Use of chimeric antigen receptor-modified t cells to treat cancer
By designing and expressing genetically modified T cells that specifically recognize CD19 chimeric antigen receptor (CAR), the problems of expansion and persistence of CAR T cells in the treatment of B-cell malignancies in existing technologies have been solved, and effective treatment of chronic lymphocytic leukemia has been achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
- Filing Date
- 2011-12-09
- Publication Date
- 2026-07-10
AI Technical Summary
In existing technologies, chimeric antigen receptor (CAR) modified T cells have problems such as limited in vivo expansion, rapid cell disappearance, and insufficient clinical activity when treating B-cell malignancies such as chronic lymphocytic leukemia (CLL), especially CD19 as a tumor target CAR therapy with insignificant effects.
A nucleic acid sequence encoding a chimeric antigen receptor (CAR) was designed, including an antigen-binding domain, a transmembrane domain, a co-stimulatory signal transduction region, and a CD3ζ signal transduction domain, for gene modification of T cells to enable them to specifically recognize tumor antigens such as CD19. The CAR was then transduced and expressed via a lentiviral vector to achieve stable expression and persistent in vivo expansion.
It has achieved the sustained presence of genetically engineered T cells in patients and a highly efficient anti-tumor immune response, significantly reducing or eliminating leukemia cells, and even maintaining long-term persistence after chemotherapy, achieving remarkable clinical therapeutic effects.
Smart Images

Figure BDA0001412804370000401 
Figure BDA0001412804370000402 
Figure BDA0001412804370000411
Abstract
Description
[0001] This application is a divisional application. The original application was filed on December 9, 2011, with application number 201180067173X (PCT / US2011 / 064191) and the invention title "Use of chimeric antigen receptor-modified T cells for cancer treatment".
[0002] Cross-reference to related applications
[0003] This application claims priority to U.S. Provisional Application No. 61 / 421,470, filed December 9, 2010, and U.S. Provisional Application No. 61 / 502,649, filed June 29, 2011, the entire contents of which are incorporated herein by reference. Background Technology
[0004] Most patients with B-cell malignancies—including chronic lymphocytic leukemia (CLL)—will die from their disease. One approach to treating these patients is to genetically modify T cells to target antigens expressed on tumor cells via the expression of chimeric antigen receptors (CARs). CARs are antigen receptors designed to recognize cell surface antigens in a human leukocyte antigen-independent manner. Attempts to treat these types of patients using genetically modified cells expressing CARs have had very limited success. See, for example, Brentjens et al., 2010, Molecular Therapy, 18:4, 666-668; Morgan et al., 2010, Molecular Therapy, published online February 23, 2010, pp. 1-9; and Till et al., 2008, Blood, 112:2261-2271.
[0005] In most cancers, tumor-specific antigens are not well defined, but CD19 is an attractive tumor target in B-cell malignancies. CD19 expression is limited to both normal and malignant B cells (Uckun et al., Blood, 1988, 71:13-29), making CD19 a widely accepted target for safe testing of CARs. Although CARs can induce T-cell activation in a manner similar to endogenous T-cell receptors, the main obstacles to the clinical application of this technology to date have been limited to in vivo expansion of CAR+T cells, rapid cell disappearance after injection, and disappointing clinical activity (Jena et al., Blood, 2010, 116:1035-1044; Uckun et al., Blood, 1988, 71:13-29).
[0006] Therefore, there is an urgent need in the art for compositions and methods for treating cancer using in vivo expandable CARs. This invention addresses this need. Summary of the Invention
[0007] The present invention provides an isolated nucleic acid sequence encoding a chimeric antigen receptor (CAR), wherein the CAR includes an antigen-binding domain, a transmembrane domain, a co-stimulatory signal transduction region and a CD3ζ signal transduction domain, wherein the CD3ζ signal transduction domain includes the amino acid sequence of SEQ ID NO:24.
[0008] In one embodiment, the nucleic acid sequence encodes a CAR comprising the amino acid sequence of SEQ ID NO:12.
[0009] In one embodiment, the nucleic acid sequence encoding CAR includes the nucleic acid sequence of SEQ ID NO:8.
[0010] In one embodiment, the antigen-binding domain in the CAR is an antibody or its antigen-binding fragment. Preferably, the antigen-binding fragment is Fab or scFv.
[0011] In one embodiment, the antigen-binding domain in the CAR binds to a tumor antigen. In one embodiment, the tumor antigen is associated with a hematologic malignancy. In another embodiment, the tumor antigen is associated with a solid tumor. In yet another embodiment, the tumor antigen is selected from CD19, CD20, CD22, ROR1, mesothelin, CD33 / IL3Ra, c-Met, PSMA, glycolipid F77, EGFRvIII, GD-2, NY-ESO-1TCR, MAGE A3TCR, and any combination thereof.
[0012] In one embodiment, the co-stimulatory signal transduction region in the CAR includes an intracellular domain of a co-stimulatory molecule selected from CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, ligands that specifically bind to CD83, and any combination thereof.
[0013] In one implementation, the CD3ζ signaling domain in the CAR is encoded by the nucleic acid sequence of SEQ ID NO:18.
[0014] The present invention also provides an isolated CAR comprising an antigen-binding domain, a transmembrane domain, a co-stimulatory signal transduction region, and a CD3ζ signal transduction domain, wherein the CD3ζ signal transduction domain comprises the amino acid sequence of SEQ ID NO:24.
[0015] The present invention also provides cells comprising a nucleic acid sequence encoding a CAR, wherein the CAR comprises an antigen-binding domain, a transmembrane domain, a co-stimulatory signal transduction region, and a CD3ζ signal transduction domain comprising the amino acid sequence of SEQ ID NO:24.
[0016] In one embodiment, the cells comprising the CAR are selected from T cells, natural killer (NK) cells, cytotoxic T lymphocytes (CTLs), and regulatory T cells.
[0017] In one implementation, when the antigen-binding domain of a CAR binds to its corresponding antigen, cells containing the CAR exhibit anti-tumor immunity.
[0018] The present invention also provides a vector comprising a nucleic acid sequence encoding a CAR, wherein the CAR comprises an antigen-binding domain, a co-stimulatory signal transduction region and a CD3ζ signal transduction domain, wherein the CD3ζ signal transduction domain comprises the amino acid sequence of SEQ ID NO:24.
[0019] The present invention also provides a method for stimulating a T-cell-mediated immune response to a target cell population or tissue in mammals. In one embodiment, the method includes administering an effective amount of genetically modified cells expressing a CAR to a mammal, wherein the CAR includes an antigen-binding domain, a co-stimulatory signal transduction region, and a CD3ζ signal transduction domain including the amino acid sequence of SEQ ID NO: 24, wherein the antigen-binding domain is selected to specifically recognize a target cell population or tissue.
[0020] The present invention also provides a method for providing antitumor immunity in mammals. In one embodiment, the method includes administering to mammals an effective amount of genetically modified cells expressing a CAR, wherein the CAR includes an antigen-binding domain, a co-stimulatory signaling region, and a CD3ζ signaling domain including the amino acid sequence of SEQ ID NO:24, thereby providing antitumor immunity in mammals.
[0021] The present invention also includes a method for treating mammals with diseases, disorders, or conditions associated with elevated tumor antigen expression. In one embodiment, the method includes administering to mammals a genetically modified cell expressing a CAR, wherein the CAR includes an antigen-binding domain, a co-stimulatory signal transduction region, and a CD3ζ signal transduction domain including the amino acid sequence of SEQ ID NO:24, thereby treating the mammal.
[0022] In one implementation, the cells are autologous T cells.
[0023] In one embodiment, the tumor antigen is selected from CD19, CD20, CD22, ROR1, mesothelin, CD33 / IL3Ra, c-Met, PSMA, glycolipid F77, EGFRvIII, GD-2, NY-ESO-1TCR, MAGEA3TCR, and any combination thereof.
[0024] This invention also provides a method for treating a person with chronic lymphocytic leukemia. In one embodiment, the method includes administering human genetically engineered T cells to express a CAR, wherein the CAR includes an antigen-binding domain, a co-stimulatory signal transduction region, and a CD3ζ signal transduction domain including the amino acid sequence of SEQ ID NO:24.
[0025] In one implementation, the person is resistant to at least one chemotherapeutic agent.
[0026] In one implementation, chronic lymphocytic leukemia is a difficult-to-treat CD19+ leukemia and lymphoma.
[0027] The present invention also includes a method for generating a persistent population of genetically engineered T cells in a person diagnosed with cancer. In one embodiment, the method includes administering genetically engineered T cells to express a CAR to a human, wherein the CAR includes an antigen-binding domain, a co-stimulatory signaling region, and a CD3ζ signaling domain including the amino acid sequence of SEQ ID NO:24, wherein the persistent population of the genetically engineered T cells persists in the human for at least one month after administration.
[0028] In one embodiment, the persistent population of genetically engineered T cells includes at least one cell selected from: human T cells, progeny of human T cells, and combinations thereof.
[0029] In one implementation, the persistent population of genetically engineered T cells includes memory T cells.
[0030] In one embodiment, the persistent population of genetically engineered T cells persists in humans for at least three months after administration. In another embodiment, the persistent population of genetically engineered T cells persists in humans for at least four, five, six, seven, eight, nine, ten, eleven, twelve, two, or three years after administration.
[0031] In one implementation, chronic lymphocytic leukemia is treated.
[0032] The present invention also provides a method for expanding a population of genetically engineered T cells in a person diagnosed with cancer. In one embodiment, the method includes administering genetically engineered T cells to express a CAR, wherein the CAR includes an antigen-binding domain, a co-stimulatory signaling region, and a CD3ζ signaling domain including the amino acid sequence of SEQ ID NO:24, wherein the administered genetically engineered T cells produce a progeny population of T cells in the human.
[0033] In one implementation, progeny T cells in humans include memory T cells.
[0034] In one implementation, the T cells are autologous T cells.
[0035] In another embodiment, the person is resistant to at least one chemotherapeutic agent.
[0036] In one embodiment, the cancer is chronic lymphocytic leukemia. In another embodiment, chronic lymphocytic leukemia is refractory CD19+ leukemia and lymphoma.
[0037] In one embodiment, the progeny T cell population persists in humans for at least three months after administration. In another embodiment, the progeny T cell population persists in humans for at least four, five, six, seven, eight, nine, ten, eleven, twelve, two, or three years after administration.
[0038] In one implementation, the cancer is treated. Attached Figure Description
[0039] The following detailed description of preferred embodiments of the invention will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the invention, presently preferred embodiments are shown in the drawings. However, it should be understood that the invention is not limited to the precise arrangement and means of the embodiments shown in the drawings.
[0040] Figure 1, including Figures 1A to 1C A series of images illustrating gene transfer vectors and transgenic, genetically modified T-cell manufacturing and clinical protocol design. Figure 1A The lentiviral vector and transgene, displaying key functional elements, are depicted. A clinically graded lentiviral vector (named pELPs 19BBz) was used to generate anti-CD19scFv, a murine monoclonal antibody derived from FMC63, along with human CD8α hinge and transmembrane domains, and human 4-1BB and CD3ζ signaling domains, for the vesicular stomatitis virus G protein pseudotype. Constitutive expression of the transgene was directed via sequences including EF-lα (elongation factor-lα promoter); LTR (long terminal repeat); RRE (rev response element (cPPT)); and central termination sequence (CTS). The figure is not to scale. Figure 1B The process of T cell production was described. Autologous cells were obtained via apheresis, and T cells were enriched by monocyte elutriation, washed, and residual leukemia cells were depleted by adding anti-CD3 / CD28-coated paramagnetic beads for positive selection and T cell activation. Lentiviral vectors were added upon cell activation and washed 3 days after the start of culture. Cells were expanded on a wave platform device (WAVE Bioreactor System) for 8–12 days. On the last day of culture, the beads were removed by passing through a magnetic field, and CART19T cells were harvested and refrigerated in infusible medium. Figure 1C The clinical protocol design was described. Patients received lympholytic chemotherapy as described above, followed by CART19 infusion #1 via intravenous gravity flow drip over a period of 15–20 minutes. Infusions were administered 1–5 days after completion of chemotherapy, using a fractionated dosing method (10%, 30%, 60%) over a 3-day period. The endpoint was determined at week 4 of the study. After active surveillance, participants were transferred to the destination protocol for long-term follow-up, in accordance with FDA guidance.
[0041] Figure 2, including Figures 2A through 2F, is a series of images showing the sustained in vivo expansion of CART19 cells and their persistence in blood and bone marrow. DNA isolated from whole blood (Figures 2A through 2C) or from bone marrow (Figures 2D through 2F), samples obtained from UPN 01 (Figures 2A and 2D), from UPN 02 (Figures 2B and 2E), and from UPN 03 (Figures 2C and 2F) were batch-tested using a qualified assay for Q-PCR analysis to detect and quantify CART19 sequences. Each data point represents the average of three measurements on 100–200 ng of genomic DNA, with a maximum %CV of less than 1.56%. Pass / fail parameters for the assay included a predetermined range for the amplification slope and efficiency, and amplification of a reference sample. The lower limit of quantification for the assay, established by a standard curve range, was 2 copies of transgene / microgram of genomic DNA; sample values below this number were considered estimates and indicated whether at least 2 / 3 replication produced a Ct value with a %CV of 15%. For UPN 01 and UPN 03, CART19 cells were infused on days 0, 1, and 2, and for UPN 02, CART19 cells were infused on days 0, 1, 2, and 11.
[0042] Figure 3, including Figures 3A through 3D, shows a series of images illustrating the following: serum and bone marrow cytokines before and after CAR T cell infusion; longitudinal measurements of changes in serum cytokines, chemokines, and cytokine receptors on designated days after CART1 cell infusion, as depicted in UPN 01 (Figure 3A), UPN 02 (Figure 3B), and UPN 03 (Figure 3C); and serial assessments of the same analytes from bone marrow in UPN 03 (Figure 3D). Samples underwent multiple analysis using Luminex bead array technology and pre-assembled and validated multiplex kits. Analytes with ≥3-fold changes were indicated and plotted as relative changes from baseline as depicted in Figures 3A through 3C, or as absolute values as depicted in Figure 3D. The absolute values of each analyte at each time point were derived from a recombinant protein-based standard curve on a 3-fold 8-point dilution series, with upper and lower limits of quantification (ULOQ, LLOQ) determined by the 80–120% measured / expected cutoff values of the standard curve. Each sample was evaluated in duplicate, the mean was calculated, and in most cases the %CV was less than 10%. To accommodate uniform data display across a wide range of absolute values, for each analyte, data was displayed as a multiple of the baseline value. In cases where the baseline value was undetectable, half of the lowest standard curve value was used as the baseline value. The standard curve range for the analyte and the baseline (day 0) value (for UPN) are shown. The units for 01, 02, and 03 (listed consecutively in parentheses) are all pg / ml: IL-1-Rα: 35.5-29,318 (689, 301, 287); IL-6: 2.7-4,572 (7, 10.1, 8.7); IFN-γ: 11.2-23,972 (2.8, ND, 4.2); CXCL10: 2.1-5,319 (481, 115, 287); MIP-1β: 3.3-7,233 (99.7, 371, 174); MCP-1: 4.8-3,600 (403, 560, 828); CXCL9: 48.2-3,700 (1,412, 126, 177); IL2-Rα: 13.4-34,210 (4,319, 9,477, 610); IL -8: 2.4-5,278 (15.3, 14.5, 14.6); IL-10: 6.7-13,874 (8.5, 5.4, 0.7); MIP-1α: 7.1-13,778 (57.6, 57.3, 48.1).
[0043] Figure 4, including Figures 4A to 4D It is a series of images depicting the extended surface CART19 expression and the establishment of in vivo functional memory CAR. Figure 4AThe detection of CAR-expressing CD3+ lymphocytes and the absence of B cells in the peripheral blood and bone marrow were depicted. On day 169 post-CAR19 cell infusion, freshly treated peripheral blood or bone marrow mononuclear cells obtained from UPN 03 were evaluated by flow cytometry for CAR19 surface expression (top) or the presence of B cells (bottom); as a control, PBMCs obtained from healthy donor ND365 were stained. Gating strategies for CD3+ and B cell populations were shown. Figure 9 To evaluate CAR19 expression in CD3+ lymphocytes, samples were co-stained with antibodies against CD14-PE-Cy7 and CD16-PE-Cy7 (dump channel) and CD3-FITC, gating CD3+ positivity. CAR19 expression in CD8+ and CD8- lymphocyte compartments was also evaluated by co-staining with antibodies against CD8α-PE and anti-CAR19 individual genotypes conjugated to Alexa-647. Data in the plot were gated for the dump channel-negative / CD3-positive cell population. To evaluate the presence of B cells, samples were co-stained with antibodies against CD14-APC and CD3-FITC (dump channel), and the presence of B cells in the dump channel-negative region was evaluated by co-staining with antibodies against CD20-PE and CD19-PE-Cy-7. In all cases, the negative gating quadrant was established against unstained controls, such as... Figure 4B and 4C The image depicts CD4+ (…). Figure 4B ) and CD8+ Figure 4C T-cell immunophenotypic analysis of T-cell subtypes. Frozen peripheral blood samples from UPN 03, obtained by apheresis on days 56 and 169 post-T-cell infusion, were incubated overnight in factor-free culture medium, washed, and subjected to multiparametric immunophenotypic analysis using markers expressing T-cell memory, activation, and consumption. Figure 8 The described gating strategy involved initial gating of release pathway (CD14, CD16, Live / Dead Aqua)-negative and CD3-positive cells, followed by gating of CD4+ and CD8+ positive cells. Gating and quadrants were established using FMO controls (CAR, CD45RA, PD-1, CD25, CD127, CCR7) or by gating positive cell populations (CD3, CD4, CD8) and clearly delineated subtypes (CD27, CD28, CD57); data were displayed after a bi-exponential transformation for objective visualization of events. Figure 4DThe functional competence of sustained CAR cells was characterized. Frozen peripheral blood samples from UPN03, obtained via apheresis on days 56 and 169 post-T cell infusion, were incubated overnight in factor-free medium, washed, and their ability to recognize CD19-expressing target cells was directly evaluated in vitro using a CD107 degranulation assay. After two hours of incubation in the presence of anti-CD28, anti-CD49d, and CD107-FITC, cell mixtures were harvested, washed, and subjected to multiparameter flow cytometry analysis to evaluate the ability to degranulate CD19-expressing target CAR19 cells. Gating strategies included initial gating to leak pathway (CD14-PE-Cy7, CD16-PE-Cy7, Live / Dead Aqua)-negative and CD3-PE-positive cells, followed by gating to CD8-PE-Texas Red-positive cells; the data shown are for the CD8+-gated cohort. In all cases, the negative gating quadrant was established against the unstained control.
[0044] Figure 5, including Figure 5A Images up to 5C are a series depicting experimental results assessing clinical response after CART1 cell infusion. Figure 5AFigure 5B depicts the results of an example experiment involving two cycles of rituximab and bendamustine treatment with minimal response in UPN 02 (R / B, arrow). CART19T cells were infused 4 days after bendamustine alone (B, arrow). Leukemia resistant to rituximab and bendamustine was rapidly cleared from the blood, as indicated by a decrease in absolute lymphocyte count (ALC) from 60,600 / μl to 200 / μl within 18 days of infusion. Corticosteroid treatment was initiated on day 18 post-infusion due to malaise and non-infectious febrile syndrome. The reference line (dotted line) indicates the upper limit of normal ALC. Figure 5B depicts the results of an example experiment involving staining consecutive bone marrow biopsies or clot specimens from patients UPN 01 and 03 against CD20. Pretreatment infiltration with leukemia present in both patients was absent in the treated specimens, accompanied by normalization of cellular composition and trilineage hematopoiesis. No CLL cells were detected in UPN 01, as assessed by flow cytometry, cytogenetics, and fluorescence in situ hybridization, nor were normal B cells detected in bone marrow or blood by flow cytometry. UPN 03 showed 5% residual normal CD5-negative B cells by flow cytometry on day +23, which also indicated they were polyclonal; no normal B cells were detected on day +176. Figure 5C depicts the experimental results of rapid resolution of chemotherapy-resistant generalized lymphadenopathy assessed using sequential CT imaging. Bilateral axillary masses resolved on days 83 (UPN 01) and 31 (UPN 03) post-injection, as indicated by arrows and circles.
[0045] Figure 6 ,include Figure 6 Images A through 6C are a series depicting the absolute lymphocyte count and total CART19+ cells in circulation for UPN 01, 02, and 03. Using absolute lymphocyte counts derived from CBC values and assuming a blood volume of 5.0 L, a graph was plotted for the total circulating lymphocyte count (total normal cells and CLL cells) against the total CART19+ cells for all three subjects. The total circulating CART19+ cells were calculated as follows: copy number / ng DNA was converted to an average % label using tandem CBC values, absolute lymphocyte counts, and Q-PCR label values, as depicted in Figure 2, as described elsewhere in this document. The Q-PCR % label was found to be closely correlated (<2-fold change) with the flow cytometry characteristics of the injected product and the sample data from which the accompanying flow cytometry data could be obtained by directly counting CART19+ cells through staining.
[0046] Figure 7 ,include Figure 7Images A through 7D depict a series of images illustrating experiments involving the direct ex vivo detection of CART19-positive cells in UPN-01 PBMCs 71 days post-T cell infusion. On day 71 post-infusion, UPN-01 PBMCs, either freshly collected after apheresis or frozen and thawed viably before staining during apheresis for the production of T cell products (baseline), underwent flow cytometry analysis to detect the presence of CART19 cells expressing the CAR19 moiety on their surface. To evaluate CAR19 expression in lymphocytes, samples were co-stained with CD3-PE and an anti-CAR19 individual genotype antibody conjugated to Alexa-647, or co-stained with CD3-PE only (the FMO of CAR19). Figure 7 A describes the initial lymphocyte phylogenetic model based on forward and lateral scattering (FSC vs. SSC), followed by phylogenetic modeling for CD3+ cells. Figure 7 B describes the CD3+ lymphocyte phylum; Figure 7 C depicts the genotype staining of individual CAR individuals; Figure 7 D depicts the CAR individual genotype FMO. The CAR19-positive phylogenetic group is established on CAR19 FMO samples.
[0047] Figure 8 ,include Figure 8 Images A through 8C depict a gating strategy used to identify CART19 expression in UPN 03 blood specimens via multicolor flow cytometry. Figure 8 The gate strategy for C is shown as a representation of the strategy used on the sample of UPN 03 on day 56, and is also representative of the strategy used on the sample of UPN 03 on day 169. Figure 8 A describes the primary phylum: Dump (CD14, CD16, LIVE / dead Aqua) negative, CD3- positive. Figure 8 B describes the secondary phylum: CD4-positive, CD8-positive. Figure 8 C depicts a three-tiered hierarchy: CAR19-positive and CAR19-negative, which is established on CAR FMO samples (far right figure).
[0048] Figure 9 The gating strategies for directly identifying CART19 expression and B cells in blood and bone marrow specimens are described. Figure 4A The gating strategy was used to show the detection of CAR-expressing CD3+ lymphocytes and the absence of B cells in the peripheral blood and bone marrow: Left panel: Cell gating; Top panel: CD3+ cell-positive gating; Bottom panel: B cell-negative gating (CD14-negative, CD3-negative). NC365: Peripheral blood control cells from healthy donors.
[0049] Figure 10Images used to summarize patient demographics and responses.
[0050] Figure 11 The method for manufacturing CART-19 cells is described.
[0051] Figure 12, including Figures 12A through 12D, is a series of images depicting the patient's clinical response. Figure 12A shows the lentiviral vector used to infect the patient's T cells. A pseudotyped, clinical-grade lentiviral vector producing the vesicular stomatitis virus G protein (pELPs 19-BB-z) was used to guide the expression of anti-CD19 scFv derived from the FMC63 murine monoclonal antibody, the human CD8α hinge and transmembrane domains, and the human 4-1BB and CD3ζ signaling domains. Details of the CAR19 transgene at the bottom of Figure 12A show the key functional elements. This figure is not to scale. 3'LTR indicates a 3' long terminal repeat; 5'LTR: 5' long terminal repeat; Amp R: ampicillin resistance gene; bovine GH Poly A: bovine growth hormone with a polyadenylated tail; cPPT / CTS: central polypurine region with a central termination sequence; EF-lα: elongation factor 1-α; env: envelope; gag: group-specific antigen; pol: HIV gene encoding polymerase and reverse transcriptase; R: repeat; RRE: rev response element; scFv: single-stranded variable fragment; TM: transmembrane; and WPRE: post-transcriptional regulatory element of marmot hepatitis virus. Figure 12B shows serum creatinine, uric acid, and lactate dehydrogenase (LDH) levels from day 1 to day 28 following the first CART19-cell infusion. Peak levels occurred concurrently with hospitalization for tumor lysis syndrome. Figure 12C shows bone marrow biopsy specimens (hematoxylin and eosin) obtained on day 3 (day -1, before CART19-cell infusion) and day 23 and month 6 after CART19-cell infusion. The baseline specimen showed cellularly overactive bone marrow with trilineage hematopoiesis (60%), infiltrated by stromal aggregates dominated by small, mature lymphocytes comprising 40% of the total cellular composition. The specimen obtained on day 23 showed residual lymphocyte aggregates (10%) negative for chronic lymphocytic leukemia (CLL), and a mixture of T cells and CD5-negative B cells. The specimen obtained 6 months after infusion showed trilineage hematopoiesis with no lymphocyte aggregates and continued absence of CLL. Figure 12D shows contrast-enhanced (illumination-enhanced) CT scans obtained before the patient was enrolled in the study and on day 31 and day 104 after the first infusion. The pre-infusion CT scan showed bilateral masses of 1 to 3 cm. The regression of axillary lymphadenopathy occurs within one month after injection and is persistent. Arrows highlight multiple enlarged lymph nodes before treatment and lymph node response on comparable CT scans after treatment.
[0052] Figure 13, including Figures 13A through 13E, is a series of images depicting serum and bone marrow cytokines before and after chimeric antigen receptor T-cell infusion. A series of measurements of the cytokines interferon-γ (Figure 13A), interferon-γ-stimulated chemokines CXC motif chemokine 10 (CXCL10) (Figure 13B) and CXC motif ligand 9 (CXCL9) (Figure 13C), and interleukin-6 (Figure 13D) were taken at the indicated time points. The increase in these inflammatory cytokines and chemokines coincided with the onset of tumor lysis syndrome. Low levels of interleukin-6 were detected at baseline, while interferon-γ, CXCL9, and CXCL10 were below the detection limit at baseline. The ranges and baseline values of the analyte standard curves in patients—provided in parentheses—are as follows: Interferon-γ: 11.2 to 23,972 pg / mL (1.4 pg / mL); CXCL10: 2.1 to 5319 pg / mL (274 pg / mL); CXCL9: 48.2 to 3700 pg / mL (177 pg / mL); Interleukin-6: 2.7 to 4572 pg / mL (8.3 pg / mL); Tumor necrosis factor-α (TNF-α): 1.9 to 4005 pg / mL (not detectable); and soluble interleukin-2 receptor: 13.4 to 34,210 pg / mL (644 pg / mL). Figure 13E This study demonstrated the induction of immune responses in the bone marrow. Cytokines TNF-α, interleukin-6, interferon-γ, chemokine CXCL9, and soluble interleukin-2 receptor were measured in supernatants obtained from bone marrow aspirates on specified days before and after CART19-cell infusion. Increased levels of interleukin-6, interferon-γ, CXCL9, and soluble interleukin-2 receptor occurred concurrently with the eradication of tumor lysis syndrome, peak chimeric antigen receptor T-cell infiltration, and leukemic infiltration.
