PCV2 ORF2 protein variants and virus-like particles composed of them

Abstract

A vaccination method for controlling PCV2 infection of different PCV2 subtypes is disclosed. Specifically, the PCV2 subtype B (PCV2B) ORF2 protein or an immunogenic composition containing the PCV2B ORF2 protein is used in the following methods: treating or preventing infection with the same PCV2B and / or different PCV2 subtypes; alleviating, preventing or treating clinical signs caused by infection with the same PCV2B or different PCV2 subtypes; and / or preventing or treating infection with diseases caused by the same PCV2B and / or different PCV2 subtypes. The invention particularly relates to PCV2 subtype B (PCV2B) ORF2 proteins, characterized in that they contain at least one mutation in the BC ring, such that the expressed protein is preferably expressed at a higher level compared to PCV2ORF2 proteins without such mutations.

Description

[0001] sequence list

[0002] This application contains sequence listings in accordance with 37C.FR1.821-1.825. The sequence listings accompanying this application are hereby incorporated in their entirety by reference. Background Technology

[0003] Porcine circovirus type 2 (PCV2) is a small (17-22 nm in diameter), icosahedral, non-enveloped DNA virus containing a single-stranded circular genome. PCV2 shares approximately 80% sequence identity with porcine circovirus type 1 (PCV-1). However, unlike the usually non-virulent PCV1, pigs infected with PCV2 exhibit a syndrome commonly known as post-weaning multisystem wasting syndrome (PMWS). Clinical features of PMWS include emaciation, pale skin, growth retardation, respiratory distress, diarrhea, icterus, and jaundice. In some infected pigs, a combination of all signs is observed, while others exhibit only one or two of these clinical signs. On necropsy, microscopic and macroscopic lesions are present in multiple tissues and organs, with lymphoid organs being the most common site of damage. A strong association has been observed between the amount of PCV2 nucleic acid or antigen and the severity of microscopically visible lymphoid lesions. The mortality rate of pigs infected with PCV2 can approach 80%. In addition to PMWS, PCV2 has been associated with several other infections, including pseudorabies, porcine reproductive and respiratory syndrome (PRRS), Glasser's disease, streptococcal meningitis, salmonellosis, post-weaning colibacillosis, dietary liver dysfunction, and purulent bronchopneumonia.

[0004] Currently, three subtypes of PCV2 (PCV2a, PCV2b, and PCV2c) are known, classified according to the unified nomenclature of PCV2 genotypes (Segales, J. et al., 2008, PCV-2 genotype definition and nomenclature, Vet Rec 162: 867-8). Two additional subtypes (PCV2d and PCV2e) have been proposed (Wang et al. Virus Res. 2009 145(1): 151-6), but they were later confirmed to belong to the PCV2a and PCV2b clusters (Cortey et al. Vet Microbiol. 2011 149(3-4): 522-32011). According to this unified nomenclature of PCV2 genotypes, the orf2 gene is used to perform pcv-2 genotyping, which is based on the proportion of nucleotide sites at which two contrasting sequences are different (p-distance). This value was obtained by dividing the number of nucleotide differences by the total number of contrasting nucleotides (Kumar et al. 2001 Bioinformatics 17, 1244-1245). Subsequently, the construction of a p-distance / frequency histogram was able to determine potential cutoff values ​​for distinguishing different genotypes (Rogers and Harpending 1992 Molecular Biology and Evolution 9, 552-569; Biagini et al. 1999 Journal of General Virology 80, 419-424). Using this method, the orf2 pcv-2 sequences were assigned to different genotypes when the genetic distance between them was 0.035.

[0005] US 2011 / 0305725 A1 describes a study designed to test a novel vaccine formulation in pigs to evaluate its efficacy against porcine circovirus and Mycoplasma hyopneumoniae. During the study, several pigs in both the control and vaccinated groups were observed to exhibit clinical signs of PMWS. It was then confirmed that these pigs had been exposed to environmental PCV2 prior to challenge. Molecular analysis of blood and tissue samples from these pigs revealed that they carried a type 2B strain of the virus, distinct from the strain used for challenge (paragraph of US 2011 / 0305725A1).

[0006] WO2011116094A2 discloses a chimeric porcine circovirus infectious DNA clone and a live attenuated chimeric virus having a PCV2 subtype PCV2 and a capsid gene of the PCV2b subtype integrated into the genome of a non-pathogenic PCV1 virus, wherein the attenuated chimeric virus can be used as a live vaccine as well as an inactivated (killed) vaccine.

[0007] WO2013030320 A1 relates to a synthetic circovirus capsid protein and methods for treating and / or preventing PCV2-related diseases in mammals using said protein. Two sequences were designed according to WO2013030320 A1, one of which was further modified with optimizations, particularly as described below:

[0008] - Eliminate the potential cleavage site at amino acid position 165.

[0009] - Introduce a mutation at position 200.

[0010] - Make a replacement at position 161.

[0011] - Make a replacement at position 170.

[0012] - Replace the S residue at position 225 with D.

[0013] - Make a replacement at position 143.

[0014] - Make two substitutions at the N-end of the sequence (positions 13 and 20).

[0015] However, since it has been found in practice that the expression of wild-type PCV2b ORF2 protein is insufficient and additional concentration steps are required to obtain virus-like particles (VLPs) that can be used to prepare subunit vaccines, there is a need for easy modification of the naturally occurring PCV2b ORF2 protein sequence to enhance expression efficacy and increase VLP production, thereby allowing for the rapid and easy production of effective PCV2 subunit vaccines.

[0016] The embodiments described in the specification and claims provide a solution to the above-mentioned technical problems.

[0017] Therefore, the present invention is implemented in its various aspects according to the claims. Attached Figure Description

[0018] Figure 1 The main amino acid changes between the ORF2 amino acid sequences of -PCV2a and PCV2b.

[0019] Figure 2 Evaluation of the baculovirus harvest supernatant of PCV2b ORF2. Lane 1 = Circoflex WSV (PCV2aORF2), Lane 2 = PCV2b ORF2 BDH SFCO, Lane 4 = PCV2bORF2 BDH R63T, Lane 5 = PCV2b ORF2 BDH R63K.

[0020] Figure 3Evaluation of 100,000 g of PCV2b ORF2 precipitate. Lane 1 = PCV2b ORF2BDH, Lane 2 = PCV2b ORF2 BDH R63K, Lane 3 = PCV2b ORF2 BDH R63T, Lane 4 = Circoflex WSV(PCV2aORF2).

[0021] Figure 4 - SDS-PAGE separation of sucrose gradient fractions. F1-F12 = fractions 1-12.

[0022] Figure 5A and Figure 5B - VLP formation was confirmed by EM.

[0023] Figure 6 Results of the evaluation of the PCV2b ORF2 mutant construct. SFCO = codon optimized for the fall armyworm (Spodopterafrugiperda). The native PCV2b ORF2 BDH and R63K constructs were not subjected to VLP examination or quantification because the R63T construct was also found.

[0024] Figure 7A and 7B Results of the evaluation of the PCV2b ORF2 mutant construct. SFCO = codon optimized for fall armyworm. VPL of the ORF2 mutant construct is expressed as μg / ml.

[0025] Figure 8 - Comparison of the amino acid sequences of wild-type and mutant PCV2b ORF2, wherein the sequences named SEQ ID NO: 5 and SEQ ID NO: 2 are the wild-type PCV2b ORF2 sequences, and the sequences named SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 are the mutant sequences, and SEQ ID NO: 3 corresponds to the sequence of the wild-type PCV2aORF2 protein. In the sequences named SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, “X” (at positions 8, 53, 57, 68, 89, 90, 121, 134, 169, 190, 215 and 234) is any amino acid residue selected from A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; X "(at position 63) is any amino acid residue selected from A, C, D, E, F, G, H, I, L, M, N, P, Q, S, T, V, W and Y; and "x" (at position 210) is any amino acid residue selected from D and E. Detailed Implementation

[0026] This invention is based on the surprising discovery that a single mutation in the amino acid sequence of the PCV2 subtype b (PCV2b) ORF2 protein is sufficient to significantly increase VLP production levels, thereby enabling the rapid production of effective PCV2 subunit vaccines.

[0027] In the basic work of this invention, the positions of the major amino acid differences between the PCV2a and PCV2b ORF2 sequences were identified as potential mutation sites.

[0028] Against this background, the typical six amino acid positions of the PCV2b ORF2 protein were identified, namely

[0029] - An arginine or lysine residue at amino acid position 59.

[0030] - An arginine or lysine residue at amino acid position 63.

[0031] - The proline residue at amino acid position 88

[0032] -The threonine residue at amino acid position 151,

[0033] -The isoleucine residue at amino acid position 206, and

[0034] - The asparagine residue at amino acid position 232.

[0035] As described herein, the amino acid positions are numbered with reference to the amino acid sequence of the full-length wild-type PCV2 ORF2 protein (SEQ ID NO: 2 or SEQ ID NO: 5). Therefore, the amino position numbers mentioned herein refer to the wild-type PCV2 ORF2 protein sequence having 234 or 233 amino acid residues (including a methionine residue at (N-terminal) amino acid position 1).

[0036] Therefore, the phrase “wherein the amino acid position number refers to the amino acid sequence of the wild-type PCV2 ORF2 protein” used in the context of this invention refers to the sequence of a naturally occurring PCV2 ORF2 protein, as exemplarily illustrated in SEQ ID NO: 2 or SEQ ID NO: 5.

[0037] Unexpectedly, mutations at the typical six amino acid positions of the PCV2b ORF2 protein showed that a single mutation within the amino acid sequence of the BC ring of the PCV2 ORF2 protein (i.e., a substitution of an arginine or lysine residue at position 63) was sufficient to significantly increase the expression of the PCV2 ORF2 protein compared to the PCV2 ORF2 protein without such a mutation.

[0038] In one aspect, the present invention thus relates to polypeptides selected from the following (a), (b) and (c): (a) a PCV2ORF2 protein having: an arginine or lysine residue at amino acid position 59, and / or a proline residue at amino acid position 88, and / or a threonine residue at amino acid position 151, and / or an isoleucine residue at amino acid position 206, and / or an asparagine residue at amino acid position 232, and having an amino acid residue at amino acid position 63 other than an arginine or lysine residue, wherein the amino acid positions are numbered with reference to the amino acid sequence of the wild-type PCV2 ORF2 protein; (b) a PCV2 ORF2 protein characterized in that it (i) contains at least one mutation in the BC ring and (ii) is preferably expressed at a significantly higher level compared to a PCV2 ORF2 protein without such a mutation; and (c) a combination of (a) and (b).

[0039] Preferably, the polypeptide (hereinafter also referred to as "the polypeptide of the present invention") is an isolated polypeptide.

[0040] Specifically, the polypeptides of the present invention are non-naturally occurring polypeptides.

[0041] According to the first aspect (a), the polypeptide of the present invention is thus a PCV2 ORF2 protein having 1, 2, 3, 4 or 5 amino acid residues selected from the following (in parentheses are single-letter codes): an arginine residue (R) or a lysine residue (K) at amino acid position 59, a proline residue (P) at amino acid position 88, a threonine residue (T) at amino acid position 151, an isoleucine residue (I) at amino acid position 206, and an asparagine residue (N) at amino acid position 232, and having an amino acid residue at amino acid position 63 other than an arginine residue or a lysine residue.

[0042] Specifically, the amino acid residues at position 63, other than arginine or lysine residues, are naturally occurring, preferably genetically encoded, amino acid residues other than arginine or lysine residues.

[0043] Subsequently, the following abbreviations were also used:

[0044] "R59" is an abbreviation for "arginine residue at amino acid position 59".

[0045] "K59" is an abbreviation for "lysine residue at amino acid position 59".

[0046] "P88" is an abbreviation for "proline residue at amino acid position 88".

[0047] "T151" is an abbreviation for "threonine residue at amino acid position 151".

[0048] "I206" is an abbreviation for "the isoleucine residue at amino acid position 206".

[0049] "N232" is an abbreviation for "asparagine residue at amino acid position 232".

[0050] Preferably, the polypeptide according to aspect (a) is thus a PCV2 ORF2 protein, whose

[0051] It has P88,

[0052] Or it has T151,

[0053] Or it has I206,

[0054] Or it has N232,

[0055] Or it may have R59 or K59,

[0056] Or it may have P88 and T151,

[0057] Or it may have P88 and I206,

[0058] Or it may have P88 and N232,

[0059] Or it may have P88 and R59 or K59,

[0060] Or it may have T151 and I206,

[0061] Or it may have T151 and N232,

[0062] Or it may have T151 and R59 or K59,

[0063] Or it may have I206 and N232,

[0064] Or it may have I206 and R59 or K59,

[0065] Or it may have N232 and R59 or K59,

[0066] Or it may have P88, T151, and I206.

[0067] Or it may have P88, T151, and N232.

[0068] Or it may have P88 and T151 and R59 or K59,

[0069] Or it may have P88, I206, and N232.

[0070] Or it may have P88 and I206 and R59 or K59,

[0071] Or it may have P88 and N232 and R59 or K59,

[0072] Or it may have T151, I206, and N232.

[0073] Or it may have T151 and I206 and R59 or K59,

[0074] Or it may have T151 and N232 and R59 or K59,

[0075] Or it may have I206 and N232 and R59 or K59,

[0076] Or it may have P88 and T151 and I206 and N232,

[0077] Or it may have P88 and T151 and I206 and R59 or K59,

[0078] Or it may have P88 and T151 and N232 and R59 or K59,

[0079] Or it may have P88 and I206 and N232 and R59 or K59,

[0080] Or it may have T151 and I206 and N232 and R59 or K59,

[0081] Or it may have P88 and T151 and I206 and N232 and R59 or K59.

[0082] More preferably, the polypeptide according to aspect (a) is therefore selected from:

[0083] PCV2 ORF2 protein with P88,

[0084] PCV2 ORF 2 protein with T151,

[0085] PCV2 ORF 2 protein with I206,

[0086] PCV2 ORF 2 protein with N232,

[0087] PCV2 ORF2 protein with R59,

[0088] PCV2 ORF2 protein with K59,

[0089] PCV2 ORF 2 protein with P88 and T151,

[0090] PCV2 ORF 2 protein with P88 and I206,

[0091] PCV2 ORF 2 protein with P88 and N232,

[0092] PCV2 ORF2 protein with P88 and R59,

[0093] PCV2 ORF2 protein with P88 and K59,

[0094] PCV2 ORF 2 protein with T151 and I206,

[0095] PCV2 ORF 2 protein with T151 and N232,

[0096] PCV2 ORF 2 protein with T151 and R59,

[0097] PCV2 ORF 2 protein with T151 and K59,

[0098] PCV2 ORF 2 protein with I206 and N232,

[0099] PCV2 ORF 2 protein with I206 and R59,

[0100] PCV2 ORF 2 protein with I206 and K59,

[0101] PCV2 ORF 2 protein with N232 and R59,

[0102] PCV2 ORF 2 protein with N232 and K59,

[0103] PCV2 ORF 2 protein with P88, T151, and I206,

[0104] PCV2 ORF 2 protein with P88, T151, and N232,

[0105] PCV2 ORF 2 protein with P88, T151, and R59,

[0106] PCV2 ORF 2 protein with P88, T151, and K59,

[0107] PCV2 ORF 2 protein with P88, I206, and N232,

[0108] PCV2 ORF 2 protein with P88, I206, and R59,

[0109] PCV2 ORF 2 protein with P88, I206, and K59,

[0110] PCV2 ORF 2 protein with P88, N232, and R59,

[0111] PCV2 ORF 2 protein with P88, N232, and K59,

[0112] PCV2 ORF 2 protein with T151, I206, and N232,

[0113] PCV2 ORF 2 protein with T151, I206, and R59,

[0114] PCV2 ORF 2 protein with T151, I206, and K59,

[0115] PCV2 ORF 2 protein with T151, N232, and R59,

[0116] PCV2 ORF 2 protein with T151, N232, and K59,

[0117] PCV2 ORF 2 protein with I206, N232, and R59,

[0118] PCV2 ORF 2 protein with I206, N232, and K59,

[0119] PCV2 ORF 2 protein with P88, T151, I206, and N232,

[0120] PCV2 ORF 2 protein with P88, T151, I206, and R59,

[0121] PCV2 ORF 2 protein with P88, T151, I206, and K59,

[0122] PCV2 ORF 2 protein with P88, T151, N232, and R59,

[0123] PCV2 ORF 2 protein with P88, T151, N232, and K59,

[0124] PCV2 ORF 2 protein with P88, I206, N232, and R59,

[0125] PCV2 ORF 2 protein with P88, I206, N232, and K59,

[0126] PCV2 ORF 2 protein with T151, I206, N232, and R59,

[0127] PCV2 ORF 2 protein with T151, I206, N232, and K59,

[0128] PCV2 ORF 2 protein with P88, T151, I206, N232, and R59, and

[0129] PCV2 ORF 2 protein with P88, T151, I206, N232, and K59.

