Compositions and methods for inhibiting expression or function of exchange protein directly activated by camp (EPAC)

CA3324320A1Pending Publication Date: 2025-10-09INST DE CARDIOLOGIE DE MONTREAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CA3324320
Authority / Receiving Office
CA · CA
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-25
Filing Date
2025-03-25
Publication Date
2025-10-09

AI Technical Summary

Technical Problem

There is a need for compositions and methods that can decrease low density lipoprotein (LDL) and/or increase LDL receptors (LDLr) in a subject to address cardiovascular complications associated with excess LDL in the blood.

Method used

Inhibiting the expression or function of exchange protein directly activated by cAMP (EPAC1 and/or EPAC2) using inhibitory nucleic acid molecules such as siRNA, ASO, dsRNA, or miRNA, or small molecules like CE3F4 or ESI-05, to modulate LDLr expression.

Benefits of technology

Inhibiting EPAC1 and/or EPAC2 leads to increased LDLr expression, thereby decreasing serum LDL levels and reducing cardiovascular risk factors.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

Disclosed are compositions and methods of decreasing serum low density lipoprotein (LDL) level in a subject. The methods include inhibiting expression or function of EPAC in the subject, wherein the inhibiting of expression or function includes administration of an inhibitor of EPAC to the subject.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OR FUNCTION OF EXCHANGE PROTEIN DIRECTLY ACTIVATED BY cAMP (EPAC)

[0002] CROSS-REFERENCE TO RELATED APPLICATION

[0003] This application claims the benefit of the filing date of U.S. provisional application no. 63 / 569,442, filed March 25, 2024, the disclosure of which is hereby incorporated by reference in its entirety.

[0004] TECHNICAL FIELD

[0005] This disclosure relates to inhibitory nucleic acid molecules and small compounds, as well as compositions containing such molecules and compounds and methods of using these for decreasing low density lipoprotein (LDL) and increasing LDL receptors (LDLr) in a subject.

[0006] BACKGROUND

[0007] Throughout the body, low density lipoprotein (LDL) transports fat molecules to cells via the bloodstream. LDL receptors (LDLr) on the surface of receiving cells can bind to and endocytose LDL, thereby internalizing LDL and lowering LDL levels in the blood. Excess LDL in the blood is associated with increased cardiovascular complications, such as coronary heart disease, resulting in one-fourth of all deaths in industrialized countries (Goldstein et al. (2015) Cell 161 :161-172). Regulating circulating LDL by modulating LDLr is, therefore, of therapeutic interest.

[0008] Several mechanisms are implicated in the regulation of LDLr expression. Down regulation of LDLr protein can be mediated by inducible degrader of LDLr (IDOL), which stimulates proteasomal degradation of LDLr (Zelcer et al. (2009) Science 325:100-104). Additionally, lysosomal degradation of LDLr protein can be stimulated by the proprotein convertase subtilisin / kexin type 9 (PCSK9) (Park et al. (2004) J Biol Chem. 48:50630-50638). On the contrary, transcriptional upregulation of LDLr can be mediated by sterol regulatory element-binding protein-2 (SREBP-2), which, when intracellular cholesterol is low, can translocate to the nucleus of a cell and stimulate LDLr gene expression (Goldstein et al. (2015) Cell 161 :161-172). The adenylate cyclase (AC) cyclic AMP(cAMP) and protein kinase A (PKA) cascade can further influence the upregulation of LDLr. For example, phosphodiesterase (PDE) inhibitors can induce SREBP2 nuclear translocation by a PKA-dependent mechanism (Shimizu-Albergine et al. (2013) Proc Natl Acad Sci., 113:E5685-5693), thereby increasing LDLr transcription. Furthermore, a functional cAMP-responsive element (CRE) present in the LDLr promotor can stimulate LDLr transcription (Liu et al. (2000) J Biol Chem. 275:5214-5221 ).

[0009] There remains a need for compositions and methods that can decrease LDL and / or increase LDLr in a subject.

[0010] SUMMARY OF THE INVENTION

[0011] The disclosure provides compositions and methods of decreasing low density lipoprotein (LDL) in the serum of a subject. Furthermore, the invention provides compositions and methods of increasing LDL receptor (LDLr) expression in a subject. In a first aspect, the disclosure provides a method of decreasing serum low density lipoprotein (LDL) level in a subject, the method including inhibiting expression or function of EPAC1 and / or EPAC2 in the subject, wherein inhibiting expression or function includes administration of an EPAC inhibitor.

[0012] In a second aspect, the disclosure provides a method of increasing LDL receptor expression in a subject, the method including inhibiting expression or function of EPAC1 and / or EPAC2 in the subject, wherein inhibiting expression or function includes administration of an EPAC inhibitor to the subject.

[0013] In some embodiments, the inhibitor of EPAC1 and / or EPAC2 is a small molecule (e.g. , CE3F4 or ESI-05).

[0014] In some embodiments, the inhibitor of EPAC1 and / or EPAC2 is an inhibitory nucleic acid molecule, such as an anti-sense oligonucleotide (ASO), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a double-stranded RNA (dsRNA), or a microRNA (miRNA).

[0015] In a particular embodiment, the inhibitory nucleic acid molecule is an siRNA

[0016] In some embodiments, the siRNA includes a locked nucleic acid or is entirely made of locked nucleic acids.

[0017] In some embodiments, siRNA comprises a sequence complementary to at least 15, 19, 21 , or 25 contiguous nucleotides of a nucleic acid sequence encoding EPAC1 or EPAC2.

[0018] In some embodiments, the siRNA molecule contains 3’ overhangs selected from the group consisting of:

[0019] (i) a single uracil overhang at one or more 3’ ends of the siRNA;

[0020] (ii) a double uracil overhang at one or more 3’ ends of the siRNA;

[0021] (iii) a single thymine overhang at one or more 3’ ends of the siRNA;

[0022] (iv) a double thymine overhang at one or more 3’ ends of the siRNA; or

[0023] (v) a single cytosine and single thymine overhang at one or more 3’ ends of the siRNA.

[0024] In some embodiments, the siRNA molecule targets an EPAC mRNA sequence comprising 5'GCAACAAGAGGCAGCAGAUUU ‘3 (SEQ ID NO:18), 5' ACCUCAAGGAGCAGAAGAAUU ‘3 (SEQ ID NO: 19), 5'CUGCAGUACUGGGUGGCCAUU ‘3 (SEQ ID NO:20), 5'ACUUAAAGAACAUGACCAAUU ‘3 (SEQ ID NO: 21 ), or 5'CUAAUAAGAACCAUCAGGAUU ‘3 (SEQ ID NO: 22).

[0025] In some embodiments, the siRNA molecule comprises the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, or SEQ ID NO: 22.

[0026] In some embodiments, the siRNA molecule comprises a sequence complementary to the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22.

[0027] In some embodiments, the method further comprises administering a second therapeutic agent (e.g., adenylate cyclase type 9 (AC9)) to the subject.

[0028] In some embodiments, the inhibitor of AC9 is an inhibitory nucleic acid molecule, such as an antisense oligonucleotide (ASO), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a doublestranded RNA (dsRNA), or a microRNA (miRNA).

[0029] In a particular embodiment the inhibitory nucleic acid molecule is an siRNA targeting AC9.

[0030] In some embodiments, the siRNA comprises a sequence complementary to at least 15, 19, 21 , or 25 contiguous nucleotides set forth within any one of SEQ ID NOs: 1-10, 16, and 17.

[0031] In some embodiments the siRNA molecule targeting AC9 contains 3’ overhangs selected from the group consisting of:

[0032] (i) a single uracil overhang at one or more 3’ ends of the siRNA; (ii) a double uracil overhang at one or more 3’ ends of the siRNA;

[0033] (Hi) a single thymine overhang at one or more 3’ ends of the siRNA;

[0034] (iv) a double thymine overhang at one or more 3’ ends of the siRNA; or

[0035] (v) a single cytosine and single thymine overhang at one or more 3’ ends of the siRNA.

[0036] In some embodiments, the siRNA targeting AC9 comprises a nucleotide sequence of any one or more of SEQ ID NOs: 1-10.

[0037] In particular embodiments, the siRNA targeting AC9 comprises:

[0038] (i) a sense strand comprising the sequence of SEQ ID NO: 1 and an antisense strand comprising the sequence of SEQ ID NO: 2;

[0039] (ii) a sense strand comprising the sequence of SEQ ID NO: 3 and an antisense strand comprising the sequence of SEQ ID NO: 4;

[0040] (iii) a sense strand comprising the sequence of SEQ ID NO: 5 and an antisense strand comprising the sequence of SEQ ID NO: 6;

[0041] (iv) a sense strand comprising the sequence of SEQ ID NO: 7 and an antisense strand comprising the sequence of SEQ ID NO: 8; or

[0042] (v) a sense strand comprising the sequence of SEQ ID NO: 9 and an antisense strand comprising the sequence of SEQ ID NO: 10.

[0043] In some embodiments, the siRNA comprises a non-natural or modified nucleoside or nucleotide, such as a 2'-O-methyl (2'-O-Me) modified nucleoside, a phosphorothioate (PS) bond between nucleosides, insertion of a 2’-deoxy-ribonuclotide into the RNA sequence, and a 2'-fluoro (2-F) modified nucleoside.

[0044] In some embodiments, the siRNA molecule targets the sequence of any one of SEQ ID NOs: 11- 15.

[0045] In some embodiments, the disclosed method further comprises administering a therapeutic agent selected from the group consisting of a statin, a proprotein convertase subtilisin / kexin type 9 (PCSK9) inhibitor, an ATP citrate lyase (ACL) inhibitor, a lipoprotein(a) (Lp(a)) inhibitor, an angiopoietin-like 3 (ANGPTL3) inhibitor, a cholesterylester transfer protein (CETP) inhibitor, a microsomal triglyceride transfer protein (MTP) inhibitor, an apolipoprotein B (ApoB) inhibitor, a bile acid binding resin, and colchicine, to the subject.

[0046] In a particular embodiment, the statin is atorvastatin.

[0047] In a particular embodiment, the PCSK9 inhibitor is an siRNA molecule targeting PCSK9 or a monoclonal antibody.

[0048] In a particular embodiment, the ACL inhibitor is bempedoic acid.

[0049] In a particular embodiment, the Lp(a) inhibitor is an siRNA molecule targeting Lp(a).

[0050] In a particular embodiment, the MTP inhibitor is lomitapide.

[0051] In a particular embodiment, the ApoB inhibitor is mipomersen.

[0052] In another aspect, the disclosure provides use of an inhibitor of EPAC1 or EPAC2 to decrease serum low density lipoprotein (LDL) level in a subject, wherein expression or function of EPAC1 or EPAC2 is inhibited in the subject by administration of the inhibitor.

[0053] In another aspect the disclosure provides an siRNA molecule that targets an EPAC mRNA sequence comprising 5'GCAACAAGAGGCAGCAGAUUU ‘3 (SEQ ID NO: 18), 5' ACCUCAAGGAGCAGAAGAAUU ‘3 (SEQ ID NO: 19), 5'CUGCAGUACUGGGUGGCCAUU ‘3 (SEQ ID NQ:20), 5'ACUUAAAGAACAUGACCAAUU ‘3 (SEQ ID NO: 21), or 5'CUAAUAAGAACCAUCAGGAUU ‘3 (SEQ ID NO: 22).

[0054] In a further aspect the disclosure provides an siRNA molecule comprising the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22. In one embodiment, the siRNA molecule comprises the sequence of SEQ ID NO: 18. In one embodiment, the siRNA molecule comprises the sequence of SEQ ID NO: 19. In one embodiment, the siRNA molecule comprises the sequence of SEQ ID NO: 20. In one embodiment, the siRNA molecule comprises the sequence of SEQ ID NO: 21 . In one embodiment, the siRNA molecule comprises the sequence of SEQ ID NO: 22.

