Biphasic single-chain insulin analogues

By designing a single-chain insulin analogue containing a C-domain with specific amino acid substitutions and shortened linkages, the problem of easy degradation at high temperatures in existing biphasic insulin products has been solved. This enables biphasic pharmacokinetic and pharmacodynamic properties as a soluble solution at neutral pH, making it suitable for simplified insulin treatment regimens.

CN107108716BActive Publication Date: 2026-06-19CASE WESTERN RESERVE UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CASE WESTERN RESERVE UNIV
Filing Date
2015-10-06
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Existing biphasic insulin products are prone to physical and chemical degradation at temperatures above room temperature, and their production is complex and costly, leading to uncertainty in use and poor therapeutic effects, especially in developing countries where they are difficult to apply effectively.

Method used

A single-chain insulin analog was designed, comprising a shortened C domain connecting the A and B domains, with specific amino acid substitutions to enhance thermal stability and degradation resistance, and providing biphasic pharmacokinetic and pharmacodynamic properties as a soluble solution at neutral pH.

🎯Benefits of technology

This invention enables the development of single-chain insulin analogs that are soluble in neutral pH solutions, providing biphasic pharmacokinetic and pharmacodynamic properties, simplifying treatment regimens, and improving stability and efficacy at high temperatures. It is suitable for diabetic patients in both developing and developed countries.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN107108716B_ABST
    Figure CN107108716B_ABST
Patent Text Reader

Abstract

Single-chain insulin comprises a C-domain of 6-11 amino acid residues, including at least two acidic residues on the N-terminal side of the C-domain and at least two basic residues on the C-terminal side of the C-domain peptide; a basic amino acid residue at position A8 corresponding to human insulin; and an acidic amino acid residue at position A14 corresponding to human insulin. The C-domain may include a 2-4 amino acid linker region between the acidic and basic residues. Residues C1 and C2 may have a net negative charge of -1 or -2; and the remaining C-domain segment may terminate with two basic residues. The pharmaceutical composition comprises the single-chain insulin formulated at a pH in the range of 7.0-8.0, and may be formulated at a concentration of 0.6 mM-5.0 mM and / or at a strength of U-100 to U-1000.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Statement regarding federally funded research or development

[0002] This invention was carried out under a cooperation agreement granted by the National Institutes of Health, and with government support under grant numbers DK040949 and DK074176. The U.S. government may have certain rights to this invention. Background of the Invention

[0004] This invention relates to polypeptide hormone analogs exhibiting enhanced pharmaceutical properties, such as increased thermodynamic stability, enhanced resistance to thermal fibrillation above room temperature, reduced mitogenicity, and / or altered pharmacokinetic and pharmacodynamic properties, i.e., imparting a biphasic duration of action relative to (a) a rapid-acting component of a soluble formulation similar to the corresponding dietary or wild-type human hormone and (b) a long-acting component of a microcrystalline NPH formulation similar to wild-type insulin or insulin analogs. More particularly, this invention relates to insulin analogs composed of a single polypeptide chain, which (i) comprises a novel class of (C) domains with a shortened connection between A and B domains, wherein the first and second positions are acidic residues; (ii) comprises an amino acid substitution at position A8; and (iii) comprises an acidic residue at position A14. This type of C domain, 6-11 residues in length, consists of an N-terminal acidic element and a C-terminal basic element similar to wild-type preinsulin. The single-chain insulin analogues of the present invention may optionally include standard or non-standard amino acid substitutions at other sites in the A or B domain, such as positions B28 and B29 known in the art to impart rapid action.

[0005] Non-standard proteins, including engineered therapeutics and vaccines, can have a wide range of medical and social benefits. Naturally occurring proteins—such as those typically encoded in the genomes of humans, other mammals, vertebrates, invertebrates, or eukaryotic cells—often confer a variety of biological activities. The benefits of non-standard proteins will enable selective activities, such as reduced binding to homologous cell receptors associated with unintended and adverse side effects (e.g., promoting cancer cell growth). Another example of social benefits is enhanced resistance to degradation at or above room temperature, facilitating transport, distribution, and use. An example of a therapeutic protein is insulin. The insulin molecule encoded in the genomes of wild-type human insulin and other mammals binds to insulin receptors in a variety of organs and cell types, regardless of the receptor isotype produced by optional RNA splicing patterns or optional post-translational glycosylation patterns. Wild-type insulin also binds to its homologous type 1 insulin-like growth factor receptor (IGF-1R) with lower affinity.

[0006] Other examples of medical benefits would include the optimization of the pharmacokinetic properties of soluble formulations, allowing insulin to have two phases of action: a rapid phase and a delayed phase.Figure 1 Such combinations of rapid and delayed phases are known in the art to be imparted by a mixture of a solution of a zinc insulin analog hexamer (such as provided by, but not limited to, insulin lispro and insulin aspart) and a microcrystalline suspension of said analog (prepared in combination with zinc ions and protamine or protamine-associated basic peptides); the latter component is known in the art as a Neutral Protamine Hagedorn (NPH) microcrystalline suspension. Premixed insulin products known in the art contain these two components in various ratios, such as 25% soluble phase and 75% microcrystalline phase, 30% soluble phase and 70% microcrystalline phase, or 50% of each phase. Because such premixed products are easy to use and require fewer daily subcutaneous injections compared to administering dietary (rapid-acting) insulin formulations (or dietary insulin analog formulations) and NPH microcrystalline suspensions of wild-type insulin or insulin analogs alone, they are widely used in diabetic patients in developing countries. The simplification of insulin regimens provided by premixed biphasic insulin products has also been demonstrated to benefit diabetic patients in affluent societies who (i) experience suboptimal glycemic control or excessive weight gain when treated with dietary insulin analogs alone; (ii) experience suboptimal glycemic control when treated with NPH insulin products or basal insulin analogs alone due to an upward shift in blood glucose concentration within 3 hours postprandial; or (iii) patients in either of the above categories for whom the addition of oral medications (e.g., metformin) does not result in satisfactory glycemic control.

[0007] Existing biphasic insulin products require complex and expensive manufacturing processes due to the need to grow NPH microcrystals in the post-fermentation and post-purification steps. Furthermore, such products are inherently sensitive to physical and chemical degradation of both the soluble and microcrystalline components at temperatures above room temperature. The biphasic pharmacokinetic properties of these premixed products can vary with tubing storage at temperatures above room temperature due to the exchange of insulin molecules between the soluble and microcrystalline phases. Finally, the use of microcrystalline suspensions may be accompanied by dosage uncertainty because the number of microcrystals aspirated into the syringe can vary with different aspirations (even from the same tubing).

[0008] Given the aforementioned drawbacks of current biphasic insulin products, the therapeutic and social benefits of biphasic insulin formulations can be enhanced by engineering insulin analogs whose pharmacokinetic properties as single-component soluble solutions impart the action of biphasic insulin. Further benefits would arise if such novel soluble insulin analogs were simpler and less costly to prepare (i.e., avoiding the need for microcrystallization) and / or if they were more resistant to chemical or physical degradation at or above room temperature than wild-type insulin. This resistance to degradation above room temperature is expected to facilitate use in developing countries where unreliable electricity and refrigeration are not available. The challenges posed by such degradation are exacerbated by the impending diabetes pandemic in Africa and Asia. Since fibrosis is the primary pathway for degradation above room temperature, the design of fibrosis-resistant formulations could improve the safety and efficacy of insulin replacement therapy in such challenging regions. Further therapeutic and social benefits would be gained if soluble biphasic insulin analogs showed reduced mitotic activity in assays developed to monitor the proliferation of insulin-stimulated human cancer cell lines.