[0130] According to the second aspect (b), the polypeptide of the present invention is specifically a PCV2 ORF2 protein, characterized in that it (i) contains at least one mutation in the BC ring and (ii) is expressed, particularly in baculovirus expression systems, at a significantly higher level than a PCV2ORF2 protein without such a mutation, preferably at least 2 times higher, more preferably at least 3 times higher, more preferably at least 5 times higher, and more preferably at least 8 times higher, wherein the PCV2ORF2 protein without such a mutation preferably has the same amino acid sequence as the polypeptide of the present invention except for at least one mutation in the BC ring.

[0131] Therefore, it is particularly understood that the amino acid sequences of the two PCV2 ORF2 proteins expressed according to this aspect of the invention are identical except for at least one mutation in the BC ring.

[0132] In the context of this invention, the term "BC loop" specifically refers to the portion of the PCV2 ORF2 amino acid sequence located in the first two N-terminal amino acid segments folded into a B-sheet secondary structure, as seen in the crystal structure of the PCV2ORF2 protein disclosed in Khayat et al., J Virol 85:7856-62 (2011) (which is incorporated herein by reference). Specifically, Khayat et al. described the loop connecting the β bands BC, DE, FG, and HI as 4–9 amino acid residues long, and described the BC and HI loops as knob-like protrusions that define the furthest extension from the PCV capsid surface and are decorated with a 5-fold axis.

[0133] To determine whether a PCV2 ORF2 protein containing at least one mutation in the BC ring is expressed at a higher level compared to a PCV2 ORF2 protein without such a mutation, the method described in Example 1 below is preferably used.

[0134] Therefore, in one embodiment, to determine whether PCV2 ORF2 protein containing at least one mutation in the BC loop is expressed at a higher level compared to PCV2 ORF2 protein without such a mutation, a baculovirus expression system is used in a method comprising the steps of: infecting Sf+ cells with baculovirus at a target MOI of 0.1, allowing the infection to proceed for 5-7 days, harvesting by centrifugation at 20000g for 20 min to remove cell debris and insoluble proteins, filtering the harvest supernatant at 0.2 μm, and directly evaluating PCV2 ORF2 expression by Western blotting using an α-PCV2 antibody.

[0135] Preferably, the method further includes preparing a baculovirus for use in infecting Sf+ cells with a target MOI of 0.1, and specifically further includes one or more of the following steps: cloning a coding sequence encoding a PCV2 ORF2 protein containing at least one mutation in the BC loop into a baculovirus transfer vector; cloning a coding sequence encoding a PCV2 ORF2 protein without such a mutation into a baculovirus transfer vector; co-transfecting the baculovirus transfer vector containing the coding sequence encoding a PCV2 ORF2 protein containing at least one mutation in the BC loop with baculovirus DNA into Sf9 cells; and co-transfecting the baculovirus transfer vector containing the coding sequence encoding a PCV2 ORF2 protein without such a mutation with baculovirus DNA into Sf9 cells.

[0136] More preferably, the method further includes one or more of the following steps: examining the expression of PCV2 ORF2 protein by recombinant baculoviruses obtained by IFA, preparing amplification stock solutions of each recombinant baculovirus on Sf+ cells, and performing TCID45 analysis. 50 The method involves titrating the amplification stock solution to determine the baculovirus titer.

[0137] Specifically, under the same and / or comparable environmental conditions, preferably in a baculovirus expression system, the polypeptide of the present invention, which is a PCV2 ORF2 protein containing at least one mutation in the loop, is expressed at a higher level compared with a PCV2 ORF2 protein without such a mutation.

[0138] More specifically, the PCV2 ORF2 protein that does not contain such a mutation is the wild-type PCV2ORF2 protein.

[0139] Preferably, at least one mutation in the BC ring according to the invention is at least one mutation in the region of amino acid positions 58-66, and specifically includes the deletion, substitution and / or addition of 1-7 amino acid residues in the region of amino acid positions 60-66 or consists of the deletion, substitution and / or addition of 1-7 amino acid residues in the region of amino acid positions 60-66.

[0140] More preferably, at least one mutation in the BC ring is the deletion, substitution, and / or addition of an amino acid residue at amino acid position 63, wherein the substitution of the amino acid residue at amino acid position 63 by an amino acid residue other than an arginine residue or a lysine residue is most preferred.

[0141] More preferably, the substitution of the amino acid residue at amino acid position 63 by an amino acid residue other than arginine or lysine is a substitution made by a naturally occurring, preferably genetically encoded, amino acid residue other than arginine or lysine.

[0142] The preferred sequence of the BC ring according to the invention is described in SEQ ID NO: 10-45, which includes the substitution of an amino acid residue at amino acid position 63 with an amino acid residue other than an arginine residue or a lysine residue.

[0143] Therefore, specifically, at least one mutation in the BC ring according to the invention comprises, or is the substitution of an amino acid residue other than an arginine residue or a lysine residue for an arginine residue or a lysine residue at amino acid position 63.

[0144] Therefore, the PCV2 ORF2 protein without such mutations as described herein preferably has an arginine residue or a lysine residue at amino acid position 63, which is then substituted according to this preferred embodiment of the invention, thereby producing a polypeptide according to the invention.

[0145] Most preferably, the polypeptide of the present invention comprises a sequence selected from SEQ ID NO: 10-45, wherein the sequence is specifically located at amino acid positions 58-66 of the sequence of the polypeptide of the present invention.

[0146] According to the third aspect (c), the polypeptide of the present invention is any combination of PCV2 ORF2 proteins as described herein according to aspects (a) and (b), and is therefore any PCV2 ORF2 protein having:

[0147] - An arginine residue or a lysine residue at amino acid position 59, and / or

[0148] - The proline residue at amino acid position 88, and / or

[0149] - The threonine residue at amino acid position 151, and / or

[0150] - The isoleucine residue at amino acid position 206, and / or

[0151] - The asparagine residue at amino acid position 232

[0152] It has an amino acid residue other than an arginine residue or a lysine residue at amino acid position 63, wherein the amino acid position is numbered with reference to the amino acid sequence of the wild-type PCV2 ORF2 protein; and is characterized in that it (i) contains at least one mutation in the BC ring and (ii) is preferably expressed at a significantly higher level than the PCV2 ORF2 protein without such mutation.

[0153] As described in the context of this invention, the term “genetically encoded amino acid residue other than arginine or lysine residue” specifically refers to amino acid residues selected from the following (in parentheses, single-letter codes): alanine residue (A), aspartic acid residue (D), asparagine residue (N), cysteine ​​residue (C), glutamine residue (Q), glutamic acid residue (E), phenylalanine residue (F), glycine residue (G), histidine residue (H), isoleucine residue (I), leucine residue (L), methionine residue (M), proline residue (P), serine residue (S), threonine residue (T), valine residue (V), tryptophan residue (W), and tyrosine residue (Y).

[0154] More specifically, the amino acid residues other than arginine or lysine residues are selected from: amino acid residues with polar but uncharged side chains, amino acid residues with hydrophobic side chains, and glycine residues, wherein preferably the amino acid residues with polar but uncharged side chains are selected from: serine residues, threonine residues, tyrosine residues, asparagine residues, and glutamine residues, and / or wherein the amino acid residues with hydrophobic side chains are preferably selected from: alanine residues, valine residues, leucine residues, isoleucine residues, phenylalanine residues, and tryptophan residues.

[0155] Most preferably, as mentioned in the context of this invention, the amino acid residues other than arginine or lysine residues are selected from serine and threonine residues.

[0156] In another preferred aspect, the polypeptide of the present invention is a recombinant PCV2 ORF2 protein, such as the PCV2 ORF2 protein expressed by a recombinant baculovirus.

[0157] As used herein, the term "recombinant PCV2 ORF2 protein" specifically refers to a protein molecule expressed from a recombinant DNA molecule, such as a polypeptide produced by recombinant DNA technology. An example of such a technology includes situations where DNA encoding the expressed protein is inserted into a suitable expression vector (preferably a baculovirus expression vector), which is then used to transfect (or, in the case of a baculovirus expression vector, infect) host cells to produce a protein or polypeptide encoded by said DNA. Therefore, the term "recombinant PCV2 ORF2 protein" as used herein specifically refers to a protein molecule expressed from a recombinant DNA molecule.

[0158] According to a specific example, recombinant PCV2 ORF2 protein is produced by a method comprising the following steps: cloning the PCV2ORF2 gene into a baculovirus transfer vector; preparing a recombinant baculovirus containing the gene in insect cells by homologous recombination using the transfer vector; and then expressing the PCV2 ORF2 protein in insect cells during infection with the recombinant baculovirus.

[0159] In one alternative example, the recombinant PCV2ORF2 protein is expressed from a recombinant expression plasmid in insect cells. In this alternative example, baculovirus is not required.

[0160] To further understand, the term "recombinant PCV2 protein consisting of a sequence" specifically also refers to any co-translational and / or post-translational modifications of the sequence, said modifications being influenced by the cells in which the polypeptide is expressed. Thus, the term "recombinant PCV2 ORF2 protein consisting of a sequence" as used herein also refers to a sequence having one or more modifications performed by the cells in which the polypeptide is expressed, particularly modifications of amino acid residues performed during protein biosynthesis and / or protein processing, preferably selected from glycosylation, phosphorylation, and acetylation.

[0161] Preferably, the recombinant PCV2ORF2 protein according to the invention is produced or obtained using a baculovirus expression system, particularly in cultured insect cells.

[0162] In another preferred aspect, the polypeptide of the present invention is the PCV2b isotype (PCV2b) ORF2 protein.

[0163] In another preferred aspect, the polypeptide of the present invention is a PCV2 ORF2 protein comprising or composed of such an amino acid sequence having at least 90%, preferably at least 92%, more preferably at least 94%, even more preferably at least 96%, more preferably at least 98%, or particularly 100% sequence identity with the amino acid sequence of SEQ ID NO: 1.

[0164] Most preferably, the polypeptides of the present invention are selected from the sequences of SEQ ID NO: 6-9, which also show... Figure 8 Therefore, the polypeptides of the present invention are preferably selected from the following sequences (i)-(iv):

[0165]

[0166] In the sequences (i)-(iv):

[0167] “X” is any amino acid residue selected from A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y;

[0168] “ X” It is any amino acid residue selected from A, C, D, E, F, G, H, I, L, M, N, P, Q, S, T, V, W, and Y; and

[0169] “ x "It is any amino acid residue selected from D and E.

[0170] For illustrative purposes and in a non-limiting example, the polypeptide according to the invention is a polypeptide consisting of the following sequence:

[0171]

[0172] in" X " is any amino acid residue selected from A, C, D, E, F, G, H, I, L, M, N, P, Q, S, T, V, W, and Y.

[0173] In another preferred aspect of the invention, the wild-type PCV2 ORF2 protein as described herein is the protein described in SEQ ID NO: 2.

[0174] According to another aspect, the present invention also provides an immunogenic composition containing the polypeptide of the present invention.

[0175] According to another preferred aspect, the present invention also provides an immunogenic composition comprising the polypeptide of the present invention and the PCV2a ORF-2 polypeptide, wherein the PCV2a ORF-2 polypeptide is preferably a polypeptide having at least 94% or preferably at least 95% sequence identity with SEQ ID NO: 3.

[0176] According to another aspect, the present invention also provides a polynucleotide comprising a sequence encoding a polypeptide of the present invention, wherein the polynucleotide according to the present invention is preferably an isolated polynucleotide.

[0177] For illustrative purposes and in a non-limiting example, the polynucleotide according to the invention is a polynucleotide containing the sequence described in SEQ ID NO: 4.

[0178] The production of polynucleotides described herein is within the skill of the art and can be performed according to recombinant techniques described in particular in the following literature: Sam brook et al., 2001, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Amusable et al., 2003, Current Protocols In Molecular Biology, Greene Publishing Associates & Wiley Interscience, NY; Innis et al. (eds.), 1995, PCR Strategies, Academic Press, Inc., San Diego; and Erliich (ed.), 1994, PCR Technology, Oxford University Press, New York, all of which are incorporated herein by reference.

[0179] The present invention also specifically provides a baculovirus containing a polynucleotide sequence encoding a polypeptide of the present invention, wherein the baculovirus according to the present invention is preferably an isolated baculovirus.

[0180] Furthermore, the present invention provides a plasmid, preferably an expression vector, containing a polynucleotide sequence encoding a polypeptide of the present invention, wherein the plasmid according to the present invention is specifically an isolated plasmid.

[0181] The present invention also provides cells comprising baculovirus or plasmid (preferably expression vector), wherein the baculovirus contains a polynucleotide containing a sequence encoding a polypeptide of the present invention, and the plasmid contains a polynucleotide containing a sequence encoding a polypeptide of the present invention, wherein the cells according to the present invention are preferably isolated cells.

[0182] In another aspect, the present invention also relates to the use of the polypeptides of the present invention, the baculoviruses of the present invention, the immunogenic compositions of the present invention, the polynucleotides of the present invention, the plasmids of the present invention, and / or the cells of the present invention for the preparation of pharmaceuticals (preferably vaccines).

[0183] In this context, the present invention also provides a method for generating the polypeptides of the invention, wherein the method includes the step of infecting cells (preferably insect cells) with the baculovirus of the invention.

[0184] Furthermore, the present invention also provides a method for generating the polypeptides of the present invention, wherein the method includes the step of transfecting cells with plasmids according to the present invention.

[0185] The peptides of the present invention are preferably expressed at high levels with stable self-assembly of sufficient virus-like particles, and they can then be used for single-shot vaccination, especially when they are included in immunogenic compositions, thereby reducing and preventing clinical signs caused by PCV2 infection (such as PCV2b and / or PCV2a infection).

[0186] The present invention is therefore further specifically based on the polypeptides of the present invention or on the immunogenic compositions of the present invention, wherein the polypeptides of the present invention or the immunogenic compositions comprising the polypeptides of the present invention can be used for a specific purpose.

[0187] In one aspect, the present invention thus relates to polypeptides of the present invention or immunogenic compositions comprising polypeptides of the present invention, used in methods for treating or preventing PCV2 infection, alleviating, preventing or treating clinical signs caused by PCV2 infection, or preventing or treating disease caused by PCV2 infection.

[0188] The present invention also provides methods for treating or preventing PCV2 infection, alleviating, preventing or treating clinical signs caused by PCV2 infection, or preventing or treating disease caused by PCV2 infection, said methods comprising administering the polypeptide of the present invention or an immunogenic composition comprising the polypeptide of the present invention to animals, particularly animals in need of such treatment.

[0189] The present invention also provides the use of the polypeptide of the present invention or an immunogenic composition comprising the polypeptide of the present invention for the preparation of a medicament for the treatment or prevention of PCV2 infection, the reduction, prevention or treatment of clinical signs caused by PCV2 infection, or the treatment or prevention of disease caused by PCV2 infection.

[0190] In a preferred aspect, the PCV2 infection as described herein is infection with PCV2 subtype b (PCV2b) and / or infection with PCV2 subtypes other than subtype 2b.

[0191] The term “PCV2 infection” used in this article is equivalent to the term “PCV2 infection”.

[0192] Specifically, infection with PCV2 subtypes other than subtype 2b, as mentioned herein, refers to infection with PCV2 subtype a (PCV2a) and / or PCV2 subtype c (PCV2c), with PCV2a infection being preferred.

[0193] As used herein, the term “PCV2 b subtype (PCV2b) ORF2 protein” refers to the protein encoded by the ORF2 gene of PCV-2b as defined by the standardized nomenclature for the PCV2 genotype definition (Segales, J. et al., 2008, PCV-2 genetype definition and nomenclature, Vet Rec162:867-8, which is incorporated herein by reference).