[0053] Figure 14, including Figures 14A through 14C, is a series of images depicting the expansion and persistence of chimeric antigen receptor T cells in vivo. Genomic DNA (gDNA) was isolated from whole blood (Figure 14A) and bone marrow aspirate (Figure 14B) samples collected from the patient at a series of time points before and after chimeric antigen receptor T-cell infusion and used for quantitative real-time polymerase chain reaction (PCR) analysis. As assessed based on transgenic DNA and the percentage of lymphocytes expressing CAR19, the level of chimeric antigen receptor T-cell expansion was 1000-fold higher than the initial graft-implantation level in peripheral blood and bone marrow. The peak level of chimeric antigen receptor T-cells was temporally correlated with tumor lysis syndrome. Blood samples obtained on day 0 and bone marrow samples obtained on day 1 showed no PCR signal at baseline. Flow cytometry analysis of bone marrow aspirate at baseline ( Figure 14CThe image shows a dominant infiltration of cloned CD19+CD5+ cells—as assessed by immunoglobulin κ light chain staining—with a very small number of T cells. CD5+ T cells were present at day 31 post-infusion, and no normal or malignant B cells were detected. This number indicates the relative frequency of cells in each quadrant. Both the x-axis and y-axis show the log10 proportion range. The gating strategy includes the initial gating of CD19+ and CD5+ cells in the left box, and the subsequent identification of immunoglobulin κ and λ expression of the CD19+CD5+ isoform (right box). Invention Details
[0054] This invention relates to compositions and methods for treating cancer, including but not limited to hematologic malignancies and solid tumors. This invention also relates to strategies for adoptive cell transfer of T cells transduced to express chimeric antigen receptors (CARs). CARs are molecules that combine antibody-based specificity to a desired antigen (e.g., a tumor antigen) with a T-cell receptor-activated intracellular domain to produce a chimeric protein exhibiting specific anti-tumor cellular immune activity.
[0055] This invention generally relates to the use of T cells that are genetically modified to stably express a desired CAR. T cells expressing CAR are referred to herein as CAR T cells or CAR-modified T cells. Preferably, the cell may be genetically modified to stably express an antibody-binding domain on its surface, conferring novel MHC-independent antigen specificity. In some examples, the T cell is genetically modified to stably express a CAR that combines the antigen-recognition domain of a specific antibody with an intracellular domain of a CD3-ζ chain or FcyRI protein into a single chimeric protein.
[0056] In one embodiment, the CAR of the present invention comprises an extracellular domain having an antigen recognition domain, a transmembrane domain, and a cytoplasmic domain. In one embodiment, a transmembrane domain naturally associated with one of the domains in the CAR is used. In another embodiment, the transmembrane domain may be selected, or may be modified by amino acid substitutions, to prevent such a domain from binding to the transmembrane domain of the same or different surface membrane proteins, thereby minimizing interactions with other members of the receptor complex. Preferably, the transmembrane domain is a CD8 hinge domain.
[0057] In contrast to the cytoplasmic domain, the CAR of the present invention may be designed to include, by itself, a CD28 and / or 4-1BB signaling domain, or in conjunction with any other desired cytoplasmic domain(s) useful within the scope of the CAR of the present invention. In one embodiment, the cytoplasmic domain of the CAR may be designed to further include a CD3-ζ signaling domain. For example, the cytoplasmic domain of the CAR may include, but is not limited to, CD3-ζ, 4-1BB, and CD28 signaling modules and combinations thereof. Thus, the present invention provides CAR T cells and methods for their use in adoptive therapy.
[0058] In one embodiment, the CAR T cells of the present invention can be generated by introducing a lentiviral vector comprising a desired CAR, such as a CAR comprising anti-CD19, a CD8α hinge and transmembrane domain, and human 4-1BB and CD3ζ signaling domains. The CAR T cells of the present invention are capable of replicating in vivo, producing long-lasting durability that leads to sustained tumor control.
[0059] In one embodiment, the present invention relates to the administration of gene-modified T cells expressing CAR via lymphocyte infusion to treat patients with cancer or at risk of cancer. Preferably, autologous lymphocyte infusion is used for treatment. Autologous PBMCs are collected from the patient in need of treatment, and the T cells are activated and expanded using methods described herein and known in the art, and then infused back into the patient.
[0060] In another embodiment, the invention generally relates to the treatment of patients at risk of developing CLL. The invention also includes the treatment of malignant tumors or autoimmune diseases in which chemotherapy and / or immunotherapy produce significant immunosuppression in the patient, thereby increasing the patient's risk of developing CLL.
[0061] This invention includes the use of T cells (also known as CART19T cells) expressing anti-CD19CAR, which includes both CD3-ζ and 4-1BB co-stimulatory domains. The CART19T cells of this invention can withstand robust in vivo T cell expansion and can establish CD19-specific memory cells, which persist for extended periods at high levels in the blood and bone marrow. In some instances, the CART19T cells injected into a patient by this invention can eliminate leukemia cells in a patient with advanced chemotherapy-resistant CLL. However, this invention is not limited to CART19T cells; more precisely, it includes any antigen-binding portion fused to one or more intracellular domains selected from the CD137 (4-1BB) signaling domain, the CD28 signaling domain, the CD3ζ signaling domain, and any combination thereof.
[0062] definition
[0063] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention relates. While any methods and materials similar to or equivalent to those described herein may be used in the practice of testing the invention, preferred materials and methods are described herein. The following terminology will be used in the description and claim of this invention.
[0064] It should also be understood that the terminology used herein is for the purpose of describing particular implementations only and is not intended to be restrictive.
[0065] This article uses the articles “a” and “an” to refer to one or more of the grammatical objects (i.e., at least one). For example, “an element” means one or more elements.
[0066] As used herein, “approximately” when referring to a measurable value such as a quantity, a period of time, etc., means a change of ±20% or ±10% from a given value, more preferably ±5%, even more preferably ±1%, and even more preferably ±0.1%, provided that such change is suitable for implementing the disclosed method.
[0067] "Activation," as used herein, refers to the state of T cells that have been adequately stimulated to induce detectable cell proliferation. Activation can also be associated with induced cytokine production and detectable effector function. The term "activated T cell," etc., refers to T cells that have undergone cell division.
[0068] The term "antibody," as used herein, refers to an immunoglobulin molecule that specifically binds to an antigen. Antibodies can be complete immunoglobulins derived from natural or recombinant sources, and can be the immunoreactive portion of a complete immunoglobulin. Antibodies are typically tetramers of immunoglobulin molecules. The antibodies of this invention can exist in a variety of forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab, and F(ab)2, as well as single-chain antibodies and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).
[0069] The term "antibody fragment" refers to a portion of a complete antibody and specifically to the antigenic determination variable region of the complete antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies formed from antibody fragments, scFv antibodies, and multispecific antibodies.
[0070] "Antibody heavy chain," as used in this article, refers to the larger chain of the two types of polypeptide chains that exist in all antibody molecules in their naturally occurring conformation.
[0071] "Antibody light chain," as used herein, refers to the smaller chain in the two types of polypeptide chains that exist in all antibody molecules in their naturally occurring conformation. The κ and λ light chains refer to the two main isotypes of antibody light chains.
[0072] As used herein, the term "synthetic antibody" refers to an antibody produced using recombinant DNA technology, such as, for example, an antibody expressed by a phage as described herein. The term should also be interpreted as referring to an antibody produced by the synthesis of a DNA molecule that encodes the antibody and expresses an antibody protein or a defined amino acid sequence of the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence techniques available and known in the art.
[0073] As used herein, the term "antigen" or "Ag" is defined as a molecule that elicits an immune response, which may involve antibody production, or activation of specific immune-active cells, or both. Those skilled in the art will understand that any macromolecule—indeed, all proteins or peptides—can be used as an antigen. Furthermore, antigens may be derived from recombinant or genomic DNA. Those skilled in the art will understand that any DNA—which includes nucleotide sequences or partial nucleotide sequences encoding proteins that elicit an immune response—encodes, as used herein, an "antigen." Furthermore, those skilled in the art will understand that an antigen need not be encoded solely by the full-length nucleotide sequence of a gene. It is readily apparent that the invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in different combinations to elicit a desired immune response. Furthermore, those skilled in the art will understand that an antigen need not be encoded by a "gene" at all. It is readily apparent that antigens can be produced, synthesized, or derived from biological samples. Such biological samples may include, but are not limited to, tissue samples, tumor samples, cells, or biological fluids.
[0074] As used herein, the term "antitumor effect" refers to a biological effect that can be clearly represented by a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer. The "antitumor effect" can also be clearly represented by the ability of the peptides, polynucleotides, cells, and antibodies of this invention to prevent tumor formation at the first site.
[0075] According to the present invention, the term "autoantigen" refers to any self-antigen that is mistakenly identified as foreign by the immune system. Autoantigens include, but are not limited to, cellular proteins, phosphoproteins, cell surface proteins, cellular lipids, nucleic acids, and glycoproteins, including cell surface receptors.
[0076] As used in this article, the term "autoimmune disease" is defined as a disorder resulting from an autoimmune response. Autoimmune diseases are the result of an inappropriate and excessive response to self-antigens. Examples of autoimmune diseases include, but are not limited to, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune mumps, Crohn's disease, type 1 diabetes mellitus, dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barré syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, spondyloarthritis, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, ulcerative colitis, and so on.
[0077] As used in this article, the term "self" refers to any substance that originates from the same individual and is subsequently reintroduced into that individual.
[0078] "Allogeneic" refers to grafts that originate from different animals of the same species.
[0079] "Xenogeneic" refers to grafts derived from animals of different species.
[0080] As used in this article, the term "cancer" is defined as a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread locally or to other parts of the body via the bloodstream and lymphatic system. Examples of various cancers include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, and so on.
[0081] As used herein, the term "co-stimulatory ligand" includes molecules on antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to cognate co-stimulatory molecules on T cells. This provides, in addition to the primary signaling provided by, for example, binding of the TCR / CD3 complex to a peptide-loaded MHC molecule, a signal that mediates a T cell response, including but not limited to proliferation, activation, differentiation, etc. Co-stimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible co-stimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin β receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies binding to Toll ligand receptors, and ligands that specifically bind to B7-H3. Costimulatory ligands also include, in particular, antibodies that specifically bind to costimulatory molecules present on T cells, such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.
[0082] "Costimulatory molecules" refer to associated binding partners on T cells that specifically bind to costimulatory ligands, thereby mediating costimulatory responses of T cells, such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to, MHCI class molecules, BTLA, and Toll ligand receptors.
[0083] As used in this article, “co-stimulatory signal” refers to a signal that binds to primary signals, such as TCR / CD3 linkages, leading to T cell proliferation and / or upregulation or downregulation of key molecules.
[0084] "Disease" is a state of health in animals in which they are unable to maintain homeostasis, and in which, if the disease is not treated, the animal's health continues to deteriorate. In contrast, "disorder" in animals is a state of health in which they are able to maintain homeostasis, but in which the animal's health is less favorable than it would be without the disorder. Without treatment, disorder does not necessarily lead to a further decline in the animal's health.
[0085] As used in this article, “effective amount” refers to the amount that provides therapeutic or preventative benefits.
[0086] "Encoding" refers to the inherent property of a specific sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, as a template for the synthesis of other polymers and macromolecules in biological processes. These polymers and macromolecules possess any of the defined sequences of nucleotides (i.e., rRNA, tRNA, and mRNA) or amino acids, and the biological properties derived from them. Therefore, if the transcription and translation of the mRNA corresponding to that gene produces a protein in a cell or other biological system, then the gene encodes a protein. Both the nucleotide sequence equivalent to the mRNA sequence and typically provided in the sequence listing (coding strand) and the non-coding strand used as a template for transcribing a gene or cDNA can be referred to as encoding the protein or other product of that gene or cDNA.
[0087] As used in this article, "endogenous" means any substance that originates from or is produced within an organism, cell, tissue, or system.
[0088] As used herein, the term “exogenous” refers to any substance introduced from or produced outside of an organism, cell, tissue, or system.
[0089] As used in this article, the term “expression” is defined as the transcription and / or translation of a specific nucleotide sequence driven by its promoter.
[0090] "Expression vector" refers to a vector comprising a recombinant polynucleotide including an expression control sequence operatively linked to a nucleotide sequence to be expressed. The expression vector includes sufficient cis-acting elements for expression; other elements for expression may be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as visceral particles, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating the recombinant polynucleotide.
[0091] "Homologous" refers to the sequence similarity or identity between two polypeptides or two nucleic acid molecules. When positions in two compared sequences are occupied by the same base or amino acid monomeric subunit—for example, if a position in each of two DNA molecules is occupied by adenine—the molecules are homologous at that position. The percentage of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared × 100. For example, if 6 out of 10 positions in two sequences are matching or homologous, the two sequences are 60% homologous. As an example, the DNA sequences ATTGCC and TATGGC share 50% homology. Typically, comparisons are made when two sequences are aligned to give the greatest homology.
[0092] As used herein, the term "immunoglobulin" or "Ig" is defined as a class of proteins that function as antibodies. Antibodies expressed by B cells are sometimes referred to as BCRs (B cell receptors) or antigen receptors. Five members of this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is a primary antibody found in bodily secretions such as saliva, tears, breast milk, gastrointestinal secretions, and mucus secretions from the respiratory and genitourinary tracts. IgG is the most common circulating antibody. IgM is the major immunoglobulin produced in the primary immune response in most subjects. It is the most effective immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in the fight against bacteria and viruses. IgD is an immunoglobulin without known antibody function but which can act as an antigen receptor. IgE is an immunoglobulin that mediates immediate anaphylaxis after exposure to an allergen by inducing the release of mediators from mast cells and basophils.
[0093] As used herein, “guidance material” includes publications, records, charts, or any other medium of expression that can be used to convey the usefulness of the compositions and methods of the present invention. Guidance material for the kits of the present invention may, for example, be attached to a container containing the nucleic acids, peptides, and / or compositions of the present invention, or be shipped together with a container containing the nucleic acids, peptides, and / or compositions. Optionally, guidance material may be shipped separately from the container, with the intention that the guidance material and the compound be used in conjunction by the recipient.
[0094] "Separated" means altered or removed from its natural state. For example, nucleic acids or peptides that are naturally present in living organisms are not "separated," but the same nucleic acid or peptide that is partially or completely separated from its natural coexisting substance is "separated." Separated nucleic acids or proteins can exist in a substantially purified form, or, for example, in unnatural environments such as host cells.
[0095] In the context of this invention, the following abbreviations are used for commonly occurring nucleic acid bases. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
[0096] Unless otherwise specified, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. A nucleotide sequence encoding a protein or RNA phrase may also include introns to the extent that the nucleotide sequence encoding that protein may contain one or more introns in some versions.
[0097] As used in this article, "lentivirus" refers to the genus *Lentinvirus* within the family Retroviridae. Among retroviruses, lentiviruses are the only ones capable of infecting non-dividing cells; they can transfer significant amounts of genetic information into the host cell's DNA, making them one of the most efficient gene delivery vectors. HIV, S1V, and FIV are examples of all lentiviruses. Lentiviral vectors provide tools for achieving significant levels of gene transfer in vivo.
[0098] As used herein, the term "modulation" refers to mediating a detectable increase or decrease in the level of response in a subject compared to the level of response in a subject lacking treatment or a compound, and / or compared to the level of response in a subject otherwise treated in the same manner but without treatment. This term includes disrupting and / or influencing natural signals or responses, thereby mediating a subject-preferentially beneficial therapeutic response.
[0099] Unless otherwise specified, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. Nucleotide sequences encoding proteins and RNA may include introns.
[0100] The term "operably linked" refers to a functional connection between a regulatory sequence and a heterologous nucleic acid sequence that results in the expression of the latter. For example, the first nucleic acid sequence is operably linked to the second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For instance, if a promoter affects the transcription or expression of a coding sequence, the promoter is operably linked to the coding sequence. Typically, operably linked DNA sequences are adjacent, meaning that two protein-coding regions must be linked within the same reading frame.
[0101] The term "overexpressed" tumor antigen or "overexpression" of a tumor antigen is intended to indicate an abnormal level of tumor antigen expression in cells of a solid tumor within a disease area, such as a patient, relative to the expression level of normal cells from a tissue or organ. Patients with solid tumors or hematologic malignancies characterized by tumor antigen overexpression can be identified by standard assays known in the art.
[0102] "Parenteral" administration of immunogenic compositions includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection, or injection techniques.
[0103] The terms “patient,” “subject,” “individual,” etc., are used interchangeably herein and refer to any animal or its cells, whether in vitro or in situ, that conform to the methods described herein. In some non-limiting embodiments, the patient, subject, or individual is a person.
[0104] As used herein, the term "polynucleotide" is defined as a nucleotide chain. Furthermore, nucleic acids are polymers of nucleotides. Therefore, nucleic acids and polynucleotides, as used herein, are interchangeable. Those skilled in the art will have general knowledge that nucleic acids are polynucleotides that can be hydrolyzed into monomeric "nucleotides." Monomeric nucleotides can be hydrolyzed into nucleosides. Polynucleotides, as used herein, include, but are not limited to, all nucleic acid sequences obtained by any means available in the art, including but not limited to recombinant methods, i.e., from recombinant libraries or cell genomes, using common cloning techniques and PCR. TM And so on, cloning nucleic acid sequences and synthesis methods.
[0105] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to compounds consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limitation on the maximum number of amino acids that can comprise a sequence of proteins or peptides. A polypeptide includes any peptide or protein comprising two or more amino acids linked together by peptide bonds. As used herein, the term refers to short chains, which are also commonly referred to in the art, for example, as peptides, oligopeptides, and oligomers; and longer chains, which are commonly referred to in the art, as proteins, which have many types. “Polypeptide” includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, and so on. Polypeptides include native peptides, recombinant peptides, synthetic peptides, or combinations thereof.
[0106] As used in this article, a "promoter" is defined as a DNA sequence that is required to initiate specific transcription of a polynucleotide sequence, is recognized by the cell's synthetic machinery, or guides the synthetic machinery.
[0107] As used herein, the term "promoter / regulatory sequence" refers to a nucleic acid sequence operatively linked to a promoter / regulatory sequence required for the expression of a gene product. In some instances, this sequence may be a core promoter sequence, and in others, it may include enhancer sequences and other regulatory elements required for gene product expression. A promoter / regulatory sequence may, for example, be a sequence that expresses a gene product in a tissue-specific manner.
[0108] A "constitutive" promoter is a nucleotide sequence that, when operatively linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in the cell under most or all physiological conditions.
[0109] An "inducible" promoter is a nucleotide sequence that, when operatively linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in the cell essentially only if the inducer corresponding to the promoter is present in the cell.
[0110] "Tissue-specific" promoters are nucleotide sequences that, when operatively linked to a coding gene or a polynucleotide specified by the gene, produce a gene product in the cell, essentially as long as the cell is a tissue-type cell corresponding to the promoter.
[0111] As used herein, the term "specific binding" for antibodies refers to an antibody that recognizes a specific antigen but substantially does not recognize or bind to other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to antigens from one or more species. However, this cross-species reactivity itself does not change the antibody's class as specific. In another instance, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, this cross-reactivity itself does not change the antibody's class as specific. In some instances, the terms "specific binding" or "specifically binding" may be used with respect to the interaction of an antibody, protein, or peptide with a second chemical species, referring to an interaction that depends on the presence of a specific structure on the chemical species (e.g., an antigenic determinant or epitope); for example, an antibody typically recognizes and binds to a specific protein structure rather than generally recognizing and binding to proteins. If an antibody is specific to epitope "A," the presence of a molecule containing epitope A (or free, unlabeled A) in a reaction involving labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody.
[0112] The term "stimulus" refers to a primary response induced by the binding of a stimulating molecule (e.g., the TCR / CD3 complex) to its associated ligand, thereby mediating signal transduction events—such as, but not limited to, signal transduction via the TCR / CD3 complex. Stimulus can mediate altered expression of certain molecules, such as downregulation of TGF-β and / or reorganization of cytoskeleton structures.
[0113] "Stimulating molecule," as used in this article, refers to a molecule on T cells that specifically binds to an associated stimulating ligand present on antigen-presenting cells.
[0114] As used herein, “stimulatory ligand” refers to a ligand that, when present on antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.), specifically binds to associated binding partners (referred to herein as “stimulatory molecules”) on T cells, thereby mediating primary T cell responses, including but not limited to activation, initiation of an immune response, proliferation, etc. Stimulatory ligands are well known in the art and include, in particular, MHC class I molecules loaded with peptides, anti-CD3 antibodies, hyperagonist anti-CD28 antibodies, and hyperagonist anti-CD2 antibodies.
[0115] The term "object" is intended to include living organisms (e.g., mammals) in which an immune response can be elicited. Examples of objects include humans, dogs, cats, mice, rats, and their transgenic species.
[0116] As used herein, “substantially purified” cells are cells that are substantially free of other cell types. Substantially purified cells also refer to cells that have been isolated from other cell types normally associated with them in their native state. In some examples, a substantially purified cell population refers to a homogeneous cell population. In other examples, the term simply refers to cells that have been isolated from cells normally associated with them in their native state. In some embodiments, cells are cultured in vitro. In other embodiments, cells are not cultured in vitro.
[0117] As used herein, the term "therapeutic" refers to treatment and / or prevention. Therapeutic effects are achieved through the suppression, mitigation, or eradication of a disease state.
[0118] The term "therapeuticly effective amount" refers to the amount of a subject compound that will elicit a biological or medical response in a tissue, system, or object being sought by an investigator, veterinarian, physician, or other clinician. The term "therapeuticly effective amount" includes amounts of compounds that, when administered, are sufficient to prevent the development of one or more signs or symptoms of a disorder or disease, or to alleviate, to some extent, the disorder or symptoms of a disease. Therapeuticly effective amounts will vary depending on the compound, the disease and its severity, and the age, weight, etc., of the subject being treated.
[0119] "Treating" a disease, as used in this article, means reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by the subject.
[0120] As used herein, the terms “transfected,” “transformed,” or “transduced” refer to a process by which exogenous nucleic acids are transferred or introduced into a host cell. “Transfected,” “transformed,” or “transduced” cells are cells that have been transfected, transformed, or transduced with exogenous nucleic acids. This includes primary target cells and their progeny.
[0121] As used in this article, the phrase “transcriptionally controlled” or “operably linked” refers to the promoter being in the correct position and orientation in relation to the polynucleotide to control the initiation of transcription and the expression of the polynucleotide by RNA polymerase.
[0122] A "vector" is a composition of matter comprising isolated nucleic acids and which can be used to deliver the isolated nucleic acids into cells. Many vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphoteric molecular compounds, plasmids, and viruses. Therefore, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as, for example, polylysine compounds, liposomes, etc. Examples of viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, etc.
[0123] Scope: In this disclosure, various aspects of the invention may be shown in the form of a scope. It should be understood that the description in the form of a scope is for convenience and brevity only and should not be construed as an unshakeable limitation on the scope of the invention. Therefore, the description of the scope should be considered to have all possible sub-scopes of the specific disclosure and individual numerical values within that range. For example, a description of a scope such as from 1 to 6 should be considered to have specific disclosed sub-scopes such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and individual numbers within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the width of the scope.
[0124] illustrate
[0125] This invention provides compositions and methods for treating diseases such as cancer. The cancer may be a hematologic malignancy, a solid tumor, a primary tumor, or a metastatic tumor. Preferably, the cancer is a hematologic malignancy, and more preferably, the cancer is chronic lymphocytic leukemia (CLL). Other diseases that can be treated using the compositions and methods of this invention include viral, bacterial, and parasitic infections, as well as autoimmune diseases.
[0126] In one embodiment, the present invention provides cells (e.g., T cells) engineered to express a CAR, wherein the CAR T cells exhibit antitumor properties. The CAR of the present invention can be engineered to include an extracellular domain having an antigen-binding domain fused to an intracellular signaling domain of the T cell antigen receptor complex ζ chain (e.g., CD3ζ). When expressed in T cells, the CAR of the present invention is capable of redirecting antigen recognition based on antigen-binding specificity. An exemplary antigen is CD19, as this antigen is expressed on malignant B cells. However, the present invention is not limited to targeting CD19. Instead, the present invention includes any antigen-binding moiety that, when it binds to its associated antigen, affects tumor cells so that the tumor cells do not grow, are induced to die, or are otherwise affected so that the patient's tumor burden is reduced or eliminated. The antigen-binding moiety is preferably fused to an intracellular domain derived from one or more of the co-stimulatory molecules and the ζ chain. Preferably, the antigen-binding portion is fused with one or more intracellular domains selected from the CD137(4-1BB) signaling domain, the CD28 signaling domain, the CD3ζ signaling domain, and any combination thereof.
[0127] In one embodiment, the CAR of the present invention includes a CD137(4-1BB) signaling domain. This is because the invention is based in part on the discovery that CAR-mediated T-cell responses can be further enhanced by the addition of a co-stimulatory domain. For example, including the CD137(4-1BB) signaling domain significantly increases antitumor activity and in vivo persistence of CAR T cells compared to other CAR T cells that are not engineered to express CD137(4-1BB).
[0128] Composition
[0129] This invention provides a chimeric antigen receptor (CAR) comprising an extracellular domain and an intracellular domain. The extracellular domain includes a target-specific binding element, also referred to as the antigen-binding moiety. The intracellular domain, or other cytoplasmic domain, includes a co-stimulatory signaling region and a ζ-chain portion. The co-stimulatory signaling region refers to a portion of the intracellular domain of the CAR that includes a co-stimulatory molecule. The co-stimulatory molecule is a cell surface molecule required for an effective lymphocyte response to an antigen, rather than an antigen receptor or its ligands.
[0130] A spacer domain may be incorporated between the extracellular and transmembrane domains of a CAR, or between the cytoplasmic and transmembrane domains of a CAR. As used herein, the term "spacer domain" generally refers to any oligopeptide or polypeptide that functions to link the transmembrane domain to the extracellular or cytoplasmic domain of the polypeptide chain. The spacer domain may comprise up to 300 amino acids, preferably 10 to 100 amino acids, and most preferably 25 to 50 amino acids.
[0131] antigen-binding portion
[0132] In one embodiment, the CAR of the present invention includes a target-specific binding element, further referred to as an antigen-binding moiety. The choice of moiety depends on the type and number of ligands defining the surface of the target cells. For example, an antigen-binding domain may be selected to recognize ligands that serve as cell surface markers on target cells associated with a specific disease state. Thus, examples of cell surface markers that can be used as ligands for the antigen moiety domain of the CAR of the present invention include those associated with viral, bacterial and parasitic infections, autoimmune diseases, and cancer cells.