[0009] Insulin administration has long been established as a treatment for diabetes. The primary goal of routine insulin replacement therapy in diabetic patients is to closely control blood glucose levels to prevent deviations above or below the normal range specific to healthy subjects. Deviations below the normal range are accompanied by direct adrenergic symptoms, or neuroglycopenic symptoms, which, in severe cases, can lead to seizures, coma, and death. Deviations above the normal range are associated with an increased long-term risk of microvascular disease, including retinopathy, blindness, and kidney failure. Insulin is a small, globular protein that plays a crucial role in vertebrate metabolism. Insulin consists of two chains: an A chain containing 21 residues and a B chain containing 30 residues. This hormone is acted upon as Zn in pancreatic β-cells. 2+ - Stable hexamer storage, but as a Zn-free form in the bloodstream. 2+ - Monomers play a role. Insulin is a product of the single-chain precursor proinsulin, in which a linker region (35 residues) connects the C-terminal residue (residue B30) of the B chain to the N-terminal residue of the A chain. Various evidences suggest that it consists of an insulin-like core and a jumbled linker peptide. The formation of three specific disulfide bridges (A6–A11, A7–B7, and A20–B19) is thought to be involved in the oxidative folding of proinsulin in the rough endoplasmic reticulum (ER). Shortly after being exported from the ER to the Golgi apparatus, proinsulin assembles to form soluble Zn. 2+- Coordinated hexamer. Internal proteolytic digestion and conversion to insulin occur in immature secretory granules, followed by morphological condensation. Zinc insulin hexamers arranged in a crystalline pattern in mature storage granules have been visualized by electron microscopy (EM). Each residue is identified by its amino acid identity (usually using a standard three-letter code), chain, and sequence position (usually as a superscript). This invention relates to a novel shortened C-domain of 6-11 residues in length, comprising an N-terminal acidic motif and a C-terminal basic motif, replacing the 36-residue wild-type C-domain characteristic of human proinsulin; and amino acid substitution combinations with positions A8 and A14 of the A chain, and optionally positions B28 and B29 of the B chain.

[0010] Fibrosis, a serious concern in the production, storage, and use of insulin and insulin analogs used to treat diabetes, is enhanced by higher temperatures, lower pH, agitation, or the presence of urea, guanidine, ethanol cosolvents, or hydrophobic surfaces. Current US drug regulations require insulin to be discarded if 1% or higher levels of fibrosis occur. Because fibrosis is enhanced at higher temperatures, insulin should ideally be kept refrigerated before use by diabetic patients. Insulin shows a 10-fold or greater increase in degradation rate for every 10°C increment above 25°C; therefore, guidelines recommend storage at <30°C and preferably refrigeration. The NPH microcrystalline component of existing biphasic insulin products is sensitive to fibrosis above room temperature and to different chemical degradation modes due to proteolytic cleavage within the A-chain; such cleavage inactivates insulin or insulin analogs.

[0011] The aforementioned cleavage of the insulin A chain in NPH microcrystals represents a process involving the breaking of chemical bonds. Such cleavage can lead to the loss or rearrangement of atoms within the insulin molecule or the formation of chemical bonds between different insulin molecules, resulting in polymer formation. Although the cleavage of the A chain in NPH microcrystals is thought to occur on the folded surface, other changes in chemical bonds can be mediated in the unfolded state of the protein or in a partially unfolded form, and such insulin modifications that increase its thermodynamic stability may also delay or prevent chemical degradation. Therefore, a desirable property for insulin analogs is that their denaturation free energy (as typically measured by circular dichroism as a function of the concentration of the chemical denaturant at helical-sensitive wavelengths) should be equal to or greater than that of wild-type insulin, or equal to or greater than that of currently clinically used dietary (rapid-acting) insulin analogs.

[0012] Insulin is also sensitive to physical degradation. Current theories of protein fibrosis assume that the fibrosis mechanism proceeds through a partially folded intermediate state, which then aggregates to form an amyloid protein-forming core. In this theory, it is possible that amino acid substitutions stabilizing the native state may or may not stabilize the partially folded intermediate state, and may or may not increase (or decrease) the free energy barrier between the native and intermediate states. Therefore, current theories suggest that the tendency for a given amino acid substitution in the two-chain insulin molecule to increase or decrease the risk of fibrosis is highly unpredictable. Structural models of the insulin molecule envision three almost fully unfolded α-helices (as seen in the native state), and parallel β-sheets forming continuously stacked B chains and continuously stacked A chains; native disulfide bond pairings between the chains and within the A chain are maintained. Such parallel cross-β-sheets require significant separation between the N-termini of the A chains and the C-termini of the B chains. In the native state, the terminal of an insulin monomer is usually close to It is known in the art that single-chain insulin analogs with shortened C-domains exhibit significant resistance to fibrosis, and this is thought to reflect a topological incompatibility between the extended structure of parallel cross-β-plates in the proinsulin filament and the structure of single-chain insulin analogs with naturally occurring disulfide bond pairings, wherein the shortened C-domain forces a distance between the N-terminus of the A chain and the C-terminus of the B chain that is unfavorable to the proinsulin filament. A band-like model of single-chain insulin analogs is shown in... Figure 2 The space-filling model of the insulin portion is shown in Figure 3 This highlights the connection structure domain (C structure domain) of the engineering renovation; Figure 3 The function of the stick-shaped representation in the text.

[0013] Inspired by medical and societal needs, this invention engineered biphasic single-chain insulin analogs for use in neutral pH soluble and monophasic formulations intended for twice-daily injection (i.e., according to a schedule similar to current premixed conventional-NPH biphasic insulin products). Our single-chain design is expected to combine (i) resistance to degradation with (ii) significant in vivo hypoglycemic efficacy with (iii) reduced cross-binding with IGF-1R and (iv) inherent biphasic pharmacokinetics and pharmacodynamics in the absence of components consisting of microcrystalline suspensions. Therefore, what will be needed is to invent a single-chain insulin analog that, as a soluble protein solution at neutral pH, exhibits biphasic pharmacokinetic and pharmacodynamic properties upon subcutaneous injection, enabling both rapid onset of action and prolonged tail of action, resulting in similar effects to premixed products such as… Mix75 / 25" or " The overall characteristic is 30". Therefore, the biphasic insulin analog formulation of the present invention will provide a simplified twice-daily bolus-based regimen, which will have clinical advantages in both developed and developing countries. The single-chain biphasic insulin analog formulation can also be introduced in insulin-naïve patients who are not adequately controlled by metformin (a widely used first-line oral medication for treating type 2 diabetes mellitus). The biphasic mechanism of action of current conventional NPH premixed products based on the pharmacokinetic properties of the two components is illustrated in the figure. Figure 4 A. Although not wishing to be bound by theory, the possible mechanisms of biphasic pharmacokinetic analogy of this invention are illustrated in diagram form. Figure 4 B.