[0194] According to another preferred aspect, infection with PCV2 subtypes other than subtype 2b, as described herein, is co-infection with the following PCV2 subtypes: (i) PCV2 subtypes other than subtype 2b, and (ii) PCV2b, especially co-infection with PCV2a and PCV2b.

[0195] As used herein, the terms “PCV2a”, “PCV2b”, and “PCV2c” refer to PCV-2a, PCV-2b, and PCV-2c respectively according to the standardized nomenclature for the PCV2 genotype definition (Segales, J. et al., 2008, PCV-2 genetype definition and nomenclature, Vet Rec 162:867-8, which is incorporated herein by reference).

[0196] Specifically, the PCV2b infection mentioned herein refers to the infection of the following PCV2: (i) PCV2 containing a polypeptide having at least 94%, preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, and most preferably at least 99% identity with the sequence of SEQ ID NO: 2, or (ii) PCV2 containing a polynucleotide comprising a sequence encoding a polypeptide having at least 94%, preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, and most preferably at least 99% identity with the sequence of SEQ ID NO: 2.

[0197] Specifically, the term "identical to the sequence of SEQ ID NO: X" as used herein is equivalent to either the term "identical to the sequence of SEQ ID NO: X in length" or the term "identical to the sequence of SEQ ID NO: X over its entire length." In this context, "X" is any integer selected from 1 to 3, such that "SEQ ID NO: X" represents any of the SEQ ID NOs mentioned herein.

[0198] Preferably, the infection of PCV2a as described herein is an infection of the following PCV2: (i) PCV2 comprising a polypeptide having at least 94%, preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, and most preferably at least 99% identity with the sequence of SEQ ID NO: 3, or (ii) PCV2 comprising a polynucleotide comprising a sequence encoding a polypeptide having at least 94%, preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, and most preferably at least 99% identity with the sequence of SEQ ID NO: 3.

[0199] Preferably, in the context of this invention, treatment or prevention of PCV2 infection is based on or comprises the induction of an immune response against said PCV2, or consists of the induction of an immune response against said PCV2, such as clinical signs selected as mentioned herein from lymphatic depletion, lymphatic inflammation, positive IHC for PCV2 antigen in lymphoid tissue, viremia, nasal shedding, fever, reduced mean daily weight gain, pulmonary inflammation, positive IHC for PCV2 antigen in lung tissue, and / or disease as mentioned herein is PMWS.

[0200] Specifically, in the context of this invention, treatment or prevention of infection with PCV2 subtypes other than 2b is based on or includes the induction of an immune response against the PCV2 subtypes other than 2b, or the simultaneous induction of immune responses against the PCV2 subtypes other than 2b and PCV2b, or consists of the induction or simultaneous induction.

[0201] As used herein, the terms “prevention” or “mitigation” refer to, but are not limited to, the process of administering to an animal a PCV2 antigen (i.e., the polypeptide of the invention) included in the composition of the invention, wherein the PCV2 antigen, when administered to the animal, elicits or is capable of eliciting an immune response against PCV2 in the animal. In summary, such treatment results in the reduction of clinical signs of disease caused by PCV2 or clinical signs associated with PCV2 infection. More specifically, as used herein, the terms “prevention” or “prevention” generally refer to a method of prevention in which an animal is exposed to the immunogenic composition of the invention prior to the induction or onset of a disease process caused by PCV2.

[0202] In this document, “reduction of clinical signs associated with PCV2 infection” means, but is not limited to, reducing the number of infected subjects in a group, reducing or eliminating the number of subjects exhibiting clinical signs of infection, or reducing the severity of any clinical signs present in the subjects, compared to wild-type infection. For example, it should represent any reduction in pathogen load, pathogen shedding, pathogen transmission, or any clinical signs of PCV2 infection. Preferably, these clinical signs are reduced by at least 10% in subjects receiving the composition of the present invention compared to subjects who have not received the composition and may become infected. More preferably, clinical signs are reduced by at least 20% in subjects receiving the composition of the present invention, preferably at least 30%, more preferably at least 40%, and even more preferably at least 50%.

[0203] The term "reduction of viremia" refers to, but is not limited to, a reduction in PCV2 virus entering the bloodstream of an animal, wherein the viremia level (i.e., the number of PCV2 RNA copies per mL of serum or the number of plaque-forming colonies per deciliter of serum) is reduced by at least 50% in the serum of a subject receiving the composition of the present invention compared to a subject that has not received the composition and may become infected. More preferably, the viremia level is reduced by at least 90% in a subject receiving the composition of the present invention, preferably at least 99.9%, more preferably at least 99.99%, and even more preferably at least 99.999%.

[0204] The term "viremia" as used in this article is specifically understood as a condition in which PCV2 particles multiply and circulate in the bloodstream of an animal.

[0205] As used herein, the term "animal" specifically refers to mammals, preferably to swine, more preferably to domestic pigs, and most preferably to piglets.

[0206] According to a particularly preferred aspect of the invention, the polypeptide of the invention or the immunogenic composition of the invention is administered only once.

[0207] Preferably, in the context of this invention, the polypeptide of the invention or the immunogenic composition of the invention is to be administered to an animal, particularly only once, preferably to a swine, more preferably to a domestic pig, and especially preferably to a piglet.

[0208] This invention overcomes the inherent problems of the prior art and provides a significant advancement in the level of technology. According to another aspect, the invention also provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in animals (preferably animals with anti-PCV2 antibodies), the method comprising the step of administering an effective amount of the polypeptide of the invention or the immunogenic composition of the invention to the animal requiring such treatment.

[0209] As used herein, the terms "vaccine" or "immunogenic composition" (both terms used synonymously) refer to any pharmaceutical composition containing the polypeptides of the present invention, which can be used to prevent or treat diseases or conditions associated with PCV2 infection in a subject. A preferred immunogenic composition can induce, stimulate, or enhance an immune response against PCV2. The term therefore includes both subunit immunogenic compositions described below, as well as compositions containing intact, killed, attenuated, and / or inactivated PCV2b mutants.

[0210] In particular, the term "PCV2b mutant" as used herein refers to PCV2b mutants comprising the polypeptides of the present invention and / or the polynucleotides of the present invention.

[0211] According to another aspect, the present invention also provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in animals (preferably animals having anti-PCV2 antibodies, particularly maternally derived anti-PCV2 antibodies), the method comprising the steps of administering to the animal requiring such treatment an effective amount of the polypeptide of the present invention or an immunogenic composition comprising the polypeptide of the present invention, wherein the immunogenic composition is a subunit immunogenic composition containing intact, killed or attenuated and / or inactivated PCV2b.

[0212] As used herein, the term "subunit immunogenic composition" refers to a composition containing at least one immunogenic polypeptide or antigen derived from or homologous to an antigen derived from a PCV2b mutant, but not all such antigens. Such compositions substantially do not contain the complete PCV2b mutant. Therefore, "subunit immunogenic compositions" are prepared from at least partially purified or fractionated (preferably substantially purified) immunogenic polypeptides derived from PCV2b mutants or their recombinant analogs. A subunit immunogenic composition may contain one or more target subunit antigens that substantially do not contain other antigens or polypeptides derived from PCV2b mutants, or are in a fractionated form. A preferred immunogenic subunit composition comprises a polypeptide of the invention as described herein.

[0213] "Immune response" refers to, but is not limited to, the cellular and / or antibody-mediated immune response in the host to the target composition or vaccine. Typically, an "immune response" includes, but is not limited to, one or more of the following effects: production or activation of antibodies, B cells, helper T cells, suppressor T cells, and / or cytotoxic T cells that specifically target one or more antigens contained in the target composition or vaccine. Preferably, the host will exhibit a therapeutic or protective immunological (memory) response, thereby enhancing resistance to new infections and / or reducing the clinical severity of disease. Such protection will be demonstrated by a reduction in the number or severity of signs associated with PCV2 infection (particularly PCV2 subtype b (PCV2b) infection and / or infection with PCV2 subtypes other than subtype 2b), or the absence of one or more of these signs, a delay in the onset of viremia, a decrease in viral persistence, a reduction in total viral load, and / or a reduction in viral shedding.

[0214] As used in this article, the term "antigen" refers to an amino acid sequence that elicits the immunological response described above.

[0215] According to another aspect, the immunogenic compositions used herein most preferably comprise the polypeptide of the invention expressed by the polypeptide according to the invention, or a fragment thereof. A preferred polypeptide of the invention is the polypeptide of SEQ ID NO: 1. However, those skilled in the art will understand that this sequence can vary by as much as 1-5% in sequence homology while still retaining its ability to be used as an antigenic feature in the immunogenic compositions according to the invention.

[0216] As is known in the art, "sequence identity" refers to the relationship between two or more polypeptide sequences or two or more polynucleotide sequences (i.e., a reference sequence and a given sequence to be compared with the reference sequence). Sequence identity is determined by comparing the given sequence with the reference sequence after optimal alignment to produce the highest degree of sequence similarity, such as by matching between such sequence strings. After such alignment, sequence identity is determined on a position-by-position basis; for example, if a nucleotide or amino acid residue is the same at a certain position, the sequence is "identical" at that particular position. The total number of such positional similarities is then divided by the total number of nucleotides or residues in the reference sequence to obtain the percentage of sequence identity. Sequence identity can be readily computed using known methods, including, but not limited to, those described in the following literature: Computational Molecular Biology, Lesk, AN, ed., Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48:1073 (1988), whose teachings are incorporated herein by reference. Preferred methods for determining sequence identity are designed to give the maximum match between the sequences being tested. Methods for determining sequence identity are incorporated into publicly available computer programs in which sequence identity is determined between given sequences. Examples of such programs include, but are not limited to, the GCG package (Devereux, J., et al., Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, SF et al., J. Molec.).Biol., 215:403-410 (1990). The BLASTX procedure is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCVI NLM NIHBethesda, MD 20894, Altschul, SF et al., J.Molec.Biol., 215:403-410 (1990), the teachings of which are incorporated herein by reference). These procedures utilize default gap weights to optimally align sequences to produce the highest level of sequence identity between a given sequence and a reference sequence. As an example, for a polynucleotide containing a nucleotide sequence having at least, for example, 85%, preferably 90%, or even more preferably 95% "sequence identity" relative to a reference nucleotide sequence, it means that the nucleotide sequence of the given polynucleotide is identical to the reference sequence except that the given polynucleotide sequence may include up to 15, preferably up to 10, or even more preferably up to 5 point mutations / reference nucleotide sequences per 100 nucleotides. In other words, in a polynucleotide having a nucleotide sequence with at least 85%, preferably 90%, or even more preferably 95% identity with a reference nucleotide sequence, up to 15%, preferably 10%, or even more preferably 5% of the nucleotides in the reference sequence may be deleted or replaced by another nucleotide, or up to 15%, preferably 10%, or even more preferably 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations in the reference sequence can occur at the 5′ or 3′ end positions of the reference nucleotide sequence or anywhere between those end positions, individually scattered among the nucleotides of the reference sequence or scattered within one or more adjacent groups within the reference sequence. Similarly, for a polypeptide containing a given amino acid sequence with at least, for example, 85%, preferably 90%, or even more preferably 95% sequence identity with a reference amino acid sequence, it means that the given amino acid sequence of the polypeptide is identical to the reference sequence, except that the given polypeptide sequence may contain up to 15, preferably up to 10, or even more preferably up to 5 amino acid changes / per 100 amino acids of the reference amino acid sequence. In other words, to obtain a given polypeptide sequence having at least 85%, preferably 90%, or even more preferably 95% sequence identity with a reference amino acid sequence, up to 15%, preferably up to 10%, or even more preferably up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another nucleotide, or up to 15%, preferably up to 10%, or even more preferably up to 5% of the total number of amino acid residues in the reference sequence may be inserted into the reference sequence. These changes to the reference sequence may occur at or anywhere between the amino or carboxyl termini of the reference amino acid sequence, individually scattered between residues in the reference sequence or scattered in one or more adjacent groups within the reference sequence.Preferably, the positions of different residues differ due to conserved amino acid substitutions. However, when determining sequence identity, conserved substitutions are not included as a match.

[0217] As used herein, “sequence homology” refers to a method for determining the relevance of two sequences. To determine sequence homology, two or more sequences are optimally aligned, with gaps introduced if necessary. However, unlike “sequence identity,” conserved amino acid substitutions are counted as matches when determining sequence homology. In other words, to obtain a polypeptide or polynucleotide with 95% sequence homology to a reference sequence, 85%, preferably 90%, even more preferably 95% of the amino acid residues or nucleotides in the reference sequence must match another amino acid or nucleotide or contain a conserved substitution of another amino acid or nucleotide, or at most 15%, preferably at most 10%, even more preferably at most 5% of the total amino acid residues or nucleotides in the reference sequence (excluding conserved substitutions) may be inserted into the reference sequence. Preferably, the homologous sequence comprises a fragment of at least 50, even more preferably at least 100, even more preferably at least 250, and even more preferably at least 500 nucleotides.

[0218] "Conservative substitution" means that an amino acid residue or nucleotide is replaced by another amino acid residue or nucleotide with similar characteristics or properties (including size, hydrophobicity, etc.) without significantly changing the overall function.

[0219] "Separated" means altered from its natural state "by artificial means," that is, if it exists naturally, it has been altered or removed from its original environment, or both. For example, a polynucleotide or polypeptide that exists naturally in a living organism is not "separated," but the same polynucleotide or polypeptide separated from its natural coexisting substance is "separated," as the term is used herein.

[0220] Therefore, according to another aspect, the present invention also provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in animals (preferably animals having anti-PCV2 antibodies, particularly maternally derived anti-PCV2 antibodies), the method comprising the steps of administering to the animal requiring such treatment an effective amount of the polypeptide of the present invention or an immunogenic composition comprising the polypeptide of the present invention, wherein the polypeptide of the present invention is any one of those described herein. Preferably, the polypeptide of the protein of the present invention is: (i) a polypeptide comprising or consisting of the sequence of SEQ ID NO: 1; or (ii) any polypeptide having at least 95% homology to the polypeptide of (i).

[0221] According to another aspect, the polypeptide of the present invention is provided in an immunogenic composition at a protein content level that effectively induces a desired immune response, namely, reducing the occurrence of one or more clinical signs caused by or associated with PCV2 infection, mitigating the severity of one or more clinical signs, or preventing or reducing one or more clinical signs. Preferably, the peptide of the present invention comprises at least 0.2 μg protein / ml of the final immunogenic composition (μg / ml), more preferably about 0.2 to about 400 μg / ml, more preferably about 0.3 to about 200 μg / ml, even more preferably about 0.35 to about 100 μg / ml, more preferably about 0.4 to about 50 μg / ml, more preferably about 0.45 to about 30 μg / ml, more preferably about 0.5 to about 18 μg / ml, even more preferably about 0.6 to about 15 μg / ml, even more preferably about 0.75 to about 8 μg / ml, even more preferably about 1.0 to about 6 μg / ml, more preferably about 1.3 to about 3.0 μg / ml, even more preferably about 1.4 to about 2.5 μg / ml, even more preferably about 1.5 to about 2.0 μg / ml, and most preferably about 1.6 μg / ml.

[0222] According to another aspect, the protein content is at least 0.2 μg of the PCV2bORF-2 protein / dose final immunogenic composition (μg / dose) as described above, more preferably about 0.2 to about 400 μg / dose, more preferably about 0.3 to about 200 μg / dose, even more preferably about 0.35 to about 100 μg / dose, more preferably about 0.4 to about 50 μg / dose, more preferably about 0.45 to about 30 μg / dose, more preferably about 0.5 to about 18 μg / dose, even more preferably about 0.6 to about 15 μg / ml, even more preferably about 0.75 to about 8 μg / dose, even more preferably about 1.0 to about 6 μg / dose, more preferably about 1.3 to about 3.0 μg / dose, even more preferably about 1.4 to about 2.5 μg / dose, even more preferably about 1.5 to about 2.0 μg / dose, and most preferably about 1.6 μg / dose. Furthermore, the content level (antigen content) of the polypeptide of the present invention, less than 20 μg / dose, preferably about 0.5-18 μg / dose, is suitable for immunizing young animals and / or in animals that are positive for PCV2 antibodies (especially those positive for maternally derived anti-PCV2 antibodies). Therefore, according to another aspect, the present invention also provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in animals (preferably animals with anti-PCV2 antibodies, especially maternally derived anti-PCV2 antibodies), the method comprising the step of administering to the animal requiring such treatment less than 20 μg / dose, preferably about 0.5-18 μg / dose, of the polypeptide of the present invention or an immunogenic composition containing the polypeptide of the present invention. The polypeptide of the present invention is any one of those described in this patent application.

