Novel Tilapia Virus and Its Uses

Abstract

This invention relates to isolated Lohu virus or TiLV, and its isolated nucleic acid sequences and peptides. The invention also relates to probes and primers, and antibodies against antigens derived from TiLV, and the use of these reagents for detecting the presence or absence of TiLV in animals. The invention further relates to iRNAs targeting the nucleic acid sequences of TiLV. The invention also relates to immunogenic compositions, including antibodies and vaccines, for inducing an immune response against TiLV in animals. The invention further relates to gene constructs and cells for developing preventative and therapeutic agents, said gene constructs and cells comprising TiLV and its isolated nucleic acid sequences and peptides.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Application Serial No. 62 / 091,824, filed on December 15, 2014, the entire contents of which are hereby incorporated by reference. Invention Field

[0003] This invention belongs to the field of virology and relates to a novel virus discovered in tilapia, named Tilapia Lake Virus (TiLV). The invention includes isolated TiLV, as well as its isolated nucleic acid sequence and polypeptide. The invention also relates to primers and probes. The invention further relates to antibodies against antigens derived from TiLV. This invention relates to a method for detecting the presence or absence of TiLV in animals using primers, probes, and antibodies. The invention also relates to iRNA targeting the nucleic acid sequence of TiLV. The invention further relates to immunogenic compositions for inducing an immune response against TiLV in animals. Background of the Invention

[0005] Tilapia is the second most important group of farmed fish worldwide, with an annual production of 2.5 million tons (Food and Agriculture Organization of the United Nations, 2010), and it serves as a major protein source for developing countries. The Sea of ​​Galilee (Lake Kinneret) in Israel is a major source for commercial fishing. However, catches have been declining in recent years.

[0006] Although the lake is home to about 27 species of fish, encompassing members of the families Cichlidae, Cyprinidae, Mugillidae, and Claridae, only tilapia (Cichlidae) have seen a significant decrease in catches. The annual catch of the lake's main edible fish, the Galilean broomtooth tilapia (Tilapia galilaeus) (St. Peter's fish), declined from 316 tons in 2005 to 51 tons in 2007, 8 tons in 2009, and 45 tons in 2010.

[0007] Galilean broomtooth tilapia helps maintain the ecological balance of the lake. Therefore, in addition to its economic impact, the significant decline in St. Peter's fish population and tilapia populations in other lakes (such as Tilapia zilli [common tilapia], Oreochromis aureus [Jordanian tilapia], and Tristamella simonisintermedia) represents a clear threat to the entire ecosystem.

[0008] This decline in lake tilapia in the Sea of ​​Galilee is caused by a new and severe disease outbreak in wild populations of tilapia species (including Galilean broomtooth tilapia, gill tilapia, Oreochromis aureus, and Middle Three-rowed tilapia) and in pond-cultured hybrid tilapia Nile tilapia-Oeochromis aureus (O. niloticus x O. aureus) in Israel. The association of the disease outbreak with the season (May to October, when water temperatures are relatively high) further suggests the involvement of infectious agents, as water temperature influences the emergence of a wide range of parasitic, bacterial, and viral diseases in fish. Routine monitoring for known parasites, bacteria, viral pathogens, or toxins has not revealed any abnormalities, and no pathogen has been identified.

[0009] A similar outbreak of disease in tilapia has also been found in Ecuador.

[0010] Therefore, there is a need to identify this declining pathogen in tilapia populations in two different geographical locations, and a need for tools and methods to detect the presence of the pathogen within fish populations and protect fish populations from this declining pathogen. This invention addresses these needs. Summary of the Invention

[0011] In some respects, this invention relates to the discovery of a novel Tilapia virus (TiLV) RNA virus as the causative agent of tilapia diseases. The widespread distribution of the virus and the existence of different clinical characteristics of its associated diseases make the results described herein of great significance for fish farming and wildlife conservation.

[0012] In some respects, the present invention relates to diagnostic tools that can be used to screen for TiLV in samples.

[0013] In some aspects, the present invention relates to vaccines for protecting fish from viral diseases. In some aspects, the present invention relates to vaccine compositions for preventing TiLV-induced diseases in fish, particularly tilapia. In some aspects, the present invention relates to methods for using vaccines to protect tilapia from TiLV-induced diseases.

[0014] Specifically, this invention relates to isolated TiLV nucleic acid sequences (including cDNA sequences corresponding to sense or antisense TiLV RNA sequences) and their peptides. The invention also relates to antibodies against antigens derived from TiLV. Furthermore, the invention relates to iRNAs targeting TiLV nucleic acid sequences. The invention relates to methods for detecting the presence or absence of TiLV in animals (e.g., fish). The invention also relates to immunogenic compositions for inducing an immune response against TiLV in animals (e.g., fish).

[0015] In some aspects, the present invention relates to an isolated nucleic acid sequence having a sequence of any one of SEQ ID NO:1-11, a sequence complementary to any one of SEQ ID NO:1-11, and fragments and variants thereof. In some embodiments, the nucleic acid is a DNA sequence, including cDNA. In some embodiments, the nucleic acid is an RNA sequence.

[0016] In some aspects, the present invention relates to a synthetic nucleic acid comprising isolated (or non-isolated) nucleic acids having sequences of SEQ ID NO:1-10, sequences complementary to any one of SEQ ID NO:1-11, and variants thereof. These synthetic nucleic acids include primers and probes.

[0017] In some respects, the present invention relates to primer sets for determining the presence or absence of TiLV in biological samples, wherein the primer set comprises at least one synthetic nucleic acid sequence selected from the group consisting of synthetic nucleic acids described herein.

[0018] In some aspects, the present invention relates to a method for determining the presence or absence of TiLV in a biological sample, the method comprising: a) contacting a nucleic acid from the biological sample with at least one primer, said primer being a synthetic nucleic acid as described herein; b) subjecting the nucleic acid and primer to amplification conditions; and c) determining the presence or absence of an amplification product, wherein the presence of the amplification product indicates the presence of TiLV-associated RNA in the sample.

[0019] In some respects, the present invention relates to oligonucleotide probes for determining the presence or absence of TiLV in biological samples.

[0020] In some respects, the present invention relates to iRNA molecules that target nucleic acids derived from TiLV (e.g., but not limited to any one of SEQ ID NO:1-11 and variants thereof) and silence the target gene.

[0021] In some aspects, the present invention relates to a method for reducing the level of TiLV protein, viral mRNA, or viral titer in animal cells, said method comprising administering the iRNA described herein to the animal.

[0022] In some aspects, the present invention relates to an isolated polypeptide encoded by any one of the nucleic acids in SEQ ID NO:1-11, nucleic acids having a sequence complementary to any one of SEQ ID NO:1-11, and fragments and variants thereof.

[0023] In some respects, the present invention relates to isolated polypeptides of SEQ ID NO:12, as well as fragments and variants thereof.

[0024] In another aspect, the present invention provides a computer-readable medium having stored thereon: (i) a nucleic acid sequence selected from the group consisting of: any one of SEQ ID NO:1-11, a sequence substantially identical to any one of SEQ ID NO:1-11, and a sequence variant of any one of SEQ ID NO:1-11; or (ii) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of: any one of SEQ ID NO:1-11, a sequence substantially identical to any one of SEQ ID NO:1-11, and a sequence variant of any one of SEQ ID NO:1-11.

[0025] In some respects, the present invention relates to an isolated antibody that specifically binds to the polypeptide of the invention (e.g., the polypeptide of SEQ ID NO:12, or a polypeptide encoded by any one of SEQ ID NO:1-11, or a complementary sequence thereto, or a fragment or variant thereof).

[0026] In some aspects, the present invention relates to a method for determining whether a sample contains TiLV, the method comprising: a) contacting a biological sample with an antibody that specifically binds to any one of the isolated (or non-isolated) polypeptides or fragments or variants thereof of SEQ ID NO:12, or a polypeptide encoded by any one of SEQ ID NO:1-11, or a complementary sequence thereof, or fragments or variants thereof; and b) determining whether the antibody binds to an antigen in the biological sample, wherein binding indicates that the biological sample contains TiLV. In some embodiments, the determination includes the use of lateral flow assay or ELISA.

[0027] In some aspects, the present invention relates to a method for determining whether a biological sample is infected with TiLV, the method comprising: a) determining whether the biological sample contains an antibody that specifically binds to any one of the isolated (or non-isolated) polypeptides of SEQ ID NO:12 or fragments or variants thereof, or a polypeptide encoded by any one of SEQ ID NO:1-11, or a complementary sequence thereof, or fragments or variants thereof.

[0028] In some aspects, the present invention provides immunogenic compositions capable of inducing an immune response against TiLV (including the TiLV of the present invention), comprising a nucleic acid of any one of SEQ ID NO:1-11 or a fragment or variant thereof, or comprising a cDNA sequence complementary to the sense or antisense strand of any one of SEQ ID NO:1-11 or a fragment or variant thereof, or comprising a polypeptide encoded by a cDNA sequence of any one of SEQ ID NO:1-11 or a sense or antisense strand complementary to any one of SEQ ID NO:1-11, or comprising a polypeptide comprising SEQ ID NO:12 or a fragment or variant thereof, or comprising killing or attenuated TiLV.

[0029] In some aspects, the present invention relates to a method for inducing an immune response in animals, the method comprising administering the immunogenic composition described herein.

[0030] In another aspect, the present invention provides a method for preventing or reducing TiLV infection in animals, the method comprising administering the TiLV immunogenic composition described herein.

[0031] In another aspect, the present invention provides a method for preventing or reducing TiLV infection in animals, the method comprising administering the TiLV antibody described herein.

[0032] In one implementation method, the administration method is oral, submersion, or injection.

[0033] In another aspect, the present invention provides the use of any of the immunogenic compositions described herein in the manufacture of a vaccine for the treatment or prevention of TiLV infection in animals.

[0034] In some aspects, the present invention relates to an isolated virus comprising at least 24 consecutive nucleotides derived from: isolated (or non-isolated) nucleic acids having a sequence of any one of SEQ ID NO: 1-11; isolated (or non-isolated) nucleic acids complementary to a sequence of any one of SEQ ID NO: 1-11; isolated (or non-isolated) nucleic acids having at least about 60% sequence identity with any one of SEQ ID NO: 1-11; or isolated (or non-isolated) nucleic acids having at least about 60% sequence identity with a nucleic acid complementary to a sequence of any one of SEQ ID NO: 1-11.

[0035] In some aspects, the present invention relates to an isolated virus comprising at least eight consecutive amino acids derived from polypeptides encoded by: isolated (or non-isolated) nucleic acids having a sequence of any one of SEQ ID NO: 1-11; isolated (or non-isolated) nucleic acids complementary to a sequence of any one of SEQ ID NO: 1-11; isolated (or non-isolated) nucleic acids having at least about 60% sequence identity with any one of SEQ ID NO: 1-11; or isolated (or non-isolated) nucleic acids having at least about 60% sequence identity with a nucleic acid complementary to a sequence of any one of SEQ ID NO: 1-11.

[0036] In some aspects, the present invention relates to an isolated cell comprising isolated (or non-isolated) nucleic acids having a sequence having any one of the sequences described herein in SEQ ID NO: 1-11, a sequence complementary to SEQ ID NO: 1-11, and fragments and variants thereof.

[0037] In some aspects, the present invention relates to a method for culturing cells, comprising: a) infecting cells with TiLV, or isolated (or non-isolated) nucleic acids having a sequence of any one of SEQ ID NO:1-11 described herein, a sequence complementary to SEQ ID NO:1-11, and fragments and variants thereof; and b) culturing the cells.

[0038] In some aspects, the present invention relates to a method for testing a TiLV vaccine, comprising: a) contacting cells with a TiLV vaccine; b) contacting cells with TiLV; and c) measuring the number of TiLV-infected cells.

[0039] In some aspects, the present invention relates to a method for testing a TiLV drug, comprising: a) contacting cells with a TiLV drug; b) contacting cells with TiLV; and c) measuring the number of TiLV-infected cells.

[0040] In some aspects, the present invention relates to a method for testing a TiLV drug, comprising: a) contacting cells with TiLV; b) contacting cells with a TiLV drug; and c) measuring TiLV replication.

[0041] In other aspects, the present invention provides methods for identifying and / or generating antiviral drugs. For example, in one aspect, the present invention provides methods for identifying drugs that bind to and / or inhibit the function of proteins encoded by the TiLV of the present invention or inhibit the replication or pathogenicity of the TiLV of the present invention. Methods for identifying drugs that affect or inhibit specific drug targets, such as high-throughput drug screening, are well known in the art and readily applicable to the proteins and viruses of the present invention.

[0042] This invention also provides methods and tools for drug design and pharmaceutical testing, as well as tools for basic research on the etiology and pathogenesis of TiLV. Brief description of the attached diagram

[0044] For the purpose of illustrating the invention, certain embodiments of the invention are depicted in the accompanying drawings. However, the invention is not limited to the precise arrangement and means of the embodiments depicted in the drawings.

[0045] Figure 1 Showing commercial hybrid tilapia (a hybrid of Nile tilapia and Oreocarp mouthbrooding tilapia) Figure 1A and Figures 1C to 1 E) and wild tilapia from the Sea of ​​Galilee (St. Peter's tilapia (S. galilaeus)) Figure 1B and Figure 1 F to Figure 1 H) Characteristics of tilapia disease and pathological examination results. Figure 1A Photographs showing a disease outbreak in tilapia in a commercial fishpond that caused mass deaths (August 2013). Figure 1B A photograph of a diseased tilapia exhibiting eye shrinkage and loss of eye function (phthisisbulbi). Figure 1C The macroscopic pathology of the skin is shown, including multifocal to coalescing epidermal erosions and ulcers, indicated by arrows. Figure 1D Hematoxylin and eosin staining of the kidney and interstitium is shown. Arrows indicate dilated veins with a large accumulation of red blood cells (congestion). Hematoxylin and eosin (H&E) staining x 10. Figure 1 E shows hematoxylin and eosin staining of the brain and cortex. Arrows indicate the pia mater and dilated blood vessels in the gray and white matter containing a large number of red blood cells. Stained using H&E x 10. Figure 1 F shows hematoxylin and eosin staining of the brain and cortex. Blood vessels in lymphocytes are circled. Staining was performed using H&E at x 40. Figure 1 Gaussian staining of the lens with hematoxylin and eosin. Cataract changes are characterized by the formation of eosinophilic globular structures (morgagnian globules) accompanied by degeneration of the crystalline fibers (circled). Staining was performed using H&E x 10. Figure 1 Gb shows hematoxylin and eosin staining of control lenses from healthy fish. H&E staining was performed at x 10. Figure 1 H shows hematoxylin and eosin staining of the eye and cornea. Loss of integrity of the superimposed squamous epithelium with inflammatory infiltration (arrows) and multiple capillaries within the stroma (neovascularization; circled). Collagen fibers within the superficial stroma are contaminated and stained pale eosinophilic (corneal edema). Stained using H&E x 10.

[0046] Figure 2 The cytopathic effect or CPE induction in infected cultures is shown and analyzed by electron microscopy (EM). Figure 2 Image A shows an image of E-11-infected cells with CPE on day 5 post-inoculation. Plaque formation and vacuolated cells are shown at the plaque edges. The centers of two plaques are marked with an asterisk. Figure 2 Image B shows primary tilapia brain cells infected with CPE on day 10 post-inoculation. The transformation from typical elongated cells to swollen, round, and granular cells is indicated by arrows. Figure 2 C and Figure 2 Images D represent the brains of control, mock-infected E-11, or primary tilapia, respectively. Figure 2 E and Figure 2 F is a transmission electron microscopy (EM) image of a thin section of infected E-11 cells, in which electron-dense particles (55 to 60 nm in diameter) aggregate and are encapsulated within a membrane in the cytoplasm. Figure 2 E, marked with an arrow) or encapsulated in the cytoplasm ( Figure 2 F). Figure 2 E and Figure 2 The scales of F are 200 and 500 nm, respectively. Figure 2 G is an EM image of negatively stained viruses precipitated from the supernatant of infected E11 cultures. Scale bar is 100 nm.

[0047] Figure 3 The PCR detection of TiLV is shown. Figure 3A illustrates the detection of TiLV by PCR. Total RNA was extracted from the brains of TiLV-infected fish (lanes 1-7) and healthy fish (lane 10), as well as from E-11 and primary tilapia brain-infected cell cultures (lanes 8 and 9, respectively), and used as templates for cDNA generation. A 250-bp fragment was amplified using primers ME1 (SEQ ID NO:23) and clone 7450 / 150R (SEQ ID NO:16). Figure 3 B shows that PCR amplification of TiLV requires reverse transcription. Total RNA was extracted from the supernatant (lanes 1 and 2), cell extracts from TiLV-infected E-11 cultures (lanes 3 and 4), or from naive E-11 cultures used for the first time in the experiment (lanes 5 and 6). Samples were not treated with DNase and underwent (+) or (-) reverse transcription prior to the PCR step. An RNA-free negative control (lane 7) was also included. A 491-bp fragment was amplified using nested ext-1 (SEQ ID NO:24) and nested ext-2 (SEQ ID NO:25) primers. Figure 3 C shows the results of the nuclease sensitivity assay. Nuclease-protected nucleic acids were extracted from purified virions and treated with (+) or (-) reverse transcriptase and / or RNase I, followed by PCR amplification using TiLV-specific primers (nested ext-1 (SEQ ID NO:24) and nested ext-2 (SEQ ID NO:25), yielding an amplified product of 491 bp), or using SnRV-specific primers (Snakehead gag-pol fw (SEQ ID NO:26) and snakehead gag-pol rev (SEQ ID NO:27), yielding an amplified product of 284 bp). M represents the DNA size standard.

[0048] Figure 4 The kinetics of TiLV-induced mortality are illustrated. Fish were divided into multiple groups of 30 fish each, free of the specific pathogen (SPF). Group 1 (solid rhombuses) and Group 2 (solid triangles) were infected via intraperitoneal (ip) injection or co-hospitalization, respectively. The control group (solid circles) consisted of the same number of fish inoculated with the supernatant of an E-11 culture used for the first time in the experiment. Differences between the three experimental groups were determined by a chi-square test, where a p-value of 0.05 was considered significant. The bars represent standard errors.

[0049] Figure 5 RNA blot analysis of nucleic acids from diseased tilapia from Israel and Ecuador is shown. Figure 5Figure A shows RNA blot analysis of total RNA extracted from the liver of diseased Ecuadorian tilapia and analyzed using a mixture of three probes representing segments 1, 4, 7, and 10 (Combo 1); 3, 6, and 9 (Combo 2); or 2, 5, and 8 (Combo 3) to prevent signal overlap caused by segments of similar size (three right-hand figures). Influenza A virus RNA hybridized with three probes representing HA, NA, and matrix proteins was used as a size reference (left-hand figure). Figure 5 B shows the RNA blot analysis of total RNA extracted from cultured cells infected with TiLV brain-derived from Israeli tilapia or from culture supernatants and analyzed with a mixture of three probes. Lanes 5, 8, and 11 show the results (6 dpi) of extracts from infected cultured cells; lanes 6, 9, and 12 show the results of extracts from infected culture supernatants; lanes 4, 7, and 10 show the results of extracts from uninfected cultured cells.

[0050] Figure 6 The results of a routine diagnostic PCR using primers designed to amplify segment 3 of the TiLV genome are shown. The appendix is ​​an image of agarose gel electrophoresis of the amplification products obtained from nucleic acid extracts of TiLV-infected cell culture supernatant. Lanes 1 and 12 are size standards. Lanes 2–10 are consecutive 2-fold dilutions of the nucleic acid extract. Lane 11 is a negative control from uninfected cell culture supernatant.

[0051] Figure 7 The results of real-time PCR are shown. Figure 7A To use a calibration curve representing the quantitative plasmid standard of the TiLV segment 1 target sequence, the range is 1 x 10^6 m / s per assay. 6 Up to 1x10 1 Within the molecule. Figure 7B To use a calibration curve with a quantitative plasmid standard representing the tilapia β-actin target sequence, the range is 1 x 10^6 m / s per assay. 6 Up to 1x10 1 Within the molecule. Figure 7 C illustrates the detection of true TiLV in various tissue samples from diseased tilapia from Israel using primers designed and specific to the TiLV nucleic acid sequence. Detailed Implementation

[0052] Tilapia are important for ecosystem sustainability and are the second most important farmed fish group worldwide. The invention described herein relates to observations of large-scale mortality in wild and farmed tilapia in Israel and Ecuador.

[0053] This article reports the isolation of a previously undescribed virus, named TiLV, from spontaneously diseased fish and the induction of disease in tilapia by this virus. Incubation of extracts from diseased, rather than healthy, tilapia with cultures of fish cells (E-11 and primary tilapia brain cells) resulted in cytopathic effects, or CPE, in the infected cultures. Furthermore, inoculation of supernatants harvested from these cultures into tilapia used for the first time in experiments induced disease. TiLV was re-isolated from cell cultures from experimentally infected fish, and the virus induced similar disease when inoculated into new fish used for the first time in experiments. Additionally, the experimentally induced disease was achieved using purified TiLV obtained through endpoint dilution. Notably, signs of naturally occurring disease (depigmentation, skin patches, eye changes, and lethargy) were observed in the experimentally induced disease. The TiLV sequence was amplified from diseased fish and TiLV-infected cell cultures, rather than from fish used for the first time in experiments, mock-infected cultures, or cultures infected with another substance (VNN).

[0054] Several pieces of evidence suggest that this infectious agent is a virus. First, the agent is transmitted through… The presence of a filter, while maintaining its infectivity, rules out the possibility of infection by microorganisms (such as bacteria and fungi) larger than the filter size. Secondly, the presence of CPE after continuous passage of the substance in cell cultures rules out the possibility of filterable toxin-induced CPE. Thirdly, virion-like structures were observed by EM in infected cells and the supernatant of these cell cultures. Fourthly, relatively dense fractions for the sucrose gradient indicated CPE activity, similar to known assembled virions. Fifthly, the capsidated TiLV genome is composed of RNA, as evidenced by the fact that it was amplified solely by RT-PCR (not PCR) from samples of infected fish and cell cultures inoculated with extracts from such fish, and that this amplification was sensitive to initial digestion with RNase I. RNA genomes are known to exist only in viruses. EM analysis and TiLV's sensitivity to organic solvents (ether or chloroform) further indicate that TiLV is an enveloped virus.

[0055] TiLV-induced disease in tilapia is transmitted via intraperitoneal (ip) injection or co-culture. The co-culture transmission model demonstrates the waterborne transmission capability of TiLV. It should be noted that relatively high mortality rates were observed in both the ip and waterborne routes in these experiments.

[0056] The presence of fish surviving TiLV-induced disease strongly indicates the potential for an effective immune response against this pathogen. This has important applications for future disease control strategies. In addition to the possibility of vaccine development, determining the susceptibility of different tilapia species to TiLV should be considered a measure of disease control. This view is based on well-documented differences in disease resistance among species within the same genus.