[0055] In another aspect the disclosure provides an siRNA molecule comprising a sequence complementary to the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22.

[0056] BRIEF DESCRIPTION OF THE DRAWINGS

[0057] The accompanying drawing is included to illustrate embodiments of the disclosure and further an understanding of its implementations.

[0058] FIG. 1 is a series of graphs showing the impact of inhibition of EPAC pathways on LDL receptor protein expression in human HepG2 hepatoma cells.

[0059] FIG. 2 is a series of graphs quantifying LDL receptor (LDLr) protein levels in HepG2 cells treated for 24 hours with pharmacological inhibitors targeting EPAC1 (CE3F4) (FIG. 2A), EPAC2 ( ESI-05) (FIG. 2B), or both (ESI-09)(FIG. 2C). Densitometry data from Western blots were calculated and normalized to the densitometry data of the actin loading control. Protein expression is shown as a percentage relative to the siScramble control. The results demonstrate that LDLr protein levels increase following pharmacological inhibition of EPAC1 , EPAC2, or both. Error bars represent the mean ± standard deviation (n = 3-6). Statistical significance was determined using repeated measures ANOVA with uncorrected Fisher’s LSD: *p < 0.05, **p < 0.01, relative to control.

[0060] FIG. 3 shows graphs quantifying EPAC1 protein (FIG. 3A) and EPAC2 mRNA level (FIG. 3B) in cells transfected for 24 hours with EPAC1 or EPAC2 expressing vectors in presence or absence of siRNA-mediated knockdown of EPAC1 or EPAC2 in HepG2 cells, relative to the siScramble control. Densitometry data from Western blots were calculated and normalized to the densitometry data of the actin loading control. Protein and mRNA expression is shown as a percentage relative to the siScramble control. The results validated the efficacy of EPAC1 and EPAC2 siRNA since they significantly reduced the protein and mRNA expression of their respective target. Error bars represent the mean ± standard deviation (n = 3-4). Statistical significance was determined using paired t-test: ***p < 0.001 , relative to control.

[0061] FIG. 4 shows a graph quantifying LDLr protein levels in HepG2 cells after siRNA-mediated knockdown of EPAC1 , EPAC2, or both in HepG2 cells, relative to the siScramble control. Densitometry data from Western blots were calculated and normalized to the densitometry data of the actin loading control. Protein expression is shown as a percentage relative to the siScramble control. The results indicate that LDLr levels increase following siRNA-mediated knockdown of EPAC. Error bars represent the mean ± standard deviation (n = 6). Statistical significance was determined using repeated measures ANOVA with uncorrected Fisher’s LSD: *p < 0.05, ***p < 0.001 , relative to the siScramble control. FIG. 5 shows graphs quantifying LDLr (FIG. 5A) and proprotein convertase subtilisin / kexin type 9 (PCSK9)(FIG. 5B) mRNA levels in HepG2 cells after 48 hours of siRNA-mediated knockdown of EPAC1 and EPAC2, in the presence or absence of 5 pM atorvastatin (Ato), relative to the siScramble control (Control) (left to right: siScramble, siEPACI , siEPAC2). mRNA expression is shown as a percentage relative to the siScramble control. The results demonstrate an additive effect of EPAC2 siRNA and atorvastatin on LDLr mRNA expression, despite PCSK9 expression showed a similar effect. In contrast, EPAC1 siRNA decreased LDLr and PCSK9 mRNA levels independently of atorvastatin. Error bars represent the mean ± standard deviation (n = 7). Statistical significance was determined using repeated measures ANOVA with uncorrected Fisher’s LSD: **p < 0.01 , ***p < 0.001 , relative to siScramble-Control;#p < 0.05, °p < 0.01 , ***p < 0.001

[0062] FIG. 6 shows graphs quantifying LDLr (FIG. 6A) and PCSK9 (FIG. 6B) protein levels in HepG2 cells after 72 hours of siRNA-mediated knockdown of EPAC1 and EPAC2, in the presence or absence of 5 pM atorvastatin (Ato), relative to the siScramble control (Control) (left to right: siScramble, siEPACI , siEPAC2). Densitometry data from Western blots were calculated and normalized to the densitometry data of the actin loading control. Protein expression is shown as a percentage relative to the siScramble control. The results demonstrate an additive effect of EPAC2 siRNA and atorvastatin on LDLr protein expression, but no such effect was observed for PCSK9 secretion. Although EPAC1 siRNA increased LDLr protein expression, the additive effect was not observed when combined with atorvastatin. Error bars represent the mean ± standard deviation (n = 6-8). Statistical significance was determined using repeated measures ANOVA with uncorrected Fisher’s LSD: *p < 0.05, **p < 0.01 , ***p < 0.001, different from siScramble-Control;#p < 0.05, °p < 0.01, ***p < 0.001.

[0063] FIG. 7 shows a graph showing quantification of3H-CE-LDL association after siRNA-mediated knockdown of EPAC2 in HepG2 cells, relative to an siScramble control. In brief, human LDL labeled with3H-cholesteryl oleate (CE) were incubated with HepG2 cells at 20 pg protein / ml for 4h. At the end, cells were solubilized in 0.2N NaOH and radioactivity was estimated with a beta counter, while being normalized to cell proteins estimated by Lowry assay. The results demonstrate that sEPAC2 siRNA increased the uptake of3H-CE compared to siScramble. Error bars represent the mean ± standard deviation, n =7. Paired t-test: “ = p < 0.01 , relative to siScramble.

[0064] FIG. 8 shows graphs quantifying LDLr protein levels in HepG2 cells after 72 hours of knockdown of EPAC1 (FIG. 8A) and EPAC2 (FIG. 8B) using the EPAC1 and EPAC2 siRNAs described herein, relative to the siScramble control. Densitometry data from Western blots were calculated and normalized to the densitometry data of the actin loading control. Protein expression is shown as a percentage relative to the siScramble control. The results demonstrate that the EPAC1 and EPAC2 siRNAs described herein increase LDLr expression in HepG2 cells. Error bars represent the mean ± standard deviation (n = 6-8). Statistical significance was determined using repeated measures ANOVA with uncorrected Fisher’s LSD: *p < 0.05, **p < 0.01, ***p < 0.001 , relative to the siScramble control.

[0065] DEFINITIONS

[0066] Unless otherwise defined herein, scientific, and technical terms used herein have the meanings that are commonly understood by those of ordinary skill in the art. In the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The use of "or" means "and / or" unless stated otherwise. The use of the term "including," as well as other forms, such as "includes" and "included," is not limiting.

[0067] As used herein, the term "about," as applied to one or more values of interest, refers to a value that falls within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of a stated reference value, unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0068] As used herein, “administration” refers to providing or giving a subject a therapeutic agent by any effective route. Exemplary routes of administration are described herein below.

[0069] As used herein, the term “administered in combination” or “combined administration” means that two or more agents are administered to a subject at the same time or within an interval such that there may be an overlap of an effect of each agent on the patient. In some embodiments, they are administered within about 60, 30, 15, 10, 5, or 1 minute of one another. In some embodiments, the administrations of the agents are spaced sufficiently closely together such that a combinatorial (e.g., a synergistic) effect is achieved.

[0070] As used herein, the term "auxiliary moiety" refers to any moiety, including, but not limited to, a small molecule, a peptide, a carbohydrate, a neutral organic polymer, a positively charged polymer, a therapeutic agent, a targeting moiety, an endosomal escape moiety, and any combination thereof, which can be conjugated to a nucleic acid molecule. In some embodiments, an "auxiliary moiety" is linked to an inhibitory nucleic acid molecule disclosed herein by forming one or more covalent or non-covalent bonds with one or more conjugating groups attached to a phosphate linkage, a phosphorothioate linkage, a 5' positions of a nucleotide sugar, or any portion of a nucleobase. One skilled in the art will readily understand appropriate points of attachment of a particular auxiliary moiety to a nucleic acid molecule.

[0071] As used herein, “delivery vehicle” refers to any substance (e.g. , molecule, peptide, conjugate, and construct) that facilitates, at least in part, the in vivo delivery of a nucleic acid molecule to targeted cells.

[0072] As used herein, the terms “effective amount,” “therapeutically effective amount,” and a “sufficient amount” of a composition described herein refer to a quantity sufficient to, when administered to the subject, effect beneficial or desired results; as such, an “effective amount” or synonym thereto depends upon the context in which it is being applied. For example, in the context of decreasing low density lipoprotein (LDL), it is an amount of the composition sufficient to achieve a treatment response as compared to the response obtained without administration of the composition. The amount of a given composition described herein that will correspond to such an amount will vary depending upon various factors, such as the given agent, the pharmaceutical compositions, the route of administration, the type of disease or disorder, the identity of the subject (e.g., age, sex, weight) or host being treated, and the like, but can nevertheless be routinely determined by one skilled in the art.

[0073] As used herein, a “formulation” includes at least an inhibitory nucleic acid molecule and a delivery vehicle.

[0074] As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).

[0075] As used herein, the term “in vivo” refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof). As used herein, the term “inhibitory nucleic acid molecule” refers to a nucleic acid molecule that has sufficient complementarity to bind to a target nucleic acid molecule to inhibit expression of protein encoded by the target nucleic acid molecule. Exemplary inhibitory nucleic acid molecules are anti-sense oligonucleotides (ASOs), small interfering RNA (siRNAs), short hairpin RNA (shRNAs), double stranded RNAs (dsRNAs), and microRNA (miRNAs). Inhibitory nucleic acid molecules may reduce target protein expression by 10% or more (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or more). In one embodiment, the target nucleic acid molecule encodes EPAC1 or EPAC2.

[0076] As used herein, “inhibiting expression or function” of a protein (e.g., EPAC1 or EPAC2), refers to inhibiting expression of the protein by regulating gene expression or destabilization of the mRNA encoding the protein, as well as inhibiting the function of the mature protein. Inhibitory nucleic acid molecules, small molecules (e.g., CE3F4 or ESI-05) and compounds can be used to inhibit expression or function of a protein.

[0077] As used herein “modified” refers to a changed state or structure of a nucleic acid molecule described herein. Molecules may be modified in many ways including chemically, structurally, and functionally. In one embodiment, the inhibitory nucleic acid molecules of the present invention are modified by the introduction of non-natural nucleosides and / or nucleotides. In other embodiments, the inhibitory nucleic acid molecules of the present invention are modified by conjugation of an auxiliary moiety.

[0078] As used herein, the term “pharmaceutical composition” refers to a mixture containing a therapeutic agent, optionally in combination with one or more pharmaceutically acceptable excipients, diluents, and / or carriers, to be administered to a subject, such as a mammal, e.g., a human, in order to prevent, treat or control a particular disease or condition affecting or that may affect the subject.

[0079] As used herein, the term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues a subject, such as a mammal (e.g., a human) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0080] “Percent (%) sequence identity” with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values may be generated using the sequence comparison computer program BLAST. As an illustration, the percent sequence identity of a given nucleic acid or amino acid sequence, A, to, with, or against a given nucleic acid or amino acid sequence, B, (which can alternatively be phrased as a given nucleic acid or amino acid sequence, A that has a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence, B) is calculated as follows: 100 multiplied by (the fraction X / Y) where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in that program’s alignment of A and B, and where Y is the total number of nucleic acids in B. It will be appreciated that where the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A.

[0081] As used herein, the term “therapeutic agent” refers to any agent that, when administered to a subject, has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect.

[0082] As used herein, “treatment” and “treating” in reference to a disease or condition, refer to an approach for obtaining beneficial or desired results, e.g., clinical results. Beneficial or desired results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease or condition; stabilized (i.e., not worsening) state of disease, disorder, or condition; preventing spread of disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder, as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented.

[0083] As used herein, the term “vector” is considered a replicon, such as plasmid, phage, viral construct or cosmid, to which another nucleic acid (e.g., DNA or RNA) segment may be attached. Vectors are used to transduce and express the nucleic acid segment in cells.