[0223] The polypeptides of the present invention used in the immunogenic compositions according to the present invention can be derived in any manner, including isolating and purifying the polypeptides of the present invention, standard protein synthesis and recombinant methodologies. Preferred methods for obtaining the polypeptides of the present invention are provided in WO06 / 072065, the teachings and contents of which are hereby incorporated by reference in their entirety, as it has been surprisingly found that the methods described therein for obtaining the PCV2a ORF-2 polypeptide can be correspondingly used to obtain the polypeptides of the present invention. In short, susceptible cells are infected with a recombinant viral vector containing a DNA coding sequence encoding the polypeptide of the present invention, the recombinant virus expressing the polypeptide of the present invention, and the expressed polypeptide of the present invention is recovered from the supernatant by filtration and inactivated by any conventional method, preferably using binary ethVlenimine, and then neutralized to stop the inactivation process.

[0224] The immunogenic compositions used herein also refer to compositions comprising i) any of the polypeptides of the present invention described above, preferably at the concentrations described above; and ii) a viral vector (preferably recombinant baculovirus) expressing at least a portion of the polypeptide of the present invention. Furthermore, the immunogenic composition may comprise i) any of the polypeptides of the present invention described above, preferably at the concentrations described above; ii) a viral vector (preferably recombinant baculovirus) expressing at least a portion of the polypeptide of the present invention; and iii) a portion of cell culture supernatant.

[0225] Therefore, according to another aspect, the present invention also provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in animals (preferably animals having anti-PCV2 antibodies, particularly maternally derived anti-PCV2 antibodies), the method comprising the steps of administering to the animal requiring such treatment an effective amount of the polypeptide of the present invention or an immunogenic composition comprising the polypeptide of the present invention, wherein the polypeptide of the present invention is recombinant, preferably baculovirus-expressed, the polypeptide of the present invention. Preferably, those recombinant or baculovirus-expressed polypeptides of the present invention have the sequence as described above.

[0226] The immunogenic compositions used herein also refer to compositions comprising i) any of the polypeptides of the present invention described above, preferably at the concentrations described above, ii) a viral vector (preferably a recombinant baculovirus) expressing at least a portion of the polypeptides of the present invention, and iii) a portion of a cell culture; wherein about 90% of the components have a size of less than 1 μm.

[0227] The immunogenic compositions used herein also refer to compositions comprising i) any of the polypeptides of the present invention described above, preferably at the concentrations described above, ii) a viral vector expressing at least a portion of the polypeptides of the present invention, iii) a portion of a cell culture, iv) and an inactivating agent, preferably BEI, for inactivating the recombinant viral vector, wherein about 90% of components i) to iii) have a size of less than 1 μm. Preferably, the BEI is present at a concentration that effectively inactivates baculoviruses, preferably in an amount of 2 to about 8 mM BEI, preferably about 5 mM BEI.

[0228] The immunogenic compositions used herein also refer to compositions comprising i) any of the polypeptides of the present invention described above, preferably at the concentrations described above, ii) a viral vector expressing at least a portion of the polypeptides of the present invention, iii) a portion of a cell culture, iv) an inactivating agent, preferably BEI, for inactivating the recombinant viral vector, and v) a neutralizing agent for stopping inactivation mediated by the inactivating agent, wherein about 90% of components i) to iii) have a size of less than 1 μm. Preferably, if the inactivating agent is BEI, the composition comprises sodium thiosulfate in an amount equivalent to that of BEI.

[0229] The protein is incorporated into a composition that can be administered to animals susceptible to PCV2 infection. In a preferred form, the composition may also include additional components known to those skilled in the art (see also Remington's Pharmaceutical Sciences (1990). 18th edition, Mack Publ., Easton). Additionally, the composition may include one or more veterinary-acceptable carriers. As used herein, "veterinary-acceptable carrier" includes any and all solvents, dispersion media, coating agents, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delay agents, etc. In a preferred embodiment, the immunogenic composition comprises the polypeptide of the invention provided accompanying, preferably mixed with an adjuvant (preferably Carbopol) and physiological saline at the concentrations described above.

[0230] Those skilled in the art will understand that the compositions used herein may comprise known injectable, physiologically acceptable sterile solutions. Aqueous isotonic solutions (e.g., saline or corresponding plasma protein solutions) are readily available for preparing ready-to-use solutions for parenteral injection or infusion. Additionally, the immunogenic compositions and vaccine compositions of the present invention may include diluents, isotonic agents, stabilizers, or adjuvants. Diluents may include water, saline, glucose, ethanol, glycerol, etc. Isotonic agents may include, in particular, sodium chloride, glucose, mannitol, sorbitol, and lactose. Stabilizers include, in particular, alkaline salts of albumin and ethylenediaminetetraacetic acid.

[0231] The term "adjuvant" as used herein may include aluminum hydroxide and aluminum phosphate; saponins, such as Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), and GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL); water-in-oil emulsions; oil-in-water emulsions; and water-in-oil-in-water emulsions. The emulsions may be based, in particular, on light liquid paraffin oils (European Pharmacopoeia type); isoprene-like oils, such as squalane or squalene oils resulting from the oligomerization of olefins (especially isobutylene or decene); esters of acids or alcohols containing straight-chain alkyl groups, more specifically vegetable oils, ethyl oleate, propylene glycol di-(caprylate / caprate), glyceryl tri-(caprylate / caprate), or propylene glycol dioleate; and esters of branched-chain fatty acids or alcohols, especially isostearates. The oils are used in combination with emulsifiers to form the emulsion. The emulsifier is preferably a nonionic surfactant, specifically an ester of sorbitol, an ester of dimannitol (e.g., dehydrated mannitol oleate), an ester of glycol, an ester of polyglycerol, an ester of propylene glycol, and an ester of oleic acid, isostearic acid, castor oil, or hydroxystearic acid (which are optionally ethoxylated), and a polyoxypropylene-polyoxyethylene copolymer block, specifically a Pluronic product, especially L121. See Hunter et al., The Theory and Practical Application of Adjuvants (Stewart-Tull, DES ed.). John Wiley and Sons, NY, pp. 51-94 (1995) and Todd et al., Vaccine 15: 564-570 (1997).

[0232] For example, the SPT emulsion described on page 147 of "Vaccine Design, The Subunit and Adjuvant Approach" (edited by M. Powell and M. Newman, Plenum Press, 1995) and the emulsion MF59 described on page 183 of the same book may be used.

[0233] Another example of adjuvants is compounds selected from polymers of acrylic acid or methacrylic acid and copolymers of maleic anhydride with alkenyl derivatives. Advantageous adjuvant compounds are polymers of acrylic acid or methacrylic acid, particularly crosslinked with polyolefin ethers of sugars or polyols. These compounds are known by the term carbomer (Pharmeuropa Vol. 8, No. 2, June 1996). Those skilled in the art may also refer to U.S. Patent No. 2,909,462, which describes such acrylic polymers crosslinked with polyhydroxylated compounds having at least three (preferably no more than eight) hydroxyl groups, the hydrogen atoms of which are replaced by unsaturated aliphatic residues having at least two carbon atoms. Preferred residues are those containing 2-4 carbon atoms, for example, vinyl, allyl, and other olefinic unsaturated groups. The unsaturated residues themselves may contain other substituents such as methyl. Products sold under the name Carbopol (BF Goodrich, Ohio, USA) are particularly suitable. They are crosslinked with allyl sucrose or with allyl pentaerythritol. Carbopol 974P, 934P, and 971P may be mentioned. Carbopol is most preferred, especially Carbopol 971P, preferably used in amounts of about 500 μg to about 5 mg per dose, even more preferably in amounts of about 750 μg to about 2.5 mg per dose, and most preferably in amounts of about 1 mg per dose.

[0234] Other suitable adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), block copolymers (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophospholipid A, avridin lipid-amine adjuvant, heat-labile enterotoxins derived from Escherichia coli (E. coli) (recombinant or otherwise), cholera toxin, IMS1314, or muramyl dipeptide.

[0235] Preferably, the adjuvant is added in an amount of about 100 μg to about 10 mg per dose. Even more preferably, the adjuvant is added in an amount of about 100 μg to about 10 mg per dose. Even more preferably, the adjuvant is added in an amount of about 500 μg to about 5 mg per dose. Even more preferably, the adjuvant is added in an amount of about 750 μg to about 2.5 mg per dose. Most preferably, the adjuvant is added in an amount of about 1 mg per dose.

[0236] Additionally, the composition may include one or more pharmaceutically acceptable carriers. As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coating agents, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delay agents, etc. Most preferably, the composition thus provided contains the polypeptide of the invention recovered from the supernatant of cells cultured in vitro, wherein the cells are infected with a recombinant viral vector containing DNA encoding and expressing the polypeptide of the invention, and wherein the cell culture is treated with about 2 to about 8 mM BEI, preferably about 5 mM BEI (to inactivate the viral vector), and an equivalent concentration of a neutralizing agent (preferably sodium thiosulfate solution, with a final concentration of about 2 to about 8 mM, preferably about 5 mM).

[0237] The present invention also relates to an immunogenic composition comprising i) any of the polypeptides of the present invention described above, preferably at the concentrations described above; ii) a viral vector expressing at least a portion of the polypeptides of the present invention; iii) a portion of a cell culture; iv) an inactivating agent for inactivating the recombinant viral vector, preferably BEI; and v) a neutralizing agent for stopping inactivation mediated by the inactivating agent, preferably in an amount equivalent to BEI of sodium thiosulfate; and vi) a suitable adjuvant, preferably in the amounts described above of Carbopol 971; wherein about 90% of components i) to iii) have a size of less than 1 μm. According to another aspect, the immunogenic composition further comprises a pharmaceutically acceptable salt, preferably a physiologically acceptable concentration of phosphate. Preferably, the pH of the immunogenic composition is adjusted to a physiological pH, which is between about 6.5 and 7.5.

[0238] The immunogenic composition used herein also refers to a composition comprising, per 1 ml: (i) at least 1.6 μg of the polypeptide of the present invention described above, preferably less than 20 μg; (ii) at least a portion of a baculovirus expressing the polypeptide of the present invention; (iii) a portion of a cell culture; (iv) about 2-8 mM BEI; (v) an amount of sodium thiosulfate equivalent to BEI; and (vi) about 1 mg Carbopol 971; and (vii) a physiologically acceptable concentration of phosphate; wherein about 90% of components (i) to (iii) have a size of less than 1 μm, and the pH of the immunogenic composition is adjusted to about 6.5-7.5.

[0239] The immunogenic composition may further include one or more other immunomodulators, such as interleukins, interferons, or other cytokines. The immunogenic composition may also include gentamicin and thimerosal. Although those skilled in the art can readily determine the amounts and concentrations of adjuvants and additives useful in the context of this invention, the invention contemplates compositions comprising about 50 μg to about 2000 μg of adjuvant and preferably about 250 μg / ml of vaccine composition. Therefore, the immunogenic composition used herein also refers to a composition comprising about 1 μg / ml to about 60 μg / ml of antibiotic, and more preferably less than about 30 μg / ml of antibiotic.

[0240] The immunogenic compositions used herein also refer to compositions comprising (i) any of the polypeptides of the present invention described above, preferably at the concentrations described above; (ii) a viral vector expressing at least a portion of the polypeptides of the present invention; (iii) a portion of a cell culture; (iv) an inactivating agent for inactivating the recombinant viral vector, preferably BEI; and (v) a neutralizing agent for stopping inactivation mediated by the inactivating agent, preferably in an amount equivalent to BEI of sodium thiosulfate; (vi) a suitable adjuvant, preferably in the amount described above of Carbopol 971; (vii) a saline buffer of a pharmaceutically acceptable concentration, preferably a saline buffer of a pharmaceutically acceptable concentration of phosphate; and (viii) an antimicrobial active agent; wherein about 90% of components (i) to (iii) have a size of less than 1 μm.

[0241] To investigate the potential interference of maternal antibodies with the peptides of the present invention, a study can be conducted in which antibody titers in study animals are determined at vaccination, and then said antibody titers are categorized into low, intermediate, and high antibody grades: a geometric mean titer <1:100 is considered low antibody titer, a titer between 1:100 and 1:1000 is considered intermediate antibody titer, and a titer >1:1000 is considered high antibody titer. This grouping can be comparable to that implemented in a Canadian field study, where an antibody titer of 1:80 is considered low, an antibody titer of 1:640 is considered intermediate, and an antibody titer >1:1280 is considered high (Larochelle et al., 2003, Can. J. Vet. Res.; 67: 114-120). To analyze the effects of low, intermediate, and high antibody titers at vaccination on viremia, vaccinated and placebo-treated animals are compared regarding the onset, endpoint, duration, number of days to positive sampling, and viral load of viremia. The presence of anti-PCV2 antibodies, especially maternally derived antibodies, preferably has no significant effect on any of those parameters. In other words, the efficacy of the peptides of the present invention in preventing and treating PCV2 infection in animals, or in alleviating clinical signs caused by or related to PCV2 infection, is preferably unaffected by the presence of anti-PCV2 antibodies on the day of vaccination, and preferably unaffected by anti-PCV2 antibody titers as high as 1:100, preferably exceeding 1:100, even more preferably exceeding 1:250, even more preferably exceeding 1:500, even more preferably exceeding 1:640, even more preferably exceeding 1:750, and most preferably exceeding 1:1000. This effect can be confirmed in single-vaccination experiments, meaning that the peptides of the present invention are administered only once without any subsequent administration of the peptides of the present invention.

[0242] Methods for detecting and quantifying anti-PCV2 antibodies are well known in the art. For example, the detection and quantification of PCV2 antibodies can be performed by indirect immunofluorescence methods described in Magar et al., 2000, Can. J. Vet Res.; 64: 184-186 or Magar et al., 2000, J. Comp. Pathol.; 123: 258-269. Other assays for quantifying anti-PCV2 antibodies are described in Opriessnig et al., 2006, 37th Annual Meeting of the American Association of Swine Veterinarians. In addition, an indirect immunofluorescence assay that can be used by those skilled in the art includes the following steps: seeding approximately 20,000-60,000 PK15 or VIDO R1 cells / well into a 96-well plate; infecting the cells with PCV2 isolate when the monolayer is approximately 65-85% confluent; incubating the infected cells for 48 hours; removing the culture medium and washing the cells twice with PBS; discarding the washing buffer and treating the cells with a cold 50 / 50 methanol / acetone fixative (~100 μl / well) at approximately -20°C for approximately 15 min; discarding the fixative and air-drying the plates; preparing a series of dilutions of porcine serum samples in PBS and a series of dilutions of anti-PCV2 positive and negative control samples (positive and negative control samples); adding the series of dilutions to the plates and incubating to allow antibody binding (if present in the serum samples) for approximately 1 hour. At 36.5±1℃, wash the plates three times with PBS and discard the PBS; stain the plates with a commercially available goat anti-porcine FITC conjugate diluted 1:100 in PBS and incubate for approximately 1 hour. At 36.5±1℃, remove the microplates from the incubator, discard the conjugate, and wash the plates twice with PBS; read the plates using a UV microscope and report each well as positive or negative, using positive and negative control samples to monitor the assay system; calculate the serum antibody titer using the highest dilution exhibiting specific IFA reactivity and the number of positive wells at each dilution, or calculate the 50% endpoint using the appropriate Reed-Muench formula.

[0243] Such measurements are described in Example 2 of WO 2008 / 076915A2.

[0244] In the event of controversial results and any questions of doubt, the anti-PCV2 titers mentioned herein represent those estimated / estimated by this assay.

[0245] Therefore, according to another aspect, the present invention provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in animals (preferably animals having anti-PCV2 antibodies, particularly maternal antibodies), the method comprising the steps of administering an effective amount of the polypeptide of the present invention, preferably less than 20 μg / dose, to the animal requiring such treatment, wherein the animal has a detectable anti-PCV2 antibody titer of up to 1:100, preferably more than 1:100, even more preferably more than 1:250, even more preferably more than 1:500, even more preferably 1:640, even more preferably more than 1:750, and most preferably more than 1:1000. Preferably, those anti-PCV2 antibody titers are detectable and quantifiable in a specific anti-PCV2 immunoassay, preferably in an assay as described above, such as exemplarily described in Example 2 of WO 2008 / 076915A2. More preferably, those anti-PCV2 antibodies are maternally derived antibodies. Most preferably, the polypeptide of the present invention is administered only once, preferably at a dose of less than 20 μg / dose.