[0057] This work also provides molecular characterization of TiLV isolated from diseased fish in Israel and Ecuador. Ten segments of the TiLV genome were identified from the virus in fish from both locations, yielding SEQ ID NO:1-11. (SEQ ID NO:1 is a shorter form of SEQ ID NO:9 – both are segment 3 of the TiLV genome). A homology search in the NCBI database yielded a single hit of segment 1 of the genome (SEQ ID NO:7), indicating very distant homology with orthomyxovirus RNA-dependent RNA polymerase. This further demonstrates that TiLV is a novel tilapia pathogen. Given the widespread commercial production of tilapia and its status as a major protein source in developing countries, diagnosing this novel pathogen is of great importance. The amplification of TiLV sequences from diseased fish and cultures infected with TiLV, as described in this work, provides a basis for PCR-based diagnostics, allowing for rapid screening, surveillance, epidemiological studies, and disease containment. Furthermore, the TiLV sequences can be used in vaccines, i.e., immunizing compositions, to induce an immune response against TiLV in tilapia populations.

[0058] The TiLV identified in this paper is a novel RNA virus. Therefore, there is no naturally occurring cDNA nucleic acid sequence. In other words, the nucleic acid sequences of SEQ ID NO:1-11 are non-naturally occurring compositions with structures significantly different from naturally occurring TiLV RNA sequences. Furthermore, any embodiments of the present invention comprising the nucleic acids of SEQ ID NO:1-11, such as primers, probes, antibodies, immunogenic compositions, cells, and cell lines, will also not be naturally occurring.

[0059] In some aspects, this invention relates to the discovery that the pathogen of this disease is a novel RNA virus. In some aspects, the invention also relates to methods for isolating and detecting this virus. As further described herein, the virus, named TiLV (TiLV), can multiply in primary tilapia brain cells or in the E-11 cell line. In some aspects, this invention relates to the discovery that the virus can induce cytopathic effects 5 to 10 days after infection. In some aspects, this invention relates to the electron microscopic discovery showing the presence of enveloped icosahedral particles of 55 to 75 nm. In some aspects, this invention relates to the discovery that intraperitoneal injection of low-passaged TiLV in tilapia induces a disease similar to the natural disease, typically presenting as lethargy, eye changes, and skin erosion, with a mortality rate greater than 80%.

[0060] In some aspects, the invention relates to the following findings: histological changes include congestion of internal organs (kidneys and brain), lesions of glial proliferation in the cerebral cortex, and the occurrence of vascular cuffs of lymphocytes; ocular inflammation includes endophthalmitis and cataractal changes in the lens. In some aspects, the invention relates to the following findings: co-breeding of healthy and diseased fish indicates that the disease is contagious and mortality occurs within days (80% to 100%). In some aspects, the invention relates to the following findings: fish surviving the initial mortality are immune to further TiLV infection, indicating the development of a protective immune response.

[0061] In some aspects, the present invention relates to the discovery that screening cDNA libraries identifies TiLV-specific sequences, thereby allowing the design of PCR-based diagnostic tests. In other aspects, the present invention relates to tests capable of specifically identifying TiLV in tilapia. Such tests contribute to controlling the worldwide spread of this virus.

[0062] definition

[0063] In the context of this invention and the specific context in which each term is used, the terms used herein generally have their common meaning in the art. Certain terms are discussed below or elsewhere in the specification to provide additional guidance to practitioners in describing the methods of the invention and how to use them. Furthermore, it should be understood that the same thing can be described in more than one way. Therefore, alternative language and synonyms may be used for any one or more terms discussed herein, regardless of whether the term is elaborated or discussed herein and is not given any particular meaning. Synonyms for certain terms are provided. The description of one or more synonyms does not preclude the use of other synonyms. Examples used wherever in this specification, including examples of any term discussed herein, are merely illustrative and in no way limit the scope and meaning of the invention or any of the exemplified terms. Likewise, the invention is not limited to its preferred embodiments.

[0064] According to the present invention, there may be a number of tools and techniques within the skill level of the art, such as those commonly used in molecular immunology, cellular immunology, pharmacology and microbiology. See, for example, Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY; Ausubel et al. (2005) Current Protocols in Molecular Biology, John Wiley and Sons, Inc.: Hoboken, NJ; Bonifacino et al. (2005) Current Protocols in Cell Biology, John Wiley and Sons, Inc.: Hoboken, NJ; Coligan et al. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Hoboken, NJ; Coico et al. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc.: Hoboken, NJ; Coligan et al. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc.: Hoboken, NJ; and Enna et al. (eds.). (2005) Current Protocols in Pharmacology, John Wiley and Sons, Inc.: Hoboken, NJ.

[0065] Unless the context clearly indicates otherwise, the singular forms “a,” “an,” and “the” include multiple referents.

[0066] The term "about" is used herein to mean approximately, approximately, roughly, or around. When the term "about" is used with a numerical range, it modifies the range by extending the boundaries above and below the stated value. Generally, the term "about" is used herein to modify values ​​that vary by about 20% around the stated value.

[0067] As used in this article, "TiLV" refers to the isolate of the Luohu virus described in this article.

[0068] As used herein, “TiLV gene” means any of the genes or gene segments identified in the TiLV genome as described in SEQ ID No:1-11.

[0069] As used in this article, the term "animal" refers to vertebrates, including but not limited to fish (e.g., tilapia).

[0070] In the context of two nucleic acids or peptides, "substantially identical" means two or more sequences or subsequences that have at least 98%, at least 99%, or higher nucleotide or amino acid residue identity when compared and aligned for maximum correspondence, such as using one of the following sequence comparison algorithms or as determined by visual inspection.

[0071] In the context of two or more nucleic acid or polypeptide sequences, "percentage identity" refers to the percentage of identical nucleotides or amino acids contained in two or more sequences or subsequences. A specific percentage of nucleotides can refer to, for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or greater identity in a specific region when comparing and aligning against the maximum correspondence within a comparison window or designated region, as determined by one of the following sequence comparison algorithms or by manual alignment and visual inspection.

[0072] As used herein, a “comparison window” includes references to any number of adjacent positions, the number being selected from 20 to 600, typically from about 50 to about 200, and more typically from about 100 to about 150, wherein, after optimal alignment of two sequences, one sequence can be compared with a reference sequence of the same number of adjacent positions. Sequence alignment methods used for comparison are well known in the art. For comparison, optimal sequence alignment can be performed, for example, by the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482, by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443, by the similarity retrieval method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (FASTDB (Intelligenetics), BLAST (National Center for Biomedical Information), GAP, BESTFIT, FASTA, and TFASTA (in the Wisconsin Genetics software package (Genetics Computer Group, 575 Science Dr., Madison, Wis.)) or by manual alignment and visual inspection (see, for example, Ausubel).

[0073] In the context of nucleic acids, base symbols can be used to indicate positions on a nucleic acid sequence that can have multiple possible alternative forms. For example, "W" represents A or T; "S" represents C or G; "M" represents A or C; "K" represents G or T; "R" represents A or G; "Y" represents C or T; "B" represents C, G, or T; "D" represents A, G, or T; "H" represents A, C, or T; and "V" represents A, C, or G.

[0074] It should be understood that for the specific TiLV polypeptides described herein, natural variations may exist between different TiLV strains. These variations may manifest as differences in one or more amino acids in the overall sequence, or as deletions, substitutions, insertions, inversions, or additions of one or more amino acids in the sequence. Amino acid substitutions that do not substantially alter biological and immunological activity have been described, for example, by Neurath et al. in "The Proteins," Academic Press New York (1979). Amino acid substitutions between relevant amino 15 acids, or substitutions that occur frequently during evolution, particularly Ser / Ala, Ser / Gly, Asp / Gly, Asp / Asn, and Ile / Val (see Dayhof, MD, Atlas of protein sequence and structure, Nat. Biomed. Res. Found., Washington DC, 1978, Vol. 5, Supplement 3). Other amino acid substitutions include Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Thr / Phe, Ala / Pro, Lys / Arg, Leu / Ile, Leu / Val, and Ala / Glu. Based on this information, Lipman and Pearson developed a method for rapid and sensitive protein comparison (Science (1985) 227:1435) and for determining functional similarity between homologous proteins. Such amino acid substitutions in exemplary embodiments of the present invention, as well as variants with deletions and / or insertions, are within the scope of the present invention, provided that the resulting protein retains its immunoreactivity. It is known that polypeptide sequences with one or more amino acid sequence changes compared to a reference polypeptide can still be used to generate antibodies that bind to the reference polypeptide.

[0075] Nucleic acids and their uses

[0076] This invention provides TiLV nucleic acid sequences. These nucleic acid sequences can be used, in particular, for the expression of TiLV-encoded proteins or fragments, variants or derivatives thereof, for the generation of antibodies against TiLV proteins, for the generation of primers and probes for the detection of TiLV and / or for the diagnosis of TiLV infection, for the generation of immunogenic compositions against TiLV, and for the screening of effective drugs against TiLV as described herein.

[0077] In some respects, the TiLV nucleic acid sequence is provided in SEQ ID NO:1-11, which corresponds to the TiLV genomic segment (see Table 2).

[0078] In some respects, the present invention relates to a TiLV-isolated nucleic acid sequence, as provided in any one of SEQ ID NO:1-11.

[0079] In some respects, the present invention relates to an isolated nucleic acid that is complementary to any one of SEQ ID NO:1-11.

[0080] In some respects, the present invention relates to variants of TiLV nucleic acid sequences that have a greater than 60% similarity to any of the sequences in SEQ ID NO:1-11.

[0081] In some aspects, the present invention relates to isolated nucleic acid sequence variants of any one of SEQ ID NO:1-11 and fragments thereof. Variants of any one of SEQ ID NO:1-11 include, but are not limited to, nucleic acid sequences having at least about 50% to about 55% identity with the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any one of SEQ ID NO:1-11 include, but are not limited to, nucleic acid sequences having at least about 55.1% to about 60% identity with the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any one of SEQ ID NO:1-11 include, but are not limited to, nucleic acid sequences having at least about 60.1% to about 65% identity with the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any one of SEQ ID NO:1-11 include, but are not limited to, nucleic acid sequences having at least about 65.1% to about 70% identity with the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any one of SEQ ID NO:1-11 include, but are not limited to, nucleic acid sequences having at least about 70.1% to about 75% identity with the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any one of SEQ ID NO:1-11 include, but are not limited to, nucleic acid sequences having at least about 75.1% to about 80% identity with the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any one of SEQ ID NO:1-11 include, but are not limited to, nucleic acid sequences having at least about 80.1% to about 85% identity with the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any one of SEQ ID NO:1-11 include, but are not limited to, nucleic acid sequences having at least about 85.1% to about 90% identity with the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any one of SEQ ID NO:1-11 include, but are not limited to, nucleic acid sequences having at least about 90.1% to about 95% identity with the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any one of SEQ ID NO:1-11 include, but are not limited to, nucleic acid sequences having approximately 95.1%, approximately 95.5%, approximately 96%, approximately 96.5%, approximately 97%, approximately 97.5%, approximately 98%, approximately 98.5%, approximately 99%, approximately 99.5%, or approximately 99.9% identity with the nucleic acid sequence of any one of SEQ ID NO:1-11. Procedures and algorithms for sequence alignment and comparison of % identity and / or homology between nucleic acid sequences are well known in the art and include BLAST, SIM alignment tools, etc.

[0082] In another embodiment, the present invention provides an isolated nucleic acid having a sequence substantially identical to that of any one of SEQ ID NO:1-11 or a fragment thereof. In yet another embodiment, the present invention provides an isolated nucleic acid having a sequence substantially identical to that of a nucleic acid complementary to any one of SEQ ID NO:1-11 or a fragment thereof.

[0083] In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 50 consecutive nucleotides of any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 100 consecutive nucleotides of any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 200 consecutive nucleotides of any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 300 consecutive nucleotides of any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 400 consecutive nucleotides of any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 500 consecutive nucleotides of any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 600 consecutive nucleotides of any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 700 consecutive nucleotides of any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 800 consecutive nucleotides of any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In another embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 900 or more consecutive nucleotides of any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof.In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 1000 or more consecutive nucleotides from any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 1200 or more consecutive nucleotides from any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 1400 or more consecutive nucleotides from any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof. In one embodiment, the present invention relates to an isolated nucleic acid sequence comprising about 10 to about 1640 or more consecutive nucleotides from any one of SEQ ID NO:1-11 or a sequence complementary to any one of SEQ ID NO:1-11 or a variant thereof.

[0084] This invention covers polynucleotide sequences capable of hybridizing with claimed polynucleotide sequences (including any of the nucleic acid sequences disclosed herein) and fragments thereof under various stringent conditions. Polynucleotides homologous to sequences shown in SEQ ID NO:1-11 can be identified, for example, by hybridizing with each other under stringent or highly stringent conditions. The term “nucleic acid hybridization” refers to an antiparallel hydrogen bond between two single-stranded nucleic acids, where A pairs with T (or U, if it is an RNA nucleic acid) and C pairs with G. Nucleic acid molecules are “hybridizable” to each other when at least one strand of one nucleic acid molecule can form hydrogen bonds with complementary bases of another nucleic acid molecule under defined stringent conditions. The stringency of hybridization reflects the degree of sequence identity of the nucleic acids involved, such that the higher the stringency, the more similar the two polynucleotide chains are. The stringency of hybridization is determined by, for example, (i) the temperature at which hybridization and / or washing is performed, and (ii) the ionic strength, and (iii) the concentration of denaturing agents such as formamide and washing solutions used in hybridization, as well as other parameters. Hybridization requires that the two strands contain substantially complementary sequences. However, a certain degree of mismatch is tolerable depending on the stringency of hybridization. Under “low stringency” conditions, a larger percentage of mismatches can be tolerated (i.e., the formation of antiparallel hybrids will not be prevented). Hybridization conditions for various stringencies are known in the art and disclosed in detail in at least Sambrook et al.

[0085] In some aspects, the present invention relates to a synthetic nucleic acid comprising nucleotides of the following: isolated (non-isolated) nucleic acid having a sequence of any one of SEQ ID NO: 1-11; isolated (non-isolated) nucleic acid complementary to a sequence of any one of SEQ ID NO: 1-11; isolated (non-isolated) nucleic acid having at least about 60% sequence identity to any one of SEQ ID NO: 1-11; isolated (non-isolated) nucleic acid having at least about 60% sequence identity to a nucleic acid complementary to a sequence of any one of SEQ ID NO: 1-11; isolated (non-isolated) nucleic acid comprising at least 10 consecutive nucleotides of any one of SEQ ID NO: 1-11; isolated (non-isolated) nucleic acid comprising at least 10 consecutive nucleotides of a nucleic acid complementary to a sequence of any one of SEQ ID NO: 1-11; isolated (non-isolated) nucleic acid comprising at least 10 consecutive nucleotides of a sequence having at least about 60% identity to a sequence of any one of SEQ ID NO: 1-11; or comprising ... The isolated (non-isolated) nucleic acid of at least 10 consecutive nucleotides of a sequence complementary to any one of NO:1-11, having at least about 60% identity.

[0086] In another aspect, the present invention provides a synthetic nucleic acid having a sequence of about 10 to about 30 consecutive nucleotides, said consecutive nucleotides being derived from a nucleic acid sequence selected from the sequence group consisting of SEQ ID NO:1-11.

[0087] In another aspect, the present invention provides a synthetic nucleic acid having a sequence consisting of about 10 to about 30 consecutive nucleotides, said consecutive nucleotides being composed of consecutive nucleotides having a sequence that is a variant of any one of SEQ ID NO:1-11 and has at least about 95.1%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5%, or about 99.9% identity with any one of SEQ ID NO:1-11.

[0088] In another aspect, the present invention provides a composition comprising one or more nucleic acids having a sequence of about 10 to about 30 consecutive nucleotides, said consecutive nucleotides being derived from a nucleic acid sequence selected from the sequence group consisting of SEQ ID NO:1-11.

[0089] In another aspect, the present invention provides a composition comprising one or more nucleic acids having a sequence consisting of about 10 to about 30 consecutive nucleotides, said consecutive nucleotides being composed of consecutive nucleotides having a sequence that is a variant of any one of SEQ ID NO:1-11 and has at least about 95.1%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5%, or about 99.9% identity with any one of SEQ ID NO:1-11.

[0090] In another aspect, the present invention provides a synthetic nucleic acid having a sequence of about 10 to about 30 consecutive nucleotides, said consecutive nucleotides being derived from a nucleic acid sequence complementary to a nucleic acid sequence selected from the sequence group consisting of SEQ ID NO:1-11.

[0091] In another aspect, the present invention provides a synthetic nucleic acid having a sequence of about 10 to about 30 consecutive nucleotides, complementary to a nucleic acid having a sequence of consecutive nucleotides having a variant of any one of SEQ ID NO:1-11 having at least about 95.1%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5%, or about 99.9% identity with any one of SEQ ID NO:1-11.

[0092] In another aspect, the present invention provides a composition comprising one or more nucleic acids having a sequence of about 10 to about 30 consecutive nucleotides, said consecutive nucleotides being derived from a nucleic acid sequence complementary to a nucleic acid sequence selected from the sequence group consisting of SEQ ID NO:1-11.

[0093] In another aspect, the present invention provides a composition comprising one or more nucleic acids having a sequence of about 10 to about 30 consecutive nucleotides complementary to a nucleic acid having a sequence of consecutive nucleotides having a variant of any one of SEQ ID NO:1-11 having at least about 95.1%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5%, or about 99.9% identity with any one of SEQ ID NO:1-11.

[0094] In other respects, the present invention relates to isolated nucleic acid sequences, such as primers and probes, comprising nucleic acid sequences of any one of SEQ ID NO:1-11. Such primers and / or probes can be used, for example, to detect the presence of TiLV of the present invention in samples from bodily fluids of animals, such as blood, saliva, or urine, and thus can be used for the diagnosis of TiLV infection. Such probes can detect polynucleotides of any one of SEQ ID NO:1-11 in samples containing TiLV represented by any one of SEQ ID NO:1-11. The isolated nucleic acids that can be used as primers and probes have sufficient length to allow hybridization with the corresponding target nucleic acid sequence, i.e., the nucleic acid sequence of any one of SEQ ID NO:1-11 or fragments or variants thereof, i.e., to form a double strand therewith.

[0095] The isolated nucleic acids of the present invention, which can be used as primers and / or probes, may comprise about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, and 100 consecutive nucleotides. The present invention also relates to primers and / or probes that can be labeled by any suitable molecules and / or labels known in the art, such as, but not limited to, fluorescent tags suitable for real-time PCR amplification, such as TaqMan, Cybergreen, TAMRA, and / or FAM probes; radioactive labels, etc. In some embodiments, oligonucleotide primers and / or probes further comprise detectable non-isotopic labels selected from the group consisting of: fluorescent molecules, chemiluminescent molecules, enzymes, cofactors, enzyme substrates, and haptens.

[0096] In another aspect, the present invention provides an oligonucleotide probe comprising about 10 to about 50 nucleotides, wherein at least about 10 consecutive nucleotides are at least 95% complementary to a nucleic acid target region within a TiLV nucleic acid sequence of any one of SEQ ID NO:1-11, wherein the oligonucleotide probe hybridizes with the nucleic acid target region under moderate to highly stringent conditions to form a detectable nucleic acid target: oligonucleotide probe duplex. In one embodiment, the oligonucleotide probe is at least about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5%, or about 99.9% complementary to SEQ ID NO:1-11. In another embodiment, the oligonucleotide probe consists substantially of about 10 to about 50 nucleotides.

[0097] In some aspects, the present invention relates to primer sets comprising isolated nucleic acids as described herein, said primer sets being adapted to amplify nucleic acids from samples containing TiLV represented by any one of SEQ ID NO:1-11 or variants thereof. The primer set may include any suitable combination of primers that will allow amplification of the target nucleic acid sequence in samples containing TiLV represented by any one of SEQ ID NO:1-11 or variants thereof. Amplification can be performed by any suitable method known in the art, such as, but not limited to, PCR, RT-PCR, and transcription-mediated amplification (TMA).

[0098] In some respects, the present invention relates to a primer set for determining the presence or absence of TiLV in a biological sample, wherein the primer set comprises at least one synthetic nucleic acid sequence selected from the group consisting of synthetic nucleic acids described herein.

[0099] In some aspects, the present invention provides a primer set for determining the presence or absence of TiLV in a biological sample, wherein the primer set comprises at least one synthetic nucleic acid sequence selected from the group consisting of: a synthetic nucleic acid having a sequence of about 10 to about 30 consecutive nucleotides, said consecutive nucleotides being derived from a nucleic acid sequence selected from the group consisting of sequences such as SEQ ID NO: 1-11 or variants thereof as described herein; or a synthetic nucleic acid having a sequence of about 10 to about 30 consecutive nucleotides, said consecutive nucleotides being derived from a nucleic acid sequence complementary to a nucleic acid sequence selected from the group consisting of sequences such as SEQ ID NO: 1-11 or variants thereof as described herein.

[0100] Primer sets can be designed by those skilled in the art using the sequences of SEQ ID NO:1-11. Examples of primer pairs that can be used in detection methods using PCR are as follows:

[0101] ME1 (SEQ ID NO:23) and clone 7450 / 150R (SEQ ID NO:16);

[0102] Nested ext-1 (SEQ ID NO:24) and nested ext-2 (SEQ ID NO:25);

[0103] NM-CLU7-SF1 (SEQ ID NO:28) and NM-CLU7-SRI (SEQ ID NO:29);

[0104] TiLV-CLU5-cF1 (SEQ ID NO:30) and TiLV-CLU5-cR1 (SEQ ID NO:31); and

[0105] CLU5-mRNA-qF1 (SEQ ID NO:34) and CLU5-mRNA-qR1 (SEQ ID NO:35),

[0106] And the optional probe CLU5-mRNA-probe (SEQ ID NO:36).

[0107] In some aspects, the present invention relates to a method for determining the presence or absence of TiLV in a biological sample, the method comprising: a) contacting a nucleic acid from the biological sample with at least one primer, said primer being a synthetic nucleic acid of: isolated (non-isolated) nucleic acid having a sequence of any one of SEQ ID NO: 1-11; isolated (non-isolated) nucleic acid complementary to a sequence of any one of SEQ ID NO: 1-11; isolated (non-isolated) nucleic acid having at least about 60% sequence identity with any one of SEQ ID NO: 1-11; isolated (non-isolated) nucleic acid having at least about 60% sequence identity with a nucleic acid complementary to a sequence of any one of SEQ ID NO: 1-11; isolated (non-isolated) nucleic acid comprising at least 10 consecutive nucleotides of any one of SEQ ID NO: 1-11; isolated (non-isolated) nucleic acid comprising at least 10 consecutive nucleotides of a nucleic acid complementary to a sequence ... A separated (non-separated) nucleic acid comprising at least 10 consecutive nucleotides of a sequence having at least about 60% identity with any of SEQ ID NO: 1-11; or a separated (non-separated) nucleic acid comprising at least 10 consecutive nucleotides of a sequence having at least about 60% identity with a nucleic acid complementary to the sequence of any of SEQ ID NO: 1-11; b) subjecting the nucleic acid and primers to amplification conditions; and c) determining the presence or absence of amplification products, wherein the presence of amplification products indicates the presence of TiLV-associated RNA in the sample.

