Cellulose-degrading enzyme composition and its uses

CN108179139BActive Publication Date: 2026-08-14NOVOZYMES
View PDF 45 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2012-08-23
Publication Date
2026-08-14

Smart Images

  • Figure BDA0001572486320000901
    Figure BDA0001572486320000901
  • Figure HDA0001572486330000011
    Figure HDA0001572486330000011
  • Figure HDA0001572486330000021
    Figure HDA0001572486330000021
Patent Text Reader

Abstract

This invention relates to recombinant filamentous fungal host cells for producing cellulase compositions, and methods for producing and using said compositions.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This invention is a divisional application of the patent application filed on August 23, 2012, with application number “201280052443.4” (international application number PCT / US2012 / 052163) and title “Cellulose-degrading enzyme composition and its use”.

[0002] Declaration of rights for inventions made under federally funded research and development

[0003] This invention was completed with government support under Cooperative Agreement DE-FC36-08GO18080 granted by the Department of Energy. The government holds certain rights in this invention.

[0004] Involves sequence lists

[0005] This application contains a sequence list in a computer-readable form, which is incorporated herein by reference. Background of the Invention Technical Field

[0007] This invention relates to the production of cellulase compositions, filamentous fungal host cells for producing said cellulase compositions, and methods for producing and using said compositions.

[0008] Description of related technologies

[0009] Cellulose is a polymer of glucose molecules linked by β-1,4-bonds. Many microorganisms produce enzymes that hydrolyze β-linked glucans. These enzymes include endoglucanases, cellobiases, and β-glucosidases. Endoglucanases digest cellulose polymers at random sites, exposing them to the attack of cellobiases. Cellobiases sequentially release cellobiose molecules from the ends of the cellulose polymer. Cellobiose is a water-soluble β-1,4-linked glucose dimer. β-glucosidases hydrolyze cellobiose into glucose.

[0010] Converting lignin-cellulose feedstock into ethanol offers several advantages: abundant feedstock is readily available, ideally avoiding the burning or landfilling of materials, and the cleanliness of ethanol fuel. Wood, agricultural residues, herbaceous crops, and municipal solid waste are considered suitable feedstocks for ethanol production. These materials are primarily composed of cellulose, hemicellulose, and lignin. Once cellulose is converted into glucose, the glucose is readily fermented into ethanol by yeast.

[0011] WO 2011 / 057140 discloses a cellobiose hydrolase I from *Aspergillus fumigatus* and its gene. WO 2011 / 057140 discloses a cellobiose hydrolase II from *Aspergillus fumigatus* and its gene. WO 2005 / 047499 discloses a β-glucosidase from *Aspergillus fumigatus* and its gene. WO 2006 / 078256 discloses a xylanase from *Aspergillus fumigatus* GH10. WO 2011 / 057140 discloses a β-xylosidase from *Aspergillus fumigatus* and its gene. WO 2011 / 041397 discloses a polypeptide from *Penicillium* sp. GH61 with enhanced cellulose-degrading activity and its gene.

[0012] There is a need in this field for new combinations of cellulases that can more effectively break down cellulosic materials.

[0013] The present invention provides a cellulase composition and a method for producing and using the composition. Summary of the Invention

[0014] The present invention relates to an enzyme composition comprising (i) Aspergillus fumigatus cellobiase I; (ii) Aspergillus fumigatus cellobiase II; (iii) Aspergillus fumigatus β-glucosidase or a variant thereof; and (iv) a Penicillium species GH61 polypeptide having enhanced cellulose-degrading activity; or a homolog thereof.

[0015] The present invention also relates to recombinant filamentous fungal host cells comprising polynucleotides encoding (i) Aspergillus fumigatus cellobiose hydrolase I; (ii) Aspergillus fumigatus cellobiose hydrolase II; (iii) Aspergillus fumigatus β-glucosidase or a variant thereof; and (iv) a Penicillium species GH61 polypeptide having enhanced cellulose-degrading activity; or a homolog thereof.

[0016] The present invention also relates to a method for producing an enzyme composition, comprising: (a) culturing filamentous fungal host cells of the present invention under conditions conducive to the production of the enzyme composition; and optionally (b) recovering the enzyme composition.

[0017] This invention also relates to a process for degrading cellulose materials, comprising treating the cellulose materials with the enzyme composition of this invention.

[0018] The present invention also relates to a method for producing fermentation products, comprising: (a) saccharifying a cellulose material with the enzyme composition of the present invention; (b) fermenting the saccharified cellulose material with one or more (e.g., several) fermenting microorganisms to produce fermentation products; and (c) recovering the fermentation products from the fermentation.

[0019] The present invention further relates to a process for fermenting cellulose materials, comprising fermenting cellulose materials with one or more (e.g., several) fermenting microorganisms, wherein the cellulose materials are saccharified by the enzyme composition of the present invention. Attached Figure Description

[0020] Figure 1 The restriction enzyme diagram of plasmid pJfyS139 is shown.

[0021] Figure 2 The restriction enzyme diagram of plasmid pJfyS142 is shown.

[0022] Figure 3 The restriction enzyme diagram of plasmid pJfyS144 is shown.

[0023] Figure 4 The restriction enzyme diagram of plasmid pDM286 is shown.

[0024] Figure 5 The restriction enzyme diagram of plasmid pDFng113-3 is shown.

[0025] Figure 6 The restriction enzyme digestion diagram of plasmid pSMai139 is shown.

[0026] Figure 7 The restriction enzyme digestion diagram of plasmid pSMai143 is shown.

[0027] Figure 8 The restriction enzyme digestion diagram of plasmid pSMai229 is shown.

[0028] Figure 9 The restriction enzyme diagram of plasmid pAG57 is shown.

[0029] Figure 10 The restriction enzyme diagram of plasmid pDFng124-1 is shown.

[0030] Figure 11 The restriction enzyme diagram of plasmid pSaMe-AFGH10 is shown.

[0031] Figure 12This compares the percentage conversion of pretreated corn stalks (PCS) to enzyme compositions containing Aspergillus fumigatus cellobiase I; Aspergillus fumigatus cellobiase II; Aspergillus fumigatus β-glucosidase variant; Penicillium GH61 polypeptide with enhanced cellulose-degrading activity, Aspergillus fumigatus xylanase, and Aspergillus fumigatus β-xylosidase (“Enzyme Composition #1”) and enzyme compositions containing Aspergillus aculeatus GH10 xylanase and Trichoderma reesei cellulase preparations (containing Aspergillus fumigatus β-glucosidase and Thermoascus aurantiacus thermophilus GH61A polypeptide) (“Enzyme Composition #2”).

[0032] definition

[0033] Acetylxylan esterase: The term "acetylxylan esterase" refers to a carboxyl esterase (EC 3.1.1.72) that catalyzes the hydrolysis of acetyl groups from polyxylan, acetylated xylose, acetylated glucose, alpha-napthyl acetate, and p-nitrophenyl acetate. For the purposes of this invention, acetylxylan esterase activity is measured using a solution containing 0.01% TWEEN. TM The substrate was determined using 0.5 mM p-nitrophenyl acetate in 50 mM sodium acetate at pH 5.0 for 20 (polyoxyethylene sorbitan monolaurate). One unit of acetylated xylan esterase is defined as the amount of enzyme capable of releasing 1 μmol of p-nitrophenolate anion per minute at pH 5 and 25 °C.

[0034] Allelic variant: The term "allelic variant" refers to any two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variations occur naturally through mutation and can lead to polymorphism within a population. Gene mutations can be silent (without change in the encoded polypeptide) or can encode a polypeptide with a modified amino acid sequence. Allelic variants of a polypeptide are polypeptides encoded by allelic variants of a gene.

[0035] α-L-Arabofuranosaccharidase: The term "α-L-Arabofuranosaccharidase" refers to α-L-arabinofuranoside arabinofuranoside hydrolase (EC 3.2.1.55), which catalyzes the hydrolysis of terminal non-reducing α-L-arabinofuranoside residues in α-L-arabinoside. This enzyme acts on α-L-arabinofuranoside, α-L-arabinanan containing (1,3)- and / or (1,5)- bonds, arabinoxylan, and arabinogalactan. α-L-arabinofuranosaccharidase is also known as arabinosaccharidase, α-arabinosaccharidase, α-L-arabinosaccharidase, α-arabinofuranoside, polysaccharide α-L-arabinofuranosaccharidase, α-L-arabinofuranoside hydrolase, L-arabinosaccharidase, or α-L-arabinananase. In this invention, α-L-arabinofuranylase activity was determined by using 5 mg of medium-viscosity wheat arabinoxylan (Megazyme International Ireland, Ltd., Bray, Co., Wicklow, Ireland) per ml of 100 mM sodium acetate at pH 5 in a total volume of 200 μl at 40°C for 30 minutes, followed by... The arabinose was determined by HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

[0036] α-Glucuronidase: The term "α-glucuronidase" refers to alpha-D-glucosiduronate glucuronohydrolase (EC 3.2.1.139), which catalyzes the hydrolysis of α-D-glucuronide to D-glucuronic acid and alcohol. For the purposes of this invention, α-glucuronidase activity is determined according to de Vries, 1998, J. Bacteriol. 180:243-249. One unit of α-glucuronidase is equal to the amount of enzyme capable of releasing 1 micromole of glucuronic acid or 4-O-methylglucuronic acid per minute at pH 5 and 40°C.

[0037] Aspartic proteases: The term "aspartic protease" refers to a protease that uses aspartic residues to catalyze the hydrolysis of peptide bonds in peptides and proteins. Aspartic proteases are a family of proteases that use aspartic residues to catalyze the hydrolysis of their substrates. Generally, they have two highly conserved aspartic residues at their active site and exhibit optimal activity at acidic pH (Szecsi, 1992, Scand. J. Clin. Lab. In vest. Suppl. 210: 5–22). For the purposes of this invention, the activity of the aspartic protease was determined according to the method described by Aikawa et al., 2001, J. Biochem. 129: 791-794.

[0038] β-Glucosidase: The term "β-glucosidase" refers to beta-D-glucoside glucohydrolase (EC No. 3.2.1.21), which catalyzes the hydrolysis of terminal non-reducing β-D-glucose residues, releasing β-D-glucose. For the purposes of this invention, β-glucosidase is defined using p-nitrophenyl-β-D-glucopyranoside as a substrate, according to the method described by Venturi et al., 2002, Extracellular beta-D-glucosidase from Chaetomium thermophilum var. coprophilum: production, purification and some biochemical properties, J. Basic Microbiol. 42:55-66. One unit of β-glucosidase is defined as the enzyme produced at 25°C, pH 4.8, containing 0.01%... 1.0 μmol of p-nitrophenol anion per minute is generated from 1 mM p-nitrophenyl-β-D-glucopyranoside as a substrate in 50 mM sodium citrate of 20 (polyoxyethylene sorbitan monolaurate).

[0039] β-Xylosidase: The term "β-xylosidase" refers to β-D-xyloside xylohydrolase (EC 3.2.1.37), which catalyzes the external hydrolysis of short β(1→4) xylooligosaccharides to remove consecutive D-xylose residues from the non-reducing end. For the purposes of this invention, one unit of β-xylosidase is defined as 0.01% xyloside at 40°C and pH 5. 1.0 μmol of p-nitrophenol anion was generated per minute from 1 mM p-nitrophenyl-β-D-xyloside as a substrate in 20 oz.

[0040] cDNA: The term "cDNA" refers to a DNA molecule that can be prepared from mature, spliced ​​mRNA molecules derived from eukaryotic or prokaryotic cells via reverse transcription. cDNA lacks the intron sequences that are present in the corresponding genomic DNA. Initial, primary RNA transcripts are precursors to mRNA, which are processed through a series of steps, including splicing, to become mature, spliced ​​mRNA.