[0246] Piglets with only low (<1:100) or medium (<1:1000) titers of maternally derived anti-PCV2 antibodies are insufficient to protect against PCV2 infection occurring before 3 weeks of age. Therefore, vaccination at a very early stage of life is desirable. In the context of this invention, vaccination / treatment of animals at or before 3 weeks of age is preferred. Furthermore, anti-PCV2 antibody titers exceeding 1:1000 preferably have no effect on the efficacy of the PCV2 vaccine, regardless of the existing initial antibody titer level. For example, vaccination of high-titer animals (>1:1000 anti-PCV2 antibody titers) preferably results in a shorter duration of viremia, an earlier viremia endpoint, fewer days of viremia sampling, and a reduction in the total number of genomic equivalents / ml compared to unvaccinated control animals. No significant differences were preferably observed in the various parameters regarding PCV2 viremia after comparing vaccinated “high,” “medium,” and “low-titer” animals. Even in the presence of anti-PCV2 antibody titers, the polypeptide of the present invention used for vaccination preferably still significantly reduces viremia in the blood (endpoint of viremia, duration of viremia, viral load). Preferably, no difference in live weight was found when comparing low- and high-titer animals in the vaccinated group. Furthermore, vaccinated animals with high anti-PCV2 antibody titers (>1:1000) at the time of vaccination / treatment also preferably showed significantly higher body weight after the onset of viremia compared to placebo-treated animals with initial high antibody titers. As a result, according to a preferred aspect, vaccination / treatment with the polypeptide of the present invention may be performed on animals 1 day old or older. However, vaccination should be performed within the first 8 weeks of age, preferably within the first 7 weeks of age. Therefore, according to another aspect, the present invention provides a method for treating or preventing PCV2 infection or reducing clinical signs caused by or related to PCV2 infection in animals, the method comprising the step of administering an effective amount of the polypeptide of the present invention to the animal requiring such treatment at 1 day old or slightly later, preferably but not later than 8 weeks of age. According to a preferred embodiment, the animal is given an immunization dose of less than 20 μg / dose of the polypeptide of the present invention. According to a more preferred embodiment, the animal requiring this treatment is given only a single dose of the polypeptide of the present invention, preferably less than 20 μg / dose.

[0247] According to another, more general aspect, the present invention provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in young animals, the method comprising the step of administering an effective amount of the polypeptide of the present invention to the animal requiring such treatment.

[0248] As used herein, the term "young animal" refers to animals aged 1-22 days. Preferably, the term "young animal" refers to animals aged 1-20 days. More preferably, the term "young animal" refers to animals aged 1-15 days, even more preferably animals aged 1-14 days, even more preferably animals aged 1-12 days, even more preferably animals aged 1-10 days, even more preferably animals aged 1-8 days, even more preferably animals aged 1-7 days, even more preferably animals aged 1-6 days, even more preferably animals aged 1-5 days, even more preferably animals aged 1-4 days, even more preferably animals aged 1-3 days, even more preferably animals aged 1 or 2 days, and most preferably animals aged 1 day. Therefore, according to another aspect, the present invention provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in young animals, the method comprising the steps of administering an effective amount of the polypeptide of the present invention to animals requiring such treatment that are 1-22 days old, preferably 1-20 days old, more preferably 1-15 days old, even more preferably 1-14 days old, even more preferably 1-12 days old, even more preferably 1-10 days old, even more preferably 1-8 days old, even more preferably 1-7 days old, even more preferably 1-6 days old, even more preferably 1-5 days old, even more preferably 1-4 days old, even more preferably 1-3 days old, even more preferably 1 or 2 days old, and most preferably 1 day old. For example, vaccination / treatment at 19-22 days of age preferably shows high vaccination efficacy. Furthermore, vaccination / treatment at 12-18 days of age, preferably 12-14 days, is preferably very effective in alleviating clinical signs associated with PCV2 infection, reducing total viral load, shortening the duration of viremia, delaying the onset of viremia, and increasing body weight. Additionally, vaccination at 1 week of age is preferably very effective in alleviating clinical signs associated with PCV2 infection, reducing total viral load, shortening the duration of viremia, delaying the onset of viremia, and increasing body weight. Preferably, in those young animals, immunization requires less than 20 μg / dose of the polypeptide of the present invention. According to a more preferred embodiment, young animals requiring this treatment are given only a single administration of the polypeptide of the present invention, preferably less than 20 μg.

[0249] Since PCV2 is ubiquitous in the wild, most young piglets are seropositive for PCV2. Therefore, according to another aspect, the present invention provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in young animals (preferably animals with anti-PCV2 antibodies on the day of vaccination), the method comprising the steps of: administering an effective amount of the polypeptide of the present invention to animals requiring such treatment at 1-22 days of age, preferably 1-20 days of age, more preferably 1-15 days of age, even more preferably 1-14 days of age, even more preferably 1-12 days of age, even more preferably 1-10 days of age, even more preferably 1-8 days of age, even more preferably 1-7 days of age, even more preferably 1-6 days of age, even more preferably 1-5 days of age, even more preferably 1-4 days of age, even more preferably 1-3 days of age, even more preferably at 1 or 2 days of age, and most preferably 1 day of age. Preferably, the young animals have a detectable anti-PCV2 antibody titer of up to 1:100 on the day of vaccination / treatment, preferably exceeding 1:100, even more preferably exceeding 1:250, even more preferably exceeding 1:500, even more preferably exceeding 1:640, even more preferably exceeding 1:750, and most preferably exceeding 1:1000 on the day of vaccination / treatment. Preferably, sufficient immunization in those young animals requires less than 20 μg / dose of the polypeptide of the present invention. According to a more preferred embodiment, the young animals requiring this treatment are given only a single dose of the polypeptide of the present invention, preferably less than 20 μg.

[0250] As described above, vaccination / treatment of young animals with the peptides of the present invention preferably results in a shorter viremia phase compared to unvaccinated control animals. The average reduction in time compared to unvaccinated control animals of the same species can preferably be, for example, 9.5 days. Therefore, according to another aspect, the present invention also provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in young animals, the method comprising the steps of administering an effective amount of the peptides of the present invention to the animal requiring such treatment, wherein the treatment or prevention results in a reduction of the viremia phase by 5 days or more, preferably 6 days or more, even more preferably 7 days or more, even more preferably 8 days or more, even more preferably 9 days, even more preferably 10 days, even more preferably 12 days, even more preferably 14 days, and most preferably more than 16 days, compared to untreated control animals of the same species. In some cases, the viremia phase is preferably reduced by more than 20 days. Generally, vaccination of young piglets preferably results in reduced weight gain loss, shorter duration of viremia, earlier viremia endpoint, and lower viral load. Therefore, according to another aspect, the present invention provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in young animals, the method comprising the steps of administering an effective amount of the polypeptide of the present invention to the animal requiring such treatment, wherein the treatment or prevention of PCV2 infection results in an improvement in vaccine efficacy parameters selected from the following compared to an untreated control animal of the same species: reduced weight gain loss, shorter duration of viremia, earlier viremia endpoint, lower viral load, or combinations thereof. Preferably, any of the above-described improved vaccine efficacy parameters require less than 20 μg / dose of the polypeptide of the present invention. Moreover, such improved vaccine efficacy parameters are achieved by a single administration of only one dose.

[0251] As used herein, the term "effective amount" refers to, but is not limited to, the amount of the polypeptide of the present invention that elicits or is capable of eliciting an immune response in animals to which the effective amount of the polypeptide of the present invention has been administered. Preferably, the effective amount is defined as the amount of the polypeptide of the present invention that confers an immune duration of at least 10 weeks (DOI), preferably at least 12 weeks (DOI), more preferably at least 15 weeks (DOI), and most preferably at least 20 weeks (DOI).

[0252] The effective dose depends on the vaccine's composition and administration schedule. Typically, when inactivated virus or modified live virus products are used in combination vaccines, the amount contains approximately 10... 2.0 To about 10 9.0 TCID 50 / dose, preferably about 10 3.0 To about 10 8.0TCID 50 / dose, more preferably about 10 4.0 To about 10 8.0 TCID 50 / dose. Specifically, when modified live PCV2 is used in a vaccine, the recommended dose for administering to susceptible animals is preferably about 10. 3.0 TCID 50 (50% endpoint tissue culture infection dose) / dose to approximately 10 6.0 TCID 50 / dose, and more preferably about 10 4.0 TCID 50 / dose to approximately 10 5.0 TCID 50 / dose. Generally, when using purified antigens, the amount of antigen will be between 0.2 and 5000 micrograms and 10 2.0 Up to 10 9.0 TCID 50 Between, 10 are preferred 6.0 Up to 10 6.0 TCID 50 Between, preferably 10 4.0 Up to 10 5.0 TCID 50 between.

[0253] Subunit vaccines are generally administered at a protein content level of at least 0.2 μg protein per dose, preferably about 0.2 to about 400 μg per dose, more preferably about 0.3 to about 200 μg per dose, even more preferably about 0.35 to about 100 μg per dose, more preferably about 0.4 to about 50 μg per dose, more preferably about 0.45 to about 30 μg per dose, more preferably about 0.5 to about 18 μg per dose, more preferably about 0.6 to about 16 μg per dose, even more preferably about 0.75 to about 8 μg per dose, even more preferably about 1.0 to about 6 μg per dose, and more preferably about 1.3 to about 3.0 μg per dose.

[0254] Preferably, prophylactic application of the immunogenic compositions described above can effectively reduce clinical signs caused by or related to PCV2 infection, preferably in young animals and / or animals with passive immunization against PCV2 on the day of treatment. Specifically, prophylactic application of the immunogenic compositions as described herein and, in particular, compositions comprising the peptides of the present invention, can preferably effectively reduce lymphadenopathy, lymphatic depletion, and / or multinucleated / giant cells in animals infected with PCV2 on the day of treatment / vaccination and possessing maternal anti-PCV-2 antibodies. For example, prophylactic application of the immunogenic compositions as described herein has been found to effectively reduce lymphatic depletion, lymphatic inflammation, positive IHC for PCV2 antigen in lymphoid tissue, viremia, nasal shedding, fever, reduced mean daily weight gain, pulmonary inflammation, and positive IHC for PCV2 antigen in lung tissue.

[0255] Furthermore, the prophylactic application of the immunogenic composition described herein is preferably effective in alleviating (1) interstitial pneumonia with interlobular edema, (2) pale skin or jaundice, and (3) spotted atrophic liver.

[0256] (4) Gastric ulcers, (5) Nephritis and (6) Reproductive disorders, such as abortion, stillbirth, mummification, etc., (7) Pia-like lesions, generally considered to be associated with Lawsonia intracellularis infection (ileitis), (8) Lymphadenopathy, (9) Lymphatic depletion, and / or (10) Multinucleated / giant histiocytosis, (11) Porcine dermatitis and nephrotic syndrome (PDNS), (12) PCVAD-related mortality, (13) PCVAD-related weight loss, (14) Reduced growth variability, (15) Reduced frequency of “dwarfism”, (16) Reduced co-infection with porcine reproductive and respiratory disease syndrome (PRRSV). Such immunogenic compositions also effectively improve economically important growth parameters such as slaughter time, carcass weight and lean meat ratio. Therefore, the term "clinical signs" used in this article refers to, but is not limited to, (1) interstitial pneumonia with interlobular edema, (2) pale skin or jaundice, (3) spotted atrophic liver, (4) gastric ulcer, (5) nephritis, and (6) reproductive disorders such as miscarriage, stillbirth, mummification, etc., and (7) pia-like lesions, which are generally considered to be associated with intracellular Lawsonia. (8) Intracellularis infection (ileitis), (9) Lymphadenopathy, (10) Lymphatic depletion and / or (11) Multinucleated / giant histiocytosis, (12) Porcine dermatitis and nephropathy syndrome (PDNS), (13) PCVAD-related death, (14) PCVAD-related weight loss, (15) Decreased growth variability, (16) Decreased frequency of “dwarfism”, (17) Decreased co-infection with porcine reproductive and respiratory disease syndrome (PRRSV), (18) Lymphatic inflammation, (19) Positive IHC for PCV2 antigen in lymphoid tissue, (20) Viremia, (21) Nasal shedding, (22) Fever, (23) Decreased mean daily weight gain, (24) Pulmonary inflammation, (25) Positive IHC for PCV2 antigen in lung tissue. Furthermore, the immunogenic compositions described herein reduce total circovirus load, including delayed onset, shorter duration, earlier viremia endpoint, and reduced viral load and its immunosuppressive effects in young animals (especially those with anti-PCV2 antibodies on the day of vaccination), resulting in higher levels of overall disease resistance and a reduced incidence of PCV2-related disease and clinical signs.

[0257] Therefore, according to another aspect, the present invention provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in young animals and / or in animals (preferably animals with anti-PCV2 antibodies), the method comprising the steps of administering to the animal requiring such treatment an effective amount of the polypeptide of the present invention or an immunogenic composition comprising the polypeptide of the present invention, wherein those clinical signs are selected from (1) interstitial pneumonia with interlobular edema, (2) pale skin or jaundice, (3) spotted atrophic liver, (4) gastric ulcer, (5) nephritis, and (6) reproductive disorders, such as abortion, stillbirth, mummification, etc., and (7) pia-like lesions, generally considered to be associated with Lawsonia intracellularis. (8) Intracellularis infection (ileitis), (9) Lymphadenopathy, (10) Lymphatic depletion and / or (11) Multinucleated / giant histiocytosis, (12) Porcine dermatitis and nephropathy syndrome (PDNS), (13) PCVAD-related death, (14) PCVAD-related weight loss, (15) Decreased growth variability, (16) Decreased frequency of “dwarfism”, (17) Decreased co-infection with porcine reproductive and respiratory disease syndrome (PRRSV), (18) Lymphatic inflammation, (19) Positive IHC for PCV2 antigen in lymphoid tissue, (20) Viremia, (21) Nasal shedding, (22) Fever, (23) Decreased mean daily weight gain, (24) Pulmonary inflammation, (25) Positive IHC for PCV2 antigen in lung tissue.According to another aspect, the present invention provides a method for treating or preventing PCV2 infection or alleviating clinical signs caused by or related to PCV2 infection in young animals, the method comprising the steps of administering an effective amount of the polypeptide of the present invention to the animal requiring such treatment, wherein the clinical signs are selected from (1) interstitial pneumonia with interlobular edema, (2) pale skin or jaundice, (3) spotted atrophic liver, (4) gastric ulcer, (5) nephritis, and (6) reproductive disorders, such as abortion, stillbirth, mummification, etc., and (7) pia-like lesions, generally considered to be associated with Lawsonia intracellularis. (8) Intracellularis infection (ileitis), (9) Lymphadenopathy, (10) Lymphatic depletion and / or (11) Multinucleated / giant histiocytosis, (12) Porcine dermatitis and nephropathy syndrome (PDNS), (13) PCVAD-related death, (14) PCVAD-related weight loss, (15) Decreased growth variability, (16) Decreased frequency of “dwarfism”, (17) Decreased co-infection with porcine reproductive and respiratory disease syndrome (PRRSV), (18) Lymphatic inflammation, (19) Positive IHC for PCV2 antigen in lymphoid tissue, (20) Viremia, (21) Nasal shedding, (22) Fever, (23) Decreased mean daily weight gain, (24) Pulmonary inflammation, (25) Positive IHC for PCV2 antigen in lung tissue.

[0258] The compositions according to the invention can be administered orally, intradermally, intratracheally, or intravaginally. The compositions are preferably administered intramuscularly or intranasally, with intramuscular administration being most preferred. In animals, it has been shown that administration of the pharmaceutical compositions described above via intravenous or direct injection into the target tissue is advantageous. For systemic administration, intravenous, intravascular, intramuscular, intranasal, intra-arterial, intraperitoneal, oral, or intrathecal routes are preferred. More local administration can be achieved subcutaneously, intradermally, intradermally, intragastric, intralobularly, intramedullary, intrapulmonary, or directly in or near the tissue to be treated (connective tissue, bone tissue, muscle tissue, nerve tissue, epithelial tissue). Depending on the desired duration and effectiveness of treatment, the compositions according to the invention can be administered once or several times (and also intermittently, for example, daily for several days, weeks, or months) and at different doses.