[0108] The present invention also relates to a method for determining the presence or absence of TiLV in a biological sample, the method comprising: a) contacting a nucleic acid from the biological sample with a primer pair selected from the group consisting of: ME1 (SEQ ID NO:23) and clone 7450 / 150R (SEQ ID NO:16); nested ext-1 (SEQ ID NO:24) and nested ext-2 (SEQ ID NO:25); NM-CLU7-SF1 (SEQ ID NO:28) and NM-CLU7-SRI (SEQ ID NO:29); TiLV-CLU5-cF1 (SEQ ID NO:30) and TiLV-CLU5-cR1 (SEQ ID NO:31); and CLU5-mRNA-qF1 (SEQ ID NO:34) and CLU5-mRNA-qR1 (SEQ ID NO:31). NO:35); b) subjecting the nucleic acid and primer pair to amplification conditions; and c) determining the presence or absence of amplification products, wherein the presence of amplification products indicates the presence of TiLV-associated RNA in the sample.

[0109] In other respects, the present invention relates to expression constructs, such as, but not limited to, plasmids and vectors comprising, but not limited to, nucleic acid sequences, their complementary sequences, fragments thereof, and variants thereof, any one of SEQ ID NO: 1-11. Such expression constructs can be prepared by any suitable method known in the art. Such expression constructs are suitable for the expression and purification of viral nucleic acids and / or proteins.

[0110] In some respects, the present invention relates to interfering RNA (iRNA) molecules that target nucleic acids derived from TiLV (e.g., but not limited to any one of SEQ ID NO:1-11 and variants thereof) and silence target genes.

[0111] In some aspects, the present invention provides an iRNA comprising a sense strand having at least 15 consecutive nucleotides, said sense strand being complementary to an antisense strand of a gene comprising a nucleic acid sequence selected from the sequence group consisting of SEQ ID NO:1-11.

[0112] In some aspects, the present invention provides an iRNA comprising an antisense strand having at least 15 consecutive nucleotides, said antisense strand being complementary to a sense strand of a gene comprising a nucleic acid sequence selected from the sequence group consisting of SEQ ID NO:1-11.

[0113] In some aspects, the present invention relates to an iRNA comprising at least 15 consecutive nucleotides from: isolated (or non-isolated) nucleic acids having a sequence of any one of SEQ ID NO: 1-11; isolated (or non-isolated) nucleic acids complementary to a sequence of any one of SEQ ID NO: 1-11; isolated (or non-isolated) nucleic acids having at least about 60% sequence identity with any one of SEQ ID NO: 1-11; or isolated (or non-isolated) nucleic acids having at least about 60% sequence identity with a nucleic acid complementary to a sequence of any one of SEQ ID NO: 1-11.

[0114] As used herein, "iRNA reagent" (an abbreviation for "interfering RNA reagent") is an RNA reagent that downregulates the expression of a target gene, such as the TiLV gene. iRNA reagents can function through one or more mechanisms, including posttranscriptional cleavage of the target mRNA, sometimes referred to in the art as RNAi, or pretranscriptional or pretranslational mechanisms. iRNA reagents can be double-stranded (ds) iRNA reagents.

[0115] As used herein, a “ds iRNA reagent” (an abbreviation for “double-stranded iRNA reagent”) is an iRNA reagent comprising more than one strand, and in some embodiments, two strands, wherein inter-strand hybridization can form regions of a double-stranded structure. The term “strand” herein refers to a continuous sequence of nucleotides (including non-naturally occurring or modified nucleotides). Two or more strands may be separate molecules, each forming part of a separate molecule, or they may be covalently linked, for example by a linker, such as a polyethylene glycol linker, to form only one molecule. At least one strand may include a region fully complementary to the target RNA. This strand is called the “antisense strand.” The second strand included in the dsRNA reagent, containing a region complementary to the antisense strand, is called the “sense strand.” However, a ds iRNA reagent may also be formed from a single RNA molecule that is at least partially self-complementary, thereby forming, for example, a hairpin or handle structure including a double-stranded region. In this case, the term “strand” refers to one of the regions of the RNA molecule that is complementary to another region of the same RNA molecule.

[0116] The iRNA reagents described herein, including ds iRNA and siRNA reagents, can mediate gene silencing through, for example, RNA degradation. For convenience, this RNA is also referred to herein as the RNA to be silenced. This gene is also referred to as the target gene. In some embodiments, the RNA to be silenced is the gene product of the TiLV gene.

[0117] As used herein, the phrase “mediated RNAi” refers to the ability of a reagent to silence a target gene in a sequence-specific manner. “Silencing a target gene” means that, compared to similar cells that are not exposed to the reagent, cells containing and / or secreting a product of a target gene when not exposed to the reagent will contain and / or secrete at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the product of such a gene when exposed to the reagent. This product of the target gene can be, for example, messenger RNA (mRNA), a protein, or a regulatory element.

[0118] In the antiviral use of this invention, silencing of the target gene can lead to a reduction in "viral titer" in cells or animals, wherein "reduction in viral titer" refers to a decrease in the number of live viruses produced by cells undergoing silencing of the viral target gene or found in organisms undergoing silencing of the viral target gene. The reduction in the amount of virus produced in cells can lead to a reduction in the measurable amount of virus produced in the tissues of treated animals and a reduction in the severity of symptoms of viral infection. The iRNA reagent of this invention is also referred to as an "antiviral iRNA reagent".

[0119] In other respects, the present invention provides a method for reducing viral titers in animals by administering at least one iRNA that inhibits the expression of the TiLV gene to the animals.

[0120] In some aspects, the present invention provides a method for reducing the level of viral proteins, viral mRNA, or viral titers in animal cells, comprising: administering an iRNA reagent to the animal, wherein the iRNA reagent comprises a sense strand having at least 15 consecutive nucleotides, said sense strand being complementary to a gene or genomic segment of TiLV comprising a nucleic acid sequence selected from the sequence group consisting of SEQ ID NO: 1-11; and an antisense strand having at least 15 consecutive nucleotides complementary to the sense strand. In one embodiment, the method further comprises co-administering a second iRNA reagent to the animal, wherein the second iRNA reagent comprises a sense strand having at least 15 or more consecutive nucleotides, said sense strand being complementary to a second gene or genomic segment of TiLV comprising a nucleic acid sequence selected from the sequence group consisting of SEQ ID NO: 1-11, and an antisense strand having at least 15 consecutive nucleotides complementary to the sense strand.

[0121] In some aspects, the present invention provides a method for reducing the level of a viral protein from at least one gene of TiLV in the cells of an animal, comprising: administering an iRNA reagent to the animal, wherein the iRNA reagent comprises a sense strand having at least 15 consecutive nucleotides, said sense strand being complementary to a gene of TiLV comprising a nucleic acid sequence selected from the sequence group consisting of SEQ ID NO:1-11, and an antisense strand having at least 15 consecutive nucleotides complementary to the sense strand.

[0122] Isolated polypeptides and their uses

[0123] This invention also relates to isolated polypeptides and their variants and derivatives. These polypeptides can be used in a variety of applications, including but not limited to antibody generation and the generation of immunogenic compositions. For example, this invention relates to the isolated polypeptide of SEQ ID NO:12. For example, this invention also relates to an isolated polypeptide encoded by a nucleic acid sequence of any one of SEQ ID NO:1-11 or fragments and variants thereof. Peptides of at least 8 amino acid residues in length can be recognized by antibodies (MacKenzie et al. (1984) Biochemistry 23:6544-6549). In some embodiments, this invention relates to fragments of the polypeptides described herein, which can be used, for example, for antibody generation.

[0124] Therefore, in some aspects, the present invention relates to an isolated polypeptide having at least about 80% sequence identity with the polypeptide of SEQ ID NO:12. In some aspects, the present invention relates to an isolated polypeptide comprising at least 8 consecutive amino acids of the polypeptide of SEQ ID NO:12. In some aspects, the present invention relates to an isolated polypeptide comprising at least 8 amino acids having at least about 80% sequence identity with the polypeptide of SEQ ID NO:12.

[0125] In one aspect, the present invention relates to polypeptide variants of the isolated polypeptide of SEQ ID NO:12. Variants of the isolated polypeptide of SEQ ID NO:12 include, but are not limited to, polypeptide sequences having at least about 50% to about 55% identity with the sequence of the isolated polypeptide of SEQ ID NO:12. Variants of the isolated polypeptide of SEQ ID NO:12 include, but are not limited to, polypeptide sequences having at least about 55.1% to about 60% identity with the sequence of the isolated polypeptide of SEQ ID NO:12. Variants of the isolated polypeptide of SEQ ID NO:12 include, but are not limited to, polypeptide sequences having at least about 60.1% to about 65% identity with the sequence of the isolated polypeptide of SEQ ID NO:12. Variants of the isolated polypeptide of SEQ ID NO:12 include, but are not limited to, polypeptide sequences having at least about 65.1% to about 70% identity with the sequence of the isolated polypeptide of SEQ ID NO:12. Variants of the isolated polypeptide of SEQ ID NO:12 include, but are not limited to, polypeptides having at least about 70.1% to about 75% identity with the sequence of the isolated polypeptide of SEQ ID NO:12. Variants of the isolated polypeptide of SEQ ID NO:12 include, but are not limited to, polypeptide sequences having at least about 75.1% to about 80% identity with the sequence of the isolated polypeptide of SEQ ID NO:12. Variants of the isolated polypeptide of SEQ ID NO:12 include, but are not limited to, polypeptide sequences having at least about 80.1% to about 85% identity with the sequence of the isolated polypeptide of SEQ ID NO:12. Variants of the isolated polypeptide of SEQ ID NO:12 include, but are not limited to, polypeptide sequences having at least about 85.1% to about 90% identity with the sequence of the isolated polypeptide of SEQ ID NO:12. Variants of the isolated polypeptide of SEQ ID NO:12 include, but are not limited to, polypeptide sequences having at least about 90.1% to about 95% identity with the sequence of the isolated polypeptide of SEQ ID NO:12. Variants of the isolated polypeptide of SEQ ID NO:12 include, but are not limited to, polypeptide sequences having at least about 95.1%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5%, or about 99.9% identity with the sequence of the isolated polypeptide of SEQ ID NO:12.

[0126] In one aspect, the present invention relates to polypeptide variants of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any one of the isolated polypeptides encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11 include, but are not limited to, polypeptide sequences having at least about 50% to about 55% identity with the sequence of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11 include, but are not limited to, polypeptide sequences having at least about 55.1% to about 60% identity with the sequence of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11 include, but are not limited to, polypeptide sequences having at least about 60.1% to about 65% identity with the sequence of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11 include, but are not limited to, polypeptide sequences having at least about 65.1% to about 70% identity with the sequence of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11 include, but are not limited to, polypeptide sequences having at least about 70.1% to about 75% identity with the sequence of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11 include, but are not limited to, polypeptide sequences having at least about 75.1% to about 80% identity with the sequence of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11 include, but are not limited to, polypeptide sequences having at least about 80.1% to about 85% identity with the sequence of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11 include, but are not limited to, polypeptide sequences having at least about 85.1% to about 90% identity with the sequence of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11.Variants of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11 include, but are not limited to, polypeptide sequences having at least about 90.1% to about 95% identity with the sequence of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11. Variants of any isolated polypeptide encoded by the nucleic acid sequence of any one of SEQ ID NO:1-11 include, but are not limited to, polypeptide sequences having at least about 95.1%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5%, or about 99.9% identity with any one of SEQ ID NO:1-11.

[0127] The present invention also relates to a polypeptide encoded by a nucleic acid complementary to the nucleic acid sequence of any one of SEQ ID NO:1-11 or a fragment or variant thereof.

[0128] This invention relates to a polypeptide comprising about 10 to about 50 consecutive amino acids of SEQ ID NO:12 or a variant thereof. This invention relates to a polypeptide comprising about 10 to about 100 consecutive amino acids of SEQ ID NO:12 or a variant thereof. This invention relates to a polypeptide comprising about 10 to about 150 consecutive amino acids of SEQ ID NO:12 or a variant thereof. This invention relates to a polypeptide comprising about 10 to about 200 consecutive amino acids of SEQ ID NO:12 or a variant thereof. This invention relates to a polypeptide comprising about 10 to about 250 consecutive amino acids of SEQ ID NO:12 or a variant thereof. This invention relates to a polypeptide comprising about 10 to about 300 consecutive amino acids of SEQ ID NO:12 or a variant thereof. This invention relates to a polypeptide comprising about 10 to about 350 consecutive amino acids of SEQ ID NO:12 or a variant thereof. This invention relates to a polypeptide comprising about 10 to about 400 consecutive amino acids of SEQ ID NO:12 or a variant thereof. This invention relates to a polypeptide comprising about 10 to about 420 consecutive amino acids of SEQ ID NO:12 or a variant thereof. In some embodiments, this invention relates to isolated and purified peptides.

[0129] In some embodiments, the polypeptides of the present invention may be adapted to act as antigens for detecting antibodies against SEQ ID NO:12 and its variants. In other embodiments, the polypeptides of the present invention, containing antigenic determinants, may be used in various immunoassays to identify animals exposed to SEQ ID NO:12 and its variants and / or samples containing SEQ ID NO:12 and its variants.

[0130] This invention relates to a polypeptide comprising about 10 to about 50 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO:1-11 or their complementary sequences or variants, encoding any isolated polypeptide. This invention relates to a polypeptide comprising about 10 to about 100 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO:1-11 or their complementary sequences or variants, encoding any isolated polypeptide. This invention relates to a polypeptide comprising about 10 to about 150 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO:1-11 or their complementary sequences or variants, encoding any isolated polypeptide. This invention relates to a polypeptide comprising about 10 to about 200 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO:1-11 or their complementary sequences or variants, encoding any isolated polypeptide. This invention relates to a polypeptide comprising about 10 to about 250 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO:1-11 or their complementary sequences or variants, encoding any isolated polypeptide. This invention relates to a polypeptide comprising about 10 to about 300 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO: 1-11 or their complementary sequences or variants, encoding any isolated polypeptide. This invention relates to a polypeptide comprising about 10 to about 350 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO: 1-11 or their complementary sequences or variants, encoding any isolated polypeptide. This invention relates to a polypeptide comprising about 10 to about 400 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO: 1-11 or their complementary sequences or variants, encoding any isolated polypeptide. This invention relates to a polypeptide comprising about 10 to about 450 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO: 1-11 or their complementary sequences or variants, encoding any isolated polypeptide. This invention relates to a polypeptide comprising about 10 to about 460 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO: 1-11 or their complementary sequences or variants, encoding any isolated polypeptide. This invention relates to a polypeptide comprising about 10 to about 470 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO:1-11 or their complementary sequences or variants encoding any isolated polypeptide. This invention also relates to a polypeptide comprising about 10 to about 480 consecutive amino acids, said consecutive amino acids being derived from any one of the nucleic acid sequences in SEQ ID NO:1-11 or their complementary sequences or variants encoding any isolated polypeptide.This invention relates to a polypeptide comprising about 10 to about 490 consecutive amino acids, said consecutive amino acids being derived from any of the nucleic acid sequences of SEQ ID NO:1-11 or their complementary sequences or variants encoding any isolated polypeptide. The invention also relates to a polypeptide comprising about 10 to about 550 or more consecutive amino acids, said consecutive amino acids being derived from any of the nucleic acid sequences of SEQ ID NO:1-11 or their complementary sequences or variants encoding any isolated polypeptide. In some embodiments, the invention relates to isolated and purified peptides.

[0131] In some embodiments, the peptides of the present invention may be adapted to act as antigens for detecting antibodies against TiLV represented by any one of SEQ ID NO:1-11 and variants thereof. In other embodiments, the peptides of the present invention, containing antigenic determinants, may be used in various immunoassays to identify animals exposed to TiLV represented by any one of SEQ ID NO:1-11 and variants thereof and / or samples containing said TiLV.

[0132] Antibody, preparation method and usage

[0133] In another aspect, the present invention relates to an antibody that specifically binds amino acids from isolated polypeptides, fragments thereof, and variant polypeptides as described herein by SEQ ID NO: 12. In one embodiment, the antibody is purified. The antibody may be polyclonal or monoclonal. The antibody may also be chimeric (i.e., a combination of sequences from more than one species, such as a chimeric mouse-human immunoglobulin), humanized, or fully human. Species-specific antibodies avoid some of the problems associated with antibodies having variable and / or constant regions from other species. The presence of such protein sequences from other species may lead to rapid clearance of the antibody or may lead to an immune response against the antibody.

[0134] In another aspect, the present invention relates to an antibody that specifically binds to amino acids of any isolated polypeptide encoded by a nucleic acid sequence derived from any of SEQ ID NO: 1-11, fragments thereof, and variants thereof as described herein. In one embodiment, the antibody is purified. The antibody may be polyclonal or monoclonal. The antibody may also be chimeric (i.e., a combination of sequences from more than one species, such as a chimeric mouse-human immunoglobulin), humanized, or fully human. Species-specific antibodies avoid some of the problems associated with antibodies having variable and / or constant regions from other species. The presence of such protein sequences from other species may lead to rapid clearance of the antibody or may lead to an immune response against the antibody.

[0135] The antibodies described in this specification may include or be derived from any mammal, such as, but not limited to, birds, dogs, humans, mice, rabbits, rats, rodents, primates, or any combination thereof, and include isolated avian, human, primate, rodent, mammalian, chimeric, humanized, and / or CDR-transplanted or CDR-adapted antibodies, immunoglobulins, lysis products, and other portions and variants thereof.

[0136] The antibodies described herein can be generated using any method known in the art for generating antibodies. Exemplary methods include animal inoculation, phage display, transgenic mouse technology, and hybridoma technology.

[0137] The antibodies of the present invention can be used to modulate the activity of any polypeptide encoded by a nucleic acid sequence of any one of SEQ ID NO:1-11 or its variants or fragments. In some aspects, the present invention relates to a method for treating animals, the method comprising administering an antibody to the animal that specifically binds to an amino acid of a polypeptide derived from a nucleic acid sequence of any one of SEQ ID NO:1-11, its fragments and variants as described herein.

[0138] In some embodiments, an antibody binding to a polypeptide encoded by a nucleic acid sequence of any of SEQ ID NO:1-11, fragments thereof, and variants thereof as described herein can interfere with or inhibit the function of the polypeptide, thereby providing a method for inhibiting viral replication and transmission. In other embodiments, the antibody binding to a polypeptide encoded by a nucleic acid sequence of any of SEQ ID NO:1-11, fragments thereof, and variants thereof as described herein does not interfere with or inhibit the function of the polypeptide.

[0139] In other embodiments, the antibodies of the present invention can be used to purify the polypeptide, its variants, or fragments as described herein as SEQ ID NO:12. In other embodiments, the antibodies of the present invention can be used to identify the expression and localization of the polypeptide, its variants, fragments, or domains of SEQ ID NO:12. Analysis of the expression and localization of the polypeptide of SEQ ID NO:12 can be used to determine the potential role of the polypeptide of SEQ ID NO:12.

[0140] In other embodiments, the antibodies of the present invention can be used to purify peptides in any polypeptide encoded by a nucleic acid sequence of any one of SEQ ID NO:1-11, its variants, or fragments as described herein. In other embodiments, the antibodies of the present invention can be used to identify the expression and localization of peptides in any polypeptide encoded by a nucleic acid sequence of any one of SEQ ID NO:1-11, its variants, fragments, or domains. Expression and localization analysis of peptides in any polypeptide encoded by a nucleic acid sequence of any one of SEQ ID NO:1-11 can be used to determine the potential role of peptides in any polypeptide encoded by a nucleic acid sequence of any one of SEQ ID NO:1-11, its fragments, and variants.

[0141] In other embodiments, the antibodies of the present invention can be used in various immunoassays to identify animals exposed to antigens derived from TiLV represented by SEQ ID NO:12 and its fragments and variants as described herein, and / or samples containing said antigens.

[0142] In other embodiments, the antibodies of the present invention can be used in various immunoassays to identify animals and / or samples containing antigens derived from TiLV represented by any one of SEQ ID NO:1-11 and their fragments and variants as described herein.

[0143] Any suitable immunoassay that can induce the formation of antigen-antibody complexes may also be used. Variations and different forms of immunoassays (e.g., but not limited to ELISA, lateral flow assays for detecting analytes in a sample, immunoprecipitation) are known in the art. In various embodiments, the antigen and / or antibody may be labeled by any suitable labeling or method known in the art. For example, enzyme-catalyzed immunoassays may use solid supports or immunoprecipitation. Immunoassays that amplify the signal from antigen-antibody immune complexes may also be used in conjunction with the methods described herein.

[0144] In some aspects, the present invention provides methods for determining the presence or absence of TiLV comprising SEQ ID NO:12 and its fragments and variants as described herein. In some embodiments, the methods for determining the sample include, but are not limited to, methods for detecting the presence of nucleic acids; methods for detecting the presence of antigens; and methods for detecting the presence of antibodies against antigens derived from: a polypeptide of SEQ ID NO:12, or a polypeptide of SEQ ID NO:12, its fragments and variants as described herein.

[0145] In some aspects, the present invention provides methods for determining the presence or absence of TiLV comprising any of SEQ ID NO:1-11, fragments thereof, and variants thereof as described herein. In some embodiments, the methods for determining the sample include, but are not limited to, methods for detecting the presence of nucleic acids; methods for detecting the presence of antigens; and methods for detecting the presence of antibodies against antigens derived from: polypeptides encoded by any of SEQ ID NO:1-11, or any polypeptide encoded by a nucleic acid sequence of any of SEQ ID NO:1-11, fragments thereof, and variants thereof as described herein.

[0146] Reagent test kit

[0147] Kits for practicing one or more of the methods described above are also provided.

[0148] The subject reagents and their kits can vary considerably. Reagents of interest include those specifically designed to determine whether an animal possesses TiLV.

[0149] A reagent specifically designed for the detection of TiLV is at least one oligonucleotide primer specific to SEQ ID NO:1-11 for amplifying nucleic acids obtained from biological samples, and optionally at least one primer adapted to achieve sequencing of the amplified nucleic acid and determination of the presence of mutations.

[0150] Examples of primers that can be included as reagents include:

[0151] ME1 (SEQ ID NO:23) and clone 7450 / 150R (SEQ ID NO:16);

[0152] Nested ext-1 (SEQ ID NO:24) and nested ext-2 (SEQ ID NO:25);

[0153] NM-CLU7-SF1 (SEQ ID NO:28) and NM-CLU7-SRI (SEQ ID NO:29);

[0154] TiLV-CLU5-cF1 (SEQ ID NO:30) and TiLV-CLU5-cR1 (SEQ ID NO:31); and

[0155] CLU5-mRNA-qF1 (SEQ ID NO:34) and CLU5-mRNA-qR1 (SEQ ID NO:35);

[0156] And the optional probe CLU5-mRNA-probe (SEQ ID NO:36).

[0157] Another type of reagent is one or more nucleic acid probes comprising SEQ ID NO:1-11 or their complements. In one embodiment, one or more probes are in the form of an array. A wide variety of array configurations are known in the art, featuring diverse probe structures, substrate compositions, and attachment techniques. In some embodiments, the array comprises at least two nucleic acid probes, in a more preferred embodiment at least five nucleic acid probes, in a more preferred embodiment at least ten nucleic acid probes, in a more preferred embodiment at least fifteen nucleic acid probes, in a more preferred embodiment at least 25 nucleic acid probes, and in a more preferred embodiment at least 50 nucleic acid probes, said nucleic acid probes comprising SEQ ID NO:1-11 or their complements.