[0084] DETAILED DESCRIPTION

[0085] Described herein are compositions (e.g., inhibitory nucleic acid molecules) and methods thereof for decreasing low density lipoprotein (LDL) in the serum of a subject. Furthermore, the invention provides compositions (e.g., inhibitory nucleic acid molecules) and methods thereof for increasing LDL receptor (LDLr) expression in a subject.

[0086] The inhibitory nucleic acid molecules (e.g., a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), an anti-sense oligonucleotide (ASO), a microRNA (miRNA), or a short hairpin RNA (shRNA)), or compositions thereof, described herein may be used in methods for reducing expression of EPAC1 and / or EPAC2. Advantageously, the methods of the present disclosure provide for effective mechanisms to decrease LDL and / or increase LDLr in a subject. In doing so, the present methods are useful for reducing LDL concentrations in the blood (e.g., serum or plasma) of a subject.

[0087] EPAC cAMP-mediated signaling pathways regulate a multitude of important biological processes under both physiological and pathological conditions, including diabetes, heart failure, and cancer. In eukaryotic cells, the effects of cAMP are mediated by two ubiquitously expressed intracellular cAMP receptors, the classic protein kinase A (PKA) and the exchange protein directly activated by cAMP / cAMP-regulated guanine nucleotide exchange factors (EPAC / cAMP-GEF). The two EPAC isoforms, EPAC1 (also known as Rap guanine nucleotide exchange factor 3 (RAPGEF3)) and EPAC2 (also known as Rap guanine nucleotide exchange factor 4 (RAPGEF4)), are guanine-nucleotide exchange factors for the Ras-like GTPases, Rap1 and Rap2, which they activate independently of the classical effector of cAMP, protein kinase A.

[0088] An increase in EPAC expression results in an increase in PI3K (phosphoinositide 3-kinase) expression, which, in turn, results in an increase in pAKT (phosphorylated AKT) expression. Whereas a decrease in pAKT expression results in an increase in LDLr expression resulting from mRNA stabilization and PCSK9 (proprotein convertase subtilisin / kexin type 9) downregulation.

[0089] The human amino acid and nucleotide sequences of EPAC1 and EPAC2 are publicly available (e.g., NCBI Reference Sequence NM_001098531.4 and UniProt 095398 for EPAC 1 ; and GeneBank Accession No. U78516 and UniProt Q8WZA2 for EPAC2). The inventors discovered that inhibition of EPAC1 or EPAC2 results in an increase in LDLr expression, which is expected to decrease the level of LDL in the serum of a subject.

[0090] Inhibitory Nucleic Acid Molecules

[0091] Exemplary inhibitory nucleic acid molecules of the disclosure are siRNAs, dsRNAs, ASOs, miRNAs, and shRNAs; however any nucleic acid molecule capable of reducing mRNA encoding EPAC1 and / or EPAC2 and / or protein expression is envisioned for use of the methods described herein. In some instances, the inhibitory nucleic acid molecules of the disclosure may be referred as RNA inhibitory (RNAi) molecules.

[0092] For any of the inhibitory nucleic acid molecules described herein (e.g., siRNA, dsRNA, ASO, miRNA, shRNA, or other inhibitory nucleic acid molecules capable of reducing expression of a target gene) the inhibitory nucleic acid molecule contains at least some sequence complementarity to the nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 15 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 16 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 17 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 18 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 19 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 20 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 21 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 22 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 23 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 24 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 25 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 26 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 27 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 28 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 29 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule comprises or consists of sequence complementary to at least 30 contiguous nucleotides of a nucleotide sequence encoding EPAC1 or EPAC2.

[0093] In some embodiments, the inhibitory nucleic acid is an siRNA targeting a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid is a dsRNA targeting a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid is an ASO targeting a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid is an miRNA targeting a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid is an shRNA targeting a nucleotide sequence encoding EPAC1 or EPAC2. In some embodiments, the inhibitory nucleic acid molecule includes one or more locked nucleic acids or is made entirely of locked nucleic acids. Each of these modalities is described further below. small interfering RNA (siRNA) siRNAs of the disclosure are single-stranded (ss) or double-stranded (ds) nucleic acid molecules made of DNA, RNA, or both DNA and RNA (e.g., a chimeric) that are complementary to a target gene of interest and prevent translation of the target’s mRNA into a protein. Once an siRNA molecule enters a cell, it is incorporated into an RNA-induced silencing complex (RISC). Upon siRNA hybridization to a target mRNA, the RISC complex will cleave the target mRNA, thereby inactivating the target mRNA, resulting in reduced mRNA and protein levels of the target.

[0094] In some embodiments, siRNAs of the disclosure may include a nucleotide sequence of about 10 to about 30 nucleotides in length (e.g., 9, about 10, about 11 , about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21 , about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, or 31 nucleotides in length).

[0095] In some embodiments, siRNAs of the disclosure may include a nucleotide sequence of 10 to 30 nucleotides in length (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length).

[0096] In some embodiments, the siRNA molecule targets an EPAC mRNA sequence including the sequence 5'GCAACAAGAGGCAGCAGAUUU ‘3 (SEQ ID NO:18), 5' ACCUCAAGGAGCAGAAGAAUU ‘3 (SEQ ID NO: 19), 5'CUGCAGUACUGGGUGGCCAUU ‘3 (SEQ ID NO:20), 5'ACUUAAAGAACAUGACCAAUU ‘3 (SEQ ID NO: 21 ), or 5'CUAAUAAGAACCAUCAGGAUU ‘3 (SEQ ID NO: 22). In some embodiments, the siRNA molecule includes the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22. In some embodiments, the siRNA molecule includes a sequence complementary to the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22.

[0097] It is within the scope of the disclosure that any length, known and previously unknown in the art, may be employed for the current invention.

[0098] In some embodiments, the siRNA contains an antisense strand. In some embodiments, lengths for an antisense strand of the siRNA molecules of the present disclosure is between 10 and 30 nucleotides (e.g., 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30 nucleotides), 15 and 25 nucleotides (e.g., 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or 25 nucleotides), or 18 and 23 nucleotides

[0099] (e.g., 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, or 23 nucleotides). In some embodiments, the antisense strand is 17 nucleotides. In some embodiments, the antisense strand is 18 nucleotides. In some embodiments, the antisense strand is 19 nucleotides. In some embodiments, the antisense strand is 20 nucleotides. In some embodiments, the antisense strand is 21 nucleotides. In some embodiments, the antisense strand is 22 nucleotides. In some embodiments, the antisense strand is 23 nucleotides. In some embodiments, the antisense strand is 24 nucleotides. In some embodiments, the antisense strand is 25 nucleotides. In some embodiments, the antisense strand is 26 nucleotides. In some embodiments, the antisense strand is 27 nucleotides. In some embodiments, the antisense strand is 28 nucleotides. In some embodiments, the antisense strand is 29 nucleotides. In some embodiments, the antisense strand is 30 nucleotides.

[0100] In some embodiments, the siRNA contains a sense strand. In some embodiments, the sense strand of the siRNA molecules of the present disclosure is between 10 and 30 nucleotides (e.g., 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30 nucleotides), or 14 and 23 nucleotides (e.g., 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, or 23 nucleotides). In some embodiments, the sense strand is 15 nucleotides. In some embodiments, the sense strand is 16 nucleotides. In some embodiments, the sense strand is 17 nucleotides. In some embodiments, the sense strand is 18 nucleotides. In some embodiments, the sense strand is 19 nucleotides. In some embodiments, the sense strand is 20 nucleotides. In some embodiments, the sense strand is 21 nucleotides. In some embodiments, the sense strand is 22 nucleotides. In some embodiments, the sense strand is 23 nucleotides. In some embodiments, the sense strand is 24 nucleotides. In some embodiments, the sense strand is 25 nucleotides. In some embodiments, the sense strand is 26 nucleotides. In some embodiments, the sense strand is 27 nucleotides. In some embodiments, the sense strand is 28 nucleotides. In some embodiments, the sense strand is 29 nucleotides. In some embodiments, the sense strand is 30 nucleotides. In some embodiments, the sense and antisense strands of an siRNA molecule of the disclosure are completely complementary. In some embodiments, the sense and antisense strands of an siRNA molecule of the disclosure are completely complementary to the extent that their lengths overlap with one another. Depending on the sequence of the first and second strand, complementarity need not be complete or perfect, which means that the first and second strand are not 100% base-paired due to mismatches. One or more mismatches may be present within the ds siRNA without impacting the siRNA’s ability to reduced expression of a target gene of interest.

[0101] The nucleotide sequence of an siRNA of the disclosure may contain sufficient complementary to a portion of a target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2) such that the siRNA can hybridize with the target gene of interest. In some embodiments, the siRNA is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2), or a portion thereof. In some embodiments, the siRNA is complementary to the target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2), or a portion thereof.

[0102] In some embodiments, the nucleotide sequence of the siRNA may contain sufficient complementary to an exon sequence of a target gene of interest (e.g., an exon of a gene encoding EPAC1 or EPAC2). In some embodiments, the nucleotide sequence of the siRNA may contain sufficient complementary to an intron sequence of a target gene of interest (e.g., an intron of a gene encoding EPAC1 or EPAC2). In some embodiments, the siRNA of the disclosure may contain sufficient complementarity to a pre-mRNA transcript or an mRNA transcript encoding EPAC1 or EPAC2.

[0103] In some embodiments, the siRNAs described herein have 0-7 nucleotide 3’ overhangs or 0-4 nucleotide 5’ overhangs. In some embodiments, the siRNA molecule has a single uracil (e.g., U) overhang at each 3’ end of the siRNA. In some embodiments, the siRNA molecule has a double uracil (e.g., UU) overhang at each 3’ end of the siRNA. In some embodiments, the siRNA molecule has a single thymine (e.g., T) overhang at each 3’ end of the siRNA. In some embodiments, the siRNA molecule has a double thymine (e.g., TT) overhang at each 3’ end of the siRNA. In some embodiments, the siRNA molecule has a cytosine and thymine (e.g., CT) overhang at each 3’ end of the siRNA.

[0104] Different siRNAs can be combined for decreasing the protein expression of a target gene of interest (e.g., a nucleotide sequence encoding EPAC1 or EPAC2). A combination of two siRNAs may be used in a method of the invention, such as two different siRNAs, three different siRNAs, four different siRNAs, or five different siRNAs targeting the same gene of interest (e.g., a gene encoding EPAC1 or EPAC2, or variants thereof).

[0105] Double-stranded RNA (dsRNA) dsRNAs of the disclosure are ds nucleic acid molecules made of DNA, RNA, or both DNA and RNA (e.g., a chimeric) that are complementary to a target gene of interest and prevent translation of the target’s mRNA into a protein. Typically, dsRNAs are longer than an siRNA and are processed within a cell to form an siRNA molecule. The siRNA is then incorporated into an RNA-induced silencing complex (RISC). Upon siRNA hybridization to a target mRNA, the RISC complex will cleave the target mRNA, thereby inactivating the target mRNA, resulting in reduced mRNA and protein levels of the target.

[0106] In some embodiments, dsRNAs of the disclosure may include a sense strand and an antisense strand, each containing a nucleotide sequence of about 25 to about 5000 nucleotides in length, or longer (e.g., 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 105, about 110, about 115, about 120, about 125, about 130, about 135, about 140, about 145, about 150, about 155, about 160, about

[0107] 165, about 170, about 175, about 180, about 185, about 190, about 195, about 200, about 210, about

[0108] 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, about 300, about

[0109] 310, about 320, about 330, about 340, about 350, about 360, about 370, about 380, about 380, about

[0110] 400, about 425, about 450, about 475, about 500, about 525, about 550, about 575, about 600, about

[0111] 625, about 650, about 675, about 700, about 725, about 750, about 775, about 800, about 825, about

[0112] 850, about 875, about 900, about 925, about 950, about 975, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 1600, about 1700, about 1800, about 1900, about 2000, about

[0113] 2200, about 2400, about 2600, about 2800, about 3000, about 3250, about 3500, about 3750, about

[0114] 4000, about 4250, about 4500, about 4750, about 5000, about 6000, about 7000, about 8000, about

[0115] 9000, or about 10000 nucleotides in length).

