid of the invention inhibits expression of the NR3C2 gene with an pEC50 value lower than 5, 6, 7, 8, 9 or 10, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.
[0479] Alternatively, or in addition, inhibition of expression of the NR3C2 gene may be characterized by a reduction of mean relative expression of the NR3C2 gene.
[0480] In some embodiments, when cells are transfected with 0. 1 nM of the nucleic acid of the invention, the mean relative expression ofNR3C2 is below 1, 0.9, 0.8, 0.7, 0.6, 0.5, or 0.4, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.
[0481] In some embodiments, when cells are transfected with 5 nM of the nucleic acid of the invention, the mean relative expression of NR3C2 is below 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4 or 0.3, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.
[0482] Inhibition of expression of the NR3C2 gene may be quantified by the following method:
[0483] HEK293 cells (human kidney-derived cell line, obtained from JCRB Cell Bank) may be maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% FBS and 1% non- essential amino acids at 37°C, 5% CO2, 95% humidity. Cells may be transfected with siRNA duplexes targeting either NR3C2 mRNA or a negative control siRNA (siRNA-control; sense strand 5’- GCCTGTACCAAGGCTTTAA-3’ (SEQ ID NO: 1117), antisense strand 5’- TTAAAGCCTTGGTACAGGC-3 ’ (SEQ ID NO: 1118)) in a 6-point, log dose response curve to give final in assay concentrations of 3nM to 0.03pM. Transfection may be carried out by diluting Lipofectamine RNAi MAX (ThermoFisher) in Opti-MEM (ThermoFisher) medium at a ratio of 48.5: 1.5. This solution may be added to an equal volume of siRNA, diluted to the required concentration in phosphate buffered saline. The lipofectamine RNAi MAX and siRNA mixture may be incubated at room temperature for 15 minutes before 20 pL was added to wells of a 96 well plate. HEK293 cells may be dissociated from flasks using trypsin and resuspended at a density of 300,000 cells / mL. 100 pL of HEK293 cell suspension may be added to each well of the siRNA-containing 96-well plates. Cells may then be incubated for 24 hours at 37°C, 5% CO2,95% humidity. Each siRNA may be tested in triplicate wells and on two separate days for a total of six replicates.
[0484] Intracellular RNA may be isolated using a RNeasy kit (Qiagen) according to the manufacturer’s instructions. cDNA synthesis may be performed using a HiScript III RT SuperMix kit (Vazyme) according to the manufacturer’s instructions. Target cDNA may be quantified by qPCR on an ABI Prism 7900HT or ABI QuantStudio 7 with primers specific for human NR3C2 and human GAPDH (forward:GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 1119), reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO: 1120)) using an AceQ Universal U+ Probe Master Mix (Vazyme).
[0485] qPCR may be performed in duplicate on cDNA derived from each well and the mean Ct calculated. Relative NR3C2 expression may be calculated from mean Ct values using the comparative Ct (AACt) method, normalized to GAPDH and relative to untreated cells. Maximum percent inhibition of NR3C2 expression and EC50 and / or pEC50 values (-loglO of the EC50) may be calculated using a four parameter (variable slope) model using NumPy (Python). Inhibition of the expression of a gene may be manifested by a reduction of the amount of mRNA of the target gene of interest in comparison to a suitable control. Inhibition of the function of a target may be manifested by a reduction of the activity of the target in comparison to a suitable control.
[0486] In other embodiments, inhibition of the expression of a gene or other target may be assessed in terms of a reduction of a parameter that is functionally linked to gene expression, e.g., protein expression or signalling pathways.METHODS OF TREATING OR PREVENTING DISEASES ASSOCIATED WITH GENE EXPRESSION / EXPRESSION OF FUNCTION OF A TARGET.
[0487] The present invention also provides methods of using nucleic acid e. g. , an siRNA of the invention or a composition containing nucleic acid e.g., an siRNA of the invention to reduce or inhibit gene expression in a cell or reduce expression or function of a target. The methods include contacting the cell with a nucleic acid e.g., dsiRNA of the invention and maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of a gene, thereby inhibiting expression of the gene in the cell. Reduction in gene expression or function of a target can be assessed by any methods known in the art. In a preferred embodiment, the gene is NR3C2.
[0488] The present invention also provides methods of using nucleic acid e. g. , an siRNA of the invention or a composition containing nucleic acid e.g., an siRNA of the invention to reduce or inhibit NR3C2 gene expression in a cell.
[0489] In the methods of the invention the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject.
[0490] A cell suitable for treatment using the methods of the invention may be any cell that expresses a gene of interest or target of interest associated with disease.
[0491] A cell suitable for treatment using the methods of the invention may be any cell that expresses a gene of interest associated with ischaemic heart diseases, in particular myocardial infarction, and / or symptoms thereof.
[0492] A cell suitable for treatment using the methods of the invention may be any cell that expresses a gene of interest associated with HFrEF and / or HFpEF.
[0493] The in vivo methods of the invention may include administering to a subject a composition containing a nucleic acid of the invention e.g., an iRNA, where the nucleic acid e.g., siRNA includes a nucleoside sequence that is complementary to at least a part of an RNA transcript of the gene of the mammal to be treated, or complementary to another nucleic acid the expression and / or function of which is associated with diseases.
[0494] The present invention further provides methods of treatment of a subject in need thereof. The treatment methods of the invention include administering a nucleic acid such as an siRNA of the invention to a subject, e.g., a subject that would benefit from a reduction or inhibition of the expression of a gene and / or expression and / or function of a target, in a therapeutically effective amount e.g., a nucleic acid such as an siRNA targeting a gene or a pharmaceutical composition comprising the nucleic acid targeting a gene.
[0495] The present invention further provides methods of treatment of a subject in need thereof. The treatment methods of the invention include administering a nucleic acid such as an siRNA of the invention to a subject, e.g., a subject that would benefit from a reduction or inhibition of the expression of NR3C2 gene, in a therapeutically effective amount e.g., a nucleic acid such as an siRNA targeting NR3C2 or a pharmaceutical composition comprising the nucleic acid targeting NR3C2. The disease to be treated is related to ischaemic heart diseases, in particular myocardial infarction, and / or symptoms thereof, HFrEF and / or symptoms thereof, and / or HFpEF and / or symptoms thereof.
[0496] As described herein, the invention pertains to treatment of HFrEF and / or HFpEF. Any reference herein to a disease, including ischaemic heart disease, can equally be considered reference to HFrEF and / or HFpEF where allowed by context.
[0497] That is, the nucleic acid according to the invention may be used in the prevention and / or treatment of an ischaemic heart disease. The term, "ischaemic heart disease", as used herein, means any disorder resulting from an imbalance between the myocardial need for oxygen and the adequacy of the oxygen supply. Most cases of ischemic heart disease result from narrowing of the coronary arteries, as occurs in atherosclerosis or other vascular disorders. The nucleic acid of the invention additionally may be useful for treating ischaemic damage to other organs. Non-limiting examples of ischemic heart diseases include ischemic cardiomyopathy, myocardial infarction or ischemic heart failure and chronic ischemic heart disease.
[0498] The patient to be treated may be a patient that already has an ischaemic heart disease or that is at risk of developing an ischaemic heart disease. That is, in certain embodiments, the nucleic acid of the present invention may be used in the treatment of an existing ischaemic heart disease. Treatment of an existing ischaemic heart disease with the nucleic acid of the present invention may prevent worsening ofthe ischaemic heart disease and / or ischaemic heart disease. In some instances, treatment of an existing ischaemic heart disease with the nucleic acid of the present invention may even cure the ischaemic heart disease. In certain embodiments, the nucleic acid of the present invention may be used to prevent manifestation of an ischaemic heart disease in a patient that is at risk of developing an ischaemic heart disease.
[0499] The skilled person is capable of diagnosing whether a patient has an ischaemic heart disease or is at risk of developing an ischaemic heart disease. Diagnosing an ischaemic heart disease may include medical history analysis, physical examination, imaging tests (such as ECG or stress test), blood tests (e.g., cardiac enzymes), and / or coronary angiography.
[0500] In certain embodiments, the ischaemic heart disease is myocardial infarction. The term "myocardial infarction", as used herein, means a process by which ischemic disease results in a region of the myocardium being replaced by scar tissue.
[0501] The patient to be treated may be a patient that already has HFrEF and / or HFpEF or that is at risk of developing HFrEF and / or HFpEF. That is, in certain embodiments, the nucleic acid of the present invention may be used in the treatment of existing HFrEF and / or HFpEF. Treatment of existing HFrEF and / or HFpEF with the nucleic acid of the present invention may prevent worsening of the HFrEF and / or HFpEF and / or associated diseases. In some instances, treatment of existing HFrEF and / or HFpEF with the nucleic acid of the present invention may even cure the HFrEF and / or HFpEF. In certain embodiments, the nucleic acid of the present invention may be used to prevent manifestation of HFrEF and / or HFpEF in a patient that is at risk of developing HFrEF and / or HFpEF.
[0502] The skilled person is capable of diagnosing whether a patient has HFrEF and / or HFpEF or is at risk of developing HFrEF and / or HFpEF. Diagnosing HFrEF and / or HFpEF may include medical history analysis, physical examination, imaging tests (such as ECG or stress test), blood tests (e.g., cardiac enzymes), and / or coronary angiography.
[0503] In certain embodiments, the nucleic acid of the invention may be administered to a patient that is at risk of myocardial infarction. Risk factors for myocardial infarction include, without limitation, age, tobacco use, high blood pressure, high cholesterol or triglycerides, obesity, diabetes, metabolic syndrome, family history or heart attacks, lack of exercise, unhealthy diet, stress, drug use, history of preeclampsia and autoimmune conditions.
[0504] In certain embodiments, the nucleic acid of the invention may be administered to a patient after myocardial infarction. That is, the patient to be treated may be a patient that had a history of one or more myocardial infarctions. In such patients, the nucleic acid of the invention may be administered to prevent the occurrence of further myocardial infarctions.
[0505] In certain embodiments, the nucleic acid of the invention may be administered to a patient that is at risk of HFrEF and / or HFpEF. Risk factors for HFrEF and / or HFpEF include, without limitation, age, tobacco use, high blood pressure, high cholesterol or triglycerides, obesity, diabetes, metabolic syndrome, family history or heart attacks, lack of exercise, unhealthy diet, stress, drug use, history of preeclampsia and autoimmune conditions, sex, type 2 diabetes, obesity, sleep apnea, hypertension, pulmonary hypertension, chronic obstructive pulmonary disease, iron deficiency, with or without anemia, coronary artery disease, atrial fibrillation, dysrhythmias.
[0506] A person skilled in the art, such as a physician is capable of determining whether a patient is at risk of developing an ischaemic heart disease, in particular a myocardial infarction, HFrEF and / or HFpEF, or whether a person already had an ischaemic heart disease, in particular a myocardial infarction, HFrEF and / or HFpEF.
[0507] A nucleic acid e.g., siRNA of the invention may be administered as a "free” nucleic acid or “free” siRNA, administered in the absence of a pharmaceutical composition. The naked nucleic acid may be in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution can be adjusted such that it is suitable for administering to a subject.
[0508] Alternatively, a nucleic acid e.g., siRNA of the invention may be administered as a pharmaceutical composition, such as a dsiRNA liposomal formulation.
[0509] In one embodiment, the method includes administering a composition featured herein such that expression of the target gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours. In one embodiment, expression of the target gene is decreased for an extended duration, e.g., at least about two, three, four days or more, e.g., about one week, two weeks, three weeks, or four weeks or longer, e.g., about 1 month, 2 months, or 3 months.
[0510] Subjects can be administered a therapeutic amount of nucleic acid e.g., siRNA, such as about 0.01 mg / kg to about 200 mg / kg.