[0014] We envision that the products of this invention will disproportionately benefit patients in Western societies, where compatibility with more complex regimens is uncertain. Health care outcomes—and long-term adherence to prescribing regimens for chronic diseases such as T2DM and metabolic syndrome—are known in the art to be a complex function of socioeconomic status, formal education, family structure, and cultural belief systems. Indeed, these social problems are increasingly highlighted by the growing burden of obesity and T2DM among unrepresented minorities, including African Americans, Hispanic Americans, and Native Americans. Therefore, the single-chain biphasic insulin analog formulation of this invention is expected to benefit patients with T1DM and T2DM who require insulin and have inadequate glycemic control with basal insulin-only therapy, for whom a completely basal bolus regimen is impractical. Invention Overview

[0016] Therefore, one aspect of the invention provides a single-chain insulin analog that, when administered subcutaneously, exhibits biphasic pharmacokinetic and pharmacodynamic properties. The analog of the invention contains histidine at position B10, thus avoiding concerns about carcinogens associated with acidic substitutions (aspartic acid or glutamate) at this position. Another aspect of the invention is that, relative to wild-type human insulin, the single-chain insulin analog exhibits absolute in vitro affinity for IR-A and IR-B in the range of 5-100%, thus making it impossible to show prolonged residence time in the hormone-receptor complex.

[0017] The aforementioned combination of features is conferred by a novel C-domain design, wherein the shortened linker polypeptide (6-11 residues in length) comprises an N-terminal acidic element (residues C1 and C2), a flexible linker or hinge (C3 and C4), and a C-terminal segment (C5 and C6) containing a pair of basic residues similar to those found in natural preinsulin. For the C-domain length, an upper limit of 11 is chosen, which is lower than the 12-residue IGF-I-derived linker described in chimeric insulin analogs with enhanced IGF-1R binding activity (Kristensen, C. et al. 1995). A lower limit of 4 is chosen to maintain the acidic motif (e.g., but not limited to Glu-Glu) of the N-terminal portion of the linker domain and the basic motif (e.g., but not limited to Arg-Arg) of the C-terminal portion of the linker domain. While not wishing to be bound by theory, we envision that when said analogs bind to IGF-1R, the acidic residues of the two - residues introduce unfavorable electrostatic repulsion, but are adequately tolerated by the insulin receptor isotype. Not wanting to be constrained by theory, we further hypothesize that C-terminal basic motifs facilitate partial subcutaneous aggregation, rather than merely tethering or space elements.

[0018] In general, the present invention provides single-chain insulin analogs comprising the C-domain of the present invention and an A-chain modified with substitutions at positions A8 and A14. The present invention therefore relates to a novel class of single-chain insulin analogs wherein the linking domain (C-domain) has a length of 4-11 and consists of two elements. The N-terminal element consists of the first two residues (referred to as C1 and C2, corresponding to residues B31-B32 of the extended insulin B-chain), wherein C1 and C2 contain at least one acidic side chain and a net formal electrostatic charge of -1 or -2 at pH 7.4. The C-terminal element contains two basic residues, such as Arg-Arg, Lys-Lys, Arg-Lys, or Lys-Arg. For 4-residue linker domains, the sequences of the present invention will therefore include, but are not limited to, Glu-Glu-Arg-Arg, Glu-Ala-Arg-Arg, Ala-Glu-Arg-Arg, Asp-Glu-Arg-Arg, Glu-Glu-Lys-Arg, Glu-Glu-Arg-Lys, and Glu-Glu-Lys-Lys. In the case of linker domains longer than 4 residues (i.e., in the range of 5-11), the linker domain contains a flexible link between the N- and C-terminal elements. In examples of 6-residue linker domains, such sequences may include Gly-Pro, Ser-Pro, Ala, Pro, Gly-Ser, Ser-Ser, Gly-Gly, or Ala-Ala at positions C3 and C4, but the scope of the invention is not limited to these possibilities. The A chain contains a basic substitution (lysine, arginine, or histidine) at A8 and a substitution (Gly, Ala, or Ser) at A21 to avoid acid-catalyzed deamidation or other Asn-related chemical degradation modes. In one instance, chain B also includes the permutation of Lys. B29 →Arg, to avoid Lys-specific proteolytic cleavage during biosynthesis in yeast. Analogs of the invention also include substitutions at position A8 (Ala, Glu, Gln, His, Lys, or Arg) intended to improve stability and activity; and substitutions at position A14 (Glu) intended to avoid the anti-hydrophobic interactions presumed by wild-type TyrA14 and to provide additional negative charge. Other possible substitutions at position A14 are also considered. Brief description of the attached diagram

[0020] Figure 1A diagram illustrating the goals of biphasic insulin products. Initial implementations used wild-type insulin (regular and NPH), while current products use dietary insulin analogs. This diagram is from R. Beaser & S. Braunstein, MedScape Multispeciality (Education / CME section; 2009) (http: / / www.medscape.org / viewarticle / 708784).

[0021] Figure 2 A banded model of .57-residue SCI. The α-helix is ​​shown in red (outer) and yellow (inner), and the B24-B28 β-chain is shown in blue (arrows). Three disulfide bridges (cystine residues) are shown (asterisks). The C-domain (sequence GGGPRR) is fully ordered (Hua, QX et al. J. Biol. Chem. 283, 14703-16 (2008)).

[0022] Figure 3 Molecular structure of the .57-residue SCI platform. A 6-residue C-domain (stick; blue-green) provides the chain between the A and B domains (space-filling diagram). Surface colors are encoded according to electrostatic sites in standard GRASP format (red, negative; purple, positive; and white, neutral). This figure is obtained from PDB entry 2jzq, which is based on NMR studies in the Weiss laboratory (Hua, QX et al. J. Biol. Chem. 283, 14703-16 (2008)).

[0023] Figure 4 Old and New Paradigms. (A) Current biphasic insulin products comprise a soluble phase (zinc hexamer; green) and an insoluble phase (NPH microcrystalline suspension; blue). (B) The proposed new paradigm attempts to utilize monomeric insulin analogs (I), zinc-free dimers (I2), zinc-stabilized and / or zinc-free hexamers (I6), and soluble aggregates (I... 6n Pairing balance in ) . Not shown: TR transition.

[0024] Figure 5 Overexpression of Thermalin-biphasic (forms 1 and 2) in the yeast *Pichia pastoris*. Coomassie-stained SDS-PAGE gels: (A) SCI-57PE (lane bd), relative to molecular weight marker (a). (B) SCI-57DP (lane g), relative to His as a positive control. A8 - Minimal preinsulin (MPI) (f) and standard (e). SCI migration ≈ 6 kilodaltons (K d Minimal preinsulin is approximately 5.8 kDa.