[0041] Cellobiose hydrolase: The term "cellobiose hydrolase" refers to 1,4-β-D-glucan cellobiose hydrolase (EC3.2.1.91 and EC3.2.1.176), which catalyzes the hydrolysis of 1,4-β-D-glycosidic bonds in cellulose, cellooligosaccharides, or any polymer containing β-1,4-linked glucose, releasing cellobiose from the reduced or non-reduced ends of the chain (Teeri, 1997, Crystalline cellulose degradation: New insight into the function of cellobiohydrolases, Trends in Biotechnology 15:160-167; Teeri et al., 1998, Trichoderma reesei cellobiohydrolases: why soefficient on crystalline cellulose?, Biochem. Soc. Trans. 26:173-178). Cellobiase activity was determined according to the methods described in Lever et al., 1972, Anal. Biochem. 47:273-279; van Tilbeurgh et al., 1982, FEBS Letters 149:152-156; van Tilbeurgh and Claeyssens, 1985, FEBS Letters 187:283-288; and Tomme et al., 1988, Eur. J. Biochem. 170:575-581. In this invention, the method of Tomme et al. can be used to determine cellobiase activity.

[0042] Cellulose-degrading enzymes or cellulases: The term “cellulose-degrading enzyme” or “cellulase” refers to one or more (e.g., several) enzymes that hydrolyze cellulose materials. Such enzymes include endoglucanases, cellobiases, β-glucosidases, or combinations thereof. Two basic methods for measuring cellulose degrading activity include (1) measuring total cellulose degrading activity and (2) measuring individual cellulose degrading activities (endoglucanases, cellobiases, and β-glucosidases), as reviewed by Zhang et al., Outlook for cellulase improvement: Screening and selection strategies, 2006, Biotechnology Advances 24:452-481. Total cellulose degrading activity is usually determined using insoluble substrates, including Whatman No. 1 filter paper, microcrystalline cellulose, bacterial cellulose, algal cellulose, cotton, pretreated lignin cellulose, etc. The most common method for determining total cellulose degrading activity is the filter paper assay using Whatman No. 1 filter paper as the substrate. This assay was established by the International Union of Pure and Applied Chemistry (IUPAC) (Ghose, 1987, Measurement of cellulase activities, Pure Appl. Chem. 59:257-68).

[0043] For the purposes of this invention, cellulase activity is determined by measuring the increase in hydrolysis of cellulose material by cellulase compared to control hydrolysis without the addition of cellulase protein under the following conditions: 1-50 mg of cellulase protein / g of cellulose (or other pretreated cellulose material) in PCS at a suitable temperature, such as 50°C, 55°C, or 60°C, for 3-7 days. Typical conditions are: 1 ml reaction solution, washed or unwashed PCS, 5% insoluble solids, 50 mM sodium acetate pH 5, 1 mM MnSO4, 50°C, 55°C, or 60°C, 72 hours. Sugar analysis was performed using an HPX-87H column (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

[0044] Cellulose Material: The term "cellulose material" refers to any material containing cellulose. The primary cell wall of biomass is dominated by cellulose, followed by hemicellulose, and then pectin. The secondary cell wall, formed after cell growth ceases, also contains polysaccharides and is reinforced by polymeric lignin covalently cross-linked to hemicellulose. Cellulose is a homopolymer of dehydrated cellobiose, and therefore a linear β-(1-4)-D-glucan, while hemicellulose comprises a variety of compounds such as xylan, xyloglucan, arabinoxylan, and mannan, forming a complex branched structure with a wide variety of substituents. Although cellulose is generally polymorphic, the cellulose present in plant tissues is primarily an insoluble crystalline matrix of parallel glucan chains. Hemicellulose is typically linked to cellulose and other hemicelluloses by hydrogen bonds, which help stabilize the cell wall matrix.

[0045] Cellulose is commonly found in, for example, the stems, leaves, shells, bark, and rachis of plants, or the leaves, branches, and wood of trees. Cellulose materials can be, but are not limited to, agricultural residues, herbaceous materials (including energy crops), municipal solid waste, pulp and paper mill residues, waste paper, and wood (including forestry residues) (see, for example, Wiselogel et al., 1995, in Handbook on Bioethanol (edited by Charles E. Wyman), pp. 105-118, Taylor & Francis, Washington DC; Wyman, 1994, Bioresource Technology 50: 3-16; Lynd, 1990, Applied Biochemistry and Biotechnology 24 / 25: 695-719; Mosier et al., 1999, Recent Progress in Bioconversion of Lignocellulosics, in Advances in Biochemical Engineering / Biotechnology, edited by T. Scheper, Volume 65, pp. 23-40, Springer-Verlag, New York). It should be understood herein that cellulose can be any form of lignin cellulose, a plant cell wall material comprising a mixed matrix of lignin, cellulose, and hemicellulose. In a preferred aspect, the cellulose material is any biomass material. In another preferred aspect, the cellulose material is lignin cellulose, comprising cellulose, hemicellulose, and lignin.

[0046] In one respect, cellulosic materials are agricultural residues. In another respect, cellulosic materials are herbaceous materials (including energy crops). In yet another respect, cellulosic materials are municipal solid waste. In yet another respect, cellulosic materials are pulp and paper mill residues. In yet another respect, cellulosic materials are waste paper. In yet another respect, cellulosic materials are wood (including forestry residues).

[0047] In another aspect, the cellulose material is *Arundo*. In another aspect, the cellulose material is bagasse. In another aspect, the cellulose material is bamboo. In another aspect, the cellulose material is corn cob. In another aspect, the cellulose material is corn fiber. In another aspect, the cellulose material is corn stalk. In another aspect, the cellulose material is *Miscanthus*. In another aspect, the cellulose material is orange peel. In another aspect, the cellulose material is rice straw. In another aspect, the cellulose material is switchgrass. In another aspect, the cellulose material is wheat straw.

[0048] In another aspect, the cellulose material is poplar. In another aspect, the cellulose material is eucalyptus. In another aspect, the cellulose material is fir. In another aspect, the cellulose material is pine. In another aspect, the cellulose material is poplar. In another aspect, the cellulose material is spruce. In another aspect, the cellulose material is willow.

[0049] In another aspect, cellulose materials are algal cellulose. In another aspect, cellulose materials are bacterial cellulose. In another aspect, cellulose materials are cotton linter. In another aspect, cellulose materials are filter paper. In another aspect, cellulose materials are microcrystalline cellulose. In another aspect, cellulose materials are phosphoric acid-treated cellulose.

[0050] In another respect, cellulose materials are aquatic biomass. As used herein, "aquatic biomass" means biomass produced by photosynthesis in an aquatic environment. Aquatic biomass can be algae, emergent plants, floating-leaf plants, or submerged plants.

[0051] Cellulose materials can be used as is or pretreated using conventional methods known in the art, as described herein. In a preferred aspect, the cellulose material is pretreated.

[0052] Coding sequence: The term "coding sequence" refers to a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of a coding sequence are typically determined by an open reading frame (OPG), which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA. Coding sequences can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0053] Control sequence: The term "control sequence" refers to a nucleic acid sequence that is essential for the expression of a polynucleotide encoding a polypeptide. Each control sequence can be native (i.e., from the same gene) or exogenous (i.e., from different genes) for the polynucleotide encoding the polypeptide, or each control sequence can be native or exogenous for each other. These control sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. At a minimum, the control sequence includes a promoter and termination signals for transcription and translation. The control sequence may be equipped with a linker for introducing a specific restriction site that facilitates the connection of the control sequence to the polynucleotide coding region encoding the polypeptide.

[0054] Endoglucanase: The term "endoglucanase" refers to endo-1,4-β-D-glucan 4-glucanohydrolase (EC 3.2.1.4), which catalyzes the endohydrolysis of β-1,4-β-D-glycosidic bonds in cellulose, cellulose derivatives (e.g., carboxymethyl cellulose and hydroxyethyl cellulose), lichen starch, mixed β-1,3-glucans such as cereal β-D-glucan or xyloglucan, and other plant materials containing cellulose components. Endoglucanase activity can be determined by measuring a decrease in substrate viscosity or an increase in the reducing end as determined by the reducing sugar assay (Zhang et al., 2006, Biotechnology Advances 24:452-481). For the purposes of this invention, the activity of endoglucanase was determined using carboxymethyl cellulose (CMC) as a substrate at pH 5 and 40°C, according to the method in Ghose, 1987, Pure and Appl. Chem. 59:257-268.

[0055] Expression: The term “expression” includes any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0056] Expression vector: The term “expression vector” refers to a linear or circular DNA molecule that contains a polynucleotide encoding a polypeptide, and the polynucleotide is operatively linked to a regulatory sequence provided for its expression.

[0057] Family 61 Glycoside Hydrolases: The terms “family 61 glycoside hydrolases” or “family GH61” or “GH61” are defined herein as polypeptides belonging to the glycoside hydrolases family 61, according to Henrissat B., 1991, A classification of glycosyl hydrolases based on amino-acid sequence similarities, Biochem. J. 280:309-316, and Henrissat B. and Bairoch A., 1996, Updating the sequence-based classification of glycosylhydrolases, Biochem. J. 316:695-696. Enzymes in this family were originally classified as glycoside hydrolases based on the very weak endo-1,4-β-D-glucanase activity measured in one family member. These enzymes have non-canonical structures and modes of action, and they cannot be considered true (bona fide) glycosidases. However, based on their ability to enhance the decomposition of lignin cellulose when used in conjunction with cellulase or a mixture of cellulases, they are retained in the CAZy classification.

[0058] Feruloyl esterase: The term "feruloyl esterase" refers to 4-hydroxy-3-methoxycinnamoyl-sugar hydrolase (EC 3.1.1.73), which catalyzes the hydrolysis of the 4-hydroxy-3-methoxycinnamoyl (feruloyl) group from esterified sugars (which are typically arabinose in natural biomass substrates) to produce ferulic acid (4-hydroxy-3-methoxycinnamic acid). Feruloyl esterase is also known as ferulic acid esterase, hydroxycinnamoyl esterase, FAE-III, cinnamic ester hydrolase, FAEA, cinnAE, FAE-I, or FAE-II. For the purposes of this invention, the activity of ferulic esterase was determined using 0.5 mM p-nitrophenyl ferulic acid in 50 mM sodium acetate at pH 5.0 as a substrate. One unit of ferulic esterase is equal to the amount of enzyme capable of releasing 1 micromole of p-nitrophenol anion per minute at pH 5 and 25°C.

[0059] Flanking DNA: The term "flank" refers to a DNA sequence that extends to either side of a specific DNA sequence, locus, or gene. Flanking DNA is closely adjacent to another DNA sequence, locus, or gene that will be integrated into the genome of a filamentous fungal cell.

[0060] Fragment: The term "fragment" means a polypeptide that has one or more (e.g., several) amino acids missing from the amino and / or carboxyl termini of a mature polypeptide; wherein the fragment exhibits enzymatic activity. In one aspect, the fragment contains at least 85%, for example at least 90% or at least 95% of the amino acid residues of the mature polypeptide containing the enzyme.

[0061] Hemicellulase or hemicellulase: The term “hemicellulase” or “hemicellulase” refers to one or more (e.g., several) enzymes that hydrolyze hemicellulose material. See, for example, Sharlom, D. and Shoham, Y. Microbial hemicellulases. Current Opinion In Microbiology, 2003, 6(3):219-228). Hemicellulases are key components in the degradation of plant biomass. Examples of hemicellulases include, but are not limited to, acetylmannan esterase, acetylxylan esterase, arabinonanase, arabinofuranylase, coumarin esterase, ferulic esterase, galactosidase, glucuronidase, glucuronidase, mannanase, mannosidase, xylanase, and xylosidase. The substrate of these enzymes, hemicellulose, is a mixed group of branched and linear polysaccharides that are cross-linked into robust networks by hydrogen bonds to cellulose microfibers in the plant cell wall. Hemicellulose is also covalently attached to lignin, forming a highly complex structure together with cellulose. The varied structure and organization of hemicellulose require the synergistic action of many enzymes for its complete degradation. The catalytic modules of hemicellulases are glycosidases (GH) that hydrolyze glycosidic bonds, or ester-linked glycoesterases (CE) that hydrolyze acetic acid or ferulic acid side groups. These catalytic modules, based on their primary structural homology, can be assigned to the GH and CE families. Some families, with generally similar folds, can be further classified into clans, labeled with letters (e.g., GH-A). The most informative and up-to-date classifications of these and other glycoactive enzymes are available in the Carbohydrate-Active Enzymes (CAZy) database. Hemicellulase activity can be measured according to Ghose and Bisaria, 1987, Pure & Appl. Chem. 59:1739-1752 at suitable temperatures, such as 50°C, 55°C, or 60°C, or suitable pH, such as 5.0 or 5.5.