[0511] Subjects can be administered a therapeutic amount of nucleic acid e.g., siRNA, such as about 0.01 mg / kg to about 200 mg / kg, so as to prevent and / or treat an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof, HFrEF and / or symptoms thereof, and / or HFpEF and / or symptoms thereof.
[0512] The nucleic acid e.g., siRNA can be administered by intravenous infusion over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. Administration of the siRNA can reduce gene product levels of a target gene, e.g., in a cell or tissue of the patient by at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%,55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or below the level of detection of the assay method used. In certain embodiments, administration results in clinical stabilization or preferably clinically relevant reduction of at least one sign or symptom of a gene-associated disorder.
[0513] Alternatively, the nucleic acid e.g., siRNA can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired daily dose of nucleic acid e.g., s iRNA to a subject. The injections may be repeated over a period of time. The administration may be repeated on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimen may include administration of a therapeutic amount of nucleic acid on a regular basis, such as every other day or to once a year. In certain embodiments, the nucleic acid is administered about once per month to about once per quarter (i.e., about once every three months).
[0514] In one aspect the present invention may be applied in the compounds, processes, compositions or uses of the formulae of Figures 5 and 6.EXAMPLES
[0515] The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.
[0516] Examples 1 -5 (Synthesis of tether 1 , Duplex Annealing, Synthesis of tether 2, Duplex Annealing, and Alternative synthesis route for the conjugate building block TriGalNAc _Tether2) are specifically disclosed in PCT / EP2023 / 070919 (WO2024 / 023262) as Examples 1-5. That disclosure is hereby incorporated by reference.EXAMPLE 6: SOLID PHASE SYNTHESIS METHOD: SCALE <luM0L
[0517] Syntheses of siRNA sense and antisense strands were performed on a MerMadel92X synthesiser with commercially available solid supports made of controlled pore glass with universal linker (Universal CPG, with a loading of 40 pmol / g; LGC Biosearch or Glen Research).
[0518] RNA phosphoramidites were purchased from ChemGenes or Hongene.
[0519] The 2'-O-Methyl phosphoramidites used were the following: 5'-(4,4'-dimethoxytrityl)-N- benzoyl-adenosine 2'-O-methyl-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'- dimethoxytrityl)-N-acetyl-cytidine 2'-O-methyl-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-uridine 2'-O-methyl-3'-[(2 -cyanoethyl)- (N, N -diisopropyl)] - phosphoramidite.
[0520] The 2’-F phosphoramidites used were the following: 5'-dimethoxytrityl-N-benzoyl- deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N- acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'- dimethoxytrityl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite and 5'-dimethoxytrityl-deoxyuridine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite.
[0521] All phosphoramidites were dissolved in anhydrous acetonitrile (Honeywell Research Chemicals) at a concentration of 0.05M, except 2’-O-methyl-uridine phosphoramidite which was dissolved in DMF / MeCN (1:4, v / v). Iodine at 0.02M in acetonitrile / Pyridine / H2O (DNAchem) was used as oxidizing reagent. Thiolation for phosphorothioate linkages was performed with 0.2 M PADS (TCI) in acetonitrile / pyridine 1: 1 v / v. 5-Ethyl thiotetrazole (ETT), 0.25M mM in acetonitrile was used as activator solution.
[0522] Inverted abasic phosphoramidite, 3-O-Dimethoxytrityl-2-deoxyribose-5-[(2-cyanoethyl)-(N, N- diisopropyl)] -phosphoramidite were purchased from Chemgenes (ANP-1422) or Hongene (OP-040).
[0523] At each cycle, the DMT was removed by deblock solution, 3% TCA in DCM (DNAchem).
[0524] The coupling time was 180 seconds. The oxidizer contact time was set to 80 seconds and thiolation time was 2* 100 seconds.
[0525] At the end of the synthesis, the oligonucleotides were cleaved from the solid support using a NH4OH:EtOH solution 4: 1 (v / v) for 20 hours at 45°C (TCI). The solid support was then filtered off, the filter was thoroughly washed with H2O and the volume of the combined solution was reduced by evaporation under reduced pressure.
[0526] Oligonucleotide were treated to form the sodium salt by ultracentrifugation using Amicon Ultra- 2 Centrifugal Filter Unit; PBS buffer (lOx, Teknova, pH 7.4, Sterile) or by EtOH precipitation from IM sodium acetate.
[0527] The single strands identity were assessed by MS ESI- and then, were annealed in water to form the final duplex siRNA and duplex purity were assessed by size exclusion chromatography.EXAMPLE 7: SOLID PHASE SYNTHESIS METHOD: SCALE >5 uMOL
[0528] Syntheses of siRNA sense and antisense strands were performed on a MerMadel2 synthesiser with commercially available solid supports made of controlled pore glass with universal linker (Universal CPG, with a loading of 40 pmol / g; LGC Biosearch or Glen Research) at 5 pmol scale. Sense strand destinedto 3' conjugation were sytnthesised at 12 pmol on 3'-PT-Amino-Modifier C6 CPG 500 A solid support with a loading of 86 pmol / g (LGC).
[0529] RNA phosphoramidites were purchased from ChemGenes or Hongene.
[0530] The 2'-O-Methyl phosphoramidites used were the following: 5'-(4,4'-dimethoxytrityl)-N- benzoyl-adenosine 2'-O-methyl-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'- dimethoxytrityl)-N-acetyl-cytidine 2'-O-methyl-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite, 5'-(4,4'-dimethoxytrityl)-uridine 2'-O-methyl-3'-[(2 -cyanoethyl)- (N, N -diisopropyl)] - phosphoramidite.
[0531] The 2’-F phosphoramidites used were the following: 5'-dimethoxytrityl-N-benzoyl- deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N- acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'- dimethoxytrityl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite and 5'-dimethoxytrityl-deoxyuridine 2'-fhioro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite.
[0532] Inverted abasic phosphoramidite, 3-O-Dimethoxytrityl-2-deoxyribose-5-[(2-cyanoethyl)-(N, N- diisopropyl)]-phosphoramidite were purchased from Chemgenes (ANP-1422) or Hongene (OP-040).
[0533] All phosphoramidites were dissolved in anhydrous acetonitrile (Honeywell Research Chemicals) at a concentration of 0.05M, except 2’-O-methyl-uridine phosphoramidite which was dissolved in DMF / MeCN (1:4, v / v). Iodine at 0.02M in acetonitrile / Pyridine / H2O (DNAchem) was used as oxidizing reagent. Thiolation for phosphorothioate linkages was performed with 0.2 M PADS (TCI) in acetonitrile / pyridine 1: 1 v / v. 5-Ethyl thiotetrazole (ETT), 0.25M mM in acetonitrile was used as activator solution.
[0534] At each cycle, the DMT was removed by deblock solution, 3% TCA in DCM (DNAchem).
[0535] For strands synthesised on universal CPG the coupling was performed with 8 eq. of amidite for 130 seconds. The oxidation time was 47 seconds, the thiolation time was 210 seconds.
[0536] For strands synthesised on 3'-PT-Amino-Modifier C6 CPG the coupling was performed with 8 eq. of amidite for 2* 150 seconds. The oxidation time was 47 seconds, the thiolation time was 250 seconds.
[0537] At the end of the synthesis, the oligonucleotides were cleaved from the solid support using a NH4OH:EtOH solution 4: 1 (v / v) for 20 hours at 45°C (TCI). The solid support was then filtered off, the filter was thoroughly washed with H2O and the volume of the combined solution was reduced by evaporation under reduced pressure.
[0538] Oligonucleotide were treated to form the sodium salt by EtOH precipitation from IM sodium acetate.
[0539] The single strand oligonucleotides were purified by IP-RP HPLC on Xbridge BEH Cl 8 5 pm, 130 A, 19x150 mm (Waters) column with an increasing gradient of B in A. Mobile phase A: 240 mM HFIP, 7 mM TEA and 5% methanol in water; mobile phase B: 240 mM HFIP, 7 mM TEA in methanol.
[0540] The single strands purity and identity were assessed by UPLC / MS ESI- on Xbridge BEH Cl 8 2.5 pm, 3x50 mm (Waters) column with an increasing gradient of B in A. Mobile phase A: 100 mM HFIP, 5 mM TEA in water; mobile phase B: 20% mobile phase A: 80% Acetonitrile (v / v).
[0541] Sense strands were conjugated as per protocol provided in any of Examples 2, 4, 6.
[0542] Sense and Antisense strands were then annealed in water to form the final duplex siRNA and duplex purity were assessed by size exclusion chromatography.EXAMPLE 8: NUCLEIC ACID SEQUENCES
[0543] siRNA oligonucleosides according to the present invention target NR3C2. The full DNA sequence of the NR3C2 target gene is SEQ ID NO: 1116.
[0544] Following Table 1 provides oligonucleoside mRNA target sequences of NR3C2, together with the corresponding positions in transcript ENST00000358102.8. It is to be understood that SEQ ID NO: 1 to 223 refer to human (Homo sapiens) mRNA sequences.Table 1
[0545] Table 2 provides the unmodified first (antisense) and corresponding unmodified second (sense) strand sequences for siRNA oligonucleosides according to the present invention, together with the corresponding positions in the overall gene sequence of SEQ ID NO: 1116 as follows.Table 2
[0546] Table 3 provides the modified first (antisense) sequences, together with the corresponding unmodified first (antisense) sequences for siRNA oligonucleosides according to the present invention as follows.Table 3
[0547] Table 4 provides the modified second (sense) sequences, together with the corresponding unmodified second (sense) sequences for siRNA oligonucleosides according to the present invention as follows.Table 4
[0548] Some of the modified second strand sequences as illustrated above in Table 4 include the preferred 5 ’ iaia motif. However, it should also be understood that the scope of these modified second strand sequences additionally includes the Me / F modified second strand in the absence of the 5 ’iaia motif.
[0549] Table 5 identifies duplexes with Duplex IDs referencing the modified antisense and sense IDs from previous Tables 3 and 4.Table 5
[0550] For duplexes of Table 5:ETX-M00001856 - ETX-M00002078 have a duplex structure according to Figure 7b.
[0551] Definitions as provided in the above Tables:A - adenosineC - cytidineG - guanosineT - thymidine m - 2’-O-methyl f- 2’fluro s - phosphorothioate bond o - thermally destabilised nucleoside ia - inverted abasic nucleoside
[0552] In a particularly preferred embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences:
[0553] In an even more preferred embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences:
[0554] In another even more preferred embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences:
[0555] In a further, particularly preferred, embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences:
[0556] In a further, more particularly preferred, embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences:
[0557] In a further, even more preferred, embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences:
[0558] In a further, even more preferred, embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences:EXAMPLE 9: DOSE-RESPONSE FOR INHIBITION OF NR3C2 EXPRESSION IN HUMAN HEK293 CELLS
[0559] HEK293 cells (human kidney-derived cell line, obtained from JCRB Cell Bank) were maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% FBS and 1% non-essential amino acids at 37°C, 5% CO2, 95% humidity. Cells were transfected with siRNA duplexes targeting either NR3C2 mRNA or a negative control siRNA (siRNA-control; sense strand 5’- GCCTGTACCAAGGCTTTAA-3 ’ (SEQ ID NO: 1117), antisense strand 5’- TTAAAGCCTTGGTACAGGC-3’ (SEQ ID NO: 1118)) in a 6- point, log dose response curve to give final in assay concentrations of 3nM to 0.03pM. Transfection was carried out by diluting Lipofectamine RNAiMAX (ThermoFisher) in Opti-MEM (ThermoFisher) medium at a ratio of 48.5: 1.5. This solution was added to an equal volume of siRNA, diluted to the required concentration in phosphate buffered saline. The lipofectamine RNAiMAX and siRNA mixture was incubated at room temperature for 15 minutes before 20 pL was added to wells of a 96 well plate. HEK293 cells were dissociated from flasks using trypsin and resuspended at a density of 300,000 cells / mL. 100 pL of HEK293 cell suspension were added to each well of the siRNA-containing 96-well plates. Cells were then incubated for 24 hours at 37°C, 5% CO2,95% humidity. Each siRNA was tested in triplicate wells and on two separate days for a total of six replicates.