[0025] Figure 6 Diabetic rats (blood glucose 400±20 mg / dL at time 0) were injected with 1 unit of the specified insulin analog per 300 g body weight. Humalog (lispro insulin) vs. Humalog 25 / 75-Premix SCI-57PE (labeled SCI-1 in the figure) fresh control (◆) SCI-57DP (labeled SCI-2) fresh control (●) dilution. B. Reduction of blood glucose during the first hour after injection (same symbol code). The number of rats in each group (n) is indicated; error bars, standard error.

[0026] Figure 7 Initial rate of decrease in blood glucose after injection of 1 unit of the specified insulin analog sq: + indicates SCI-57PE (labeled SCI-1) after 25 days of agitation at 45°C; ++ indicates SCI-57DP (labeled SCI-2) after 57 days of agitation at 45°C. *p<0.05, compared to all other insulins. **p<0.05, compared to premixed lispro insulin 75 / 25. Data for the first 1 hour after injection (see...) Figure 8 B); Error bar, standard error.

[0027] Figure 8 Diabetic rats (blood glucose at time 0 was 410±20 mg / dL) were injected with 1 unit of the specified analog / 300 g body weight. A. Fresh samples: (◆) SCI-57DP (labeled as SCI-2), (Δ) Lantus (insulin glargine), Humalog (lispro insulin) and (●) dilution. A. Fresh insulin. B. Effect of agitation at high temperature: (◆) Fresh SCI-57DP vs. (□) SCI-57DP agitated at 45°C for 57 days vs. (○) Lantus (glargine insulin) agitated at 45°C for 11 days.

[0028] Figure 9 Lilly Co 2+ –EDTA chelation assay: Normalized absorbance at 574 nm (visible wavelength) is displayed as a function of time after adding EDTA (in 10-fold molar excess) to a solution of R6 cobalt insulin hexamer or SCI-1 hexamer at 25°C. Wild-type insulin (black line): Single-exponential transition, time constant 6.3 (±0.1) min. SCI-1 (green line): Biphasic transition, time constants 0.9 (±0.1) min (fast phase) and 14.1 (±0.1) min (slow phase); r 2=0.998. Protein content was 3.5 mg / ml in 50 mM Tris-HCl (pH 7.4) containing 1 mM NaSCN, 0.2 mM CoCl2 and 50 mM phenol. Invention Details

[0030] This invention relates to single-chain insulin analogs that provide prolonged duration of action, an IR-A / IR-B receptor binding affinity ratio similar to wild-type insulin with an absolute affinity ranging from 5-100% (the selected lower limit corresponds to pre-insulin), increased discrimination against IGF-1R, presumed enhanced resistance to chemical degradation at position A21 (due to Asn substitution for Gly, Ala, or Ser), presumed enhanced resistance to fibrosis above room temperature (due to single-chain topology), and presumed increased thermodynamic activity (partly due to Thr). A8 Replaced with basic side chains; Arg, Lys, His, Orn).

[0031] The invention is characterized by the ability, when formulated as a clear and soluble single-phase protein solution, to generate biphasic absorption kinetics from a subcutaneous reservoir via a single-chain insulin analog. Conventional premixed products known in the art provide a final end with a possible pairing equilibrium between self-assembled states. Figure 4 A). Alternative strategies for providing a combination of fast and delayed absorptions are considered, which rely on rate constants that manage these pairing equilibrium and relative thermodynamic stability, such as... Figure 4 As illustrated in Figure B. The molecular implementation of this strategy requires insulin analogs that are (i) superstable as zinc-free monomers and dimers, and (ii) also compliant in forming stable zinc-mediated hexamers, which are sensitive to higher-order aggregation (soluble in vials or pens, but possibly insoluble in reservoirs). While not wishing to be bound by theory, zinc-free monomers and dimers can provide the dietary component; zinc-stable hexamer aggregates would provide the long-acting component. Further not wishing to be bound by theory, it is further possible that single-chain insulin analogs, when provided in the bloodstream as monomeric protein molecules, could exhibit biphasic signal transduction properties on target cells through the inherent characteristics of their hormone-receptor signal transduction complexes, thus mimicking the biphasic pharmacokinetic properties of existing conventional-NPH premixed products.

[0032] The invention is characterized by an isoelectric point of 6.8-7.8 for the single-chain analogs, making soluble formulations feasible under neutral conditions (pH 7.0-8.0) in the presence of 2-3 zinc ions / 6 protein monomers or in the presence of fewer than 2 zinc ions / 6 protein monomers, thus preventing hexamer assembly. Therefore, the invention is characterized by the single-chain insulin analogs retaining the ability to undergo zinc ion-dependent hexamer formation, similar to what is known in the art as T6 insulin hexamer, T3R... f The classic zinc insulin hexamer, also known as the R6 insulin hexamer.

[0033] It is also considered that single-chain analogs can be made using A- and B-domain sequences derived from animal insulin, with non-limiting examples including, for example, porcine, bovine, equine, and canine insulin. Additionally or alternatively, the insulin analogs of the present invention may contain the deletion of residues B1-B3, or may be combined with a variant B chain lacking lysine (e.g., LysB29 in wild-type human insulin) to avoid Lys-directed proteolytic degradation of precursor polypeptides in yeast biosynthesis in Pichia pastoris, Saccharomyces cerevisciae, or other yeast expression species or strains. The B-domain of the single-chain insulin of the present invention may optionally contain non-standard substitutions, such as D-amino acids at positions B20 and / or B23 (intended to increase thermodynamic stability, receptor binding affinity, and resistance to fibrosis), in Phe B24 Halogen modification at the 2-ring position (i.e., ortho-F-Phe) B24 , adjacent-Cl-Phe B24 or adjacent -Br-Phe B24 (Expected to improve thermodynamic stability and resistance to fibrosis) Phe B24 2-methyl ring modification (expected to increase receptor binding affinity) and / or in Tyr B16 and / or Tyr B26 Iodine-substituted compounds (3-mono-iodide-Tyr or [3,5]-di-iodide-Tyr) were introduced into the aromatic ring; this is expected to improve thermodynamic stability and receptor binding activity. Thr was also considered. B27 Thr B30One or more serine residues in the C-domain may be modified, alone or in combination, via monosaccharide adducts; examples are O-linked N-acetyl-β-D-galactopyranoside (referred to as GalNAc-Oβ-Ser or GalNAc-Oβ-Thr), O-linked α-D-mannopyranoside (mannose-Oβ-Ser or mannose-Oβ-Thr) and / or α-D-glucopyranoside (glucose-Oβ-Ser or glucose-Oβ-Thr).

[0034] Furthermore, based on the similarity between human and animal insulin, and the past use of animal insulin in human diabetic patients, it is also considered that other minor modifications, particularly those substitutions considered "conservative," may be introduced into the insulin sequence. For example, additional amino acid substitutions may be made within groups of amino acids having similar side chains without departing from the present invention. These include neutral hydrophobic amino acids: alanine (Ala or A), valine (Val or V), leucine (Leu or L), isoleucine (Ile or I), proline (Pro or P), tryptophan (Trp or W), phenylalanine (Phe or F), and methionine (Met or M). Similarly, neutral polar amino acids may be substituted for each other within the group of glycine (Gly or G), serine (Ser or S), threonine (Thr or T), tyrosine (Tyr or Y), cysteine ​​(Cys or C), glutamine (Glu or Q), and asparagine (Asn or N). Basic amino acids are considered to include lysine (Lys or K), arginine (Arg or R), and histidine (His or H). Acidic amino acids are aspartic acid (Asp or D) and glutamic acid (Glu or E). Unless otherwise noted or apparent from the context, the amino acids described herein should be considered L-amino acids. Standard amino acids may also be substituted by non-standard amino acids belonging to the same chemical class. By way of non-limiting examples, the basic side chain Lys may be substituted by basic amino acids with shorter side chain lengths (ornithine, diaminobutyric acid, or diaminopropionic acid). Lys may also be substituted by the neutral aliphatic isosteric leucine (Nle), which may further be substituted by analogs containing shorter aliphatic side chains (aminobutyric acid or aminopropionic acid).