[0062] Highly stringent conditions: The term "highly stringent conditions" refers to pre-hybridization and hybridization for 12 to 24 hours at 42°C using standard Southern blotting in 5X SSPE, 0.3% SDS, 200 μg / ml cleaved and denatured salmon sperm DNA, and 50% formamide. The vector material is then washed three times for 15 minutes each using 2X SSC and 0.2% SDS at 65°C.

[0063] Homologous 3' or 5' region: The term "homologous 3' region" refers to a DNA fragment that shares the same sequence as a region in the genome or has at least 70%, such as at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity, and when combined with a homologous 5' region, can be integrated into a specific site in the genome via homologous recombination. Homologous 5' and 3' regions must be linked in the genome, meaning they are on the same chromosome and within 200kb of each other.

[0064] Homologous flanking region: The term “homologous flanking region” refers to a DNA segment that is identical to or has at least 70%, such as at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with a region in the genome, and is located upstream or downstream of a specific site in the genome immediately following the targeted integration of extracellular DNA.

[0065] Homologous repeat: The term "homologous repeat" refers to a DNA segment that is repeated at least twice in recombinant DNA introduced into the host cell, and that can assist in DNA loss through homologous recombination, i.e., inserting a selection marker between two homologous repeats. Homologous repeat is also known as direct repeat.

[0066] Host cell: The term "host cell" refers to any cell type suitable for transformation, transfection, transduction, etc., using nucleic acid constructs or expression vectors containing polynucleotides encoding polypeptides. The term "host cell" also encompasses any offspring of the parent cell that differ from the parent cell due to mutations occurring during replication.

[0067] Separate: The term “separate” means a substance that exists in a form or environment not found in nature. Non-limiting examples of separate substances include (1) any substance that is not naturally occurring, (2) any substance that is at least partially separated from one or more of the naturally occurring components that are naturally associated with it, including but not limited to any enzyme, variant, nucleic acid, protein, peptide, or cofactor; (3) any substance that has been artificially modified relative to the substance found in nature; or (4) any substance that has been modified by increasing the amount of the substance relative to other components that are naturally associated with it (e.g., recombinant production in a host cell; multiple copies of the gene encoding the substance; use of a promoter stronger than the promoter naturally associated with the gene encoding the substance).

[0068] Low stringency conditions: The term "low stringency conditions" refers to pre-hybridization and hybridization for 12 to 24 hours at 42°C using standard Southern blotting in 5X SSPE, 0.3% SDS, 200 μg / ml cleaved and denatured salmon sperm DNA, and 25% formamide. The vector material is then washed three times for 15 minutes each using 2X SSC and 0.2% SDS at 50°C.

[0069] Mature polypeptide: The term "mature polypeptide" refers to a polypeptide in its final form after translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, according to the SignalP program (Nielsen et al., 1997, Protein Engineering 10:1-6) predicting amino acids 1 to 26 of SEQ ID NO:2 as the signal peptide, the mature polypeptide of *Aspergillus fumigatus* cellobiose hydrolase I is amino acids 27 to 532 of SEQ ID NO:2. In another aspect, according to the SignalP program (Nielsen et al., 1997, Protein Engineering 10:1-6) predicting amino acids 1 to 19 of SEQ ID NO:4 as the signal peptide, the mature polypeptide of *Aspergillus fumigatus* cellobiose hydrolase II is amino acids 20 to 454 of SEQ ID NO:4. In yet another aspect, according to the SignalP program (SEQ ID NO:6) predicting amino acids 1 to 19 of SEQ ID NO:6 as the signal peptide, the mature polypeptide of *Aspergillus fumigatus* β-glucosidase is amino acids 20 to 863 of SEQ ID NO:6. In another aspect, according to the SignalP program predicting that amino acids 1 to 25 of SEQ ID NO:8 are the signal peptide, the mature polypeptide of the *Penicillium* species GH61 polypeptide is amino acids 26 to 253 of SEQ ID NO:8. In another aspect, according to the SignalP program predicting that amino acids 1 to 17 of SEQ ID NO:10 are the signal peptide, the mature polypeptide of *Aspergillus fumigatus* xylanase I is amino acids 17 to 364 of SEQ ID NO:10. In another aspect, according to the SignalP program predicting that amino acids 1 to 19 of SEQ ID NO:12 are the signal peptide, the mature polypeptide of *Aspergillus fumigatus* xylanase II is amino acids 20 to 323 of SEQ ID NO:12. In another aspect, according to the SignalP program predicting that amino acids 1 to 19 of SEQ ID NO:14 are the signal peptide, the mature polypeptide of *Aspergillus fumigatus* xylanase III is amino acids 20 to 397 of SEQ ID NO:14. In another respect, according to the predicted SignalP program of amino acids 1 to 20 of SEQ ID NO:16, the mature polypeptide of Aspergillus fumigatus β-xylosidase is amino acids 21 to 792 of SEQ ID NO:20.

[0070] In another aspect, according to the SignalP program predicting that amino acids 1 to 17 of SEQ ID NO:18 are the signal peptide, the mature polypeptide of *Trichoderma reesei* cellobiose hydrolase I is amino acids 18 to 514 of SEQ ID NO:18. In another aspect, according to the SignalP program predicting that amino acids 1 to 18 of SEQ ID NO:20 are the signal peptide, the mature polypeptide of *Trichoderma reesei* cellobiose hydrolase II is amino acids 19 to 471 of SEQ ID NO:20. In another aspect, according to the SignalP program predicting that amino acids 1 to 19 of SEQ ID NO:22 are the signal peptide, the mature polypeptide of *Trichoderma reesei* β-glucosidase is amino acids 20 to 744 of SEQ ID NO:22. In another aspect, according to the SignalP program predicting that amino acids 1 to 19 of SEQ ID NO:24 are the signal peptide, the mature polypeptide of *Trichoderma reesei* xylanase I is amino acids 20 to 229 of SEQ ID NO:24. In another aspect, according to the SignalP program predicting that amino acids 1 to 19 of SEQ ID NO:26 are the signal peptide, the mature polypeptide of *Trichoderma reesei* xylanase II is amino acids 20 to 223 of SEQ ID NO:26. In another aspect, according to the SignalP program predicting that amino acids 1 to 16 of SEQ ID NO:28 are the signal peptide, the mature polypeptide of *Trichoderma reesei* xylanase III is amino acids 17 to 347 of SEQ ID NO:28. In another aspect, according to the SignalP program predicting that amino acids 1 to 20 of SEQ ID NO:30 are the signal peptide, the mature polypeptide of *Trichoderma reesei* β-xylosidase is amino acids 21 to 797 of SEQ ID NO:30.

[0071] It is known in the art that host cells can produce a mixture of two or more mature polypeptides (i.e., having different C-terminal and / or N-terminal amino acids) expressed by the same polynucleotide.

[0072] Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" refers to a polynucleotide encoding a mature polypeptide with enzymatic activity. In one aspect, according to the SignalP program predicting nucleotides 1 to 78 of SEQ ID NO:1 encoding a signal peptide (Nielsen et al., 1997, see above), the mature polypeptide coding sequence for Aspergillus fumigatus cellobiase I is nucleotides 79 to 1956 of SEQ ID NO:1 or its cDNA sequence. In another aspect, according to the SignalP program predicting nucleotides 1 to 57 of SEQ ID NO:3 encoding a signal peptide, the mature polypeptide coding sequence for Aspergillus fumigatus cellobiase II is nucleotides 58 to 1700 of SEQ ID NO:3 or its cDNA sequence. In yet another aspect, according to the SignalP program predicting nucleotides 1 to 57 of SEQ ID NO:5 encoding a signal peptide, the mature polypeptide coding sequence for Aspergillus fumigatus β-glucosidase is nucleotides 58 to 2580 of SEQ ID NO:5 or its cDNA sequence. In another aspect, according to the SignalP program predicting nucleotides 1 to 75 of SEQ ID NO:7 encoding a signal peptide, the mature polypeptide coding sequence of the Penicillium GH61 polypeptide is nucleotides 76 to 832 of SEQ ID NO:7 or its cDNA sequence. In another aspect, according to the SignalP program predicting nucleotides 1 to 51 of SEQ ID NO:9 encoding a signal peptide, the mature polypeptide coding sequence of Aspergillus fumigatus xylanase I is nucleotides 52 to 1145 of SEQ ID NO:9 or its cDNA sequence. In another aspect, according to the SignalP program predicting nucleotides 1 to 57 of SEQ ID NO:11 encoding a signal peptide, the mature polypeptide coding sequence of Aspergillus fumigatus xylanase II is nucleotides 58 to 1400 of SEQ ID NO:11 or its cDNA sequence. In another aspect, according to the SignalP program predicting nucleotides 1 to 106 of SEQ ID NO:13 encoding a signal peptide, the mature polypeptide coding sequence of Aspergillus fumigatus xylanase III is nucleotides 107 to 1415 of SEQ ID NO:13 or its cDNA sequence. In another respect, according to the SignalP program predicting that nucleotides 1 to 60 of SEQ ID NO:15 encode the signal peptide, the mature polypeptide encoding sequence of Aspergillus fumigatus β-xylosidase is nucleotides 61 to 2373 of SEQ ID NO:19 or its cDNA sequence.

[0073] In another aspect, according to the SignalP program predicting nucleotides 1 to 51 of SEQ ID NO:17 encoding a signal peptide, the mature polypeptide encoding sequence of *Trichoderma reesei* cellobiose hydrolase I is nucleotides 52 to 1545 of SEQ ID NO:17 or its cDNA sequence. In another aspect, according to the SignalP program predicting nucleotides 1 to 54 of SEQ ID NO:19 encoding a signal peptide, the mature polypeptide encoding sequence of *Trichoderma reesei* cellobiose hydrolase II is nucleotides 55 to 1608 of SEQ ID NO:19 or its cDNA sequence. In yet another aspect, according to the SignalP program predicting nucleotides 1 to 57 of SEQ ID NO:21 encoding a signal peptide, the mature polypeptide encoding sequence of *Trichoderma reesei* β-glucosidase is nucleotides 58 to 2612 of SEQ ID NO:21 or its cDNA sequence. In another aspect, according to the SignalP program predicting nucleotides 1 to 57 of SEQ ID NO:23 encoding a signal peptide, the mature polypeptide coding sequence of *Trichoderma reesei* xylanase I is nucleotides 58 to 749 of SEQ ID NO:23 or its cDNA sequence. In another aspect, according to the SignalP program predicting nucleotides 1 to 57 of SEQ ID NO:25 encoding a signal peptide, the mature polypeptide coding sequence of *Trichoderma reesei* xylanase II is nucleotides 58 to 778 of SEQ ID NO:25 or its cDNA sequence. In another aspect, according to the SignalP program predicting nucleotides 1 to 48 of SEQ ID NO:27 encoding a signal peptide, the mature polypeptide coding sequence of *Trichoderma reesei* xylanase III is nucleotides 49 to 1349 of SEQ ID NO:27 or its cDNA sequence. In another respect, according to the SignalP program predicting that nucleotides 1 to 60 of SEQ ID NO:29 encode the signal peptide, the mature polypeptide encoding sequence of Trichoderma reesei β-xylosidase is nucleotides 61 to 2391 of SEQ ID NO:39 or its cDNA sequence.