[0259] Preferably, an intramuscular administration of one dose of the immunogenic composition as described above is given to the recipient in need. According to another aspect, the polypeptide of the present invention as described herein, or an immunogenic composition containing any such polypeptide of the present invention, is bottled and administered in one (1) mL / dose. Thus, according to another aspect, the present invention also provides a 1 mL immunogenic composition containing the polypeptide of the present invention as described herein, for the treatment or prevention of PCV2 infection or the reduction of clinical signs caused by or related to PCV2 infection in young animals, comprising the step of administering an effective amount of the polypeptide of the present invention to the animal requiring such treatment. According to another aspect, the present invention also provides a 1 mL immunogenic composition containing the polypeptide of the present invention as described herein, for the treatment or prevention of PCV2 infection or the reduction of clinical signs caused by or related to PCV2 infection in animals (preferably animals with anti-PCV2 antibodies), comprising the step of administering an effective amount of the polypeptide of the present invention or an immunogenic composition containing the polypeptide of the present invention to the animal requiring such treatment.

[0260] According to another aspect, at least one dose of the immunogenic composition as described above is additionally administered to the subject in need at least once, wherein the second or any additional administration is given at least 14 days after the initial or any previous administration. Preferably, the immunogenic composition is administered together with an immunostimulant. Preferably, the immunostimulant is administered at least twice. Preferably, there is at least 3 days between the first and second or any additional administration of the immunostimulant, more preferably at least 5 days, and even more preferably at least 7 days. Preferably, the immunostimulant is administered at least 10 days, preferably 15 days, even more preferably 20 days, and even more preferably at least 22 days after the initial administration of the immunogenic composition provided herein. A preferred immunostimulant is, for example, keyhole hemocyanin (KLH), preferably emulsified with incomplete Freund's adjuvant (KLH / ICFA). However, it should be understood that any other immunostimulant known to those skilled in the art may also be used. The term "immunostimulant" as used herein refers to any reagent or composition that can trigger an immune response, preferably without inducing or increasing a specific immune response (e.g., an immune response against a specific pathogen). Further instructions were given to administer an appropriate dose of the immunostimulant.

[0261] Detailed description of the preferred implementation scheme

[0262] The following examples illustrate preferred materials and procedures according to the invention. While any methods and materials similar to or equivalent to those described herein may be used in the practice or testing of the invention, preferred methods, apparatus, and materials are described here. However, it should be understood that these examples are provided illustratively only, and nothing herein should be considered as limiting the overall scope of the invention.

[0263] Example 1

[0264] Material and Procedure / Mutant Design

[0265] Using the Clustal W method, in the product The amino acid sequence of PCV2aORF2 of the included PCV2ORF2 protein was compared with the amino acid sequence of PCV2b ORF2 BDH and many other published PCV2a and PCV2b ORF2 amino acid sequences obtained from GenBank. The locations of major amino acid differences between the PCV2a and PCV2b ORF2 sequences were identified as potential mutation sites (see [link to relevant documentation]). Figure 1 Seven PCV2b ORF2 coding sequences were prepared using identified major amino acid changes, with corresponding amino acids from PCV2a ORF2 swapped from the PCV2b ORF2 BDH. PCV2a ORF2... The codon encodes the mutated amino acid.

[0266] The following describes in detail the seven PCV2b ORF2 mutant constructs:

[0267] 1. PCV2b ORF2 BDH K59A

[0268] 2.PCV2b ORF2 BDH R63T

[0269] 3.PCV2b ORF2 BDH R63K

[0270] 4.PCV2b ORF2 BDH SFCO P88K T15 1P**

[0271] 5. PCV2b ORF2 BDH G191R

[0272] 6. PCV2b ORF2b BDH I206K

[0273] 7.PCV2b ORF2 BDH N232E

[0274] Except for number 4, which was established by localization mutagenesis of the synthesized PCV2b ORF2b BDH SFCO coding sequence, all coding sequences were synthesized at Integrated DNA Technologies.

[0275] **SFCO= is a codon optimized for the fall armyworm. This construct was built prior to the above alignment through preliminary sequence evaluation. Two mutations were also identified in this sequence evaluation.

[0276] Preparation of mutant PCV2b ORF2 baculovirus

[0277] Each of the seven PCV2b ORF2 mutant coding sequences, along with the unmutated PCV2b ORF2 BDH coding sequence, was cloned into the baculovirus transfer vector pVL 1393 and co-transfected into Sf9 cells along with baculovirus DNA. PCV2b ORF2 expression of each recombinant baculovirus was examined by IFA. Amplification stock solutions of each recombinant baculovirus were prepared on Sf+ cells and analyzed by TCID45. 50 The method involves titration to determine the baculovirus titer.

[0278] Evaluation of expression of mutant PCV2b ORF2 baculovirus

[0279] The expression of the PCV2bORF2 coding sequence of each recombinant baculovirus was evaluated by infecting Sf+ cells with a target MOI of 0.1. Infection was allowed to proceed for 5–7 days, followed by harvesting by centrifugation at 20,000 g for 20 min to remove cell debris and insoluble proteins. The harvested supernatant was filtered through a 0.2 μm filter, and PCV2bORF2 expression was directly evaluated by Western blotting using an α-PCV2 antibody (e.g., ...). Figure 2 The presence of macromolecular structures was also evaluated in the harvest supernatant. Briefly, samples of each harvest supernatant were centrifuged at 100,000 g for 2 hours. The resulting precipitates were resuspended in small volumes of TBS and separated by SDS-PAGE. PCV2b ORF2 bands (e.g., PCV2a ORF2) were detected in the stained gel by size comparison with PCV2a ORF2. Figure 3 The PCV2b ORF2 protein was also partially purified by centrifugation at 100,000 g for 2 h, followed by separation of the resuspended precipitate over a discontinuous sucrose gradient of 10%–60% for quantification and confirmation by VLP via electron microscopy (EM). Figure 4 ).

[0280] After sucrose gradient separation, fractions containing PCV2b ORF2 were combined, and the PCV2b ORF2 concentration was determined by SDS-PAGE gel density determination relative to a BSA standard curve. Furthermore, samples of the sucrose gradient purified material were further concentrated and presented for VLP verification via EM using tungstic phosphate as a negative staining agent (e.g., Figure 5).

[0281] exist Figure 6The table shows the evaluation results of the PCV2b ORF2 BDH mutant construct. The results confirmed that a single amino acid mutation at position 63, from arginine to threonine, increased the expression of PCV2bORF2 BDH in Sf+ cells by almost 10-fold. A single R63T mutation increased PCV2bORF2 BDH expression in Sf+ cells to a level similar to PCV2a ORF2. Amino acid sequence analysis of PCV2bORF2 BDH suggests that the BC loop may be sensitive to cleavage by trypsin-like proteases. Structural data published by Khayat et al. in 2011 suggest that arginine 63 is located on the BC loop extending furthest from the PCV2 viral capsid formed by the ORF2 protein, thus making it sensitive to proteases released after Sf+ cell lysis during baculovirus replication.

[0282] In addition to the threonine substitution at position 63, in another embodiment of the invention, the arginine is substituted with other uncharged polar amino acids (including serine, tyrosine, asparagine, and glutamine) to obtain the same stabilizing effect. Alternatively, nonpolar amino acids (including glycine, alanine, valine, leucine, isoleucine, phenylalanine, and tryptophan) can also achieve the same effect.

[0283] Example 2

[0284] This study confirmed the efficacy of one implementation of a porcine circovirus type 2 (OCR2b) vaccine against PCV2a and / or PCV2b challenge. Cesarean-derived colostrum-deprived (CDCD) piglets were used in this study and divided into two groups: 1) pigs vaccinated with an experimental porcine circovirus vaccine comprising the PCV2b ORF2 R63T variant (inactivated baculovirus vector) of Example 1, challenged with virulent PCV2b; and 2) unvaccinated challenge control pigs challenged with virulent PCV2b. On day 0, 1 mL of the vaccine was administered intramuscularly (IM) to group 1, while group 2 (unvaccinated challenge control pigs) received no treatment. On day 28, all pigs in groups 1 and 2 were administered 1 mL of virulent PCV2b intranasally (IN) and 1 mL intramuscularly at a dose of 3.0 Log. 10 TCID 50 Pigs were challenged with an approximate dose of live virus per mL. All pigs received 2.0 mL of keyhole hemocyanin (KLH / ICFA) emulsified in incomplete Freund's adjuvant intramuscularly on days 25 and 31. Clinical signs were monitored daily, and blood was drawn periodically for serological testing. On day 56, all pigs were necropsy, and selected tissues were collected for gross pathological examination.

[0285] Overall, the vaccinated animals showed a decrease in all experimental parameters compared to their respective challenge control groups.

[0286] Example 3

[0287] Several other substitutions were generated at amino acid site 63 to compare with the PCV2b ORF BDH native strain. Figure 7A and 7B The results show the evaluation of the PCV2b ORF2 BDH mutant construct. The results confirmed that, except for the amino acid mutation at position 63 from arginine (R) to threonine (T), arginine (R)63 to glycine (G), arginine (R)63 to glutamine (Q), and arginine (R)63 to aspartic acid (D) increased the expression of PCV2b ORF2 BDH in Sf+ cells by at least 4-fold compared to the wild type. Specifically, the single mutations R63G and R63Q increased PCV2b ORF2 BDH expression in Sf+ cells to levels similar to PCV2a ORF2.

[0288] Preparation of recombinant baculovirus encoding PCV2b ORF2 R63 mutant

[0289] A point mutation at amino acid position 63 was generated in the coding sequence of PCV2b ORF2 by targeted mutagenesis. Briefly, the baculovirus transfer plasmid pVLl393-PCV2bORF2 was targeted mutagenesis using primers listed in Table 1. The resulting baculovirus transfer vector was sequenced to confirm the appropriate mutation in the coding sequence and then co-transfected into Sf9 cells with linearized baculovirus DNA. Co-transfectants were harvested after 5 days, and PCV2b ORF2 expression was evaluated by IFA using a PCV2-specific antibody. Amplification stockpiles of each baculovirus were prepared in Sf9 cells and evaluated by TCID using an α-baculovirus gp64 monoclonal antibody based on IFA. 50 The method involves titration.

[0290] Primers sequence positive <![CDATA[5' - CTGTCAAGAAAACCACAGTCX 1 X 2 X 3 ACGCCCTCCTGGAATGTG - 3’]]> Reverse The inverse complement of the forward primer mutation <![CDATA[X 1 ]]> <![CDATA[X 2 ]]> <![CDATA[X 3 ]]> R63D G A C R63Q C A G R63G G G A R63L T T G R63T A C A

[0291] Expression and quantification of PCV2b ORF2 VLP

[0292] SF+ cells in a rotary flask were infected with recombinant baculovirus at an MOI of 0.1 and incubated at 27°C with constant stirring at approximately 100 rpm. Infected cultures were harvested once SF+ cell viability dropped below 30% or 7 days post-infection. The crude baculovirus harvest was centrifuged at 20,000 g for 20 min at 4°C to precipitate cells and insoluble debris, followed by 0.2 μm filtration. The clarified baculovirus harvest fluid (35 mL) was centrifuged at 100,000 g RCF for 2 h at 4°C to precipitate PCV2b ORF2 VLP. The resulting precipitate was resuspended in TBS and further separated at 100,000 g RCF for 2 h at 4°C on a 10%–60% discontinuous sucrose gradient. Fractions containing a majority of PCV2b ORF2 (as determined by SDS-PAGE and Western blotting using an α-PCV2 antibody) were pooled and evaluated by density assay. In summary, the pooled fractions containing PCV2b ORF2 were separated by SDS-PAGE and stained with SIMPLYBLUE™ Safe Stain. Gel images were captured and analyzed using an Alpha View camera and software. The mass of the PCV2b ORF2 bands was calculated using the BSA standard curve included on each gel. The PCV2b ORF2 concentration in the pooled fractions was calculated by dividing the mass of the PCV2b ORF2 bands by the total volume of the sample loaded onto the gel. The PCV2b ORF2 concentration in the harvested material was calculated by multiplying the PCV2b ORF2 concentration in the pooled fractions by the volume of the pooled fractions and then dividing the result by the initial volume of the harvest fluid used for centrifugation.

[0293] Example 4

[0294] This study evaluated the efficacy of the porcine circovirus type 2 ORF2b prototype vaccine (containing the PCV2b ORF2 protein expressed by recombinant baculovirus SEQ ID NO: 1) against PCV2b challenge when administered at 3 weeks of age.

[0295] Forty-two healthy CDCD pigs (X pigs from each of the X litters and X pigs from each of the X litters) were barred and housed in six pens. Pigs within each pen were similarly randomized to one of five treatment groups: Group 1 (strict negative control), consisting of X pigs, receiving no treatment; Group 2 (challenge control, n=X), receiving no treatment; Group 3 (containing the experimental PCV2b+Carbopol vaccine of SEQ ID NO: 1, n=X); and Group 4 (containing the experimental PCV2b+ISA207VG vaccine of SEQ ID NO: 1, n=X). A summary of the treatment groups is provided in Table 2.

[0296] Table 2:

[0297]

[0298]

[0299] On day 0, pigs were 24 days old and received a 1 mL dose of vaccine via intramuscular injection (IM) in group 3 pigs. On days 11 and 17, all IM pigs received a 2.0 mL dose of KLH / ICFA. On day 14, all pigs were challenged with approximately 5.0 log10 TCID50 / mL of live, virulent PCV2b in 1.0 mL of IM via the right neck and 1.0 mL via the nasal cavity. The overall health of the pigs was checked daily. Blood samples were collected on days -4, 14, 21, 28, 33, and 42, and serum PCV2 viremia was assessed by quantitative real-time polymerase chain reaction on all days except day -4. Following PCV2b challenge, vaccinated animals showed significantly lower viremia and decreased to asymptomatic levels compared to unvaccinated animals.

[0300] In the context of the invention made and the accompanying experimental data, the following should be considered in particular:

[0301] - Regarding lymphatic depletion: To support the evidence for “adjunctive prevention of lymphatic depletion”, a pig is considered positive if one or more of four lymphoid tissue samples (tonsils, TBLN, MLN, or ILN) are histologically positive for lymphatic depletion.

[0302] - Regarding lymphoid inflammation: To support the evidence for "adjunctive prevention of lymphoid inflammation", a pig is considered positive if one or more of the four lymphoid tissue samples (tonsils, TBLN, MLN, or ILN) are histologically positive for lymphoid inflammation;

[0303] - Regarding lymph node colonization: To support evidence that the pig cleared the infection before 4 weeks after the virus exposure, the pig is considered positive if one or more of the four lymphoid tissue samples (tonsils, TBLN, MLN, or ILN) are confirmed by IHC to be positive for PCV2 lymph node colonization;

[0304] - Regarding viremia: To support evidence for "adjunctive prevention of viremia," if the serum rt-PCR test result is ≥1.0 x 10⁻⁶. 4 The PCV2 genomic equivalent (low linear level) suggests that the pigs were positive on the day of sampling; and

[0305] - Regarding death: To support the evidence for “adjunctive prevention of death”, a pig is considered to be death-positive if it succumbs to attack (death or euthanasia for humane reasons, with attributable clinical signs, gross lesions and / or histological damage consistent with PCV2).

[0306] In the sequence list:

[0307] SEQ ID NO:1 corresponds to SEQ ID NO:2, which includes the substitution R63T.

[0308] SEQ ID NO: 2 corresponds to the sequence of the wild-type PCV2b ORF2 protein.

[0309] SEQ ID NO: 3 corresponds to the sequence of the wild-type PCV2a ORF2 protein.

[0310] SEQ ID NO:4 corresponds to the polynucleotide sequence encoding SEQ ID NO:1.

[0311] SEQ ID NO: 5 corresponds to the sequence of the wild-type PCV2b ORF2 protein.

[0312] SEQ ID NO: 6 corresponds to the sequence of the polypeptide of the present invention having a length of 233 amino acid residues and having an arginine residue at amino acid position 59.

[0313] SEQ ID NO: 7 corresponds to the sequence of the polypeptide of the present invention having a length of 233 amino acid residues and having a lysine residue at amino acid position 59.

[0314] SEQ ID NO: 8 corresponds to the sequence of the polypeptide of the present invention having a length of 234 amino acid residues and having an arginine residue at amino acid position 59.