[0035] For comparative purposes, the amino acid sequence of human pre-insulin is provided as SEQ ID NO:1.

[0036] SEQ ID NO:1 (Pre-insulin)

[0037] Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-A rg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys-Thr-Arg-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Val-Gly-Gln-Val-Glu -Leu-Gly-Gly-Gly-Pro-Gly-Ala-Gly-Ser-Leu-Gln-Pro-Leu-Ala-Leu-Glu-Gly-Ser-Leu-Gln-Lys-A rg-Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys-Ser-Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn

[0038] The amino acid sequence of the A chain of human insulin is provided as SEQ ID NO:2.

[0039] SEQ ID NO:2 (Human A Chain)

[0040] Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys-Ser-Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn

[0041] The amino acid sequence of the B chain of human insulin is provided as SEQ ID NO:3.

[0042] SEQ ID NO:3 (Human B Chain)

[0043] Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys-Thr

[0044] Provides KP-insulin (lispro insulin, The active component, the amino acid sequence of the modified B chain of Eli Lilly and Co., is shown as SEQ ID NO:4.

[0045] SEQ ID NO:4 (KPB chain)

[0046] Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Lys-Pro-Thr

[0047] SEQ ID NO 5 provides the amino acid sequence of a previously disclosed single-chain insulin analog (Hua, QX et al. J. Biol. Chem. 283, 14703-16 (2008)), the structure of which is shown in Figure 1 and 2 Unlike the analogues of the present invention, this sequence lacks the acidic residues at positions A14, C1, and C2, and contains the acidic residue at position B10; the resulting single-chain insulin analogue does not exhibit the biphasic pharmacodynamic properties required by the present invention.

[0048] The amino acid sequences of the single-chain insulin analogs of the present invention are partially given in SEQ ID NOs 6-19, corresponding to the single-chain insulin analogs. These sequences use standard single-letter codes, such that Ala is represented by A, cysteine ​​by C, aspartic acid by D, glutamic acid by E, etc., as is known in the art. Red elements indicate sequences or substitutions not present in wild-type insulin or wild-type preinsulin. The dashes in SEQ ID NOs 13 and 19 indicate the deletion of N-terminal residues B1-B3 (referred to as des-B1-B3 analogs).

[0049]

[0050]

[0051]

[0052] The amino acid sequences of the single-chain insulin analogs of the present invention are also given in SEQ ID NO 20-34, corresponding to single-chain insulin analogs having optional elements at positions indicated by X1, X2, etc.; these positions are indicated in green. As described above, red elements represent sequences or substitutions not present in other forms in wild-type insulin or wild-type preinsulin. The dashes in SEQ ID NO 13 and 19 indicate the deletion of N-terminal residues B1-B3 (referred to as des-B1-B3 analogs).

[0053]

[0054]

[0055]

[0056] Where X1 is selected from Ala, Arg, Asn, Asp, Gln, Glu, or Lys; X2 is selected from Ala, Arg, Gln, Glu, or Lys; X3 is selected from Gln, Glu, Phe, Trp, or Tyr; and X1 is selected from Ala, Arg, Glu, Lys, or Pro.

[0057] The amino acid sequences of the single-chain insulin analogs of the present invention are also given in SEQ ID NO 35-49, corresponding to single-chain insulin analogs having optional elements at the positions (purple-red) of the linker domains represented by Y1, Y2, etc., and including the aforementioned optional sequence features X1, X2, etc., represented in green. As mentioned above, the red elements represent sequences or substitutions not present in other forms in wild-type insulin or wild-type preinsulin. The dashes in SEQ ID NO 13 and 19 indicate the deletion of N-terminal residues B1-B3 (referred to as des-B1-B3 analogs).

[0058]

[0059]

[0060] Where X1 is selected from Ala, Arg, Asn, Asp, Gln, Glu, or Lys; X2 is selected from Ala, Arg, Gln, Glu, or Lys; X3 is selected from Gln, Glu, Phe, Trp, or Tyr; X1 is selected from Ala, Arg, Glu, Lys, or Pro; and Y1 and Y2 are each Asp or Glu.

[0061] The amino acid sequence of the single-chain insulin analog of the present invention is also given in SEQ ID NO 50-64, corresponding to having an additional 1-5 amino acid residues (referred to as B). 1-5 A single-chain insulin analogue (hereinafter indicated in blue) having optional elements at the location of the linker domain (purple-red) indicated by Y1, Y2, etc., and including the aforementioned optional sequence features X1, X2, etc., indicated in green. As described above, the red elements represent sequences or substitutions not present in other forms in wild-type insulin or wild-type preinsulin. The dashes in SEQ ID NO 13 and 19 indicate the deletion of N-terminal residues B1-B3 (referred to as des-B1-B3 analogues).

[0062]

[0063]

[0064] Wherein X1 is selected from Ala, Arg, Asn, Asp, Gln, Glu, or Lys; X2 is selected from Ala, Arg, Gln, Glu, or Lys; X3 is selected from Gln, Glu, Phe, Trp, or Tyr; X1 is selected from Ala, Arg, Glu, Lys, or Pro; wherein Y1 and Y2 are each Asp or Glu; and wherein residues B1, B2, B3, B4, and B5 are each optionally present and can be selected from Ala, Asn, Gln, Gly, Pro, Ser, or Thr.

[0065] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 6 (see above), with codons optimized for use in Pichia pastoris.

[0066] SEQ.ID.NO65

[0067] TTCGTCAATCAACACTTGTGTGGTTCCCACTTGGTTGAGGCATTGTACTTGGTCTGTGGTGAGAGAGGATTCTTCTACACCGATCCAACTGGTGGTGGTCCTAGAAGAGGAATCGTCGAGCAATGTTGCCACTCCATTGTTCCTTGGAACAATTGGAAAACTACTGCAACTAA

[0068] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 7 (see above), with codons optimized for use in Pichia pastoris.

[0069] SEQ.ID.NO 66

[0070] TTCGTCAATCAACACTTGTGTGGTTCCCACTTGGTTGAGGCATTGTACTTGGTCTGTGGTGAGAGAGGATTCTTCTACACCGATCCAACTGGTGAGGGTCCTAGAAGAGGAATCGTCGAGCAATGTTGCCACTCCATTTGTTCCTTGGAACAATTGGAAAACTACTGCAACTAA

[0071] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 8 (see above), with codons optimized for use in Pichia pastoris.