[0116] In some embodiments, dsRNAs of the disclosure may include a sense strand and an antisense strand, each containing a nucleotide sequence of 25 to 5000 nucleotides in length, or longer (e.g., 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150,

[0117] 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310,

[0118] 320, 330, 340, 350, 360, 370, 380, 380, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700,

[0119] 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700,

[0120] 1800, 1900, 2000, 2200, 2400, 2600, 2800, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4750, 5000, 6000, 7000, 8000, 9000 or 10000 nucleotides in length).

[0121] It is within the scope of the disclosure that any length, known and previously unknown in the art, may be employed for the current invention.

[0122] In some embodiments, the sense and antisense strands of an dsRNA molecule of the disclosure are completely complementary. In some embodiments, the sense and antisense strands of an dsRNA molecule of the disclosure are completely complementary to the extent that their lengths overlap with one another. Depending on the sequence of the first and second strand, complementarity need not be complete or perfect, which means that the first and second strand are not 100% base-paired due to mismatches. One or more mismatches may be present within the ds dsRNA without impacting the dsRNA’s ability to reduced expression of a target gene of interest.

[0123] The nucleotide sequence of an dsRNA of the disclosure may contain sufficient complementary to a portion of a target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2) such that the dsRNA can hybridize with the target gene of interest. In some embodiments, the dsRNA is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2), or a portion thereof. In some embodiments, the dsRNA is complementary to the target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2), or a portion thereof.

[0124] In some embodiments, the nucleotide sequence of the dsRNA may contain sufficient complementary to an exon sequence of a target gene of interest (e.g., an exon of a gene encoding EPAC1 or EPAC2). In some embodiments, the nucleotide sequence of the dsRNA may contain sufficient complementary to an intron sequence of a target gene of interest (e.g., an intron of a gene encoding EPAC1 or EPAC2). In some embodiments, the dsRNA of the disclosure may contain sufficient complementarity to a pre-mRNA transcript or an mRNA transcript encoding EPAC1 or EPAC2.

[0125] Different dsRNAs can be combined for decreasing the protein expression of a target gene of interest (e.g., a gene encoding EPAC1 or EPAC2). A combination of two dsRNAs may be used in a method of the invention, such as two different dsRNAs, three different dsRNAs, four different dsRNAs, or five different dsRNAs targeting the same gene of interest (e.g., a gene encoding EPAC1 or EPAC2, or variants thereof).

[0126] Anti-Sense Oligonucleotide (ASO)

[0127] ASOs of the disclosure are single (ss) nucleic acid molecules made of DNA, RNA, or both DNA and RNA (e.g., a chimeric) that are complementary to a target gene of interest and prevent translation of the target’s mRNA into a protein. Upon hybridization to a target mRNA, RNase H will degrade the mRNA by hydrolyzation, resulting in reduced mRNA and protein levels of the target.

[0128] In some embodiments, ASOs of the disclosure may include a nucleotide sequence of 12 to 50 nucleotides in length (e.g., 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 ,

[0129] 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, or 51 nucleotides in length).

[0130] In some embodiments, ASOs of the disclosure may include a nucleotide sequence of 12 to 50 nucleotides in length (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32,

[0131] 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length).

[0132] It is within the scope of the disclosure that any length, known and previously unknown in the art, may be employed for the current invention.

[0133] The nucleotide sequence of the ASO may contain sufficient complementary to a portion of a target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2) such that the ASO can hybridize with the target gene of interest. In some embodiments, the ASO is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2), or a portion thereof. In some embodiments, the ASO is complementary to the target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2), or a portion thereof.

[0134] In some embodiments, the nucleotide sequence of the ASO may contain sufficient complementary to an exon sequence of a target gene of interest (e.g., an exon of a gene encoding EPAC1 or EPAC2). In some embodiments, the nucleotide sequence of the ASO may contain sufficient complementary to an intron sequence of a target gene of interest (e.g., an intron of a gene encoding EPAC1 or EPAC2). In some embodiments, the ASO of the disclosure may contain sufficient complementarity to a pre-mRNA transcript or an mRNA transcript encoding EPAC1 or EPAC2.

[0135] Different ASOs can be combined for decreasing the protein expression of a target gene of interest (e.g., a gene encoding EPAC1 or EPAC2). A combination of two ASOs may be used in a method of the invention, such as two different ASOs, different three ASOs, four different ASOs, or five different ASOs targeting the same gene of interest (e.g., a gene encoding EPAC1 or EPAC2, or variants thereof) micro RNA (miRNA) miRNAs of the disclosure are single stranded (ss) nucleic acid molecules made of DNA, RNA, or both DNA and RNA (e.g., a chimeric) that are complementary to a target gene of interest and prevent translation of the target’s mRNA into a protein. Once a miRNA molecule enters a cell, it is incorporated into an RNA-induced silencing complex (RISC). Upon miRNA hybridization to a target mRNA, the RISC complex will cleave the target mRNA, thereby inactivating the target mRNA, resulting in reduced mRNA and protein levels of the target.

[0136] In some embodiments, miRNAs of the disclosure may include a nucleotide sequence of 6 to 30 nucleotides in length (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26,

[0137] 27, 28, 29, 30, or 31 nucleotides in length).

[0138] In some embodiments, miRNAs of the disclosure may include a nucleotide sequence of 6 to 30 nucleotides in length (e.g., 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27,

[0139] 28, 29, or 30 nucleotides in length).

[0140] The nucleotide sequence of the miRNA may contain sufficient complementary to a portion of a target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2) such that the miRNA can hybridize with the target gene of interest. In some embodiments, the miRNA is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2), or a portion thereof. In some embodiments, the miRNA is complementary to the target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2), or a portion thereof.

[0141] In some embodiments, the nucleotide sequence of the miRNA may contain sufficient complementary to an exon sequence of a target gene of interest (e.g., an exon of a gene encoding EPAC1 or EPAC2). In some embodiments, the nucleotide sequence of the miRNA may contain sufficient complementary to an intron sequence of a target gene of interest (e.g., an intron of a gene encoding EPAC1 or EPAC2). In some embodiments, the miRNA of the disclosure may contain sufficient complementarity to a pre-mRNA transcript or an mRNA transcript encoding EPAC1 or EPAC2.

[0142] Different miRNAs can be combined for decreasing the protein expression of a target gene of interest (e.g., a gene encoding EPAC1 or EPAC2). A combination of two or more miRNAs may be used in a method of the invention, such as two different miRNAs, three different miRNAs, four different miRNAs, or five different miRNAs targeting the same gene of interest (e.g., a gene encoding EPAC1 or EPAC2, or variants thereof). short hairpin RNA (shRNA) shRNAs of the disclosure are ss or ds nucleic acid molecules made of DNA, RNA, or both DNA and RNA (e.g., a chimeric) that are complementary to a target gene of interest and prevent translation of the target’s mRNA into a protein. Once a shRNA molecule enters a cell, it is incorporated into an RNA- induced silencing complex (RISC). Upon shRNA hybridization to a target mRNA, the RISC complex will cleave the target mRNA, thereby inactivating the target mRNA, resulting in reduced mRNA and protein levels of the target.

[0143] In some embodiments, shRNAs of the disclosure may include a nucleotide sequence of 60 to 100 nucleotides in length (e.g., 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, or 110 nucleotides in length).

[0144] In some embodiments, shRNAs of the disclosure may include a nucleotide sequence of 60 to 100 nucleotides in length (e.g., 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides in length). shRNAs of the disclosure contain a variable hairpin loop structure and a stem sequence. In some embodiments the stem sequence may be 10 to 50 nucleotides in length (e.g., 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length). In some embodiments, the hairpin size is between 4 to 50 nucleotides in length, although the loop size may be larger without significantly affecting silencing activity. shRNA molecules of the disclosure may contain mismatches, for example G-U mismatches between two strands of the shRNA stem without decreasing potency. In some embodiments, shRNAs are designed to include one or several G-U pairings in the hairpin stem to stabilize hairpins during propagation in bacteria, for example.

[0145] The nucleotide sequence of the shRNA may contain sufficient complementary to a portion of a target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2) such that the shRNA can hybridize with the target gene of interest. In some embodiments, the shRNA is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2), or a portion thereof. In some embodiments, the shRNA is complementary to the target gene of interest (e.g., an mRNA encoding EPAC1 or EPAC2), or a portion thereof.

[0146] In some embodiments, the nucleotide sequence of the shRNA may contain sufficient complementary to an exon sequence of a target gene of interest (e.g., an exon of a gene encoding EPAC1 or EPAC2). In some embodiments, the nucleotide sequence of the shRNA may contain sufficient complementary to an intron sequence of a target gene of interest (e.g., an intron of a gene encoding EPAC1 or EPAC2). In some embodiments, the shRNA of the disclosure may contain sufficient complementarity to a pre-mRNA transcript or an mRNA transcript encoding EPAC1 or EPAC2.

[0147] Different shRNAs can be combined for decreasing the protein expression of a target gene of interest (e.g., a gene encoding EPAC1 or EPAC2). A combination of two or more shRNAs may be used in a method of the invention, such as two different shRNAs, three different shRNAs, four different shRNAs, or five different shRNAs targeting the same gene of interest (e.g., a gene encoding EPAC1 or EPAC2, or variants thereof).

[0148] Modifications to the Inhibitory Nucleic Acid Molecules

[0149] It is contemplated that any of the inhibitory nucleic acid molecules disclosed herein may be used in the methods disclosed herein in an unmodified or in a modified form. Unmodified inhibitory nucleic acid molecules contain nucleobases that include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleic acid molecules are described in more detail below.

[0150] Modifications may be achieved by systematically adding or removing linked nucleosides to generate longer or shorter sequences.

[0151] Modifications may be achieved by incorporating, for example, one or more alternative nucleosides, alternative 2’ sugar moieties, and / or alternative internucleoside linkages, which are described further below. Typically, these types of modifications are introduced to optimize the molecule’s efficacy or biophysical properties (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, reduce immunogenicity, and / or targeting to a particular location or cell type). Modification may further be achieved by covalently or non-covalently conjugating a moiety (e.g., a targeting moiety, a hydrophobic moiety, a cell penetrating peptide, or a polymer) to the 5’ end and / or 3’ end of the inhibitory nucleic acid molecule, as described in more detail below.

[0152] Nucleoside Modifications

[0153] Modification of the inhibitory nucleic acid molecules described herein include one or more of the following nucleoside modifications: 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalky I, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5- trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F- adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and / or 3-deazaguanine and 3-deazaadenine. The inhibitory nucleic acid molecules may also include nucleobases in which the purine or pyrimidine base is replaced with other heterocycles, for example 7- deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and / or 2-pyridone. Further modification of the inhibitory nucleic acid molecules described herein may include nucleobases disclosed in US 3,687,808; Kroschwitz, J. I., ed. The Concise Encyclopedia of Polymer Science and Engineering, New York, John Wiley & Sons, 1990, pp. 858-859; Englisch et al., Angewandte Chemie, International Edition 30:613, 1991 ; and Sanghvi, Y.S., Chapter 16, Antisense Research and Applications, CRC Press, Gait, M.J. ed., 1993, pp. 289-302.

[0154] An RNA (e.g., and siRNA) sequence may also be modified by the insertion of a 2’-deoxy- ribonuclotide into the RNA sequence.