[0133] In one embodiment, the CAR of the present invention can be engineered to specifically bind to the desired antigen-binding portion of an antigen on tumor cells in order to target tumor antigens of interest. In the context of this invention, "tumor antigen," "hyperproliferative disorder antigen," or "antigen associated with a hyperproliferative disorder" refers to antigens common to specific hyperproliferative disorders such as cancer. The antigens discussed herein are included by way of example only. This enumeration is not intended to be exhaustive, and more examples will readily become apparent to those skilled in the art.
[0134] Tumor antigens are proteins produced by tumor cells that elicit an immune response, particularly a T-cell-mediated immune response. The choice of the antigen-binding moiety in this invention will depend on the specific type of cancer to be treated. Tumor antigens are well known in the art and include, for example, glioma-associated antigens, carcinoembryonic antigen (CEA), β-human chorionic gonadotropin, alpha-fetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxylesterase, muco-hsp70-2, M-CSF, prostate enzymes, prostate-specific antigen (PSA), PAP, NY-ESO-1, LAGE-1a, p53, prostein, PSMA, Her2 / neu, susceptin and telomerase, prostate cancer tumor antigen-1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrinB2, CD22, insulin-like growth factor (IGF)-I, IGF-II, IGF-I receptor, and mesothelin.
[0135] In one implementation, tumor antigens include one or more antigenic cancer epitopes associated with malignant tumors. Malignant tumors express a number of proteins that can be used as target antigens for immune attack. These molecules include, but are not limited to, tissue-specific antigens such as MART-1, tyrosinase and GP 100 in melanoma, and prostatic acid phosphatase (PAP) and prostate-specific antigen (PSA) in prostate cancer. Other target molecules belong to the group of transformation-related molecules such as the oncogene HER-2 / Neu / ErbB-2. Another group of target antigens are fetal cancer antigens such as carcinoembryonic antigen (CEA). In B-cell lymphoma, tumor-specific individual genotype immunoglobulins constitute the truly tumor-specific immunoglobulin antigens unique to an individual tumor. B-cell differentiation antigens such as CD19, CD20, and CD37 are other candidates for target antigens in B-cell lymphoma. Some of these antigens (CEA, HER-2, CD19, CD20, individual genotype) have been used with limited success as targets for passive immunotherapy using monoclonal antibodies.
[0136] The tumor antigens mentioned in this invention can also be tumor-specific antigens (TSA) or tumor-associated antigens (TAA). TSAs are unique to tumor cells and do not occur on other cells in the body. TAA-associated antigens are not unique to tumor cells, and instead, they are expressed on normal cells even in conditions where immune tolerance to the antigen cannot be induced. Antigen expression on tumors can occur in conditions that enable the immune system to respond to the antigen. TAAs can be antigens expressed on normal cells during embryonic development when the immune system is immature and unable to respond, or they can be antigens that are normally present at very low levels on normal cells but are expressed at much higher levels on tumor cells.
[0137] Non-limiting examples of TSA or TAA antigens include the following: differentiation antigens such as MART-1 / MelanA (MART-1), gp100 (Pmel 17), tyrosinase, TRP-1, TRP-2, and tumor-specific multilineage antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor-suppressor genes such as p53, Ras, HER-2 / neu; unique tumor antigens resulting from chromosomal translocations such as BCR-ABL, E2A-PRL, H4-RET, 1GH-IGK, MYL-RAR; and viral antigens such as Epstein-Barr virus antigen EBVA and human papillomavirus (HPV) antigens E6 and E7. Other major protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72, CA 19-9, CA72-4, CAM 17.1, NuMa, K-ras, β-linkin, CDK4, Mum-1, p15, p16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, β-HCG, BCA225, BTAA, CA 125, CA 15-3, CA 27.29, BCAA, CA 195, CA 242, CA-50, CAM43, CD68 / P1, CO-029, FGF-5, G250, Ga733 / EpCAM, HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 / Mac-2 binding protein / cyclic protein C-related protein, TAAL6, TAG72, TLP, and TPS.
[0138] In a preferred embodiment, the antigen-binding portion of the CAR targets antigens including, but not limited to, CD19, CD20, CD22, ROR1, mesothelin, CD33 / IL3Ra, c-Met, PSMA, glycolipid F77, EGFRvIII, GD-2, MY-ESO-1TCR, MAGE A3TCR, etc.
[0139] Depending on the desired antigen to be targeted, the CAR of the present invention can be engineered to include an appropriate antigen-binding moiety that is specific to the desired antigen target. For example, if CD19 is the desired antigen to be targeted, an antibody against CD19 can be used as the antigen-binding moiety and incorporated into the CAR of the present invention.
[0140] In one embodiment, the antigen-binding portion of the CAR of the present invention targets CD19. Preferably, the antigen-binding portion of the CAR of the present invention is anti-CD19 scFV, wherein the nucleic acid sequence of the anti-CD19 scFV includes the sequence proposed in SEQ ID:14. In one embodiment, the anti-CD19 scFV includes a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:20. In another embodiment, the anti-CD19 scFV portion of the CAR of the present invention includes the amino acid sequence proposed in SEQ ID NO:20.
[0141] Transmembrane domain
[0142] For the transmembrane domain, the CAR can be designed to include a transmembrane domain fused to the extracellular domain of the CAR. In one implementation, a transmembrane domain naturally associated with one of the domains in the CAR is used. In some examples, the transmembrane domain can be selected, or modified by amino acid substitution, to avoid binding such a domain to the transmembrane domain of the same or different surface membrane proteins, thereby minimizing interactions with other members of the receptor complex.
[0143] The transmembrane domain can be derived from natural or synthetic sources. In natural sources, the domain can originate from any membrane-binding or transmembrane protein. Specifically, the transmembrane region used in this invention can be derived from the α, β, or ζ chain of the T-cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154 (i.e., including at least one or more of the transmembrane regions mentioned above). Optionally, the transmembrane domain can be synthetic, in which case it will include dominant hydrophobic residues such as leucine and valine. Preferably, a triplet of phenylalanine, tryptophan, and valine will be found at each end of the synthetic transmembrane domain. Optionally, short oligopeptides or polypeptide linkers, preferably between 2 and 10 amino acids in length, can form a link between the transmembrane domain and the cytoplasmic signaling domain of the CAR. Glycine-serine dinucleotides provide a particularly suitable linker.
[0144] Preferably, the transmembrane domain in the CAR of the present invention is a CD8 transmembrane domain. In one embodiment, the CD8 transmembrane domain includes the nucleic acid sequence of SEQ ID NO:16. In one embodiment, the CD8 transmembrane domain includes a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:22. In another embodiment, the CD8 transmembrane domain includes the amino acid sequence of SEQ ID NO:22.
[0145] In some examples, the transmembrane domain of the CAR of the present invention includes a CD8α hinge domain. In one embodiment, the CD8 hinge domain includes the nucleic acid sequence of SEQ ID NO:15. In one embodiment, the CD8 hinge domain includes a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:21. In another embodiment, the CD8 hinge domain includes the amino acid sequence of SEQ ID NO:21.
[0146] Cytoplasmic domain
[0147] The cytoplasmic domain or other intracellular signaling domain of the CAR of the present invention is the cause of activation of at least one normal effector function in an immune cell in which the CAR has been placed. The term "effector function" refers to a cell-specific function. For example, the effector function of a T cell may include cytolytic activity or helper activity involving cytokine secretion. Therefore, the term "intracellular signaling domain" refers to a protein portion that transduces effector function signals and directs the cell to perform its specific function. Although the entire intracellular signaling domain can generally be used, in many cases, the entire strand is not necessary. With regard to the use of a truncated portion of the intracellular signaling domain, such a truncated portion can be used in place of the complete strand, as long as it transduces effector function signals. The term "intracellular signaling domain" therefore refers to any truncated portion of an intracellular signaling domain that is sufficient to transduce effector function signals.
[0148] Preferred examples of intracellular signal transduction domains for use in the CAR of the present invention include cytoplasmic sequences of T-cell receptors (TCRs) and co-receptors that work together to initiate signal transduction upon antigen receptor binding, as well as any derivatives or variants of these sequences and any synthetic sequences having the same functional capabilities.
[0149] It is known that the signal generated by the TCR alone is insufficient to fully activate T cells, and secondary or co-stimulatory signals are also required. Therefore, T cell activation can be considered to be mediated by two different classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation via the TCR (primary cytoplasmic signaling sequence) and those that function in an antigen-independent manner to provide secondary or co-stimulatory signals (secondary cytoplasmic signaling sequences).
[0150] Primary cytoplasmic signaling sequences regulate primary activation of the TCR complex in a stimulatory or inhibitory manner. Primary cytoplasmic signaling sequences that function in a stimulatory manner may contain signaling motifs, which are known to be tyrosine-based activation motifs or ITAMs of immune receptors.
[0151] Examples of ITAMs containing primary cytoplasmic signaling sequences specifically used in this invention include those derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. Particularly preferred are the cytoplasmic signaling molecules in the CAR of this invention, which include cytoplasmic signaling sequences derived from CD3ζ.
[0152] In a preferred embodiment, the cytoplasmic domain of the CAR may be designed to include a CD3-ζ signaling domain itself, or may be combined with any other desired cytoplasmic domain(s) useful within the scope of the CAR of this invention. For example, the cytoplasmic domain of the CAR may include a CD3ζ chain portion and a co-stimulatory signaling region. A co-stimulatory signaling region refers to a portion of the intracellular domain of the CAR that includes a co-stimulatory molecule. A co-stimulatory molecule is a cell surface molecule required for an effective lymphocyte response to an antigen, rather than an antigen receptor or its ligands. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83, etc. Therefore, although this invention primarily uses 4-1BB as an example of a co-stimulatory signaling element, other co-stimulatory elements are also within the scope of this invention.
[0153] The cytoplasmic signaling sequences within the cytoplasmic signaling region of the CAR of the present invention can be linked together randomly or in a prescribed order. Optionally, short oligopeptides or polypeptide linkers, preferably between 2 and 10 amino acids in length, can form this linker. Glycine-serine duplexes provide particularly suitable linkers.
[0154] In one embodiment, the cytoplasmic domain is designed to include a CD3-ζ signal transduction domain and a CD28 signal transduction domain. In another embodiment, the cytoplasmic domain is designed to include a CD3-ζ signal transduction domain and a 4-1BB signal transduction domain. In yet another embodiment, the cytoplasmic domain is designed to include a CD3-ζ signal transduction domain and both CD28 and 4-1BB signal transduction domains.
[0155] In one embodiment, the cytoplasmic domain in the CAR of the present invention is designed to include a 4-1BB signal transduction domain and a CD3-ζ signal transduction domain, wherein the 4-1BB signal transduction domain includes the nucleic acid sequence proposed in SEQ ID NO:17 and the CD3-ζ signal transduction domain includes the nucleic acid sequence proposed in SEQ ID NO:18.
[0156] In one embodiment, the cytoplasmic domain in the CAR of the present invention is designed to include a 4-1BB signal transduction domain and a CD3-ζ signal transduction domain, wherein the 4-1BB signal transduction domain includes a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:23, and the CD3-ζ signal transduction domain includes a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:24.
[0157] In one embodiment, the cytoplasmic domain in the CAR of the present invention is designed to include a 4-1BB signal transduction domain and a CD3-ζ signal transduction domain, wherein the 4-1BB signal transduction domain includes the amino acid sequence proposed in SEQ ID NO:23, and the CD3-ζ signal transduction domain includes the amino acid sequence proposed in SEQ ID NO:24.
[0158] carrier
[0159] This invention includes a DNA construct comprising a CAR sequence, wherein the sequence comprises an antigen-binding portion of a nucleic acid sequence operatively linked to an intracellular domain. Exemplary intracellular domains of the CAR that can be used in this invention include, but are not limited to, intracellular domains of CD3-ζ, CD28, 4-1BB, etc. In some examples, the CAR may comprise any combination of CD3-ζ, CD28, 4-1BB, etc.
[0160] In one embodiment, the CAR of the present invention comprises anti-CD19scFv, a human CD8 hinge and transmembrane domain, and human 4-1BB and CD3ζ signaling domains. In one embodiment, the CAR of the present invention comprises the nucleic acid sequence proposed in SEQ ID NO:8. In another embodiment, the CAR of the present invention comprises a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:12. In yet another embodiment, the CAR of the present invention comprises the amino acid sequence proposed in SEQ ID NO:12.
[0161] The nucleic acid sequence encoding the desired molecule can be obtained using recombination methods known in the art, such as, for example, by screening a library from a cell expressing the gene, by obtaining the gene from a vector known to contain the gene, or by directly isolating the gene from cells and tissues containing the gene using standard techniques. Optionally, the gene of interest can be synthesized without cloning.
[0162] This invention also provides vectors in which the DNA of this invention is inserted. Vectors derived from retroviruses, such as lentiviruses, are suitable tools for achieving long-term gene transfer because they allow for long-term, stable integration of transgenes and their propagation in daughter cells. Lentiviral vectors have additional advantages over vectors derived from oncogenic retroviruses, such as murine leukemia viruses, because they can transduce non-proliferating cells, such as hepatocytes. They also have the additional advantage of low immunogenicity.
[0163] In short, cloning typically involves operatively linking a nucleic acid encoding a CAR polypeptide or a portion thereof to a promoter and incorporating the construct into an expression vector to express the natural or synthetic nucleic acid encoding the CAR. This vector is suitable for replication and integration into eukaryotic cells. A typical cloning vector contains transcription and translation terminators, an initial sequence, and a promoter that can be used to regulate the expression of the desired nucleic acid sequence.
[0164] The expression constructs of the present invention can also be used with standard gene delivery protocols for nucleic acid immunotherapy and gene therapy. Methods of gene delivery are known in the art. See, for example, U.S. Patent Nos. 5,399,346, 5,580,859, and 5,589,466, which are incorporated herein by reference in their entirety. In another embodiment, the present invention provides a gene therapy vector.
[0165] This nucleic acid can be cloned into many types of vectors. For example, it can be cloned into vectors including, but not limited to, plasmids, phage particles, phage derivatives, animal viruses, and granules. Specific vectors of interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.
[0166] Furthermore, the expression vector can be provided to cells in the form of a viral vector. Viral vector technology is well known in the art and has been described, for example, in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, ColdSpring Harbor Laboratory, New York) and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. Typically, a suitable vector contains at least one origin of replication functioning in an organism, a promoter sequence, a convenient restriction enzyme site, and one or more optional markers (e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Patent No. 6,326,193).
[0167] Many virus-based systems have been developed for transferring genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. Selected genes can be inserted into vectors and packaged into retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to target cells in vivo or in vitro. Many retroviral systems are known in the art. In some embodiments, adenoviral vectors are used. Many adenoviral vectors are known in the art. In one embodiment, lentiviral vectors are used.
[0168] Additional promoter elements, such as enhancers, regulate the frequency of transcription initiation. These are typically located in a 30–110 bp region upstream of the start site, although recent studies have shown that many promoters also contain functional elements downstream of the start site. The spacing between promoter elements is often flexible to maintain promoter function when an element is inverted or moved relative to another. In the thymidine kinase (TK) promoter, the spacing between promoter elements can be increased to 50 bp before activity begins to decline. Depending on the promoter, individual elements can function cooperatively or independently to initiate transcription.
[0169] An example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strongly constitutive promoter sequence capable of driving high-level expression of any polynucleotide sequence operatively linked thereto. Another example of a suitable promoter is elongation growth factor-1α (EF-1α). However, other constitutive promoter sequences may also be used, including but not limited to the early promoter of simian virus 40 (SV40), mouse mammary cancer virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, Russ's sarcoma virus promoter, and human gene promoters, such as, but not limited to, actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Furthermore, the invention should not be limited to the application of constitutive promoters. Inducible promoters are also considered as part of the invention. The use of inducible promoters provides a molecular switch that can turn on the expression of a polynucleotide sequence operatively linked to the inducible promoter when such expression is desired, or turn off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.
[0170] To assess the expression of CAR peptides or portions thereof, the expression vector introduced into cells may also contain either or both of an optional marker gene or a reporter gene to facilitate the identification and selection of expressing cells from a population of cells seeking transfection or infection via a viral vector. Alternatively, the optional marker may be carried on a separate DNA segment and used in co-transfection procedures. Both the optional marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in host cells. Useful optional markers include, for example, antibiotic resistance genes such as neo.
[0171] Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. Typically, a reporter gene is a gene that is either absent from or expressed by the recipient organism or tissue, and that encodes a polypeptide whose expression is clearly indicated by readily detectable properties such as enzyme activity. The expression of the reporter gene is determined at an appropriate time after DNA has been introduced into the recipient cells. Suitable reporter genes may include those encoding luciferase, β-galactosidase, chloramphenicol acetyltransferase, secretory alkaline phosphatase, or green fluorescent protein genes (e.g., Ui-Tei et al., 2000 FEBS Letters 479:79-82). Suitable expression systems are well-known and can be prepared using known techniques or are commercially available. Typically, a construct with at least five flanking regions exhibiting the highest level of reporter gene expression is identified as a promoter. Such promoter regions can be ligated into reporter genes and used to evaluate the ability of reagents to regulate promoter-driven transcription.
[0172] Methods for introducing genes into cells and expressing genes into cells are known in the art. Within the scope of expression vectors, the vector can be readily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells, by any method in the art. For example, expression vectors can be transferred into host cells by physical, chemical, or biological means.
[0173] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipid transfection, particle bombardment, microinjection, electroporation, and so on. Methods for producing cells comprising vectors and / or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). A preferred method for introducing polynucleotides into host cells is calcium phosphate transfection.
[0174] Biological approaches to introducing polynucleotides of interest into host cells include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian cells, such as human cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, among others. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362.
[0175] Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, and beads; and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system used as a delivery vehicle in both in vitro and in vivo is the liposome (e.g., an artificial membrane capsule).
[0176] In the case of using a non-viral delivery system, an exemplary delivery tool is a liposome. Consider using a lipid formulation to introduce nucleic acid into host cells (in vitro, ex vivo, or in vivo). Alternatively, the nucleic acid may be associated with a lipid. Lipid-associated nucleic acid can be encapsulated within the aqueous interior of a liposome, dispersed within the lipid bilayer of the liposome, attached to the liposome via a linker molecule associated with both the liposome and the oligonucleotide, trapped within the liposome, complexed with the liposome, dispersed in a solution containing lipids, mixed with lipids, conjugated with lipids, contained in lipids as a suspension, contained in or complexed with micelles, or otherwise associated with lipids. The lipids, lipid / DNA, or lipid / expression vector associated with the composition are not limited to any specific structure in solution. For example, they may be present in a bilayer structure, as micelles, or have a “collapsed” structure. They may also be simply dispersed in solution, possibly forming aggregates of varying sizes or shapes. Lipids are fatty substances and can be naturally occurring or synthetic lipids. For example, lipids include fat droplets, which occur naturally in the cytoplasm and in compounds containing long-chain aliphatic hydrocarbons and their derivatives such as fatty acids, alcohols, amines, amino alcohols and aldehydes.
[0177] Suitable lipids are available from commercial sources. For example, dimyristicophosphatidylcholine (“DMPC”) is available from Sigma, St. Louis, MO; dicetyl phosphate (“DCP”) is available from K&K Laboratories (Plainview, NY); cholesterol (“Choi”) is available from Calbiochem-Behring; dimyristicophosphatidylglycerol (“DMPG”) and other lipids are available from Avanti Polar Lipids, Inc. (Birmingham, AL). The lipid stock solution in chloroform or chloroform / methanol can be stored at approximately -20°C. Chloroform is used as the sole solvent because it evaporates more readily than methanol. “Liposome” is a general term encompassing a variety of single and multilayer lipid instruments formed by creating closed lipid bilayers or aggregates. Liposomes can be characterized by a vesicular structure containing a phospholipid bilayer membrane and an internal aqueous medium. Multilayer liposomes have multiple lipid layers separated by an aqueous medium. When phospholipids are suspended in an excess of aqueous solution, they spontaneously form. This lipid component undergoes self-rearrangement before forming a closed structure and trapping water and dissolved solute between the lipid bilayers (Ghosh et al., 191 Glycobiology 5; 505-10). However, compositions exhibiting structures in solution that differ from normal vesicle structures are also included. For example, lipids may present as micelle structures or simply as heterogeneous aggregates of lipid molecules. Lipid-transfected amine-nucleic acid complexes are also considered.
[0178] Regardless of the method used to introduce exogenous nucleic acids into host cells, or otherwise expose cells to the inhibitors of the present invention to confirm the presence of recombinant DNA sequences in host cells, a variety of assays can be performed. Such assays include, for example, "molecular biology" assays known to those skilled in the art, such as DNA blotting and RNA blotting, RT-PCR and PCR; and "biochemical" assays, such as assays by, for example, immunological means (ELISA and Western blotting) or by means of reagents described herein that identify substances falling within the scope of the present invention, to detect the presence or absence of a specific peptide.
[0179] Sources of T cells
[0180] Prior to the expansion and genetic modification of the T cells of this invention, the source of the T cells is obtained from the subject. T cells can be obtained from many sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from the site of infection, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments of the invention, any number of T cell lines available in the art can be used. In some embodiments of the invention, the T cells can be generated using any number of techniques known to those skilled in the art, such as Ficoll. TMThe separation method obtains cells from unit blood collected from the subject. In a preferred embodiment, cells from an individual's circulating blood are obtained via apheresis. Apheresis products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. In one embodiment, cells collected by apheresis may be rinsed to remove the plasma fraction and place the cells in a suitable buffer or medium for subsequent processing steps. In one embodiment of the invention, the cells are rinsed with phosphate-buffered saline (PBS). In an alternative embodiment, the rinse solution is deficient in calcium and may be deficient in magnesium, or may be deficient in many—if not all—divalent cations. Furthermore, surprisingly, the initial activation step in the absence of calcium results in amplified activation. Those skilled in the art will readily understand that the rinsing step can be accomplished by methods known to those skilled in the art, such as using a semi-automatic "maximum (direct current, flow-through)" sedimentation centrifuge (e.g., Cobe 2991 cell processor, Baxter CytoMate, or Haemonetics cell recoverer 5) according to the manufacturer's instructions. After rinsing, the cells can be resuspended in a biocompatible buffer, such as, for example, a Ca-free buffer. 2+ Mg-free 2+ PBS, PlasmaLyteA, or other salt solutions with or without buffer. Optionally, unwanted components from apheresis samples can be removed, and cells can be directly resuspended in the culture medium.
[0181] In another embodiment, T cells are isolated from peripheral blood lymphocytes by lysing red blood cells and depleting monocytes, for example, by passing through PERCOLL TM Gradient centrifugation or counterflow centrifugal elutriation. Specific subsets of T cells, such as CD3... + CD28 + CD4 + CD8 + CD45RA + and CD45RO + T cells can be further isolated using positive or negative selection techniques. For example, in one embodiment, T cells are isolated by conjugating anti-CD3 / anti-CD28 (i.e., 3×28)-conjugated beads such as... M-450CD3 / CD28T cells are incubated together for a period sufficient to positively select the desired T cells for isolation. In one embodiment, the time period is approximately 30 minutes. In a further embodiment, the time period ranges from 30 minutes to 36 hours or longer, and all integer values in between. In a further embodiment, the time period is at least 1, 2, 3, 4, 5, or 6 hours. In another preferred embodiment, the time period is 10 to 24 hours. In a preferred embodiment, the incubation time is 24 hours. For isolating T cells from patients with leukemia, using a longer incubation time, such as 24 hours, can increase cell yield. Longer incubation times can be used to isolate T cells in any situation where there are fewer T cells compared to other cell types, for example, in isolating tumor-infiltrating lymphocytes (TILs) from tumor tissue or from immune-compromised individuals. Furthermore, using a longer incubation time can increase the capture efficiency of CD8+ T cells. Therefore, by simply shortening or lengthening the time, allowing T cells to bind to CD3 / CD28 beads, and / or by increasing or decreasing the bead-to-T-cell ratio (as further described herein), T-cell subsets can be preferentially selected or excluded at the beginning of culture or at other time points in the process. Additionally, by increasing or decreasing the ratio of anti-CD3 and / or anti-CD28 antibodies on beads or other surfaces, T-cell subsets can be preferentially selected or excluded at the beginning of culture or at other desired time points. Those skilled in the art will understand that multiple rounds of selection can also be used within the scope of this invention. In some embodiments, it may be desirable to implement a selection procedure and use “unselected” cells during activation and expansion. “Unselected” cells may also undergo further rounds of selection.
[0182] Enrichment of negatively selected T cell populations can be accomplished using a combination of antibodies involving surface markers unique to the negatively selected cells. One approach is cell sorting and / or selection, performed via negative magnetic immunoadhesion or flow cytometry using a mixture of monoclonal antibodies targeting cell surface markers present on the negatively selected cells. For example, to enrich CD4 by negative selection + Cellular monoclonal antibody mixtures typically include antibodies against CD14, CD20, CD11b, CD16, HLA-DR, and CD8. In some embodiments, enrichment or positive selection of cells typically expressing CD4 may be desired. + CD25 + CD62L hi GITR + and FoxP3 + Regulatory T cells. Optionally, in some embodiments, regulatory T cells are depleted by anti-C25 conjugated beads or other similar selection methods.
[0183] To separate the desired cell population by positive or negative selection, the concentrations of cells and surfaces (e.g., particles such as beads) can be varied. In some embodiments, it is desirable to significantly reduce the volume in which beads and cells are mixed together (i.e., increase the cell concentration) to ensure maximum contact between cells and beads. For example, in one embodiment, a concentration of 2 billion cells / ml is used. In another embodiment, a concentration of 1 billion cells / ml is used. In a further embodiment, more than 100 million cells / ml is used. In a further embodiment, concentrations of 10, 15, 20, 25, 30, 35, 40, 45, or 50 × 10⁻⁶ are used. 6 Cell concentration per ml. In another embodiment, 75, 80, 85, 90, 95, or 100 × 10⁻⁶ cells / ml are used. 6 Cell concentration per ml. In a further embodiment, 125 or 150 × 10⁶ cells / ml can be used. 6 Cells / ml concentration. Using high concentrations can produce increased cell yield, cell activation, and cell expansion. Furthermore, using high cell concentrations allows for more efficient capture of cells that weakly express target antigens of interest, such as CD28-negative T cells, or capture of cells from samples containing a large number of tumor cells (i.e., leukemia blood, tumor tissue, etc.). Such cell populations may have therapeutic value and are desirable. For example, using high cell concentrations allows for more efficient selection of normal CD8 cells with weaker CD28 expression. + T cells.
[0184] In related embodiments, it is desirable to use lower concentrations of cells. By significantly diluting the mixture of T cells and surfaces (e.g., particles such as beads), the interaction between particles and cells is minimized. This selects cells expressing high amounts of the desired antigens that bind to the particles. For example, at dilute concentrations, CD4 + T cells compared to CD8 + T cells express higher levels of CD28 and are captured more effectively. In one embodiment, a cell concentration of 5 × 10⁻⁶ is used. 6 / ml. In other embodiments, the concentration used can be from approximately 1×10⁻⁶. 5 / ml to 1×10 6 / ml, and any integer value between them.