[0158] Another type of reagent is one or more antibodies as described herein, which specifically bind amino acids of the polypeptide from the isolated polypeptide, its fragments and variants from SEQ ID NO:12, or amino acids of the polypeptide from any isolated polypeptide encoded by the nucleic acid sequence of any of SEQ ID NO:1-11, its fragments and variants.

[0159] The kit of the present invention may include the primers, probes, arrays, and antibodies described above, as well as additional reagents used in various methods, such as: labeling reagents; enzymes, such as reverse transcriptase, DNA and RNA polymerases; various buffers, such as hybridization and washing buffers; signal generation and detection reagents; and reagents for isolating nucleic acids from samples. Furthermore, the kit may include instructions for practicing the methods of the present invention.

[0160] This invention also covers systems for practicing one or more of the methods described above. The subject system can vary considerably, but generally includes at least one element for detecting TiLV, i.e., one or more of the reagents described above for detecting TiLV, including primers, probes, arrays, antibodies, and additional reagents for practicing the methods of this invention.

[0161] Immunogenic composition, preparation method and usage

[0162] As used herein, the term immunogenic composition means a composition capable of inducing an immune response in animals or cells. As used herein, references to immunogenic compositions may include vaccines.

[0163] In some aspects, the present invention provides immunogenic compositions capable of inducing an immune response against TiLV (including the TiLV of the present invention), said compositions comprising a nucleic acid of any one of SEQ ID NO:1-11 or a fragment or variant thereof, or comprising a cDNA sequence complementary to the sense or antisense strand of any one of SEQ ID NO:1-11 or a fragment or variant thereof, or comprising a polypeptide encoded by a cDNA sequence of any one of SEQ ID NO:1-11 or a cDNA sequence complementary to the sense or antisense strand of any one of SEQ ID NO:1-11, or comprising a polypeptide comprising SEQ ID NO:12 or a fragment or variant thereof, or comprising killing or attenuated TiLV.

[0164] In some aspects, the present invention relates to an immunogenic composition comprising any TiLV nucleic acid or polypeptide described herein, including variants and fragments.

[0165] In one embodiment, the immunogenic composition is able to improve the symptoms of TiLV infection and / or reduce the duration of TiLV-related disease. In another embodiment, the immunogenic composition is able to induce protective immunity against TiLV-related disease. The immunogenic compositions of the present invention are effective against the TiLV viruses disclosed herein, and are also cross-reactive with and effective against several different clades and strains of TiLV, as well as against other orthomyxoviruses.

[0166] In another embodiment, the present invention provides a method for inducing an immune response in an animal, the method comprising administering TiLV nucleic acid, TiLV polypeptide, or a TiLV immunogenic composition to the animal. Methods for administering polypeptides to animals and methods for generating an immune response in animals by administering immunogenic peptides in immunologically effective amounts are known in the art.

[0167] The types of immunogenic compositions covered by this invention include, but are not limited to, attenuated live virus immunogenic compositions, inactivated (killed) virus immunogenic compositions, and subunit immunogenic compositions.

[0168] The TiLV virus of the present invention can be attenuated by removing or destroying those viral sequences that cause or contribute to the disease and symptoms associated with TiLV infection and leaving those sequences required for viral replication intact. In this way, attenuated TiLV that replicates in animals and induces an immune response in animals, but does not induce the harmful disease and symptoms commonly associated with TiLV infection, can be produced. Those skilled in the art can determine which TiLV sequences can or should be removed or destroyed and which sequences should be left intact in order to generate attenuated TiLV suitable for use in immunogenic compositions.

[0169] The novel TiLVs of this invention can also be inactivated, such as by chemical treatment, to “kill” the viruses, thereby preventing them from replicating or causing disease in animals, but still inducing an immune response in animals. Many suitable virus inactivation methods are known in the art, and those skilled in the art can readily select appropriate methods and produce inactivated “killed” TiLVs suitable for use as immunogenic compositions.

[0170] The immunogenic compositions of the present invention may include subunit immunogenic compositions. Subunit immunogenic compositions include nucleic acid immunogenic compositions, such as DNA immunogenic compositions, which contain nucleic acids encoding one or more viral proteins or subunits, or portions of those proteins or subunits. When such immunogenic compositions are used, the nucleic acids are administered to an animal, and the immunogenic protein or peptide encoded by the nucleic acids is expressed in the animal, thereby generating an immune response against said protein or peptide in the animal. Subunit immunogenic compositions may also be protein immunogenic compositions, which contain the viral protein or subunit itself, or portions of those proteins or subunits.

[0171] To prepare the nucleic acid and DNA immunogenic compositions of the present invention, the TiLV sequences disclosed herein can be incorporated into plasmids or expression vectors containing nucleic acids encoding viral proteins or peptides. Any suitable plasmid or expression vector capable of driving the expression of the protein or peptide in animals can be used. Such plasmids and expression vectors should include promoters suitable for directing the transcription of nucleic acids. The nucleic acid sequences encoding TiLV proteins or peptides can also be incorporated into suitable recombinant viruses for administration to animals. Examples of suitable viruses include, but are not limited to, vaccinia virus, retrovirus, adenovirus, and adeno-associated virus. Those skilled in the art can readily select suitable plasmids, expression vectors, or recombinant viruses for delivering the TiLV nucleic acid sequences of the present invention.

[0172] To produce the protein-based immunogenic composition of the present invention, the TiLV nucleic acid sequence of the present invention is delivered into cultured cells, for example by transfecting cultured cells with a plasmid or expression vector containing the TiLV nucleic acid sequence, or by infecting cultured cells with a recombinant virus containing the TiLV nucleic acid sequence. The TiLV protein or peptide can then be expressed in the cultured cells and purified. The purified protein can then be incorporated into a composition suitable for administration to animals. Methods and techniques for expressing and purifying recombinant proteins are well known in the art, and any such suitable method can be used.

[0173] The subunit immunogenic compositions of the present invention may encode or contain any of the TiLV proteins or peptides described herein that are immunogenic in animals, or any portion, fragment, derivative, or mutant thereof. Those skilled in the art can readily test the immunogenicity of the TiLV proteins or peptides described herein and can select proteins or peptides suitable for the subunit immunogenic compositions.

[0174] The generation of TiLV virus and immunogenic compositions can also be performed using recombinant expression systems that express TiLV, TiLV protein, fragments of TiLV protein, or variants of TiLV viral protein. Expression systems may include any suitable plasmids or linear expression constructs known in the art.

[0175] The TiLV virus and immunogenic composition described herein can be produced in cells. The production of the TiLV virus and immunogenic composition described herein can also be achieved on any available medium and permissible cells or tissues that may be derived from fish or other animal cell lines. As used herein, cells or tissues may include, but are not limited to, individual cells, tissues, organs, insect cells, fish cells, mammalian cells, hybridoma cells, primary cells, continuous cell lines, and / or genetically engineered cells, such as recombinant cells expressing the virus. For example, the production of the TiLV virus and immunogenic composition can be in any cell type, including but not limited to tilapia cells. Suitable cell lines for producing the TiLV virus and immunogenic composition described herein: The cell culture system used to produce the TiLV virus and immunogenic composition described herein can be a conventional adherent monolayer culture. Alternatively, suspension and microcarrier cell culture systems may also be used.

[0176] The immunogenic compositions described herein may comprise inactivated or killed TiLV vaccines. Inactivated immunogenic compositions may be prepared by methods well known in the art. For example, once TiLV has multiplied to a high titer, TiLV antigen quality can be obtained by methods well known in the art. For example, TiLV viral antigen quality can be obtained by dilution, concentration, or extraction. All of these methods have been employed to obtain appropriate TiLV antigen quality to produce immunogenic compositions. TiLV may be inactivated by treatment with formalin (e.g., 0.1-10%), β-propiolactone (BPL) (e.g., 0.01-10%), or diazinon (BEI) (e.g., 1-10 mM), or by other methods known to those skilled in the art.

[0177] In addition to the generation of TiLV through inactivation, various attenuation methods are possible and are well known and described in the art. Attenuation methods for producing modified live immunogenic compositions can also be used in conjunction with the compositions and methods described herein. Suitable attenuation methods for use with the viruses described herein include continuous passage in cell cultures, continuous passage in animals, various methods for generating genetic modifications, and ultraviolet or chemical mutagenesis.

[0178] Attenuation of TiLV can be achieved through cold adaptation of TiLV strains. Cold-adapted TiLV virus strains can be produced by methods including passage of wild-type TiLV virus followed by selection of TiLV strains that grow at reduced temperatures. For example, cold-adapted TiLV can be produced by continuously passaged wild-type TiLV in embryonic cells or chicken eggs at progressively decreasing temperatures, thereby selecting certain members of the TiLV mixture that replicate stably at reduced temperatures. Cold-adapted TiLV strains can exhibit a temperature-sensitive phenotype. Temperature-sensitive cold-adapted TiLVs replicate at reduced temperatures, but at certain higher growth temperatures at which wild-type TiLVs would replicate. The temperatures at which temperature-sensitive TiLVs would grow are referred to herein as the “allowable” temperatures of the temperature-sensitive TiLVs, and the higher temperatures at which temperature-sensitive TiLVs would not grow, but correspondingly wild-type TiLVs would grow, are referred to herein as the “unallowable” temperatures of the temperature-sensitive TiLVs. Cold-adapted TiLVs can also be produced through recombinant methods. In this method, one or more specific mutations associated with the identified cold adaptation, attenuation, temperature sensitivity, or dominant interference phenotype can be identified and reintroduced into wild-type TiLV strains using reverse genetics. Reverse genetics requires the following steps: using an RNA polymerase complex isolated from TiLV-infected cells, an artificial TiLV genome segment containing the mutation incorporated into the synthetic RNA segment is transcribed into a viral particle using a helper virus, followed by selection of the virus containing the desired alteration.

[0179] Attenuation of TiLV can be achieved through continuous passage of wild-type TiLV lines in cell cultures. TiLV lines can be passaged in various cell systems until they lose their pathogenicity while fully retaining their immunogenic characteristics. Once inoculated into a host, TiLV can multiply to some extent. For example, attenuated TiLV compositions can be prepared from cell lines that have been attenuated through continuous passage, which includes passage at suboptimal temperatures until the TiLV is no longer pathogenic but still induces a protective immune response.

[0180] Suitable attenuated TiLV strains can also be obtained through continuous passages to obtain over-attenuated strains. "Over-attenuated" means that the number of passages used for attenuation is substantially greater than the number of passages required to remove pathogenicity. Attenuated TiLV retains its antigenicity after these numerous passages, thus its immunogenicity is not impaired. Such strains practically do not produce symptoms or side effects when administered, and are therefore safe and effective vaccines.

[0181] Methods for purifying inactivated viruses are known in the art and may include, for example, gradient centrifugation, ultracentrifugation, continuous flow ultracentrifugation, and chromatographic methods such as one or more of ion exchange chromatography, size exclusion chromatography, and liquid affinity chromatography. Other purification methods include ultrafiltration and percolation.

[0182] Other examples of purification methods suitable for this invention include polyethylene glycol or ammonium sulfate precipitation (see Trepanier et al. (1981) Journal of Virological Methods 3:201-711; Hagen et al. (1996) Biotechnology Progress 12:406-412; and Carlsson et al. (1994) Journal of Virological Methods 47:27-36) as well as ultrafiltration and microfiltration (see Pay et al. (1985) Developments in Biological Standardization 60:171-174; Tsurumi et al. (1990) Polymer Journal 22:1085-1100; and Makino et al. (1994) Archives of Virology 139:87-96).

[0183] Viruses can be purified using chromatographic methods (such as ion-exchange chromatography). Chromatographic purification allows for the production of large quantities of virus-containing suspensions. Viral products of interest interact with the chromatographic medium via simple adsorption / desorption mechanisms, and large volumes of sample can be processed with a single loading. Contaminants without affinity for the adsorbent pass through the column. The viral material can then be eluted in a concentrated form.

[0184] Anion exchange resins that can be used include, but are not limited to, DEAE and EMD TMAE. Cation exchange resins may include sulfonic acid-modified surfaces. Viruses can be purified using ion exchange chromatography, including strong anion exchange resins (e.g., EMD TMAE) for the first step and EMD-SO3 (cation exchange resin) for the second step. Metal-binding affinity chromatography steps may optionally be included for further purification (see, for example, WO 97 / 06243).

[0185] Resins can also be used, such as synthetic methacrylate-based resins like Fractogel EMD, which have long, covalently attached linear polymer chains and allow for a large number of spatially accessible ligands for binding to biomolecules without any spatial barriers.

[0186] Column-based liquid affinity chromatography is another purification method applicable to this invention. An example of a resin used in this purification method is Matrex Cellufine Sulfate (MCS). MCS consists of a rigid, spherical (approximately 45-105 μm in diameter) cellulose matrix with an exclusion limit of 3,000 Daltons (its pore structure excludes biomacromolecules) and a low concentration of sulfate functional groups at the 6-position of the cellulose. When the functional ligands (sulfates) are relatively highly dispersed, they exhibit insufficient cation charge density to allow the most readily soluble proteins to adsorb onto the bead surface. Therefore, most proteins present in typical viral conjugates (cell culture supernatants, such as pyrogens and most contaminating proteins, as well as nucleic acids and endotoxins) are washed off the column, achieving a degree of purification of the bound viruses.

[0187] Inactivated viruses can be further purified by gradient centrifugation or density gradient centrifugation. For commercial-scale operations, continuous flow sucrose gradient centrifugation would be an option. This method is widely used for purifying antiviral immunogenic compositions and is known to those skilled in the art.

[0188] Other purification methods that can be used to purify the viruses of the present invention include the use of nucleic acid degrading agents, nucleic acid degrading enzymes such as nucleases with DNase and RNase activities or endonucleases such as those from Serratia marcescens, membrane adsorbers with anionic functional groups, or additional chromatographic steps utilizing anionic functional groups (e.g., DEAE or TMAE). Ultrafiltration / difiltration and final aseptic filtration steps may also be added to the purification method.

[0189] The purified viral preparations of this invention are substantially free of contaminating proteins derived from cells or cell cultures and may contain less than about 1000, 500, 250, 150, 100, or 50 pg of cellular nucleic acid / .mu.g viral antigen, and less than about 1000, 500, 250, 150, 100, or 50 pg of cellular nucleic acid / dose. The purified viral preparations may also contain less than about 20 pg or less than about 10 pg. Methods for measuring the level of host cell nucleic acid in a viral sample are known in the art. Standard methods permitted or recommended by regulatory agencies such as the WHO or FDA may be used.

[0190] The immunogenic compositions of the present invention comprise at least one TiLV-derived immunogenic component, such as those described herein. The compositions may also comprise one or more additives, including but not limited to one or more pharmaceutically acceptable carriers, buffers, stabilizers, diluents, preservatives, solubilizers, liposomes, or immunomodulators. Suitable immunomodulators include, but are not limited to, adjuvants, cytokines, polynucleotides encoding cytokines, and agents that facilitate cellular uptake of the TiLV-derived immunogenic components.

[0191] The immunogenic compositions applicable to the present invention can therefore be formulated in a conventional manner using one or more physiologically acceptable carriers, said carriers comprising excipients and adjuvants that facilitate the processing of the active compound into a formulation that can be used to induce an immunogenic response. These immunogenic compositions can be manufactured in ways known per se, such as by conventional mixing, dissolving, granulation, pelleting, grinding, emulsification, encapsulation, embedding, or lyophilization processes. Proper formulation depends on the chosen route of administration.

[0192] When a therapeutically effective amount of the protein or other active ingredient of the present invention is administered via intravenous, skin, or subcutaneous injection, the protein or other active ingredient of the present invention will be in the form of a pyrogen-free, parenterally acceptable aqueous solution. The preparation of such a parenterally acceptable solution of the protein or other active ingredient, while appropriately considering pH, isotonicity, solubility, etc., is within the skill of the art. Isotonic media such as sodium chloride injection, Ringer's injection, dextran injection, dextran and sodium chloride injection, lactated Ringer's injection, Hanks's solution, physiological saline buffer, or other media as known in the art can be used to prepare the solution. The immunogenic compositions of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those skilled in the art. For administration via mucosa, a penetrant suitable for the barrier to be penetrated is used in the formulation. Such penetrants are well known in the art.

[0193] For oral administration, the compound can be readily formulated by co-mixing the active compound with an immunogenically acceptable carrier well known in the art. Such carriers enable the compounds of the present invention to be formulated as powders, tablets, pills, sugar-coated pills, capsules, liquids, gels, syrups, slurries, suspensions, solutions, elixirs, etc., for oral ingestion by animals to be treated. Immunogenic formulations for oral use are available, solid excipients, optionally milled, and, if desired, processed into granules to obtain tablets or sugar-coated pill cores. Suitable excipients are specifically fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose formulations, such as, for example, corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrants, such as croscarmellose, agar, or alginate or salts thereof, such as sodium alginate, can be added. The sugar-coated core has a suitable coating. For this purpose, a concentrated sugar solution may be used, optionally containing gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol and / or titanium dioxide, lacquer solution, and suitable organic solvents or solvent mixtures. When administered in liquid form, a liquid carrier, such as water, petroleum, animal or plant-derived oils (such as peanut oil, mineral oil, soybean oil, or sesame oil), or synthetic oil, may be added. The liquid form of the immunogenic composition may also contain physiological saline solution, dextran or other sugar solution, or glycols such as ethylene glycol, propylene glycol, or polyethylene glycol. Dyes or pigments may be added to the coating of the tablet or sugar-coated core for identification or characterization of different combinations of active compound doses.

[0194] Orally applicable immunogenic formulations include push-fit capsules made of gelatin and sealed soft capsules made of gelatin and plasticizers such as glycerin or sorbitol. Push-fit capsules may contain a mixture of the active ingredient and fillers such as lactose, binders such as starch, and / or lubricants such as talc or magnesium stearate, and optionally, stabilizers. In soft capsules, the active compound may be dissolved or suspended in a suitable liquid such as fatty oil, liquid paraffin, or liquid polyethylene glycol. Stabilizers may also be added. All formulations intended for oral administration should be dosage-appropriate for such administration. For sublingual administration, the composition may be in the form of tablets or lozenges formulated in a conventional manner.

[0195] Capsules and cartridges can be formulated as powder mixtures containing compounds and suitable powder bases such as lactose or starch. The compounds can be formulated for parenteral administration by injection, such as via bolus injection or continuous infusion. Formulations for injection can be presented as unit dosage forms, such as in ampoules or multi-dose containers, containing added preservatives. Compositions can take the form of suspensions, solutions, or emulsions in oily or aqueous media and may contain formulation agents such as suspending agents, stabilizers, and / or dispersants.

[0196] Immunogenic formulations intended for parenteral administration include aqueous solutions of the active compound in a water-soluble form. Alternatively, suspensions of the active compound can be prepared as suitable oily injectable suspensions. Suitable lipophilic solvents or mediators include fatty oils, such as sesame oil, or synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. Aqueous injectable suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or reagents that increase the solubility of the compound to allow for the preparation of highly concentrated solutions. Alternatively, the active ingredient may be in powder form prepared prior to use using a suitable mediator such as pyrogen-free sterile water.

[0197] The carrier for the hydrophobic compound used in this invention can be a co-solvent system comprising benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. The co-solvent system can be a VPD co-solvent system. VPD is a solution of 3% w / v benzyl alcohol, 8% w / v nonpolar surfactant polysorbate 80, and 65% w / v polyethylene glycol 300, diluted to volume in anhydrous ethanol. The VPD co-solvent system (VPD:5W) consists of VPD diluted 1:1 with a 5% dextrose aqueous solution. This co-solvent system adequately dissolves the hydrophobic compound and itself exhibits low toxicity when administered systemically. Of course, the proportions of the co-solvent system can be varied without compromising its solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components can be changed: for example, other low-toxicity nonpolar surfactants can be used instead of polysorbate 80; the amount of polyethylene glycol can be varied; other biocompatible polymers can replace polyethylene glycol, such as polyvinylpyrrolidone; and other sugars or polysaccharides can replace dextrose.

[0198] Alternatively, other delivery systems for hydrophobic immunogenic compounds may be used. Liposomes and emulsions are well-known examples of delivery media or carriers for hydrophobic drugs. Liposomes include amphiphilic agents, such as lipids present in aqueous solutions in aggregated form as micelles, insoluble monolayers, liquid crystals, or sheet layers. Suitable lipids for liposome formulations include, but are not limited to, monoglycerides, diglycerides, thioesters, lysophosphatidylcholine, phospholipids, saponins, bile acids, etc. The preparation of such liposome formulations is within the skill level of the art.

[0199] Alternatively, sustained-release systems can be used to deliver compounds, such as semi-permeable matrices of solid hydrophobic polymers containing therapeutic agents. Various types of sustained-release materials have been established and are well known to those skilled in the art. Sustained-release capsules can release compounds for several weeks to up to 100 days, depending on their chemical properties. Further strategies for stabilizing proteins or other active ingredients may be employed, depending on the chemical properties and biological stability of the therapeutic agent.

[0200] Immunogenic compositions may also contain suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars, starch, cellulose derivatives, gelatin, and polymers such as polyethylene glycol. Many active ingredients of the present invention can be provided as salts of counterions with immunogenic compatibility. Such immunogenically acceptable base addition salts are those that retain the biological efficacy and properties of the free acid and are obtained by reaction with inorganic or organic bases such as sodium hydroxide, magnesium hydroxide, ammonia, trialkylamines, dialkylamines, monoalkylamines, diamino acids, sodium acetate, potassium benzoate, triethanolamine, etc.

[0201] The immunogenic compositions of the present invention may be in the form of a complex of the protein or other active ingredient of the present invention together with a protein or peptide antigen.

[0202] The immunogenic compositions and vaccines described herein may also be multivalent immunogenic compositions that further contain additional polypeptides from other viruses or nucleic acid sequences encoding additional polypeptides.

[0203] The immunogenic compositions and vaccines described herein may also be multivalent immunogenic compositions that further contain additional polypeptide fragments from other viruses or nucleic acid sequences encoding additional polypeptide fragments.

[0204] The immunogenic compositions and vaccines described herein may also be multivalent immunogenic compositions that also contain additional viruses (e.g., attenuated, killed, or otherwise inactivated viruses) or encode nucleic acid sequences of additional viruses (e.g., attenuated, killed, or otherwise inactivated viruses).

[0205] The immunogenic compositions and vaccines described herein may also contain fusion proteins, or nucleic acids encoding fusion proteins comprising a TiLV polypeptide or a fragment or variant thereof and at least one polypeptide or polypeptide fragment or variant from another virus.