[0072] SEQ.ID.NO 67

[0073] TTCGTCAATCAGCACTTGTGTGGTTCCCACTTGGTTGAGGCTTTGTACTTGGTTTGTGGTGAGAGAGGTTTCTTCTACACTGATCCAACTGAAGAGGGTCCAAGAAGAGGTATCGTTGAGCAGTGTTGTCACTCCATCTGTTCCTTGGAGCAGTTGGAGAACTACTGTAACTGA

[0074] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 9 (see above), with codons optimized for use in Pichia pastoris.

[0075] SEQ.ID.NO 68

[0076] TTCGTCAATCAGCACTTGTGTGGTTCCCACTTGGTTGAGGCTTTGTACTTGGTTTGTGGTGAGAGAGGTTTCTTCTACACTGATCCAACTGAAGAGGGTCCAAGAAGAGGTATCGTTGAGCAGTGTTGTCACTCCATCTGTTCCTGGGAGCAGTTGGAGAACTACTGTAACTGA

[0077] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 10 (see above), with codons optimized for use in Pichia pastoris.

[0078] SEQ.ID.NO 69

[0079] TTCGTCAATCAGCACTTGTGTGGTTCCCACTTGGTTGAGGCTTTGTACTTGGTTTGTGGTGAGAGAGGTTTCTTCTACACTCCAGAAACTGAAGAGGGTCCAAGAAGAGGTATCGTTGAGCAGTGTTGTCACTCCATCTGTTCCTTGGAGCAGTTGGAGAACTACTGTAACTGA

[0080] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 11 (see above), with codons optimized for use in Pichia pastoris.

[0081] SEQ.ID.NO 70

[0082] TTCGTCAATCAGCACTTGTGTGGTTCCCACTTGGTTGAGGCTTTGTACTTGGTTTGTGGTGAGAGAGGTTTCTTCTACACTCCAAGAACTGAAGAGGGTCCAAGAAGAGGTATCGTTGAGCAGTGTTGTCACTCCATCTGTTCCTTGGAGCAGTTGGAGAACTACTGTAACTGA

[0083] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 12 (see above), with codons optimized for use in Pichia pastoris.

[0084] SEQ.ID.NO 71

[0085] TTCGTCAATCAGCACTTGTGTGGTTCCCACTTGGTTGAGGCTTTGTACTTGGTTTGTGGTGAGAGAGGTTTCTTCTACACTGAGCCAACTGAAGAGGGTCCAAGAAGAGGTATCGTTGAGCAGTGTTGTCACTCCATCTGTTCCTTGGAGCAGTTGGAGAACTACTGTAACTGA

[0086] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 13 (see above), with codons optimized for use in Pichia pastoris.

[0087] SEQ.ID.NO 72

[0088] TTCGTCAAACAGCACTTGTGTGGTTCCCACTTGGTTGAGGCTTTGTACTTGGTTTGTGGTGAGAGAGGTTTCTTCTACACTCCAGAAACTGAAGAGGGTCCAAGAAGAGGTATCGTTGAGCAGTGTTGTCACTCCATCTGTTCCTTGGAGCAGTTGGAGAACTACTGTAACTGA

[0089] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 15 (see above), with codons optimized for use in Pichia pastoris.

[0090] SEQ.ID.NO 73

[0091] TTCGTTAACCAGCACTTGTGTGGTTCCCACTTGGTTGAGGCTTTGTACTTGGTTTGTGGTGAGAGAGGTTTCTTCTACACTGATCCAACTGAAGAGAGAAGAGGTATCGTTGAGCAGTGTTGTCACTCCATCTGTTCCTTGGAGCAGTTGGAGAACTACTGTAACTAA

[0092] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 16 (see above), with codons optimized for use in Pichia pastoris.

[0093] SEQ.ID.NO 74

[0094] TTCGTTAACCAGCACTTGTGTGGTTCCCACTTGGTTGAGGCTTTGTACTTGGTTTGTGGTGAGAGAGGTTTCTTCTACACTGATCCAACTGAAGAGAGAAGAGGTATCGTTGAGCAGTGTTGTCACTCCATCTGTTCCTTGGAGCAGTTGGAGAACTACTGTAACTAA

[0095] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 17 (see above), with codons optimized for use in Pichia pastoris.

[0096] SEQ.ID.NO 75

[0097] TTCGTTAACCAGCACTTGTGTGGTTCCCACTTGGTTGAGGCTTTGTACTTGGTTTGTGGTGAGAGAGGTTTCTTCTACACTGATCCAACTGAAGAGAGAGGTATCGTTGAGCAGTGTTGTCACTCCATCTGTTCCTTGGAGCAGTTGGAGAACTACTGTAACTAA

[0098] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 18 (see above), with codons optimized for use in Pichia pastoris.

[0099] SEQ.ID.NO 76

[0100] TTCGTCAATCAGCACTTGTGTGGTTCCCACTTGGTTCAGGCTTTGTACTTGGTTTGTGGTGAGAGAGGTTTCTTCTACACTCCAGAAACTGAAGAGGGTCCAAGAAGAGGTATCGTTGAGCAGTGTTGTCACTCCATCTGTTCCTTGGAGCAGTTGGAGAACTACTGTAACTGA

[0101] The following DNA sequence encodes the single-chain insulin analog specified in SEQ ID NO 19 (see above), with codons optimized for use in Pichia pastoris.

[0102] SEQ.ID.NO 77

[0103] TTCGTCAAACAGCACTTGTGTGGTTCCCACTTGGTTGAGGCTTTGTACTTGGTTTGTGGTGAGAGAGGTTTCTTCTACACTGACCCAACTGAAGAGGGTCCAAGAAGAGGTATCGTTGAGCAGTGTTGTCACTCCATCTGTTCCTTGGAGCAGTTGGAGAACTACTGTAACTGA

[0104] A similar synthetic gene was prepared and cloned into *Pichia pastoris*, which encodes SCI-59A (see below) and derivatives of SCI-59A and SCI-59B containing additional glutamate substitutions. B13 →Gln, as specifically expressed in SEQ.ID NO 31-37.

[0105] Two single-chain insulin analogs of the present invention (coded by SEQ ID NO 8 and SEQ ID NO 10; designated SCI-57DP and SCI-57PE, respectively) are prepared by biosynthesizing precursor peptides in *Pichia pastoris*; this system secretes folded proteins containing native disulfide bridges and cleaved N-terminal extended peptides. The overexpression efficiency (>200 mg / L fermentation medium) is shown in... Figure 5The cleaved single-chain insulin product has a length of 57, which is the sum of a 30-residue B-domain, a 6-residue C-domain (in all cases, the sequence is EEGPRR), and a 21-residue A-domain. The isoelectric points (pI) of the forms SCI-57DP and SCI-57PE in all cases are predicted to shift to below 5.0 by removing the positive charge at the wild-type position B29 (LysB29), by acidic substitution of B28 or B29, by acidic substitution of A14 (TyrA14→Glu), and by negating the basic and acidic side chains in the C-domain.