[0185] In other embodiments, the cells can be incubated on a rotator at varying speeds for varying durations at any temperature between 2-10°C or room temperature.
[0186] Following the rinsing step, the T cells used for stimulation can also be frozen. Not wanting to be bound by theory, the freezing and subsequent thawing steps provide a more homogeneous product by removing granulocytes from the cell population and to some extent removing monocytes. After the rinsing step to remove plasma and platelets, the cells can be suspended in a cryoprotectant. Although many cryogenic solutions and parameters are known in the art and will be useful in this context, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or a medium containing 10% dextran 40 and 5% dextrose, 20% human serum albumin and 7.5% DMSO, or 31.25% Plasmalyte-A, 31.25% dextrose 5%, 0.45% NaCl, 10% dextran 40 and 5% dextrose, 20% human serum albumin and 7.5% DMSO, or other suitable cell cryogenic media containing, for example, Hespan and PlasmaLyte A. The cells are then frozen to -80°C at a rate of 1°C per minute and stored in the vapor phase of a liquid nitrogen tank. Other methods of controlled freezing, as well as uncontrolled immediate freezing at -20°C or in liquid nitrogen, can be used.
[0187] In some embodiments, refrigerated cells are thawed and rinsed as described herein, and allowed to stand at room temperature for 1 hour before activation using the method of the present invention.
[0188] Within the scope of this invention, it is also contemplated that blood samples or apheresis products be collected from the subject at a time prior to the need for cell expansion as described herein. Thus, the source of cells to be expanded can be collected at any point in time necessary, and desired cells, such as T cells, are isolated and frozen for later use in T-cell therapy for any number of diseases or conditions, such as those described herein, that would benefit from T-cell therapy. In one embodiment, the blood sample or apheresis sample is taken from a generally healthy subject. In some embodiments, the blood sample or apheresis sample is taken from a generally healthy subject at risk of disease but not yet diseased, and the cells of interest are isolated and frozen for later use. In some embodiments, T cells may be expanded, frozen, and used at a later time. In some embodiments, samples are collected from the patient immediately after diagnosis of a specific disease, but before any treatment, as described herein. In a further embodiment, prior to any number of relevant treatments, cells are isolated from a blood sample or apheresis sample from the subject, said treatments including but not limited to: agents such as natalizumab, efalizumab, antiviral agents, chemotherapy, radiation, immunosuppressants such as cyclosporine, azathioprine, methotrexate, mycophenolate mofetil, and FK506, antibodies or other immunoablative agents such as CAMPATH, anti-CD3 antibodies, cyclophosphamide, fludarabine, cyclosporine, FK506, rapamycin, mycophenolate mofetil, steroids, FR901228, and irradiation. These drugs inhibit calcium-dependent phosphatases—calcineurin (cyclosporine and FK506)—or inhibit p70S6 kinase, which is important for growth factor-induced signaling (rapamycin) (Liu et al., Cell 66:807-815, 1991; Henderson et al., Immun. 73:316-321, 1991; Bterer et al., Curr. Opin. Immun. 5:763-773, 1993). In a further embodiment, cells are isolated from the patient and frozen for later use in conjunction with bone marrow or stem cell transplantation, T-cell ablation therapy using chemotherapeutic agents such as fludarabine, external beam radiotherapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH (e.g., before, simultaneously with, or after). In another embodiment, cells are isolated and then frozen for later use after B-cell ablation therapy, such as with CD20-reactive agents like Rituxan.
[0189] In a further embodiment of the invention, T cells are obtained directly from the patient after treatment. In this regard, it has been observed that after certain cancer treatments, particularly those with drugs that damage the immune system, the quality of the T cells obtained shortly after treatment, during the period when the patient is recovering normally from treatment, can be optimal or improved for their ex vivo expansion capacity. Similarly, after ex vivo manipulation using the methods described herein, these cells can be in a preferred state for enhanced graft inoculation and in vivo expansion. Therefore, within the scope of the invention, the collection of blood cells, including T cells, dendritic cells, or other hematopoietic cells, during this recovery period is contemplated. Further, in some embodiments, transfer (e.g., transfer with GM-CSF) and modulatory protocols can be used to generate disease in the subject, wherein the repopulation, recycling, regeneration, and / or expansion of specific cell types is advantageous, particularly during a defined time window following therapy. Illustrative cell types include T cells, B cells, dendritic cells, and other cells of the immune system.
[0190] T cell activation and expansion
[0191] Whether before or after T cells are genetically modified to express the desired CAR, T cells can generally be activated and expanded using methods described below: for example, U.S. Patents 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Patent Application Publication No. 20060121005.
[0192] Typically, T cells of the present invention expand through contact with a surface having an agent attached thereto that stimulates signals associated with the CD3 / TCR complex and a ligand that stimulates co-stimulatory molecules on the T cell surface. Specifically, T cell populations can be stimulated, as described herein, by contact with an anti-CD3 antibody, or its antigen-binding fragment, or an anti-CD2 antibody immobilized on the surface, or by contact with a protein kinase C activator (e.g., lichenin) in combination with a calcium ionocarp. For co-stimulation of helper molecules on the T cell surface, ligands binding to helper molecules are used. For example, T cell populations can be contacted with anti-CD3 and anti-CD28 antibodies under conditions suitable for stimulating T cell proliferation. To stimulate CD4... + T cells or CD8 +T cell proliferation was performed using anti-CD3 and anti-CD28 antibodies. Examples of anti-CD28 antibodies, including 9.3, B-T3, and XR-CD28 (Diacione, Besancon, France), may be used, as with other methods known in the art (Berg et al., Transplant Proc. 30(8):3975-3977, 1998; Haanen et al., J. Exp. Med. 190(9):1319-1328, 1999; Garland et al., J. Immunol Meth. 227(1-2):53-63, 1999).
[0193] In some embodiments, the primary and co-stimulatory signals of T cells can be provided in different ways. For example, the reagents providing each signal can be in solution or attached to a surface. When attached to a surface, the reagents can be attached to the same surface (i.e., in the form of "cis") or separate surfaces (i.e., in the form of "trans"). Alternatively, one reagent can be attached to a surface and another reagent can be in solution. In one embodiment, the reagent providing the co-stimulatory signal is bound to the cell surface, and the reagent providing the primary activation signal is in solution or attached to the surface. In some embodiments, both reagents can be in solution. In another embodiment, the reagent can be in a soluble form and subsequently cross-linked to a surface, such as a cell expressing an Fc receptor or antibody, or other binding agent that will bind the reagent. In this regard, see, for example, U.S. Patent Application Publications 20040101519 and 20060034810 for artificial antigen-presenting cells (aAPCs), which are considered for activating and expanding the T cells of the present invention.
[0194] In one embodiment, the two reagents are immobilized on beads, either on the same bead ("cis") or separate beads ("trans"). For example, the reagent providing the primary activation signal is an anti-CD3 antibody or its antigen-binding fragment, and the reagent providing the co-stimulatory signal is an anti-CD28 antibody or its antigen-binding fragment; and both reagents are co-immobilized to the same bead in equal molecular weights. In one embodiment, the reagent is used to bind to CD4... +Each antibody is used in a 1:1 ratio to the beads for T cell expansion and T cell growth. In some aspects of the invention, the ratio of anti-CD3:CD28 antibodies bound to the beads is used so that an increase in T cell expansion is observed compared to expansion observed using a 1:1 ratio. In one specific embodiment, an increase from about 1 to about 3 times is observed compared to expansion observed using a 1:1 ratio. In one embodiment, the ratio of CD3:CD28 antibodies bound to the beads is in the range of 100:1 to 1:100 and all integer values therebetween. In one aspect of the invention, more anti-CD28 antibody than anti-CD3 antibody is bound to the particles, i.e., the CD3:CD28 ratio is less than 1. In some embodiments of the invention, the ratio of anti-CD28 antibody bound to the beads to anti-CD3 antibody is greater than 2:1. In one specific embodiment, a CD3:CD28 ratio of 1:100 bound to the beads is used. In another embodiment, a CD3:CD28 ratio of 1:75 bound to the beads is used. In a further embodiment, a 1:50 CD3:CD28 ratio of the antibodies bound to the beads is used. In another embodiment, a 1:30 CD3:CD28 ratio of the antibodies bound to the beads is used. In a preferred embodiment, a 1:10 CD3:CD28 ratio of the antibodies bound to the beads is used. In another embodiment, a 1:3 CD3:CD28 ratio of the antibodies bound to the beads is used. In yet another embodiment, a 3:1 CD3:CD28 ratio of the antibodies bound to the beads is used.
[0195] A particle-to-cell ratio of 1:500 to 500:1 and any integer value therebetween can be used to stimulate T cells or other target cells. As will be readily apparent to those skilled in the art, the particle-to-cell ratio can depend on the particle size relative to the target cells. For example, small beads may bind only a few cells, while larger beads may bind many. In some embodiments, a cell-to-particle ratio in the range of 1:100 to 100:1 and any integer value therebetween, and in further embodiments, a ratio including 1:9 to 9:1 and any integer value therebetween, can also be used to stimulate T cells. The ratio of anti-CD3- and anti-CD28-binding particles to T cells generating T cell stimulation can vary as recorded above; however, certain preferred values include 1:100, 1:50, 1:40, 1:30, 1:20, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, and 15:1, with a preferred ratio of at least 1:1 particles per T cell. In one embodiment, a particle-to-cell ratio of 1:1 or less is used. In a specific embodiment, a preferred particle:cell ratio is 1:5. In further embodiments, the particle-to-cell ratio can be varied depending on the number of days of stimulation. For example, in one embodiment, the particle-to-cell ratio is from 1:1 to 10:1 on the first day, and additional particles are added to the cells daily or every other day thereafter for up to 10 days, to a final ratio from 1:1 to 1:10 (based on cell counts on the day of addition). In one specific embodiment, the particle-to-cell ratio is 1:1 on the first day of stimulation and adjusted to 1:5 on the third and fifth days of stimulation. In another embodiment, particles are added on a daily or every other day basis to achieve a final ratio of 1:1 on the first day and 1:5 on the third and fifth days of stimulation. In another embodiment, the particle-to-cell ratio is 2:1 on the first day of stimulation and adjusted to 1:10 on the third and fifth days of stimulation. In yet another embodiment, particles are added on a daily or every other day basis to achieve a final ratio of 1:1 on the first day and 1:10 on the third and fifth days of stimulation. Those skilled in the art will understand that a variety of other ratios may be suitable for use in this invention. In particular, the ratio will vary depending on particle size and cell size and type.
[0196] In a further embodiment of the invention, cells, such as T cells, are combined with reagent-coated beads, the beads and cells are then separated, and the cells are subsequently cultured. In an alternative embodiment, the reagent-coated beads and cells are not separated prior to culture, but are cultured together. In a further embodiment, the beads and cells are first aggregated by the application of forces such as magnetic forces, generating increased cell surface marker connectivity, thereby inducing cell stimulation.
[0197] As an example, cell surface proteins can be linked by allowing paramagnetic beads (3×28 beads) to attach anti-CD3 and anti-CD28 to contact T cells. In one embodiment, the cells (e.g., 10 4 Up to 10 9 T cells) and beads (e.g., in a 1:1 ratio) M-450CD3 / CD28T paramagnetic beads are conjugated in a buffer solution, preferably PBS (without divalent cations such as calcium and magnesium). Furthermore, those skilled in the art will readily understand that any cell concentration can be used. For example, target cells may be very sparse in a sample and constitute only 0.01% of the sample, or the entire sample (i.e., 100%) may include the target cells of interest. Therefore, any number of cells is within the scope of this invention. In some embodiments, it is desirable to significantly reduce the volume in which the particles and cells are mixed together (i.e., increase the cell concentration) to ensure maximum contact between the cells and particles. For example, in one embodiment, a concentration of approximately 2 billion cells / ml is used, and in another embodiment, more than 100 million cells / ml is used. In further embodiments, cell concentrations of 10, 15, 20, 25, 30, 35, 40, 45, or 50 × 10⁻⁶ are used. 6 Cells / ml. In another embodiment, cell concentrations of 75, 80, 85, 90, 95, or 100 × 10⁻⁶ cells / ml are used. 6 Cells / ml, in a further embodiment, may be 125 or 150 × 10⁶. 6 Cells / ml concentration. High concentrations can produce increased cell yield, cell activation, and cell expansion. Furthermore, using high cell concentrations allows for more efficient capture of cells that weakly express target antigens of interest, such as CD28-negative T cells. Such cell populations can have therapeutic value and will be desirable in some implementations. For example, using high cell concentrations allows for more effective selection of normal CD8+ T cells with weaker CD28 expression.
[0198] In one embodiment of the invention, the mixture may be cultured for several hours (approximately 3 hours) to approximately 14 days or any integer value of hours in between. In another embodiment, the mixture may be cultured for 21 days. In one embodiment of the invention, beads and T cells are cultured together for approximately eight days. In another embodiment, beads and T cells are cultured together for 2-3 days. Several cycles of stimulation may also be desired so that the culture time of T cells can be 60 days or more. Suitable conditions for T cell culture include appropriate culture media (e.g., minimally essential medium or RPM1 medium 1640 or X-vivo 15, (Lonza)) which may contain factors necessary for proliferation and survival, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGF-β, and TNF-α or any other additives known to the art for cell growth. Other additives used for cell growth include, but are not limited to, surfactants, human plasma protein powder (plasmanate), and reducing agents such as N-acetylcysteine and 2-mercaptoethanol. Culture media may include RPMI 1640, AIM-V, DMEM, MEM, α-MEM, F-12, X-Vivo15, and X-Vivo 20, preferably (Optimizer), with added amino acids, sodium pyruvate, and vitamins, serum-free or supplemented with appropriate amounts of serum (or plasma) or a defined hormone group, and / or sufficient amounts of cytokines (one or more) for T cell growth and expansion. Antibiotics, such as penicillin and streptomycin, are included only in experimental cultures and not in cell cultures of the injected subjects. Target cells are maintained under conditions necessary for growth, such as a suitable temperature (e.g., 37°C) and atmosphere (e.g., air with 5% CO2).
[0199] T cells exposed to varying stimuli over time can exhibit different characteristics. For example, typical blood or apheresed peripheral blood mononuclear cell products have higher cytotoxicity than cytotoxic or suppressive T cell populations. c CD8 + More helper T cells (T cells) H CD4 + T cells are generated approximately 8-9 days prior through in vitro expansion of the CD3 and CD28 receptors, primarily by T cells. H The T cell population consists of cells, and after about 8-9 days, the T cell population includes a gradually increasing number of T cells. c Cell population. Therefore, depending on the therapeutic goal, the treatment primarily includes T cells. H Injecting a population of T cells can be advantageous. Similarly, if T cells have already been isolated... cIf the cell's antigen-specific subtype is identified, it can be beneficial to expand that subtype to a greater extent.
[0200] Furthermore, in addition to CD4 and CD8 markers, other phenotypic markers also changed significantly, but largely reproducibly, during the course of cell expansion. This reproducibility enables the ability to regulate activated T cell products for specific purposes.
[0201] Therapeutic applications
[0202] This invention includes cells (e.g., T cells) transduced with a lentiviral vector (LV). For example, the LV encodes a CAR that combines the antigen recognition domain of a specific antibody with an intracellular domain of CD3-ζ, CD28, 4-1BB, or any combination thereof. Thus, in some instances, the transduced T cells can elicit a CAR-mediated T-cell response.
[0203] This invention provides the use of CAR to alter the specificity of primary T cells for tumor antigens. Therefore, this invention also provides a method for stimulating a T cell-mediated immune response against a target cell population or tissue in mammals, comprising the steps of: administering CAR-expressing T cells to mammals, wherein the CAR includes a binding portion that specifically interacts with a predetermined target, including, for example, the ζ-chain portion of an intracellular domain of human CD3ζ, and a co-stimulatory signal transduction region.
[0204] In one embodiment, the present invention includes a class of cell therapies in which T cells are genetically modified to express CAR, and CAR T cells are injected into a recipient in need of them. The injected cells are able to kill the recipient's tumor cells. Unlike antibody therapies, CAR T cells are able to replicate in vivo, producing long-lasting efficacy that can lead to sustained tumor control.
[0205] In one embodiment, the CAR T cells of the present invention can undergo a robust in vivo T cell expansion over a sustained period of time. In another embodiment, the CAR T cells of the present invention develop into specific memory T cells that can be reactivated to suppress any additional tumor forms or growth. For example, it is not desirable for the CAR19 cells of the present invention to undergo a robust in vivo T cell expansion over a sustained period of time at high levels in the blood and bone marrow, and to form specific memory T cells. Without wishing to be bound by any specific theory, CAR T cells can differentiate in vivo into a central memory-like state after encountering and subsequently eliminating target cells expressing alternative antigens.
[0206] Without being bound by any specific theory, the anti-tumor immune response induced by CAR-modified T cells can be either an active or passive immune response. Furthermore, CAR-mediated immune responses can be part of adoptive immunotherapy procedures, in which CAR-modified T cells induce a specific immune response against the antigen-binding portion of the CAR. For example, CAR19 cells elicit a specific immune response against cells expressing CD19.
[0207] Although the data disclosed herein specifically discloses lentiviral vectors including anti-CD19scFv derived from FMC63 murine monoclonal antibodies, human CD8α hinge and transmembrane domains, and human 4-1BB and CD3ζ signaling domains, the invention should be construed as including any number of variations in each of the construct components as described elsewhere herein. That is, the invention includes the use of any antigen-binding portion of the CAR to generate a CAR-mediated T-cell response specific to the antigen-binding portion. For example, the antigen-binding portion of the CAR of the present invention may target tumor antigens for the purpose of treating cancer.
[0208] Treatable cancers include tumors that are not vascularized or are substantially not vascularized, as well as vascularized tumors. Cancers may include non-solid tumors (such as hematologic malignancies, such as leukemia and lymphoma) or may include solid tumors. Types of cancers treatable with the CAR of this invention include, but are not limited to, carcinomas, germ cell tumors, and sarcomas, and certain leukemias or lymphomas, benign and malignant tumors, and malignant tumors such as sarcomas, carcinomas, and melanomas. Adult tumors / cancers and childhood tumors / cancers are also included.
[0209] Hematologic cancers are cancers of the blood or bone marrow. Examples of hematologic (or blood-borne) cancers include leukemia, including acute leukemia (such as acute lymphoblastic leukemia, acute myeloid leukemia, acute myeloid leukemia, and myeloblastic, promyelocytic, granulocytic, monocytic, and erythroleukemia), chronic leukemia (such as chronic myeloid (granulocytic) leukemia, chronic myeloid leukemia, and chronic lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (painless and high-grade forms), multiple myeloma, Waldenström's macroglobulinemia, heavy chain disease, myelodysplastic syndromes, hairy cell leukemia, and spinal dysplasia.
[0210] Solid tumors are abnormal masses of tissue that do not typically contain cysts or fluid-filled areas. Solid tumors can be benign or malignant. Different types of solid tumors are named after the cell types that form them (such as sarcoma, carcinoma, and lymphoma). Examples of solid tumors such as sarcoma and carcinoma include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma and other sarcomas, synovial tumor, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, malignant lymphoma, pancreatic cancer, breast cancer, lung cancer, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, hepatocellular carcinoma, and bile duct carcinoma. Cancer, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder cancer, melanoma and CNS tumors (such as gliomas (such as brainstem gliomas and mixed gliomas), glioblastomas (also known as glioblastoma multiforme), astrocytomas, CNS lymphomas, germ cell tumors, medulloblastomas, schwannomas, craniopharyngiomas, ependymomas, pineal tumors, hemangioblastomas, acoustic neuromas, oligodendrogliomas, meningiomas, neurocytomas, retinoblastomas and brain metastases).
[0211] In one embodiment, the antigen-binding portion of the CAR of the present invention is designed to treat specific cancers. For example, a CAR designed to target CD19 can be used to treat cancers and disorders, including but not limited to pre-BALL (indications for children), adult ALL, mantle cell lymphoma, metastatic large B-cell lymphoma, salvage after allogeneic bone marrow transplantation, etc.
[0212] In another implementation, CARs can be engineered to target CD22 to treat metastatic large B-cell lymphoma.
[0213] In one implementation, cancers and disorders include, but are not limited to, pre-B ALL (childhood indication), adult ALL, mantle cell lymphoma, metastatic large B-cell lymphoma, salvage after allogeneic bone marrow transplantation, etc., which can be treated with a combination of CARs targeting CD19, CD20, CD22 and ROR1.
[0214] In one implementation, CARs can be designed to target mesothelin to treat mesothelioma, pancreatic cancer, ovarian cancer, and so on.
[0215] In one implementation, the CAR can be designed to target CD33 / IL3Ra to treat acute myeloid leukemia, etc.
[0216] In one implementation, CARs can be designed to target c-Met to treat triple-negative breast cancer, non-small cell lung cancer, and so on.
[0217] In one implementation, CARs can be designed to target PSMA to treat prostate cancer, etc.
[0218] In one implementation, CARs can be designed to target glycolipid F77 to treat prostate cancer, etc.
[0219] In one implementation, the CAR can be designed to target EGFRvIII to treat glioblastoma, etc.
[0220] In one implementation, CARs can be designed to target GD-2 to treat neurocytomas, melanomas, and so on.
[0221] In one implementation, the CAR can be designed to target NY-ESO-1TCR to treat myeloma, sarcoma, melanoma, and so on.
[0222] In one implementation, CARs can be designed to target MAGE A3TCR to treat myeloma, sarcoma, melanoma, and so on.
[0223] However, this invention should not be construed as limited to the antigen targets and diseases disclosed herein. Rather, it should be construed as including any antigen targets associated with diseases for which CAR therapy may be used.
[0224] The CAR-modified T cells of the present invention can also be used as a type of vaccine for in vitro immunization and / or in vivo therapy in mammals. Preferably, the mammal is human.
[0225] For in vitro immunization, at least one of the following occurs in vitro before the cells are administered into a mammal: i) expanding the cells, ii) introducing nucleic acids encoding CARs into the cells, and / or iii) cryopreserving the cells.
[0226] In vitro procedures are well known in the art and are discussed more fully below. Simply put, cells are isolated from a mammal (preferably human) and genetically modified (i.e., transduced or transfected in vitro) using a vector expressing a CAR disclosed herein. The CAR-modified cells can be administered to a mammalian recipient to provide therapeutic benefit. The mammalian recipient can be human, and the CAR-modified cells can be autologous relative to the recipient. Alternatively, the cells can be allogeneic, syngeneic, or xenogeneic relative to the recipient.
[0227] The in vitro expansion procedure for hematopoietic stem cells and progenitor cells described herein by reference in U.S. Patent No. 5,199,942 can be applied to the cells of the present invention. Other suitable methods are known in the art, and therefore the present invention is not limited to any specific method of in vitro cell expansion. Briefly, in vitro culture and expansion of T cells comprises: (1) collecting CD34+ hematopoietic stem cells and progenitor cells from a peripheral blood harvest or bone marrow explant; and (2) expanding such cells in vitro. In addition to the cell growth factors described in U.S. Patent No. 5,199,942, other factors such as flt3-L, IL-1, IL-3, and c-kit ligands can also be used to culture and expand cells.
[0228] In addition to using cell-based vaccines for ex vivo immunization, the present invention also provides compositions and methods for in vivo immunization to elicit an immune response against antigens in a patient.
[0229] Generally, activated and expanded cells, as described herein, can be used to treat and prevent diseases arising in individuals without an immune response. In particular, the CAR-modified T cells of the present invention are used to treat CCL. In some embodiments, the cells of the present invention are used to treat patients at risk of developing CCL. Therefore, the present invention provides a method for treating or preventing CCL, comprising administering a therapeutically effective amount of the CAR-modified T cells of the present invention to a subject in need of it.
[0230] The CAR-modified T cells of the present invention can be administered alone or as a pharmaceutical composition in combination with a diluent and / or other components such as IL-2 or other cytokines or cell populations. In short, the pharmaceutical compositions of the present invention may comprise target cell populations as described herein, combined with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may comprise buffers such as neutral buffered saline, sulfate buffered saline, etc.; carbohydrates such as glucose, mannose, sucrose, or dextran, mannitol; proteins; peptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The compositions of the present invention are preferably formulated for intravenous administration.
[0231] The pharmaceutical compositions of the present invention can be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by factors such as the patient's condition, and the type and severity of the patient's disease—although the appropriate dosage can be determined by clinical trials.
[0232] When referring to "immunologically effective amount," "antitumor effective amount," "tumor-suppressive effective amount," or "therapeutic amount," the precise amount of the composition of the invention to be administered can be determined by a physician, taking into account individual differences in the patient's (subject's) age, weight, tumor size, degree of infection or metastasis, and disease condition. It can generally be indicated that a pharmaceutical composition including T cells described herein can be administered in doses of 10... 4 Up to 10 9 A dose of cells / kg body weight, preferably 10. 5 Up to 10 6 The T-cell composition is administered at a dose of cells per kg of body weight—including all integer values within those ranges. The T-cell composition can also be administered multiple times at these doses. The cells can be administered using infusion techniques known in immunotherapy (see, for example, Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The optimal dose and treatment regimen for a specific patient can be readily determined by a physician skilled in the medical field by monitoring the patient's disease signs and thus adjusting the treatment accordingly.
[0233] In some embodiments, it is desirable to administer activated T cells to a subject, followed by a redraw of blood (or apheresis) to activate the T cells derived therefrom according to the invention, and then re-infusing these activated and expanded T cells into the patient. This process can be performed multiple times every few weeks. In some embodiments, T cells can be activated from blood draws ranging from 10 cc to 400 cc. In some embodiments, T cells are activated from blood draws of 20 cc, 30 cc, 40 cc, 50 cc, 60 cc, 70 cc, 80 cc, 90 cc, or 100 cc. Not bound by theory, multiple blood draws / multiple re-infusion protocols can be used to select certain T cell populations.
[0234] The application of the target composition can be performed in any convenient manner, including by spraying, injection, swallowing, infusion, implantation, or transplantation. The compositions described herein can be administered to patients subcutaneously, intradermally, intratumorally, intranodally, intraspinally, intramuscularly, intravenously (iv), or intraperitoneally. In one embodiment, the T-cell composition of the present invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T-cell composition of the present invention is preferably administered by intravenous injection. The T-cell composition can be injected directly into the tumor, lymph node, or site of infection.