[0560] Intracellular RNA was isolated using a RNeasy kit (Qiagen) according to the manufacturer’s instructions. cDNA synthesis was performed using a HiScript III RT SuperMix kit (Vazyme) according to the manufacturer’s instructions. Target cDNA was quantified by qPCR on an ABI Prism 7900HT or ABI QuantStudio 7 with primers specific for human NR3C2 and human GAPDH (forward: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 1119), reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO: 1120)) using an AceQ Universal U+ Probe Master Mix (Vazyme).
[0561] qPCR was performed in duplicate on cDNA derived from each well and the mean Ct calculated. Relative NR3C2 expression was calculated from mean Ct values using the comparative Ct (AACt) method, normalized to GAPDH and relative to untreated cells. Maximum percent inhibition of NR3C2 expression and pEC50 values (-log 10 of the EC50) are calculated using a four parameter (variable slope) model using NumPy (Python). Results are shown in Table 6. Sequences of RNAi molecules are depicted in the relevant Tables herein.
[0562] Table 6 - Results of dose-response experiments for inhibition of NR3C2 mRNA expression in human HEK293 cells. Observed pEC50s are reported along with the minimum relative expression value (relative to medium control) for two experimental replicates (repeated on separate days with three repeats per day).EXAMPLE 10: PREDICTION OF NR3C2 INHIBITION BY NUCLEIC ACIDS OF THE INVENTION
[0563] siRNAdesignR is a computational tool developed by e-therapeutics for the engineering, selection, and optimisation of features for the prediction of siRNA efficacy. In the first step of the process siRNAdesignR identified all possible siRNA target sequences in a gene (consensus regions found in all transcripts) and then filtered out sequences with undesirable characteristics (sequences that match any other human gene with 0 or 1 mismatches, sequences that are commonly mutated (in >1% of the population), sequences that encode immunostimulatory motifs or have degenerate bases and sequences in the 5’ untranslated region.
[0564] For the remaining sequences we then derived over 400 features describing the nucleotide sequence of an siRNA target sequence and how these nucleotides interacted with each other and other nucleotides on the messenger RNA at a distance from the target sequence. These nucleotide interactions were predicted using a large language model trained on messenger RNA sequences. The most informative features were then selected with a regression analysis and used to train a machine learning model, which learnt how individual, and combinations of, features encode information on whether an siRNA is likely to be efficacious in vitro i.e. cause a significant reduction in mRNA levels.
[0565] For the development of the machine learning model a database of siRNA sequences was built and their corresponding efficacy determined by screening hundreds of siRNAs in in vitro (cell line) models. This data was split into training (90% of the data) and test (10% of the data) sets. These datasets were used to train and test different machine learning models with optimised model hyperparameters. Over 10,000 models were evaluated with this method using an automated pipeline that tracked the hyperparameters and model performance. Performance was evaluated using five metrics; the Spearman correlation coefficient (see Figure 9), the root mean squared error, precision@10, precision@20 and the rank of the best performing siRNA (determined experimentally).
[0566] The best performing model (ranked over all five metrics) was then validated using a previously unseen dataset (Figure 10). Models were considered accurate if precision@20 was greater than 0.5, and if the most efficacious siRNA (determined experimentally) was in the top 20 predictions.
[0567] As a final selection step, siRNAdesignR checked for cross species reactivity of the ranked siRNA sequences. This was not applied as a hard filter, but rather siRNA sequences would be preferred if they had cross species reactivity with Macaca fascicularis, Mus musculus and Rattus norvegicus but accepted if they had high efficacy predictions and Macaca fascicularis cross reactivity.
[0568] The outcome of the prediction is shown in Table 7.
[0569] Table 7 - siRNAdesignR predictions for efficacious antisense sequences of siRNAs targeting NR3C2.
[0570] To demonstrate that siRNAdesignR could be used to find lead sequences for clinical projects, the inventors validated predictions for a different target, SLC25A5, in relevant preclinical models (Figures 11- 14).
[0571] Highlighted in Figure 11 is an siRNA sequence that ranked within the top 20 predictions by siRNAdesignR for the target SLC25A5. This sequence was subsequently tested in dose response in vitro (in a Huh7 cell line), measuring the amount of mRNA knockdown (Figure 12), and in vivo (in C57BL / 6 mice), measuring mRNA and protein knockdown (Figures 13 and 14).EXAMPLE 11: PHARMACODYNAMIC STUDY IN HEALTHY MICEMethods
[0572] To test the activity of 4 selected GalNAc-siRNAs against the murine Nr3c2 transcript, maleC57BL / 6 mice were injected subcutaneously with either 1 or 3 mg / kg of GalNAc-siRNA constructs (ETX-M2590 (ETX-M00001882), ETX-M2591 (ETX-M00001856), ETX-M2592 (ETX-M00001860) or ETX- M2593 (ETX-M00001924)). Control animals received 0.9% saline injections, and negative control animals were injected with 3 mg / kg of a negative control GalNAc-siRNA (ETX-M2594 (sense strand CACGUACGCGGAAUACUUCGA - SEQ ID NO: 1124; antisense strand UCGAAGUAUUCCGCGUACGUGAU - SEQ ID NO: 1125)) that has no mRNA target in mice. Each group contained n=4 mice. At various time-points post dosing, a subset of mice was sacrificed, livers and serum were harvested and analysed. For the analysis of liver target mRNA expression, liver samples were homogenized, RNA was extracted using the MagMAX™ mirVana™ Total RNA Isolation Kit (Thermo- A27828), cDNA was prepared using HiScript® III RT SuperMix for qPCR (+gDNA wiper)(Vazyme- R323), and gene expression of Nr3c2 and the housekeeper Gapdh were measured by RT-qPCR on a Q7 Fast Real-time PCR system (Applied biosystem). The levels of Nr3c2 were measured using in-house designed primers (Fwd: TCTGGCTTCTGCTTCTTC (SEQ ID NO: 1121); Rev: CTTCCAAGAGCAAGTTCTG (SEQ ID NO: 1122); Probe: AAGGACAGCACTCTCAGGACC (SEQ ID NO: 1123)) and Gapdh levels were measured using a commercial Taqman assay (Thermo, Mm99999915_g I ). The Expression levels were calculated using the 2-ddCt method whereby Nr3c2 levels were normalised to Gapdh levels and then normalised to the expression levels of vehicle control animals at each timepoint. The results are shown in Figure 20. Serum samples were analysed for levels of liver markers ALT, AST, and ALP on an Automatic biochemical analyzer (AU480, Beckman) using commercial kits (Beckman-OSR6107, Beckman-OSR6104, Beckman-OSR6109). The results are shown in Figure 21.ResultsPharmacodynamic Study in Healthy Mice- Knockdown of hepatic Nr3c2 mRNA in mice treated with GalNAc-siRNA constructs.
[0573] To test the knockdown efficacy of 4 selected GalNAc-siRNAs with predicted activity against human, monkey, and mouse NR3C2, mice were injected with 2 doses (1 and 3 mg / kg) of GalNAc-siRNA and liver samples were analysed up to 4 weeks post GalNAc-siRNA dosing. All 4 GalNAc-siRNAs tested resulted in knockdown up to 40% at day 7 at 3 mg / kg which was sustained until day 14 (Figure IB). ETX- M2590 exhibited knockdown at the 1 mg / kg dose level (Figure 20A).
[0574] Regarding Figure 20, Mice were injected with saline, a negative control GalNAc-siRNA with no target mRNA in mouse, as well as 4 different anti-NR3C2 GalNAc-siRNAs on day 0. Mice were sacrificed, livers were collected 7-, 14-, 21- and 28-days post dosing and Nr3c2 target mRNA levels were analysed by qPCR and normalised to the housekeeper Gapdh. A: Hepatic target mRNA levels following injection with 1 mg / kg GalNAc-siRNA, 3 mg / kg negative control GalNAc-siRNA or saline. B: Hepatic target mRNA levels following injection with 3 mg / kg GalNAc-siRNA or saline.
[0575] Note that saline levels are plotted in both graphs for comparison. Mean ± SEM. N=4 per timepoint / treatment.Pharmacodynamic Study in Healthy Mice - No treatment-related effect on markers of liver health in mice treated with GalNAc-siRNAs.
[0576] To examine the effects of the tested GalNAc-siRNAs on liver health, serum levels of the liver markers ALP (alkaline phosphatase), ALT (alanine transaminase) and AST (aspartate transaminase) were measured throughout the time course. No changes in the serum levels of these markers of liver health were observed with either 1 mg / kg (Figure 21 A-C) or 3 mg / kg (Figure 21 D-F) of the 4 tested GalNAc-siRNA constructs. These data indicate that the GalNAc-siRNAs displayed a favourable safety profde in this study. Regarding Figure 21, mice were injected with saline, a negative control GalNAc-siRNA with no target mRNA in mouse, as well as 4 different anti-Nr3c2 GalNAc-siRNAs on day 0. Mice were sacrificed and serum was collected 7-, 14-, 21- and 28-days post dosing for biochemical assessment of ALP, ALT, and AST levels. A-C: Levels of ALP (A), ALT (B) or AST (C) following injection of 1 mg / kg GalNAc-siRNA, 3 mg / kg negative control GalNAc-siRNA or saline. D-F : Levels of ALP (D), ALT (E) or AST (F) following injection of 3 mg / kg GalNAc-siRNA or saline.
[0577] Note that saline levels are plotted in both graphs for comparison. Mean ± SEM. N=4 per timepoint / treatment.EXAMPLE 12: DISEASE MODEL PROOF-OF-CONCEPT (PoC) STUDYMethods
[0578] To model heart failure with reduced ejection fraction (HFrEF) in mice, male C57BL / 6 mice underwent myocardial infarction (MI) induction by left anterior descending artery (LAD) ligation. Mice were injected subcutaneously 7 days before MI, or at the time of MI, with 10 mg / kg of GalNAc-siRNA (ETX-M2590). The mice subsequently received GalNAc-siRNA (ETX-M2590) injections once per week over the course of 6 weeks post-MI. Control groups included sham-operated animals and Mi-animals injected with vehicle (0.9% saline, subcutaneous, Ix / week) as well as animals receiving the mineralocorticoid receptor antagonist eplerenone by food at a dose of 1 g / kg diet as positive control. A combination group received siRNA on the day of MI induction, followed by weekly siRNA injections and eplerenone by food for the first 7 days. Survival, body weight and food intake were recorded weekly and are shown in Figure 23.
[0579] On days 14, 21 and 42 post-MI, Echocardiography was performed (group size n=14-19) using a Vevo 1100 High-Resolution Imaging System (VisualSonics) and a 30 mHz probe. During the procedure, the mice were anesthetized using Isoflurane (1%). Parameters assessed by Echocardiography were LVEF, FS, ESD, EDD, CO, SV, LVPWTs, LVPWTd, LV mass and HR. The results for day 42 ECHO are shown in Figure 24.
[0580] Afterwards, the animals were sacrificed, and livers and hearts were collected. Livers and hearts were frozen for subsequent molecular analysis, and heart samples were also prepared for histological assessment. Serum was harvested for terminal biochemical analysis and ELISA measurements.