[0206] Other viral peptides and nucleic acid sequences applicable to the immunogenic compositions described herein are discussed in Tucker et al. (2000) "Assessment of DNA vaccine potential for juvenile Japanese flounder Paralichthys olivaceus, through the introduction of reporter genes by particle bombardment and histopathology" Vaccine 19(7-8):801; Corbeil et al. (1999) "Evaluation of the protective immunogenicity of the N,P,M,NV,G proteins of infectious hematopoietic necrosis virus in rainbow trout Oncorhynchus mykiss using DNA vaccines" Dis. Aquat. Organ 39(1):29; Nusbaum et al. (2002) "Protective immunity induced by DNA vaccination of channel catfish with early and late transcripts of the channel catfish herpes virus (IHV-1)" Vet Immunol. Immunopathol. 84:151; Clark et al. (1992) "Developmental expression of surface antigen genes in the parasitic cil ate Ichtyophthirius multifiliis" Proc. Natl. Acad. Sci. 89(14):6363-6367; and Sato et al. (2000) "Expression of YAV proteins and vaccination a gainst viral ascites among cultured juvenile yellowtail" Biosci. Biochem. 64:1494. Multiple nucleic acid and amino acid sequences of fish pathogen antigens are known and available from the Genbank database or other sources.

[0207] Other additives suitable for immunogenic compositions and vaccine formulations are known and will be apparent to those skilled in the art.

[0208] In one aspect, animals can be vaccinated by directly injecting TiLV peptides, fragments thereof, or variants into them to elicit an immunogenic response. In some embodiments, the TiLV peptide itself can be injected, or an immunogenic TiLV composition containing other components, including, for example, excipients, additives, and adjuvants.

[0209] Inoculation can also be performed by direct inoculation of DNA encoding the TiLV polypeptide. When such vaccines are used, nucleic acids are administered to the animal, and the immunogenic polypeptide encoded by the nucleic acids is expressed in the animal, thereby generating an immune response against the protein or peptide in the animal. Subunit vaccines can also be protein vaccines, which contain the viral protein or subunit itself, or portions of those proteins or subunits. Any suitable plasmid or expression vector capable of driving polypeptide expression can be used. Plasmids and expression vectors may include promoters for directing transcription of nucleic acids. The nucleic acid sequence encoding the TiLV polypeptide can also be incorporated into a suitable recombinant virus for administration to animals. Examples of suitable viruses include, but are not limited to, vaccinia virus, retrovirus, adenovirus, and adeno-associated virus. Those skilled in the art will be able to select suitable plasmids, expression vectors, or recombinant viruses for delivering the TiLV nucleic acid sequence of the present invention. Direct inoculation of DNA encoding proteins has been successfully used for many different proteins (as reviewed, for example, in Donnelly et al. (1993), The Immunologist 2:20-26 (1993)).

[0210] Inoculation with the TiLV nucleic acid and polypeptide described herein can also be performed using a live recombinant vector capable of expressing the polypeptide described herein. A live recombinant vector is a microorganism or virus in which additional genetic information, such as a nucleic acid sequence encoding a TiLV polypeptide or a fragment thereof, has been cloned. Fish infected with such a live recombinant vector will produce an immune response not only against the immunogen of the vector, but also against the TiLV polypeptide or a fragment of the TiLV polypeptide.

[0211] Alternatively, passive inoculation can be performed by generating TiLV antibodies in an antibody-producing cell line in a first animal species (e.g., rabbit) or by in vitro techniques, followed by administration of such antibodies (in purified or unpurified form) to a second animal species. This type of passive inoculation can be used when the second animal is already infected with TiLV. In some cases, passive inoculation can be useful where the infection in the second animal has not yet provided sufficient time to generate an immune response.

[0212] Many inoculation methods for fish are known in the art. For example, the TiLV nucleic acids and peptides described herein can be inoculated into fish by injection, immersion, soaking, or oral administration. Administration protocols can be optimized according to standard inoculation practices.

[0213] For oral administration of tilapia, the TiLV nucleic acid, peptide, or immunogenic composition described herein can be mixed with feed, applied to feed, or administered in capsule form. In some embodiments, administration can be performed by incubating fresh feed in a TiLV vaccine suspension before feeding the animal (e.g., tilapia), thereby causing the ingestion of the fresh feed to result in the accumulation of the TiLV vaccine in the digestive tract of the vaccinated animal. Those skilled in the art will recognize that these methods of administration can expose the antigen to potential degradation or denaturation, and therefore those skilled in the art will ensure that the administration method is appropriate for the selected antigen. In the case of oral administration, the vaccine can also be mixed with one or more carriers. Carriers suitable for oral administration include metabolizable and non-metabolizable substances.

[0214] Tilapia can also be vaccinated via immersion. The skin and gill epithelium of fish have mucosal surfaces that facilitate pathogen recognition by adsorbing antigens. Adsorption subsequently leads to the activation of antibody-producing cells as part of an immune response. Therefore, in one embodiment, fish can be vaccinated with the peptides described herein by immersing the fish in water containing a TiLV vaccine composition. At least two types of immersion vaccination can be used with the peptides described herein. In immersion vaccination, the fish is immersed for a short time (e.g., about 30 seconds) in a concentrated vaccine solution (e.g., 1 part vaccine, 9 parts water). In bath vaccination, immersion occurs in water containing a lower concentration of vaccine for a longer period (e.g., several hours). Those skilled in the art will be able to readily determine the dilution of TiLV vaccine sufficient to induce an immune response in the immersion regimen and the duration of immersion.

[0215] Another method for inoculating tilapia with the TiLV nucleic acid and peptide described herein is by injection. In injection, the vaccine is injected into the abdominal cavity of the fish. Although the correct injection site can be readily determined by those skilled in the art, the commonly used needle insertion site for tilapia is the midline of the abdomen, one pelvic fin length anterior to the base of the pelvic fin. In some embodiments, the TiLV nucleic acid, peptide, or immunogenic composition may be delivered into the fish's body cavity in an oil emulsion or other adjuvants or additives that enhance and / or prolong the immune response. In addition to intraperitoneal injection, injection can also be performed by intramuscular injection. Those skilled in the art will appreciate that improper handling and needle insertion can lead to the death of the fish, and therefore mild anesthesia may be used during inoculation to reduce stress and mechanical damage to the animal. Those skilled in the art will also appreciate that needles of appropriate length and thickness can be important to ensure proper inoculation while avoiding secondary complications due to infection, inflammation, or tissue damage.

[0216] The TiLV nucleic acid, peptide, or immunogenic compositions described herein can be delivered from pressurized packaging or nebulizers in the form of aerosol sprays, using suitable propellants such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gases. In the case of pressurized aerosols, the dosage unit can be determined by providing a valve for delivering a metering amount. Capsules and cartridges can be formulated into powder mixtures containing the compound and suitable powder bases such as lactose or starch.

[0217] The TiLV nucleic acid, peptide, or immunogenic composition described herein can be administered at any immunogenically effective amount sufficient to trigger an immune response in animals. In some cases, this amount may range from about 0.01 to about 1000 micrograms of TiLV nucleic acid, peptide, or immunogenic composition per animal.

[0218] The compositions of the present invention can be administered to animals or humans in an “immunely effective amount.” As used herein, the term “immunely effective amount” refers to an amount capable of inducing a desired immune response or enhancing the induction of a desired immune response in animals or humans. A desired response may, in particular, include the induction of an antibody- or cell-mediated immune response, or both. A desired response may also be the induction of an immune response sufficient to improve symptoms of TiLV-related disease and / or to provide protective immunity against TiLV in animals or humans following subsequent stimulation. An immunely effective amount may be an amount that induces actual “protection” against TiLV-related disease, meaning an amount that prevents any symptoms or symptom caused by TiLV-related disease in animals or humans. An immunely effective amount may also be an amount sufficient to delay the onset of symptoms and symptom associated with infection, reduce the degree or speed of infection, reduce the severity of any disease or symptom caused by infection, and reduce the viral load in infected animals or humans.

[0219] Those skilled in the art can readily determine what constitutes the "immunely effective dose" of the compositions of the present invention without any excessive experimentation. The effective dose can be determined by conventional means, starting with a low dose and then gradually increasing the dose while monitoring the immunizing effect. In determining the optimal dosage, various factors can be considered, including the size, age, and general condition of the animal, the presence of other drugs in the animal's body, and the toxicity of the specific TiLV to which the animal was vaccinated. The actual dosage can be selected after considering the results from various animal studies.

[0220] The immunogenic composition can be administered in a single dose, in fractions, or using a "primer-booster" regimen. The composition can be administered via any suitable route, including but not limited to parenteral, intradermal, transdermal, subcutaneous, intramuscular, intravenous, intraperitoneal, intranasal, oral, or intraocular routes, or a combination of multiple routes. The composition can also be administered using a "gun" device that fires particles, such as gold particles, onto which the composition of the invention has been coated, into the skin of an animal. Those skilled in the art will be able to formulate the immunogenic composition according to the chosen route.

[0221] The dosage of the immunogenic compositions described herein can range from about 0.1 to 2.0 ml, depending on the route of administration, but is not limited to this range. For inactivated TiLV, the composition may contain a suitable viral TCID prior to inactivation. 50 The antigen content in the TiLV formulation may have, but is not limited to, a titer of 10 to 10,000 units / ml, as the amount administered per dose. Those skilled in the art will be able to readily determine the appropriate antigen content for the immunogenic compositions described herein.

[0222] For immunogenic compositions containing modified live or attenuated TiLV, the therapeutically effective dose can be determined by those skilled in the art. For immunogenic compositions containing TiLV subunit antigens, the therapeutically effective dose can be determined by those skilled in the art. Furthermore, the amount and concentration of adjuvants and additives applicable in the context of this invention can be readily determined by those skilled in the art.

[0223] Including TiLV cells and their uses

[0224] TiLV can be used to infect cells. Cells can be cultured in any available medium and in any permissible cell or tissue, which may or may be derived from fish cells, including but not limited to tilapia cells, CHSE-214 salmon (Oncorhynchus tshawytscha) cells, BF-2 bluegill sunfish (Lepomis macrocturus) cells, BB spotted catfish (Ictalurus nebulosus) cells, EPC carp (Cyprinus carpio) cells, KF-1 carp cells, RTG-2 rainbow trout (Salmo gairdneri) cells, FHM blackhead goby (Pimephales promelas) cells, and E-11 snakehead (Ophicephalus striatus) cells. As used herein, cells or tissues may include, but are not limited to, individual cells, tissues, organs, insect cells, rodent cells, avian cells, mammalian cells, hybridoma cells, primary cells, continuous cell lines, and / or genetically engineered cells. Cell lines suitable for propagation, growth, or carrying TiLV nucleic acid sequences, or suitable for expressing peptides derived from TiLV nucleic acid sequences, include tilapia cells, CHSE-214 salmon cells, BF-2 bluegill sunfish cells, BB spotted catfish cells, EPC carp cells, KF-1 carp cells, RTG-2 rainbow trout cells, FHM blackhead catfish cells, and E-11 snakehead cells, as well as non-fish cells, but not limited to dog kidney cells, BSC-1 cells, LLC-MK cells, CV-1 cells, and CHO cells. Cells, COS cells, mouse cells, human cells, HeLa cells, 293 cells, VERO cells, MDBK cells, MDCK cells, MDOK cells, CRFK cells, RAF cells, TCMK cells, LLC-PK cells, PK15 cells, WI-38 cells, MRC-5 cells, T-FLY cells, BHK cells, SP2 / 0 cells, NSO, PerC6 (human retinal cells), chicken embryonic cells or derivatives, embryonic oocytes, embryonic chicken eggs or derivatives thereof.

[0225] Cell culture medium formulations suitable for culturing cells infected with the TiLV virus described herein include, but are not limited to, Modified Eagle's Media (MEM), Minimal Essential Media (MEM), Dulbecco's Modified Eagle's Media (D-MEM), D-MEM-F12, William's E Media, RPMI, HyClone Cell Culture Medium (HyClone, Logan, Utah), and serum-free basal epithelial medium (CellnTech), as well as analogues and derivatives thereof. These may also be specialized cell culture and virus growth media such as VP-SFM, OptiPro™ SFM, AIM VR, HyQSFM4MegaVir, EX-CELL Vero SFM, EPISERF, ProVero, any 293 or CHO medium, as well as analogues and derivatives thereof. The culture media described herein may be supplemented with any additives known in the art suitable for cell and virus culture, such as, for example, animal serum and its fractions or analogues, amino acids, growth factors, hormones, buffers, trace elements, trypsin, sodium pyruvate, vitamins, L-glutamine, and biological buffers. One culture medium is OptiPRO SFM supplemented with L-glutamine and trypsin. In some embodiments, the cell culture medium may be supplemented with 0.1 to 10 units of trypsin. Alternatively, plant-derived trypsin equivalents (e.g., Accutase) in the range of 2-100 units may also be used in cell culture. The cell culture medium may be used with or without animal-derived components. An example of supplementation with animal-derived components is γ-irradiated serum in the range of 0.5-10% final concentration.

[0226] Expression vectors can be introduced into cells to produce proteins encoded by nucleotide sequences of the present invention (e.g., any one of SEQ ID NO:1-11 and fragments and variants thereof described herein). Cells can carry expression vectors by introducing them into suitable host cells using methods known in the art.

[0227] Expression vectors can be introduced into cells to produce proteins encoded by the nucleotide sequences of the present invention (e.g., any of SEQ ID NO:1-11 described herein or sequences complementary to any of SEQ ID NO:1-11 and their fragments and variants). Cells can carry expression vectors by introducing them into suitable host cells using methods known in the art.

[0228] Cells can be transfected using eukaryotic expression vectors to produce proteins described herein (e.g., proteins encoded by the nucleotide sequence of the vector, such as SEQ ID NO:12 or proteins encoded by SEQ ID NO:1-11) as well as their fragments and variants.

[0229] Exogenous nucleic acids (e.g., any of SEQ ID NO:1-11, cDNA of any of SEQ ID NO:1-11, or cDNA complementary to any of SEQ ID NO:1-11, its fragments, or variants) can be introduced into cells using a variety of techniques known in the art.

[0230] Eukaryotic expression vectors can be used to transfect cells to produce proteins encoded by nucleotide sequences (e.g., cDNA of any one of SEQ ID NO: 1-11, any one of SEQ ID NO: 1-11, or cDNA complementary to any one of SEQ ID NO: 1-11, a fragment thereof, or a variant thereof). Mammalian cells can carry expression vectors by introducing them into suitable host cells using methods known in the art.

[0231] Exogenous nucleic acids can be introduced into cells using a variety of techniques known in the art, such as lipid transfection, microinjection, calcium phosphate or calcium chloride precipitation, DEAE-dextrin-mediated transfection, or electroporation. Other methods for transfecting cells may include calcium phosphate precipitation, modified calcium phosphate precipitation, polybrene precipitation, microinjection liposome fusion, and receptor-mediated gene delivery. Expression vectors may contain a coding sequence or a portion thereof encoding the protein to be expressed and produced. Expression vectors containing sequences encoding the produced protein and polypeptide, as well as appropriate transcriptional and translational control elements, can be produced using methods well known and practiced by those skilled in the art. These methods include synthetic techniques, in vitro recombinant DNA techniques, and in vivo gene recombination, as described in Sambrook et al. and Ausubel et al.

[0232] Cells transfected with TiLV or its nucleic acids (e.g., any one of SEQ ID NO:1-11, cDNA of any one of SEQ ID NO:1-11, or cDNA complementary to any one of SEQ ID NO:1-11, its fragments, or variants) can be primary and subcultured cells, which can be obtained from various tissues and include cell types that can be maintained and proliferated in culture.

[0233] Cells maintained in the culture can be passaged by transferring them from a previous culture to a culture with fresh medium. In one embodiment, the induced epithelial cells are stably maintained in the cell culture for at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, or 30 passages.

[0234] In one embodiment, cells infected with TiLV or containing its nucleic acid (e.g., any of SEQ ID NO:1-11, cDNA of any of SEQ ID NO:1-11, or cDNA complementary to any of SEQ ID NO:1-11, its fragments, or variants) may express a variety of markers that distinguish them from uninfected cells. The expression of these markers can be evaluated using a variety of methods known in the art. The presence of the markers can be determined at the DNA, RNA, or peptide level.

[0235] In one embodiment, the method may include detecting the presence of marker gene peptide expression. Peptide expression includes the presence of a marker gene peptide sequence or the presence of a marker gene peptide in an elevated amount compared to non-epithelial cells. These can be detected by a variety of techniques known in the art, including sequencing and / or binding to specific ligands (such as antibodies). For example, peptide expression can be evaluated by methods including, but not limited to, immunostaining, FACS analysis, or proteoblotting. These methods are well known in the art.

[0236] In another embodiment, the method may include detecting the presence of nucleic acids (e.g., any one of SEQ ID NO:1-11, cDNA of any one of SEQ ID NO:1-11, or cDNA complementary to any one of SEQ ID NO:1-11, its fragments, or variants). RNA expression includes the presence of an RNA sequence, the presence of RNA splicing or processing, or the presence of a certain amount of RNA. These can be detected by various techniques known in the art, including sequencing all or part of the marker gene RNA, or by selective hybridization or selective amplification of all or part of the RNA. In one embodiment, in situ hybridization may be used to detect TiLV nucleic acids.

[0237] The resulting transformed cells can be used for basic research and testing of therapeutics and preventative agents. Specifically, for the latter, host cells can be incubated and / or contacted with the potential therapeutic or preventative agent. The resulting expression of the gene construct can be detected and compared with the expression of the gene construct in the cells before contact with the reagent.

[0238] These gene constructs, and the host cells transformed with them, can also serve as the basis for testing transgenic animals as research tools and for testing therapeutics and preventative agents. Such animals will include, but are not limited to, nude mice and fish. Phenotypes can be associated with genes and observed to determine the genetic effects and phenotypic changes in animals following administration or exposure to potential therapeutic agents.

[0239] Another embodiment of the present invention is a method and / or assay for screening and / or identifying test reagents for the prevention and / or treatment of TiLV, comprising contacting or incubating the test reagent with or together with nucleotides constituting a nucleic acid sequence as described herein SEQ ID NO:1-11 or a fragment or variant thereof, and determining whether the test reagent binds to the nucleotides, wherein if the test reagent binds to the nucleotides, then the test reagent is identified as a treatment and / or preventive agent for TiLV.

[0240] Another embodiment of the present invention is a method and / or assay for screening and / or identifying test reagents for the prevention and / or treatment of TiLV, comprising contacting or incubating the test reagent with or together with nucleotides constituting a nucleic acid sequence as described herein SEQ ID NO:1-11 or a fragment or variant thereof, and detecting the expression of nucleotides before and after contacting or incubating with the test reagent, wherein if the expression of nucleotides decreases after contacting or incubating with the test reagent, then the test reagent is identified as a treatment and / or preventive agent for TiLV.

[0241] Another embodiment of the present invention is a method and / or assay for screening and / or identifying test reagents for the prevention and / or treatment of TiLV, comprising contacting or incubating together a gene construct containing nucleotides constituting a nucleic acid sequence as described herein SEQ ID NO:1-11 or a fragment or variant thereof, and detecting the expression of nucleotides in the gene construct before and after contacting or incubating the test reagent with the gene construct, wherein if the expression of the gene is reduced or decreased after contact with the test reagent or compound, then the test reagent is identified as a therapeutic and / or preventive agent for TiLV.

[0242] Another embodiment of the present invention is a method and / or assay for screening and / or identifying test reagents for the prevention and / or treatment of TiLV, comprising transforming host cells with a gene construct containing nucleotides constituting a nucleic acid sequence as described herein SEQ ID NO:1-11 or a fragment or variant thereof; detecting the expression of nucleotides in the host cells; contacting the test reagent with the host cells; and detecting the expression of nucleotides in the host cells after contact with the test reagent or compound, wherein if the expression of nucleotides is reduced or decreased after contact with the test reagent or compound, then the test reagent is identified as a therapeutic and / or preventive agent for TiLV.

[0243] Nucleotide or gene expression can be determined using measurable phenotypes that are natural or artificially associated with the gene (such as reporter genes).

[0244] Another embodiment is a method and / or assay for screening and / or identifying a test reagent for the prevention and / or treatment of TiLV, comprising contacting or incubating the test reagent with or together with a polypeptide encoded by the nucleotide sequence of SEQ ID NO:1-11 or a fragment or variant thereof, and detecting the presence of a complex between the test reagent and the polypeptide, wherein if a complex between the test reagent and the polypeptide is detected, then the test reagent is identified as a preventive and / or therapeutic agent for TiLV.

[0245] Another embodiment is a method and / or assay for screening and / or identifying a test reagent for the prevention and / or treatment of TiLV, comprising contacting or incubating the test reagent with or together with a polypeptide encoded by a nucleotide sequence of SEQ ID NO:1-11 or a fragment or variant thereof and a known ligand of the polypeptide, and detecting the presence of a complex between the test reagent and the ligand, wherein if a complex between the test reagent and the ligand is detected, then the test reagent is identified as a preventive and / or therapeutic agent for TiLV.

[0246] Another embodiment of the present invention is a method and / or assay for screening and / or identifying a test reagent for the prevention and / or treatment of TiLV, comprising contacting or incubating the test reagent with or together with a polypeptide encoded by a nucleotide sequence of SEQ ID NO:1-11 or a fragment or variant thereof and a known antibody of the polypeptide, and detecting the presence and amount of unbound antibody, wherein the presence of unbound antibody indicates that the test reagent binds to the polypeptide, and the test reagent is identified as a preventive and / or therapeutic agent for TiLV.

[0247] High-throughput screening can also be used to screen test reagents. Small peptides or molecules can be synthesized and bound to a surface, contacted with the polypeptide, and then washed. The bound peptides are then visualized and detected using methods known in the art.

[0248] This invention also provides peptides for rational drug design, wherein structural analogs of bioactive peptides can be designed. Such analogs will interfere with the peptide in vivo, such as through nonproductive binding to a target. In this method, the three-dimensional structure of the protein is determined by any method known in the art, including but not limited to X-ray crystallography and computer modeling. Information may also be obtained using the structures of homologous proteins or target-specific antibodies.

[0249] Using these techniques, it is possible to design reagents that act as inhibitors or antagonists of peptides, or as decoys that nonproductively bind to target molecules and block the binding of active peptides.

[0250] As used herein, the term "agent" refers to a substance that produces or is capable of producing an effect and includes, but is not limited to, chemicals, pharmaceuticals, biological agents, small organic molecules, antibodies, nucleic acids, peptides, and proteins.

[0251] Example

[0252] The invention can be understood by referring to the following non-limiting embodiments, which are given to more fully illustrate preferred embodiments of the invention. These should in no way be construed as limiting the broad scope of the invention.