[0074] Moderately stringent conditions: The term "moderately stringent conditions" refers to pre-hybridization and hybridization for 12 to 24 hours at 42°C in 5X SSPE, 0.3% SDS, 200 μg / ml of cleaved and denatured salmon sperm DNA, and 35% formamide, according to standard Southern blotting. The vector material is then washed three times for 15 minutes each using 2X SSC and 0.2% SDS at 55°C.

[0075] Medium-high stringent conditions: The term "medium-high stringent conditions" refers to pre-hybridization and hybridization for 12 to 24 hours at 42°C in 5X SSPE, 0.3% SDS, 200 μg / ml of cleaved and denatured salmon sperm DNA, and 35% formamide, according to standard Southern blotting. The vector material is then washed three times for 15 minutes each using 2X SSC and 0.2% SDS at 60°C.

[0076] Nucleic acid constructs: The term “nucleic acid construct” refers to single-stranded or double-stranded nucleic acid molecules that are isolated from naturally occurring genes, or that are modified to contain segments of nucleic acid in a manner that would not normally exist in nature, or that are synthetic and contain one or more (e.g., several) regulatory sequences.

[0077] Operable ligation: The term “operable ligation” refers to a configuration in which a regulatory sequence is placed in the appropriate position relative to the coding sequence of a polynucleotide, such that the regulatory sequence guides the expression of the coding sequence.

[0078] Polypeptide with enhanced cellulolytic activity: The term "polypeptide with enhanced cellulolytic activity" refers to an enhanced GH61 polypeptide that catalyzes the hydrolysis of cellulose materials by an enzyme with enhanced cellulolytic activity. For the purposes of this invention, the enhanced cellulolytic activity is determined by measuring the increase in reducing sugars or the total amount of cellobiose and glucose in the hydrolyzed cellulose material by a cellulase compared to a control hydrolysis under the following conditions: 1-50 mg total protein / g cellulose in PCS, wherein the total protein comprises 50-99.5% w / w cellulase protein and 0.5-50% w / w GH61 polypeptide protein with enhanced cellulolytic activity, at a suitable temperature, e.g., 50°C, 55°C, or 60°C, and pH, e.g., 5.0 or 5.5, for 1-7 days, while the control hydrolysis is performed with an equal amount of total protein loading without enhanced cellulolytic activity (1-50 mg cellulase protein / g cellulose in PCS). In a preferred aspect, the cellulase protein loading is 2-3% by weight of Aspergillus oryzae β-glucosidase (recombinantly produced in Aspergillus oryzae according to WO 02 / 095014) or 2-3% by weight of Aspergillus fumigatus β-glucosidase (recombinantly produced in Aspergillus oryzae as described in WO 2002 / 095014). 1.5L (Novozymes A / S) A mixture from Denmark serves as a source of cellulose-degrading activity.

[0079] GH61 peptides with cellulose-degrading-enhancing activity enhance the hydrolysis of cellulose materials catalyzed by enzymes with cellulose-degrading activity by reducing the amount of cellulose-degrading enzymes required to achieve the same level of hydrolysis, preferably by at least 1.01 times, for example at least 1.05 times, at least 1.10 times, at least 1.25 times, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 10 times, or at least 20 times.

[0080] Pretreated corn stalks: The term “PCS” or “pretreated corn stalks” refers to cellulose material derived from corn stalks that has undergone heat and dilute sulfuric acid treatment, alkali pretreatment, or neutral pretreatment.

[0081] Sequence identity: The parameter “sequence identity” describes the correlation between two amino acid sequences or two nucleotide sequences.

[0082] For the purposes of this invention, the degree of sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol.48:443-453) executed in the Needle program, preferably version 5.0.0 or later, such as the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, TrendsGenet. 16:276-277), preferably version 5.0.0 or later. The parameters used are a gap penalty of 10, a gap extension penalty of 0.5, and an EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The percentage of identity is calculated using the Needle output labeled "longest identity" (obtained using the -nobrief option), and is calculated as follows:

[0083] (Same residues × 100) / (Alignment length - total number of gaps in alignment)

[0084] For the purposes of this invention, the degree of sequence identity between two nucleotide sequences was determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, see above) executed in a Needle program, preferably version 5.0.0 or later, such as EMBOSS (The European Molecular Biology Open Software Suite, Rice et al., 2000, see above). The parameters used were a nick penalty of 10, a nick extension penalty of 0.5, and an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The percentage of identity was calculated using the Needle output labeled "Highest Identity" (obtained using the -nobrief option), and was calculated as follows:

[0085] (same deoxyribonucleotides × 100) / (alignment length - total number of gaps in alignment)

[0086] Subsequence: The term "subsequence" refers to a polynucleotide that has one or more (e.g., several) nucleotides deleted from the 5' and / or 3' ends of a mature polypeptide coding sequence; wherein the subsequence encodes a fragment having enzymatic activity. In one aspect, the subsequence contains at least 85%, for example at least 90%, or at least 95% of the nucleotides of the mature polypeptide coding sequence of the enzyme.

[0087] Substantioplasmin-like serine protease: The term "substantioplasmin-like serine protease" refers to a protease with similar substrate specificity to substantioplasmin, which uses serine residues to catalyze the hydrolysis of peptide bonds in peptides and proteins. Substantioplasmin-like protease (substantioplasmin) is a serine protease characterized as a catalytic triad of three amino acids: aspartic acid, histidine, and serine. The arrangement of these catalytic residues is identical to that of the prototypical substantioplasmin from Bacillus licheniformis (Siezen and Leunissen, 1997, Protein Science 6:501-523). The activity of Bacillus subtilis protease-like serine protease can be determined by using the synthetic substrate N-succinyl-L-Ala-L-Ala-L-Pro-L-Phe-p-nitroanilide (AAPF) (Bachem AG, Bubendorf, Switzerland) in 100 mM NaCl-100 mM MOPS pH 7.0 at 50 °C for 3 hours, followed by measurement of absorbance at 405 nm.

[0088] Targeted integration: The term “targeted integration” refers to the stable integration of extracellular DNA into a defined genomic locus.

[0089] Transformer: The term "transformer" refers to a cell that takes up extracellular DNA (exogenous, artificial, or modified) and expresses the genes contained therein.

[0090] Transformation: The term “transformation” refers to the introduction of extracellular DNA into a cell, that is, the genetic change in a cell caused by the incorporation and expression of foreign genetic material (exogenous DNA) through uptake via the cell membrane and directly from its surroundings.

[0091] Trypsin-like serine protease: The term "trypsin-like serine protease" refers to a protease that has substrate specificity similar to trypsin, catalyzing the hydrolysis of peptide bonds in peptides and proteins using serine residues. For the purposes of this invention, trypsin-like serine protease activity is determined according to the steps described in Dienes et al., 2007, Enzyme and Microbial Technology 40:1087-1094.

[0092] Variants: The term "variant" refers to a polypeptide with enzymatic activity that contains alterations, namely substitutions, insertions, and / or deletions, at one or more (e.g., several) positions. Substitution means replacing an amino acid occupying a position with a different amino acid; deletion means removing an amino acid occupying a position; and insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.

[0093] Very High Tough Conditions: The term "very high tough conditions" refers to pre-hybridization and hybridization for 12 to 24 hours at 42°C in 5X SSPE, 0.3% SDS, 200 μg / ml of cleaved and denatured salmon sperm DNA, and 50% formamide, according to standard Southern blotting. The vector material is then washed three times for 15 minutes each using 2X SSC and 0.2% SDS at 70°C.

[0094] Very low stringency conditions: The term "very low stringency conditions" refers to pre-hybridization and hybridization for 12 to 24 hours at 42°C using standard Southern blotting in 5X SSPE, 0.3% SDS, 200 μg / ml cleaved and denatured salmon sperm DNA, and 25% formamide. The vector material is then washed three times for 15 minutes each using 2X SSC and 0.2% SDS at 45°C.

[0095] Xylan-containing materials: The term "xylan-containing material" refers to any material containing a plant cell wall polysaccharide with a backbone of β-(1-4)-linked xylose residues. Terrestrial plant xylans are heteropolymers with a β-(1-4)-xylan backbone branched by short sugar chains. They contain D-glucuronic acid or its 4-O-methyl ether, L-arabinose, and / or a variety of oligosaccharides containing D-xylose, L-arabinose, D- or L-galactose, and D-glucose. Xylan-type polysaccharides can be classified into homooxylans and heterooxylans, the latter including glucuronide xylan, (arabino)glucuronide xylan, (glucuronide)arabinoxylan, arabinoxylan, and complex heterooxylans. See, for example, Ebringerova et al., 2005, Adv. Polym. Sci. 186:1-67.

[0096] In the process of this invention, any material containing xylan can be used. In a preferred aspect, the xylan-containing material is lignin cellulose.

[0097] Xylan degradation activity or xylan decomposition activity: The term “xylan degradation activity” or “xylan decomposition activity” refers to the biological activity of hydrolyzing xylan-containing materials. Two basic methods for determining xylan decomposition activity include: (1) determining total xylan decomposition activity, and (2) determining individual xylan decomposition activities (e.g., endoxylanase, β-xylosidase, arabinofuranyl esterase, α-glucuronyl esterase, acetylxylan esterase, ferulic acid esterase, and α-glucuronyl esterase). Recent advances in xylanase assays are summarized in several published articles, including Biely and Puchard, Recent progress in the assays of xylanolytic enzymes, 2006, Journal of the Science of Food and Agriculture 86(11):1636-1647; Spanikova and Biely, 2006, Glucuronoyl esterase-Novel carbohydrate esterase produced by Schizophlum commune, FEBS Letters 580(19):4597-4601; Herrmann, Vrsanska, Jurickova, Hirsch, Biely and Kubicek, 1997, The beta-D-xylosidase of Trichodermareesei is a multifunctional beta-D-xylan xylohydrolase, Biochemical Journal 321:375-381.

[0098] Total xylan degradation activity can be measured by identifying reducing sugars formed from various types of xylans, including, for example, oat spelt, beechwood, and larchwood xylans, or by spectrophotometric determination of stained xylan fragments released from various covalently stained xylans. The most common assay for total xylan degradation activity is based on the generation of reducing sugars from poly(4-O-methylglucuronic acid) xylans, as described in Bailey, Biely, and Puttanen, 1992, Interlaboratory testing of methods for assay of xylanase activity, Journal of Biotechnology 23(3):257-270. Xylanase activity can also be measured using 0.2% AZCL-arabinoxylan as a substrate at 37°C at 0.01%... X-100 (4-(1,1,3,3-tetramethylbutyl)phenyl-polyethylene glycol) and 200 mM sodium phosphate buffer at pH 6 were used for determination. One unit of xylanase activity was defined as the production of 1.0 μmol azuril per minute from 0.2% AZCL-arabinoxylan as substrate in 200 mM sodium phosphate pH 6 buffer at 37 °C.

[0099] For the purposes of this invention, xylan degradation activity was determined by measuring the increase in the hydrolysis of birch xylan (Sigma Chemical Co., Inc., St. Louis, MO, USA) caused by xylan-degrading enzymes under the following typical conditions: 1 ml reaction, 5 mg / ml substrate (total solids), 5 mg xylan-degrading protein / g substrate, 50 mM sodium acetate, pH 5, 50 °C, 24 h, with sugar analysis performed using the p-hydroxybenzoic acid hydrazide (PHBAH) assay as described in Lever, 1972, A new reaction for colorimetric determination of carbohydrates, Anal. Biochem 47:273-279.

[0100] Xylanase: The term "xylanase" refers to 1,4-β-D-xylan-xylohydrolase (EC 3.2.1.8), which catalyzes the internal hydrolysis of the 1,4-β-D-xylosidic bond in xylan. For the purposes of this invention, xylanase activity is determined using 0.2% AZCL-arabinoxylan as a substrate. One unit of xylanase activity is defined as the production of 1.0 μmol of azurite per minute from 0.2% AZCL-arabinoxylan as a substrate at 37°C, pH 6, in 200 mM sodium phosphate pH 6 buffer. Invention Details

[0101] The present invention relates to an enzyme composition comprising (i) Aspergillus fumigatus cellobiose hydrolase I; (ii) Aspergillus fumigatus cellobiose hydrolase II; (iii) Aspergillus fumigatus β-glucosidase or a variant thereof; and (iv) a Penicillium species (emersonii) GH61 polypeptide having enhanced cellulose-degrading activity; or a homolog thereof.