[0581] For the analysis of mRNA expression, liver or heart samples were homogenized, RNA was extracted using the MagMAX™ mirVana™ Total RNA Isolation Kit (Thermo-A27828), cDNA was prepared using HiScript® III RT SuperMix for qPCR (+gDNA wiper)(Vazyme-R323), and gene expression of Nr3c2 (Liver) or Anp and Bnp (heart) and the housekeeper Gapdh were measured by RT-qPCR on a Q7 Fast Real-time PCR system (Applied biosystem). The levels of Nr3c2 were measured using in-house designed primers (Fwd: TCTGGCTTCTGCTTCTTC (SEQ ID NO: 1121); Rev: CTTCCAAGAGCAAGTTCTG (SEQ ID NO: 1122); Probe: AAGGACAGCACTCTCAGGACC (SEQ ID NO: 1123)) and Gapdh, Anp and Bnp levels were measured using commercial Taqman assays: Gapdh (Thermo, Mm999999 l 5_g l ). Anp (Thermo, MmO I255747_g 1 ) and Hwp (Thermo, MmO I 25577O_g l ).
[0582] For histological analysis, 3 sections of the heart, taken at equal spacing between apex and base, were stained using hematoxylin / eosin (H&E) and picrosirius red (PSR) to assess general morphology and fibrosis, respectively.
[0583] For serum analysis, a biochemical analyzer was used to measure the levels of circulating ALT / AST / ALP, Albumin, Bilirubin, Creatinine, BUN, Ca, Phos, total protein, Cl, Na and K.
[0584] ELISA analysis was performed to measure the circulating levels of FGF21 (abeam; ab212160), ANP (Novus; NBP2-66733) and NT-proBNP (Novus; NBP2-76775), according to the manufacturer’s instructions.
[0585] Two additional groups of mice were subjected to MI induction by LAD ligation. The mice in groups of n=10 were injected with 0.9% saline or 10 mg / kg GalNAc-siRNA (ETX-M2590) 6 days prior to MI induction by LAD ligation. One day post MI, mice were sacrificed, livers and serum were harvested, and Nr3C2 mRNA expression was assessed by qPCR. For the analysis of liver target mRNA expression, liver samples were homogenized, RNA was extracted using the MagMAX™ mirVana™ Total RNA Isolation Kit (Thermo-A27828), cDNA was prepared using HiScript® III RT SuperMix for qPCR (+gDNA wiper)(Vazyme-R323), and gene expression of Nr3c2 and the housekeeper Gapdh were measured by RT- qPCR on a Q7 Fast Real-time PCR system (Applied biosystem). The levels of Nr3c2 were measured using in-house designed primers (Fwd: TCTGGCTTCTGCTTCTTC (SEQ ID NO: 1121); Rev: CTTCCAAGAGCAAGTTCTG (SEQ ID NO: 1122); Probe: AAGGACAGCACTCTCAGGACC (SEQ ID NO: 1123)) and Gapdh levels were measured using a commercial Taqman assay (Thermo, Mm99999915 g 1 ). Expression levels were calculated using the 2ddctmethod whereby Nr3c2 levels were normalised to Gapdh levels and then normalised to the expression levels of the vehicle control group. The results are shown in Figure 22A.
[0586] Serum FGF21 levels were measured using a commercial ELISA kit (abeam ab212160), according to the manufacturer’s instructions. The results are shown in Figure 22B.ResultsDisease Model PoC Study - Knockdown efficiency and FGF21 levels in mice treated with GalNAc-siRNA to reduce hepatic NR3C2 expression prior to myocardial infarction.
[0587] To assess the effect of hepatic Nr3c2 knockdown in the MI disease model, mice were pre-injected with saline or 10 mg / kg of ETX-M2590 six days before induction of myocardial infarction (MI). Mice then underwent Mi-induction by left anterior descending artery (LAD) ligation and were sacrificed one day post- MI. Measurement of hepatic Nr3c2 target mRNA expression revealed a more than 70% target mRNA knockdown. Analysis of serum fibroblast growth factor 21 (FGF21) levels one day post-MI in control and ETX-M2590 treated animals revealed a trend towards increased FGF21 in ETX-M2590 treated mice (Figure 22B).
[0588] Regarding Figure 22, mice were injected with saline or GalNAc-siRNA (ETX-M2590) on day - 6 before MI. Mice then underwent Mi-induction on day 0 and were sacrificed one day post-MI and liver and serum were collected. A - Hepatic Nr3c2 levels normalised to the housekeeper Gapdh. B - Serum FGF21 levels.
[0589] Mean ± SEM. N=10 per group.Disease Model PoC Study - No treatment-related effects on survival, body weight or food intake
[0590] To examine the effects of reducing hepatic Nr3c2 expression using GalNAc-siRNA on post-MI cardiac remodeling, male C57BL / 6 mice were injected subcutaneously with 10 mg / kg ETX-M2590 GalNAc-siRNA either 7 days before or on the day of MI induction and were then injected weekly with ETX-M2590. Control groups included saline injected, sham -operated, or Mi-operated animals as well as animals treated with the positive control mineralocorticoid receptor antagonist (MRA) Eplerenone by food at 1 g / kg diet starting on the day of MI. An additional group was injected weekly with ETX-M2590 at 10 mg / kg starting on the day of MI and received MRA by food for the first 7 days post MI.
[0591] All MI groups exhibited a certain, expected, degree of mortality within the first 2 weeks postsurgery which was not affected by treatment (Figure 23A). One additional death was observed in the MRA+siRNA group on day 41. Body weight (Figure 23B) and food intake (Figure 23C) were unaffected by treatment, and all MI animals gained weight and consumed the same amount of food as sham operated controls.
[0592] Regarding Figure 23, mice were injected weekly with saline or GalNAc-siRNA (ETX-M2590) starting on day -7 or day 0 (day of MI). A positive control group received an MRA (Eplerenone) by food starting on day 0. An additional group received weekly GalNAc-siRNA injections starting on day 0,combined with MRA treatment for the first 7 days post-MI. Mice underwent Mi-induction on day 0 and survival, body weights and food intake were recorded throughout the study. A - Survival rates; B - Body weights; C - Food intake.
[0593] Mean ± SEM. N=14-19 per group.Disease Model PoC Study - Improved cardiac function post-MI in mice treated with ETX-M2590,
[0594] To assess the effects of reducing hepatic Nr3c2 mRNA expression on cardiac parameters in mice following myocardial infarction (MI), echocardiography (ECHO) was performed 42 days post MI in ETX- M2590 treated mice.
[0595] Myocardial infarction resulted in the expected decreases in ejection fraction and fractional shortening, indicative of a HFrEF phenotype (Figure 24A, B). Treatment with ETX-M2590 either pre- or post-MI resulted in significant improvements of these parameters of cardiac function to a similar extend as the positive control MRA, alone or in combination ETX-M2590+MRA (Figure 24A, B). Stroke volume and the resulting cardiac output were reduced by MI and significantly improved with ETX-M2590 pre- and post-MI treatment as well as by the positive control MRA and by combination treatment of ETX- M2590+MRA (Figure 24C, D). The dimensional parameters end-systolic and end-diastolic left ventricular (LV) diameter were increased by MI, indicative of the expected cardiac dilation (Figure 24 E, F) . Treatment with ETX-M2590 pre-MI as well as MRA treatment, alone or in combination ETX-M2590+MRA, significantly improved the end systolic LV diameter (Figure 24E), indicative of reduced cardiac dilation. Systolic posterior wall thinning was observed in the MI group which was significantly improved with ETX- M2590 treatment pre- and post-MI as well as combination of ETX-M2590+MRA and by the positive control MRA alone (Figure 24G), indicating a potentially improved cardiac structural remodelling with ETX-M2590 treatment to reduce hepatic Nr3c2 expression. Diastolic posterior wall thickness was unaffected (Figure 24H). Left ventricular mass was increased by MI, as expected, and not affected by treatment (Figure 51) and heart rate was not affected by any intervention (Figure 24J).
[0596] Regarding Figure 24, mice were injected weekly with saline or GalNAc-siRNA (ETX-M2590) starting on day -7 or day 0 (day of MI). A positive control group received an MRA (Eplerenone) by food starting on day 0. An additional group received weekly GalNAc-siRNA injections starting on day 0, combined with MRA treatment for the first 7 days post-MI. Mice underwent Mi-induction on day 0 and echocardiography measurements were performed on day 42 post-MI. A - Left ventricular ejection fraction (LVEF); B - Fractional shortening (FS); C - Stroke volume (SV); D - Cardiac output (CO); E - End- systolic diameter (ESD); F - End-diastolic diameter (EDD); G - Left ventricular posterior wall thickness systolic (LVPWs); H - Left ventricular posterior wall thickness diastolic (LVPWd); I - Left ventricular mass (LV mass); J - Heartrate (HR).
[0597] Mean ± SEM. N=14-19 per group. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001 versus Ml+Vehicle.
[0598] Overall, these data indicate a positive effect of reducing hepatic Nr3c2 mRNA expression using the GalNAc-siRNA ETX-M2590 on cardiac function and remodelling post-MLEXAMPLE 13: HDI (HYDRODYNAMIC INJECTION) STUDYMethods
[0599] To test the activity of 15 selected GalNAc-siRNAs against the human NR3C2 sequence in mice, female Balb / c mice, in groups of n=5, were injected subcutaneously with 3 mg / kg of GalNAc-siRNA (ETX- M2590, ETX-M2591, ETX-M2592, ETX-M2593, ETX-M2655 (ETX-M00001870), ETX-M2656 (ETX- M00001875), ETX-M2657 (ETX-M00001901), ETX-M2658 (ETX-M00001887), ETX-M2659 (ETX- M00001867), ETX-M2660 (ETX-M00001879), ETX-M2661 (ETX-M00001891), ETX-M2662 (ETX- M00001859), ETX-M2663 (ETX-M00001869), ETX-M2664 (ETX-M00001877) or ETX-M2665 (ETX- M00001897)), a negative control GalNAc-siRNA (ETX-M2594) with no mRNA target in mice or human, or with 0.9% saline vehicle. 6 days after GalNAc-siRNA injection, the mice received 30 pg / mouse of a plasmid (pcDNA3. 1) encoding the human NR3C2 cDNA by hydrodynamic injection. One day after plasmid injection, the animals were sacrificed, and livers were harvested. For the analysis of human target mRNA expression in mouse livers, liver samples were homogenized, RNA was extracted using the MagMAX™ mirVana™ Total RNA Isolation Kit (Thermo-A27828), cDNA was prepared using HiScript® III RT SuperMix for qPCR (+gDNA wiper)(Vazyme-R323), and gene expression of NR3C2 and the housekeeper NEO were measured by RT-qPCR on a Q7 Fast Real-time PCR system (Applied biosystem). In-house designed primers were used to detect the expression levels of NR3C2 (Fwd: TGTATGAACTATGCCAGGGGA - SEQ ID NO: 1126; Rev: TGGAATTGTGCTTAGTAGCAGC - SEQ ID NO: 1127; Probe: CACCAAATCAGCCTTCAGTTCGTTCG - SEQ ID NO: 1128) and NEO (Fwd: GATGGATTGCACGCAGGTTCTC - SEQ ID NO: 1128; Rev: GAACACGGCGGCATCAGAGC - SEQ ID NO: 1130; Probe: CGCTTGGGTGGAGAGGCTATTCGGCTATGA - SEQ ID NO: 1131). Expression levels were calculated using the 2-ddctmethod whereby NR3C2 levels were normalised to NEO levels and then normalised to the expression levels in saline-injected controls.Results
[0600] The 4 GalNAc-siRNAs against NR3C2 tested in the pharmacodynamic study (Figures 20 and 21) also target the human and monkey NR3C2 transcript. In vitro screening identified additional 11 sequences with in vitro high efficacy that were predicted to only be active against the human and monkey NR3C2 transcript but not the murine. To test the activity of these sequences, as well as the 4 sequences already tested against the murine transcript in the pharmacodynamic study, against the human NR3C2 transcript, a hydrodynamic injection (HDI) model was used. In this model, hepatic expression of the human NR3C2transcript in mice was achieved by injecting 30 pg of a plasmid (pcDNA3.1) encoding the human NR3C2 cDNA into mice via hydrodynamic injection. Mice were injected with 3 mg / kg of the respective GalNAc- siRNAs six days before HDI and were sacrificed one day post-HDI to assess hepatic expression of human NR3C2 and the internal expression control neomycin resistance (NEO).