[0235] In certain embodiments of the invention, activated and expanded cells, using the methods described herein or other methods known in the art for expanding T cells to a therapeutic level, are administered to a patient in combination with any number of relevant therapeutic modalities (e.g., before, during, or after), including but not limited to treatment with agents such as antiviral therapy, cidofovir and interleukin-2, cytarabine (also known as ARA-C), or nastatinumab treatment for MS patients or erfaizumab treatment for psoriasis patients or other treatments for PML patients. In further embodiments, the T cells of the invention may be used in combination with chemotherapy, radiation, immunosuppressants such as cyclosporine, azathioprine, methotrexate, mycophenolate mofetil, and FK506, antibodies or other immunoablative agents such as CAM PATH, anti-CD3 antibodies or other antibody therapies, cytotoxins, fludarabine, cyclosporine, FK506, rapamycin, mycophenolate mofetil, steroids, FR901228, cytokines, and irradiation. These drugs inhibit calcium-dependent phosphatases—calcineurin (cyclosporine and FK506)—or inhibit p70S6 kinase, which is important for growth factor-induced signaling (rapamycin) (Liu et al., Cell 66:807-815, 1991; Henderson et al., Immun. 73:316-321, 1991; Bierer et al., Curr. Opin, Tmmun. 5:763-773, 1993). In a further embodiment, the cell composition of the present invention is administered to the patient in conjunction with bone marrow transplantation, T-cell ablation therapy using chemotherapeutic agents such as fludarabine, external beam radiotherapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH (e.g., before, simultaneously with, or after). In another embodiment, the cell composition of the present invention is administered after B-cell ablation therapy such as Rituxan, which reacts with CD20. For example, in one embodiment, the subject may undergo standard treatment with high-dose chemotherapy followed by peripheral blood stem cell transplantation. In some embodiments, the subject receives an injection of the expanded immune cells of the present invention after transplantation. In an additional embodiment, the expanded cells are administered before or after surgery.
[0236] The dosage of the above treatments administered to patients will vary depending on the precise nature of the condition being treated and the recipient of the treatment. The dosage ratios administered to individuals can be implemented according to practices accepted in the art. For example, the dosage of CAMPATH for adult patients will typically range from 1 to approximately 100 mg, usually administered daily for a period between 1 and 30 days. Although larger doses of up to 40 mg per day may be used in some instances (described in U.S. Patent No. 6,120,766), a preferred daily dose is 1 to 10 mg per day.
[0237] Experimental Examples
[0238] The present invention is described in further detail with reference to the following experimental embodiments. These embodiments are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Therefore, the invention should not in any way be construed as limited to the following embodiments, but should be construed as including any and all variations that become apparent from the teachings provided herein.
[0239] Without further description, it is believed that those skilled in the art, utilizing the foregoing description and the following illustrative examples, can manufacture and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore specifically point to preferred embodiments of the invention and are not to be construed as limiting the remainder of this disclosure in any way.
[0240] Example 1: Chimeric receptor-expressing T cells establish memory and effective anti-inflammatory effects in patients with advanced leukemia. Tumor effect
[0241] Lymphocytes engineered to express chimeric antigen receptors (CARs) have demonstrated minimal in vivo expansion and antitumor effects in previous clinical trials. The results presented in this paper demonstrate that CD137-containing CAR T cells exhibit potent, non-cross-resistant clinical activity after infusion therapy in three of three patients with advanced chronic lymphocytic leukemia (CLL). The engineered T cells expanded more than 1,000-fold in vivo, were delivered to the bone marrow, and continued to express functional CARs at high levels for at least 6 months. On average, each infused CAR+ T cell eradicated at least 1,000 CLL cells. CD19-specific immune responses were demonstrated in blood and bone marrow, with complete remission observed in two of the three patients. A subset of cells persisted as memory CAR+ T cells, indicating the potential of this non-MHC-restricted approach for the effective treatment of B-cell malignancies.
[0242] The materials and methods used in these experiments are now described.
[0243] Materials and methods
[0244] General laboratory instructions
[0245] Sample handling, freezing, and laboratory analysis were conducted at the Translational and Correlative Studies Laboratory at the University of Pennsylvania, which operates in accordance with established Standard Operating Procedures (SOPs) and / or protocols for sample reception, handling, freezing, and analysis, based on Good Laboratory Practice principles. Assay performance and data reporting conformed to MIATA guidelines (Janetzki et al., 2009, Immunity 31:527-528).
[0246] Scheme Design
[0247] The clinical trial (NCT01029366) was conducted as illustrated in Figure 1. Patients with CD19-positive hematologic malignancies who had persistent disease after at least two prior treatment regimens and were ineligible for allogeneic stem cell transplantation were eligible for this trial. Following tumor restaging, peripheral blood T cells for CAR-T19 production were collected via apheresis and administered to the subjects a single course of chemotherapy, such as [previous treatment], one week prior to infusion. Figure 10 As specified. CART19 cells are... Figure 10 The doses indicated were administered intravenously over a 3-day divided dose regimen (10%, 30%, and 60%), with a second dose administered on day 10 if feasible; only patients with sufficient UPN 02 cells were given for the second infusion. Toxicity and response were assessed in subjects at frequent intervals for at least 6 months. This protocol was approved by the US Food and Drug Administration, the Recombinant DNA Advisory Committee, and the Institutional Review Board of the University of Pennsylvania. The first day of infusion was designated as study day 0.
[0248] Subject: Clinical summary
[0249] Clinical summary Figure 10The following is an overview, and a detailed history is provided elsewhere in this article. Patient UPN01 was first diagnosed with stage II B-cell CLL at age 55. The patient was asymptomatic and observed for approximately 1–1 / 2 years until treatment for progressive lymphocytosis, thrombocytopenia, adenosis, and splenomegaly was required. During this time period, the patient received the current lines of therapy. The most recent therapy consisted of two cycles of pentostatin, cyclophosphamide, and rituximab two months prior to CART-19 cell infusion, with minimal response. The patient subsequently received one cycle of bendamustine as lympholytic chemotherapy prior to CART-19 cell infusion.
[0250] Patient UPN 02, aged 68, was first diagnosed with CLL when presenting with fatigue and leukocytosis. The patient remained relatively stable for 4 years, during which time progressive leukocytosis (195,000 / μl), anemia, and thrombocytopenia requiring treatment developed. Karyotype analysis revealed that CLL cells had lost chromosome 17p. Due to the progressive disease, the patient was treated with alemtuzumab, achieving partial remission, but within 18 months, the disease progressed again. The patient was boosted with alemtuzumab for 18 weeks, achieving partial remission and a 1-year progression-free interval. The patient subsequently received 2 cycles of bendamustine and rituximab without significant response. Figure 5A Prior to CAR-19 cell infusion, the patient received bendamustine as a single-agent chemotherapy for lympholytic depletion.
[0251] Patient UPN 03 presented with asymptomatic stage I CLL at age 50 and was subsequently observed for several years. The patient had progressive leukocytosis (white blood cell count 92,000 / μl) and progressive adenosis requiring treatment. The patient received two cycles of rituximab and fludarabine, which resulted in normalization of blood cell counts and significant improvement, although the adenosis was not completely resolved. The patient had a progression-free interval of approximately 3 years. Karyotype testing revealed a deletion of chromosome 17p in the cells, and FISH confirmed TP53 deletion in 170 out of 200 cells. Over the next few years, the patient required three different lines of therapy for progressive leukocytosis and adenosis. Figure 10 Finally, the patient received alemtuzumab for 6 months prior to CART-1 cell infusion, achieving partial remission. Prior to CART-19 cell infusion, the patient received pentostatin and cyclophosphamide as lympholytic chemotherapy.
[0252] Carrier generation
[0253] The CD19-BB-Z transgenic vector (GeMCRIS 0607-793) was designed and constructed as described (Milone et al., 2009, Mol Ther. 17:1453-1464). The lentiviral vector was produced as described using Lentigen's three-plasmid production method according to current good manufacturing practices (Zufferey et al., 1997, Nature Biotechnol 15:871-875).
[0254] Preparation of CART19 cell products
[0255] Methods for preparing T cells using paramagnetic polystyrene beads coated with anti-CD3 and anti-CD28 monoclonal antibodies have been described (Laport et al., 2003, Blood 102:2004-2013). Lentiviral transduction was performed as described (Levine et al., 2006, Proc Natl Acad Sci USA 103:17372-17377).
[0256] Methods for calculating tumor burden
[0257] Estimate the CLL load at baseline, such as Figure 10 As shown. Calculate the number of CLL cells in bone marrow, blood, and secondary lymphoid tissues as follows.
[0258] Bone marrow: In healthy adults, bone marrow comprises approximately 5% of total body weight (Woodard et al., 1960, Phys MedBiol, 5:57-59; Bigle et al., 1976, Health Phys 31:213-218). Bone marrow in iliac crest samples has an increasing percentage of inactive (fatty) bone marrow with age, rising from 20% of total bone marrow at age 5 to approximately 50% at age 35, where it remains stable until age 65, and then rises to approximately 67% of inactive bone marrow by age 75 (Hartsock et al., 1965, Am J Clin Path 43:326-331). The international reference values for the total bone mass of active (erythrocyte) and inactive (adipose) bone marrow in 35-year-old men are currently set at 1170g and 2480g, respectively (Basic anatomical and physiological data for use in radiological protection: The Skeleton in Annals of the ICRP, Vol. 25 (ed. Smith, H.) 58-68 (Report of Task Group 2 of the International Commission on Radiation Protection, Oxford, 1995)). Adult men aged 35 to 65 years have bone marrow comprising 5.0% of total body weight, consisting of 1.6% active (erythrocyte) bone marrow and 3.4% inactive (adipose) bone marrow (Basic anatomical and physiological data for use in radiological protection: The Skeleton in Annals of the ICRP). ICRP, Vol. 25 (ed. Smith, H.) 58-68 (Report of Task Group 2 of the International Commission on Radiation Protection, Oxford, 1995). Based on bone marrow biopsies and aspirate specimens, the weight of CLL cells at baseline was calculated for three patients, as shown in Table 1. These estimates of total CLL bone marrow mass were then calculated using 1 kg = 10⁻⁶. 12 The number of cells that transform into the total number of CLL cells in the bone marrow, and the resulting number is shown in Figure 10These calculations are based on the assumption that CLLs are uniformly distributed in the bone marrow. For patient UPN 01, calculations are shown for bone marrow biopsies obtained before bendamustine chemotherapy and aspirates obtained after bendamustine and before CART19 infusion. Due to technical limitations of day-1 aspirates, the number of day-1 aspirates is less precise compared to day-14 biopsy specimens. Patient UPN 02 has a single pre-treatment biopsy specimen showing complete bone marrow replacement by CLLs. This patient has an unchanged specimen on day 30 after CART19. Bone marrow burden for patient UPN 03 is calculated based on chemotherapy and before CART19 biopsy.
[0259] Table 1: Bone Marrow Quality
[0260]
[0261]
[0262] Blood: Only patient UPN 02 had a high CLL tumor burden in their blood prior to CART19 infusion. Flow cytometry showed that the cells had a typical phenotype as a clonal population of CD5+CD10-CD19+CD20(weak)+CD23(variable)+IgM-B cells with weak (dim) surface κ restriction. Approximately 35% of the CLL cells co-expressed CD38. The CLL burden was not cleared by 3 cycles of bendamustine chemotherapy and was present at the time of CART19 infusion. At the time of CART19 infusion, the CLL count in the blood was 55,000 cells / μL. Assuming a blood volume of 5.0L, patient UPN 02 had 2.75 × 10⁻⁶ cells / μL in their blood on day 0. 11 CLL cells. Normal total WBCs were given in patients UPN 01 and 03, and the circulating disease burden in these patients was not calculated, which would lead to a slight underestimation of the total body burden.
[0263] Secondary lymphoid tissue: The volume of lymphadenopathy and splenomegaly was quantified on axial CT scans using FDA-approved software. This volume was measured only in the chest, abdomen, and pelvis. Mass was measured in all patients at the level plane from the T1 vertebral body to the bifurcation of the common femoral artery, and in some patients, also in the inguinal region (nodes). Nodes and bony ends in the head / neck were excluded from the analysis and from the baseline CLL target cell count, which would also result in a slight underestimation of the total body load. Patients UPN 01 and 03 had sustained complete remission for more than 6 months, and therefore the formula (baseline volume - month 3 volume) was used to determine the reduction in tumor load from baseline; patient UPN 02 had stable disease in adenopathy, and therefore baseline tumor mass was estimated by subtracting a reference spleen volume from an age-matched healthy male (Harris et al., 2010, Eur J Radiol 75:e97-el01). Baseline tumor mass was determined using a density method (1 kg / L density, and 1 kg = 10⁻⁶). 12 Transformation into CLL cells was performed using either a single cell method or a volumetric method (CLL cells were 10 μM in diameter or 600 fL, assumed to be spherical), and both values were displayed. Figure 10 The tumor volumes in the secondary lymphoid tissue of the three patients are shown in Table 2 below, as calculated from available CT scans.
[0264] Table 2: Tumor Volume
[0265]
[0266] The baseline CT scan for patient UPN 01 was performed 8 days after two cycles of pentostatin / cyclophosphamide / rituximab and showed no response to the chemotherapy regimen compared to the previous CT scan. This patient had one cycle of bendamustine prior to CART19, and therefore, the potential contribution of bendamustine and CART19 cannot be ruled out for the change in tumor volume in UPN 01 from day -37 to day +31. Similarly, the change in tumor volume in UPN 03 reflects the combined effect of one cycle of pentostatin / cyclophosphamide and CART19.
[0267] Methods for estimating the effective E:T ratio in patients
[0268] The E:T ratio of injected CAR T cells to killed tumor cells is calculated using the number of tumor cells present at the time of CAR T cell injection and the number of injected CAR T cells (Carpenito et al., 2009, Proc Natl Acad Sci U SA 106:3360-3365). For the present invention, the following is used: Figure 10The number of injected CART19+ T cells shown is not accurate because it is impossible to determine the absolute number of CART19+ T cells present in the body with sufficient accuracy or precision. (See Figure 2 and...) Figure 6 The available data depicting CART19 expansion in blood and bone marrow are robust. However, it is impossible to determine the transport of CART19 to other sites such as secondary lymphoid tissues, resulting in significant uncertainty regarding the total number of CART19 cells acquired in vivo at maximum tumor reduction. The calculated values in Table 3 were used to obtain the effective E:T ratio.
[0269] Table 3: Calculated in vivo CART19E:T ratio
[0270]
[0271] 1 = Average of density and volume methods
[0272] 2 = The patient was unresponsive to UPN02 in the bone marrow and had a partial reduction in tumor mass in the adenosis (3.1E+11 cells) as measured by CT in the spleen and lymph nodes. For response in the blood, see [link to relevant documentation]. Figure 5A .
[0273] Sample processing and freezing
[0274] Samples (peripheral blood, bone marrow) were collected in pale purple-topped (K2EDTA) or red-topped (additive-free) vacuum tubes (Becton Dickinson) and transferred to the TCSL within 2 hours of collection. Samples were processed within 30 minutes of receipt according to established laboratory SOPs. Peripheral blood and bone marrow mononuclear cells were purified using Ficoll-Paque (GE Healthcare, 17-1440-03) via Ficoll density gradient centrifugation and purified using 5100 Cryo 1 ° Cryopreservation containers were frozen in RPM1 (Gibco 11875-135) supplemented with 4% human serum albumin (Gemini Bio-Products, 800-120), 2% Hetastarch (Novaplus, NDC0409-7248-49), and 10% DMSO (Sigma, D2650); after 24–72 hours at -80°C, cells were transferred to liquid nitrogen for long-term preservation. Apheresis samples were obtained from the University of Pennsylvania Hospital Blood Bank and processed in CVPF using a Ficoll gradient purification process, and then frozen as described above. Immediate viability upon thawing was greater than 85% at the time of evaluation. For serum separation, samples were allowed to coagulate at room temperature for 1.5–2 hours; serum was separated by centrifugation, and 100 μl aliquots were frozen individually at -80°C.
[0275] cell lines
[0276] K562 (CML, CD19-negative) was obtained from ATCC (CCL-243). K562 / CD19—a generous gift from Carmine Carpenito—is K562 transduced at 100% frequency to express the CD19 molecule. NALM-6, a CD19-positive non-T, non-BALL precursor B cell line (Hurwitz et al., 1979, Int J Cancer 23:174-180) and confirmed to express the CD19 antigen, is a generous gift from Laurence Cooper. These cell lines were maintained in R10 medium (RPMI 1640 (Gibco, 11875)) supplemented with 10% fetal bovine serum (Hycione) and 1% Pen-Strep (Gibco, 15140-122). Peripheral mononuclear cells (ND365) from healthy donors were obtained via apheresis from the Human Immunology Center at the University of Pennsylvania, processed as described above, and frozen.
[0277] DNA isolation and Q-PCR analysis
[0278] Whole blood or bone marrow samples were collected in pale purple-topped (K3EDTA) BD vacutainer tubes (Becton Dickinson). Genomic DNA was isolated directly from whole blood using the QIAamp DNA Blood Medium Extraction Kit (Qiagen) and established laboratory SOPs, quantified by spectrophotometer, and stored at -80°C. Q-PCR analysis of genomic DNA samples was performed in batches using 123–200 ng of genomic DNA / time point, ABI Taqman technology, and confirmed detection of integrated CD19CAR transgenic sequences. From qualifying studies and pre-established acceptance ranges, pass / fail parameter ranges, including the standard curve slope and r, were calculated. 2 The ability to accurately quantify reference samples (1000 copies / spike) and the absence of amplification in healthy donor DNA samples was assessed. Primers / probes for the CD19CAR transgene were as described (Milone et al., 2009, Mol Ther 17:1453-1464). To determine the copy number / unit of DNA, an 8-point standard curve was generated, which was calculated by multiplying 100 ng of non-transduced control genomic DNA by 10... 6Composed of -5 copies of lentiviral plasmid. Each data point (sample, standard curve, reference sample) was evaluated in triplicate, and the mean was reported. For patient UPN 01, all reported values were derived from positive Ct values in 3 / 3 replication, with a %CV of less than 0.46%. For patient UPN 02, except for the sample from day +177 (2 / 3 replication positive, high %CV), all reported values were derived from positive Ct values in 3 / 3 replication, with a %CV of less than 0.72%. For patient UPN 03, except for the samples from day +1 (2 / 3 replication positive, 0.8% CV) and day +3 (2 / 3 replication positive, 0.67% CV), all reported values were derived from positive Ct values in 3 / 3 replication, with a %CV of less than 1.56%. The limit of quantitation (LLOQ) was determined by the standard curve as 2 copies / µg DNA (10 copies / 200ng input DNA); mean values below the LLOQ (i.e., reportable but not quantifiable) are considered approximate. Parallel amplification reactions controlling the amount of interrogated DNA were performed using the following: 12–20 ng of input genomic DNA, primer / probe combinations specific to the non-transcribed genomic sequence upstream of the CDKN 1A gene (GENEBANK: Z85996) (sense primer: GAAAGCTGACTGCCCCTATTTG; SEQ ID NO.25, antisense primer: GAGAGGAAGTGCTGGGAACAAT; SEQ ID NO.26, probe: VIC-CTC CCC AGT CTC TTT; SEQ ID NO.27), and an 8-point standard curve generated from diluted control genomic DNA; these amplification reactions produced a correction factor (CF) (ng detected / ng input). Copies of transgene / micrograms of DNA were calculated using the following formula: copies / input DNA (ng) calculated from the CD19 standard curve × CF × 1000 ng. The accuracy of this assay was determined by quantifying the labeling ability of injected cell products using Q-PCR according to the following formula: Average labeling = Detected copies / injected DNA × 6.3 pg DNA / male somatic cells × CF, compared with the positivity of transgenes by flow cytometry using CAR-specific detection reactants. These blinded determinations yielded 22.68% labeling for UPN 01 injected products (22.6%, by flow cytometry), 32.33% labeling for UPN 02 injected products (23%, by flow cytometry), and 4.3% labeling for UPN 03 injected products (4.7% labeling, by flow cytometry).
[0279] Cytokine analysis
[0280] Quantification of soluble cytokines was performed using Luminex bead array technology and kits purchased from Life Technologies (Invitrogen). Assays were performed using an 8-point standard curve generated from 3-fold serial dilutions, according to the manufacturer's protocol. Each standard point and sample was evaluated in duplicate at a 1:3 dilution; the calculated %CV for both measurements was less than 15%. Data were analyzed using 5-parameter logistic regression analysis on a Bioplex 200 and with Bioplex Manager version 5.0 software. The standard curve quantification range was determined from 80–120% (observed / expected values). Individual analyte quantification ranges are reported in the figure description.
[0281] Cell assay for detecting CAR function
[0282] After thawing and overnight incubation in TCM, cell functionality was evaluated by measuring CD107 degranulation in response to target cells. The degranulation assay utilized 1×10⁻⁶ cells in a final volume of 500 μL on a 48-well plate. 6 PBMC and 0.25×10 6 Target cells were subjected to treatment at 37°C in the presence of CD49d (Becton Dickinson), anti-CD28, monensin (e-Bioscience), and CD107a-FITC antibody (eBiosciences) for 2 hours, essentially as described (Betts et al., 2003, J Immunol Methods 281:6578).
[0283] antibody reactants
[0284] These studies used the following antibody: MDA-CAR—a murine anti-CD19 CAR antibody conjugated to Alexa647, a generous gift from Dr. Bipulendu Jena and Dr. Laurence Cooper (MD Anderson Cancer Center). For multiparameter immunophenotyping and functional assays: anti-CD3-A700, anti-CD8-PE-Cy7, anti-PD-1-FITC, anti-CD25-AF488, anti-CD28-PercP-Cy5.5, anti-CD57-eF450, anti-CD27-APC-eF780, anti-CD17-APC-eF780, anti-CD45RA-eF605NC, CD107a-FITC (all from e-Bioscience), anti-CD4-PE-Texas Red and Live / Dead Aqua (from Life Technologies), and anti-CD14-V500 and anti-CD16-V500 (from Becton Dickinson). For routine immunophenotypic analysis: CD3-PE, CD14-APC, CD14-PE-Cy7, CD16-FITC, CD16PE-Cy7, CD19-PE-Cy7, CD20-PE, all were derived from Becton Dickinson.
[0285] Multiparameter flow cytometry
[0286] Cells were evaluated by flow cytometry, either fresh after Ficoll-Paque treatment or frozen after standing overnight, at a density of 2 × 10⁻⁶. 6 Cells / ml density was determined in T cell culture medium (TCM) (X-vivo 15 (Lonza, 04-418Q)) supplemented with 5% human AB serum (GemCall, 100-512), 1% Hepes (Gibco, 15630-080), 1% Pen-Strep (Gibco, 15140-122), 1% Glutamax (Gibco, 35050-061), and 0.2% N-acetylcysteine (American Regent, NDC05 17-7610-03). Multiparametric immunophenotypic analysis was performed using FMO staining as described in the main text, on 4 × 10⁴ cells / ml. 6 Total cells / condition. Cells were cultured on ice at 1 × 10⁻⁶ concentrations of antibody and reactant as recommended by the manufacturer. 6Cells were stained at a density of 1 cell / 100 μl PBS for 30 min, rinsed, resuspended in 0.5% paraformaldehyde, and obtained using a modified LSRII (BDImmunocytometry system) equipped with blue (488 nm), violet (405 nm), green (532 nm), and red (633 nm) lasers and appropriate filter sets for detection and separation of the above antibody combinations. A minimum of 100,000 CD3+ cells were obtained for each staining. For functional assays, cells were rinsed, stained with surface markers, resuspended in 0.5% paraformaldehyde, and obtained as above; a minimum of 50,000 CD3+ events were collected for each staining condition. Compensation values were determined using single antibody staining and BD compensation beads (Becton Dickinson) and calculated and automatically applied by the instrument. Data were analyzed using FlowJo software (version 8.8.4, Treestar). For routine immunophenotypic analysis, cells were obtained using the Accuri C6 cell counter equipped with blue (488 nm) and red (633 nm) lasers. Compensation values were determined using single antibody staining and BD compensation beads (Becton Dickinson) and calculated manually. Data were analyzed using the C-Flow software analysis package (version 1.0, 264.9, Accuri cell counter).
[0287] The patient's past medical history and response to treatment
[0288] Clinical treatment summary Figure 10Overview. Patient UPN 01 was first diagnosed with stage II B-cell CLL at age 55. The patient was asymptomatic and observed for approximately 1–1 / 2 years until treatment for progressive lymphocytosis, thrombocytopenia, adenosis, and splenomegaly was required. After 4 cycles of fludarabine, the patient achieved complete remission with completely normal blood cell counts and CT scans. Progression was recorded within 5 months, with asymptomatic lymphocytosis, thrombocytopenia, and increased adenosis. The patient was observed asymptomatic for approximately 3 years and subsequently required treatment with rituximab and fludarabine for progressive leukocytosis, anemia, and thrombocytopenia. The patient received 4 cycles of rituximab and fludarabine, resulting in partial improvement in blood cell counts. The patient again progressed within a year, requiring treatment clearly indicated by leukocytosis (WBC 150,000 / μl) and thrombocytopenia (platelet count 30,000 / μl), and was treated with alemtuzumab with normal blood cell counts. Progression was recorded within 13 months. The patient then received a single-agent rituximab with no significant response, followed by rituximab, cyclophosphamide, vincristine, and prednisone (R-CVP) for two cycles with minimal response, followed by lenalidomide. Lenalidomide was discontinued due to toxicity. The patient then received two cycles of pentostatin, cyclophosphamide, and rituximab with minimal response.
[0289] Later, the patient received bendamustine as lymphoblastic chemotherapy 4 days prior to CAR-T19 cell infusion. Prior to treatment, WBC count was 14,200 / μl, heme was 11.4 gm / dl, platelet count was 78,000 / μl, and ALC was 8,000 / μl. CT scan showed spreading adenosis and extensive bone marrow infiltration with CLL (67% cells). The patient received 1.6 × 10⁻⁶ cells / mL. 7 CART-19 cells / kg (1.13×10⁻⁶) 9 Total CART19 cells (as assessed by FACS). No infusion toxicity. The patient developed neutropenia approximately 10 days after bendamustine and 6 days after CART19 cell infusion, and began experiencing fever, chills, and transient hypotension 10 days after the first CART19 infusion. Simultaneously, chest X-ray and CT scan confirmed left upper lobe pneumonia treated with antibiotics. The fever persisted for approximately 2 weeks and resolved when neutrophils recovered. The patient has not had any further infections or systemic symptoms.
[0290] The patient achieved rapid and complete remission as depicted in Figure 5. Circulating CLL cells were undetectable in the blood by flow cytometry between 1 and 6 months post-infusion. Bone marrow examination by morphology and flow cytometry at 1, 3, and 6 months post-CAR-19 cell infusion showed a persistent absence of lymphocytic infiltration. CT scans at 1 and 3 months post-infusion showed complete resolution of the adenomatous dysplasia. The patient had persistent leukopenia (WBC 1000–3900 / µL) and thrombocytopenia (platelets, approximately 100,000 / µL), and mild hypogammaglobulinemia (IgG 525 mg / dL, normal 650–2000 mg / dL), but no infectious complications.
[0291] Patient UPN 02 was treated with CAR-T19 cells at age 77. This patient had a history of coronary artery disease and was initially diagnosed with CLL in 2000 at age 68 when experiencing fatigue and leukocytosis. The patient remained relatively stable for four years, at which point the patient developed progressive leukocytosis (195,000 / μl), anemia, and thrombocytopenia requiring treatment. Genetic testing at that time revealed a deletion of chromosome 17p in the CLL cells. Due to the progressive disease, the patient received a 12-week course of alemtuzumab, achieving partial remission and improved blood cell counts. Within 18 months, the patient developed progressive leukocytosis, anemia, thrombocytopenia, and splenomegaly. Karyotype analysis confirmed the deletion of chromosome 17p, and now a deletion of chromosome 13q has been identified. The patient was treated again with alemtuzumab for 18 weeks, with improvement in leukocytosis and stabilization of anemia and splenomegaly. Within one year, the patient showed signs of progressive leukocytosis, anemia, and thrombocytopenia. Treatment included two cycles of bendamustine and rituximab, which led to stabilization of the condition, but not as... Figure 5A The significant improvement shown.