[0155] Locked nucleic acids

[0156] The inhibitory nucleic acid molecules described herein (e.g., an siRNA molecule) may contain one or more locked nucleic acids or can be made entirely of locked nucleic acids. A locked nucleic acid includes a covalent bond between C2' and C4' of the ribose through the oxygen atom. Locked nucleic acids are disclosed, for example, in Koshkin et al. (Biochemistry 45(23): S. 7447-7455, 2006) and Obika et al. (Tetrahedron Letters 38(5): S. 8735-8738, 1997).

[0157] Sugar Modifications

[0158] Modifications of the inhibitory nucleic acid molecules described herein may also include one or more of the following 2’ sugar modifications: 2’-O-methyl (2’-O-Me), 2'-methoxyethoxy (2'-O- CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE), 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2 -DMAOE, and / or 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylamino-ethoxy-ethyl or 2 -DMAEOE), i.e., 2'-O-CH2OCH2N(CH3)2. Other possible 2'-modifications that can modify the inhibitory nucleic acid molecules described herein include all possible orientations of OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O- alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or 02 to C10 alkenyl and alkynyl. Other potential sugar substituent groups include, e.g., aminopropoxy (- OCH2CH2CH2NH2), allyl (-CH2-CH=CH2), -O-allyl (-O-CH2-CH=CH2) and fluoro (F). 2'-sugar substituent groups may be in the arabino (up) position or ribo (down) position. In some embodiments, the 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the interfering RNA molecule, particularly the 3' position of the sugar on the 3' terminal nucleoside or in 2 -5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.

[0159] Internucleoside Linkage Modifications

[0160] Modifications of the inhibitory nucleic acid molecules described herein may include one or more of the following internucleoside modifications: phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'- alkylene phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage.

[0161] Conjugates

[0162] Any of the inhibitory nucleic acid molecules described herein may be modified via the addition of an auxiliary moiety, e.g., a cell penetrating peptide (CPP), a polymer, a hydrophobic moiety, or a targeting moiety. The auxiliary moiety may be present as a 5’ terminal modification (e.g., covalently bonded to a 5’- terminal nucleoside), a 3’ terminal modification (e.g., covalently bonded to a 3’-terminal nucleoside), or an internucleoside linkage (e.g., covalently bonded to phosphate or phosphorothioate in an internucleoside linkage).

[0163] CPPs are known in the art (e.g., TAT or Arg8) (Snyder and Dowdy, 2005, Expert Opin. Drug Deliv. 2, 43-51 ). Specific examples of CPPs are provided in WO2011157713, which is incorporated herein by reference in its entirety.

[0164] Inhibitory nucleic acid molecules of the disclosure may include covalently attached neutral polymer-based auxiliary moieties. Neutral polymers include poly(C1-6 alkylene oxide), e.g., poly(ethylene glycol) and polypropylene glycol) and copolymers thereof, e.g., di- and triblock copolymers.

[0165] An inhibitory nucleic acid molecule containing a hydrophobic moiety may exhibit superior cellular uptake, as compared to an inhibitory nucleic acid molecule lacking the hydrophobic moiety. A hydrophobic moiety is a monovalent group (e.g., a bile acid (e.g., cholic acid, taurocholic acid, deoxycholic acid, oleyl lithocholic acid, or oleoyl cholenic acid), glycolipid, phospholipid, sphingolipid, isoprenoid, vitamin, saturated fatty acid, unsaturated fatty acid, fatty acid ester, triglyceride, pyrene, porphyrine, texaphyrine, adamantine, acridine, biotin, coumarin, fluorescein, rhodamine, Texas-Red, digoxygenin, dimethoxytrityl, t-butydimethylsilyl, t-buty Idipheny Isilyl, cyanine dye (e.g., Cy3 or Cy5), Hoechst 33258 dye, psoralen, or ibuprofen) covalently linked to the nucleic acid backbone (e.g., 5’- terminus) of the inhibitory nucleic acid molecule.

[0166] A targeting moiety is selected based on its ability to target oligonucleotides of the invention to a desired or selected cell population that expresses the corresponding binding partner (e.g., either the corresponding receptor or ligand) for the selected targeting moiety. For example, an oligonucleotide of the invention could be targeted to hepatocytes expressing asialoglycoprotein receptor (ASGP-R) by selecting a targeting moiety containing N-acetylgalactosamine (GalNAc).

[0167] A targeting moiety may include one or more ligands (e.g., 1 to 9 ligands, 1 to 6 ligands, 1 to 3 ligands, 3 ligands, or 1 ligand). The ligand may target a cell expressing asialoglycoprotein receptor (ASGP-R), IgA receptor, HDL receptor, LDL receptor, or transferrin receptor. Non-limiting examples of the ligands include N-acetylgalactosamine (e.g., a triantennary N-acetylgalactosamine), glycyrrhetinic acid, glycyrrhizin, lactobionic acid, lactoferrin, IgA, or a bile acid (e.g., lithocholyltaurine or taurocholic acid).

[0168] The ligand may be a small molecule, e.g., a small molecule targeting a cell expressing asialoglycoprotein receptor (ASGP-R). A non-limiting example of a small molecule targeting an asialoglycoprotein receptor is N-acetylgalactosamine. Alternatively, the ligand can be an antibody or an antigen-binding fragment or an engineered derivative thereof (e.g., Fcab or a fusion protein (e.g., scFv)).

[0169] Preparation of Inhibitory Nucleic Acid Molecules

[0170] Inhibitory nucleic acid molecules of the disclosure may be prepared using techniques and methods known in the art for the oligonucleotide synthesis. For example, inhibitory nucleic acid molecules of the disclosure may be prepared using a phosphoramidite-based synthesis cycle. This synthesis cycle includes the steps of (1 ) de-blocking a 5’-protected nucleotide to produce a 5’-deblocked nucleotide, (2) coupling the 5’-deblocked nucleotide with a 5’-protected nucleoside phosphoramidite to produce nucleosides linked through a phosphite, (3) repeating steps (1) and (2) one or more times as needed, (4) capping the 5’-terminus, and (5) oxidation or sulfurization of internucleoside phosphites. The reagents and reaction conditions useful for the oligonucleotide synthesis are known in the art.

[0171] The inhibitory nucleic acid molecules disclosed herein may be linked to solid support as a result of solid-phase synthesis. Cleavable solid supports that may be used are known in the art. Non-limiting examples of the solid support include, e.g., controlled pore glass or macroporous polystyrene bonded to a strand through a cleavable linker (e.g., succinate-based linker) known in the art (e.g., UnyLinkerTM). A nucleic acid linked to solid support may be removed from the solid support by cleaving the linker connecting a nucleic acid and solid support.

[0172] Compositions

[0173] The inhibitory nucleic acid molecules and small molecules described herein may be formulated into various compositions (e.g., a pharmaceutical composition) for administration to a subject in a biologically compatible form suitable for administration in vivo. For example, the inhibitory nucleic acid molecules described herein (e.g., the siRNA molecules of SEQ ID NOs: 1-10, or variants thereof) may be administered in a suitable diluent, carrier, or excipient, and may further contain a preservative, e.g., to prevent the growth of microorganisms. Conventional procedures and ingredients for the selection and preparation of suitable compositions are described, for example, in Remington, J.P. The Science and Practice of Pharmacy, Easton, PA. Mack Publishers, 2012, 22nded. And in The United States Pharmacopeial Convention, The National Formulary, United States Pharmacopeial, 2015, USP 38 NF 33).

[0174] Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or other primates and mammals.

[0175] Combination treatment with an inhibitor of adenylate cyclase type 9 (AC9)

[0176] In some embodiments, the inhibitor of EPAC1 and or EPAC2 described herein is administered in combination with an inhibitor of AC9. In some embodiments the inhibitor of AC9 is an inhibitory nucleic acid molecule, such as an anti-sense oligonucleotide (ASO), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a double-stranded RNA (dsRNA), or a microRNA (miRNA). In some embodiments, the inhibitory nucleic acid molecule includes one or more locked nucleic acids or is made entirely of locked nucleic acids. Exemplary siRNA molecules targeting AC9 are shown in Table 1.

[0177] TABLE 1. EXEMPLARY siRNA SEQUENCES

[0178] A = adenine; C = cytosine; G = guanine; T = thymine; U = uracil. Note: the RNA sequence of SEQ ID NO: 1 contains thymine nucleotides at positions 20-21 , when reading from 5’ to 3’; the RNA sequence of SEQ ID NO: 2 contains a thymine nucleotide at position 21, when reading from 5’ to 3’.

[0179] The effect of inhibition of AC9 an LDLr expression is described in PCT international application no. PCT / CA2023 / 051037, published as WO 2024 / 026565, which is hereby incorporated by reference in its entirety.

[0180] In some embodiments, the siRNA targeting AC9 may target a nucleotide sequence of any one of SEQ ID NOs: 11-15 (e.g., see Table 2), or a complementary sequence thereof, or variant thereof with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto. TABLE 2. TARGET SEQUENCES

[0181] In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 15 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 16 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 17 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 18 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 19 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 20 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 21 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 22 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 23 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 24 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 25 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 26 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 27 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 28 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 29 contiguous nucleotides set forth within SEQ ID NO: 16. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 30 contiguous nucleotides set forth within SEQ ID NO: 16. The nucleotide sequence of SEQ ID NO: 16 is set forth in Table 3.

[0182] In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 15 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 17 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 17 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 18 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 19 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 20 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 21 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 22 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 23 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 24 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 25 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 26 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 27 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 28 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 29 contiguous nucleotides set forth within SEQ ID NO: 17. In some embodiments, the AC9 targeting siRNA comprises sequence complementary to at least 30 contiguous nucleotides set forth within SEQ ID NO: 17. The nucleotide sequence of SEQ ID NO: 17 is set forth in Table 3.

[0183] TABLE 3. ADENYLATE CYCLASE 9 SEQUENCE

[0184] Additional therapeutic agent

[0185] T reatments using the inhibitory nucleic acids described herein may further include use of an additional therapeutic agent (e.g., a nucleic acid molecule to be expressed within a cell, a polypeptide, or a drug). For example, additional therapeutic agent may be a blood pressure medication, an antiinflammatory medication (e.g., a steroid or colchicine), or immunosuppressive agent. In some embodiments, the second therapeutic agent is a statin. Non-limiting examples of additional therapeutic agents are a statin (e.g., atorvastatin), a proprotein convertase subtilisin / kexin type 9 (PCSK9) inhibitor (e.g., an siRNA or monoclonal antibody targeting PCSK9), an ATP Citrate Lyase (ACL) inhibitor (e.g., bempedoic acid), a lipoprotein(a) (Lp(a)) inhibitor (e.g., an siRNA targeting Lp(a)), an angiopoietin-like 3 (ANGPTL3) inhibitor (e.g., an siRNA tareting ANGPTL3), a cholesterylester transfer protein (CETP) inhibitor, a microsomal triglyceride transfer protein (MTP) inhibitor (e.g., lomitapide), an apolipoprotein B (ApoB) inhibitor (e.g., mipomersen), a bile acid binding resin, and an anti-inflammatory medication (e.g., colchicine). In some embodiments, the additional therapeutic agent (e.g., statin) is administered in combination with an inhibitory nucleic acid molecule of the disclosure. In some embodiments, the subject is orally administered a statin. In some embodiments, the subject is administered a statin daily.

[0186] Methods of Treatment

[0187] The disclosure provides methods of decreasing LDL in the serum of a subject. In some embodiments, the method contains the steps of administering to a subject an inhibitory nucleic acid molecule described herein, wherein the inhibitory nucleic acid molecule targets EPAC1 and / or EPAC2. In some embodiments, the method contains the steps of administering to a subject a siRNA molecule described herein, wherein the siRNA molecule targets EPAC1 or EPAC2. In some embodiments, the method contains the steps of administering to a subject a dsRNA molecule described herein, wherein the dsRNA molecule targets EPAC1 or EPAC2. In some embodiments, the method contains the steps of administering to a subject an ASO molecule described herein, wherein the ASO molecule targets EPAC1 or EPAC2. In some embodiments, the method contains the steps of administering to a subject a miRNA molecule described herein, wherein the miRNA molecule targets EPAC1 or EPAC2. In some embodiments, the method contains the steps of administering to a subject a shRNA molecule described herein, wherein the shRNA molecule EPAC1 or EPAC2.