[0601] HDI resulted in the expression of the human NR3C2 transcript in mouse livers (Figure 25). Pretreatment with siRNA resulted in >70% reduction in hepatic NR3C2 expression with all GalNAc-siRNAs tested (Figure 25). ETX-M2655 and ETX-M2664 were identified as top sequences (>85% knockdown) with multiple additional sequences defined as second tier: ETX-M2590 used in the mouse disease model study above as well as ETX-M2592, ETX-M2656 and ETX-M2659.
[0602] Regarding Figure 25, Mice were injected with saline, a negative control GalNAc-siRNA with no target mRNA in mouse, as well as 15 different anti-NR3C2 GalNAc-siRNAs on day -6. Mice were injected by hydrodynamic injection (HDI) with an NR3C2 encoding plasmid on day 0 and sacrificed on day 1. Livers were collected and human NR3C2 target mRNA levels were analysed by qPCR and normalised to the expression control NEO. A: Hepatic target mRNA levels following injection with 3 mg / kg GalNAc- siRNA, negative control GalNAc-siRNA or saline.
[0603] Mean ± SEM. N=4-5 per group. *p<0.05; **p<0.0I; ***p<0.00I; ****p<0.0001 versus Saline.EXAMPLE 14: Confirmation of siRNA Activity against NR3C2 in Primary Human Hepatocytes (PHH)Methods
[0604] The activity of 54 siRNAs against NR3C2 mRNA in Primary Human Hepatocytes (PHH) was carried out. PHH cells from BioIVT & Elevating Science™ were cultured in InvitroGRO CP Medium (BioreclamationIVT-S03316, 225 mL) supplemented with Fetal bovine serum (Gbico-10091148, 25.3 mL) and Penicillin- Streptomycin Solution (Gibco- 15070-063, 2.5 mL). GalNAc-siRNA were transfected using Lipofectamine®RNAiMAX Reagent (ThermoFisher) at 0.0 InM and l.OnM for 48 hours. RNA was isolated using EZ -Press 96 RNA Purification Kit (EZBioscience-EZ4001-L). cDNA was prepared using 5 x HiScript III qRT SuperMix (+gDNA wiper) and gene expression of NR3C2 and the housekeeping gene, B- actin were measured by RT-qPCR on a Q7 Fast Real-time PCR system (Applied Biosystem). Relative NR3C2 expression was calculated from mean Ct values using the comparative Ct (AACt) method, normalized to b-actin.Results
[0605] The siRNAs tested in this study are shown in Table 8 below along with their Mean Relative Expression. Activity of all tested siRNAs is shown in Figure 26. All tested siRNAs displayed activity in PHH. Results were evaluated with the HDI results (Example 15) to select lead siRNAs.Table 8EXAMPLE 15: Confirmation of siRNA Activity in a Human hydrodynamic injection (HDD Mouse ModelMethods
[0606] Transient expression of human mRNA in mice was used to assess the activity of siRNAs against human mRNA sequences. A single subcutaneous dose of siRNAs (0.5 mg / kg) was administered on Day - 6. Hydrodynamic injection (HDI) of a plasmid expressing human NR3C2 mRNA was performed on Day 0. The study was terminated, and mRNA expression was analyzed on Day 1. As a negative control, saline was injected in place of an siRNA in the vehicle control group. An overview of the study is shown in Figure 27.
[0607] Female BALB / c mice (n=5) were injected subcutaneously with 0.5 mg / kg of GalNAc-siRNA or with 0.9% saline vehicle. Six days after GalNAc-siRNA injection, the mice received 30 pg / mouse of a plasmid (pcDNA3.1) encoding the human NR3C2 cDNA by hydrodynamic injection. One day after plasmid injection, the animals were sacrificed, and livers were harvested. For the analysis of human target mRNA expression in mouse livers, liver samples were homogenized, RNA was extracted using the MagMAX™ mirVana™ Total RNA Isolation Kit (Thermo-A27828), cDNA was prepared using HiScript® III RT SuperMix for qPCR (+gDNA wiper)(Vazyme-R323), and gene expression of NR3C2 and the plasmid control gene, NEO were measured by RT-qPCR on a Q7 Fast Real-time PCR system (Applied biosystem). Expression levels were calculated using the 2-AACt method whereby NR3C2 levels were normalised to NEO levels and then normalised to the expression levels in saline-injected controls. qPCR was performed in triplicate on cDNA derived from each well and the mean Ct calculated. Relative NR3C2 expression was calculated from mean Ct values using the comparative Ct (AACt) method, normalised to NEO and relative to vehicle-injected.Results
[0608] The siRNAs tested in this study are shown in Table 9 below along with their mean relative expression in the experiment. Activity of all tested siRNAs was in the human HDI mouse model is shownin Figure 28. As can be seen from Figure 28 and Table 9, a number of siRNAs tested displayed high activity against the human NR3C2 mRNA sequence. Particularly preferred siRNAs for use in the invention are ETX-M00003139 and ETX-M00003137, and these are specifically contemplated through this disclosure, even when not singled out in a specific passage of this disclosure.Table 9EXAMPLE 16: DISEASE MODEL PROOF-OF-CONCEPT (PoC) STUDY - HFpEFMethods
[0609] HFpEF was induced in C57B6N mice fed a high-fat diet (60% kcal from fat) and water containing L-NAME (0.5 g / L) over 11 weeks. Mice were randomized into homogenous treatment groups, according to their echocardiography parameters obtained at week 10 (E / A ratio, E7A’ ratio and ejection fraction confirming HFpEF phenotype) after the induction phase. One group of mice was treated with 10 mg / kg ETX-M00002590 weekly for 6 weeks by subcutaneous injection. Control animals received weekly subcutaneous saline injections. Positive control groups received either eplerenone in their diet (Ig / kg diet) or 10 mg / kg empagliflozin by daily oral gavage for a period of 6 weeks (until end of study). All groups remained on a high fat diet and L-NAME drinking water for the duration of the study.
[0610] In week 10 and 17, left ventricular function and dimensions was assessed using two-dimensional echocardiograph (VF16-5 probe, Siemens, Acuson NX3 Elite). Numeric images of the heart were obtained in parasternal long and short-axis views using or not time motion for systolic function. Heart rate left ventricular end-diastolic and end-systolic diameters and volumes, as well as posterior and anterior wall thicknesses in diastole and systole were measured. Left ventricular ejection fraction and fractional shortening were calculated. Diastolic function was assessed using pulse-wave doppler imaging from apical four chambers view of the mitral flow and the mitral annulus. Early (E) and late (A) peak transmitral flow velocity and, the isovolumic relaxation time (IVRT) and annular tissue velocity of the mitral valve (E’ and A’ peaks) were measured and E / A, as well as E7A’ and E / E’ ratios were calculated.
[0611] After the final echocardiography on week 17, arterial and left ventricle pressure were measured. Animals were anesthetized and a 2-cm incision was performed to the right of the trachea to visualize the right carotid artery. The artery was dissected free, and an ultraminiature conductance catheter (Millar probe)was inserted and advanced into the ascending aorta to measure blood pressure. Thereafter, the catheter was further advanced into the left ventricle to record internal pressure. Systolic, diastolic, and mean arterial pressure were obtained from arterial trace. Left ventricle end-diastolic, end-systolic, and pulsed pressure, as well as tau (relaxation index), dP / dt min and max (relaxation and contractile indices) were measured.
[0612] Data were fitted to a linear model with a single categorical covariate representing the mean effect of the treatment, relative to the Vehicle Control. Treatment groups were compared to the Vehicle Control with one or two-tailed t-tests on their respective covariate (testing for a distinct effect versus the Vehicle Control). P-values were subsequently adjusted for multiple comparisons via the FDR-method.
[0613] After 5 weeks of treatment period (week 16), an exercise tolerance test, consisting in gradual increase in running speed until exhaustion was performed on a computerized treadmill (Harvard apparatus). Exercise capacity was evaluated using test duration and distance covered.
[0614] For serum analysis, a biochemical analyzer was used to measure the levels of circulating ALT / AST / ALP, Albumin, Bilirubin, Creatinine, BUN, Ca, Phos, total protein, Cl, Na and K using commercial assays at IDEXX laboratories. ELISA analysis was performed for FGF21 (abeam, ab212160) according to the manufacturer’s instructions. Treatment groups were compared to the Vehicle Control with pairwise one or two-tailed Wilcoxon tests. P-values were subsequently adjusted for multiple comparisons via the FDR-method.ResultsDisease Model PoC Study - FGF21 levels in mice treated with GalNAc-siRNA to reduce hepatic NR3C2 expression.
[0615] Analysis of serum fibroblast growth factor 21 (FGF21) levels revealed a trend towards increased FGF21 in ETX-M00002590 treated mice (Figure 29).Disease Model PoC Study - Improved cardiac remodelling in mice treated with ETX-M00002590
[0616] Echocardiography examination in week 17 showed a cardiac remodelling in HFD / L-NAME vehicle mice, with an increase in Left Ventricle (LV) wall thickness, as assessed by anterior and posterior wall thickness in diastole and systole. LV anterior and posterior wall thickness in diastole and systole were improved by treatment with ETX-M00002590 (Figure 30). Eplerenone also led to statistically significant improvements in all four parameters.Disease Model PoC Study - Improved cardiac function in mice treated with ETX-M00002590
[0617] The HFD / L-NAME model results in mild diastolic dysfunction, and treatment with ETX- M00002590 improved the diastolic function with an increased E7A’ and a decreased E / E’ ratios (Figure 31 A, B). Eplerenone and Empaglifizon also improved diastolic dysfunction. Arterial blood pressure wasincreased by HFD / L-NAME diet and ETX-M00002590 treatment led to significant decrease in blood pressure (Figure 31C, D, E). siRNA treatment led to a statistically significant reduction in LV end-diastolic pressure (Figure 3 IF) as well as trending improvements in contractility indices (Figure 31G, H) confirming beneficial outcome on cardiac function.Disease Model PoC Study - No Hyperkalaemia and decreased glucose observed in mice treated with ETX- M00002590
[0618] At termination of HFD / L-NAME model, plasma was collected, and panels of biochemistry parameters were examined. No change in plasma concentration of potassium was observed with any of the treatments (Figure 32A). A decrease in plasma glucose was detected with ETX-M00002590 and empagliflozin (Figure 32B).Disease Model PoC Study - Mice treated with ETX-M00002590 showed no change in heart weight and a decrease in liver weight.
[0619] At termination of HFD / L-NAME model, organs were collected and a decrease in liver weight was detected with ETX-M00002590 and empagliflozin (Figure 33).
[0620] Overall, ETX-M00002590 treatment achieved beneficial effects on improved diastolic function, while reducing cardiac hypertrophy, arterial pressure, and LV end-diastolic pressure in HFD / L-NAME induced model of HFpEF.
[0621] The present invention is not intended to be limited in scope to the disclosed embodiments, which are provided, for example, to illustrate various aspects of the invention. Various modifications to the compositions and methods described will become apparent from the description and teachings herein. Such variations may be practiced without departing from the true scope and spirit of the disclosure and are intended to fall within the scope of the present disclosure.
[0622] In case of ambiguity between the sequences in this specification and the sequences in the attached sequence listing, the sequences provided herein are considered to be the correct sequences.