[0292] Prior to CAR-19 cell infusion, the patient had only received bendamustine as lymphoblastic chemotherapy, administered in three fractions, totaling 4.3 × 10⁴ cells. 6 CART19 cells / kg (4.1×10⁻⁶) 8 The patient (total cells) experienced a transient fever reaching 102 degrees Celsius, lasting 24 hours. On day 11 following the initial infusion, the patient received 4.1 × 10⁻⁶ cells. 8 (4.3×l0 6Enhancement with CART-19 cells (per kg) was administered, and this infusion was complicated by fever, chills, and tachypnea without hypoxia requiring 24-hour hospitalization. There was no evidence of myocardial ischemia, and the symptoms resolved. On day 15 after the initial CART-19 infusion and day 4 after the enhanced CART-19 cell infusion, the patient was admitted to hospital with high fever (up to 104℉), chills, and shivering. Extensive testing using blood and urine cultures and CXR failed to identify the source of infection. The patient complained of tachypnea without hypoxia. Echocardiography showed severe impairment of motor function. Ejection fraction was 20%. The patient received prednisone 1 mg / kg for one day and 0.3 mg / kg for approximately one week. This resulted in rapid resolution of the fever and heart failure.
[0293] Along with the onset of high fever, the patient experienced a rapid decrease in lymphocytes from the peripheral blood, such as... Figure 5A The patient presented with persistent circulating CLL, stable moderate anemia, and thrombocytopenia, despite a normalized white blood cell count. One month post-treatment, bone marrow showed persistent, extensive CLL infiltration, despite significant peripheral blood cytopenia, and CT scan revealed partial reduction in adenopathy and splenomegaly. Five months after CAR-T19 cell infusion, the patient developed progressive lymphocytosis. Nine months post-infusion, the patient maintained lymphocytosis (16,500 / μl) and stable, moderate anemia and thrombocytopenia, with stable adenopathy. The patient remained asymptomatic and has not received further treatment.
[0294] Patient UPN 03 was diagnosed with asymptomatic stage I CLL at age 50 and was subsequently observed for 6 years. Later, the patient developed progressive leukocytosis (WBC count 92,000 / μl) and progressive adenosis requiring treatment. The patient received two cycles of rituximab and fludarabine, resulting in normalization and significant improvement in blood cell counts, although the adenosis was not completely resolved. The patient had a progression-free interval of approximately 3 years, followed by rapidly progressive leukocytosis (WBC 165,000 / μl) and progressive adenosis requiring treatment in the next 6 months. The patient received one cycle of fludarabine and three cycles of rituximab and fludarabine, resulting in normalized blood cell counts and resolution of palpable adenosis. The patient had a progression-free interval of approximately 20 months until the patient again rapidly developed progressive leukocytosis and adenosis. At this point, the bone marrow was extensively infiltrated by CLL, and karyotype analysis showed that the cells contained deletions of chromosome 17p, with FISH confirming TP53 deletion in 170 / 200 cells. The patient received one cycle of rituximab and bendamustine, followed by four cycles of bendamustine only (due to a severe allergic reaction to rituximab). The patient initially had normalized blood cell counts but developed progressive leukocytosis and adenosis shortly after therapy was discontinued.
[0295] Autologous T cells were collected from the patient (UPN3) using apheresis and cryopreserved. The patient was subsequently treated with alemtuzumab for 11 weeks with an excellent hematologic response. Adenopathy, although not completely resolved, improved. Over the next 6 months, the patient's condition remained active but stable. Later, prior to CAR-T19 cell infusion, the patient received pentostatin and cyclophosphamide as lymphocyte depletion chemotherapy.
[0296] Three days after chemotherapy but before cell infusion, the bone marrow was hypercellular (60%), with approximately 40% involving CLL. Due to inherent manufacturing limitations of apheresis collection from CLL patients, as described in Table 3 and (Bonyhadi et al., 2005, J Immunol 174:2366-2375), this patient received a total of 1.46 × 10⁻⁶ cells infused over 3 days. 5 1.42 × 10⁶ CART19+ cells per kg 7(Total CART19+ cells). No infusion toxicity was observed. Fourteen days after the initial infusion, the patient began to present with symptoms of treatment-associated chills, fever up to 102°F, nausea, and diarrhea. The patient had no respiratory or cardiac symptoms. By day 22 post-infusion, tumor lysis syndrome was clearly diagnosed by elevated LDH and uric acid, complicated by renal insufficiency. The patient was hospitalized and treated with fluid resuscitation and raburicase, and uric acid and renal function rapidly normalized. Detailed clinical evaluation was performed using CXR, blood, urine, and stool cultures, all of which were negative or normal.
[0297] Within one month of CART-19 infusion, the patient had cleared circulating CIX from the blood and bone marrow through morphological, flow cytometry, cytogenetic, and FISH analyses, and CT scans showed resolution of the adenomatous dysplasia (Figure 5C). The patient's remission has lasted for more than eight months since the initial CART19 cell infusion.
[0298] The experimental results will now be described.
[0299] Clinical protocol
[0300] Three patients with advanced, chemotherapy-resistant CLL were recruited for the experimental clinical trial, as depicted in Figure 1. All patients underwent extensive pretreatment with multiple chemotherapy and biological regimens, such as... Figure 10 As shown. Two of the patients had p53-deficient CLL—a deficiency that predicts poor response to conventional therapy and rapid progression (Dohner et al., 1995, Blood, 851580-1589). Each of the patients had a large tumor burden after preparatory chemotherapy, including extensive bone marrow infiltration (40 to 95%) and lymphadenopathy; the patient with UPN 02 also had significant peripheral lymphocytosis. CART19T cells such as Figure 1B The details of the fabrication and product characteristics for each patient are shown in Table 4. All patients were pretreated with lympholytic chemotherapy for 1–4 days prior to CAR19T cell infusion. Because the trial tested CARs incorporating the 4–1BB co-stimulatory signaling region, a fractionated-dose cell infusion schedule was used, as follows: Figure 1A The drawing.
[0301] Table 4: Release Standards of Apheresis Components and CART19 Products
[0302]
[0303]
[0304] 1 = Dosage #2.
[0305] 2 = The measured value on day 12 was below the LOQ and had been decreasing since the beginning of expansion, consistent with the presence of residual plasmid DNA from the self-vector. This information was submitted to the FDA as revised.
[0306] 3 = Product release from FACS-based surface staining.
[0307] 4 = Treatment exceptions permitted by the standard for release of external DSMC and IRB.
[0308] CART19's in vivo expansion and persistence, and its delivery to the bone marrow.
[0309] It is believed that utilizing CAR+ T cells expanded with CD3 / CD28 beads and expressing the 4-1BB signaling domain improves CARs lacking 4-1BB. A Q-PCR assay was developed to quantitatively track CART19 cells in blood and bone marrow. All patients exhibited CART19 cell expansion and persistence in the blood for at least 6 months, as illustrated in Figures 2A and 2C. Specifically, patients UPN 01 and UPN 03 had 1,000 to 10,000-fold expansion of CAR+ T cells in the blood during the first month post-infusion. Peak expansion levels coincided with the onset of clinical symptoms post-infusion in patients UPN 01 (day 15) and patients UPN 03 (day 23). Furthermore, after an initial delay that could be simulated using first-order kinetics, CART19 T cell levels stabilized in all three patients, ranging from 90 to 180 days post-infusion. Significantly, CART19 T cells were also delivered to the bone marrow of all patients, although at levels 5 to 10 times lower than observed in the blood, as depicted in Figures 2D to 2F. Patients with UPN 01 and 03 showed a log-linear delay in bone marrow, with a disappearance T1 / 2 of approximately 35 days.
[0310] Induction of specific immune responses in blood and bone marrow compartments after CART19 injection
[0311] Serum samples from all patients were collected and batch analyzed to quantify cytokine levels, assessing a panel of cytokines, chemokines, and other soluble factors to evaluate potential toxicity and provide evidence of CART19 cell function, as depicted in Figure 3. Of the thirty analytes tested, eleven showed a 3-fold or greater change from baseline, including four cytokines (IL-6, INF-γ, IL-8, and IL-10), five chemokines (MIC-1α, MIC-1β, MCP-1, CXCL9, and CXCL10), and soluble receptors for IL-1Rα and IL-2Rα. Among these, interferon-γ showed the largest relative change from baseline. Interestingly, the peak time of cytokine elevations in UPN 01 and UPN 03 correlated temporally with the previously described clinical symptoms and peak CART19 cell levels in the blood. Only a modest change was recorded in patient UPN 02, possibly as a result of corticosteroid treatment administered to that patient. Elevated soluble IL-2 levels were not detected in the patient's serum, which is one of the preclinical fundamental principles of CAR+ T cell formation using the 4-1BB signaling domain, which has a reduced tendency to trigger IL-2 secretion compared to the CD28 signaling domain (Milone et al., 2009, Mol Ther. 17:1453-1464). This could be associated with sustained clinical activity, as previous studies have shown that CAR+ T cells can be induced by regulatory T cell suppression (Lee et al., 2011, Cancer Res 71:2871-2881) through CARs secreting large amounts of IL-2 or through the provision of exogenous IL-2 post-injection. Ultimately, as depicted in Figure 3D, robust induction of cytokine secretion was observed in the supernatant of bone marrow aspirate from UPN 03, which also coincided with the development and complete remission of tumor lysis syndrome.
[0312] Prolonged expression and establishment of memory CART19 cell populations in blood
[0313] A central question in CAR-mediated cancer immunotherapy is whether optimized cell manufacturing and co-stimulatory domains enhance the persistence of genetically modified T cells and allow for the establishment of CAR+ memory T cells in patients. Previous studies have not demonstrated robust expansion, prolonged persistence, and / or expression of CAR on T cells after infusion (Kershaw et al., 2006, Clin CancerRes 12:6106-6115; Lamers et al., 2006, J Clin Oncol 24:e20-e22; Till et al., 2008, Blood, 112, 2261-2271; Savoldo et al., 2011, J Clin Invest doi:10.1172 / JCI46110). Flow cytometry analysis of samples from both blood and bone marrow on day 169 post-infusion showed the presence of CAR19-expressing cells in UPN 03. Figure 4A and 4B ), and the absence of B cells, such as Figure 4A As depicted. Notably, by Q-PCR assays, all three patients exhibited persistent CAR+ cells at 4 months and longer, as shown in Figure 2 and Figure 6 The in vivo frequencies of CAR+ cells as depicted by flow cytometry closely matched values obtained from PCR assays of the CART19 transgene. Importantly, in patients UPN 03, only CD3+ cells expressed CAR19, as CAR19+ cells were undetectable in CD16 or CD14- positive subtypes, such as... Figure 4A As described, CAR expression was also detected on the surface of 4.2% of T cells in the blood of patient UPN 01 on day 71 post-infusion, as... Figure 7 What is depicted.
[0314] Next, using anti-CAR individual genotype antibody (MDA-647) and Figure 8 The gating strategy illustrated, multicolor flow cytometry was used to conduct more detailed studies to further characterize the expression, phenotype, and function of CART19 cells in UPN 03. Based on CAR19 expression, significant differences in the expression of memory and activation markers were observed between CD8+ and CD4+ cells. On day 56, CART19CD8+ cells initially exhibited a primary effector memory phenotype (CCR7-CD27-CD28-) consistent with prolonged and stable exposure to the antigen, as shown in the diagram. Figure 4CThe depiction is as follows. In contrast, CAR-negative CD8+ cells consist of a mixture of effector and central memory cells, with CCR7 expression in the cell subtype and large numbers in both CD27+ / CD28- and CD27+ / CD28+ fractions. Although both CART19 and CAR-negative cell populations substantially express CD57, this molecule is consistently co-expressed with PD-1 in CART19 cells, possibly reflecting the extensive replication history of these cells. Compared to the CAR-negative cell population, the overall CART19 CD8+ population lacks expression of both CD25 and CD127. By day 169, although the phenotype of the CAR-negative cell population remained similar to the day 56 sample, the CART19 population had evolved into a population containing a small number of cells with central memory cell characteristics, notably CCR7 expression, higher levels of CD27 and CD28, and CAR+ cells that were PD-1-negative, CD57-negative, and CD127-positive.
[0315] In the CD4+ compartment, on day 56, CART19 cells were characterized by a consistent lack of CCR7 distribution in both the CD57+ and - compartments, with CD27+ / CD28+ / PD-1+ cells dominating, and virtually no CD25 and CD127 expression. Figure 4B As depicted. In contrast, at this time point, CAR-negative cells were heterogeneous in terms of CCR7, CD27, and PD-1 expression, expressed CD127, and also contained a large population of CD25+ / CD127- (potentially regulatory T cells). By day 169, although CD28 expression remained consistently positive in all CAR+CD4+ cells, a subset of CAR19CD4+ cells had evolved towards a central memory phenotype with CCR7 expression, a higher percentage of CD27- cells, the emergence of a PD-1-negative subtype, and the acquisition of CD127 expression. CAR-negative cells remained reasonably consistent with their day 56 counterparts, except for a decrease in CD27 expression and a reduction in the percentage of CD25+ / CD127- cells.
[0316] In the blood, CART19 cells can maintain effector function after 6 months.
[0317] Besides short persistence and insufficient in vivo proliferation, limitations of previous experiments using CAR+T cells also include rapid loss of functional activity of infused T cells. High levels of CART19 cell persistence and surface expression of the CAR19 molecule in patients UPN 01 and 03 provided an opportunity to directly test anti-CD19-specific effector function in cells recovered from refrigerated peripheral blood samples. PBMCs from patient UPN 03 were co-cultured with target cells that were positive or negative for CD19 expression (Fig. 4d). Steady CD19-specific effector function of CART19 T cells was demonstrated by specific degranulation of CD19-positive but not CD19-negative target cells, as assessed by surface CD107a expression. Notably, exposure of the CART19 population to CD19-positive targets induced rapid internalization of surface CAR-19—as... Figure 8 The surface expression of CAR19 in the same effector cells was plotted using standard flow cytometry staining. The presence of co-stimulatory molecules on target cells did not require triggering CAR19 cell degranulation because the NALM-6 lineage does not express CD80 or CD86 (Brentjens et al., 2007, Clin Cancer Res 1:5426-5435). Effector function was evident at day 56 post-infusion and remained stable at day 169. Steady effector function in CAR+ and CAR-T cells was also demonstrated by pharmacological stimulation.
[0318] Clinical activity of CART19 cells
[0319] No significant toxicities were observed in any patient during the four-day period following injection, except for transient febrile reactions. However, between 7 and 21 days after the first injection, all patients subsequently developed significant clinical and laboratory toxicities. These toxicities were short-lived and reversible. Of the three patients treated to date, 2 CRs and 1 PR were achieved >6 months after CART1 injection according to standard guidelines (Hallek et al., 2008, Blood 111:5446). Details of each patient's past medical history and response to therapy are available in [details omitted]. Figure 10 Described in the text.
[0320] In short, patient UPN 01 developed a febrile syndrome 10 days after infusion, accompanied by chills and transient hypotension. The fever lasted approximately 2 weeks and resolved; the patient had no further systemic symptoms. The patient achieved rapid and complete remission, as depicted in Figure 5. Circulating CLL cells were undetectable in the blood by flow cytometry between 1 and 6 months post-infusion. Bone marrow analysis by morphology and flow cytometry at 1, 3, and 6 months post-CART19 cell infusion showed the continued absence of lymphocytic infiltration, as depicted in Figure 5B. CT scans at 1 and 3 months post-infusion showed resolution of adenosis, as depicted in Figure 5C. At the time of this report, complete remission lasted 10+ months.
[0321] Patient UPN 02 received two cycles of bendamustine and rituximab, resulting in a stable condition, such as... Figure 5A The patient was described as receiving a third dose of bendamustine as part of lympholytic chemotherapy prior to CART19T cell infusion. On day 11 after the first infusion and the day of the second CART19 cell booster, the patient developed fever up to 40°C, chills, and dyspnea, requiring 24-hour hospitalization. Fever and systemic symptoms persisted, and on day 15, the patient experienced transient heart failure; all symptoms resolved after the initiation of corticosteroid therapy on day 18. Simultaneously with the onset of high fever following CART19 infusion, the patient rapidly cleared p53-deficient CLL cells from the peripheral blood, such as… Figure 5A The patient presented with a reduced adenopathic portion, and one month after treatment, the bone marrow showed persistent, extensive CLL infiltration despite significant peripheral blood cytopenia. The patient remained asymptomatic.
[0322] Patient UPN 03 received pentostatin and cyclophosphamide as lympholytic chemotherapy prior to CART19 cell infusion. Three days after chemotherapy but before cell infusion, the bone marrow was hypercellular (60%), with approximately 50% involving CLL. The patient received a low dose of CART19 cells (1.5 × 10⁻⁶). 5 CAR+ T cells / kg, divided into 3 days). Furthermore, there was no acute infusion toxicity. However, 14 days after the initial infusion, the patient began experiencing chills, fever, nausea, and diarrhea. By day 22 post-infusion, tumor lysis syndrome was diagnosed, requiring hospitalization. The patient's systemic symptoms resolved, and within one month of CAR19 infusion, circulating CLL was cleared from the blood and bone marrow by morphological, flow cytometry, cytogenetic, and FISH analyses. CT scans showed abnormal adenomatous resolution, as depicted in Figures 5B and 5C. Complete remission persisted for over 8 months from the initial CAR19 cell infusion.
[0323] Considerations on the ratio of CART19 effectors to CLL target cells in vivo
[0324] Preclinical studies showed that large tumors could be resected, and that in humanized mice with an in vivo E:T ratio of 1:42, injection of 2.2 × 10⁻⁶ tumors was effective. 7 One CAR can eradicate 1×10 9 Tumors composed of 100 cells (Carpenito et al., 2009, Proc Natl Acad Sci USA 106:3360-3365), although these calculations do not account for T cell expansion after injection. Estimation of CLL tumor burden over time allows for calculation of tumor reduction and estimated CART19E:T ratios across three subjects based on the number of injected CAR+T cells. Tumor burden is calculated by measuring CLL load in bone marrow, blood, and secondary lymphoid tissues. Figure 10 The baseline tumor burden shown indicates that each patient had 10 tumors prior to CAR19 infusion. 12 Orders of magnitude of CLL cells (i.e., 1 kg tumor load). Patient UPN 03 had 8.8 × 10⁸ CLL cells in the bone marrow on day -1 (i.e., after chemotherapy and before CAR-T19 infusion). 11 Estimated baseline tumor burden of 10 CLL cells and 3.3–5.5 × 10⁶ cells in secondary lymphoid tissue. 11 The tumor mass measured per CLL cell depends on the method of volumetric CT scan analysis. Considering that only 1.4 × 10⁻⁶ UPN 03 was injected... 7 1,300 CART19 cells, using an initial total tumor burden of 1.3 × 10⁻⁶ cells. 12 An estimate of the number of CLL cells (with no CLL cells detectable after treatment) yielded an impressive E:T ratio of 1:93,000. Similar calculations were performed for UPN 01 and UPN 02, yielding effective in vivo E:T ratios of 1:2200 and 1:1000 (as shown in Table 3). Finally, the contribution of continuous killing of CART19 T cells, combined with >1,000-fold in vivo CART19 expansion, may contribute to the potent anti-leukemic effect mediated by CART19 cells.
[0325] T-cell expression of chimeric receptors establishes memory and potent antitumor effects in patients with advanced leukemia.
[0326] Limited in vivo expression and effector function of CARs are central limitations in trials testing first-generation CARs (Kershaw et al., 2006, Clin Cancer Res 12:6106-6115; Lamers et al., 2006, J Clin Oncol 24:e20-e22; Till et al., 2008, Blood, 112, 2261-2271; Park et al., 2007, Mol Ther 15:825833; Pule et al., 2008, Nat Med 14:1264-1270). Based on clinical modeling demonstrating the improved durability of CARs containing the 4-1BB signaling module (Milone et al., 2009, Mol Ther. 17:1453-1464; Carpenito et al., 2009, Proc Natl Acad Sci USA 106:3360-3365), experiments were designed to develop a second-generation CAR engineered using lentiviral vector technology. This second-generation CAR was found to be safe in a chronic HIV infection setting (Levine et al., 2006, Proc Natl Acad Sci USA 103:17372-17377). These results show that when this second-generation CAR is expressed in T cells and cultured under conditions designed to promote the influx of central memory T cells (Rapoport et al., 2005, Nat Med 11:1230-1237; Bondanza et al., 2006, Blood 107:1828-1836), improved CAR T cell expansion was observed after infusion compared to previously reported. CART19 cells established CD19-specific cellular memory and killed tumor cells at an in vivo E:T ratio not previously achieved.
[0327] CART19 was the first CAR trial to incorporate the 4-1BB signaling domain and the first to utilize lentiviral vector technology. These results demonstrate effective CAR tracking to the tumor site, effectively establishing CD19-specific “tumor-infiltrating lymphocytes.” Significant in vivo expansion allows for the first demonstration that CARs directly recovered from patients can maintain effector function in vivo for months. Previous studies have suggested a preference for primary T cells, introducing first-generation CARs into virus-specific T cells (Pule et al., 2008, Nat Med 14:1264-1270); however, the results of introducing second-generation CARs into optimally co-stimulated primary T cells have challenged this notion. Not wishing to be bound by any specific theory, a cautionary note is warranted: with the dissolution of the kilogram-sized tumor burden in all three patients, accompanied by the potentially dangerously high levels of delayed release of cytokines in two of the patients, the clinical effects were profound and unprecedented. No classic cytokine storm effect was observed. However, this study was designed to mitigate this possibility through careful infusion of CART19 over three days.
[0328] The study found that very low doses of CAR elicited effective clinical responses. This is a pilot study demonstrating the safety of the CAR19 vector design. The observation that CAR19 cell doses several orders of magnitude lower than those tested in previous trials can provide clinical benefit has important implications for the future execution of CAR therapies on a wider scale and for the design of trials testing CARs targeting non-CD19 targets.
[0329] This study further indicates that CAR19 is expressed in both central memory and effector T cells, and this may contribute to their long-term survival compared to previous reports. Without being bound by any specific theory, CAR T cells can differentiate into a central memory-like state in vivo upon encountering and subsequently eliminating target cells expressing alternative antigens (e.g., CLL tumor cells or normal B cells). Indeed, 4-1BB signaling has been reported to promote memory development within the context of TCR signaling (Sabbagh et al., 2007, Trends Immunol 28:333-339).
[0330] The expanded proliferation and survival of CART19 have revealed previously unreported aspects of the pharmacokinetics of CAR T cells. Cytokine release kinetics in serum and bone marrow were observed to correlate with peak CART19 levels, suggesting a possible delay when CD19-expressing cellular targets become limited. The mechanism of expanded CART19 survival may involve the incorporation of the aforementioned 4-1BB domain or signaling via native TCR and / or CAR. An intriguing possibility is that expanded survival is associated with a population of CART19 already identified in bone marrow specimens, suggesting that CD19CARs can be maintained by encountering B-cell progenitors in the bone marrow. What, then, is responsible for the initial expansion of CART19 cells in vivo? With very few exceptions (Savoldo et al., 2011, J Clin Invest doi:10.1 172 / JCI461 10; Pule et al., 2008, NatMed 14:1264-1270), this study is the only one to omit the 1L-2 infusion, allowing CAR19 cells to potentially be expanded in response to homeostatic cytokines or more likely in response to leukemia targets and / or CD19 expressed on normal B cells. In the latter case, this could be an attractive feature for CARs targeting normal APCs, such as CD19 and CD20, because CAR19 self-renewal can potentially occur on normal cells, providing a mechanism for CAR memory and thus long-term tumor immune surveillance through a “self-inoculation / boost” mechanism. The mechanisms of this CAR19 homeostasis may require further investigation to elucidate the intrinsic and extrinsic mechanisms of persistence. Prior to these results, most researchers had regarded CAR therapy as a temporary form of immunotherapy. However, CARs with optimized signal transduction domains can mitigate the effects of induction and consolidation, as well as be used for long-term immune surveillance.
[0331] Effective anti-leukemic effects were observed in all three patients—including two with p53-deficient leukemia. Previous studies using CAR have had difficulty separating the antitumor effect from lympholytic chemotherapy. However, the concurrent and likely dependent on in vivo CAR-mediated delayed cytokine release in patients refractory to fludarabine indicated a CART19-mediated effective antitumor effect. These results do not rule out the role of chemotherapy in enhancing the CAR effect.
[0332] A thorough comparison of vector, transgenic, and cell manufacturing processes with results from ongoing studies from other centers is needed to gain a full understanding of the key characteristics required to achieve sustained function of CAR T cells in vivo. Unlike antibody therapies, CAR-modified T cells have the potential to replicate in vivo and long-term persistence, leading to sustained tumor control. The availability of off-the-shelf therapies composed of non-cross-resistant killer T cells has the potential to improve outcomes for patients with B-cell malignancies. For example, the limitation of antibody therapies using agents such as rituximab and bevacizumab is that the therapy requires repeated antibody infusions, which are inconvenient and expensive. The delivery of extended antibody therapies with anti-CD19scFv expressed on T cells following a single infusion of CAR1 cells (in this case, three of the three patients treated to date have continued for at least six months) offers many practical advantages, including convenience and cost savings.
[0333] Example 2: Chimeric antigen receptor-modified T cells in chronic lymphocytic leukemia
[0334] A lentiviral vector was designed to express a chimeric antigen receptor that is specific to the B-cell antigen CD19 and binds to both the CD137 (co-stimulatory receptor [4-1BB] in T cells) and CD3-ζ (signal transduction domain of the T-cell antigen receptor) signaling domains. Low-dose (approximately 1.5 × 10⁻⁶) infusions were observed in patients with refractory chronic lymphocytic leukemia (CLL). 5 Autologous chimeric antigen receptor-modified T cells (cells per kilogram of body weight) expanded to levels exceeding 1000 times the initial in vivo level. Delayed development and complete remission of tumor lysis syndrome were also observed in this patient.
[0335] Aside from tumor lysis syndrome, the only other grade 3 / 4 toxicity effect involving chimeric antigen receptor T cells was lymphopenia. The engineered cells remained at high levels in the blood and bone marrow for at least 6 months and continued to express chimeric antigen receptors. A specific immune response was detected in the bone marrow, accompanied by the loss of normal B cells and leukemia cells expressing CD19. Remission lasted for 10 months post-treatment. Hypogammaglobulinemia was a anticipated chronic toxicity effect.
[0336] The materials and methods used in these experiments are now described.