[0253] Example 1 - Materials and methods used in Examples 2-9

[0254] Cell culture:Eight established fish cell lines were used in this study: (1) CHSE-214 (ATCC CRL 1681) from Chinook salmon (Oncorhynchus tshawytscha); (2) BF-2 (ATCC CCL 91) from bluegill (Lepomis micropterus); (3) BB (ATCC CCL 59) from brownbullhead (Ictalurus nebulosus); (4) and (5) EPC (ATCC CRL 2872 and KF-1) from common carp (C. carpio); (6) RTG-2 (ATCC CCL 55) from rainbow trout (Salmogairdneri); and (7) from fathead... FHM (ATCC CCL 42) from minnow (Pimephalespromelas); and E-11 from striped snakehead (Ophicephalusstriatus) (M. Ucko, Israel Oceanographic and Limnological Research). In addition, cultures of primary tilapia brain cells were prepared as previously described in Hasegawa et al. 1997 and Hedrick et al. 2000. Briefly, commercial Nile tilapia (O. niloticus) (50 g) were euthanized by an overdose of an anesthetic (600 mg / L tricaine mesylate [MS-222]; Finquel, USA), and the brains were aseptically removed. The chopped brains were manually homogenized and passed through a 100 μm sieve grinder. Cells were then washed and seeded at 25°C in 12.5-ml sealed flasks (Becton-Dickinson, San Francisco, CA, USA). The initial culture medium consisted of 80% Leibovitz (L-15) medium (Gibco, USA), 10% inactivated fetal bovine serum (FCS) (Gibco), and 10% inactivated tilapia serum medium; supplemented with L-glutamine (300 mg / L), HEPES (1%), and penicillin. Streptomycin and amphotericin B

[0255] During the first 21 days of incubation, 50% of the culture medium was replaced weekly. Thereafter, the monolayers were treated with trypsin and transferred to new 25-ml flasks (Cellstar; Greiner Bio-One, Germany) containing a 1:1 mixture of conditioned medium (from the old culture) and fresh medium. Primary cell cultures were passaged every week. After 35 passages, tilapia serum and conditioned medium were omitted, and cells were separated every 2 to 3 weeks (at a 1:2 ratio) into standard medium (L-15 with 5% inactivated FCS).

[0256] Viruses and virus cultureA total of 25 TiLV isolates were collected from suspected disease outbreaks occurring between May 2011 and June 2013. Isolations were obtained from all areas of Israel with commercially farmed fish: the Mediterranean coast (2 isolates); the Jordan Valley (including the Bet-Shean Valley and the Yizrael Valley; 9 isolates); and Upper and Lower Galilee (3 isolates). Additionally, 11 isolates were obtained from various species of wild tilapia from the Sea of ​​Galilee. Outbreaks in farmed fish were defined as a sudden and unexplained increase in mortality (2% or higher per day) lasting at least three consecutive days. If two wards in the same farm were affected simultaneously, these were classified as single disease outbreaks. Therefore, each isolate represents a different clinical disease outbreak. Viruses from wild fish exhibiting ocular lesions were isolated from commercial catches in the Sea of ​​Galilee; each isolate represents a different catch. Fish weighing 20–200 g or 40–350 g (wild and farmed, respectively) were collected during the hot season (May to October, water temperatures between 22 and 32°C). To minimize the risk of contamination, the brains and viscera (kidneys, liver, spleen, and heart) of suspected fish were aseptically removed, pooled, and manually homogenized with 9 volumes of Hanks' balanced salt solution (HBSS). The mixture was centrifuged at 3,000 x g for 10 minutes, and the supernatant was filtered through a 0.22 μL filter (Sarstedt, Germany). The filtrate was stored at -80°C until use. For infection, the monolayer (approximately 90% confluence) was washed twice with HBSS, and after washing the cells with HBSS, it was incubated at 25°C with 500 μL of virus filtrate for 1 hour, supplemented with L-15 medium (2% FCS), and incubated at 25°C. The cytopathic effect (CPE) of the culture was observed daily for 21 days. In the experiment reproducing tilapia disease through viral infection, a virus named TiLVx2 was used, which was purified by two rounds of consecutive endpoint dilution assays. This was performed using E-11 cultures infected with consecutive dilutions of TiLV (isolate 4 / 2011; obtained from the brain of a diseased St. Peter's fish collected from Lake Kineret in June 2011).

[0257] Virus titration:The original virus-containing culture supernatant (isolate 4 / 2011) was cultured in E-11 cells and serially diluted with HBSS in 10-fold increments. 50 μl from each dilution was seeded onto an E-11 monolayer in 96-well plates. Each diluted sample was used in four wells. The plates were incubated at 25°C, and CPE was observed daily. After 7 days, the 50% tissue culture infection dose (TCID) was calculated using the method of Reed and Muench 1938. 50 (ml) -1 ).

[0258] Electron microscopy analysis: For TiLV examination by transmission electron microscopy, E-11 infected cultures were scraped from flasks, centrifuged (2,000 rpm, 7 min), fixed for 2 h with 1.5% glutaraldehyde in 0.1 M sodium dimethylarsinate (pH 7.2), and then washed five times in phosphate buffer (pH 7.2). The pellet consisting of infected E-11 cells was post-fixed in 1% OsO4 in phosphate buffer and dehydrated with gradually increasing concentrations of ethanol. The pellet was then washed twice with 100% propylene oxide and treated with propylene oxide-Epon (3:1) for 30 min, followed by treatment with propylene oxide-Epon (1:1) for 15 min. Finally, the pellet was embedded in 100% Epon and kept overnight. Thin sections (70 to 90 nm) were placed on a copper grid coated with Formvar and stained with uranyl acetate followed by lead citrate according to the Reynolds method (Reynolds 1963). All photomicrographs were obtained using a JEOL 1200-EX electron microscope (Electron Microscopy [EM] Unit, Institute of Biotechnology, Bar-Ilan University, Israel) operated at 60 or 80 kV. EM analysis of negatively stained viral pellets was performed at the EM Unit, Tel Aviv University, using a JEM 1200-EX transmission electron microscope (JEOL-USA, Peabody, MA, USA), exactly as previously described in Oberpichler et al. 2008. The viral pellets used for this analysis were precipitated by ultracentrifugation in 25% sucrose buffer.

[0259] Virus from culture supernatant was purified using sucrose gradient fractionation:Cultured E-11 cells were infected with TiLV (isolate 4 / 2011), and the culture supernatant was removed from cell debris by centrifugation (10 min, 3,000 rpm). The supernatant was separated into layers on 2 ml of 30% (w / v) sucrose-Tris-EDTA (TE) buffer and centrifuged at 65,000 rpm (Sorvall Discovery 90SE) for 2 h in a T865 rotor. The pellet was resuspended in TE buffer and separated into layers on a sucrose stepwise gradient (Bacharach et al. 2000; Laham and Bacharach 2007; Melamed et al. 2004). The gradient consisted of 3 ml layers with sucrose concentrations from bottom to top of 70, 60, 50, 40, 30, 20, and 10% (w / v) in TE. The layers were then ultracentrifuged at 40,000 rpm for 2 h in a TST41.14 rotor (Sorvall Discovery 90SE). One milliliter aliquot was taken from the top of the gradient, and the viral cells from each fraction were pelleted by ultracentrifugation (65,000 rpm for 2 hours; T865 rotor; Sorvall Discovery 90SE) and resuspended in 1 ml of TE buffer. 100 μl aliquots from each sample were incubated with E-11 cells used for the first time in the experiment to monitor CPE. Incubation of the culture with an aliquot from a fraction having the same sucrose gradient but without the addition of culture supernatant did not induce CPE.

[0260] Nucleic acid and cDNA were isolated and synthesized from purified virions:Nucleic acid was extracted from the purified virion pellet using the peqGOLD Trifast kit for RNA (Peqlab, Germany) or the High Pure PCR template preparation kit for DNA (Roche, Germany). Reverse transcription was performed using the Verso cDNA kit (Thermo, Lithuania) according to the manufacturer's instructions. To identify TiLV-specific sequences, the supernatant of TiLV (isolate 4 / 2011)-infected E-11 cultures was removed from cell debris by centrifugation (3,000 x g for 10 min), and the purified supernatant was further purified by ultracentrifugation (65,000 rpm for 2 h in a T865 rotor [Sorvall Discovery 90SE]) with 30% sucrose buffer. The pellet was resuspended in TE buffer and the virions were further purified by 40–70% (w / v) sucrose buffer. Following ultracentrifugation (TST41.14 rotor, 40,000 rpm for 2 hours; Sorvall Discovery 90SE), a 40% sucrose fraction was collected, and the virions were precipitated by further ultracentrifugation (TST41.1 rotor, 40,000 rpm for 2 hours; Sorvall Discovery 90SE). RNA was extracted from the precipitate using guanidine thiocyanate (peqGOLD Trifast; Peqlab). Using the purified RNA as a template, cDNA was generated by reverse transcription and random primers. Fragments of this cDNA were isolated by shotgun cloning (Nehls and Boehm 1995).

[0261] Shotgun cloning using random primersShotgun cloning was performed as described by Nehls and Boehm. Purified cDNA (approximately 10 ng) was bidirectionally guided using the MluI(N)6 primer (GGAACTCAATGCACGCGTNNNNNN) (SEQ ID NO: 13) with ReddyMix PCR master mix (Thermo, Lithuania). The guided product was amplified by PCR using the MluI primer (GGAACTCAATG CACGCGT) (SEQ ID NO: 14) and cloned into the pJET1.2 / blunt-end vector (CloneJET; Fermentas / Thermo, Lithuania), which was transformed into Escherichia coli strain HIT-DH5α cells (Real Biotech, Taiwan). Ampicillin-resistant transformants grown at 37°C on LB agar plates containing 100 μg / ml ampicillin were picked and incubated overnight in 5 ml LB agar supplemented with 100 μg / ml ampicillin. Plasmid DNA was isolated using the HiYield Plasmid Mini Kit (RBC, Taiwan). Insert fragments were amplified by PCR using primers derived from pJET1.2, separated by electrophoresis on a 1.0% gel in 1X Tris-acetate-EDTA (TAE) buffer at 80V for 1.5 hours, stained with ethidium bromide, excised, and purified by gel extraction using the GeneJET gel extraction and DNA cleanup microkit (Thermo, Lithuania). Individual fragments were sequenced by Hy Laboratories (Israel) using an ABI 3730. Homology of sequences with nucleotide sequences in the GenBank database was analyzed using Basic Local Alignment Search Tool (BLASTn) and Vector NTI 6 (InforMax, Inc.) software. Further searches of protein databases were performed using BLASTx. PCR amplification targeting the TiLV genome tested internal primers from each sequenced clone. Primers derived from clone 7450 specifically amplified homologous sequences from cultures infected with TiLV in reverse transcription PCR (RT-PCR).

[0262] Rapid amplification of cDNA ends (RACE):To extend the sequence of clone 7450 obtained by shotgun cloning, rapid 3' and 5' amplification (RACE) reactions were performed on the cDNA ends using total RNA extracted from TiLV-infected E11 cells using EZ-RNA reagent (Biological Industries), as previously described (Scotto-Lavino et al. 2006a; Scott-Lavino et al. 2006b). Briefly, for 3' RACE, primer Q was used. T (CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTTVN) (SEQ ID NO:15) and the SuperScript III first-strand synthesis system for RT-PCR (catalog number 18080-051; Invitrogen) were used to generate cDNA according to the manufacturer's instructions. Cloning primers 7450 / 150R (TATCACGTGCGTACTCGTTCAGT) (SEQ ID NO:16), derived from the internal sequence of the shotgun fragment, and primers Q0 (CCAGTGAGCAGAGTGACG, (SEQ ID NO:17), derived from Q...) were used. T Primers were used to amplify cDNA using Ex-Taq enzyme (catalog number RR001A; TaKaRa). The resulting PCR product was diluted 1:20 and amplified using nested primers Q. I (GAGGACTCGAGCTCAAGC(SEQ ID NO:18), originating from Q) T The primers were used to perform a second PCR with E11-inf-R (AAGTTCTCTTGCCTCTTGG (SEQ ID NO:19), a sequence derived from a shotgun fragment). For 5' RACE, the same procedure was followed, but cDNA was generated using primer clone 7450 / 150F (CACCCAGACTTGCGGACATA) (SEQ ID NO:20). Poly(A) tails were added to the cDNA using a terminal transferase (catalog number 3333566; Roche) according to the manufacturer's instructions. Primers E-11-inf-F (TCCAAGGAAACAGCTGAGC (SEQ ID NO:21), a sequence derived from a shotgun fragment), along with Q0 and Q11-inf-R, were used. T The primer mixture was used to amplify tailed cDNA by PCR. The resulting PCR product was diluted 1:20 and used E11-inf-F-in(GAGGCAATATGGATTCTTCG) (SEQ ID NO:22) and Q I Primers were used to enable a second nested PCR.

[0263] RT-PCR: Samples from the brain, heart, head kidney, spleen, and liver were obtained from suspected TiLV outbreak clinical cases, pooled, and directly frozen at -80°C. Total RNA was purified using peqGOLD Trifast (Peqlab, Germany) according to the manufacturer's instructions, followed by reverse transcription and amplification (Verso 1-step RT-PCR ReddyMix kit; Thermo, Lithuania). The kit's random primers were replaced with external specific primers ME1 (GTTGGGCACAAGGCATCCTA) (SEQ ID NO:23) and clone 7450 / 150R (TATCACGTGCGTACTCGTTCAGT) (SEQ ID NO:16). The following cycles were performed: 50°C for 15 minutes (reverse transcription); 95°C for 2 minutes (enzyme inactivation); and 35 cycles of 95°C for 30 seconds, 56°C for 60 seconds, and 72°C for 60 seconds; the reaction was terminated by holding at 72°C for 7 minutes. PCR products were isolated on a 1% agarose gel in 0.5X TAE buffer (40 mM Tris-acetate and 1 mM EDTA).

[0264] Nuclease sensitivity assay:Collect 9 ml of supernatant from TiLV-infected E-11 cultures and purify and precipitate the virions using ultracentrifugation (107,000 X g, 4, for 2 h) with 25% (w / v) sucrose buffer. Supernatant from uninfected E-11 cultures was used as a control. To digest the free nucleic acids, the precipitate was resuspended in 300 μl of 1X DNase buffer (10 mM Tris-HCl [pH 7.5], 2.5 mM MgCl2, and 0.5 mM CaCl2) supplemented with 33 μg RNase A (Sigma R4642) and 1 U DNase (Baseline-ZERO DNase). The samples were incubated at room temperature for 40 min, after which each reaction mixture was diluted in 9 ml of Leibovitz (L-15) medium supplemented with 5% FCS, and the virions were precipitated as described above. To release nuclease-protected nucleic acids from the virus and digest any possible remnants of RNase A and DNase I, the precipitate was resuspended in 150 μl of proteinase K buffer (50 mM Tris-HCl [pH 7.5], 100 mM NaCl, 10 mM EDTA, 1% SDS) supplemented with 100 μg / ml proteinase K (Roche), and the proteins were digested at 37°C for 30 minutes. Nucleic acids were extracted by phenol-chloroform-isoamyl alcohol (CIP) and precipitated with ethanol, 0.3 M sodium acetate (pH 5.2), and glycogen as a carrier. The nucleic acid was resuspended in 20 μl of buffer (10 mM Tris-HCl [pH 8.3], 10 mM MgCl2, 1 mM dithiothreitol [DTT], 60 mM NaCl) and 3 μl was added to 100 μl of RNase I buffer (100 mM NaCl, 50 mM Tris-HCl [pH 7.9], 10 mM MgCl2, 1 mM DTT) with or without 50 units of RNase I (catalog number M0243S; NEB). Digestion was performed at 37°C for 5 minutes, and the nucleic acid was CIP extracted and precipitated as described above. The nucleic acid was resuspended in 20 μl of reverse transcription reaction mixture; a reaction solution without reverse transcriptase was also prepared to ensure the absence of protective DNA.cDNA was amplified using TiLV-specific primers (nested ext-1 [TATGCAGTACTTTCCCTGCC] (SEQ ID NO:24) and nested ext-2 [TTGCTCTGAGCAAGAGTACC] (SEQ ID NO:25)) or snakehead retrovirus (SnRV)-specific primers (snakehead gag-pol fw [CAGATCACTGATCGATGC] (SEQ ID NO:26) and snakehead gag-pol rev [GTCTGAAAGGTAAGGTGG] (SEQ ID NO:27)). The amplified products (491 bp for TiLV and 284 bp for SnRV) were separated by electrophoresis on a 1% agarose gel.

[0265] Sensitivity determination of ether and chloroform: The TiLV sensitivity of ethers and chloroform was determined as previously described (Crandell et al. 1975; Hutoran et al. 2005).

[0266] An experimental representation of disease and ethical issues: The Nile tilapia (Chitrellada strain) used in this study were grown in a specific pathogen-free (SPF) facility (UV-treated pathogen-free environment) at a constant temperature of 28°C. The fish were fed a daily regimen of 2% (w / w); water parameters (O2 > 5 ppm; NH4+ < 1 ppm, NaCl < 1 ppt) were kept constant. All experimental induction of infection was performed using TiLV's field isolate (isolate 4 / 2011, generation 2), which was aliquoted and frozen at -80°C. Before use, the virus was thawed and recultured (generation 3). For artificial re-enhancement of the disease, 2.6 x 10⁻⁶ ppm was used. 5 TCID 50 Intraperitoneal (ip) injection (Group 1) was administered to each fish (30 to 35 grams). All experimental groups (30 fish per group) were performed in triplicate. To prevent waterborne infection, each group of fish was placed in a separate 100-liter aquarium. During the co-culture experiment (Group 2), the 30 fish from each group were placed in a 200-liter aquarium divided into three compartments by a water-permeable mesh, allowing water to circulate throughout the aquarium (but not the fish); the control group remained in the middle at all times. Fish that survived the initial ip infection were pooled, and then, after 3 weeks, the fish were divided into two groups (15 fish per group) and reinfected via ip. The control group was injected with uninfected (first-time) E-11 culture.

[0267] For in vivo / in vitro experiments, brains of TiLV-infected fish were collected (5 to 7 days post-infection) and minced as described above. The homogenate (500 μl) was incubated with confluent E-11 culture. When CPE appeared, the supernatant was collected and injected intraperitoneally (200 μl) into fish used for the first time.

[0268] The health of the fish was carefully monitored throughout the growth and experimentation period; external signs and mortality were monitored twice daily for a total of 21 days. Animal care, experimental procedures, and safety regulations complied with the guidelines established by the Committee on Laboratory Animal Care at the Israeli Veterinary Services and were carried out under permit 020_b5471_6 issued by the Israel Committee for Animal Welfare.

[0269] Histological analysis Tissue samples were collected from euthanized, naturally infected fish via an abdominal incision and fixed in 10% neutral buffered formalin. The samples were embedded in paraffin (Paraplast Plus; Diapath) and cut into 5 μm serial sections using a microtome (Reichert-Jung 2050), stained with hematoxylin and eosin (H&E) 277 (Roberts et al. 2012), and examined under an optical microscope (Leica DMRB). Images were acquired using a Nikon digital light system.

[0270] Statistical analysis: Results of in vivo experiments are presented as a percentage of the mean mortality rate from three (or two, in the case of surviving fish) independent experiments. Each experiment consisted of three experimental groups, each with 30 fish (three independent replicates).

[0271] Experiments using surviving fish were conducted in duplicate (two independent replicates), with each group consisting of 20 fish. Differences between experiments (infection by direct intraperitoneal injection, infection by co-hospitalization, and control fish) were determined by chi-square test, with a p-value greater than 0.05 considered significant.

[0272] Culture preservation: TiLV (CNCM accession number I-4817) is deposited at the National Collection of Cultures and Microorganisms (CNCM) of the Pasteur Institute in Paris, France.

[0273] Nucleotide sequence accession number: The GenBank accession number for the extended sequence of clone 7450 is KJ605629 (SEQ ID NO:1).

[0274] Example 2 - Geographical distribution and characteristics of diseased tilapia from the Sea of ​​Galilee and commercial fishponds

[0275] Disease outbreaks have been detected in wild and commercial tilapia in the Sea of ​​Galilee and in commercial fishponds in Israel along the northern coast, Beit Shea, Izerle, the Jordan Valley, and in Upper and Lower Galilee. In commercial fishponds, the disease has caused mass mortality. Figure 1A Sampling of commercially caught fish from the Sea of ​​Galilee revealed that all tilapia species are susceptible to the disease, but no large-scale mortality was observed. In this case, affected fish exhibited obvious eye lesions. Figure 1B ).

[0276] Pathological findings include macroscopic lesions characterized primarily by ocular changes, including lens opacity (cataract). In advanced cases, lesions include a ruptured lens with lenticulitis-induced uveitis or endophthalmitis, accompanied by ciliary membrane formation, followed by swelling of the eyeball (hydroma), loss of spherical integrity with occasional corneal perforation and condensation of contents, and loss of ocular function (tabula). Figure 1B Other lesions include skin erosion (observed in fish raised in diseased ponds); Figure 1C ), meningeal hemorrhage, and moderate hemorrhage in the spleen and kidneys ( Figure 1D ).

[0277] Histological lesions of the brain include edema, focal hemorrhage in the pia mater, and capillary congestion in the white and gray matter. Figure 1 E). Lesions of glial cell proliferation and occasional vascular cuffs of lymphocytes were detected. Figure 1 F). Some neurons in the telencephalon, and specifically in the optic lobe, exhibit various levels of neuronal degeneration, including cytoplasmic thinning and vacuolation, and peripherally depressed nuclei (central chromatin dissolution).

[0278] The ocular lesions include a wavy, thin, and frequently curling and ruptured lens capsule surrounded by round fibrous proliferation and degeneration, with multiple adhesions to the iris and ciliary body (posterior synechiae), and a moderate number of eosinophilic cells and melanomatous macrophage centers or MMCs. Infiltration extends into the anterior chamber, iris, vitreous fluid, and choroid (endophthalmitis). Cataract changes are present within the lens, characterized by eosinophilic homogeneous spherical structures (Molgani bodies), significantly enlarged lens epithelial cells (capsule cells) with abundant eosinophilic microvacuolated cytoplasm, large pools of proteinaceous fluid (liquefied lens fibers), mineralization, and flattened, elongated cells (fibrosis). Figure 1 Ga, and Figure 1 Compared to a normal lens in Gb). The squamous epithelium of the cornea is frequently eroded and ulcerated and infiltrated by a moderate number of lymphocytes, macrophages, and eosinophils, with prominent features of stromal neovascularization and edema. Figure 1 H).

[0279] The liver parenchyma showed lesions of hepatocyte swelling and occasional random distribution, accompanied by granular accumulation of yellow to brown pigmented cytoplasm. Splenomegaly was present, with proliferating lymphocytes surrounding ellipsoids. Both the size and number of MMCs were increased in both the liver and spleen. MMCs are distinct clusters of pigment-loaded cells commonly found within the reticuloendothelial stroma of hematopoietic tissues. MMC proliferation is associated with late-stage chronic infection as a response to severe tissue damage in various infections (especially viruses) or adverse environmental conditions. Therefore, they are considered indicators of fish population health (Agius and Roberts 2003).

[0280] Example 3 - Isolation of pathogens from infected samples

[0281] To culture potential pathogens from diseased tilapia, organs of fish possessing the above-described characteristics were combined, homogenized, and incubated with eight different cell lines as described in Example 1. No known pathogens were identified, and only the established E-11 cell line and primary tilapia brain cells consistently exhibited CPE when incubated with the aforementioned homogenate. In E-11 cells, CPE became visible 5 to 7 days post-inoculation, accompanied by cytoplasmic vacuolation and plaque formation. Figure 2 A), which rapidly progresses to almost complete breakdown of the cell monolayer (9 to 10 days post-inoculation). CPE in primary tilapia brain cells is characterized by the transformation of typically elongated cells into swollen, round, and granular cells, which is clearly observed 10 to 12 days post-inoculation. Figure 2B), resulting in extensive monolayer detachment (days 14 to 19), but no plaque formation. Controlled mock-infected E-11 and primary tilapia brain cultures showed no CPE (respectively). Figure 2 C and 2D). When inoculating cultures used for the first experiment with supernatant of cultures having CPE (tested up to 18 generations) and when passing Similar results were observed when filtering the supernatant or the homogenate mentioned above. Furthermore, the number of plaques induced by the reagent was positively correlated with its dilution, resulting in a one-hit curve. A single infectious unit was therefore sufficient to produce a plaque. These results indicate that the CPE was caused by the presence of infectious agents such as viruses. The substance causing the CPE was recovered from 25 samples collected from all Israeli regions of farmed fish.