[0102] In one aspect, the recombinant Trichoderma host cell further comprises Aspergillus fumigatus xylanase, Aspergillus fumigatus β-xylosidase, or a combination thereof; or homologs thereof.

[0103] The enzyme composition of the present invention is more effective in decomposing cellulose materials than the cellulose-decomposing enzyme composition produced by Trichoderma reesei.

[0104] Enzyme composition

[0105] In this invention, any Aspergillus fumigatus cellobiase I, Aspergillus fumigatus cellobiase II, Aspergillus fumigatus β-glucosidase or variant thereof may be used; Penicillium GH61 polypeptide with cellulose-enhancing activity, Aspergillus fumigatus xylanase, or Aspergillus fumigatus β-xylosidase, or homolog thereof.

[0106] In one aspect, the Aspergillus fumigatus cellobiase I or a homologue thereof is selected from the group consisting of: (i) cellobiase I comprising or constituting the mature polypeptide of SEQ ID NO:2; (ii) cellobiase I comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:2; and (iii) cellobiase I encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to the sequence of SEQ ID NO:2. The mature polypeptide coding sequence of NO:1 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) cellobiase I, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:1 or its full-length complementary strand under at least high-strength conditions, for example, very high-strength conditions.

[0107] In another aspect, the Aspergillus fumigatus cellobiase II or its homologs are selected from the group consisting of: (i) cellobiase II comprising or constituting the mature polypeptide of SEQ ID NO:4; (ii) cellobiase II comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:4; and (iii) cellobiase II encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to the sequence of SEQ ID NO:4. The mature polypeptide coding sequence of NO:3 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) cellobiase II, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:3 or its full-length complementary strand under at least high-strength conditions, for example, very high-strength conditions.

[0108] In another aspect, the Aspergillus fumigatus β-glucosidase or its homologs are selected from the group consisting of: (i) β-glucosidase comprising or constituting the mature polypeptide of SEQ ID NO:6; (ii) β-glucosidase comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:6; and (iii) β-glucosidase encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to the sequence of SEQ ID NO:6. The mature polypeptide coding sequence of NO:5 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) β-glucosidase, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:5 or its full-length complementary strand under at least high stringent conditions, for example, very high stringent conditions.

[0109] In another aspect, the GH61 polypeptide of *Penicillium* species *emersonii* or its homologs having cellulolytic-enhancing activity is selected from the group consisting of: (i) GH61 polypeptides having cellulolytic-enhancing activity comprising or constituting the mature polypeptide of SEQ ID NO:8; (ii) GH61 polypeptides having cellulolytic-enhancing activity comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:8; (iii) GH61 polypeptides having cellulolytic-enhancing activity encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to the sequence of SEQ ID NO:8. The mature polypeptide coding sequence of NO:7 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) a GH61 polypeptide having cellulose-enhancing activity, which is encoded by a polynucleotide that hybridizes with the mature polypeptide coding sequence of SEQ ID NO:7 or its full-length complementary strand under at least high stringent conditions, for example, very high stringent conditions.

[0110] In another aspect, the Aspergillus fumigatus xylanase or its homologs are selected from the group consisting of: (i) xylanases comprising or constituting a mature polypeptide of SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14; (ii) xylanases comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:10, SEQ ID NO:14; and (iii) xylanases encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to SEQ ID NO:9, SEQ ID NO:11, or SEQ ID NO:14. The mature polypeptide coding sequence of NO:13 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) xylanase, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:9, SEQ ID NO:11 or SEQ ID NO:13 or its full-length complementary strand under at least high stringent conditions, for example, very high stringent conditions.

[0111] In another aspect, the Aspergillus fumigatus β-xylosidase or its homologs are selected from the group consisting of: (i) β-xylosidase comprising or constituting the mature polypeptide of SEQ ID NO:16; (ii) β-xylosidase comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:16; and (iii) β-xylosidase encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to the sequence of SEQ ID NO:16. The mature polypeptide coding sequence of NO:15 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) β-xylosidase, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:15 or its full-length complementary strand under at least high stringent conditions, for example, very high stringent conditions.

[0112] Nucleic acid probes can be designed using polynucleotides or subsequences thereof from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, or 15, and polypeptides or fragments thereof from SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, or 16, to identify and clone DNA encoding enzymes from strains of different genera or species according to methods known in the art. Specifically, these probes can be used to hybridize with genomic DNA or cDNA of cells of interest according to standard Southern blotting methods to identify and isolate the corresponding genes therefrom. These probes may be significantly shorter than the complete sequence, but should be at least 15, for example at least 25, at least 35, or at least 70 nucleotides in length. Preferably, the nucleic acid probes are at least 100 nucleotides in length, for example at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, or at least 900 nucleotides. Both DNA and RNA probes can be used. Probes are typically labeled to detect corresponding genes (e.g., using...). 32 P, 3 H, 35S, biotin or avidin labeling). These probes are covered in this invention.

[0113] DNA that hybridizes to the probes described above and encodes the enzyme can be screened from genomic DNA or cDNA libraries. Genomic or other DNA can be isolated by agarose or polyacrylamide gel electrophoresis, or by other separation techniques. DNA from the library or isolated DNA can be transferred to nitrocellulose or other suitable carrier material and immobilized thereon. To identify clones or DNA that hybridize to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13 or 15 or their subsequences, the carrier material is used in a Sounthern blot.

[0114] For the purposes of this invention, hybridization refers to the hybridization of polynucleotides with labeled nucleic acid probes under very low to very high stringent conditions, said nucleic acid probes corresponding to: (i) SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, or 15; (ii) the mature polypeptide coding sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, or 15; (iii) their cDNA sequence; (iv) their full-length complementary strand; or (iv) their subsequence. Molecules hybridizing with nucleic acid probes under these conditions can be detected using, for example, X-ray film or any other detection method known in the art.

[0115] In one aspect, the nucleic acid probe is SEQ ID NO:1, 3, 5, 7, 9, 11, 13, or 15, or a mature polypeptide encoding sequence thereof. In another aspect, the nucleic acid probe is a polypeptide encoding SEQ ID NO:2, 4, 6, 8, 10, 12, 14, or 16, a mature polypeptide thereof, or a fragment thereof, of a polynucleotide.

[0116] Techniques for isolating or cloning polynucleotides are known in the art and include isolating DNA or cDNA, or combinations thereof, from the genome. Cloning polynucleotides from such genomic DNA can be achieved by detecting cloned DNA fragments with shared structural characteristics, for example, using well-known polymerase chain reaction (PCR) or antibody screening of expression libraries. See, for example, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification methods can be used, such as ligase chain reaction (LCR), ligated activated transcription (LAT), and polynucleotide-based amplification (NASBA). The polynucleotide may be an allelic or species variant of the polypeptide coding region of the polynucleotide.

[0117] Variants of the above-mentioned enzymes (or proteins) can be engineered using protein engineering.

[0118] In one aspect, the variant is an Aspergillus fumigatus β-glucosidase variant. In another aspect, the Aspergillus fumigatus β-glucosidase variant contains substitutions at one or more of positions (several) corresponding to positions 100, 283, 456, and 512 of SEQ ID NO:6, wherein the variant has β-glucosidase activity.

[0119] In one embodiment, the variant has at least 80%, for example at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% sequence identity with the parental β-glucosidase.

[0120] In another embodiment, the variant has at least 80%, for example at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% sequence identity with the mature polypeptide SEQ ID NO:6.

[0121] For the purposes of this invention, the mature polypeptide disclosed in SEQ ID NO:6 is used to determine the corresponding amino acid residues in other β-glucosidases. The amino acid sequences of the other β-glucosidases are aligned with the mature polypeptide disclosed in SEQ ID NO:6, and based on this alignment, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) (e.g., executed using the Needle program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet 16: 276-277), preferably version 5.0.0 or later) is used to determine the amino acid position number corresponding to any amino acid residue in the mature polypeptide disclosed in SEQ ID NO:6. The parameters used are a nick opening penalty of 10, a nick extension penalty of 0.5, and an EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The identification of the corresponding amino acid residues in another β-glucosidase can be determined by aligning multiple polypeptide sequences using several computer programs with their respective default parameters. These computer programs include, but are not limited to, MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32:1792-1797), MAFFT (version 6.857 or later; Katoh et al., 2005, Nucleic Acids Research 33:511-518; Katoh and Toh, 2007, Bioinformatics 23:372-374; Katoh et al., 2009, Methods in Molecular Biology 537:39-64; Katoh and Toh, 2010, Bioinformatics). 26:1899-1900) and using ClustalW's EMBOSS EMMA (1.83 or later; Thompson et al., 1994, Nucleic Acids Research 22:4673-4680).

[0122] For amino acid substitutions, the following nomenclature is used: initial amino acid, position, substituted amino acid. Accordingly, a substitution of threonine with alanine at position 226 is named "Thr226Ala" or "T226A". Multiple mutations can be separated by plus signs ("+"), for example, "Gly205Arg+Ser411Phe" or "G205R+S411F", representing the substitution of glycine (G) with arginine (R) at positions 205 and 411, respectively, and the substitution of serine (S) with phenylalanine (F).

[0123] In one aspect, the variant includes substitutions for one or more positions(s) corresponding to positions 100, 283, 456, and 512. In another aspect, the variant includes substitutions for any two positions corresponding to positions 100, 283, 456, and 512. In yet another aspect, the variant includes substitutions for any three positions corresponding to positions 100, 283, 456, and 512. In yet another aspect, the variant includes substitutions for each position corresponding to positions 100, 283, 456, and 512.

[0124] In another aspect, the variant comprises or constitutes a substitution at the position corresponding to position 100. In another aspect, the amino acid at the position corresponding to position 100 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Asp. In another aspect, the variant described in S comprises or constitutes a substituted F100D of the mature polypeptide of EQID NO:6.

[0125] In another aspect, the variant comprises or constitutes a substitution at the position corresponding to position 283. In another aspect, the amino acid at the position corresponding to position 283 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Gly. In another aspect, said variant comprises or constitutes a substitution S283G of the mature polypeptide of SEQ ID NO:6.

[0126] In another aspect, the variant comprises or constitutes a substitution at the position corresponding to position 456. In another aspect, the amino acid at the position corresponding to position 456 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Glu. In another aspect, said variant comprises or constitutes N456E substituted for the mature polypeptide of SEQ ID NO:6.

[0127] In another aspect, the variant comprises or constitutes a substitution at the position corresponding to position 512. In another aspect, the amino acid at the position corresponding to position 512 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Tyr. In another aspect, said variant comprises or constitutes a substituted F512Y of the mature polypeptide of SEQ ID NO: 6.

[0128] In another respect, the variants include or consist of substitutions at positions corresponding to positions 100 and 283, as those described above.

[0129] In another respect, the variants include or consist of substitutions at positions corresponding to positions 100 and 456, as those mentioned above.

[0130] In another respect, the variants include or consist of substitutions at positions corresponding to positions 100 and 512, as those described above.

[0131] In another respect, the variants include or consist of substitutions at positions corresponding to positions 283 and 456, as those mentioned above.

[0132] In another respect, the variants include or consist of substitutions at positions corresponding to positions 283 and 512, as those described above.

[0133] In another respect, the variants include or consist of substitutions at positions corresponding to positions 456 and 512, as those mentioned above.

[0134] In another respect, the variants include or consist of substitutions at positions corresponding to positions 100, 283, and 456, as those mentioned above.

[0135] In another respect, the variants include or consist of substitutions at positions corresponding to positions 100, 283, and 512, as those mentioned above.

[0136] In another respect, the variants include or consist of substitutions at positions corresponding to positions 100, 456, and 512, as those mentioned above.