[0315] SEQ ID NO: 9 corresponds to the sequence of the polypeptide of the present invention having a length of 234 amino acid residues and having a lysine residue at amino acid position 59.

[0316] SEQ ID NO: 10 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and an alanine residue at amino acid position 63.

[0317] SEQ ID NO: 11 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a cysteine ​​residue at amino acid position 63.

[0318] SEQ ID NO: 12 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and an aspartic acid residue at amino acid position 63.

[0319] SEQ ID NO: 13 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a glutamic acid residue at amino acid position 63.

[0320] SEQ ID NO: 14 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a phenylalanine residue at amino acid position 63.

[0321] SEQ ID NO: 15 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a glycine residue at amino acid position 63.

[0322] SEQ ID NO: 16 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a histidine residue at amino acid position 63.

[0323] SEQ ID NO: 17 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and an isoleucine residue at amino acid position 63.

[0324] SEQ ID NO: 18 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a leucine residue at amino acid position 63.

[0325] SEQ ID NO: 19 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a methionine residue at amino acid position 63.

[0326] SEQ ID NO: 20 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and an asparagine residue at amino acid position 63.

[0327] SEQ ID NO: 21 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a proline residue at amino acid position 63.

[0328] SEQ ID NO: 22 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a glutamine residue at amino acid position 63.

[0329] SEQ ID NO: 23 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a serine residue at amino acid position 63.

[0330] SEQ ID NO: 24 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a threonine residue at amino acid position 63.

[0331] SEQ ID NO: 25 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a valine residue at amino acid position 63.

[0332] SEQ ID NO: 26 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a tryptophan residue at amino acid position 63.

[0333] SEQ ID NO: 27 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and a tyrosine residue at amino acid position 63.

[0334] SEQ ID NO: 28 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having an arginine residue at amino acid position 59 and an alanine residue at amino acid position 63.

[0335] SEQ ID NO: 29 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a cysteine ​​residue at amino acid position 63.

[0336] SEQ ID NO: 30 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and an aspartic acid residue at amino acid position 63.

[0337] SEQ ID NO: 31 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a glutamic acid residue at amino acid position 63.

[0338] SEQ ID NO: 32 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a phenylalanine residue at amino acid position 63.

[0339] SEQ ID NO: 33 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a glycine residue at amino acid position 63.

[0340] SEQ ID NO: 34 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a histidine residue at amino acid position 63.

[0341] SEQ ID NO: 35 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and an isoleucine residue at amino acid position 63.

[0342] SEQ ID NO: 36 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a leucine residue at amino acid position 63.

[0343] SEQ ID NO: 37 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a methionine residue at amino acid position 63.

[0344] SEQ ID NO: 38 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and an asparagine residue at amino acid position 63.

[0345] SEQ ID NO: 39 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a proline residue at amino acid position 63.

[0346] SEQ ID NO: 40 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a glutamine residue at amino acid position 63.

[0347] SEQ ID NO: 41 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a serine residue at amino acid position 63.

[0348] SEQ ID NO: 42 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a threonine residue at amino acid position 63.

[0349] SEQ ID NO: 43 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a valine residue at amino acid position 63.

[0350] SEQ ID NO: 44 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a tryptophan residue at amino acid position 63.

[0351] SEQ ID NO: 45 corresponds to the sequence of amino acid positions 58-66 (also referred to herein as the “BC-loop”) of the polypeptide of the present invention having a lysine residue at amino acid position 59 and a tyrosine residue at amino acid position 63.

[0352] SEQ ID NO: 46 corresponds to the sequence of the polypeptide of the present invention having a length of 234 amino acid residues and having a threonine residue at amino acid position 63. sequence list <110> Boehringer Ingelheim Animal Health <120> PCV2 ORF2 protein variants and virus-like particles composed of them <130> Pl0-0163 <160> 46 <170> PatentIn version 3.5 <210> 1 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> corresponds to SEQ ID NO:2with the substitution R63T <400> 1 Met Thr Tyr Pro Arg Arg Arg Phe Arg Arg Arg Arg His Arg Pro Arg 1 5 10 15 Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro 20 25 30 Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg 35 40 45 Leu Ser Arg Thr Ile Gly Tyr Thr Val Lys Lys Thr Thr Val Thr Thr 50 55 60 Pro Ser Trp Asn Val Asp Met Met Arg Phe Asn Ile Asn Asp Phe Leu 65 70 75 80 Pro Pro Gly Gly Gly Ser Asn Pro Leu Thr Val Pro Phe Glu Tyr Tyr 85 90 95 Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr 100 105 110 Gln Gly Asp Arg Gly Val Gly Ser Thr Ala Val Ile Leu Asp Asp Asn 115 120 125 Phe Val Thr Lys Ala Asn Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr 130 135 140 Ser Ser Arg His Thr Ile Thr Gln Pro Phe Ser Tyr His Ser Arg Tyr 145 150 155 160 Phe Thr Pro Lys Pro Val Leu Asp Arg Thr Ile Asp Tyr Phe Gln Pro 165 170 175 Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Thr Gly Asn 180 185 190 Val Asp His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Ile Tyr Asp 195 200 205 Gln Asp Tyr Asn Ile Arg Ile Thr Met Tyr Val Gln Phe Arg Glu Phe 210 215 220 Asn Leu Lys Asp Pro Pro Leu Asn Pro Lys 225 230 <210>2 <211>234 <212>PRT <213>Porcine circovirus <400>2 Met Thr Tyr Pro Arg Arg Arg Phe Arg Arg Arg Arg His Arg Pro Arg 1 5 10 15 Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro 20 25 30 Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg 35 40 45 Leu Ser Arg Thr Ile Gly Tyr Thr Val Lys Lys Thr Thr Val Arg Thr 50 55 60 Pro Ser Trp Asn Val Asp Met Met Arg Phe Asn Ile Asn Asp Phe Leu 65 70 75 80 Pro Pro Gly Gly Gly Ser Asn Pro Leu Thr Val Pro Phe Glu Tyr Tyr 85 90 95 Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr 100 105 110 Gln Gly Asp Arg Gly Val Gly Ser Thr Ala Val Ile Leu Asp Asp Asn 115 120 125 Phe Val Thr Lys Ala Asn Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr 130 135 140 Ser Ser Arg His Thr Ile Thr Gln Pro Phe Ser Tyr His Ser Arg Tyr 145 150 155 160 Phe Thr Pro Lys Pro Val Leu Asp Arg Thr Ile Asp Tyr Phe Gln Pro 165 170 175 Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Thr Gly Asn 180 185 190 Val Asp His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Ile Tyr Asp 195 200 205 Gln Asp Tyr Asn Ile Arg Ile Thr Met Tyr Val Gln Phe Arg Glu Phe 210 215 220 Asn Leu Lys Asp Pro Pro Leu Asn Pro Lys 225 230 <210>3 <211>233 <212>PRT <213>Porcine circovirus <400>3 Met Thr Tyr Pro Arg Arg Arg Tyr Arg Arg Arg Arg His Arg Pro Arg 1 5 10 15 Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro 20 25 30 Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg 35 40 45 Leu Ser Arg Thr Phe Gly Tyr Thr Val Lys Ala Thr Thr Val Thr Thr 50 55 60 Pro Ser Trp Ala Val Asp Met Met Arg Phe Asn Ile Asp Asp Phe Val 65 70 75 80 Pro Pro Gly Gly Gly Thr Ash Lys Ile Ser Ile Pro Phe Glu Tyr Tyr 85 90 95 Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr 100 105 110 Gln Gly Asp Arg Gly Val Gly Ser Thr Ala Val Ile Leu Asp Asp Asn 115 120 125 Phe Val Thr Lys Ala Thr Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr 130 135 140 Ser Ser Arg His Thr Ile Pro Gln Pro Phe Ser Tyr His Ser Arg Tyr 145 150 155 160 Phe Thr Pro Lys Pro Val Leu Asp Ser Thr Ile Asp Tyr Phe Gln Pro 165 170 175 Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Ser Arg Asn 180 185 190 Val Asp His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Lys Tyr Asp 195 200 205 Gln Asp Tyr Asn Ile Arg Val Thr Met Tyr Val Gln Phe Arg Glu Phe 210 215 220 Asn Leu Lys Asp Pro Pro Leu Glu Pro 225 230 <210> 4 <211> 705 <212> DNA <213> Artificial Sequence <220> <223> SEQ ID NO: 1 <220> <221> misc_feature <222> (187)..(189) <400> 4 atgacgtatc caaggaggcg tttccgcaga cgaagacacc gcccccgcag ccatcttggc 60 cagatcctcc gccgccgccc ctggctcgtc cacccccgcc accgttaccg ctggagaagg 120 aaaaatggca tcttcaacac ccgcctctcc cgcaccatcg gttatactgt caagaaaacc 180 acagtcacaa cgccctcctg gaatgtggac atgatgagat ttaatattaa tgattttctt 240 cccccaggag ggggctcaaa ccccctcact gtgccctttg atactacag aataaggaag 300 gttaaggttg agttctggcc ctgctcccca atcacccagg gtgacagggg agtgggctcc 360 actgctgtta ttctagatga taactttgta acaaaggcca atgccctaac ctatgacccc 420 tatgtaaact actcctcccg ccataccata acccagccct tctcctacca ctcccggtac 480 tttaccccga aacctgtcct tgataggaca atcgattact tccaacccaa taacaaaaga 540 aatcaactct ggctgagact acaaactact ggaaatgtag accatgtagg cctcggcact 600 gcgttcgaaa acagtatata cgaccaggac tacaatatcc gtataaccat gtatgtacaa 660 ttcagagaat ttaatcttaa agacccccca cttaacccta agtga 705 <210> 5 <211> 233 <212> PRT <213> Porcine circovirus <400> 5 But Thr Tyr Pro Arg Arg Arg Tyr Arg Arg Arg Arg His Arg Pro Arg 1 5 10 15 Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro 20 25 30 Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg 35 40 45 Leu Ser Arg Thr Phe Gly Tyr Thr Ile Lys Arg Thr Thr Val Arg Thr 50 55 60 Pro Ser Trp Ala Val Asp Met Met Arg Phe Asn Ile Asn Asp Phe Leu 65 70 75 80 Pro Pro Gly Gly Gly Ser Asn Pro Arg Ser Val Pro Phe Glu Tyr Tyr 85 90 95 Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr 100 105 110 Gln Gly Asp Arg Gly Val Gly Ser Ser Ala Val Ile Leu Asp Asp Asn 115 120 125 Phe Val Thr Lys Ala Thr Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr 130 135 140 Ser Ser Arg His Thr Ile Thr Gln Pro Phe Ser Tyr His Ser Arg Tyr 145 150 155 160 Phe Thr Pro Lys Pro Val Leu Asp Ser Thr Ile Asp Tyr Phe Gln Pro 165 170 175 Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Ala Gly Asn 180 185 190 Val Asp His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Ile Tyr Asp 195 200 205 Gln Glu Tyr Asn Ile Arg Val Thr Met Tyr Val Gln Phe Arg Glu Phe 210 215 220 Asn Leu Lys Asp Pro Pro Leu Asn Pro 225 230 <210>6 <211>233 <212>PRT <213>Porcine circovirus <220> <221>misc_feature <222>(8)..(8) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(53)..(53) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(57)..(57) <223>Xaa can be any naturally occurring amino acid <220> <221>MISC_FEATURE <222>(63)..(63) <223>Xaa at position 63is seleoted from the group consisting of Ala,Asn,Asp,Cys,Glu,Gln,Gly,His,Ile,Leu,Met,Phe,Pro,Ser,Thr,Trp,Tyr,and Val. <220> <221>misc_feature <222>(68)..(68) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(89)..(90) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(121)..(121) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(134)..(134) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(169)..(169) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(190)..(190) <223>Xaa can be any naturally occurring amino acid <220> <221>MISC_FEATURE <222>(210)..(210) <223>Xaa at position 210is selected from the group consisting ofAspand Glu. <220> <221>misc_feature <222>(215)..(215) <223>Xaa can be any naturally occurring amino acid <400>6 Met Thr Tyr Pro Arg Arg Arg Xaa Arg Arg Arg Arg His Arg Pro Arg 1 5 10 15 Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro 20 25 30 Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg 35 40 45 Leu Ser Arg Thr Xaa Gly Tyr Thr Xaa Lys Arg Thr Thr Val Xaa Thr 50 55 60 Pro Ser Trp Xaa Val Asp Met Met Arg Phe Asn Ile Asn Asp Phe Leu 65 70 75 80 Pro Pro Gly Gly Gly Ser Asn Pro Xaa Xaa Val Pro Phe Glu Tyr Tyr 85 90 95 Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr 100 105 110 Gln Gly Asp Arg Gly Val Gly Ser Xaa Ala Val Ile Leu Asp Asp Asn 115 120 125 Phe Val Thr Lys Ala Xaa Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr 130 135 140 Ser Ser Arg His Thr Ile Thr Gln Pro Phe Ser Tyr His Ser Arg Tyr 145 150 155 160 Phe Thr Pro Lys Pro Val Leu Asp Xaa Thr Ile Asp Tyr Phe Gln Pro 165 170 175 Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Xaa Gly Asn 180 185 190 Val Asp His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Ile Tyr Asp 195 200 205 Gln Xaa Tyr Asn Ile Arg Xaa Thr Met Tyr Val Gln Phe Arg Glu Phe 210 215 220 Asn Leu Lys Asp Pro Pro Leu Asn Pro 225 230 <210>7 <211>233 <212>PRT <213>Porcine circovirus <220> <221>misc_feature <222>(8)..(8) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(53)..(53) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(57)..(57) <223>Xaa can be any naturally occurring amino acid <220> <221>MISC_FEATURE <222>(63)..(63) <223>Xaa at position 63is selected from the group consisting of Ala,Asn,Asp,Cys,Glu,Gln,Gly,His,Ile,Leu,Met,Phe,Pro,Ser,Thr,Trp,Tyr,and Val. <220> <221>misc_feature <222>(68)..(68) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(89)..(90) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(121)..(121) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(134)..(134) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(169)..(169) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(190)..(190) <223>Xaa can be any naturally occurring amino acid <220> <221>MISC_FEATURE <222>(210)..(210) <223>Xaa at position 210is selected from the group consisting ofAspand Glu. <220> <221>misc_feature <222>(215)..(215) <223>Xaa can be any naturally occurring amino acid <400>7 Met Thr Tyr Pro Arg Arg Arg Xaa Arg Arg Arg Arg His Arg Pro Arg 1 5 10 15 Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro 20 25 30 Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg 35 40 45 Leu Ser Arg Thr Xaa Gly Tyr Thr Xaa Lys Lys Thr Thr Val Xaa Thr 50 55 60 Pro Ser Trp Xaa Val Asp Met Met Arg Phe Asn Ile Asn Asp Phe Leu 65 70 75 80 Pro Pro Gly Gly Gly Ser Asn Pro Xaa Xaa Val Pro Phe Glu Tyr Tyr 85 90 95 Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr 100 105 110 Gln Gly Asp Arg Gly Val Gly Ser Xaa Ala Val Ile Leu Asp Asp Asn 115 120 125 Phe Val Thr Lys Ala Xaa Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr 130 135 140 Ser Ser Arg His Thr Ile Thr Gln Pro Phe Ser Tyr His Ser Arg Tyr 145 150 155 160 Phe Thr Pro Lys Pro Val Leu Asp Xaa Thr Ile Asp Tyr Phe Gln Pro 165 170 175 Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Xaa Gly Asn 180 185 190 Val Asp His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Ile Tyr Asp 195 200 205 Gln Xaa Tyr Asn Ile Arg Xaa Thr Met Tyr Val Gln Phe Arg Glu Phe 210 215 220 Asn Leu Lys Asp Pro Pro Leu Asn Pro 225 230 <210>8 <211>234 <212>PRT <213>Porcine circovirus <220> <221>misc_feature <222>(8)..(8) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(53)..(53) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(57)..(57) <223>Xaa can be any naturally occurring amino acid <220> <221>MISC_FEATURE <222>(63)..(63) <223>Xaa at position 63is selected from the group consisting of Ala,Asn,Asp,Cys,Glu,Gln,Gly,His,Ile,Leu,Met,Phe,Pro,Ser,Thr,Trp,Tyr,and Val. <220> <221>misc_feature <222>(68)..(68) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(89)..(90) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(121)..(121) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(134)..(134) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(169)..(169) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(190)..(190) <223>Xaa can be any naturally occurring amino acid <220> <221>MISC_FEATURE <222>(210)..(210) <223>Xaa at position 210is selected from the group consisting ofAspand Glu. <220> <221>misc_feature <222>(215)..(215) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(234)..(234) <223>Xaa can be any naturally occurring amino acid <400>8 Met Thr Tyr Pro Arg Arg Arg Xaa Arg Arg Arg Arg His Arg Pro Arg 1 5 10 15 Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro 20 25 30 Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg 35 40 45 Leu Ser Arg Thr Xaa Gly Tyr Thr Xaa Lys Arg Thr Thr Val Xaa Thr 50 55 60 Pro Ser Trp Xaa Val Asp Met Met Arg Phe Asn Ile Asn Asp Phe Leu 65 70 75 80 Pro Pro Gly Gly Gly Ser Asn Pro Xaa Xaa Val Pro Phe Glu Tyr Tyr 85 90 95 Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr 100 105 110 Gln Gly Asp Arg Gly Val Gly Ser Xaa Ala Val Ile Leu Asp Asp Asn 115 120 125 Phe Val Thr Lys Ala Xaa Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr 130 135 140 Ser Ser Arg His Thr Ile Thr Gln Pro Phe Ser Tyr His Ser Arg Tyr 145 150 155 160 Phe Thr Pro Lys Pro Val Leu Asp Xaa Thr Ile Asp Tyr Phe Gln Pro 165 170 175 Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Xaa Gly Asn 180 185 190 Val Asp His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Ile Tyr Asp 195 200 205 Gln Xaa Tyr Asn Ile Arg Xaa Thr Met Tyr Val Gln Phe Arg Glu Phe 210 215 220 Asn Leu Lys Asp Pro Pro Leu Asn Pro Xaa 225 230 <210>9 <211>234 <212>PRT <213>Porcine circovirus <220> <221>misc_feature <222>(8)..(8) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(53)..(53) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(57)..(57) <223>Xaa can be any naturally occurring amino acid <220> <221>MISC_FEATURE <222>(63)..(63) <223>Xaa at position 63is selected from the group consisting of Ala,Asn,Asp,Cys,Glu,Gln,Gly,His,Ile,Leu,Met,Phe,Pro,Ser,Thr,Trp,Tyr,and Val. <220> <221>misc_feature <222>(68)..(68) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(89)..(90) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(121)..(121) <223>Xaa can be any naturally occurring ammio acid <220> <221>misc_feature <222>(134)..(134) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(169)..(169) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(190)..(190) <223>Xaa can be any naturally occurring amino acid <220> <221>MISC_FEATURE <222>(210)..(210) <223>Xaa at position 210is selected from the group consisting ofAspand Glu. <220> <221>misc_feature <222>(215)..(215) <223>Xaa can be any naturally occurring amino acid <220> <221>misc_feature <222>(234)..(234) <223>Xaa can be any naturally occurring amino acid <400>9 Met Thr Tyr Pro Arg Arg Arg Xaa Arg Arg Arg Arg His Arg Pro Arg 1 5 10 15 Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro 20 25 30 Arg His Arg Tyr Arg Trp Arg Lys Asn Gly Ile Phe Asn Thr Arg 35 40 45 Leu Ser Arg Thr Xaa Gly Tyr Thr Xaa Lys Thr Thr Val Xaa Thr 50 55 60 Pro Ser Trp Xaa Val Asp Met Met Arg Phe Asn Ile Asn Phe Leu 65 70 75 80 Pro Pro Gly Gly Gly Ser Asn Pro Xaa Xaa Val Pro Phe Glu Tyr Tyr 85 90 95 Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr 100 105 110 Gln Gly Asp Arg Gly Val Gly Ser Xaa Ala Val Ile Leu Asp Asp Asn 115 120 125 Phe Val Thr Lys Ala Xaa Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr 130 135 140 Ser Ser Arg His Thr I Thr Gln Pro Phe Ser Tyr His Ser Arg Tyr 145 150 155 160 Phe Thr Pro Lys Pro Val Leu Asp Xaa Thr Ile Asp Tyr Phe Gln Pro 165 170 175 Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Xaa Gly Asn 180 185 190 Val Asp His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Ile Tyr Asp 195 200 205 Gln Xaa Tyr Asn Ile Arg Xaa Thr Met Tyr Val Gln Phe Arg Glu Phe 210 215 220 Asn Leu Lys Asp Pro Pro Leu Asn Pro Xaa 225 230 <210>10 <211>9 <212>PRT <213>Porcine circovirus <400>10 Lys Arg Thr Thr Val Ala Thr Pro Ser 1 5 <210>11 <211>9 <212>PRT <213>Porcine circovirus <400>11 Lys Arg Thr Thr ValCys Thr Pro Ser 1 5 <210>12 <211>9 <212>PRT <213>Porcine circovirus <400>12 Lys Arg Thr Thr Val Asp Thr Pro Ser 1 5 <210>13 <211>9 <212>PRT <213>Porcine circovirus <400>13 Lys Arg Thr Thr ValGlu Thr Pro Ser 1 5 <210>14 <211>9 <212>PRT <213>Porcine circovirus <400>14 Lys Arg Thr Thr Val Phe Thr Pro Ser 1 5 <210>15 <211>9 <212>PRT <213>Porcine circovirus <400>15 Lys Arg Thr Thr Val Gly Thr Pro Ser 1 5 <210>16 <211>9 <212>PRT <213>Porcine circovirus <400>16 Lys Arg Thr Thr Val His Thr Pro Ser 1 5 <210>17 <211>9 <212>PRT <213>Porcine circovirus <400>17 Lys Arg Thr Thr Val Ile Thr Pro Ser 1 5 <210>18 <211>9 <212>PRT <213>Porcine circovirus <400>18 Lys Arg Thr Thr Val Leu Thr Pro Ser 1 5 <210>19 <211>9 <212>PRT <213>Porcine circovirus <400>19 Lys Arg Thr Thr Val Met Thr Pro Ser 1 5 <210>20 <211>9 <212>PRT <213>Porcine circovirus <400>20 Lys Arg Thr Thr Val Asn Thr Pro Ser 1 5 <210>21 <211>9 <212>PRT <213>Porcine circovirus <400>21 Lys Arg Thr Thr Val Pro Thr Pro Ser 1 5 <210>22 <211>9 <212>PRT <213>Porcine circovirus <400>22 Lys Arg Thr Thr Val Gln Thr Pro Ser 1 5 <210>23 <211>9 <212>PRT <213>Porcine circovirus <400>23 Lys Arg Thr Thr Val Ser Thr Pro Ser 1 5 <210>24 <211>9 <212>PRT <213>Porcine circovirus <400>24 Lys Arg Thr Thr ValThr Thr Pro Ser 1 5 <210>25 <211>9 <212>PRT <213>Porcine circovirus <400>25 Lys Arg Thr Thr Val ValThr Pro Ser 1 5 <210>26 <211>9 <212>PRT <213>Porcine circovirus <400>26 Lys Arg Thr Thr ValTrp Thr Pro Ser 1 5 <210>27 <211>9 <212>PRT <213>Porcine circovirus <400>27 Lys Arg Thr Thr ValTyr Thr Pro Ser 1 5 <210>28 <211>9 <212>PRT <213>Porcine circovirus <400>28 Lys Lys Thr Thr Val Ala Thr Pro Ser 1 5 <210>29 <211>9 <212>PRT <213>Porcine circovirus <400>29 Lys Lys Thr Thr Val Cys Thr Pro Ser 1 5 <210>30 <211>9 <212>PRT <213>Porcine circovirus <400>30 Lys Lys Thr Thr Val Asp Thr Pro Ser 1 5 <210>31 <211>9 <212>PRT <213>Porcine circovirus <400>31 Lys Lys Thr Thr Val Glu Thr Pro Ser 1 5 <210>32 <211>9 <212>PRT <213>Porcine circovirus <400>32 Lys Lys Thr Thr Val Phe Thr Pro Ser 1 5 <210>33 <211>9 <212>PRT <213>Porcine circovirus <400>33 Lys Lys Thr Thr Val Gly Thr Pro Ser 1 5 <210>34 <211>9 <212>PRT <213>Porcine circovirus <400>34 Lys Lys Thr Thr Val His Thr Pro Ser 1 5 <210>35 <211>9 <212>PRT <213>Porcine circovirus <400>35 Lys Lys Thr Thr ValIle Thr Pro Ser 1 5 <210>36 <211>9 <212>PRT <213>Porcine circovirus <400>36 Lys Lys Thr Thr Val Leu Thr Pro Ser 1 5 <210>37 <211>9 <212>PRT <213>Porcine circovirus <400>37 Lys Lys Thr Thr Val Met Thr Pro Ser 1 5 <210>38 <211>9 <212>PRT <213>Porcine circovirus <400>38 Lys Lys Thr Thr Val Asn Thr Pro Ser 1 5 <210>39 <211>9 <212>PRT <213>Porcine circovirus <400>39 Lys Lys Thr Thr Val Pro Thr Pro Ser 1 5 <210>40 <211>9 <212>PRT <213>Porcine circovirus <400>40 Lys Lys Thr Thr Val Gln Thr Pro Ser 1 5 <210>41 <211>9 <212>PRT <213>Porcine circovirus <400>41 Lys Lys Thr Thr ValSer Thr Pro Ser 1 5 <210>42 <211>9 <212>PRT <213>Porcine circovirus <400>42 Lys Lys Thr Thr ValThr Thr Pro Ser 1 5 <210>43 <211>9 <212>PRT <213>Porcine circovirus <400>43 Lys Lys Thr Thr Val ValThr Pro Ser 1 5 <210>44 <211>9 <212>PRT <213>Porcine circovirus <400>44 Lys Lys Thr Thr Val Trp Thr Pro Ser 1 5 <210>45 <211>9 <212>PRT <213>Porcine circovirus <400>45 Lys Lys Thr Thr Val Tyr Thr Pro Ser 1 5 <210>46 <211>234 <212>PRT <213>Porcine circovirus <220> <221>MISC_FEATURE <222>(63)..(63) <223>Xaa at position 63is selected from the group consisting of Ala,Asn,Asp,Cys,Glu,GIn,Gly,His,Ile,Leu,Met,Phe,Pro,Ser,Thr,Trp,Tyr,and Val. <400>46 Met Thr Tyr Pro Arg Arg Arg Phe Arg Arg Arg Arg His Arg Pro Arg 1 5 10 15 Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro 20 25 30 Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg 35 40 45 Leu Ser Arg Thr Ile Gly Tyr Thr Val Lys Lys Thr Thr Val Xaa Thr 50 55 60 Pro Ser Trp Asn Val Asp Met Met Arg Phe Asn Ile Asn Asp Phe Leu 65 70 75 80 Pro Pro Gly Gly Gly Ser Asn Pro Leu Thr Val Pro Phe Glu Tyr Tyr 85 90 95 Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr 100 105 110 Gln Gly Asp Arg Gly Val Gly Ser Thr Ala Val Ile Leu Asp Asp Asn 115 120 125 Phe Val Thr Lys Ala Asn Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr 130 135 140 Ser Ser Arg His Thr Ile Thr Gln Pro Phe Ser Tyr His Ser Arg Tyr 145 150 155 160 Phe Thr Pro Lys Pro Val Leu Asp Arg Thr Ile Asp Tyr Phe Gln Pro 165 170 175 Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Thr Gly Asn 180 185 190 Val Asp His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Ile Tyr Asp 195 200 205 Gln Asp Tyr Asn Ile Arg Ile Thr Met Tyr Val Gln Phe Arg Glu Phe 210 215 220 Asn Leu Lys Asp Pro Pro Leu Asn Pro Lys 225 230