[0623] While the disclosure has been described with reference to the specific embodiments set forth in the following Examples, it should be understood by those skilled in the art that various changes may be made, and equivalents may be substituted without departing from the true spirit and scope of the disclosure. Further, the following Examples are offered by way of illustration and are not intended to limit the scope of the disclosure in any manner. In addition, modifications may be made to adapt to a situation, material, composition of matter, process, process step or steps, to the objective, spirit, and scope of the disclosure.All such modifications are intended to be within the scope of the disclosure. Standard techniques well known in the art or the techniques specifically described below were utilized.
[0624] The invention also relates to the following numbered clauses:1. An inhibitor of expression and / or function of NR3C2, wherein said inhibitor is conjugated to one or more ligand moieties.2. An inhibitor according to clause 1, wherein said inhibitor is an siRNA oligomer.3. An inhibitor of expression and / or function of NR3C2, wherein said inhibitor is an siRNA oligomer.4. An inhibitor according to clause 3, wherein said inhibitor comprises an siRNA oligomer conjugated to one or more ligand moieties.5. An inhibitor of expression and / or function of NR3C2, such as the inhibitor of clauses 1-4, for use in treatment of HFrEF, such as an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof, and / or for use in the treatment of HFpEF.6. An inhibitor according to clause 1, 2 or 4, wherein said one or more ligand moieties comprise one or more GalNAc ligands or comprise one more GalNAc ligand derivatives.7. An inhibitor for use according to clause 1 , 2 or 4 wherein said one or more ligand moieties comprise one or more GalNAc ligand derivatives.8. An inhibitor or an inhibitor for use according to one or more preceding clauses, wherein the target of the inhibitor is NR3C2.9. An inhibitor, or inhibitor for use, according to one or more preceding clauses, which is an siRNA oligomer having a first and a second strand wherein: i) the first strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25; even more preferably 23; and / or ii) the second strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 21 nucleosides.10. An inhibitor, or inhibitor for use, according to clause 9, wherein the second sense strand further comprises one or more abasic nucleosides in a terminal region of the second strand, and wherein said abasic nucleoside(s) is / are connected to an adjacent nucleoside through a reversed intemucleoside linkage.11. An inhibitor, or inhibitor for use, according to clause 10, wherein the second strand comprises:1 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or ii 2, or more than 2, abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand; and / or iii 2, or more than 2, abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or iv 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside; and / or v 2, or more than 2, consecutive abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside in either the 5 ’ or 3 ’ terminal region of the second strand; and / or vi a reversed intemucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or vii a reversed intemucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or viii an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / or ix abasic nucleosides as the 2 terminal nucleosides connected via a 5 ’-3’ linkage when reading the strand in the direction towards that terminus; and / or x abasic nucleosides as the 2 terminal nucleosides connected via a 3 ’-5’ linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; and / or xi abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5’ reversed linkage or a 3 ’-3’ reversed linkage; and / or xii abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either(1) the reversed linkage is a 5-5’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or(2) the reversed linkage is a 3-3’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5’3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.12. An inhibitor, or inhibitor for use, according to clause 10 or 11, wherein the reversed intemucleoside linkage is at a terminal region which is distal to the 5 ’ terminal region of the second strand, or at a terminal region which is distal to the 3’ terminal region of the second strand.13. An inhibitor, or inhibitor for use, according to any one of clauses 10 to 12, wherein the reversed intemucleoside linkage is a 3’3 reversed linkage.14. An inhibitor, or inhibitor for use, according to any one of clauses 10 to 12, wherein the reversed intemucleoside linkage is a 5’5 reversed linkage.15. An inhibitor, or inhibitor for use, according to any one of clauses 9 to 14, wherein one or more nucleosides on the first strand and / or the second strand is / are modified, to form modified nucleosides.16. An inhibitor, or inhibitor for use, according to clause 15 , wherein the modification is a modification at the 2’-OH group of the ribose sugar, optionally selected from 2'-Me or 2’-F modifications.17. An inhibitor, or inhibitor for use, according to clause 15 or 16, wherein the first strand comprises a 2’-F at any of position 14, position 2, position 6, or any combination thereof, counting from position 1 of said first strand.18. An inhibitor, or inhibitor for use, according to any one of clauses 15 to 17, wherein the second strand comprises a 2’-F modification at position 7 and / or 9, and / or 11 and / or 13, counting from position 1 of said second strand.19. An inhibitor, or inhibitor for use, according to any one of clauses 15 to 18, wherein the first and second strand each comprise 2'-Me and 2’-F modifications.20. An inhibitor, or inhibitor for use, according to any one of clauses 15 to 19, which is an siRNA, wherein the siRNA comprises at least one thermally destabilizing modification, suitably at one or more of positions 1 to 9 of the first strand counting from position 1 of the first strand, and / or at one or more of positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the destabilizing modification is selected from a modified unlocked nucleic acid (IMUNA) and a glycol nucleic acid (GNA), preferably a glycol nucleic acid.21. An inhibitor, or inhibitor for use, according to clause 20, wherein the siRNA comprises at least one thermally destabilizing modification at position 7 of the first strand, counting from position 1 of the first strand.22. An inhibitor, or inhibitor for use, according to any one of clauses 15 to 21, which is an siRNA, wherein the siRNA comprises 3 or more 2’-F modifications at positions 7 to 13 of the second strand, such as 4, 5, 6 or 7 2’-F modifications at positions 7 to 13 of the second strand, counting from position 1 of said second strand23. An inhibitor, or inhibitor for use, according to any one of clauses 15 to 22, which is an siRNA, wherein said second strand comprises at least 3, such as 4, 5 or 6, 2’-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand.24. An inhibitor, or inhibitor for use, according to any one of clauses 15 to 23, which is an siRNA, wherein said first strand comprises at least 5 2 ’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region, or at least within 1 or 2 nucleosides from the terminal nucleoside at the 3’ terminal region.25. An inhibitor, or inhibitor for use, according to any one of clauses 15 to 24, which is an siRNA wherein said first strand comprises 7 2’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region.26. An inhibitor, or inhibitor for use, according to any one of clauses 15 to 25, wherein the siRNA oligomer further comprises one or more phosphorothioate intemucleoside linkages.27. An inhibitor, or inhibitor for use, according to clause 26, wherein said one or more phosphorothioate intemucleoside linkages are respectively between at least three consecutive positions in a 5’ or 3’ near terminal region of the second strand, whereby said near terminal region is preferably adjacent said terminal region wherein said one or more abasic nucleosides of said second strand is / are located according to at least clause 10.28. An inhibitor, or inhibitor for use, according to clause 26 or 27, wherein said one or more phosphorothioate intemucleoside linkages are respectively between at least three consecutive positions in a 5 ’ and / or 3 ’ terminal region of the first strand, whereby preferably a terminal position at the 5 ’ and / or 3’ terminal region of said first strand is attached to its adjacent position by a phosphorothioate intemucleoside linkage.29. An inhibitor, or inhibitor for use according to any one of clauses 9 to 28, wherein the oligomer is an siRNA and the second strand of the siRNA is conjugated directly or indirectly to one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3 ’ terminal region thereof.30. An inhibitor, or inhibitor for use according to clause 29, wherein the ligand moiety comprises i) one or more GalNAc ligands; and / orii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands and / or GalNAc ligand derivatives conjugated to said SiRNA through a linker.31. An inhibitor, or inhibitor for use according to clause 30, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5’ or 3’ terminal region of the second strand of the siRNA oligomer, preferably at the 3 ’ terminal region thereof.32. An inhibitor, or inhibitor for use according to clause 30 or 31, wherein the ligand moiety comprises:An inhibitor, or inhibitor for use according to clause 30 or 31, having the structure:wherein:Ri at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl;R2 is selected from the group consisting of hydrogen, hydroxy, -OCi-salkyl, -C(=O)OCi.3alkyl, halo and nitro;Xi and X2at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10;q, r, s, t, v are independently integers from 0 to 4, with the proviso that:(i) q and r cannot both be 0 at the same time; and(ii) s, t, and v cannot all be 0 at the same time;Z is an oligomer.34. An inhibitor, or inhibitor for use according to clause 30 or 31, having the structure:wherein: r and s are independently an integer selected from 1 to 16; andZ is an oligomer.35. An inhibitor, or inhibitor for use according to one or more preceding clauses, formulated as a pharmaceutical composition with an excipient and / or carrier.36. A pharmaceutical composition comprising an inhibitor according to one or more preceding clauses, in combination with a pharmaceutically acceptable excipient or carrier.37. A pharmaceutical composition comprising an inhibitor according to one or more preceding clauses, in combination with a pharmaceutically acceptable excipient or carrier, for use in the treatment of HFrEF, such as an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof, and / or for use in the treatment of HFpEF and / or symptoms thereof.38. Use of NR3C2 as a target for identifying one or more therapeutic agents for the treatment of HFrEF, such as an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof, and / or for the treatment of HFrEF and / or symptoms thereof.39. A method of treating HFrEF, such as an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof, and / or for treating HFpEF and / or symptoms thereof, which comprises administering to a patient an inhibitor of NR3C2, such as an inhibitor as defined according to one or more preceding clauses.40. NR3C2 for use as a biomarker of HFrEF and associated conditions such as ischaemic heart diseases, in particular myocardial infarction, and / or symptoms thereof, and / or a biomarker of HFpEF and / or symptoms thereof.41. NR3C2 for use in an in vivo method of predicting susceptibility to HFrEF, such as an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof, and / or susceptibility to HFpEF and / or symptoms thereof typically by monitoring the sequence and / or level of expression and / or function of NR3C2 in a sample obtained from a patient.42. A method of predicting susceptibility to HFrEF, such as an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof, and / or predicting susceptibility to HFpEF and / or symptoms thereof, and optionally treating a disease related to HFrEF, such as an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof, and / or a disease related to HFpEF and / or symptoms thereof in a patient, said method comprising:(a) obtaining a sample from the patient,(b) detecting the sequence and / or expression and / or function of NR3C2 in said sample obtained from the patient,(c) predicting susceptibility to a disease related to HFrEF, such as ischaemic heart disease, or a disease related to HFpEF, based on the sequence and / or expression and / or function of NR3C2 in said sample obtained from the patient,(d) preferably administering to the diagnosed patient an effective amount of an inhibitor of NR3C2.43. An inhibitor or composition according to any preceding clause, in the preparation of a medicament for use in the treatment of HFrEF, an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof, and / or the treatment of HFpEF and / or symptoms thereof.44. The inhibitor for use or the composition for use according to any of the preceding clauses, wherein the inhibitor or the composition is administered after myocardial infarction.45. A nucleic acid for inhibiting expression of NR3C2, comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is:(i) at least partially complementary to a portion of RNA transcribed from the NR3C2 gene, and(ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand sequences as listed in Table 2.46. A nucleic acid for inhibiting expression of NR3C2, comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is:(i) at least partially complementary to a portion of RNA transcribed from the NR3C2 gene, and(ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand modified sequences as listed in Table 3.47. A nucleic acid according to clause 45 or 46, wherein the first strand comprises nucleosides 2-18 of any one of the sequences defined in clause 45 or 46, in particular wherein the first strand comprises nucleosides 2-18 of any one of the sequences defined in Tables 2 or 3.48. A nucleic acid according to clause 45, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand sequences as listed in Table 2, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.49. A nucleic acid according to clause 46, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand modified sequences as listed in Table 4, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.50. A nucleic acid according to clause 45, wherein the first strand comprises any one of the first strand sequences as listed in Table 2.51. A nucleic acid according to clause 46, wherein the first strand