[0188] The disclosure provides methods of increasing LDLr in a subject. In some embodiments, the method contains the steps of administering to a subject an inhibitory nucleic acid molecule described herein, wherein the inhibitory nucleic acid molecule targets EPAC1 or EPAC2. In some embodiments, the method contains the steps of administering to a subject a siRNA molecule described herein, wherein the siRNA molecule targets EPAC1 or EPAC2. In some embodiments, the method contains the steps of administering to a subject a dsRNA molecule described herein, wherein the dsRNA molecule targets EPAC1 or EPAC2. In some embodiments, the method contains the steps of administering to a subject an ASO molecule described herein, wherein the ASO molecule targets EPAC1 or EPAC2. In some embodiments, the method contains the steps of administering to a subject a miRNA molecule described herein, wherein the miRNA molecule targets EPAC1 or EPAC2. In some embodiments, the method contains the steps of administering to a subject a shRNA molecule described herein, wherein the shRNA molecule targets EPAC1 or EPAC2.

[0189] Any of the methods can administer a composition (e.g., a pharmaceutical composition) or delivery vehicle (e.g., a vector or nanoparticle) that contains or expresses any of the inhibitory nucleic acid molecules described herein (e.g., siRNA, dsRNA, ASO, miRNA, or shRNA).

[0190] Delivery Vehicle

[0191] The inhibitory nucleic acid molecule of the disclosure may be administered as a nude nucleic acid molecule or may be delivered to a subject (e.g., a human) using any suitable delivery vehicle. For example, a delivery vehicle for any of the inhibitory nucleic acid molecules described herein may be a vector, plasmid, or nano particle, (e.g., a micelle, a liposome, an exosome, or a lipid nano particle (LNP)).

[0192] The inhibitory nucleic acid molecule of the disclosure and compositions thereof may be delivered to a subject via a vector (e.g., a viral vector). Any suitable viral vector system can be used including, e.g., adenoviruses (e.g., Ad2, Ad5, Ad9, Ad15, Ad17, Ad19, Ad20, Ad22, Ad26, Ad27, Ad28, Ad30, or Ad39), rhabdoviruses (e.g., vesicular stomatitis virus), retroviruses, adeno-associated vectors, poxviruses, herpes viral vectors, and Sindbis viral vectors.

[0193] The inhibitory nucleic acid molecule of the disclosure and compositions thereof may be delivered to a subject via liposomes. Liposomes are artificially-prepared vesicles which may primarily be composed of a lipid bilayer and may be used as a delivery vehicle for the administration of the inhibitory nucleic acids described herein, and compositions thereof. Liposomes can be of different sizes such as, but not limited to, a multilamellar vesicle (MLV) which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV) which may be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV) which may be between 50 and 500 nm in diameter. Liposome design may include, but is not limited to, opsonins or ligands in order to improve the attachment of liposomes to unhealthy tissue or to activate events such as, but not limited to, endocytosis. Liposomes may contain a low or a high pH in order to improve the delivery of the pharmaceutical composition.

[0194] The inhibitory nucleic acid molecule of the disclosure and compositions thereof may be delivered to a subject via exosomes. Exosomes produced from cells can be collected from cell culture medium by any suitable method. Typically, a preparation of exosomes can be prepared from cell culture or tissue supernatant by centrifugation, filtration or combinations of these methods. For example, using standard methods, exosomes can be prepared by differential centrifugation, that is low speed (<20000 g) centrifugation to pellet larger particles followed by high speed (>100000 g) centrifugation to pellet exosomes, size filtration with appropriate filters (for example, 0.22 micrometer filter), gradient ultracentrifugation (for example, with sucrose gradient) or a combination of these methods.

[0195] The inhibitory nucleic acid molecules of the disclosure, and compositions thereof, may be delivered to a subject via LNPs. For example, the inhibitory nucleic acid molecules (e.g., siRNA, dsRNA, ASO, miRNA, or shRNA) may be formulated in a lipid nanoparticle such as those described in International Publication No. W02012170930, herein incorporated by reference in its entirety. As a nonlimiting example, LNP formulations may contain cationic lipids, distearoylphosphatidylcholine (DSPC), cholesterol, polyethylene glycol (PEG), R-3-[(co-methoxy poly( ethylene glycol)2000)carbamoyl)]-1 ,2- dimyristyloxl-propyl-3-amine (PEG-c-DOMG), distearoyl-rac-glycerol (DSG) and / or dimethylaminobutanoate (DMA). As a non-limiting example, 1-5% of the lipid molar ratio of PEG-c- DOMG as compared to the cationic lipid, DSPC and cholesterol. In another embodiment the PEG-c- DOMG may be replaced with a PEG lipid such as, but not limited to, PEG-DSG (1 ,2-Distearoyl-sn- glycerol, methoxypoly ethylene glycol) or PEG-DPG ( 1 ,2-Dipalmitoy l-sn-glycerol, methoxypolyethylene glycol). The cationic lipid may be selected from any lipid known in the art such as, but not limited to, (6Z,9Z,28Z,31Z)-heptatriacont-6,9,28,31-tetraene-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 1 ,2-dilinoleyloxy-n,n-dimethyl-3-aminopropane (DLin-DMA), C 12-200, and N,N-dimethyl-2,2-di-(9Z,12Z)- 9,12-octadecadien-1-yl-1,3-dioxolane-4-ethanamine (DLin-KC2-DMA).

[0196] Exemplary commercial reagents useful for lipid-based delivery of inhibitory nucleic acid molecules including, but not limited to, TransIT-TKO™ (Mirus, Catalog No. MIR 2150), Transmessenger™ (Qiagen, Catalog No. 301525), Oligofectamine™ and Lipofectamine™ (Invitrogen, Catalog No. MIR 12252-011 and Catalog No. 13778-075), siPORT™ (Ambion, Catalog No. 1631 ), and DharmaFECT™ (Fisher Scientific, Catalog No. T-2001-01 ). Dosage

[0197] The actual dosage amount of a composition of the present disclosure administered to a subject can be determined by physical and physiological factors such as body weight, severity of condition, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. Depending upon the dosage (e.g., mg / kg) and the route of administration, the number of administrations of a preferred dosage and / or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject. Administration may occur any suitable number of times per day, and for as long as necessary. Subjects may be adult or pediatric humans, with or without comorbid diseases.

[0198] Routes of Administration

[0199] The compositions utilized in the methods described herein can be administered to a subject by any suitable route of administration. For example, a composition containing an inhibitory nucleic acid of the disclosure may be administered intramuscularly, intravenously, intradermally, percutaneously, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, peritoneally, subcutaneously, subconjunctivally, intravesicularlly, mucosally, intrapericardially, intraumbilically , intraocularly, orally, topically, locally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, by catheter, by lavage, in cremes, or in lipid compositions.

[0200] In some embodiments, the compositions utilized in the methods described herein can be administered to the subject intravenously. In some embodiments, the compositions utilized in the methods described herein can be administered to the subject subcutaneously.

[0201] EXAMPLES

[0202] The following examples are put forth so as to provide those of ordinary skill in the art with a description of how the compositions and methods described herein may be used and evaluated and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention.

[0203] Example 1. Impact of inhibition of EPAC pathways on LDLr protein expression in vitro

[0204] FIG. 1 shows the impact of inhibition of EPAC pathways on LDLr protein expression in human HepG2 hepatoma cells. CE3F4 (5,7-Dibromo-6-fluoro-3,4-dihydro-2-methyl-1(2 / - / )- quinolinecarboxaldehyde), an inhibitor of EPAC1, and ESI-05 (1 ,3,5-Trimethyl-2-[(4- methylphenyl)sulfonyl]benzene), an inhibitor of EPAC2, were used at concentrations of 0.25 pM, 0.5 pM, and 1.0 pM. At each inhibitor concentration, expression of LDLr increased significantly relative to the control (no inhibitor). The graph was generated from Western blot data of LDLr expression. The Mean ± Standard Deviation is shown (n=3 to 5; repeated measures ANOVA with uncorrected Fisher’s LSD). Example 2. Inhibition of expression or function of EPAC by siRNAs

[0205] Low-density lipoprotein receptor (LDLr) protein expression was analyzed in HepG2 cells treated for 24 hours with pharmacological inhibitors of EPAC1 (CE3F4), EPAC2 (ESI-05), or both (ESI-09) at concentrations ranging from 0.25 M to 1.0 M. LDLr protein expression was increased by more than 2- fold by CE3F4 (Fig. 2A), ESI-05 (Fig. 2B), and ESI-09 (Fig. 2C). These data show that inhibition of EPAC1 , EPAC2, or both increases LDLr protein expression in human hepatic HepG2 cells.

[0206] Validation of EPAC1 and EPAC2 siRNA was conducted in HepG2 cells over-expressing EPAC1 and EPAC2 using expression vectors in presence or absence of siRNA-mediated knockdown of EPAC1 or EPAC2 for 24 hours in HepG2 cells. Protein expression of EPAC1 and mRNA expression of EPAC2 was significantly reduced by 88% (p < 0.001) and 58% (p < 0.01) by EPAC1 and EPAC2 siRNA, respectively (Fig 3A and Fig. 3B).

[0207] LDLr protein expression was analyzed in HepG2 cells after siRNA-mediated knockdown (KD) of EPAC1, EPAC2, or both (Fig. 2). LDLr protein expression was significantly increased by EPAC1 (25%, p < 0.05), EPAC2 (2-fold, p < 0.001 ), and the combination of both (50%, p = 0.14) (Fig. 4).

[0208] The effect of EPAC siRNA on LDLr and PCSK9 mRNA expression was analyzed in HepG2 cells treated or untreated with 5 pM atorvastatin for 24 hours. Results showed that EPAC2 siRNA increased LDLr mRNA levels by 57% (p < 0.001 ), while EPAC1 siRNA had no significant effect (Fig. 5A). Atorvastatin significantly increased LDLr mRNA expression in cells transfected or not with EPAC siRNA (Fig. 5A). The combination of siEPAC2 with atorvastatin further increased LDLr mRNA expression by 41% (p < 0.01) compared to atorvastatin alone. In parallel, PCSK9 mRNA levels were reduced by 23% (p < 0.01 ) by EPAC1 siRNA, while EPAC2 siRNA had no significant effect (Fig. 5B). As with LDLr, atorvastatin significantly increased PCSK9 mRNA expression in cells transfected or not with EPAC siRNA (Fig. 5B). Compared to atorvastatin alone, EPAC1 siRNA slightly reduced PCSK9 mRNA expression by 19% (p < 0.05), while siEPAC2 siRNA increased PCSK9 mRNA levels by 30% (p < 0.05) (Fig. 5B).

[0209] The effect of EPAC siRNA on LDLr protein expression and PCSK9 secretion was analyzed in HepG2 cells treated or untreated with 5 pM atorvastatin for 24 hours. Results showed that EPAC1 and EPAC2 siRNA increased LDLr protein expression by 34% (p < 0.01 ) and 93% (p < 0.001), respectively (Fig. 6A). Atorvastatin significantly increased LDLr protein expression in cells transfected or untransfected with EPAC siRNA (Fig. 6A). The combination of siEPAC2 with atorvastatin further increased LDLr protein expression by 62% (p < 0.01 ) compared to atorvastatin alone (Fig. 6A). In parallel, PCSK9 secretion levels were increased by EPAC1 (26%, p = 0.1 ) and EPAC2 (76%, p = 0.07) siRNA (Fig. 6B). As with LDLr, atorvastatin significantly increased PCSK9 secretion in cells transfected or untransfected with EPAC siRNA (Fig. 6B). Compared to atorvastatin alone, EPAC1 and EPAC2 siRNA had no significant supplemental effect on PCSK9 secretion (Fig. 6B).