[0137] In another respect, the variants include or consist of substitutions at positions corresponding to positions 283, 456, and 512, as those mentioned above.

[0138] In another respect, the variants include or consist of substitutions at positions corresponding to positions 100, 283, 456, and 512, as those mentioned above.

[0139] In another respect, the variants contain or consist of one or more substitutions selected from the following group: G142S, Q183R, H266Q, and D703G.

[0140] In another respect, the variant contains or constitutes a substituted F100D+S283G of the mature polypeptide of SEQ ID NO:6.

[0141] In another respect, the variant contains or constitutes a substituted F100D+N456E of the mature polypeptide of SEQ ID NO:6.

[0142] In another aspect, the variant contains or constitutes a substituted F100D+F512Y of the mature polypeptide of SEQ ID NO:6.

[0143] In another respect, the variant contains or constitutes a substituted S283G+N456E of the mature polypeptide of SEQ ID NO:6.

[0144] In another respect, the variant contains or constitutes a substituted S283G+F512Y of the mature polypeptide of SEQ ID NO:6.

[0145] In another respect, the variant contains or constitutes a substituted N456E+F512Y of the mature polypeptide of SEQ ID NO:6.

[0146] In another respect, the variant contains or constitutes a substituted F100D+S283G+N456E of the mature polypeptide of SEQ ID NO:6.

[0147] In another aspect, the variant contains or constitutes a substituted F100D+S283G+F512Y of the mature polypeptide of SEQ ID NO:6.

[0148] In another aspect, the variant contains or constitutes a substituted F100D+N456E+F512Y of the mature polypeptide of SEQ ID NO:6.

[0149] In another respect, the variant contains or constitutes a substitution of S283G+N456E+F512Y for the mature polypeptide of SEQ ID NO:6.

[0150] In another aspect, the variant contains or constitutes a substitution of F100D+S283G+N456E+F512Y for the mature polypeptide of SEQ ID NO:6.

[0151] The variants may consist of 720 to 863 amino acids, for example 720 to 739, 740 to 759, 760 to 779, 780 to 799, 800 to 819, 820 to 839, and 840 to 863 amino acids.

[0152] The variant may further include changes in one or more other locations.

[0153] The enzyme composition may further comprise one or more (e.g., several) enzymes selected from the group consisting of: cellulase, GH61 polypeptide with cellulolytic-enhancing activity, hemicellulase, esterase, patulin, laccase, lignin-degrading enzyme, pectinase, peroxidase, protease, and swelling agent. In another aspect, the cellulase is preferably one or more (e.g., several) enzymes selected from the group consisting of: endoglucanase, cellobiase, and β-glucosidase. In another aspect, the hemicellulase is preferably one or more (e.g., several) enzymes selected from the group consisting of: acetylmannan esterase, acetylxylan esterase, arabinonanase, arabinofuranase, coumarate esterase, ferulic acid esterase, galactosidase, glucuronidase, glucuronidase, mannanase, mannosidase, xylanase, and xylosidase.

[0154] One or more enzymes may be wild-type proteins, recombinant proteins, or combinations of wild-type and recombinant proteins. For example, one or more enzymes may be native proteins of a cell, which can be used as a host cell to recombinantly express the enzyme composition.

[0155] Examples of bacterial endoglucanases that can be used in the methods of the present invention include, but are not limited to, Acidothermus cellulolyticus endoglucanase (WO 91 / 05039; WO 93 / 15186; U.S. Patent 5,275,944; WO 96 / 02551; U.S. Patent 5,536,655, WO 00 / 70031, WO 05 / 093050); Thermobifida fusca endoglucanase III (WO 05 / 093050); and Thermobifida fusca endoglucanase V (WO 05 / 093050).

[0156] Examples of fungal endoglucanases that can be used in this invention include, but are not limited to, *Trichoderma reesei* endoglucanase I (Penttila et al., 1986, Gene 45:253-263), *Trichoderma reesei* Cel7B endoglucanase I; GENBANK TM Accession number M15665); Trichoderma reesei endoglucanase II (Saloheimo et al., 1988, Gene 63:11-22, Trichoderma reesei Cel5A endoglucanase II; GENBANK TM Accession number M19373; SEQ ID NO: 6); Trichoderma reesei endoglucanase III (Okada et al., 1988, Appl. Environ. Microbiol. 64:555-563; GENBANK) TM Accession number AB003694); Trichoderma reesei endoglucanase V (Saloheimo et al., 1994, Molecular Microbiology 13:219-228; GENBANK) TM Accession number Z33381); Aspergillus echinosporum endoglucanase (Ooi et al., 1990, Nucleic Acids Research 18:5884); Aspergillus kawachii endoglucanase (Sakamoto et al., 1995, Current Genetics 27:435-439); Erwinia carotovara endoglucanase (Saarilahti et al., 1990, Gene 90:9-14); Fusarium oxysporum endoglucanase (GENBANK) TM Accession number L29381); Endoglucanase of *Thermoidea* variant (GENBANK) TM Accession number AB003107); Melanocarpus albomyces endoglucanase (GENBANK) TM Accession number MAL515703); Neurospora crassa endoglucanase (GENBANK) TMAccession number XM_324477); *Specific humic fungi* endoglucanase V; *Thermophilus hygrophytes* CBS 117.65 endoglucanase; *Basidiomycetes* CBS 495.95 endoglucanase; *Basidiomycetes* CBS 494.95 endoglucanase; *Cladorrhinum foecundissimum* NRRL 8126CEL6B endoglucanase; *Cladorrhinum foecundissimum* NRRL 8126CEL6C endoglucanase; *Cladorrhinum foecundissimum* NRRL 8126CEL7C endoglucanase; *Cladorrhinum foecundissimum* ATCC 62373CEL7A endoglucanase; and Trichoderma reesei strain VTT-D-80133 endoglucanase (GENBANK) TM Login number M15665).

[0157] In one aspect, the enzyme composition further comprises *Trichoderma* endoglucanase I. In another aspect, the enzyme composition further comprises *Trichoderma reesei* endoglucanase I. In yet another aspect, the enzyme composition further comprises *Trichoderma reesei* Cel7B endoglucanase I (GENBANK). TM (Accession number M15665). In another aspect, the *Trichoderma reesei* endoglucanase I is natural for the host cell. In another aspect, the *Trichoderma reesei* endoglucanase I is the mature polypeptide of SEQ ID NO:90.

[0158] In another aspect, the enzyme composition further comprises *Trichoderma* endoglucanase II. In another aspect, the enzyme composition further comprises *Trichoderma reesei* endoglucanase II. In another aspect, the enzyme composition further comprises *Trichoderma reesei* Cel5A endoglucanase II (GENBANK). TM (Accession number M19373). In another aspect, the *Trichoderma reesei* endoglucanase II is natural for the host cell. In another aspect, the *Trichoderma reesei* endoglucanase I is the mature polypeptide of SEQ ID NO:92.

[0159] The composition can be prepared according to methods known in the art and can be in the form of a liquid or dry composition. The composition can be stabilized according to methods known in the art.

[0160] The enzyme composition may also be a fermentation broth preparation or a cell composition.

[0161] The term "fermentation broth" is used herein to refer to a preparation produced by cell fermentation that undergoes little or no recovery and / or purification. For example, fermentation broth is produced when a microbial culture is grown to saturation, incubated under carbon-limited conditions to allow protein synthesis (e.g., expression of enzymes by the host cell), and secreted into the cell culture medium. The fermentation broth may contain unfractionated or fractionated contents of fermentation material derived at the end of fermentation. Typically, fermentation broth is unfractionated and contains used culture medium and cell fragments remaining after, for example, removal of microbial cells (e.g., filamentous fungal cells) by centrifugation. In some embodiments, the fermentation broth contains used cell culture medium, extracellular enzymes, and living and / or non-living microbial cells.

[0162] In one embodiment, the fermentation broth formulation and cell composition comprise a first organic acid component and a second organic acid component, the first organic acid component comprising at least one organic acid with 1-5 carbons and / or its salt, and the second organic acid component comprising at least one organic acid with 6 or more carbons and / or its salt. In a specific embodiment, the first organic acid component is acetic acid, formic acid, propionic acid, its salt, or a mixture of two or more of the foregoing, and the second organic acid component is benzoic acid, cyclohexanecarboxylic acid, 4-methylvaleric acid, phenylacetic acid, its salt, or a mixture of two or more of the foregoing.

[0163] In one aspect, the composition contains an organic acid and optionally further contains killed cells and / or cell fragments. In one embodiment, the killed cells and / or cell fragments are removed from the cell-killing whole culture medium to provide a composition free of these components.

[0164] The fermentation broth formulation or cell composition may further contain preservatives and / or antimicrobial (e.g., bacteriostatic) agents, including but not limited to sorbitol, sodium chloride, potassium sorbate, and others known in the art.

[0165] The cell-killing whole culture or composition may contain ungraded contents of fermentation material derived at the end of fermentation. Typically, the cell-killing whole culture or composition contains used culture medium and cell fragments present after microbial cells (e.g., filamentous fungal cells) have been grown to saturation and incubated under carbon-limited conditions to allow protein synthesis. In some embodiments, the cell-killing whole culture or composition contains used cell culture medium, extracellular enzymes, and killed filamentous fungal cells. In some embodiments, the microbial cells present in the cell-killing whole culture or composition may be permeated and / or lysed using methods known in the art.

[0166] The whole culture medium or cell composition described herein is typically a liquid but may contain insoluble components such as killed cells, cell fragments, culture medium components, and / or insoluble enzymes. In some embodiments, insoluble components may be removed to provide a clear liquid composition.

[0167] The whole culture medium formulations and cell compositions of the present invention can be produced by the methods described in WO 90 / 15861 or WO 2010 / 096673.

[0168] host cells

[0169] This invention also relates to recombinant filamentous fungal host cells comprising polynucleotides encoding: (i) *Aspergillus fumigatus* cellobiose hydrolase I; (ii) *Aspergillus fumigatus* cellobiose hydrolase II; (iii) *Aspergillus fumigatus* β-glucosidase or a variant thereof; and (iv) a *Penicillium* species GH61 polypeptide having enhanced cellulose-degrading activity; or homologs thereof. The term "host cell" encompasses any progeny of the parent cell that differs from the parent cell due to mutations occurring during replication.

[0170] The host cell can be any filamentous fungal cell available for the recombinant production of enzymes or proteins.

[0171] "Filamentous fungi" encompasses all filamentous forms within the phylum Eumycota and subphyla of Oomycetes (as defined by Hawksworth et al., 1995, see above). Filamentous fungi are typically characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. They undergo vegetative growth through hyphal extension, and their carbon metabolism is obligate aerobic. In contrast, yeasts, such as Saccharomyces cerevisiae, exhibit vegetative growth through budding of single-celled cells, and their carbon metabolism can be fermentative.

[0172] The host cells of filamentous fungi can be from genera such as *Acremonium*, *Aspergillus*, *Aureobasidium*, *Bjerkandera*, *Ceriporiopsis*, *Chrysosporium*, *Coprinus*, *Coriolus*, *Cryptococcus*, *Filibasidium*, *Fusarium*, *Humicola*, *Magnaporthe*, *Mucor*, and *Myceliophtho*. Cells of the genera *Neocallimastix*, *Neurospora*, *Paecilomyces*, *Penicillium*, *Phanerochaete*, *Phlebia*, *Piromyces*, *Pleurotus*, *Schizophyllum*, *Talaromyces*, *Thermoascus*, *Thielavia*, *Tolypocladium*, *Trametes*, or *Trichoderma*.

[0173] For example, the host cells of the filamentous fungi may be *Aspergillus awamori*, *Aspergillus fumigatus*, *Aspergillus foetidus*, *Aspergillus japonicus*, *Aspergillus nidulans*, *Aspergillus niger*, *Aspergillus oryzae*, *Bjerkandera adusta*, *Ceriporiopsisaneirina*, *Ceriporiopsis caregiea*, *Ceriporiopsis gilvescens*, *Ceriporiopsis pannocinta*, *Ceriporiopsis rivulosa*, *Ceriporiopsis subrufa*, *Ceriporiopsis subvermispora*, *Chrysosporium inops*, and *Chrysosporium*. keratinophilum), Chrysosporium lucknowense, Chrysosporium merdartium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinuscinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, elderberry falciparum, skin-colored falciparumFusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thievaria terrestris, Trametes Trichoderma villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cells.