[0106] The thermodynamic stability of the single-chain analogs was probed by guanidine denaturation monitored by CD, as described in (Hua, QX et al. J. Biol. Chem. 283, 14703-16 (2008)). The results (Column 2 of Table 1) showed that SCI-57DP and SCI-57PE were each more stable to chemical denaturation than wild-type insulin or KP-insulin. Higher concentrations of guanidine hydrochloride were required in each case to achieve 50% protein unfolding (Column 3 of Table 1); a trend toward larger m values ​​was observed (Column 4), indicating more efficient desolvation of the nonpolar surface of the folded state. SCI-57PE was found to be significantly more susceptible to fibrosis with gentle agitation at 37°C compared to wild-type insulin or KP-insulin (Column 5 of Table 1). Although wild-type insulin and KP-insulin formed fibrils in less than 10 days under these conditions, SCI-57PE was resistant to fibrosis for at least 9 months.

[0107] The receptor-binding affinity of SCI-57DP and SCI-57PE was determined relative to wild-type human insulin. This assay used the A isotype of the insulin receptor. SCI-57DP and SCI-57PE showed binding constants of 0.06 (±0.01) nM and 0.08 (±0.01) nM, respectively, relative to human insulin (equilibrium dissociation constant of 0.05 (±0.01) nM). SCI-57DP showed at most 1 / 5 the affinity of wild-type human insulin for the mitogenic type 1 IGF-I receptor. The assay protocol for receptor-binding activity was as follows: Microtiter plates (Nunc Maxisorb) were incubated overnight at 4°C with AU5 IgG (100 μl / well, 40 mg / ml, in phosphate-buffered saline). Binding data were analyzed using a two-point continuous model. Data were corrected for nonspecific binding (the amount of radioactivity that maintains membrane association in the presence of 1 μM human insulin). In all assays, the percentage of tracer bound in the absence of competing ligands is less than 15% to avoid ligand-depletion artifacts. Dissociation constant (Ki) dThe model was determined by fitting to a mathematical model, as described by Whittaker and Whittaker (2005. J. Biol. Chem. 280: 20932-20936); the model uses a nonlinear regression that assumes heterogeneous competition (Wang, 1995, FEBS Lett. 360: 111-114).

[0108] Table 1. Thermodynamic and physical stability of insulin analogs at 25 °C a

[0109]

[0110] a Thermodynamic stability was inferred from the guanidine denaturation (222 nm) detected by CD- at 25 °C, and analyzed by extrapolation to a two-state model at zero denaturation concentration.

[0111] b ΔG u The apparent change in denaturation free energy in guanidine hydrochloride is represented by extrapolation to zero denaturation concentration using a two-state model.

[0112] c C mid The concentration of guanidine hydrochloride is defined as the concentration at which 50% of the protein is unfolded.

[0113] d The value of m reveals the unfolding free energy ΔG. u The slope relative to the molar concentration of the denaturant; it is related to the degree of exposure of the nonpolar surface during denaturation.

[0114] e Fibrosis lag time is a measure of the number of days before the onset of thiamine-T-positive aggregation;

[0115] Triple copies of the analogue were gently shaken at nominal strength U-100 in a Tris-HCl formulation at 45°C.

[0116] f ND; Not detected

[0117] Biological activity and pharmacodynamics were tested in male Sprague-Dawley rats (approximately 300g) with diabetes induced by streptozotocin. Figure 6 ). Relative to and 25-75 Premixes were used to evaluate the PD effect of sq injection of U-100 (0.6 mM) SCI-57PE and SCI-57DP; the overall characteristics of the obtained blood glucose concentrations were analyzed. Figure 6A) indicates that the PD properties of our two candidates are similar to those of premixed Lilly products, summarizing both their long-acting (120–540 min) and fast-acting components. Figure 6 B). The initial rate of decrease in blood glucose concentration within the first hour after injection was shown in Figure 7 .

[0118] Thermal stability of SCI. In the above rats, under conditions favorable to the rapid degradation of the current insulin product (i.e., with gentle stirring in a glass vial at 45°C in the presence of an air-liquid interface); Figure 8 To evaluate the retention or loss of efficacy of SCI-57DP. Figure 8 A uses fresh materials. The control is... and although Inactivated after 11 days Figure 8 (○ in B) and Inactivated within 5 days (not shown), but SCI-2 (◆ and □) remained fully active when tested as a clear solution after 57 days. Figure 8 B). SCI-57PE (its G) u Greater than SCI-DP; Table 1 above shows similar resistance to degradation (not shown).

[0119] Structural studies were performed using circular dichroism (CD) and NMR spectroscopy. Far-UV CD spectra of SCI-57DP and SCI-57PE indicated a predominantly α-helical structure, consistent with the native structure of human insulin and the solution structure of single-chain insulin analogs (Hua, QX et al. J. Biol. Chem. 283, 14703-16 (2008)). NMR studies focused on aqueous solutions (pH 7-8) of SCI-57DP in the monomeric state at protein concentrations <1 mM in the absence of zinc ions. Spectra were obtained at a proton frequency of 700 MHz. 2D-NMR NOESY spectroscopy and... 1 H- 15 The N heteronuclear single quantum coherence (HSQC) 2D “fingerprint” spectrum provides evidence of the folded structure; the patterns of NOEs and chemical shifts are consistent with prior analysis of a 57-residue single-chain insulin analog (Hua, QX et al. J. Biol. Chem. 283, 14703-16 (2008)).

[0120] The rate of hexamer decomposition was evaluated by visible absorption spectroscopy in the R6 cobalt hexamer of SCI-1 at 25 °C and pH 7.4. This assay utilizes the two tetrahedral Co atoms in the R6 insulin hexamer. 2+ The blue dd absorption bands at the site are used to monitor the rate of metal ion release and chelation via the excess chelating agent EDTA; octahedral Co 2+–EDTA complexes are colorless. It is noteworthy that, although wild-type insulin's Lilly Co... 2+ – EDTA chelation assays under these conditions result in a single-exponential loss of absorbance at 574 nm. Figure 9 (The black line in the text), but SCI-1 showed both a fast phase (faster than lispro insulin; not shown) and a slow phase (slower than wild-type insulin); Figure 9 The biphasic kinetic behavior (as shown by the green line in the image) is unprecedented in the list of two-chain insulin analogs tested by the Weiss group at CWRU in an EDTA assay. This PK-related assay was studied in animals (and subsequently in humans), and these spectroscopic results inspired our hypothesis that the SCI of this invention could exhibit biphasic PK properties in subcutaneous reservoirs (as in rats). The molecular mechanism of this biphasic behavior remains undetermined but may involve phenol-dependent RT transitions, as found in insulin degludec (a novel basic analog from Novo-Nordisk).

[0121] Methods for treating patients with diabetes include administering the single-chain insulin analogs described herein. In another aspect of the invention, the single-chain insulin analogs can be prepared in yeast (Pichia pastoris) or synthesized entirely chemically via natural fragment linking. In the case of non-standard modifications, such as D-amino acid substitutions, halogen substitutions within the aromatic ring of Phe or Tyr, or modifications involving the O-linking of serine or threonine to a carbohydrate, synthetic preparation routes are preferred; however, it is feasible to prepare subgroups of single-chain analogs containing non-standard modifications using extended genetic code techniques or tetra-base codon techniques (for the review, see Hohsaka, T., & Sisido, M., 2012). In yet another aspect of the invention, the use of non-standard amino acid substitutions can increase the resistance of the single-chain insulin analogs to chemical or physical degradation. We further consider providing methods for treating diabetes or metabolic syndrome using the analogs of the invention. The insulin analogs are delivered via subcutaneous injection using a syringe or pen device.