[0210] A quantification of3H-CE-LDL association (FIG. 7) showed a significant increase (18%, p < 0.01 ) of3H-CE-LDL in HepG2 cells treated with an siRNA-mediated KD of EPAC2.

[0211] The EPAC1 and EPAC2 siRNA sequences described herein (Table 4) were validated by evaluating their effect on LDLr protein expression. Results showed that LDLr expression was significantly increased by siEPAC1-1 (2.5-fold, p < 0.001 ), siEPAC1-2 (22%, p < 0.05), and siEPAC1-3 (69%, p < 0.01) (Fig. 8A). EPAC2-2 and EPAC2-4 also increased LDLr levels by 94% (p < 0.001 ) and 20% (p < 0.01 ), respectively (Fig. 8B). Table 4

[0212] Experimental protocols

[0213] Cell culture

[0214] HepG2 hepatocellular carcinoma cells were growth in Eagle’s minimum essential medium (EMEM). The medium was supplemented with 10% FBS, 100 units / ml penicillin, and 100 pg / ml streptomycin. Cells were cultured in 5% CO2 at 37°C and were harvested once a week with trypsin-EDTA. For experiments, cells were trypsinized, seeded, and cultured at least for 3 days prior to the assays. siRNA transfection

[0215] HepG2 cells were transfected with EPAC1 , EPAC2 or scramble siRNA in the presence of Lipofectamine RNAiMAX in Opti-MEM for 72 h unless otherwise stated.

[0216] PCSK9 secretion

[0217] The level of PCSK9 level in culture media was measured using the PCSK9 ELISA assay kit (Mbl International Corporation, Schaumburg, IL, USA), according to the manufacturer's instructions.

[0218] Isolation and radiolabeling of lipoproteins

[0219] Lipoproteins were isolated from human plasma obtained from BiolVT (Westbury, NY). Before the isolation, the plasma was adjusted to 0.01% ethylenediamine tetraacetate (EDTA), 0.02% sodium azide, and 10 pM phenylmethylsulfonyl fluoride (PMSF). Human LDL (d = 1.025-1.063 g / ml) was prepared by ultracentrifugation as described by Brissette et al. (doi: 10.1042 / bj3180841 ). LDL was labeled with 1 ,2- [3H]cholesteryl oleate essentially as described by Roberts et al. (doi: 10.1042 / bj2260319). Thereafter the labeled LDL were reisolated by ultracentrifugation. The specific activity of LDL labeled in CE ranged from 7000 to 12,000 cpm / pg protein.

[0220] Lipoprotein cell association assays

[0221] Cell association of [3H]CE-lipoprotein (20 pg of protein / ml) was measured at 37°C for 4 h in 12-well plates. Cells were washed twice with 1 ml of phosphate-buffered saline (PBS) and incubated in a total volume of 250 pl containing 125 pl of culture medium (2x ), 4% bovine serum albumin, pH 7.4 (total binding). Nonspecific association was assessed by the addition of 1.5 mg of protein / ml of unlabeled lipoproteins. At the end of the incubation the cells were washed twice with 1 ml of PBS containing 0.2% BSA (PBS-BSA) followed by two washes with 1 ml of PBS. The cells were then solubilized in 1.5 ml of 0.2 N NaOH. Radioactivity counts in the homogenates were obtained with a beta-counter. To compare the association of lipoproteins labeled in CE (3H), the association data were estimated as micrograms of protein per milligram of cell protein (apparent uptake). To achieve this, the specific activity of [3H]CE-lipoprotein was expressed in counts per microgram of lipoprotein protein. The specific association was calculated by subtracting the nonspecific association from the total association.

[0222] Immunoblotting

[0223] For Western blotting, cells were washed with cold PBS and then scraped and lysed in ice-cold lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCI, 1% Triton X-100, 0.1% SDS, 0.5% sodium deoxycholate, 1 mM PMSF, and protease inhibitor cocktail). Lysate was microcentrifugated for 20 min at 4°C and supernatant was assessed for cell proteins. Proteins (30-50 mg) were separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blotting to PVDF membrane.

[0224] Quantification of mRNA Expression by Reverse Transcription-Quantitative PCR

[0225] HepG2 cells total RNA were extracted using Aurum Total RNA isolation kits according to the manufacturer’s protocol. cDNA was synthesized with components from High-Capacity cDNA Reverse Transcription kits and with the use of MultiScribe Reverse Transcriptase, according to the manufacturer’s procedures. RNA was quantified by using the Nanodrop according to the manufacturer’s procedures and quality were assessed using Agilent RNA 6000 Nano Kit for Bioanalyzer 2100 System. Primers were designed using the Beacon designer software v.8 and obtained from IDT. The reference gene for normalization, HPRT 1 and TBP, was selected by using the Bio-Rad CFX Maestro software which uses the GeNorm method. The qPCR was performed with SYBR-Green reaction mix. The qPCR conditions consisted of an initial denaturation at 95°C for 5 minutes, followed by 40 cycles of amplification, with each cycle consisting of 95°C for 15 seconds, and 60°C for 60 seconds. Results were analysed with the deltadelta Ct method done with the Bio-Rad CFX Maestro software.

[0226] Other methods

[0227] Protein content was determined by the method of Lowry using BSA as standard.

[0228] Numbered Embodiments

[0229] 1 . A method of decreasing serum low density lipoprotein (LDL) level in a subject, the method comprising inhibiting expression or function of Exchange Protein Directly Activated by cAMP (EPAC)1 and / or EPAC2 in the subject, wherein inhibiting expression or function comprises administration of an inhibitor of EPAC1 and / or EPAC2 to the subject.

[0230] 2. A method of increasing LDL receptor expression in a subject, the method comprising inhibiting expression or function of EPAC1 and / or EPAC2 in the subject, wherein inhibiting expression or function comprises administration of an inhibitor of EPAC1 and / or EPAC2 to the subject.

[0231] 3. The method of embodiment 1 or 2, wherein the inhibitor of EPAC1 and / or EPAC2 is a small molecule.

[0232] 4. The method of embodiment 3, wherein the small molecule is CE3F4 or ESI-05.

[0233] 5. The method of embodiment 1 or 2, wherein the inhibitor of EPAC1 and / or EPAC2 is inhibitory nucleic acid molecule. 6. The method of embodiment 5, wherein the inhibitory nucleic acid molecule is an anti-sense oligonucleotide (ASO), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a double-stranded RNA (dsRNA), a microRNA (miRNA), and / or includes a locked nucleic acid.

[0234] 7. The method of embodiment 5, wherein the inhibitory nucleic acid molecule is an siRNA.

[0235] 8. The method of embodiment 7, wherein the siRNA comprises a sequence complementary to at least 15 contiguous nucleotides of a nucleic acid sequence encoding EPAC1 or EPAC2.

[0236] 9. The method of embodiment 8, wherein the siRNA comprises a sequence complementary to at least 19 contiguous nucleotides of a nucleic acid sequence encoding EPAC1 or EPAC2.

[0237] 10. The method of embodiment 9, wherein the siRNA comprises a sequence complementary to at least 21 contiguous nucleotides of a nucleic acid sequence encoding EPAC1 or EPAC2.

[0238] 11. The method of embodiment 10, wherein the siRNA comprises a sequence complementary to at least 25 contiguous nucleotides of a nucleic acid sequence encoding EPAC1 or EPAC2.

[0239] 12. The method of any one of embodiments 7-11, wherein the siRNA molecule contains 3’ overhangs selected from the group consisting of:

[0240] (i) a single uracil overhang at one or more 3’ ends of the siRNA;

[0241] (ii) a double uracil overhang at one or more 3’ ends of the siRNA;

[0242] (iii) a single thymine overhang at one or more 3’ ends of the siRNA;

[0243] (iv) a double thymine overhang at one or more 3’ ends of the siRNA; or

[0244] (v) a single cytosine and single thymine overhang at one or more 3’ ends of the siRNA.

[0245] 13. The method of any one of embodiments 7-12, wherein the siRNA molecule targets an EPAC mRNA sequence comprising 5'GCAACAAGAGGCAGCAGAUUU ‘3 (SEQ ID NO: 18), 5' ACCUCAAGGAGCAGAAGAAUU ‘3 (SEQ ID NO: 19), 5'CUGCAGUACUGGGUGGCCAUU ‘3 (SEQ ID NO:20), 5'ACUUAAAGAACAUGACCAAUU ‘3 (SEQ ID NO: 21 ), or 5'CUAAUAAGAACCAUCAGGAUU ‘3 (SEQ ID NO: 22).

[0246] 14. The method of any one of embodiments 7-13, wherein the siRNA molecule comprises the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22.

[0247] 15. The method of any one of embodiments 7-14, wherein the siRNA molecule comprises a sequence complementary to the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22.

[0248] 16. The method of any one of embodiments 1-15, wherein the method further comprises administering a second therapeutic agent to the subject.

[0249] 17. The method of embodiment 16, wherein the second therapeutic agent is an inhibitor of adenylate cyclase type 9 (AC9).

[0250] 18. The method of embodiment 17, wherein the inhibitor of AC9 is an inhibitory nucleic acid molecule.

[0251] 19. The method of embodiment 18, wherein the inhibitory nucleic acid molecule is an anti-sense oligonucleotide (ASO), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a double-stranded RNA (dsRNA), or a microRNA (miRNA).

[0252] 20. The method of embodiment 19, wherein the inhibitory nucleic acid molecule is an siRNA.

[0253] 21. The method of embodiment 20, wherein the siRNA comprises a sequence complementary to at least 15 contiguous nucleotides set forth within any one of SEQ ID NOs: 1-10, 16, and 17.

[0254] 22. The method of embodiment 21 , wherein the siRNA comprises a sequence complementary to at least 19 contiguous nucleotides set forth within any one of SEQ ID NOs: 1-10, 16, and 17. 23. The method of embodiment 22, wherein the siRNA comprises a sequence complementary to at least 21 contiguous nucleotides set forth within any one of SEQ ID NOs: 1-10, 16, and 17.

[0255] 24. The method of embodiment 23, wherein the siRNA comprises a sequence complementary to at least 25 contiguous nucleotides set forth within any one of SEQ ID NOs: 16 and 17.

[0256] 25. The method of any one of embodiments 20-24, wherein the siRNA molecule contains 3’ overhangs selected from the group consisting of:

[0257] (i) a single uracil overhang at one or more 3’ ends of the siRNA;

[0258] (ii) a double uracil overhang at one or more 3’ ends of the siRNA;

[0259] (iii) a single thymine overhang at one or more 3’ ends of the siRNA;

[0260] (iv) a double thymine overhang at one or more 3’ ends of the siRNA; or

[0261] (v) a single cytosine and single thymine overhang at one or more 3’ ends of the siRNA.

[0262] 26. The method of any one of embodiments 20-25, wherein the siRNA comprises a nucleotide sequence of any one or more of SEQ ID NOs: 1-10.

[0263] 27. The method of embodiment 26, wherein the siRNA comprises:

[0264] (i) a sense strand comprising the sequence of SEQ ID NO: 1 and an antisense strand comprising the sequence of SEQ ID NO: 2;

[0265] (ii) a sense strand comprising the sequence of SEQ ID NO: 3 and an antisense strand comprising the sequence of SEQ ID NO: 4;

[0266] (iii) a sense strand comprising the sequence of SEQ ID NO: 5 and an antisense strand comprising the sequence of SEQ ID NO: 6;

[0267] (iv) a sense strand comprising the sequence of SEQ ID NO: 7 and an antisense strand comprising the sequence of SEQ ID NO: 8; or

[0268] (v) a sense strand comprising the sequence of SEQ ID NO: 9 and an antisense strand comprising the sequence of SEQ ID NO: 10.

[0269] 28. The method of any one of embodiments 20-27, wherein the siRNA comprises a non-natural or modified nucleoside or nucleotide.