[0337] Materials and methods
[0338] Research Procedures
[0339] A self-designed, inactive lentiviral vector (GeMCRTS 0607-793) underwent preclinical safety testing, as previously reported (Milone et al., 2009, Mol Ther, 17:1453-64). Methods for T-cell preparation have also been previously described (Porter et al., 2006, Blood, 107:1325-31). Quantitative polymerase chain reaction (PCR) analysis was performed to detect chimeric antigen receptor T cells in blood and bone marrow. The lower limit of quantitation was determined based on a standard curve; average values below the lower limit of quantitation (i.e., reportable but not quantifiable) were considered approximate. The lower limit of quantitation was determined to be 25 copies per microgram of genomic DNA.
[0340] Soluble factor analysis was performed using serum from whole blood and bone marrow that was divided into aliquots for single use and stored at -80°C. Soluble cytokines were quantified using Luminex bead array technology and reactants (Life Technologies).
[0341] Apheresis #1
[0342] A 12-15 liter apheresis procedure is performed at the apheresis center. During this procedure, peripheral blood mononuclear cells (PBCs) are obtained for the production of CAR-19 T cells. At least 50 × 10⁶ cells are harvested from the single leukocyte extraction method. 9 100 white blood cells were used to produce CAR-19 T cells. Baseline blood white blood cells were also obtained and refrigerated.
[0343] Cytoreductive chemotherapy
[0344] Chemotherapy begins approximately 5–10 days before infusion so that CAR-19 cells can be delivered 1–2 days after chemotherapy is completed. Therefore, the timing of chemotherapy initiation depends on the length of the regimen. The aim of chemotherapy is to induce lymphopenia to facilitate the influx and steady-state expansion of CAR-19 cells. Chemotherapy may also be chosen to reduce the disease tumor burden. Cytoreductive chemotherapy is selected and administered by a community oncologist. The choice of chemotherapy depends on the patient's underlying disease and previous treatments. Fludarabine (30 mg / m² / day × 3 days) and cyclophosphamide (300 mg / m² / day × 3 days) are the agents of choice because they have the most experience in promoting adoptive immunotherapy. Several other acceptable regimens utilizing FDA-approved drugs are appropriate, including CHOP, HyperCVAD, EPOCH, DHAP, ICE, or other regimens.
[0345] Re-grading assessment
[0346] Limited re-stratification is performed upon completion of chemotherapy to provide baseline tumor burden measurements. This includes imaging, physical examination, and minimal residual disease (MRD) assessment. Subjects undergo the following pre-infusion tests: physical examination, adverse event recording, and blood draws for hematological, chemical, and pregnancy testing (if appropriate).
[0347] Preparation of CART-19T cells
[0348] Autologous T cells are engineered to express extracellular single-chain antibodies (scFv) specific to CD19. Extracellular scFv alters the specificity of transduced T cells for cells expressing CD19, a molecule whose expression is restricted on the surface of malignant cells and normal B cells. In addition to CD19 scFv, cells are also transduced to express intracellular signaling molecules consisting of either the TCRζ chain or a tandem signaling domain composed of the 4-1BB and TCRζ signaling modules. scFvs are derived from mouse monoclonal antibodies and therefore contain mouse sequences, while the signaling domains are entirely natural human sequences. CART-19 T cells are created by isolating T cells via apheresis and using lentiviral vector technology (Dropulic et al., 2006, Human Gene Therapy, 17:577-88; Naldini et al., 1996, Science, 272:263-7; Dull et al., 1998, J Virol, 72:8463-71) to introduce scFv:TCRζ:4-1BB into CD4 and CD8 T cells. In some patients, control scFv:TCRζ: was introduced into a subset of cells for competitive repopulation experiments. These receptors are “universal” because they bind antigens in an MHC-independent manner; therefore, a receptor construct can be used to treat a patient population with CD19 antigen-positive tumors.
[0349] The CAR construct was developed at the University of Pennsylvania, and the clinical-grade vector was manufactured by Lentigen. CAR-19 cells are based on... Figure 11 The method shown was used in the clinical cell and vaccine production facility at the University of Pennsylvania. At the end of cell culture, the cells were refrigerated in injectable frozen medium. In one or two bags, 2.5 × 10⁻⁶ cells were administered. 9 Up to 5×10 9Each bag contains a single-dose injection of CART-19-transduced T cells. Each bag contains an aliquot of frozen culture medium (volume determined by dose) containing the following injectable grades of reactants (% v / v): 31.25 plasmalyte-A, 31.25 dextran (5%), 0.45 NaCl, up to 7.50 DMSO, 1.00 glucan 40, 5.00 human serum albumin, approximately 2.5-5 × 10⁻⁵. 9 Each bag contains one autologous T cell. To increase safety, the initial dose is administered in divided doses on days 0, 1, and 2, with approximately 10% of cells on day 0, 30% on day 1, and 60% on day 2.
[0350] store
[0351] Bags containing CAR-19-transduced T cells (10 to 100 ml capacity) are stored in a monitored -135°C freezer under blood bank conditions. Injection bags are stored in the freezer until needed.
[0352] Cell thawing
[0353] After recording cells in the research pharmacy, frozen cells are transported to the subject's bedside in dry ice. A bag of cells is thawed at the bedside using a water bath maintained at 36°C to 38°C. The bag is gently massaged until the cells are just thawed. No frozen chunks should remain in the container. If CART-19 cell products show signs of damage or leakage in the bag, or otherwise indicate impairment, they should not be injected.
[0354] Preoperative medication
[0355] Side effects following T-cell infusion may include transient fever, chills, and / or nausea. Pre-treatment with acetaminophen 650 mg orally and diphenhydramine hydrochloride 25-50 mg orally or intravenously is recommended before CART-19 cell infusion. This medication regimen can be repeated every six hours as needed. If the patient has persistent fever that is not relieved by acetaminophen, a course of nonsteroidal anti-inflammatory drugs (NSAIDs) may be used. Patients are advised against receiving systemic corticosteroids such as hydrocortisone, prednisone, prednisolone (methylprednisolone preparation (Solu-Medrol)), or dexamethasone (Decadron) at any time, except in life-threatening emergencies, as these can have adverse effects on T-cells. If an acute infusion reaction to corticosteroids is required, an initial dose of 100 mg of hydrocortisone is recommended.
[0356] Application / Injection
[0357] Infusions begin 1-2 days after completion of chemotherapy. On the day of the first infusion, patients are assessed with differential CBC counts and CD3, CD4, and CD8 counts due to the partial induction of lymphopenia by the given chemotherapy. We do not wish to be bound by any specific theory, but believe 2.5-5 × 10⁻⁵. 9 The initial IV dose of 1 × 10⁻⁶ CART-19 cells is optimal for this regimen. This is because a healthy adult has approximately 1 × 10⁻⁶ cells. 12 The recommended total dose is approximately 0.5% of the total cell mass (Roederer, 1995, Nat Med, 1:621-7; Macallan et al., 2003, Eur J Immunol, 33:2316-26). The first dose is administered in divided doses on day 0 (10%), day 1 (30%), and day 2 (60%). The subject receives the infusion in an isolation room. The cells are thawed at the patient's bedside as described elsewhere in this document. The thawed cells are given at a tolerably rapid infusion rate so that the infusion lasts approximately 10–15 minutes. The transduced T cells are administered via rapid intravenous infusion at a flow rate of approximately 10–20 mL per minute through an 18-gauge latex-free Y-type transfusion set with a three-way stopcock. The infusion lasts approximately 15 minutes. One or two bags of CART-19 modified cells are transported on ice and administered to the subject while still cold. In subjects receiving a CART-19 cell mixture, the cells were administered simultaneously using a Y-adapter to facilitate mixing. Subjects underwent infusion and pre-treatment as described elsewhere in this document. Vital signs and pulse oximetry were assessed before administration, at the end of infusion, and every 15 minutes thereafter for one hour until these were stable and satisfactory. Blood samples were obtained before infusion and 20 minutes after infusion to determine baseline CART-19 levels. Patients experiencing toxicities from their previous cytoreductive chemotherapy had their infusion schedule delayed until these toxicities were resolved. Specific toxicities for which delayed T-cell infusion was permitted included: 1) pulmonary: requiring supplemental oxygen to maintain more than 95% saturation or the presence of progressive radiographic abnormalities on chest X-ray; 2) cardiac: new cardiac arrhythmias uncontrolled by medical treatment; 3) hypotension requiring vasopressor support; 4) active infection: positive blood cultures of bacteria, fungi, or viruses within 48 hours of T-cell infusion. Serum samples of potassium and uric acid were collected before the first infusion and two hours after each subsequent infusion.
[0358] Post-injection laboratory to assess implantation and persistence.
[0359] Subjects returned on days 4 and 10 following the initial CART-19 cell infusion for blood draws to assess serum cytokine levels and for CART-19 PCR to evaluate the presence of CART-19 cells. Subjects returned weekly for three weeks to undergo the following: physical examination, documentation of adverse events, and blood draws for hematological, chemistry, CART-19 cell transfer and persistence, and research lab testing.
[0360] Second injection
[0361] We do not wish to be bound by any specific theory, and believe that a second dose of CAR-19 cells can be administered to the patient on day 11, provided that the patient shows adequate tolerance to the first dose and produces sufficient CAR-19 cells. The dose is 2-5 × 10⁻⁵. 9 Total cells. Serum samples of potassium and uric acid can be collected two hours after injection.
[0362] Second blood component apheresis
[0363] At the apheresis center, a 2-liter apheresis procedure was performed. PBMCs were obtained for research and refrigerated. Subjects underwent the following: physical examination, recording of adverse events, and blood draw for hematological, chemistry, CAR-19 cell transfer and persistence, and research assays. Additionally, re-grading was performed to provide tumor burden measurements. Re-grading tests were determined by disease type and included imaging, MRD assessment, bone marrow aspiration, and biopsy and / or lymph node biopsy.
[0364] Monthly assessment 2 to 6 months after injection
[0365] Subjects returned monthly between 2 and 6 months after CAR-19 cell infusion. During these study visits, subjects underwent the following: concomitant medication administration, physical examination, recording of adverse events, and blood draws for hematological, chemistry, CAR-19 cell transfer and persistence, and research assays. HIV DNA testing was performed 2–6 months after CAR-19 cell infusion to rule out the presence of detectable RCLs.
[0366] Evaluations will be conducted quarterly after injection until two years later.
[0367] Subjects were evaluated quarterly after inoculation for up to 2 years. During these study visits, subjects underwent the following: concomitant drug administration, physical examination, recording of adverse events, and blood draws for hematological, chemistry, CAR-19 cell transfer and persistence, and research assays. HIV DNA testing was performed at 3 and 6 months after CAR-19 cell inoculation to rule out the presence of detectable RCLs.
[0368] The experimental results will now be described.
[0369] Patient's medical history
[0370] The patient was diagnosed with stage I CLL in 1996. After six years of observation, he first required treatment for progressive leukocytosis and adenosis. In 2002, he was treated with two cycles of rituximab plus fludarabine; this treatment resulted in normalization of blood cell counts and partial resolution of adenosis. In 2006, due to disease progression, he received four cycles of rituximab and fludarabine, again resulting in normalization of blood cell counts and partial regression of adenosis. This response was followed by a 20-month progression-free interval and a 2-year treatment-free interval. In February 2009, he developed rapidly progressive leukocytosis and relapsed adenosis. His bone marrow was extensively infiltrated by CLL. Cytogenetic analysis showed that 3 out of 15 cells contained deletions of chromosome 17p, and fluorescence in situ hybridization (FISH) testing showed that 170 out of 200 cells had deletions including TP53 on chromosome 17p. He received one cycle of rituximab and bendamustine and three additional cycles of bendamustine without rituximab (due to a severe allergic reaction). This treatment produced only a transient improvement in lymphocytosis. Progressive gonadal disease was recorded using computational computed tomography (CT) after treatment.
[0371] Autologous T cells were collected using leukocyte extraction and cryopreserved. The patient subsequently received alemtuzumab (anti-CD52, mature lymphocytes, cell surface antigen) for 11 weeks, resulting in improved hematopoiesis and partial resolution of adenosis. Over the next 6 months, his condition remained stable with persistent, extensive bone marrow involvement and spreading adenosis in multiple 1- to 3-cm lymph nodes. In July 2010, the patient was enrolled in a Phase 1 clinical trial of chimeric antigen receptor-modified T cells.
[0372] Cell injection
[0373] Autologous T cells from the patient were thawed and transduced with lentivirus to express the CD19-specific chimeric antigen receptor (Figure 12A); sequence identifiers for the lentiviral vector and related sequences are depicted in Table 5. Four days prior to cell infusion, the patient received chemotherapy designed to deplete lymphocytes (4 mg / m² of pentostatin and 600 mg / m² of cyclophosphamide) without rituximab (Lamanna et al., 2006, J Clin Oncol, 24:1575-81). Three days after chemotherapy but prior to cell infusion, the bone marrow was cellularly hypercellular, with approximately 40% involving CLL. Leukemia cells expressed κ light chains and CD5, CD19, CD20, and CD23. Cytogenetic analysis revealed two separate clones, both resulting in the loss of chromosome 17p and TP53 loci (46,XY,del(17)(p12)[5] / 46,XY,der(17)t(l7;21)(q10;q10)[5] / 46,XY
[14] ). The patient received a total of 3×10 8 1.42 × 10⁶ T cells, of which 5% were transduced. 7 1.46 × 10⁶ transduced cells 5 The doses (10% per kilogram of cells) were administered intravenously in three consecutive daily doses (10% on day 1, 30% on day 2, and 60% on day 3). No cytokines were administered post-injection. No toxic effects of the injection were recorded.
[0374] Table 5: Sequence identifiers of the pELPS-CD19-BBz transfer vector
[0375]
[0376]
[0377] Clinical response and assessment
[0378] Fourteen days after the first infusion, the patient began to experience chills and low-grade fever associated with grade 2 fatigue. Over the next five days, the chills worsened, and his temperature rose to 39.2°C (102.5°F), accompanied by chills, sweating, anorexia, nausea, and diarrhea. He had no respiratory or cardiac symptoms. Due to the fever, chest radiographs and blood, urine, and stool cultures were performed, all of which were negative or normal. On day 22 post-infusion, tumor lysis syndrome was diagnosed (Figure 12B). Uric acid levels were 10.6 mg / dL (630.5 μmol / L), phosphorus levels were 4.7 mg / dL (1.5 mmol / L) (normal range, 2.4 to 4.7 mg / dL [0.8 to 1.5 mmol / L]), and lactate dehydrogenase levels were 1130 U / L (normal range, 98 to 192). Evidence of acute kidney injury was present, with a creatinine level of 2.60 mg / dL (229.8 μmol / L) (baseline level <1.0 mg / dL [<88.4 μmol / L]). The patient was admitted to the hospital and treated with fluid resuscitation and rapurizase. Uric acid levels returned to normal within 24 hours, and creatinine levels returned to normal within 3 days; he was discharged on the 4th day of hospitalization. Lactate dehydrogenase levels gradually decreased and returned to normal over the following months.
[0379] By day 28 post-CART19 cell infusion, adenopathy was no longer apparent, and by day 23, there was no evidence of CLL in the bone marrow (Fig. 12C). The karyotype was now normal in 15 out of 15 cells (46, XY), and FISH testing was negative for TP53 deletion in 198 out of 200 cells examined; this was considered to be within the normal limits for a negative control. Flow cytometry analysis showed no residual CLL, and B cells were undetectable (<1% of cells within the CD5+CD10-CD19+CD23+ lymphocyte phylum). A CT scan performed on day 31 post-infusion showed resolution of adenopathy (Fig. 12D).
[0380] Physical examinations at three and six months post-CART19-cell infusion remained routine, with no apparent adenosis, and a CT scan at three months post-CART19-cell infusion showed persistent remission (Figure 12D). Bone marrow studies at three and six months, using morphological analysis, karyotype analysis (46, XY), or flow cytometry, also showed no evidence of CLL and a persistent lack of normal B cells. Remission had persisted for at least 10 months.
[0381] CART19 cell toxicity
[0382] No acute toxic effects were observed with cell infusion. The only recorded serious (grade 3 or 4) adverse event was the aforementioned grade 3 tumor lysis syndrome. The patient had grade 1 lymphopenia at baseline and grade 2 or 3 lymphopenia that began on day 1 post-treatment and continued for at least 10 months. Grade 4 lymphopenia was recorded on day 19 with an absolute lymphocyte count of 140 cells per cubic millimeter, but from day 22 to at least 10 months, the absolute lymphocyte count ranged between 390 and 780 cells per cubic millimeter (grade 2 or 3 lymphopenia). The patient had transient grade 1 or 2 thrombocytopenia (platelet count, 98,000 to 131,000 cells per cubic millimeter) from day 19 to day 26 and grade 1 or 2 neutropenia (absolute neutrophil count, 1090 to 1630 cells per cubic millimeter) from day 17 to day 33. Other signs and symptoms that may be associated with the study treatment include grade 1 and 2 elevated levels of aminotransferases and alkaline phosphatases, which develop 17 days after the first infusion and resolve by day 33; and grade 1 and 2 systemic symptoms consisting of fever, chills, sweating, myalgia, headache, and fatigue. Grade 2 hypogammaglobulinemia was corrected with intravenous immunoglobulin.
[0383] Analysis of serum and bone marrow cytokines
[0384] The patient's clinical response was accompanied by a delayed increase in inflammatory cytokine levels (Figures 13A to 13D), with interferon-γ levels, interferon-γ-responsive chemokines CXCL9 and CXCL10, and interleukin-6 being 160-fold higher than baseline levels. Transient increases in T-cytokine levels corresponded to clinical symptoms, peaking 17 to 23 days after the first CART19-cell infusion.
[0385] Cytokines were measured in the supernatant from a series of bone marrow aspirates, and evidence of immune activation was shown. Figure 13E Significant increases in interferon-γ, CXCL9, interleukin-6, and soluble interleukin-2 receptors were recorded compared to baseline levels on the day prior to T-cell infusion; these values peaked on day 23 following the first CART19-cell infusion. The increase in bone marrow cytokines was consistent with the disappearance of leukemia cells from the bone marrow. Serum and bone marrow tumor necrosis factor-α remained unchanged.
[0386] Expansion and persistence of chimeric antigen receptor T cells
[0387] Starting on day 1 post-infusion, real-time PCR was used to detect DNA encoding anti-CD19 chimeric antigen receptor (CAR19) (Fig. 14A). By day 21 post-infusion, more than 3 log expansions of cells were recorded in vivo. At peak levels, CAR19 cells comprised more than 20% of circulating lymphocytes in the blood; these peak levels coincided with the onset of systemic symptoms, tumor lysis syndrome (Fig. 12B), and elevated serum cytokine levels (Figs. 13A–13D). CAR19 cells remained detectable at high levels for 6 months post-infusion, although this value decreased 10-fold from the peak level. The doubling time of chimeric antigen receptor T cells in the blood was approximately 1.2 days, and the elimination half-life was 31 days.
[0388] Chimeric antigen receptor T cells in bone marrow
[0389] CART19 cells were first identified in bone marrow specimens 23 days after the first infusion (Fig. 14B) and persisted for at least 6 months, with a decay half-life of 34 days. The highest levels of CART19 cells in the bone marrow were identified in the initial assessment 23 days after the first infusion and occurred concurrently with the induction of an immune response, as indicated by the cytokine-secretion distribution map. Figure 13E Flow cytometry analysis of bone marrow aspirates indicated clonal expansion of CD5+CD19+ cells at baseline, which were absent in samples obtained 1 month and 3 months post-infusion (data not shown). Normal B cells were not detected post-treatment. Figure 14C ).
[0390] Therapy using autologous gene-modified CART19 cells
[0391] This article describes the delayed development and complete remission of tumor lysis syndrome 3 weeks after treatment with autologous T cells genetically modified to target CD19 via transduction with a lentiviral vector expressing anti-CD19 linked to the CD3-ζ and CD137(4-1BB) signaling domains. The genetically modified cells were present in the bone marrow at high levels after infusion, persisting for at least 6 months. The generation of a CD19-specific immune response in the bone marrow was demonstrated by the transient release of cytokines and the removal of leukemia cells concurrent with peak infiltration of chimeric antigen receptor T cells. The development of tumor lysis syndrome following cellular immunotherapy has not been previously reported (Baeksgaard et al., 2003, Cancer Chemother Pharacol, 51:187-92).
[0392] Genetic manipulation of target-specific tumor antigens by autologous T cells is an attractive strategy for cancer therapy (Sadelain et al., 2009, Curr Opin Immunol, 21:215-23; Jena et al., 2010, Blood, 116:1035-44). A key feature of the method described in this paper is that chimeric antigen receptor T cells can recognize tumor targets in an HLA-unrestricted manner, allowing for the construction of “off-the-shelf” chimeric antigen receptors for tumors with diverse histological features. The use of HIV-derived lentiviral vectors in cancer therapy is another approach that may offer several advantages over the use of retroviral vectors (June et al., 2009, Nat Rev Immunol, 9:704-16).
[0393] In previous trials of chimeric antigen receptor T cells, the targeted tumor response was modest, and the in vivo proliferation of the modified cells was not durable (Kershaw et al., 2006, Clin Cancer Res, 12:6106-15; Till et al., 2008, Blood, 112:2261-71; Pule et al., 2008, Nat Med, 14:1264-70). Brentjens et al. reported preliminary results from a clinical trial of a chimeric antigen receptor targeting CD19 that is linked to the CD28 signaling domain, finding transient tumor responses in two of three patients with advanced CLL (Brentjens et al., 2010, Mol Ther, 18:666-8); however, the chimeric antigen receptor rapidly disappeared from circulation.
[0394] Surprisingly, the very low dose of chimeric antigen receptor T cells injected produced a clinically significant antitumor response. Indeed, 1.5 × 10⁻⁶ 5 The infused dose of chimeric antigen receptor T cells per kilogram is several orders of magnitude lower than the doses used in previous studies of T cells modified to express chimeric antigen receptors or transgenic T-cell receptors (Kershaw et al., 2006, Clin Cancer Res, 12:6106-15; Brentjens et al., 2010, Mol Ther, 18:666-8; Morgan et al., 2010, Mol Ther, 18:843-51; Johnson et al., 2009, Blood, 114:535-46). This is not supported by any specific theory that the chemotherapy enhances the effect of chimeric antigen receptors.
[0395] The prolonged persistence of CART19 cells in the patient's blood and bone marrow is due to the inclusion of the 4-1BB signaling domain. Because CART19 cells expressing single-chain Fv antibody fragments containing murine sequences are not excluded, it is possible that CART19-cell-mediated elimination of normal B cells promotes the induction of immune tolerance to chimeric antigen receptors. Given the lack of detectable CD19-positive leukemia cells in this patient and the absence of any concrete theoretical support, it is possible that chimeric antigen receptor T cell homeostasis is achieved, at least in part, from stimulation delivered by early B-cell progenitor cells—as they begin to appear in the bone marrow. This invention relates to the discovery of a novel mechanism by which “memory” chimeric antigen receptor T cells can exist.
[0396] Although CD19 is an attractive tumor target, its expression is limited to both normal and malignant B cells, raising concerns that persistence of chimeric antigen receptor T cells could mediate long-term B-cell deficiency. Indeed, in this patient, B cells were absent from the blood and bone marrow for at least 6 months after infusion. The patient did not have recurrent infections. Targeting B cells via CD20 with rituximab is an effective and relatively safe strategy for patients with B-cell tumors, and long-term B-cell lymphopenia is manageable (Molina, 2008, Ann Rev Med, 59:237-50). B-cell recovery has been reported in patients treated with rituximab within months of therapy discontinuation. It is unclear whether such recovery occurs in patients with persistent anti-B-cell T cells in vivo.
[0397] Patients with TP53-deficient CLL experience short-term remission following standard therapy (Dohner et al., 1995, Blood, 85:1580-9). Allogeneic bone marrow transplantation is the only method to induce long-term remission in patients with advanced CLL (Gribben et al., 2011, Biol Blood Marrow Transplant, 17:Suppl:S63-S70). However, due to the high frequency of chronic transplant-to-host disease—which is often particularly severe in older patients typically affected by CLL (Gribben et al., 2011, Biol Blood Marrow Transplant, 17:Suppl:S63-S70; Sorror et al., 2008, Blood, 111:446-52)—the resulting effective transplant-to-tumor effect is associated with a considerable morbidity. The data presented in this article suggest that genetically modified autologous T cells can circumvent this limitation.
[0398] Delayed onset of tumor lysis syndrome and cytokine secretion, combined with robust in vivo chimeric antigen receptor T-cell expansion and significant anti-leukemic activity, indicate substantial and persistent effector function of CART19 cells. The experiments described herein underscore the potency of the therapy and provide support for the detailed study of the genetic modification of autologous T cells to target CD19 (and other targets) via transduction of a chimeric antigen receptor linked to an effective signaling domain. Unlike antibody-mediated therapies, chimeric antigen receptor-modified T cells have the potential to replicate in vivo, and long-term persistence can result in sustained tumor control. Two other patients with advanced CLL have also received CART19 infusions according to this protocol, and all three have had tumor responses. These findings warrant continued investigation of CD19-altered T cells for B-cell tumors.