[0122] The single-chain insulin analogues of the present invention may also include other modifications, such as halogen atoms at positions B24, B25, or B26, as more fully described in concurrently pending U.S. Patent Application No. 13 / 018,011, the disclosure of which is incorporated herein by reference. The insulin analogues of the present invention may also include a shortened B chain due to the deletion of residues B1-B3, as more fully described in concurrently pending U.S. Provisional Patent Application No. 61 / 589,012.

[0123] The pharmaceutical composition may comprise such an insulin analog and optionally include zinc. Zinc ions can be of various zinc ions: including protein ratios, ranging from 2.2 zinc atoms / insulin analog hexamer to 10 zinc atoms / insulin analog hexamer. The pH range of the formulation is pH 7.0–8.0; a buffer (typically sodium phosphate or Tris-hydrochloric acid) may or may not be present. In such formulations, the concentration of the insulin analog is typically about 0.6–5.0 mM; concentrations up to 5 mM are available for vials or pens; more concentrated formulations (U-200 or higher) may have particular benefit in patients with significant insulin resistance. Excipients may include glycerol, glycine, arginine, Tris, other buffers and salts, and antimicrobial preservatives such as phenol and m-cresol; the latter preservatives are known to improve the stability of the insulin hexamer. Such pharmaceutical compositions may be used to treat patients with diabetes or other medical conditions by administering a physiologically effective amount of the composition.

[0124] Based on the foregoing disclosure, it should now be apparent that the provided single-chain insulin analogues will achieve the objectives described above. That is, these insulin analogues exhibit enhanced resistance to fibrosis while retaining the desired pharmacokinetic and pharmacodynamic characteristics (conferring biphasic action) and maintaining at least a portion of the biological activity of wild-type insulin. Therefore, it should be understood that any variations clearly falling within the scope of the claimed invention, and thus the selection of specific component elements, can be identified without departing from the spirit of the invention disclosed and described herein.

[0125] The following references are cited to demonstrate that the test and measurement methods described herein will be understood by those skilled in the art.

[0126] Brange J editor. (1987) Galenics of Insulin: The Physico-chemical and Pharmaceutical Aspects of Insulin and Insulin Preparations. Berlin: SpringerBerlin Heidelberg.

[0127] Hohsaka, T. and Sisido, M. (2012) Incorporation of non-natural amino acids into proteins. Curr. Opin. Chem. Biol. 6, 809-15.

[0128] Hua, Q. X., Nakagawa, S. H., Jia, W., Huang, K., Phillips, N. B., Hu, S., and Weiss, M. A. (2008). Design of an active ultrastable single-chain insulin analog: synthesis, structure, and therapeutic implications. J. Biol. Chem. 283, 14703 - 14716.

[0129] Ilag, L. L., Kerr, L., Malone, J. K., and Tan, M. H. (2007). Prandial premixed insulin analogue regimens versus basal insulin analogue regimens in the management of type 2 diabetes: an evidence-based comparison. Clin. Ther. 29, 1254 - 70.

[0130] Jang, H. C., Guler, S., and Shestakova, M. (2008). When glycaemic targets can no longer be achieved with basal insulin in type 2 diabetes, can simple intensification with a modern premixed insulin help? Results from a subanalysis of the PRESENT study. Int. J. Clin. Pract. 62, 1013 - 8.

[0131] Kalra, S., Balhara, Y., Sahay, B., Ganapathy, B., and Das, A. (2013). Why is premixed insulin the preferred insulin? Novel answers to a decade-old question. J. Assoc. Physicians India 61, 9 - 11.

[0132] Lee,H.C.,Kim,S.J.,Kim,K.S.,Shin,H.C.and Yoon,J.W.(2000)Remission inmodels of type 1 diabetes by gene therapy using a single-chain insulinanalogue.Nature 408,483-8.Retraction in:Lee HC,Kim KS,Shin HC.2009.Nature458,600.

[0133] Mosenzon,O.and Raz,I.(2013)Intensification of insulin therapy fortype 2 diabetic patients in primary care:basal-bolus regimen versus premixinsulin analogs:when and for whom?Diabetes Care 36 Suppl 2,S212-8.

[0134] Phillips,N.B.,Whittaker,J.,Ismail-Beigi,F.and Weiss,M.A.(2012)Insulinfibrillation and protein design:topological resistance of single-chainanalogues to thermal degradation with application to a pumpreservoir.J.Diabetes Sci.Technol.6,277-288.

[0135] Qayyum,R.,Bolen,S.,Maruthur,N.,Feldman,L.,Wilson,L.M.,Marinopoulos,S.S.et al.(2008)Systematic review:comparative effectiveness and safety ofpremixed insulin analogues in type 2 diabetes.Ann.Intern.Med.149,549-59.

[0136] Rolla,A.R.and Rakel,R.E.(2005)Practical approaches to insulin therapyfor type 2 diabetes mellitus with premixed insulin analogues.Clin.Ther.27,1113-25.

[0137] Wang,Z.X.(1995)An exact mathematical expression for describingcompetitive biding of two different ligands to a protein molecule FEBSLett.360:111-114.

[0138] Whittaker,J.and Whittaker,L.(2005)Characterization of the functionalinsulin binding epitopes of the full-length insulin receptor.J.Biol.Chem.280:20932-20936.

Claims

1. A single-chain insulin comprising an amino acid sequence selected from SEQ ID NOS: 8 and 10.

2. A pharmaceutical composition comprising the single-chain insulin of claim 1, formulated at a pH in the range of 7.0-8.

0.

3. The pharmaceutical composition of claim 2, further comprising a pH buffer solution.

4. The pharmaceutical composition of claim 2 or 3, wherein the single-chain insulin is formulated at a concentration of 0.6 mM to 5.0 mM.

5. The pharmaceutical composition of claim 2 or 3, wherein the single-chain insulin is formulated at a strength of U-100, U-200, U-300, U-400 or U-500.

6. The pharmaceutical composition of claim 2 or 3, wherein the single-chain insulin is formulated at a strength of U-500 to U-1000.

7. The pharmaceutical composition of claim 2 or 3 further comprises 2-4 zinc ion / insulin hexamers.

8. The pharmaceutical composition of claim 2 or 3, further comprising fewer than 2 zinc ion / insulin hexamers.

9. Use of the pharmaceutical composition of any one of claims 2-8 in the preparation of a medicament for treating diabetes in patients in need by subcutaneous administration.

10. The use of claim 9, wherein the pharmaceutical composition is administered twice daily.

Citation Information

Patent Citations

  • Halogen-stabilized insulin

    US20110166064A1

  • Isoform-specific insulin analogues

    CN102065885A

  • Insulin formulations for rapid uptake

    CN102341119A

  • Single-chain insulin

    CN1902226A

  • Insulin precursors for diabetes treatment

    WO2009133099A2