[0174] Fungal cells can be transformed in a manner known per se through methods involving protoplast formation, protoplast transformation, and cell wall regeneration. Suitable methods for transforming Aspergillus and Trichoderma host cells are described in EP 238 023 and Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81:1470-1474, and Christensen et al., 1988, Bio / Technology 6:1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78:147-156 and WO 96 / 00787. Yeast can be transformed using methods described in the following literature: Becker and Guarente, in Abelson, JN and Simon, MI (eds.), Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, J. Bacteriol. 153:163; and Hinnen et al., 1978, Proc. Natl. Acad. Sci. USA 75:1920.

[0175] The Trichoderma host cell can be any Trichoderma cell that can be used for recombinant production of enzymes or proteins. For example, the Trichoderma cell can be *Trichoderma harzianum*, *Trichoderma koningii*, *Trichoderma longibrachiatum*, *Trichoderma reesei*, or *Trichoderma viride* cells. In one aspect, the Trichoderma cell is a *Trichoderma harzianum* cell. In another aspect, the Trichoderma cell is a *Trichoderma koningii* cell. In another aspect, the Trichoderma cell is a *Trichoderma longibrachiatum* cell. In another aspect, the Trichoderma cell is a *Trichoderma reesei* cell. In another aspect, the Trichoderma cell is a *Trichoderma viride* cell.

[0176] In another aspect, the *Trichoderma reesei* cells are *Trichoderma reesei* RutC30. In another aspect, the *Trichoderma reesei* cells are *Trichoderma reesei* TV10. In another aspect, the *Trichoderma viride* cells are mutants of *Trichoderma reesei* RutC30. In another aspect, the *Trichoderma reesei* cells are mutants of *Trichoderma reesei* TV10. In another aspect, the *Trichoderma viride* cells are morphological mutants of *Trichoderma reesei*. See, for example, WO 97 / 26330, which is incorporated herein by reference in its entirety.

[0177] Trichoderma cells can be transformed in a manner known per se through processes involving protoplast formation, protoplast transformation, and cell wall regeneration. Suitable methods for transforming Trichoderma host cells are described in EP 238023 and Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81:1470-1474 and Christensen et al., 1988, Bio / Technology 6:1419-1422.

[0178] In Trichoderma host cells, said genes can be inactivated by disrupting or deleting one or more (e.g., several) native cellulase and / or hemicellulase genes or portions thereof. This results in mutant cells producing less or no said cellulase and / or hemicellulase when cultured under the same conditions compared to parental cells. In one aspect, said one or more (e.g., several) cellulase genes encode enzymes selected from the group consisting of: cellobiase I, cellobiase II, endoglucanase I, endoglucanase II, β-glucosidase, and swelling enzyme. In another aspect, said one or more (e.g., several) hemicellulase genes encode enzymes selected from the group consisting of: xylanase I, xylanase II, xylanase III, and β-xylosidase. In another aspect, the one or more (e.g., several) hemicellulase genes encode enzymes selected from the group consisting of: acetylmannan esterase, acetylxylan esterase, arabinonanase, arabinofuranosidase, coumarin esterase, ferulic esterase, galactosidase, glucuronidase, glucuronidase, mannanase, and mannosidase.

[0179] The mutant cells can have the expression of polynucleotides encoding Trichoderma cellulases or hemicellulases reduced or eliminated using methods known in the art, such as insertion, disruption, substitution, or deletion. In a preferred aspect, the polynucleotide is inactivated. The polynucleotide to be modified or inactivated can be, for example, a coding region or a portion thereof essential for its activity, or a regulatory sequence required for expression of the coding region. Examples of such regulatory sequences can be promoter sequences or functional portions thereof, i.e., portions sufficient to affect polynucleotide expression. Other regulatory sequences that can be modified include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, signal peptide sequences, transcription terminators, and transcription activators.

[0180] Polynucleotide modification or inactivation can be achieved by inducing mutagenesis in parental cells and selecting mutant cells in which the expression of polynucleotides has been reduced or eliminated. Mutagenesis can be specific or random and can be performed, for example, by using suitable physical or chemical mutagens, by using suitable oligonucleotides, or by mutagenesis generated by PCR of the DNA sequence. Furthermore, mutagenesis can be performed by any combination of these mutagens.

[0181] Examples of physical or chemical mutagens suitable for the purposes of this invention include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methylhydroxylamine, nitrous acid, ethyl methanesulphonate (EMS), sodium bisulfite, formic acid, and nucleotide analogs.

[0182] When using these reagents, the mutagenesis is usually performed by incubating the parental cells to be mutated in the presence of the mutagen under suitable conditions, and screening and / or selecting mutant cells that show reduced gene expression or no gene expression.

[0183] Polynucleotide modification or inactivation can also be achieved by inserting, substituting, or deleting one or more (e.g., several) nucleotides in a gene or its regulatory elements required for transcription or translation. For example, nucleotides can be inserted or removed to result in the introduction of a stop codon, removal of a start codon, or alteration of the open reading frame. Such modification or inactivation can be achieved by localized mutagenesis or PCR-induced mutagenesis according to methods known in the art. Although the modification can theoretically be performed in vivo, i.e., directly on cells expressing the polynucleotide to be modified, it is preferred to perform the modification in vitro as exemplified below.

[0184] Examples of convenient methods for eliminating or reducing polynucleotide expression include techniques based on gene substitution, gene deletion, or gene disruption. For example, in gene disruption methods, a nucleic acid sequence corresponding to an endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence, which is then transformed into parental cells to produce a defective gene. Through homologous recombination, the defective nucleic acid sequence replaces the endogenous polynucleotide. Ideally, the defective polynucleotide also encodes a marker that can be used to select transformants in which the polynucleotide has been modified or disrupted. In one aspect, the polynucleotide is disrupted using selective markers (such as those described herein).

[0185] Modification or inactivation of the polynucleotide can also be achieved by inhibiting the expression of the enzyme encoded by the polynucleotide in the cell, i.e., by administering or expressing a double-stranded RNA (dsRNA) molecule in the cell, wherein the dsRNA contains a subsequence of the polynucleotide encoding the enzyme. In a preferred aspect, the dsRNA is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more double-stranded nucleotides in length.

[0186] The dsRNA is preferably a small interfering RNA (siRNA) or a microRNA (miRNA). In one preferred aspect, the dsRNA is a small interfering RNA for repressing transcription. In another preferred aspect, the dsRNA is a microRNA for repressing translation. In yet another aspect, the double-stranded RNA (dsRNA) molecule comprises a portion of the coding sequence of a mature polypeptide of SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, and / or SEQ ID NO:29 for the purpose of repressing the expression of the polypeptide in the cell. Although the invention is not limited to any specific mechanism of action, the dsRNA can enter the cell and cause degradation of similar or identical single-stranded RNA (ssRNA), including endogenous mRNA. When cells are exposed to dsRNA, mRNA from homologous genes is selectively degraded through a process called RNA interference (RNAi).

[0187] The dsRNA can be used for gene silencing to selectively degrade RNA using the dsRNAi of the present invention. This process can be practiced in vitro, ex vivo, or in vivo. In one aspect, the dsRNA molecule can be used to generate loss-of-function mutations in cells, organs, or animals. Methods for preparing and using dsRNA molecules to selectively degrade RNA are well known in the art, see, for example, U.S. Patent Nos. 6,489,127; 6,506,559; 6,511,824; and 6,515,109.

[0188] In one aspect, the *Trichoderma* cellobiase I or a homologue thereof is selected from the group consisting of: (i) cellobiase I comprising or constituting the mature polypeptide of SEQ ID NO:18; (ii) cellobiase I comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:18; and (iii) cellobiase I encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to the sequence of SEQ ID NO:18. The mature polypeptide coding sequence of NO:17 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) cellobiase I, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:17 or its full-length complementary strand under at least high stringent conditions, for example, very high stringent conditions.

[0189] In another aspect, the *Trichoderma* cellobiase II or its homologs are selected from the group consisting of: (i) cellobiase II comprising or constituting the mature polypeptide of SEQ ID NO:20; (ii) cellobiase II comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:20; and (iii) cellobiase II encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to the sequence of SEQ ID NO:20. The mature polypeptide coding sequence of NO:19 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) cellobiase II, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:19 or its full-length complementary strand under at least high stringent conditions, for example, very high stringent conditions.

[0190] In another aspect, the *Trichoderma* β-glucosidase or its homolog is selected from the group consisting of: (i) β-glucosidase comprising or constituting the mature polypeptide of SEQ ID NO:22; (ii) β-glucosidase comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:22; and (iii) β-glucosidase encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to the sequence of SEQ ID NO:22. The mature polypeptide coding sequence of NO:21 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) β-glucosidase, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:21 or its full-length complementary strand under at least high stringent conditions, for example, very high stringent conditions.

[0191] In another aspect, the *Trichoderma* xylanase or its homolog is selected from the group consisting of: (i) xylanase comprising or constituting a mature polypeptide of SEQ ID NO:24, SEQ ID NO:26, or SEQ ID NO:28; (ii) xylanase comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:24, SEQ ID NO:26, or SEQ ID NO:28; and (iii) xylanase encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to SEQ ID NO:23, SEQ ID NO:25, or SEQ ID NO:28. The mature polypeptide coding sequence of NO:27 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) xylanase, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27 or its full-length complementary strand under at least high stringent conditions, for example, very high stringent conditions.

[0192] In another aspect, the *Trichoderma* β-xylosidase or its homolog is selected from the group consisting of: (i) β-xylosidase comprising or constituting the mature polypeptide of SEQ ID NO:30; (ii) β-xylosidase comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:30; and (iii) β-xylosidase encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to the sequence of SEQ ID NO:30. The mature polypeptide coding sequence of NO:29 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) β-xylosidase, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:29 or its full-length complementary strand under at least high stringent conditions, for example, very high stringent conditions.

[0193] In one respect, the *Trichoderma* cellobiase I gene is inactivated. In another respect, the *Trichoderma* cellobiase II gene is inactivated. In another respect, the *Trichoderma* β-glucosidase gene is inactivated. In another respect, the *Trichoderma* xylanase gene is inactivated. In another respect, the *Trichoderma* β-xylosidase gene is inactivated.

[0194] In another aspect, the Trichoderma cellobiase I gene and the Trichoderma cellobiase II gene were inactivated.

[0195] In another aspect, two or more (e.g., several) genes selected from the group consisting of: cellobiase I, cellobiase II, β-glucosidase, xylanase I, xylanase II, xylanase III, and β-xylosidase genes are inactivated. In another aspect, three or more (e.g., several) genes selected from the group consisting of: cellobiase I, cellobiase II, β-glucosidase, xylanase I, xylanase II, xylanase III, and β-xylosidase genes are inactivated. In another aspect, four or more (e.g., several) genes selected from the group consisting of: cellobiase I, cellobiase II, β-glucosidase, xylanase I, xylanase II, xylanase III, and β-xylosidase genes are inactivated. In another aspect, five or more (e.g., several) genes selected from the group consisting of: cellobiase I, cellobiase II, β-glucosidase, xylanase I, xylanase II, xylanase III, and β-xylosidase genes are inactivated. In another aspect, six or more (e.g., several) genes selected from the group consisting of: cellobiase I, cellobiase II, β-glucosidase, xylanase I, xylanase II, xylanase III, and β-xylosidase genes are inactivated.

[0196] In another aspect, the genes for cellobiase I, cellobiase II, β-glucosidase, xylanase I, xylanase II, xylanase III, and β-xylosidase are inactivated.