[0270] 29. The method of embodiment 28, wherein the wherein the modification is chosen from a 2'-O-methyl (2'-O-Me) modified nucleoside, a phosphorothioate (PS) bond between nucleosides, insertion of a 2’- deoxy-ribonuclotide into the RNA sequence, and a 2'-fluoro (2'-F) modified nucleoside.

[0271] 30. The method of any one of embodiments 20-29, wherein the siRNA molecule targets the sequence of any one of SEQ ID NOs: 11-15.

[0272] 31. The method of any one of embodiments 1-30, wherein the method further comprises administering a therapeutic agent selected from the group consisting of a statin, a proprotein convertase subtilisin / kexin type 9 (PCSK9) inhibitor, an ATP Citrate Lyase (ACL) inhibitor, a lipoprotein(a) (Lp(a)) inhibitor, an angiopoietin-like 3 (ANGPTL3) inhibitor, a cholesterylester transfer protein (CETP) inhibitor, a microsomal triglyceride transfer protein (MTP) inhibitor, an apolipoprotein B (ApoB) inhibitor, a bile acid binding resin, and colchicine, to the subject.

[0273] 32. The method of embodiment 31 , wherein the statin is atorvastatin.

[0274] 33. The method of embodiment 31 , wherein the PCSK9 inhibitor is an siRNA molecule targeting PCSK9 or a monoclonal antibody.

[0275] 34. The method of embodiment 31 , wherein the ACL inhibitor is bempedoic acid.

[0276] 35. The method of embodiment 31 , wherein the Lp(a) inhibitor is an siRNA molecule targeting Lp(a). 36. The method of embodiment 31 , wherein the MTP inhibitor is lomitapide.

[0277] 37. The method of embodiment 31 , wherein the ApoB inhibitor is mipomersen.

[0278] 38. Use of an inhibitor of EPAC1 or EPAC2 to decrease serum low density lipoprotein (LDL) level in a subject, wherein expression or function of EPAC1 or EPAC2 is inhibited in the subject by administration of the inhibitor.

[0279] 39. Use of an inhibitor of EPAC1 or EPAC2 to decrease LDL receptor expresssion in a subject, wherein expression or function of EPAC1 or EPAC2 is inhibited in the subject by administration of the inhibitor.

[0280] 40. An siRNA molecule that targets an EPAC mRNA sequence comprising 5'GCAACAAGAGGCAGCAGAUUU ‘3 (SEQ ID NO:18), 5' ACCUCAAGGAGCAGAAGAAUU ‘3 (SEQ ID NO: 19), 5'CUGCAGUACUGGGUGGCCAUU ‘3 (SEQ ID NO:20), 5'ACUUAAAGAACAUGACCAAUU ‘3 (SEQ ID NO: 21 ), or 5'CUAAUAAGAACCAUCAGGAUU ‘3 (SEQ ID NO: 22).

[0281] 41. An siRNA molecule comprising the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22.

[0282] 42. An siRNA molecule comprising a sequence complementary to the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22.

[0283] Other Embodiments

[0284] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each independent publication or patent application was specifically and individually indicated to be incorporated by reference.

[0285] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations following, in general, the principles and including such departures from the invention that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims.

[0286] Other embodiments are within the claims.

Claims

CLAIMSWhat is claimed is:1 . A method of decreasing serum low density lipoprotein (LDL) level in a subject, the method comprising inhibiting expression or function of Exchange Protein Directly Activated by cAMP (EPAC)1 and / or EPAC2 in the subject, wherein inhibiting expression or function comprises administration of an inhibitor of EPAC1 and / or EPAC2 to the subject.

2. A method of increasing LDL receptor expression in a subject, the method comprising inhibiting expression or function of EPAC1 and / or EPAC2 in the subject, wherein inhibiting expression or function comprises administration of an inhibitor of EPAC1 and / or EPAC2 to the subject.

3. The method of claim 1 or 2, wherein the inhibitor of EPAC1 and / or EPAC2 is a small molecule.

4. The method of claim 3, wherein the small molecule is CE3F4 or ESI-05.

5. The method of claim 1 or 2, wherein the inhibitor of EPAC1 and / or EPAC2 is inhibitory nucleic acid molecule.

6. The method of claim 5, wherein the inhibitory nucleic acid molecule is an anti-sense oligonucleotide (ASO), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a double-stranded RNA (dsRNA), a microRNA (miRNA), and / or includes a locked nucleic acid.

7. The method of claim 5, wherein the inhibitory nucleic acid molecule is an siRNA.

8. The method of claim 7, wherein the siRNA comprises a sequence complementary to at least 15 contiguous nucleotides of a nucleic acid sequence encoding EPAC1 or EPAC2.

9. The method of claim 8, wherein the siRNA comprises a sequence complementary to at least 19 contiguous nucleotides of a nucleic acid sequence encoding EPAC1 or EPAC2.

10. The method of claim 9, wherein the siRNA comprises a sequence complementary to at least 21 contiguous nucleotides of a nucleic acid sequence encoding EPAC1 or EPAC2.

11. The method of claim 10, wherein the siRNA comprises a sequence complementary to at least 25 contiguous nucleotides of a nucleic acid sequence encoding EPAC1 or EPAC2.

12. The method of claim 7, wherein the siRNA molecule contains 3’ overhangs selected from the group consisting of:(i) a single uracil overhang at one or more 3’ ends of the siRNA;(ii) a double uracil overhang at one or more 3’ ends of the siRNA;(iii) a single thymine overhang at one or more 3’ ends of the siRNA;(iv) a double thymine overhang at one or more 3’ ends of the siRNA; or(v) a single cytosine and single thymine overhang at one or more 3’ ends of the siRNA.

13. The method of claim 7, wherein the siRNA molecule targets an EPAC mRNA sequence comprising 5'GCAACAAGAGGCAGCAGAUUU ‘3 (SEQ ID NO:18), 5' ACCUCAAGGAGCAGAAGAAUU ‘3 (SEQ IDNO: 19), 5'CUGCAGUACUGGGUGGCCAUU ‘3 (SEQ ID NO:20), 5'ACUUAAAGAACAUGACCAAUU ‘3 (SEQ ID NO: 21 ), or 5'CUAAUAAGAACCAUCAGGAUU ‘3 (SEQ ID NO: 22).

14. The method of claim 7, wherein the siRNA molecule comprises the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22.

15. The method of claim 7, wherein the siRNA molecule comprises a sequence complementary to the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22.

16. The method of claim 1, wherein the method further comprises administering a second therapeutic agent to the subject.

17. The method of claim 16, wherein the second therapeutic agent is an inhibitor of adenylate cyclase type 9 (AC9).

18. The method of claim 17, wherein the inhibitor of AC9 is an inhibitory nucleic acid molecule.

19. The method of claim 18, wherein the inhibitory nucleic acid molecule is an anti-sense oligonucleotide (ASO), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a double-stranded RNA (dsRNA), or a microRNA (miRNA).

20. The method of claim 19, wherein the inhibitory nucleic acid molecule is an siRNA.

21. The method of claim 20, wherein the siRNA comprises a sequence complementary to at least 15 contiguous nucleotides set forth within any one of SEQ ID NOs: 1-10, 16, and 17.

22. The method of claim 21 , wherein the siRNA comprises a sequence complementary to at least 19 contiguous nucleotides set forth within any one of SEQ ID NOs: 1-10, 16, and 17.

23. The method of claim 22, wherein the siRNA comprises a sequence complementary to at least 21 contiguous nucleotides set forth within any one of SEQ ID NOs: 1-10, 16, and 17.

24. The method of claim 23, wherein the siRNA comprises a sequence complementary to at least 25 contiguous nucleotides set forth within any one of SEQ ID NOs: 16 and 17.

25. The method of claim 20, wherein the siRNA molecule contains 3’ overhangs selected from the group consisting of:(i) a single uracil overhang at one or more 3’ ends of the siRNA;(ii) a double uracil overhang at one or more 3’ ends of the siRNA;(iii) a single thymine overhang at one or more 3’ ends of the siRNA;(iv) a double thymine overhang at one or more 3’ ends of the siRNA; or(v) a single cytosine and single thymine overhang at one or more 3’ ends of the siRNA.

26. The method of claim 20, wherein the siRNA comprises a nucleotide sequence of any one or more of SEQ ID NOs: 1-10.

27. The method of claim 26, wherein the siRNA comprises:(i) a sense strand comprising the sequence of SEQ ID NO: 1 and an antisense strand comprising the sequence of SEQ ID NO: 2;(ii) a sense strand comprising the sequence of SEQ ID NO: 3 and an antisense strand comprising the sequence of SEQ ID NO: 4;(Hi) a sense strand comprising the sequence of SEQ ID NO: 5 and an antisense strand comprising the sequence of SEQ ID NO: 6;(iv) a sense strand comprising the sequence of SEQ ID NO: 7 and an antisense strand comprising the sequence of SEQ ID NO: 8; or(v) a sense strand comprising the sequence of SEQ ID NO: 9 and an antisense strand comprising the sequence of SEQ ID NO: 10.

28. The method of claim 20, wherein the siRNA comprises a non-natural or modified nucleoside or nucleotide.

29. The method of claim 28, wherein the wherein the modification is chosen from a 2'-O-methyl (2'-O-Me) modified nucleoside, a phosphorothioate (PS) bond between nucleosides, insertion of a 2’-deoxy- ribonuclotide into the RNA sequence, and a 2'-fluoro (2'-F) modified nucleoside.

30. The method of claim 20, wherein the siRNA molecule targets the sequence of any one of SEQ ID NOs: 11-15.

31. The method of claim 1 , wherein the method further comprises administering a therapeutic agent selected from the group consisting of a statin, a proprotein convertase subtilisin / kexin type 9 (PCSK9) inhibitor, an ATP Citrate Lyase (ACL) inhibitor, a lipoprotein(a) (Lp(a)) inhibitor, an angiopoietin-like 3 (ANGPTL3) inhibitor, a cholesterylester transfer protein (CETP) inhibitor, a microsomal triglyceride transfer protein (MTP) inhibitor, an apolipoprotein B (ApoB) inhibitor, a bile acid binding resin, and colchicine, to the subject.

32. The method of claim 31 , wherein the statin is atorvastatin.

33. The method of claim 31 , wherein the PCSK9 inhibitor is an siRNA molecule targeting PCSK9 or a monoclonal antibody.

34. The method of claim 31 , wherein the ACL inhibitor is bempedoic acid.

35. The method of claim 31 , wherein the Lp(a) inhibitor is an siRNA molecule targeting Lp(a).

36. The method of claim 31 , wherein the MTP inhibitor is lomitapide.

37. The method of claim 31 , wherein the ApoB inhibitor is mipomersen.

38. Use of an inhibitor of EPAC1 or EPAC2 to decrease serum low density lipoprotein (LDL) level in a subject, wherein expression or function of EPAC1 or EPAC2 is inhibited in the subject by administration of the inhibitor.

39. Use of an inhibitor of EPAC1 or EPAC2 to decrease LDL receptor expression in a subject, wherein expression or function of EPAC1 or EPAC2 is inhibited in the subject by administration of the inhibitor.

40. An siRNA molecule that targets an EPAC mRNA sequence comprising 5'GCAACAAGAGGCAGCAGAUUU ‘3 (SEQ ID NO:18), 5' ACCUCAAGGAGCAGAAGAAUU ‘3 (SEQ IDNO: 19), 5'CUGCAGUACUGGGUGGCCAUU ‘3 (SEQ ID NO:20), 5'ACUUAAAGAACAUGACCAAUU ‘3 (SEQ ID NO: 21 ), or 5'CUAAUAAGAACCAUCAGGAUU ‘3 (SEQ ID NO: 22).

41. An siRNA molecule comprising the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22.

42. An siRNA molecule comprising a sequence complementary to the sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , or SEQ ID NO: 22.