comprises any one of the first strand modified sequences as listed in Table 3.52. A nucleic acid according to clause 48, wherein the second strand comprises any one of the second strand sequences as listed in Table 2.53. A nucleic acid according to clause 49, wherein the second strand comprises any one of the second strand modified sequences as listed in Table 4.54. A nucleic acid according to any one of clauses 45-53, wherein the first strand has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides.55. A nucleic acid according to any one of clauses 45-54, wherein the second strand has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 or 23 nucleosides.56. A nucleic acid according to any one of clauses 45-55, wherein the duplex region of the nucleic acid is between 17 and 30 nucleosides in length, more preferably is 19 or 21 or 23 nucleosides in length.57. A nucleic acid according to any one of clauses 45-56, wherein the region of complementarity between the first strand and the portion of RNA transcribed from the NR3C2 gene is between 17 and 30 nucleosides in length.58. A nucleic acid according to any one of clauses 45-57, wherein the nucleic acid further comprises one or more single-stranded nucleoside overhangs, optionally wherein the overhang is present on the first or second strand, preferably at the 3 ’ terminus of the first or second strand, and / or wherein the overhang comprises 1 to 4 nucleosides, more preferably 2 nucleosides.59. A nucleic acid according to any one of clauses 45-58, wherein the nucleic acid is an siRNA oligonucleoside.60. A nucleic acid according to any of clauses 49 or 53, wherein the second strand comprises 2 consecutive abasic nucleosides in the 5’ terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 5’ terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 5’ terminal region of the second strand, wherein:(a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 5’ near terminal region through a reversed intemucleoside linkage; and(b) the reversed linkage is a 5-5’ reversed linkage; and(c) the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.61. A nucleic acid according to clause 50, wherein(i) the first strand and the second strand each has a length of 23 nucleosides;(ii) two phosphorothioate intemucleoside linkages are respectively between three consecutive positions in said 5 ’ near terminal region of the second strand, wherein a first phosphorothioate intemucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 5 ’ near terminal region of the second strand, and a second phosphorothioate intemucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 5’ near terminal region of the second strand;(iii) two phosphorothioate intemucleoside linkages are respectively between three consecutive positions in both 5 ’ and 3 ’ terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5’ and 3’ terminal regions of said first strand is each attached to a respective 5’ and 3’ adjacent penultimate nucleoside by a phosphorothioate intemucleoside linkage, and each first 5 ’ and 3 ’ penultimate nucleoside is attached to a respective 5’ and 3’ adjacent antepenultimate nucleoside by a phosphorothioate intemucleoside linkage; and(iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 3’ terminal region of the second strand.62. A nucleic acid according to clause 50 or 51, wherein the 2 consecutive inverted abasic nucleosides in the 5 ’ terminal region of the second strand present as the following 5 ’ terminal motifwherein:T represents a 2’Me ribose modification,B represents the nucleoside bases of the first two basic nucleosides in the 5' terminal region of the second strand, andZ represents the remaining 19 contiguous basic nucleosides of said second strand.63. A nucleic acid according to any one of clauses 45-62, wherein the nucleic acid is conjugated directly or indirectly to one or more ligand moieties, optionally wherein said ligand moiety is present at a terminal region of the second strand, preferably at the 3 ’ terminal region thereof.64. A nucleic acid according to clause 63, wherein the ligand moiety comprises:(i) one or more N-acetyl galactosamine (GalNAc) ligands, and / or(ii) one or more N-acetyl galactosamine (GalNAc) ligand derivatives.65. A nucleic acid according to clause 64, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5’ or 3’ terminal region of the second strand of the nucleic acid, preferably at the 3 ’ terminal region thereof.66. A nucleic acid according to any one of clauses 63 to 65, comprising the structure:wherein:R1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl;R2 is selected from the group consisting of hydrogen, hydroxy, -OCl-3alkyl, -C(=O)OCl-3alkyl, halo and nitro;X 1 and X2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that:(i) q and r cannot both be 0 at the same time; and(ii) s, t, and v cannot all be 0 at the same time;Z is an oligonucleoside moiety.67. A nucleic acid according to clause 66, comprising the structure:wherein oligonucleotide represents the contiguous nucleosides of the second strand.68. A nucleic acid according to any one of clauses 63 to 65, comprising the structure:wherein: r and s are independently an integer selected from 1 to 16; andZ is an oligonucleoside moiety.69. A nucleic acid according to clause 68, comprising the structure:wherein oligonucleotide represents the contiguous nucleosides of the second strand.70. A nucleic acid according to clause 67 or 69, wherein the structure is conjugated to the 3’ terminal region of the second strand.71. A nucleic acid as defined in clauses 62, 67 and 70.72. A nucleic acid as defined in clauses 62, 69 and 70.73. A pharmaceutical composition comprising a nucleic acid according to any one of clauses 45-72, in combination with a pharmaceutically acceptable excipient or carrier.74. A nucleic acid or pharmaceutical composition according to any one of clauses 45-73, for use in therapy.75. A nucleic acid or pharmaceutical composition according to any one of clauses 45-74, for use in the treatment of HFrEF, such as an ischaemic heart disease, in particular myocardial infarction and / or symptoms thereof, or for use in the treatment of HFpEF and / or symptoms thereof.76. A nucleic acid or pharmaceutical composition according to clause 75, wherein the nucleic acid or the pharmaceutical composition is administered after myocardial infarction.77. A nucleic acid according to clause 50, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 228, SEQ ID NO: 238, SEQ ID NO: 243, SEQ ID NO: 235, SEQ ID NO: 245 and SEQ ID NO: 250, preferably SEQ ID NO: 238 or SEQ ID NO: 245.78. An nucleic according to clause 51, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 674, SEQ ID NO: 684, SEQ ID NO: 689, SEQ ID NO: 681, SEQ ID NO: 691 and SEQ ID NO: 696, Preferably SEQ ID NO: 684 or SEQ ID NO: 691.79. A nucleic according to clause 52, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 451, SEQ ID NO: 461, SEQ ID NO: 466, SEQ ID NO: 458, SEQ ID NO: 468 and SEQ ID NO: 473, preferably SEQ ID NO: 461 or SEQ ID NO: 468.80. A nucleic acid according to clause 53, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 897, SEQ ID NO: 907, SEQ ID NO: 912, SEQ ID NO: 904, SEQ ID NO: 914, and SEQ ID NO: 919, preferably SEQ ID NO: 907 or SEQ ID NO: 914.81. A nucleic acid according to clause 45 or clause 48, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:, preferablyor82. A nucleic acid according to clause 46 or clause 49, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:, preferablyor
Claims
CLAIMS1. An inhibitor of expression and / or function of NR3C2, for use in the treatment of heart failure with preserved ejection fraction (HFpEF).
2. An inhibitor for use according to claim 1 , wherein said inhibitor is conjugated to one or more ligand moieties.
3. An inhibitor for use according to claim 1 or claim 2, wherein said inhibitor is an siRNA oligomer.
4. An inhibitor for use according to claim 3, wherein said one or more ligand moieties comprise one or more GalNAc ligands or comprise one more GalNAc ligand derivatives.
5. An inhibitor for use according to one or more preceding claims, wherein the target of the inhibitor is NR3C2.
6. An inhibitor for use according to one or more preceding claims, which is an siRNA oligomer having a first and a second strand wherein: i) the first strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25; even more preferably 23; and / or ii) the second strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 21 nucleosides.
7. An inhibitor for use according to claim 6, wherein the second sense strand further comprises one or more abasic nucleosides in a terminal region of the second strand, and wherein said abasic nucleoside(s) is / are connected to an adjacent nucleoside through a reversed intemucleoside linkage.
8. An inhibitor for use according to claim 7, wherein the second strand comprises: i 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or ii 2, or more than 2, abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand; and / or iii 2, or more than 2, abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or iv 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside; and / orv 2, or more than 2, consecutive abasic nucleosides in either the 5 ’ or 3 ’ terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside in either the 5 ’ or 3 ’ terminal region of the second strand; and / or vi a reversed intemucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or vii a reversed intemucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or viii an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / or ix abasic nucleosides as the 2 terminal nucleosides connected via a 5 ’-3’ linkage when reading the strand in the direction towards that terminus; and / or x abasic nucleosides as the 2 terminal nucleosides connected via a 3 ’-5’ linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; and / or xi abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5’ reversed linkage or a 3 ’-3’ reversed linkage; and / or xii abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either(1) the reversed linkage is a 5-5’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or,(2) the reversed linkage is a 3-3’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5’3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.
9. An inhibitor for use according claim 7 or 8, wherein the reversed intemucleoside linkage is at a terminal region which is distal to the 5 ’ terminal region of the second strand, or at a terminal region which is distal to the 3’ terminal region of the second strand.
10. An inhibitor for use according to any one of claims 7 to 9, wherein the reversed intemucleoside linkage is a 3’3 reversed linkage.
11. An inhibitor for use according to any one of claims 7 to 9, wherein the reversed intemucleoside linkage is a 5’5 reversed linkage.
12. An inhibitor for use according to any one of claims 6 to 11, wherein one or more nucleosides on the first strand and / or the second strand is / are modified, to form modified nucleosides.
13. An inhibitor for use according to claim 12, wherein the modification is a modification at the 2’-OH group of the ribose sugar, optionally selected from 2'-Me or 2’-F modifications.
14. An inhibitor for use according to claim 12 or 13, wherein the first strand comprises a 2’-F at any of position 14, position 2, position 6, or any combination thereof, counting from position 1 of said first strand.
15. An inhibitor for use according to any one of claims 12 to 14, wherein the second strand comprises a 2’-F modification at position 7 and / or 9, and / or 11 and / or 13, counting from position 1 of said second strand.
16. An inhibitor for use according to any one of claims 12 to 15, wherein the first and second strand each comprise 2'-Me and 2’-F modifications.
17. An inhibitor for use according to any one of claims 12 to 16, which is an siRNA, wherein the siRNA comprises at least one thermally destabilizing modification, suitably at one or more of positions 1 to 9 of the first strand counting from position 1 of the first strand, and / or at one or more of positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the destabilizing modification is selected from a modified unlocked nucleic acid (IMUNA) and a glycol nucleic acid (GNA), preferably a glycol nucleic acid.
18. An inhibitor for use according to claim 17, wherein the siRNA comprises at least one thermally destabilizing modification at position 7 of the first strand, counting from position 1 of the first strand.
19. An inhibitor for use according to any one of claims 12 to 18, which is an siRNA, wherein the siRNA comprises 3 or more 2’-F modifications at positions 7 to 13 of the second strand, such as 4, 5, 6 or 7 2’-F modifications at positions 7 to 13 of the second strand, counting from position 1 of said second strand.
20. An inhibitor for use according to any one of claims 12 to 19, which is an siRNA, wherein said second strand comprises at least 3, such as 4, 5 or 6, 2’-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand.
21. An inhibitor for use according to any one of claims 12 to 20, which is an siRNA, wherein said first strand comprises at least 5 2’-Me consecutive modifications at the 3’ terminal region, preferably includingthe terminal nucleoside at the 3 ’ terminal region, or at least within 1 or 2 nucleosides from the terminal nucleoside at the 3’ terminal region.
22. An inhibitor for use according to any one of claims 12 to 21, which is an siRNA wherein said first strand comprises 7 2 ’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region.
23. An inhibitor for use according to any one of claims 12 to 22, wherein the siRNA oligomer further comprises one or more phosphorothioate intemucleoside linkages.
24. An inhibitor for use according to claim 23, wherein said one or more phosphorothioate intemucleoside linkages are respectively between at least three consecutive positions in a 5’ or 3’ near terminal region of the second strand, whereby said near terminal region is preferably adjacent to said terminal region.
25. An inhibitor for use according to claim 23 or 24, wherein said one or more phosphorothioate intemucleoside linkages are respectively between at least three consecutive positions in a 5’ and / or 3’ terminal region of the first strand, whereby preferably a terminal position at the 5 ’ and / or 3 ’ terminal region of said first strand is attached to its adjacent position by a phosphorothioate intemucleoside linkage.
26. An inhibitor for use according to any one of claims 6 to 25, wherein the oligomer is an siRNA and the second strand of the siRNA is conjugated directly or indirectly to one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3 ’ terminal region thereof.