[0399] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated by reference in their entirety. Although the invention has been disclosed in reference to specific embodiments, it will be apparent to those skilled in the art that other embodiments and variations of the invention can be devised without departing from the true spirit and scope of the invention. The claims are intended to be construed to include all such embodiments and equivalent variations. Sequence Listing <110> The Trustees of the University of Pennsylvania C.H. June D.L. Porter M. Kalos B.L. Levine <1gcgcgctcac tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg cgttacccaa 60 cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtaatagcga agaggcccgc 120 accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatgggacgc gccctgtagc 180 ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc 240 gccctagcgc ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggcttt 300 ccccgtcaag ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac 360 ctcgacccca aaaaacttga ttagggtgat ggttcacgta gtgggccatc gccctgatag 420 acggtttttc gccctttgac gttggagtcc acgttcttta atagtggact cttgttccaa 480 actggaacaa cactcaaccc tatctcggtc tattcttttg atttataagg gattttgccg 540 atttcggcct attggttaaa aaatgagctg atttaacaaa aatttaacgc gaattttaac 600 aaaatattaa cgcttacaat ttaggtggca cttttcgggg aaatgtgcgc ggaaccccta 660 tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat 720 780 ttatccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa acgctggtga 840 aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa ctggatctca 900 acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg atgagcactt 960 ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa gagcaactcg 1020 gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc acagaaaagc 1080 atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc atgagtgata 1140 acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta accgcttttt 1200 tgcacaacat ggggatcat gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag 1260 ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca acgttgcgca 1320 aactattaac tggcgaacta cttactctag cttcccggca acaattaata gactggatgg 1380 aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc tggtttattg 1440 ctgataaatc tggagccggt gagcgtgggt ctcgcggtat cattgcagca ctggggccag 1500 atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca actatggatg 1560 aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg taactgtcag 1620 accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa tttaaaagga 1680 tctaggtgaa gatcctttt gataatctca tgaccaaaat cccttaacgt gagttttcgt 1740 tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc 1800 tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc 1860 cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac 1920 caaatactgt tcttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac 1980 cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt 2040 cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag cggtcgggct 2100 gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat 2160 acctacagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag gcggacaggt 2220 atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg 2280 cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt 2340 gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt 2400 tcctggcctt ttgctggcct tttgctcaca tgttctttcc tgcgttatcc cctgattctg 2460 tggataaccg tattaccgcc tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg 2520 agcgcagcga gtcagtgagc gaggaagcgg aagagcgccc aatacgcaaa ccgcctctcc 2580 ccgcgcgttg gccgattcat taatgcagct ggcacgacag gtttcccgac tggaaagcgg 2640 gcagtgagcg caacgcaatt aatgtgagtt agctcactca ttaggcaccc caggctttac 2700 actttatgct tccggctcgt atgttgtgtg gaattgtgag cggataacaa tttcacacag 2760 gaaacagcta tgaccatgat tacgccaagc gcgcaattaa ccctcactaa agggaacaaa 2820 agctggagct gcaagcttaa tgtagtctta tgcaatactc ttgtagtctt gcaacatggt 2880 aacgatgagt tagcacatg cttacaagg aggaaaag caccgtgcat gccgattggt 2940 ggaagtagg tggtacgatc gtgccttatt aggaggcaa cagacgggtc tgacatggat 3000 tggacgaacc actgaattgc cgcattgcag agatattgta tttaagtgcc tagctcgata 3060 cataaacggg tctctctggt tagaccagat ctgagcctgg gagctctctg gctaactagg 3120 gaacccactg cttaagccctc aaaagctt gccttgagtg cttcaagtag tgtgtgcccg 3180 tctgttgtgt gactctgta actagagatc cctcagaccc tttagtcag tgtggaaaat 3240 cttagcagt ggccccgaa cagggacttg aaagcgaaag ggaaccaga ggagctctt 3300 cgacgcagga ctcggcttgc tgaagcgcgc acggcaagg gcgaggggcg gcgactggtg 3360 agtacgccaa aaattttgac tagcggaggc taggaggaga gagatggggtg cgagagcgtc 3420 agtattaagc gggggagaat tegtcggcga tgggaaaaa ttcggttaag gccaggggga 3480 aagaaaaaat attaatttaa acatagta tgggcagca gggagctga acgattcgca 3540 gttaatcctg gcctgttaga aacatcagaa ggctgtagac aaatactggg acagctacaa 3600 ccatcccttc agacaggatc agagaactt agatcattat atatacagt agcaccctc 3660 tattgtgtgc atcaaggat agagaataaa gatcaagg aagctttaga agatagag 3720 gagagcaa aaaagta gaccaccgca cagcaagcgg ccgctgatct tcagacctgg 3780 aggaggagat aggaggagga atggaggagg tgaattatt aaataag tagtaaaat 3840 tgaaccatta ggagtagcac ccaccaggc aaagagaga gtggtgcaga gagaaaaaag 3900 agcagtggga ataggactt tgttccttgg gttcttggga gcagcaggaa gcactatggg 3960 cgcagcgtca atgacgctga cggtacaggc cagacaatta ttgtctgta tagtgcagca 4020 gcagaacaat tgctgaggg ctattgaggc gcacagcat ctgttgcaac tcacagctg 4080 gggcatcaag cagctccagg siagaatcct ggctgtggaa agataccta aggatcaca 4140 gctcctgggg attggggtt gctctggaaa actcattgc accactgctg tgccttggaa 4200 tgctagttgg agtaataaat ctctggaaca gatttggaat cacacgacct ggatggagtg 4260 ggacagagaa attackacatt acacaagctt atacactcc ttaattgaag atcgcaaaa 4320 ccaggcagaa aagaatgaac aagattatt ggattagat aaatgggcaa gtttgtggaa 4380 ttggtttaac atacaatt ggctgtggta tataaaatta ttcataatga tagtaggagg 4440 cttggtaggt ttagaatag ttttgctgt acttctata gtgaatagag ttaggcagg 4500 atattcacca ttacgtttc agacccacct cccaccccg agggaccg acaggccg 4560 aggaagaa gagaaggtg gagagaga gagahaga tccattcgat tagtgaacgg 4620 atctcgacgg tatcgattag actgtagccc aggaatatgg cagctagatt gtacacattt 4680 agaaggaaaa gttatctttgg tagcagttca tgtagccagt ggatatag aagcagaagt 4740 aattccagca gagacagggc aagaaacagc attacktccctc ttaaaattag caggagatg 4800 gccagtaaaa acagtacata cagacaatgg cagcaatttc accagtacta cagttaaggc 4860 cgcctgttgg tgggcgggga tcaagcagga atttggcatt ccctacaatc cccaagtca 4920 aggagtaata gatctatga aagaatt aaaaaattt ataggacagg taagagatca 4980 ggctgaacat cttaagacag cagtacaaat ggcagtattc atccacatt ttaaaagaaa 5040 agggggggatt ggggggtaca gtgcaggga aagaatagta gacataatag caacagacat 5100 acaaactaaa gaattacaaa aacaaattac aaaaattcaa aattttcggg tttattacag 5160 ggacagcaga gatccagttt ggctgcattg atcacgtgag gctccggtgc ccgtcagtgg 5220 gcagagcgca catcgcccac agtccccgag aagttgggg gaggggtcgg caattgaacc 5280 ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg atgtcgtgta ctggctccgc 5340 ctttttccg agggtgggg agaaccgtat ataagtgcag tagtcgccgt gaacgttctt 5400 tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg tgtgtggttc ccgcgggcct 5460 ggcctcttta cgggttatgg cccttgcgtg ccttgaatta cttccacctg gctgcagtac 5520 gtgattcttg atcccgagct tcgggttgga agtgggtggg agagttcgag gccttgcgct 5580 taaggagcc cttcgcctcg tgcttgagtt gaggcctggc ctgggcgctg gggccgccgc 5640 gtgcgaatct ggtggcacct tcgcgcctgt ctcgctgctt tcgataagtc tctagccatt 5700 taaaatttt gatgacctgc tgcgacgctt tttttctggc aagatagtct tgtaaatgcg 5760 ggccaagatc tgcacactgg tatttcggtt tttggggccg cgggcggcga cggggcccgt 5820 gcgtcccagc gcacatgttc ggcgaggcgg ggcctgcgag cgcggccacc gagatcgga 5880 cggggtagt ctcaagctgg ccggcctgct ctggtgcctg gcctcgcgcc gccgtgtatc 5940 gccccgccct gggcggcaag gctggcccgg tcggcaccag ttgcgtgagc ggaagatgg 6000 ccgcttccg gccctgctgc agggagctca aaatggagga cgcggcgctc gggagagcgg 6060 gcgggtgagt cacccacaca aagaaaagg gcctttccgt cctcagccgt cgcttcatgt 6120 gactccactg agtaccgggc gccgtccagg cacctcgatt agttctcgag cttttggagt 6180 acgtcgtctt taggttgggg ggaggggttt tatgcgatgg agtttcccca cactgagtgg 6240 gtggagactg aagttaggcc agcttggcac ttgatgtaat tctccttgga atttgccctt 6300 tttgagtttg gatcttggtt cattctcaag cctcagacag tggttcaaag tttttttctt 6360 ccatttcagg tgtcgtgatc tagaggatcc atggccttac cagtgaccgc cttgctcctg 6420 ccgctggcct tgctgctcca cgccgccagg ccggacatcc agatgacaca gactacatcc 6480 tccctgtctg cctctggg agacagagtc accatcagtt gcagggcaag tcaggacatt 6540 agtaaatatt taaattggta tcagcagaaa ccagatggaa ctgttaaact cctgatctac 6600 catacatcaa gattacactc aggagtccca tcaaggttca gtggcagtgg gtctggaaca 6660 gattattctc tcaccattag caacctggag caagaagata ttgccactta cttttgccaa 6720 cagggtaata cgcttccgta cacgttcgga ggggggacca agctggagat cacaggtggc 6780 ggtggctcgg gcggtggtgg gtcgggtggc ggcggatctg aggtgaaact gcaggagtca 6840 ggacctggcc tggtggcgcc ctcacagagc ctgtccgtca catgcactgt ctcaggggtc 6900 tcattacccg actatggtgt aagctggatt cgccagcctc cacgaaaggg tctggagtgg 6960 ctgggagtaa tatggggtag tgaaaccaca tactataatt cagctctcaa atccagactg 7020 accatcatca aggacaactc caagagccaa gttttcttaa aaatgaacag tctgcaaact 7080 gatgacacag ccatttacta ctgtgccaaa cattattact acggtggtag ctatgctatg 7140 gactactggg gccaaggaac ctcagtcacc gtctcctcaa ccacgacgcc agcgccgcga 7200 ccaccacac cggcgcccac catcgcgtcg cagcccctgt ccctgcgccc agaggcgtgc 7260 cggccagcgg cggggggcgc agtgcacacg agggggctgg acttcgcctg tgatatctac 7320 atctgggcgc ccttggccgg gactgtggg gtccttctcc tgtcactggt tatcacct 7380 tactgcaaac ggggcagaaa gaactccctg tatatattca aacaaccatt tatgagacca 7440 gtacaaacta ctcaagagga agatggctgt agctgccgat ttccagaga agaagaagga 7500 ggatgtgaac tgagagtgaa gttcagcagg agcgcagacg cccccgcgta caagcagggc 7560 cagaaccagc tctataacga gctcaatcta ggacgaagg aggagtacga tgttttggac 7620 aagagacgtg gccgggaccc tgagatgggg ggaagccga gagggaa ccccaggaa 7680 ggcctgtaca atgactgca gaagataag atggcggagg cctacagtga gattgggatg 7740 aaaggcgagc gccggagggg caggggcac gatggcctttt accaggctct cagtacagcc 7800 accaaggaca cctacgacgc ccttcacatg caggccctgc cccctcgcta agtcgacaat 7860 siacctctgg attacaaat tgtgaaaga ttgactgta ttcttaacta tgttgctcct 7920 tttacgctat gtggatacgc tgctttaatg cctttgtatc atgctattgc ttcccgtatg 7980 gctttcattt tctcctcctt gtataaatcc tggttgctgt ctctttatga ggagttgtgg 8040 cccgttgtca ggcaacgtgg cgtggtgtgc actgtgtttg ctgacgcaac ccccactggt 8100 tggggcattg ccaccacctg tcagctcctt tccgggactt tcgctttccc cctccctatt 8160 gccacggcgg aactcatcgc cgcctgcctt gcccgctgct ggacaggggc tcggctgttg 8220 ggcactgaca attccgtggt gttgtcgggg aagctgacgt cctttccatg gctgctcgcc 8280 tgtgttgcca cctggattct gcgcgggacg tccttctgct acgtcccttc ggccctcaat 8340 ccagcggacc ttccttcccg cggcctgctg ccggctctgc ggcctcttcc gcgtcttcgc 8400 cttcgccctc agacgagtcg gatctccctt tgggccgcct ccccgcctgg aattcgagct 8460 cggtaccttt aagaccaatg acttacaagg cagctgtaga tcttagccac tttttaaaag 8520 aaaagggggg actggaaggg ctaattcact cccaacgaag acaagatctg ctttttgctt 8580 gtactgggtc tctctggtta gaccagatct gagcctggga gctctctggc taactaggga 8640 acccactgct taagcctcaa taaagcttgc cttgagtgct tcaagtagtg tgtgcccgtc 8700 tgttgtgtga ctctggtaac tagagatccc tcagaccctt ttagtcagtg tggaaaatct 8760 ctagcagtag tagttcatgt catcttatta ttcagtattt ataacttgca aagaaatgaa 8820 tatcagagag tgagaggaac ttgtttattg cagcttataa tggttacaaa taaagcaata 8880 gcatcacaaa tttcacaaat aaagcatttt tttcactgca ttctagttgt ggtttgtcca 8940 aactcatcaa tgtatcttat catgtctggc tctagctatc ccgcccctaa ctccgcccat 9000 cccgccccta actccgccca gttccgccca ttctccgccc catggctgac taattttttt 9060 tatttatgca gaggccgagg ccgcctcggc ctctgagcta ttccagaagt agtgaggagg 9120 cttttttgga ggcctaggga cgtacccaat tcgccctata gtgagtcgta ttac 9174 <210> 2 <211> 228 <212> DNA <213> Artificial Sequence <220> <223> Chemically Synthesized <400> 2 atgtagtctt atgcaatact cttgtagtct tgcaacatgg taacgatgag ttagcaacat 60 gccttacaag gagagaaaaa gcaccgtgca tgccgattgg tggaagtaag gtggtacgat 120 cgtgccttat taggaaggca acagacgggt ctgacatgga ttggacgaac cactgaattg 180 ccgcattgca gagatattgt atttaagtgc ctagctcgat acataaac 228 <210> 3 <211> 98 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 3 gggtctctct ggttagacca gatctgagcc tgggagctct ctggctaact agggaaccca 60 ctgcttaagc ctcaataaag cttgccttga gtgcttca 98 <210> 4 <211> 85 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 4 agtagtgtgt gcccgtctgt tgtgtgactc tggtaactag agatccctca gaccctttta 60 gtcagtgtgg aaaatctcta gcagt 85 <210> 5 <211> 1377 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 5 cgaacaggga cttgaaagcg aaagggaaac cagaggagct ctctcgacgc aggactcggc 60 ttgctgaagc gcgcacggca agaggcgagg ggcggcgact ggtgagtacg ccaaaaattt 120 tgactagcgg aggctagaag gagagagatg ggtgcgagag cgtcagtatt aagcggggga 180 gatttagatc gcgatggga aaaattcggt taggccagg gggaaagaa aaataataat 240 taaaacatat agtatgggca agcagggagc tegacgatt cgcagttaat cctggcctgt 300 tagaaacatc agaaggctgt agacaatc tgggacagct acaaccatcc cttcagacag 360 gatcagaga acttagatca ttatatata cagtagcaac cctctattgt gtgcatcaa 420 'ggatagagat aaagacacc aaggaagctt gawghagat agaggaag aaaaaaaaaa 480 gtaagaccac cgcacagcaa gcggccgctg atctcagac ctggaggagg agatatgagg 540 gaattga gagtgatt attaataat aaagtagtaaaattgacc attaggta 600 gcacccacca aggcaagg aagagtggtg cagagagaaa aaagagcagt gggaatagga 660 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg 720 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg 780 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc 840 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg 900 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat 960 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac 1020 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat 1080 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca 1140 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga 1200 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg 1260 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa 1320 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtat 1377 <210> 6 <211> 547 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 6 tagactgtag cccaggaata tggcagctag attgtacaca tttagaagga aaagttatct 60 tggtagcagt tcatgtagcc agtggatata tagaagcaga agtaattcca gcagagacag 120 ggcaagaaac agcatacttc ctcttaaaat tagcaggaag atggccagta aaaacagtac 180 atacagacaa tggcagcaat ttcaccagta ctacagttaa ggccgcctgt tggtgggcgg 240 ggatcaagca ggaatttggc attccctaca atccccaaag tcaaggagta atagaatcta 300 tgaataaaga attaaagaaa attataggac aggtaagaga tcaggctgaa catcttaaga 360 cagcagtaca aatggcagta ttcatccaca attttaaaag aaaagggggg attggggggt 420 acagtgcagg ggaaagaata gtagacataa tagcaacaga catacaaact aaagaattac 480 aaaaacaaat tacaaaaatt caaaattttc gggtttatta cagggacagc agagatccag 540 tttggct 547 <210> 7 <211> 1178 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 7 gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg 60 gaggggtcgg caattgaacc ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg 120 atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 180 tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg 240 tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg ccttgaatta 300 cttccacctg gctgcagtac gtgattcttg atcccgagct tcgggttgga agtgggtggg 360 agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt gaggcctggc 420 ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt ctcgctgctt 480 tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt tttttctggc 540 aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt tttggggccg 600 cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg ggcctgcgag 660 cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct ctggtgcctg 720 gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg tcggcaccag 780 ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca aaatggagga 840 cgcggcgctc gggagagcgg gcgggtgagt cacccacaca aaggaaaagg gcctttccgt 900 cctcagccgt cgcttcatgt gactccactg agtaccgggc gccgtccagg cacctcgatt 960 agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt tatgcgatgg 1020 agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac ttgatgtaat 1080 tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag cctcagacag 1140 tggttcaaag tttttttctt ccatttcagg tgtcgtga 1178 <210> 8 <211> 1459 <212> DNA <213> Artificial sequence<00013accatcagtt gcagggcaag tcaggacatt agtaaatatt taaattggta tcagcagaaa 180 ccagatggaa ctgttaaact cctgatctac catacatcaa gattacactc aggagtccca 240 tcaaggttca gtggcagtgg gtctggaaca gattattctc tcaccattag caacctggag 300 caagaagata ttgccactta cttttgccaa cagggtaata cgcttccgta cacgttcgga 360 ggggggacca agctggagat cacaggtggc ggtggctcgg gcggtggtgg gtcgggtggc 420 ggcggatctg aggtgaaact gcaggagtca ggacctggcc tggtggcgcc ctcacagagc 480 ctgtccgtca catgcactgt ctcaggggtc tcattacccg actatggtgt aagctggatt 540 cgccagcctc cacgaaaggg tctggagtgg ctgggagtaa tatggggtag tgaaaccaca 600 tactataatt cagctctcaa atccagactg accatcatca aggacaactc caagagccaa 660 gttttcttaa aaatgaacag tctgcaaact gatgacacag ccatttacta ctgtgccaaa 720 cattattact acggtggtag ctatgctatg gactactggg gccaaggaac ctcagtcacc 780 gtctcctcaa ccacgacgcc agcgccgcga ccaccaacac cggcgcccac catcgcgtcg 840 cagcccctgt ccctgcgccc agaggcgtgc cggccagcgg cggggggcgc agtgcacacg 900 agggggctgg acttcgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg 960 gtccttctcc tgtcactggt tatcaccctt tactgcaaac ggggcagaaa gaaactcctg 1020 tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga agatggctgt 1080 agctgccgat ttccagaaga agaagaagga ggatgtgaac tgagagtgaa gttcagcagg 1140 agcgcagacg cccccgcgta caagcagggc cagaaccagc tctataacga gctcaatcta 1200 ggacgaagag aggagtacga tgttttggac aagagacgtg gccgggaccc tgagatgggg 1260 ggaaagccga gaaggaagaa ccctcaggaa ggcctgtaca atgaactgca gaaagataag 1320 atggcggagg cctacagtga gattgggatg aaaggcgagc gccggagggg caaggggcac 1380 gatggccttt accagggtct cagtacagcc accaaggaca cctacgacgc ccttcacatg 1440 caggccctgc cccctcgct 1459 <210> 9 <211> 591 <212> DNA <213> Artificial Sequence <220> <223> Chemically Synthesized <400> 9 atcaacctct ggattacaaa atttgtgaaa gattgactgg tattcttaac tatgttgctc 60 cttttacgct atgtggatac gctgctttaa tgcctttgta tcatgctatt gcttcccgta 120 tggctttcat tttctcctcc ttgtataaat cctggttgct gtctctttat gaggagttgt 18" ggcccgttgt caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca acccccactg 240 gttggggcat tgccaccacc tgtcagctcc tttccgggac tttcgctttc cccctcccta 300<00013"ttgccacggc ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg gctcggctgt 360 tgggcactga caattccgtg gtgttgtcgg ggaagctgac gtcctttcca tggctgctcg 420 cctgtgttgc cacctggatt ctgcgcggga cgtccttctg ctacgtccct tcggccctca 480 atccagcgga ccttccttcc cgcggcctgc tgccggctct gcggcctctt ccgcgtcttc 540 gccttcgccc tcagacgagt cggatctccc tttgggccgc ctccccgcct g 591 <210> 10 <211> 98 <212> DNA <213> Artificial Sequence <220> <223> Chemically Synthesized<00"<400> 10 gggtctctct ggttagacca gatctgagcc tgggagctct ctggctaact agggaaccca 60 ctgcttaagc ctcaataaag cttgccttga gtgcttca 98 <210> 11 <211> 84 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 11 agtagtgtgt gcccgtctgt tgtgtgactc tggtaactag agatccctca gaccctttta 60 gtcagtgtgg aaaatctcta gcag 84 <210> 12 <211> 486 <212> PRT <213> Artificial sequence <220> <223> Chemically synthesized <400> 12 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu 20 25 30 Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln 35 40 45 Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr 50 55 60 Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro 65 70 75 80 Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile 85 90 95 Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly 100 105 110 Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr 115 120 125 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu 130 135 140 Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser 145 150 155 160 Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly 165 170 175 Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly 180 185 190 Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser 195 200 205 Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys 210 215 220 Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys 225 230 235 240 His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly 245 250 255 Thr Ser Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro 260 265 270 Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu 275 280 285 Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp 290 295 300 Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly 305 310 315 320 Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg 325 330 335 Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln 340 345 350 Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu 355 360 365 Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala 370 375 380 Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu 385 390 395 400 Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp 405 410 415 Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu 420 425 430 Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile 435 440 445 Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr 450 455 460 Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met 465 470 475 480 Gln Ala Leu Pro Pro Arg 485 <210> 13 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 13 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccg 63 <210> 14 <211> 726 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 14 gacatccaga tgacacagac tacatcctcc ctgtctgcct ctctgggaga cagagtcacc 60 atcagttgca gggcaagtca ggacattagt aaatatttaa attggtatca gcagaaacca 120 gatggaactg ttaaactcct gatctaccat acatcaagat tacactcagg agtcccatca 180 aggttcagtg gcagtgggtc tggaacagat tattctctca ccattagcaa cctggagcaa 240 gaagatattg ccacttactt ttgccaacag ggtaatacgc ttccgtacac gttcggaggg 300 gggaccaagc tggagatcac aggtggcggt ggctcgggcg gtggtgggtc gggtggcggc 360 ggatctgagg tgaaactgca ggagtcagga cctggcctgg tggcgccctc acagagcctg 420 tccgtcacat gcactgtctc aggggtctca ttacccgact atggtgtaag ctggattcgc 480 cagcctccac gaaagggtct ggagtggctg ggagtaatat ggggtagtga aaccacatac 540 tataattcag ctctcaaatc cagactgacc atcatcaagg acaactccaa gagccaagtt 600 ttcttaaaaa tgaacagtct gcaaactgat gacacagcca tttactactg tgccaaacat 660 tattactacg gtggtagcta tgctatggac tactggggcc aaggaacctc agtcaccgtc 720 tcctca 726 <210> 15 <211> 135 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 15 accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60 tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120 gacttcgcct gtgat 135 <210> 16 <211> 72 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 16 atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc 60 accctttact gc 72 <210> 17 <211> 126 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 17 aaacggggca gaaagaaact cctgtatata ttcaaacaac catttatgag accagtacaa 60 actactcaag aggaagatgg ctgtagctgc cgatttccag aagaagaaga aggaggatgt 120 gaactg 126 <210> 18 <211> 336 <212> DNA <213> Artificial Sequence <220> <223> Chemically Synthesized <400> 18 agagtgaagt tcagcaggag cgcagacgcc cccgcgtaca agcagggcca gaaccagctc 60[[ID= nineteen]] tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120 cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 180 gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 240 cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 300<00%1509>tacgacgccc ttcacatgca ggccctgccc cctcgc 336 <210> 19 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> Chemically Synthesized <400> 19 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro 20 <210> 20 <211> 242 <212> PRT <213> Artificial sequence <220> <223> Chemically synthesized <400> 20 Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln 65 70 75 80 Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Gly Gly Gly Gly Ser 100 105 1i0 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Lys Leu Gln Glu 115 120 125 It should be noted that there seems to be a small error in the original text where "1i0" in line should probably be "110". This has been left as is in the translation for the purpose of following the instructions precisely.Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys 130 135 140 Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg 145 150 155 160 Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser 165 170 175 Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile 180 185 190 Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln 195 200 205 Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly 210 215 220 Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val 225 230 235 240 Looking Looking <210> 21 <211> 47 <212> PRT <213> artificial sequence <220> <223> Chemical synthesis <400> 21 Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala 1 5 10 15 Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly 20 25 30 Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr 35 40 45 <210> twenty two <211> twenty two <212> PRT <213> Artificial sequence <220> <223> Chemically synthesized <400> twenty two Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu 1 5 10 15 Val Ile Thr Leu Tyr Cys 20 <210> twenty three <211> 42 <212> PRT <213> Artificial sequence <220> <223> Chemically synthesized <400> twenty three Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met 1 5 10 15 Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe 20 25 30 Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu 35 40 <210> twenty four <211> 112 <212> PRT <213> Artificial sequence <220> <223> Chemical synthesis <400> 24 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly 1 5 10 15 Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30 Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40 45 Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys 50 55 60 Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg 65 70 75 80 Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala 85 90 95 Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 100 105 110 <210> 25 <211> 22 <212> DNA <213> artificial sequence <220> <223> Chemical synthesis <400> 25 gaaagctgac tgcccctatt tg 22 <210> 26 <211> 22 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 26 gagaggaagt gctgggaaca at 22 <210> 27 <211> 15 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 27 ctccccagtc tcttt 15
Claims
1. A lentiviral vector comprising a nucleic acid sequence encoding a chimeric antigen receptor (CAR), wherein the CAR comprises a CD19 antigen-binding domain, a CD8α transmembrane domain, a CD8α hinge domain, a 4-1BB co-stimulatory signal transduction region, and a CD3ζ signal transduction domain, wherein the CD19 antigen-binding domain is composed of the amino acid sequence of SEQ ID NO: 20, the CD8α transmembrane domain is composed of the amino acid sequence of SEQ ID NO: 22, the CD8α hinge domain is composed of the amino acid sequence of SEQ ID NO: 21, the 4-1BB co-stimulatory signal transduction region is composed of the amino acid sequence of SEQ ID NO: 23, and the CD3ζ signal transduction domain is composed of the amino acid sequence of SEQ ID NO:
24.
2. A lentiviral vector comprising a nucleic acid sequence encoding a chimeric antigen receptor (CAR), wherein the CAR comprises a CD19 antigen-binding domain, a CD8α transmembrane domain, a CD8α hinge domain, a 4-1BB co-stimulatory signal transduction region, and a CD3ζ signal transduction domain, wherein the CD19 antigen-binding domain is encoded by a nucleic acid sequence of SEQ ID NO: 14, the CD8α transmembrane domain is encoded by a nucleic acid sequence of SEQ ID NO: 16, the CD8α hinge domain is encoded by a nucleic acid sequence of SEQ ID NO: 15, the 4-1BB co-stimulatory signal transduction region is encoded by a nucleic acid sequence of SEQ ID NO: 17, and the CD3ζ signal transduction domain is encoded by a nucleic acid sequence of SEQ ID NO:
18.
3. The lentiviral vector according to any one of claims 1-2, wherein the vector further comprises a promoter.
4. The lentiviral vector according to claim 3, wherein the promoter is the EF-1α promoter.
5. The lentiviral vector according to claim 4, wherein the EF-1α promoter comprises the nucleic acid sequence of SEQ ID NO:
7.
6. T cells, comprising a lentiviral vector according to any one of claims 1-5.
7. Use of the lentiviral vector according to any one of claims 1-5 for preparing T cells that are genetically modified to express the CAR.