[0282] Example 4 - Morphological characteristics of virus-like particles

[0283] Further evidence of viral infection in the E-11 culture of CPE came from EM examination of thin sections of these cells as described in Example 1. This analysis revealed the presence of a membrane encapsulating the cells within the cytoplasm ( Figure 2 E) or encapsulated in the cytoplasm ( Figure 2 The presence of sparse, electron-dense particles (55 to 75 nm in diameter) in F) was observed. Such particles were not found in healthy control cell cultures. Notably, these particles did not originate from the blackfish retrovirus (SnRV) expressed in E-11, as this type C retrovirus assembles more extensively and is generated only at the plasma membrane. Furthermore, the SnRV virion is not visible via EM in this specific cell line (although the SnRV sequence can be amplified by PCR).

[0284] The precipitate purified from the supernatant of infected E-11 cultures by ultracentrifugation with 25% sucrose buffer was negatively stained and examined by EM. This analysis revealed that the viral body-like structure (approximately 75 to 80 nm) consisted of an easily detectable thick coating (…). Figure 2 G) Surrounding. These viral bodies are abundant and undetectable in control pellets prepared from E-11 cells used for the first time in the experiment.

[0285] Example 5 - Sensitivity of infectious agents to ether or chloroform

[0286] EM analysis in Example 4 showed that the infectious agent isolated from diseased tilapia was an enveloped virus. To verify this, the virions in the supernatant of E-11 infected cells were exposed to ether or chloroform, and the effect of these treatments on infectivity was measured as described in Example 1.

[0287] Table 1 summarizes the results of two replicates of the ether susceptibility assay and three replicates of the chloroform susceptibility assay. A decrease in infectivity of approximately three (chloroform) to five (ether) orders of magnitude was observed, confirming the substance's sensitivity to these solvents. This indicates that the infectious agent is indeed encapsulated by a lipid membrane.

[0288] Table 1. Sensitivity determination of ether and chloroform

[0289]

[0290] Example 6 - Initial Molecular Characteristics of Tilapia Virus

[0291] It has been confirmed that the infectious agent can be isolated from diseased fish and can be propagated in specific cell cultures (Example 3). This pathogen has been named TiLV, referring to the location where the pathogen was initially isolated.

[0292] To purify TiLV, TiLV-infected culture supernatants were fractionated using a rapid sucrose stepwise gradient ranging from 10% to 70%. CPE-inducing activity was primarily localized in the 30% to 40% sucrose fraction.

[0293] To further identify the TiLV-specific sequence, RNA was extracted from TiLV virions (purified via ultracentrifugation with sucrose buffer) and used as a template in the reverse transcription reaction. Fragments of the obtained cDNA were cloned using a shotgun cloning method as described in Example 1. This method allows the cloning of small amounts of existing cDNA without prior knowledge of their sequences. One of these fragments (clone 7450) was subjected to 5' and 3' RACE reactions, resulting in the identification of 1,326 bases of the TiLV sequence (SEQ ID NO:1) (GenBank accession number KJ605629), which contains a 420-amino acid open reading frame (ORF) (SEQ ID NO:12). SEQ ID NO:1 was subsequently identified as part of SEQ ID NO:9.

[0294] BLAST searches (Altschul et al. 1997; Johnson et al. 2008) in the GenBank database revealed no significant homology between the nucleic acid and protein sequences of this clone.

[0295] Example 7 - PCR for TiLV detection

[0296] As described in Example 1, PCR was performed to detect TiLV. To establish a PCR assay for detecting TiLV, total RNA was extracted from the brain, kidney, heart, liver, and spleen of dying fish. Additionally, RNA was extracted from the brain of primary tilapia infected with TiLV or from E-11 cultures, and this RNA was used as a template for cDNA generation. These samples were subjected to RT-PCR using primers derived from clone 7450 (SEQ ID NO:1). A 250-bp fragment was amplified using primers ME1 (GTTGGGCACAAGGCATCCTA) (SEQ ID NO:23) and clone 7450 / 150R (TATCACGTGCGTACTCGTTCAGT) (SEQ ID NO:16). The PCR assay resulted in the amplification of the expected 250-bp fragment from the brain of TiLV-infected fish. Figure 3 A).

[0297] TiLV amplification was achieved only after the reverse transcription step, even when the sample was not treated with DNase. Figure 3 B). Total RNA was extracted from the supernatant or from cell extracts from TiLV-infected E-11 cultures, or from E-11 cultures used for the first time in the experiment. Samples were not treated with DNase and were reverse transcribed (+) or not (-) prior to the PCR step. An RNA-free negative control (lane 7) was also included. A 491-bp fragment was amplified using nested ext-1 (TATGCAGTACTTTCCCTGCC) (SEQ ID NO:25) and nested ext-2 (TTGCTCTGAGCAAGAGTACC) (SEQ ID NO:26) primers, only during reverse transcriptase. This highly indicated the TiLV RNA genome. Amplification was consistently observed in brain tissue samples compared to other organs. Amplification was also observed in TiLV-infected primary tilapia brains and E-11 cultures, but not in negative controls including cDNA prepared from the brains of healthy (first-time-used) fish. Figure 3 B).

[0298] No amplification was observed in additional negative controls, including mock-infected primary tilapia brains and E-11 cultures, or E-11 cultures infected with viral neural necrosis (VNN) β-Nodamura virus. Notably, the absence of amplification in samples from VNN-infected cells further suggests that clone 7450 represents a sequence derived from TiLV, rather than a fish gene upregulated at infection. In all cases, sequencing of the amplified fragment revealed complete identity with the expected sequence.

[0299] The above PCR assays were also used to further test the RNA properties of the TiLV genome. For this purpose, virions in the supernatant of TiLV-infected E-11 cultures were exposed to DNase I and RNase A to digest the unprotected nucleic acids. The particles were then precipitated with sucrose buffer and digested with proteinase K to purify the protected deproteinized nucleic acids. These nucleic acids were then exposed to RNase I, an enzyme that prefers single-stranded RNA. The resulting products were reverse transcribed or not, and subjected to PCR amplification using TiLV-specific primers (nested ext-1 [TATGCAGTACTTTCCCTGCC](SEQ ID NO:25) and nested ext-2 [TTGCTCTGAGCAAGAGTACC](SEQ ID NO:26) or SnRV-specific primers (blackfish gag-pol fw [CAGATCACTGATCGATGC](SEQ ID NO:27) and blackfish gag-pol rev [GTCTGAAAGGTAAGGTGG](SEQ ID NO:28)).

[0300] Only after the reverse transcription step ( Figure 3 C, lanes 1 and 3, similar to Figure 3 The results in B) and only when RNase I is avoided ( Figure 3 TiLV sequence amplification was only observed in lanes C, 1, and 2. Single-stranded genomic RNA of SnRV purified along with the TiLV genome was used as an internal positive control for this assay. Figure 3 C, lanes 5 to 8). These results further indicate that the TiLV genome encapsulated within the virion is composed of single-stranded RNA.

[0301] Example 8 - Reproduction of Tilapia Disease by Intraperitoneal Injection

[0302] To test whether TiLV can cause disease in tilapia, supernatant from E-11 or primary tilapia brain cultures used for the first time in experiments or infected with TiLV was filtered. And will Injection was performed into native Nile tilapia (group of 30 fish, as described in Example 1). All fish used for the first time inoculated with control supernatant (from E-11 culture used for the first time in the experiment) remained asymptomatic. However, 74% to 85% of the fish injected with TiLV-infected E-11 or TiLV-infected primary tilapia brain cultures developed clinical disease (lethargy, discoloration, eye changes, skin patches and ulcers) and died within 10 days. Figure 4The same mortality rate was also observed in fish injected with TiLV purified by an endpoint dilution assay (TiLVx2). Furthermore, brains from experimentally infected fish were harvested and incubated with E-11 cells used for the first time in the experiment. Such cultures developed characteristic CPE. The supernatant from these cultures was then harvested and injected into fish used for the first time in the experiment, resulting in disease in the fish. Overall, this in vivo / in vitro passage experiment was repeated three times consecutively, with a consistent mortality rate of 75% to 85% within 10 days post-injection in each round.

[0303] This clearly confirms that TiLV, isolated from infected fish and multiplied in E-11 cells, is indeed the pathogen of the disease. Importantly, the fish (35 fish) that survived the experimentally induced disease developed complete immunity to the disease upon challenge consisting of a second intraperitoneal injection (3 to 4 weeks after the first injection). This demonstrates that fish can generate a protective immune response to TiLV.

[0304] Example 9 - Reproduction of Tilapia Diseases through Co-culture

[0305] To determine whether TiLV is infectious under similar natural conditions, a co-culture experiment was conducted in which fish used for the experiment for the first time were co-cultured with fish that were experimentally infected with TiLV as described in Example 1.

[0306] These experiments clearly demonstrate that fish used in the experiments for the first time developed lethal diseases with a mortality rate similar to that obtained via the intraperitoneal injection (IP) route, but with slower kinetics (a delay of 2 to 3 days in reaching 50% mortality, P < 0.05). Figure 4 These experiments provide evidence that TiLV is transmitted via water.

[0307] Example 10 - Bioinformatics Data Analysis

[0308] After depletion of ribosomal RNA, Ion Torrent data (two libraries) were generated using brain RNA from diseased tilapia as templates. Illumina data (two libraries) were generated from particles obtained from infected E11 cultured cells after nuclease treatment and sucrose gradient purification. The Ion Torrent libraries were pretreated with cutadapt (Martin 2011) to remove low-quality ends, trim to a maximum length of 150 bp, and remove adapter sequences.

[0309] Use taxMaps ( https: / / github.com / nygenome / taxmapsReads from all four libraries (two brain and two cell cultures) were taxonomically classified by mapping the National Center for Biotechnology Information's (NCBI) nt database, the NCBI RefSeq database (Pruitt et al. 2012), the tilapia reference genome sequence (Orenil 1.1), and the corresponding annotated tilapia mRNA sequence (Brawand et al. 2014). Unclassified reads were then independently assembled using the VICUNA assembler (Yang et al. 2012) (without mapping to any known sequence). Contigs from each library were aligned using BLAST (Camacho et al. 2009) with all contigs from the other three libraries, retaining hits with an e-value of 1e-10 or lower. A single join clustering method was used to group all contigs showing any similarity together. Assuming the infectious agent should be present in all four libraries, ten contig clusters containing at least one contig from each of the four libraries were identified.

[0310] Within each cluster, contigs are aligned to one another and manually assembled to produce the longest sequence after removing inverted tandem repeats at the ends of the contigs (which appear to be caused by amplification artifacts). Overlap prediction ORFs from contigs assembled from different groups are used to correct for frameshift errors (mostly caused by insertions / deletions in Ion Torrent reads) and to infer the longest possible ORF.

[0311] Based on the model that genomic segments are expected to contain conserved ends, a combination of k-mer analysis, read depth analysis, and manual curation was used to construct 5' and 3' end sequence motifs to refine the end sequences. Plotting of 10 final shared sequences against the initial raw read data using BWA-MEM (Li 2013) confirmed that 99% of unidentified reads from the Illumina library and 87% of unidentified reads from the Ion Torrent library were mapped to shared sequences.

[0312] Example 11 - Complete Characterization of the TiLV Genome

[0313] Based on bioinformatics common sequences, PCR primers were designed and continuous sequences from all 10 clusters were amplified from infected tilapia species. The terminal sequences of each genomic segment were corrected by rapid 5'- and 3'- amplification (RACE) of the cDNA ends (Table 2). Analogous analysis was performed on samples from diseased tilapia from Israel, followed by samples from tilapia with similar disease symptoms from Ecuador, using high-throughput sequencing and PCR amplification. Sequences of 10 segments were obtained, showing greater than 94% nucleotide sequence identity with corresponding sequences from Israeli tilapia.

[0314] Fragments of each segment were cloned into a plasmid vector to generate probes for RNA blotting. A mixture of three probes representing segments 1, 4, 7, and 10 (Combo 1); 3, 6, and 9 (Combo 2); or 2, 5, and 8 (Combo 3) was used to prevent signal overlap caused by segments of similar size. Total RNA was extracted from the livers of diseased Ecuadorian tilapia and from TiLV cultured cells or cell culture supernatants infected with the brains of Israeli tilapia. RNA blotting confirmed the presence of all 10 sequences in the nucleic acid extracts from infected Israeli and Ecuadorian tilapia. Figure 5 ).

[0315] The homology search in the NCBI sequence database yielded only a single hit for segment 1, indicating very distant homology with the orthomyxovirus RNA-dependent RNA polymerase motif (Table 2).

[0316] Table 2 TiLV Genome Segments

[0317]

[0318] Example 12 - Diagnostic PCR

[0319] Conventional PCR:Primers NM-CLU7-SF1, 5'-AGT TGC TTC TCA YAA GCC TGC TA (SEQ ID NO:28) and NM-CLU7-SR1, 5'-TCG TGT TCA CAR CCA GGT TTA CTT (SEQ ID NO:29) were designed to amplify an approximately 245-nt region of TiLV segment 3 (cluster 7, accession number KJ605629). cDNA from RNA extracted with TRI reagent (Invitrogen) was synthesized using Superscript III (Life Technologies) and random hexamer according to the supplier's protocol. PCR was performed using Amplitaq Gold (Life Technologies), and the PCR products were visualized on agarose gels, purified using a Purelink Gel Extraction kit (Invitrogen), and target specificity was confirmed by Sanger sequencing of both strands (GeneWiz, NJ). Figure 6 )

[0320] Quantitative Real-Time PCR Establish a quantitative real-time PCR assay for TiLV targeting TiLV region 1 and β-actin (Nile tilapia β-actin mRNA, XM_003443127) as a housekeeping gene control. Figure 7 For both assays, the corresponding target regions were cloned into plasmid vectors using primers TiLV-CLU5-cF1 (5'-GGT CAA TTC GAG TCA TGC TCG (SEQ ID NO:30)) / TiLV-CLU5-cR1 (5'-GCT GGA CTG CTT TAT AAA TAG CAT AG (SEQ ID NO:31)) or TIL-actin-cF1 (5'-ATC CTG CGT CTG GAC CTG GCT (SEQ ID NO:32)) / TIL-actin-cR1 (5'-TGC CAA TGGTGA TGA CCT GTC (SEQ ID NO:33)) to generate quantitative calibration standards. Figure 7A and 7 B).

[0321] Directed real-time PCR was performed using the following specific oligonucleotides:

[0322] TiLV segment 1 (cluster 5)

[0323] CLU5-mRNA-qF1, 5'-AGC TAT GTT ATC TGG CGC T (SEQ ID NO: 34)

[0324] CLU5-mRNA-qR1, 5'-GTT GTT ATA CCT ATA GGC ACA T (SEQ ID NO: 35)

[0325] CLU5-mRNA-probe, FAM-5'-GCC ATT CCA CTC AGC AGA ACG TCT G-TAMRA (SEQ IDNO: 36)

[0326] Tilapia β-actin

[0327] TIL-actin-qF1,5'-GCG TGA CAT CAA RGA GAA GCT G(SEQ ID NO:37)

[0328] TIL-actin-qR1,5'-CCA ATG GTG ATG ACC TGT C (SEQ ID NO:38)

[0329] TIL-actin-probe, FAM-5'-CCC TGG AGA AGA GTT ACG AGC TGC-TAMRA (SEQ ID NO:39)

[0330] like Figure 7 As shown in Figure C, real-time PCR was used to detect true TiLV in various tissue samples from diseased tilapia from Israel using primers specific to TiLV.

[0331] References

[0332] Agius and Roberts 2003.J.Fish Dis.26: 499-509.

[0333] Altschul et al. 1997. Nucleic Acids Res. 25: 3389-3402.

[0334] Bacharach et al. 2000. J. Virol. 74: 11027-11039.

[0335] Bigarré et al. 2010. J. Fish Dis. 32: 667-673.

[0336] Brawand et al.2014.Nature 513:375-81.

[0337] Camacho et al.2009.BMC Bioinformatics 10:421.

[0338] Crandell et al.1975.J.Clin.Microbiol.2:465-468.

[0339] Food and Agriculture Organization of the United Nations(FAO).2010.Cultured aquatic species information programme,Oreochromis niloticus(Linnaeus,1758).Food and Agriculture Organization of the United Nations,Rome,Italy.

[0340] Food and Agriculture Organization of the United Nations(FAO).2010.Fisheries and Aquaculture Department.Species fact sheets:Oreochromisniloticus(Linnaeus,1758).

[0341] Food and Agriculture Organization of the United Nations,Rome,Italy.

[0342] Hasegawa et al.1997.Fish Pathol.32:127-128.

[0343] Hedrick et al.2000.J.Aquat.Anim.Health 12:44-57.

[0344] Hutoran et al.2005.J.Virol.79:1983-1991.

[0345] Johnson et al.2008.Nucleic AcidsRes.36(Suppl 2):W5-W9.

[0346] Laham and Bacharach 2007 J.Virol.81:10687-10698.

[0347] Li 2013.arXiv:1303.3997.

[0348] Martin 2011EMBnet.journal 17:10-12.

[0349] Melamed et al.2004.J.Virol.78:9675-9688.

[0350] Nehls and Boehm 1995.Trends Genet.11:39-40.

[0351] Oberpichler et al.2008.Environ.Microbiol.10:2020-2029.

[0352] Pruitt et al.2012 Nucleic Acids Res.40:D130-D135.

[0353] Reed and Muench 1938.Am.J.Hyg.27:493-497.

[0354] Reynolds 1963.J.Cell.Biol.17:208-212.

[0355] Roberts et al.2012 Laboratory Methods in Fish Pathology,FourthEdition,John Wiley&Sons,Inc.

[0356] Scotto-Lavino et al.2006a.Nat.Protoc.1:2742-2745.

[0357] Scotto-Lavino et al.2006b.Nat.Protoc.1:2555-2562.

[0358] Shlapobersky et al.2010.Virology 399:239-247.

[0359] Yang et al. 2012. BMC Genomics 13: 475. sequence list <110> Columbia University, New York <120> Novel Tilapia Virus and Its Uses <130> 01001 / 004493-WO0 <140> Submit at the same time <141> 2015-12-15 <150> US 62 / 091,824 <151> 2014-12-15 <160> 39 <170> PatentIn version 3.5 <210> 1 <211> 1326 <212> DNA <213> Luohu RNA virus <400> 1 gaaatggact cgcggtttgc acagctaact ggggttttct gtgacgattt cacttatagc 60 gaagggagcc gaaggttcct aagttcttac agtacagtag agagacgtcc aggagtcccc 120 gtagagggtg actgttatga ctgtttgaag aataagtgga ttgcctttga gctggaaggc 180 cagccgcgga aatttccaaa ggcaacagtt cgttgcattt tgaacaatga tgctacatac 240 gtttgctctg agcaagagta ccagcagatt tgtaaggtac aattcaagga ttatttggag 300 atcgacgggg ttgttaaagt tgggcacaag gcatcctacg atgctgagct aagggaacgg 360 ctattggaac taccacatcc aaagagtggc ccgaagcctc gtattgagtg ggtggcacca 420 cccagacttg cggacatatc caaggaaaca gctgagctaa agaggcaata tggattcttc 480 gagtgctcaa agttcctcgc ctgcggtgag gagtgtggtc ttgaccaaga ggcaagagaa 540 cttatactga acgagtacgc acgtgataga gaatttgagt tccgcaatgg agggtggata 600 caaaggtata cagttgcttc tcacaagcct gctacacaga agatattacc tctaccggct 660 agtgctccac ttgctcgtga gctttgatg ttgattgcta gaagcacaac tcaggcaggg 720 aaagtactgc atagcgataa taccagcata ctagctgtac cggtcatgcg cgactctgga 780 aagcacagta aaaggagacc aaccgcctcc actcaccact tagttgtagg tctaagtaaa 840 cctggctgtg aacacgattt tgagtttgac gggtacaggg cagctgtgca tgtgatgcac 900 ctagatccca agcaatcggc tatataggg gagcaagact ttgtgagtac ccgagaaatt 960 tacaagctgg atatgttgga actacctccc ataagtagga agggtgatct ggacagagct 1020 agtggtcttg agacaagatg ggacgtcatc ttacttctgg aatgcctcga ctctacaagg 1080 gttagccaag cagtggctca acattttaat aggcaccggc tagcacttag cgtctgtaag 1140 gacgagttca ggaaaggcta ccagctggct tctgagataa ggggtacaat acccttaagc 1200 tcactttatt attcactttg tgcagtaaga ttgcggatga cagtacaccc atttgcgaga 1260 tgatcgcttt cgacgccttc gctaaaggtt acgacgttct aatagaggat tatgggaaaa 1320 atttgc 1326 <210> 2 <211> 1471 <212> DNA <213> Luohu RNA virus <400> 2 ccaaatttta ctctctatta ccaaatacat ttacttctga aaaatgagtc agtttgggaa 60 atcattcaag ggcagaactg aggtcacaat aaccgaatat cgctctcata ctgtcaaaga 120 tgtgcacaga agcttactta cggctgacaa gtctctaagg aagtcattct gttttaggaa 180 cgccctaaac cagttcttgg ataaagattt gcctcttttg cccattcggc caaaattaga 240 gtccagggtt gctgtgaaaa agtctaagct gaggagtcag ctgtcgttca gacccggttt 300 gactcaggag gaagcaattg atctttacaa caagggctat gatggtgaca gcgtctcagg 360 tgccttgcaa gacagggtag tcaatgagcc tgtagcttac tcgagtgcag ataatgacaa 420 atttcacagg ggcttagcgg cttagggta cactttggct gatagagcat ttgatacatg 480 cgaatccggc ttcgtgagag caatcctac cactccatgc gggttcatat gttgtgggcc 540 aggttctttc aaagattcac ttggattgt gataaaaatc ggcgaatttct ggcacatgta 600 tgacggttc cacacttcg tcgctgtcga ggatgctaag ttcctagcaa gtaagtctcc 660 ttcgttttgg ttggcaaac gtcttgcaaa gaggctgaat ctggtcccaa aagaggatcc 720 atctatagca gcagctgagt gccttgtag gaagtgtgg gaagctagtt tgctagggc 780 acctactgca ctagatccat ttggaggcag ggccttctgc gaccaggtt gggtgtacca 840 cagggacgta gggtatgca cagctaacca catatcacag gaacacttt ttcacaagc 900 gctttcagtg aggaacttg gaccgcagg tagtgcaat gtctcaggct caatacatac 960 cgccctggac aggctcagag cagcgtacag taggggcg cccgccctcta gatctatact 1020 gcaagggctt gcaatctca tcacacctgt aggtgaaac tttgaatgcg atctcgacaa 1080 gaggaagctc ataataagg cattacgttc tcccgagagg tacattacga taggaggcct 1140 ggttgtaaac ctggacgatg tggttagagg gttctacctt gacaaggcga aggtcactgt 1200 tctctcgaga tcaaagtgga tgggttacga ggaccttcct cagaaacctc cgaacggtac 1260 attttactgt agaaagagga aggcaatgct tctcatctca tgtagtccag gcacgtacgc 1320 aaagaagcga aaagtggcag tgcaggagga tcgctttaaa gatatgaggg ttgagaattt 1380 ccgggaggta gcggaaaata tggatctaaa tcagtagggt ttcttggcaa aagccttcac 1440 tatatatatg gtaataatga gaaagatttg c