Claims

1. A PCV2 ORF2 polypeptide, comprising an amino acid sequence in which the amino acid at position 63 of the amino acid sequence of SEQ ID NO:2 is mutated to a threonine residue, a glutamine residue, a glycine residue, a leucine residue, or an aspartic acid residue. The peptide in question exhibits higher expression compared to the wild-type PCV2 ORF2 protein without the mutation. The amino acid positions are numbered according to SEQ ID NO:

2.

2. The polypeptide according to claim 1, wherein the polypeptide is a recombinant PCV2 ORF2 protein.

3. The polypeptide of claim 2, wherein the polypeptide is PCV2 ORF2 protein expressed by recombinant baculovirus.

4. The polypeptide according to any one of claims 1-3, wherein the polypeptide is a PCV2 b isotype (PCV2b) ORF2 protein.

5. The polypeptide according to any one of claims 1-3, wherein the polypeptide is a PCV2 ORF2 protein composed of the amino acid sequence of SEQ ID NO:

1.

6. An immunogenic composition comprising the polypeptide according to any one of claims 1-5.

7. The immunogenic composition according to claim 6, wherein the immunogenic composition further comprises the PCV2aORF-2 polypeptide.

8. A polynucleotide comprising a sequence encoding a polypeptide according to any one of claims 1-5.

9. A plasmid containing a polynucleotide comprising a sequence encoding a polypeptide according to any one of claims 1-5.

10. The plasmid of claim 9, wherein the plasmid is an expression vector.

11. An isolated cell containing a plasmid, said plasmid containing a polynucleotide sequence encoding a polypeptide according to any one of claims 1-5.

12. The cell of claim 11, wherein the plasmid is an expression vector.

13. A virus-like particle comprising a plurality of polypeptides according to any one of claims 1-5.

14. A baculovirus comprising a polynucleotide containing a sequence encoding a polypeptide according to any one of claims 1-5.

15. An isolated cell comprising a baculovirus, said baculovirus containing a polynucleotide sequence encoding a polypeptide according to any one of claims 1-5.

16. The cell of claim 15, wherein the cell is an insect cell.

17. Use of the polypeptide according to any one of claims 1-5 or the immunogenic composition according to claim 6 or 7 in the preparation of a medicament for the treatment or prevention of PCV2 infection.

18. Use of the polypeptide according to any one of claims 1-5 or the immunogenic composition according to claim 6 or 7 in the preparation of a medicament, wherein the medicament is used to alleviate, prevent or treat clinical signs caused by PCV2 infection.

19. Use of the polypeptide according to any one of claims 1-5 or the immunogenic composition according to claim 6 or 7 in the preparation of a medicament for the prevention or treatment of disease caused by PCV2 infection.

20. The use of any one of claims 17-19, wherein the PCV2 infection is an infection of the PCV2b subtype (PCV2b) and / or an infection of a subtype of PCV2 other than the 2b subtype.

21. Use according to any one of claims 17-19, wherein the PCV2 infection is an infection of a subtype of PCV2 other than subtype 2b.

22. Use according to any one of claims 17-19, wherein the PCV2 infection is (i) co-infection with PCV2b and (ii) PCV2 subtypes other than subtype 2b.

23. The use of claim 20, wherein the PCV2 infection of a subtype other than subtype 2b is an infection of PCV2 subtype a (PCV2a) and / or PCV2 subtype c (PCV2c).

24. The use of claim 20, wherein the PCV2 infection of a subtype other than subtype 2b is a PCV2a infection.

25. Use according to any one of claims 17-19, wherein the PCV2 infection is (i) simultaneous infection with PCV2b and (ii) PCV2a.

26. The use of claim 17, wherein the treatment or prevention of PCV2 infection is based on, or consists of, the induction of an immune response against said PCV2.

27. The use of claim 18, wherein the clinical signs are selected from lymphatic depletion, lymphatic inflammation, positive IHC for PCV2 antigen in lymphoid tissue, viremia, nasal shedding, fever, decreased mean daily weight gain, pulmonary inflammation, and positive IHC for PCV2 antigen in lung tissue.

28. The use of claim 19, wherein the disease is PMWS.

29. The use of claim 20, wherein the treatment or prevention of infection with the subtypes of PCV2 other than 2b is based on the induction of an immune response against the subtypes of PCV2 other than 2b or the simultaneous induction of immune responses against the subtypes of PCV2 other than 2b and PCV2b, or consists of said induction.

30. Use according to any one of claims 17-19, wherein the polypeptide or the immunogenic composition is administered only once.

31. A method for generating a polypeptide according to any one of claims 1-5, the method comprising transfecting cells with a plasmid according to claim 9 or 10.

32. A method for producing a polypeptide according to any one of claims 1-5, the method comprising infecting cells with a baculovirus according to claim 14.

33. The method of claim 32, wherein the cell is an insect cell.

Images