27. An inhibitor for use according to claim 26, wherein the ligand moiety comprises i) one or more GalNAc ligands; and / or ii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands and / or GalNAc ligand derivatives conjugated to said siRNA through a linker.
28. An inhibitor for use according to claim 27, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5 ’ or 3 ’ terminal region of the second strand of the siRNA oligomer, preferably at the 3 ’ terminal region thereof.
29. An inhibitor for use according to claim 27 or 28, wherein the ligand moiety comprises:
30. An inhibitor for use according to claim 27 or 28, having the structure:wherein:Ri at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl;R2 is selected from the group consisting of hydrogen, hydroxy, -OCi-salkyl, -C(=O)OCi-3alkyl, halo and nitro;Xi and X2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that:(i) q and r cannot both be 0 at the same time; and(ii) s, t, and v cannot all be 0 at the same time;Z is an oligomer.
31. An inhibitor for use according to claim 27 or 28, having the structure:wherein: r and s are independently an integer selected from 1 to 16; andZ is an oligomer.
32. An inhibitor for use according to one or more preceding claims, formulated as a pharmaceutical composition with an excipient and / or carrier.
33. A pharmaceutical composition comprising an inhibitor according to any one of the preceding claims, in combination with a pharmaceutically acceptable excipient or carrier, for use in the treatment of HFpEF.
34. Use of NR3C2 as a target for identifying one or more therapeutic agents for the treatment of HFpEF, and / or associated disorders and / or symptoms thereof.
35. A method of treating HFpEF, and / or associated disorders and / or symptoms thereof, which comprises administering to a patient an inhibitor of NR3C2, such as an inhibitor as defined according to one or more preceding claims.
36. NR3C2 for use as a biomarker of HFpEF and / or associated conditions and / or symptoms thereof.
37. NR3C2 for use in an in vivo method of predicting susceptibility to HFpEF, and / or associated disorders and / or symptoms thereof, typically by monitoring the sequence and / or level of expression and / or function of NR3C2 in a sample obtained from a patient.
38. A method of predicting susceptibility to HFpEF, and optionally treating a disease related to HFpEF, in a patient, said method comprising:(a) obtaining a sample from the patient,(b) detecting the sequence and / or expression and / or function of NR3C2 in said sample obtained from the patient,(c) predicting susceptibility to a disease related to HFpEF, based on the sequence and / or expression and / or function of NR3C2 in said sample obtained from the patient,(d) preferably administering to the diagnosed patient an effective amount of an inhibitor of NR3C2.
39. An inhibitor or composition according to any preceding claim, in the preparation of a medicament for use in the treatment of HFpEF.
40. A nucleic acid for inhibiting expression of NR3C2, comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is:(i) at least partially complementary to a portion of RNA transcribed from the NR3C2 gene, and(ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand sequences as listed in Table 2.
41. A nucleic acid for inhibiting expression of NR3C2, comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is:(i) at least partially complementary to a portion of RNA transcribed from the NR3C2 gene, and(ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand modified sequences as listed in Table 3.
42. A nucleic acid according to claim 40 or 41, wherein the first strand comprises nucleosides 2-18 of any one of the sequences defined in claim 40 or 41, in particular wherein the first strand comprises nucleosides 2-18 of any one of the sequences defined in Tables 2 or 3.
43. A nucleic acid according to claim 40, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand sequences as listed in Table 2, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.
44. A nucleic acid according to claim 41, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand modified sequences as listed in Table 4, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.
45. A nucleic acid according to claim 40, wherein the first strand comprises any one of the first strand sequences as listed in Table 2.
46. A nucleic acid according to claim 41, wherein the first strand comprises any one of the first strand modified sequences as listed in Table 3.
47. A nucleic acid according to claim 43, wherein the second strand comprises any one of the second strand sequences as listed in Table 2.
48. A nucleic acid according to claim 44, wherein the second strand comprises any one of the second strand modified sequences as listed in Table 4.
49. A nucleic acid according to any one of claims 40-48, wherein the first strand has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides.
50. A nucleic acid according to any one of claims 40-49, wherein the second strand has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 or 23 nucleosides.
51. A nucleic acid according to any one of claims 40-50, wherein the duplex region of the nucleic acid is between 17 and 30 nucleosides in length, more preferably is 19 or 21 or 23 nucleosides in length.
52. A nucleic acid according to any one of claims 40-51, wherein the region of complementarity between the first strand and the portion of RNA transcribed from the NR3C2 gene is between 17 and 30 nucleosides in length.
53. A nucleic acid according to any one of claims 40-52, wherein the nucleic acid further comprises one or more single-stranded nucleoside overhangs, optionally wherein the overhang is present on the first or second strand, preferably at the 3 ’ terminus of the first or second strand, and / or wherein the overhang comprises 1 to 4 nucleosides, more preferably 2 nucleosides.
54. A nucleic acid according to any one of claims 40-53, wherein the nucleic acid is an siRNA oligonucleoside.
55. A nucleic acid according to any of claims 44 or 48, wherein the second strand comprises 2 consecutive abasic nucleosides in the 5’ terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 5’ terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 5’ terminal region of the second strand, wherein:(a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 5’ near terminal region through a reversed intemucleoside linkage; and(b) the reversed linkage is a 5-5’ reversed linkage; and(c) the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.
56. A nucleic acid according to claim 45, wherein(i) the first strand and the second strand each has a length of 23 nucleosides;(ii) two phosphorothioate intemucleoside linkages are respectively between three consecutive positions in said 5 ’ near terminal region of the second strand, wherein a first phosphorothioate intemucleoside linkageis present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 5 ’ near terminal region of the second strand, and a second phosphorothioate intemucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 5’ near terminal region of the second strand;(iii) two phosphorothioate intemucleoside linkages are respectively between three consecutive positions in both 5 ’ and 3 ’ terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5’ and 3’ terminal regions of said first strand is each attached to a respective 5’ and 3’ adjacent penultimate nucleoside by a phosphorothioate intemucleoside linkage, and each first 5 ’ and 3 ’ penultimate nucleoside is attached to a respective 5’ and 3’ adjacent antepenultimate nucleoside by a phosphorothioate intemucleoside linkage; and(iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 3’ terminal region of the second strand.
57. A nucleic acid according to claim 45 or claim 46, wherein the 2 consecutive inverted abasic nucleosides in the 5’ terminal region of the second strand present as the following 5’ terminal motif:wherein:T represents a 2’Me ribose modification,B represents the nucleoside bases of the first two basic nucleosides in the 5' terminal region of the second strand, andZ represents the remaining 19 contiguous basic nucleosides of said second strand.
58. A nucleic acid according to any one of claims 40-57, wherein the nucleic acid is conjugated directly or indirectly to one or more ligand moieties, optionally wherein said ligand moiety is present at a terminal region of the second strand, preferably at the 3 ’ terminal region thereof.
59. A nucleic acid according to claim 58, wherein the ligand moiety comprises:(i) one or more N-acetyl galactosamine (GalNAc) ligands, and / or(ii) one or more N-acetyl galactosamine (GalNAc) ligand derivatives.
60. A nucleic acid according to claim 59, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5’ or 3’ terminal region of the second strand of the nucleic acid, preferably at the 3 ’ terminal region thereof.
61. A nucleic acid according to any one of claims 58 to 60, comprising the structure:wherein:R1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl;R2 is selected from the group consisting of hydrogen, hydroxy, -OCl-3alkyl, -C(=O)OCl-3alkyl, halo and nitro;XI and X2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that:(i) q and r cannot both be 0 at the same time; and(ii) s, t, and v cannot all be 0 at the same time;Z is an oligonucleoside moiety.
62. A nucleic acid according to claim 61, comprising the structure:wherein oligonucleotide represents the contiguous nucleosides of the second strand.
63. A nucleic acid according to any one of claims 58 to 60, comprising the structure:wherein: r and s are independently an integer selected from 1 to 16; andZ is an oligonucleoside moiety.
64. A nucleic acid according to claim 63, comprising the structure:wherein oligonucleotide represents the contiguous nucleosides of the second strand.
65. A nucleic acid according to claim 62 or claim 64, wherein the structure is conjugated to the 3’ terminal region of the second strand.
66. A nucleic acid as defined in claims 57, 62 and 65.
67. A nucleic acid as defined in claims 57, 64 and 65.
68. A nucleic acid according to claim 45, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 290, SEQ ID NO: 270, SEQ ID NO: 238, SEQ ID NO: 245, SEQ ID NO: 283, SEQ ID NO: 235, SEQ ID NO: 226, SEQ ID NO: 335, SEQ ID NO: 228 or SEQ ID NO: 410, preferably SEQ ID NO: 290, SEQ ID NO: 270, SEQ ID NO: 238, SEQ ID NO: 245 or SEQ ID NO: 283, more preferably SEQ ID NO: 290 or SEQ ID NO: 270.
69. A nucleic according to claim 46, wherein the first strand comprises any one of the following sequences: SEQ ID NO: 736, SEQ ID NO: 716, SEQ ID NO: 684, SEQ ID NO: 691, SEQ ID NO: 729, SEQ ID NO: 681, SEQ ID NO: 672, SEQ ID NO: 781, SEQ ID NO: 674 or SEQ ID NO: 856, preferably SEQ ID NO: 736, SEQ ID NO: 716, SEQ ID NO: 684, SEQ ID NO: 691 or SEQ ID NO: 729, more preferably SEQ ID NO: 736 or SEQ ID NO: 716.
70. A nucleic according to claim 47, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 513, SEQ ID NO: 493, SEQ ID NO: 461, SEQ ID NO: 468, SEQ ID NO: 506, SEQ ID NO: 458, SEQ ID NO: 449, SEQ ID NO: 558, SEQ ID NO: 451 or SEQ ID NO: 633, preferably SEQ ID NO: 513, SEQ ID NO: 493, SEQ ID NO: 461, SEQ ID NO: 468 or SEQ ID NO: 506, more preferably SEQ ID NO: 513 or SEQ ID NO: 493.
71. A nucleic acid according to claim 48, wherein the second strand comprises any one of the following sequences: SEQ ID NO: 959, SEQ ID NO: 939, SEQ ID NO: 907, SEQ ID NO: 914, SEQ ID NO: 952, SEQ ID NO: 904, SEQ ID NO: 895, SEQ ID NO: 1004, SEQ ID NO: 897, SEQ ID NO: 897 or SEQ ID NO: 1079, preferably SEQ ID NO: 959, SEQ ID NO: 939, SEQ ID NO: 907, SEQ ID NO: 914 or SEQ ID NO: 952, more preferably SEQ ID NO: 959 or SEQ ID NO: 939.
72. A nucleic acid according to claim 40 or claim 43, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
73. A nucleic acid according to claim 45 or claim 48, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
74. A nucleic acid according to claim 45 or claim 48, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:
75. A nucleic acid according to claim 45 or claim 48, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:
76. A nucleic acid according to claim 41 or claim 44, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
77. A nucleic acid according to claim 41 or claim 44, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences:
78. A nucleic acid according to claim 41 or claim 44, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:
79. A nucleic acid according to claim 41 or claim 44, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from the following first and second sequence:
80. A pharmaceutical composition comprising a nucleic acid according to any one of claims 40-79, in combination with a pharmaceutically acceptable excipient or carrier.
81. A nucleic acid or pharmaceutical composition according to any one of claims 40-80, for use in therapy.
82. A nucleic acid or pharmaceutical composition according to any one of claims 40-80, for use in the treatment of HFrEF, such as an ischaemic heart disease, in particular myocardial infarction, and / or symptoms thereof.
83. A nucleic acid or pharmaceutical composition according to claim 81 or claim 82, wherein the nucleic acid or the pharmaceutical composition is administered after myocardial infarction.
84. A nucleic acid or pharmaceutical composition according to any one of claims 40-80, for use in the treatment of HFpEF and / or symptoms thereof.