[1471] <210> 3 <211> 1098 <212> DNA <213> Luohu RNA virus <400> 3 ccaaatgttt ctcttagctc agactccaat agctatgcag gcgctggtcc tgacaagctg 60 cctagtttgc gcactagcaa gtgatgaaag tttaaggata aaacgactac aatcatacct 120 aaacaatacc taccaaagta gggagataga aagtgaaata aggcgtggat ttgcatccaa 180 gttcaggatg gagagttgct cctgcactat gggggtgcac tacattgtaa ccccatcctc 240 gggtgggtcg ttctgcactg ggttacatgc agtacctaac agcttcccag ccctcgggta 300 caaacttccc aaagcagggg gaagaggtga ttggaaagct actgaagtta ggattgacga 360 agatagtggg gttgttctat acaacgtttc caggtgcagc cacagtagcg agtgcagaga 420 tttggaggtg tattccaccg tactgccagg tcagtgtgac tgtaccagac ccactgtgga 480 cgactacaag accatgctgg cctcaaggca gccgaagtcg tttgtagtag caggcctcat 540 tatactgtgt ttacttgcta gctcagtagc aattggcatg ggtgtttaca attatgctgg 600 ggtcatcggc ctagcggacg cagctcaagc agatgtttct gagatttggg agtacttaga 660 agctttgaca cgggaagtca ccggtatgac gctaggagag ttttgctcga ttaaatccct 720 cgtctgtaaa tctgataaca taggcaaatt caaagagcaa tttgcagcct ttggggaagc 780 tattcttgca atagtgtttg ggatgctaga gaaatataag tttgtctatt acctggtgct 840 ttcgctgatg gttctctcgc tactcagtaa acttgtttct ctgttgaagc aggtgccctt 900 ctatgggagt atcaaagttt tagtattccg gaggctaaga gttgtgtgtt tcaagacctt 960 tttctatatt aagaagcggc ttaagaagaa aagcccgctt gaggatgacg aagtccctct 1020 gcttccatta tcttgatcct taagcttcta ttcctggtag gtcataaagt ggtaaactga 1080 gaaaagagta aaatttgc 1098 <210> 4 <211> 1044 <212> DNA <213> Luohu RNA virus <400> 4 ccaaatttta cctctcgcat gcatttttat ctacaggatt gtccaatgag ttggcttagg 60 gtgataagaa cccttacttt gttttcaaca ctctttaacg gaagcgatca atgcgtggac 120 aacatgtggc ggttttacgg gagatcaaac tacacgtcaa gcgtagtcat tgacggggac 180 aaatattctg ttgaaggttc atattcgagt agtgattatc tggatccagc agtacagaag 240 gtggttctgg gacttgatgg tagcaacgaa gtcatagact caggtgggtc tccatactac 300 atgtatgatt tggagggatc aaaaggggaa ctccatcatc tgaactgcaa ctttgtcgag 360 aaacgatgta atccgacgct aaactttatg cttggaggat ttgttttgtg cccaggaata 420 tcgagaaaag aactggagcc tgtaaccgac aagatattgg agagccgggg aataccgggc 480 cgaggtaaaa tacgtactat aaaaataagc tctaaactgt ttgagacatc gctgtgcctt 540 tcgaagagga ggcccactt tagcacctgt atgctaatgt cgcgtggtct ttgtacaaac 600 tgtaagcgta ctatagatag aacatatatg acgccaaacg gcttcagaac tgaatacaag 660 tggagctgca gagacaatag cacaaacag tgttggtat tagttgagtc actggaggag 720 aatcactccc catacaaatg ccactttcc gcagtggaag tcctactacc agccgaata 780 aagcgtcacc agctcatcag cgagtggtcc gcgatgcagg atgaagttgc ttataagaag 840 tcaatgctt atcttcttgc tcgtactttt cttagctata caaaatgcg tagattaaat 900 cctgtaattg atctttcgat atcaccacca gtgacagtaa gatcctgctg taaaattaat 960 aaatacatgt jagactatat gtcctatcat gtgggcgaaa tgcccaggta cagttttaag 1020 tgcttgattg agagaatat ttgc 1044 <210> 5 <211> 777 <212> DNA <213> RNA flow <400> 5 ccaaatttta ctctctttgc attgcatacc gtatagtaat agacacaatg tcctacaaga 60 ttggtgagct tgagagaatt atcacgcgca aaaacaccct cccaaggac agcggaagtc 120 agactgggct gttccatcga ctgctcctag agcattactc tggtgcctcg aacgtatggt 180 tcttttgtgc aactgggttt acacccaata caaatggcac aacctggatt gtattgacga 240 gtcacccaac cgatggtgga gaaaaggtac ctttgaaatg gaagtatgaa gtgagccccg 300 gattgccagt cagaagggta cttgcccagg agggtacagc agtaagaggc ccgaaaggag 360 cctatttagt caaaggggac atgcatctct gttcaactac cttctacact agaagggaag 420 cgaagtactg gctctgtgcg ccatccccaa agtttccaca ttggaccaag agatcagcgt 480 tggtgaccag cactcgacca ctgactgagt tgagcagggt tgccacatac ctagaggcta 540 taagtaaggg tgcaactgat gtcaatgaat cgtggtgttc ctaccacaga gttgggttag 600 tgccaatccc taaaggaatc acgtttgaac tctaattacc cagctgtttc gttgtcttat 660 tggggaggcc tttctaagtt aactaattac ttttgaaagc agggataatt ggtctgagag 720 cttcttatgg tactcagtac cgttcactaa ggatggtagc atgagagaaa gatttgc <777> <210> 6 <211> 1249 <212> DNA <213> Luohu RNA virus <400> 6 ccaagttta ctcctattac ccagaatagc taacttaata aactgaaaat ggtgagaact 60 aaagacta gtatggcagc tgccagcact gttgcaccag aggtagcaat ggatgaaagt 120 tcaccagca ctcgcaggt acagctgaa ctcccagaa accttgaggt ttcacgaa 180 gcttgtggtc atgtgttttgg aagttcctttt aacagggagg acacagtgt gatatctgat 240 gctgctgcat ttctctttaa atgcacact cactccctcg atggtcagga ggctaggtt 300 ctgagagcca gtgaaaagaa gagagagagg gagaacgcta agaatcaag gaaggcacca 360 gaagcaggga tgagggtcgg aaggagcctt attackacca gcagatggac tgaatactgc 420 gcaacctgtg tgcctgcact gggctcaaag atgaggtga taaagccctc agggacgca 480 gctatgattc agatgaa ggaccataac tctctattaa gagtgtgtgt tcgcattgag 540 gtctggaagg ctaggtacgt cagttttggtt gctctcgacg agaggattca gactttggag 600 gacgcccaat ggttcccata tctgagtggg gattcctatc gtgcttgccc agggctggtt 660 ggtggctact ttgcaagaa agcagcagca gggaaagg gaagaacta caaaagttg 720 aatcagactg ctataatccc gcctccgaga tttctgatca ttggccacag gctgcagata 780 ggcgaccagg tcaccctcag ggagctgctt gcctcaattg cttggggcct ttgcgacggt 840 gtccttgctg agtgttggag cccctcgcag ggggacggga gtattggtgt tgttgttggt 900 ctacctctgc aagctacagg aagctgcttc ctggtggtag ctagccacgg gctctcagca 960 attgccgact ctaggattga gggaacaggg aacacgaatc tgctggaaga atgcattgcc 1020 attcagaaac aggacggtgt cataaaatgt aagagaagtg ggaagagtct gtatcactgc 1080 ctcaaggaga cagcaggggc tgttgggaga taggcaacga agtaggccac ccatgcgcgg 1140 aaagctgcac aggctgccaa gggcccctct tagcccaagt tttctatata ttctttaaca 1200 agtcatctaa aactggtaaa ttcttagacg gtaattggag aaagatttg 1249 <210> 7 <211> 1640 <212> DNA <213> LuoHu RNA virus <400> 7 ccaaacgtta tctcttaatt acgcactatt actgtactac cataaggtat gtgggcattt 60 caagaaggag tttgcaaagg taacctgtta tcaggcccga cctcaatgaa ggcaccggat 120 tcagcagcga gggagtcatt agacagagcg tctgaaatca tgacaggaaa atcgtacaat gctgtccaca ctggggactt aagcaagctg cctaatcagg gagaaagtcc actgaggata gtcgattccg acctttattc agaaaggagt tgctgttggg ttatagagaa ggagggcaga gttgtatgca aaagtaccac gctcacccgc ggtatgacgg gcctgttgaa cacaacaagg 420. tgtagttctc catctgagct catatgtaag gttttgacag tagccct atctgaaaag ataggtgaca cgagcgtcga ggagttactt tctcatggca ggtactttaa gtgcgcactt cgcgaccagg agaggggtaa accccaagagc agagctatct ttctgtcaca tccattcttc 540 agattgcttt cctctgtagt agagacgcac gctagatctg tgctgtcaaa ggtctcagca 660. gtgtacaccg ctactgctag tgcagaacaa cgggctatga tggccgcaca ggttgtagag tcaagaaaac atgttcttaa tggcgactgt actaagtata atgaggcaat cgacgcagac acactgctaa aagtgtggga tgcaataggc atggggtcaa tcggagtcat gctcgcttac 780 atggtgcgca ggaaatgcgt tctcattaaa gacactctag taggtgtcc aggaggtatg ttgatgggaa tgtttaacgc aactgccacc ttggcattgc aggggacgac tgacagattc 900 ctgtctttca gcgacgactt tataacatcg tttaactcgc ctgctgaatt acgcgagata 960 gaggacctgc tttcgcaag ctgtcataac ttgtcgctaa agaagagtta catttcagtt 1020 gcctcactgg aaataaactc gtgtaccctc actagggacg gtgacctagc cacagggttg 1080 ggttgtactg ctggtgtccc tttcagggga ccacttgtga ctctgaaaca gactgcagct 1140 atgtatctg gcgctgttga ctcaggagtt atgccattcc actcagcaga acgtctgttc 1200 cagataaagc agcaggaatg tgcctatagg tataacaacc ccacttacac aacgaggaat 1260 gaggacttcc tccccacatg cctgggaggg aagactgtaa ttagctttca atctctactg 1320 acttgggatt gccacccatt ttggtaccag gtgcaccccg atggcccaga cactatagat 1380 cagaaagtcc tgtctgtcct tgcttcaaag actcgcagaa ggaacccg actggaggct 1440 ctctcagact tggaccccct ggtccctcat aggctcctcg tatcagagtc agacgttagc 1500 aagatcagag cagctaggca ggctcacttg aagtccttag gcttggaaca acccacaaac 1560 tttaactatg ctatttataa agcagtccag cccaccgctg ggtgctaagt aactatatag 1620 gcgaatgaga gaaatatttg 1640 <210> 8 <211> 465 <212> DNA <213> Luohu RNA virus <400> 8 ccaaatttta accctactaa caccaaatat agctataagc caggatgagt gtggcagatt 60 atttgtcaag tgacagtgac tcgggggctg agagctcagg atgtttagta ctaagaagtc 120 ggaagatcaa gaagggcaag aaagctgctt caaagaagcg aagttggaag aatgaaaggt 180 atggtgctga cgagagcggt gaagataata tagagtgggg tgacgaagtc gacctcgaga 2 / 240 tggacgactg tgattctgca atcccagagt gggctagggt tgatttcaat cccaaaaaca 300 gaagggacag agaggatgat gggcagagtg acctatctcg attttccgaa gatttcggaa 360 agaagtctct tgacgtgcag tcttagcacc ttaatatcgg ttctgatttc gttcgtatcc 420 acaggccaac gctaactata cagggtgtca gagggaaaga tttgc 465 <210> 9 <211> 1371 <212> DNA <213> Luohu RNA virus <400> 9 ccaaatatta ccccttaatc cttaatagac cgttaacttt cttttgaaat ggactcgcgg 60 tttgcacagc taactggggt tttctgtgac gatttcactt atagcgaagg gagccgaagg 120 ttcctaagtt cttacagtac agtagagaga cgtccaggag tccccgtaga gggtgactgt 180 tatgactgtt tgaagaataa gtggattgcc ttgagctgg aaggccagcc gcggaaattt 240 ccaaaggcaa cagttcgttg cattttgaac aatgatgcta catacgtttg ctctgagcaa 300 gagtaccagc agatttgtaa ggtacaattc aaggattatt tggagatcga cggggttgtt 360 aaagttgggc acaaggcatc ctacgatgct gagctaaggg aacggctatt ggaactacca 420 catccaaaga gtggcccgaa gcctcgtatt gagtgggtgg caccacccag acttgcggac 480 atatccaagg aaacagctga gctaaagagg caatatggat tcttcgagtg ctcaaagttc 540 ctcgcctgcg gtgaggagtg tggtcttgac caagaggcaa gagaacttat actgaacgag 600 tacgcacgtg atagagaatt tgagttccgc aatggagggt ggatacaaag gtatacagtt 660 gcttctcaca agcctgctac acagaagata ttacctctac cggctagtgc tccacttgct 720 cgtgagcttt tgatgttgat tgctagaagc acaactcagg cagggaaagt actgcatagc 780 gataatacca gcatactagc tgtaccggtc atgcgcgact ctggaaagca cagtaaaagg 840 agaccaaccg cctccactca ccacttagtt gtaggtctaa gtaaacctgg ctgtgaacac 900 gattttgagt ttgacgggta cagggcagct gtgcatgtga tgcacctaga tcccaagcaa 960 tcggctaata taggggagca agactttgtg agtacccgag aaatttacaa gctggatatg 1020 ttggaactac ctcccataag taggaagggt gatctggaca gagctagtgg tcttgagaca 1080 agatgggacg tcatcttact tctggaatgc ctcgactcta caagggttag ccaagcagtg 1140 gctcaacatt ttaataggca ccggctagca cttagcgtct gtaaggacga gttcaggaaa 1200 ggctaccagc tggcttctga gataaggggt acaataccct taagctcact ttattattca 1260 ctttgtgcag taagattgcg gatgacagta cacccatttg cgagatgatc gctttcgacg 1320 ccttcgctaa aggttacgac gttctaatag aggattatgg gaaaaatttg c 1371 <210> 10 <211> 548 <212> DNA <213> LuoHu RNA virus <400> 10 ccaaatttta ctcacaagtc cgattacttt ttccgcttgg tgatgtcacg atggatagaa 60 aatacagatt ctgtgtcagt aatcttgaca gagatgagtc ggtcgtacgt cactttgtgc 120 cattaccccc cttggagctt gtgctgcggc ggcaagacat cacaacctgg tcaagtctgg 180 atcctggatc gaaaacattg tctagaatgt tcagagatct cagagttaat gacactgagt 240 cagccaactt ggcaggagag tgcaatggtg atagggagct gggtccaagt agtaacggag 300 cacggaattt tgcacacttc aacatcggaa aggcaggcac caagaagggt catgtggagg 360 atatctgaca tggctggcga tagaacttta tgagggcggt ccaggggcaa ttgaagctcc 420 gcgaacctac tgattcctca gctagaacat tgtagtgaac catgtgacat taataattta 480 gctttagtaa aaatggataa gcttcagctc tggcaaagta tgactttaag gacgtgagaa 540 agatttgc 548 <210> 11 <211> 657 <212> DNA <213> Luohu RNA virus <220> <221> misc_feature <222> (1)..(1) <223> n is a, c, g or t <400> 11 ncaaatatta cctcatctac actaacattt ccaattggac agcatatcca ggaataagta 60 tggctcaaat cccaacacta agagagggcc aagggaagct ctacgatttc acgctcaacg 120 gcatgacagt gactagagac acagtcaaca ctgtagttgc tctggagttt cttgtcaatg 180 caggtccgga tttgctttcc ctaacaattg gcgaaggcct ctcagaagaa acaaagttta 240 aacacctgct tgttaagcac gccggcatga cccgaaagcg gatagaggaa aggctgggac 300 gaatctcgag gcgagtcagt gtgacagtcg acgcaattat aataacaaac cgcaagggtc 360 aaagatttga attcaatcgg aagcagtacc tggatattgc caaacaagct atgaagctta 420 agctccctgg gattaactgt gtcgacatac ccactgcgct cgcttttctc gaggaggtcc 480 tggcaactgc tttgaaggac actgaaggtt cacaagatga caggatggcc cttaaggcag 540 acacttctgc tgctatcaat catttccgtg aaatgcttaa ataaaaagtg agtcttcagt 6-00 gtcattttcc ccagggaggt aagctactcc atttgtgtaa tgatgagaaa aatttgc 657 <210> 12 <211> 420 <212> PRT <213> LuoHu RNA virus <400> 12 Glu Met Asp Ser Arg Phe Ala Gln Leu Thr Gly Val Phe Cys Asp Asp 1 5 10 15 Phe Thr Tyr Ser Glu Gly Ser Arg Arg Phe Leu Ser Ser Tyr Ser Thr 20 25 30 Val Glu Arg Arg Pro Gly Val Pro Val Glu Gly Asp Cys Tyr Asp Cys 35 40 45 Leu Lys Asn Lys Trp Ile Ala Phe Glu Leu Glu Gly Gln Pro Arg Lys 50 55 60 Phe Pro Lys Ala Thr Val Arg Cys Ile Leu Asn Asn Asp Ala Thr Tyr 65 70 75 80 Val Cys Ser Glu Gln Glu Tyr Gln Gln Ile Cys Lys Val Gln Phe Lys 85 90 95 Asp Tyr Leu Glu Ile Asp Gly Val Val Lys Val Gly His Lys Ala Ser 100 105 110 Tyr Asp Ala Glu Leu Arg Glu Arg Leu Leu Glu Leu Pro His Pro Lys 115 120 125 Ser Gly Pro Lys Pro Arg Ile Glu Trp Val Ala Pro Pro Arg Leu Ala 130 135 140 Asp Ile Ser Lys Glu Thr Ala Glu Leu Lys Arg Gln Tyr Gly Phe Phe 145 150 155 160 Glu Cys Ser Lys Phe Leu Ala Cys Gly Glu Glu Cys Gly Leu Asp Gln 165 170 175 Glu Ala Arg Glu Leu Ile Leu Asn Glu Tyr Ala Arg Asp Arg Glu Phe 180 185 190 Glu Phe Arg Asn Gly Gly Trp Ile Gln Arg Tyr Thr Val Ala Ser His 195 200 205 Lys Pro Ala Thr Gln Lys Ile Leu Pro Leu Pro Ala Ser Ala Pro Leu 210 215 220 Ala Arg Glu Leu Leu Met Leu Ile Ala Arg Ser Thr Thr Gln Ala Gly 225 230 235 240 Lys Val Leu His Ser Asp Asn Thr Ser Ile Leu Ala Val Pro Val Met 245 250 255 Arg Asp Ser Gly Lys His Ser Lys Arg Arg Pro Thr Ala Ser Thr His 260 265 270 His Leu Val Val Gly Leu Ser Lys Pro Gly Cys Glu His Asp Phe Glu 275 280 285 Phe Asp Gly Tyr Arg Ala Ala Val His Val Met His Leu Asp Pro Lys 290 295 300 Gln Ser Ala Asn Ile Gly Glu Gln Asp Phe Val Ser Thr Arg Glu Ile 305 310 315 320 Tyr Lys Leu Asp Met Leu Glu Leu Pro Pro Ile Ser Arg Lys Gly Asp 325 330 335 Leu Asp Arg Ala Ser Gly Leu Glu Thr Arg Trp Asp Val Ile Leu Leu 340 345 350 Leu Glu Cys Leu Asp Ser Thr Arg Val Ser Gln Ala Val Ala Gln His 355 360 365 Phe Asn Arg His Arg Leu Ala Leu Ser Val Cys Lys Asp Glu Phe Arg 370 375 380 Lys Gly Tyr Gln Leu Ala Ser Glu Ile Arg Gly Thr Ile Pro Leu Ser 385 390 395 400 Ser Leu Tyr Tyr Ser Leu Cys Ala Val Arg Leu Arg Met Thr Val His 405 410 415 Pro Phe Ala Arg 420 <210> 13 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Synthetic primer <220> <221> misc_feature <222> (19)..(24) <223> n is a, c, g or t <400> 13 1]ggaactcaat gcacgcgtnn nnnn 24 <210> 14 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 14 ggaactcaat gcacgcgt 18 <210> 15 <211> 54 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <220> <221> misc_feature <222> (54)..(54) <223> n is a, c, g, or t <400> 15 ccagtgagca gagtgacgag gactcgagct caagcttttt tttttttttt ttvn 54 <210> 16 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 16 tatcacgtgc gtactcgttc agt 23 <210> 17 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 17 ccagtgagca gagtgacg 18 <210> 18 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 18 gaggactcga gctcaagc 18 <210> 19 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 19 aagttctctt gcctcttgg 19 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 20 cacccagact tgcggacata 20 <210> twenty one <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> twenty one tccaaggaaa cagctgagc 19 <210> twenty two <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> twenty two gaggcaatat ggattcttcg 20 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> twenty three gttgggcaca aggcatccta 20 <210> twenty four <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> twenty four tatgcagtac tttccctgcc 20 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 25 ttgctctgag caagagtacc 20 <210> 26 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 26 cagatcactg atcgatgc 18 <210> 27 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 27 gtctgaaagg taaggtgg 18 <210> 28 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 28 agttgcttct cayaagcctg cta 23 <210> 29 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 29 tcgtgttcac arccaggttt actt 24 <210> 30 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 30 ggtcaattcg agtcatgctc g 21 <210> 31 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 31 gctggactgc tttataaata gcatag 26 <210> 32 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 32 atcctgcgtc tggacctggc t 21 <210> 33 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 33 tgccaatggt gatgacctgt c 21 <210> 34 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 34 agctatgtta tctggcgct 19 <210> 35 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 35 gttgttatac ctataggcac at 22 <210> 36 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 36 gccattccac tcagcagaac gtctg 25 <210> 37 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 37 gcgtgacatc aargagaagc tg 22 <210> 38 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 38 ccaatggtga tgacctgtc 19 <210> 39 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 39 ccctggagaa gagttacgag ctgc 24

Claims

1. An isolated nucleic acid whose sequence is selected from the group consisting of SEQ ID NO: 2-11.

2. An isolated nucleic acid that is complementary to a sequence selected from the group consisting of SEQ ID NO: 2-11.

Images