[0197] In another aspect, one or more (e.g., several) protease genes are inactivated. In another aspect, the one or more (e.g., several) protease genes are subtilis protease-like serine proteases, aspartic proteases, and trypsin-like serine protease genes as described in WO 2011 / 075677 (which is incorporated herein by reference in its entirety).

[0198] Nucleic acid constructs

[0199] Nucleic acid constructs containing enzymes or proteins can be operatively linked to the polynucleotide to direct the expression of the coding sequence in filamentous fungal host cells under conditions compatible with the regulatory sequences. Depending on the expression vector, manipulation of the polynucleotide prior to insertion into the vector may be desirable or necessary. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

[0200] The regulatory sequence can be a promoter, which is recognized by the filamentous fungal host cell for expressing a polynucleotide encoding an enzyme or protein. The promoter contains a transcriptional regulatory sequence that mediates polypeptide expression. The promoter can be any polynucleotide exhibiting transcriptional activity in the host cell, including mutant, truncated, and heterozygous promoters, and can be derived from a gene encoding an extracellular or intracellular polypeptide that is homologous or heterologous to that of the host cell.

[0201] Examples of suitable promoters for guiding the transcription of nucleic acid constructs in filamentous fungal host cells are promoters derived from the genes of the following enzymes: Aspergillus nidulans acetamase, Aspergillus niger neutral α-amylase, Aspergillus niger acid-stable α-amylase, Aspergillus niger or Aspergillus awamori glucosylamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96 / 00787), Fusarium venenatum amylase (WO 00 / 56900), Fusarium venenatum Daria (WO 00 / 56900), Fusarium venenatum Quinn (WO 00 / 56900), and Rhizomucor. Trichoderma reesei lipase, aspartic protease, β-glucosidase, cellobiase I, cellobiase II, endoglucanase I, endoglucanase II, endoglucanase III, endoglucanase V, xylanase I, xylanase II, xylanase III, β-xylosidase, translation elongation factor, and NA2-tpi promoter. Promoters (a modified promoter derived from a neutral α-amylase gene in Aspergillus, wherein the untranslated leader sequence is replaced by an untranslated leader sequence of a triose phosphate isomerase gene in Aspergillus; non-limiting examples include modified promoters derived from a neutral α-amylase gene in Aspergillus niger, wherein the untranslated leader sequence is replaced by an untranslated leader sequence of a triose phosphate isomerase gene in Aspergillus nidulans or Aspergillus oryzae); and their mutant, truncated, and heterozygous promoters. Other promoters are described in U.S. Patent No. 6,011,147, which is incorporated herein by reference in its entirety.

[0202] The regulatory sequence can also be a transcription terminator, which is recognized by the filamentous fungal host cell to terminate transcription. The terminator is operatively linked to the 3' end of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell can be used in this invention.

[0203] Preferred terminators for filamentous fungal host cells are derived from the genes of the following enzymes: *Aspergillus nidulans* o-aminobenzoic acid synthase, *Aspergillus niger* glucosidase, *Aspergillus niger* α-glucosidase, *Aspergillus oryzae* TAKA amylase, *Fusarium oxysporum* trypsin-like protease, *Trichoderma reesei* β-glucosidase, *Trichoderma reesei* cellobiose hydrolase I, *Trichoderma reesei* cellobiose hydrolase II, *Trichoderma reesei* endoglucanase I, *Trichoderma reesei* endoglucanase II, *Trichoderma reesei* endoglucanase III, *Trichoderma reesei* endoglucanase V, *Trichoderma reesei* xylanase I, *Trichoderma reesei* xylanase II, *Trichoderma reesei* xylanase III, *Trichoderma reesei* β-xylosidase, and *Trichoderma reesei* translation elongation factor.

[0204] The regulatory sequence can also be a suitable leader sequence, which is an untranslated region of mRNA important for translation in filamentous fungal host cells. The leader sequence is operatively linked to the 5' end of a polynucleotide encoding a polypeptide. Any leader sequence that is functional in the host cell can be used.

[0205] Preferred leader sequences for filamentous fungal host cells were obtained from the genes of the following enzymes: Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

[0206] The regulatory sequence can also be a polyadenylated sequence, which is a sequence operatively linked to the 3' end of a polynucleotide and, during transcription, is recognized by the filamentous fungal host cell as a signal to add polyadenylated residues to the transcribed mRNA. Any polyadenylated sequence that is functional in the host cell can be used.

[0207] Preferred polyadenylated sequences for filamentous fungal host cells were obtained from the genes of the following enzymes: Aspergillus nidulans o-aminobenzoic acid synthase, Aspergillus niger glucosidase, Aspergillus niger α-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei cellobiase I, Trichoderma reesei cellobiase II, and Trichoderma reesei endoglucanase V.

[0208] The regulatory sequence can also be a signal peptide coding region, encoding a signal peptide linked to the N-terminus of the polypeptide and directing the polypeptide into the cellular secretion pathway. The 5' end of the polynucleotide coding sequence may inherently contain a signal peptide coding sequence, which is naturally linked together with the region encoding the polypeptide coding sequence in the translation reading frame. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding sequence exogenous to the coding sequence. An exogenous signal peptide coding sequence may be necessary when the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, the exogenous signal peptide coding sequence can be directly substituted for the natural signal peptide coding sequence to enhance polypeptide secretion. However, any signal peptide coding sequence that directs the expressed polypeptide into the host cell's secretion pathway can be used.

[0209] The effective signal peptide coding sequences for filamentous fungal host cells are obtained from the genes of the following enzymes: Aspergillus niger neutral amylase, Aspergillus niger glucosylase, Aspergillus oryzae TAKA amylase, *Pseudomonas spp.* cellulase, *Pseudomonas spp.* endoglucanase V, *Pseudomonas spp.* lipase, *Mucor spp.* aspartic protease, *Trichoderma reesei* cellobiose hydrolase I, *Trichoderma reesei* cellobiose hydrolase II, *Trichoderma reesei* endoglucanase I, *Trichoderma reesei* endoglucanase II, *Trichoderma reesei* endoglucanase III, and *Trichoderma reesei* endoglucanase V.

[0210] The regulatory sequence can also be a propeptide-coding sequence, which encodes the propeptide located at the N-terminus of the polypeptide. The resulting polypeptide is called a proenzyme or propolypeptide (or, in some cases, a zymogen). The propeptide is usually inactive and can be converted into an active polypeptide through catalytic or autocatalytic cleavage by the propeptide. Propeptide-coding sequences can be obtained from the genes of *Heterospora thermophila* laccase (WO 95 / 33836) and *Mucor mannii* aspartic protease.

[0211] When both the signal peptide and the propeptide sequence are present, the propeptide sequence is placed immediately next to the N-terminus of the polypeptide, and the signal peptide sequence is placed immediately next to the N-terminus of the propeptide sequence.

[0212] Ideally, regulatory sequences should be added that modulate polypeptide expression relative to the growth of the filamentous fungal host cell. Examples of regulatory sequences are those systems that cause gene expression to be turned on or off in response to chemical or physical stimuli, including the presence of regulatory compounds. Regulatory sequences include the *Aspergillus niger* glucosylamylase promoter, the *Aspergillus oryzae* TAKAα-amylase promoter and *Aspergillus oryzae* glucosylamylase promoter, the *Trichoderma reesei* cellobiose hydrolase I promoter and the *Trichoderma reesei* cellobiose hydrolase II promoter. Other examples of regulatory sequences are those that allow gene amplification. In eukaryotic systems, these regulatory sequences include dihydrofolate reductase genes amplified in the presence of methotrexate and metallothionein genes amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide will be operatively linked to the regulatory sequence.

[0213] expression carrier

[0214] Recombinant expression vectors can be constructed to contain a polynucleotide encoding an enzyme or protein, a promoter, a terminator, and transcription and translation termination signals. Multiple nucleotides and regulatory sequences can be combined to produce a recombinant expression vector, which may include one or more (e.g., several) convenient restriction sites to allow insertion or substitution of the polynucleotide encoding the polypeptide at these sites. Alternatively, the polynucleotide can be expressed by inserting a nucleic acid construct or polynucleotide containing the polynucleotide into a suitable vector for expression. In the preparation of the expression vector, a coding sequence is placed within the vector, thereby operatively linking the coding sequence to a suitable regulatory sequence for expression.

[0215] Recombinant expression vectors can be any vector (e.g., plasmids or viruses) that allows for convenient recombinant DNA steps and enables the expression of polynucleotides. The choice of vector will generally depend on its compatibility with the host cell to which it will be introduced. Vectors can be linear or closed circular plasmids.

[0216] The vector can be a self-replicating vector, that is, a vector that exists as an extrachromosomal entity and replicates independently of chromosome replication, such as a plasmid, extrachromosomal element, minichromosome, or artificial chromosome. The vector can contain any means to ensure self-replication. Alternatively, the vector can be one that integrates into the genome when introduced into a host cell and replicates along with the chromosome in which it is integrated. Furthermore, a single vector or plasmid, or two or more vectors or plasmids, can be used, collectively containing the complete DNA of the host cell genome to be introduced, or transposons can be used.

[0217] The vector preferably contains one or more (e.g., several) selective markers to facilitate easy selection of cells that have been transformed, transfected, transduced, etc. Selective markers are genes whose products provide resistance to biocides or viruses, resistance to heavy metals, prototrophic toauxotrophs, etc.

[0218] Examples of selective markers for filamentous fungal host cells include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosylaminoimidazole synthase), amdS (acetamidophosphatase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (adenosyl sulfate transferase), and trpC (anthranilate synthase), as well as their equivalents. Preferred genes for use in *Aspergillus* cells include the *amdS* and *pyrG* genes from *Aspergillus nidus* or *Aspergillus oryzae*, and the *bar* gene from *Streptomyces hygroscopicus*. Preferred genes for use in *Trichoderma* cells include the *adeA*, *adeB*, *amdS*, *hph*, and *pyrG* genes. Examples of bacterial selectivity markers are markers conferencing antibiotic resistance, such as resistance to ampicillin, chloramphenicol, kanamycin, neomycin, spectinomycin, or tetracycline.

[0219] The selective marker may be a dual selective marker system as described in WO 2010 / 039889A2 (which is incorporated herein by reference in its entirety). In one aspect, the selective marker is the hph-tk dual selective marker system.

[0220] The vector preferably contains elements that allow the vector to integrate into the host cell genome or to replicate autonomously in the cell independently of the genome.

[0221] To integrate into the host cell genome, the vector can rely on a polynucleotide sequence encoding a polypeptide or any other vector element for integration into the genome via homologous or non-homologous recombination. Alternatively, the vector can contain additional polynucleotides to guide integration into the precise location within the host cell's genomic chromosome via homologous recombination. To increase the likelihood of integration at a precise location, the integrative element should contain a sufficient number of nucleic acids with high sequence identity to the corresponding target sequence, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, to increase the probability of homologous recombination. The integrative element can be any sequence homologous to the target sequence in the host cell genome. Furthermore, the integrative element can be a non-coding or coding polynucleotide. On the other hand, the vector can be integrated into the host cell's genome via non-homologous recombination.

[0222] For autonomous replication, the vector may also include an origin of replication, which enables the vector to replicate autonomously within the host cell. The origin of replication can be any plasmid replicator that functions within the cell to mediate autonomous replication. The terms "origin of replication" or "plasmid replicator" refer to a polynucleotide capable of enabling replication within a plasmid or vector.

[0223] Examples of useful origins of replication in filamentous fungal host cells are AMA1 and ANS1 (Gems et al., 1991, Gene98:61-67; Cullen et al., 1987, Nucleic Acids Res.15:9163-9175; WO 00 / 24883). The isolation of the AMA1 gene and the construction of plasmids or vectors containing this gene can be performed according to the methods disclosed in WO 00 / 24883.

[0224] More than one copy of a polynucleotide can be inserted into filamentous fungal host cells to increase polypeptide production. This increase in polynucleotide copy number can be achieved by integrating at least one additional copy of the sequence into the host cell genome, or by including an amplifiable selective marker gene in the polynucleotide, wherein cells containing an amplified copy of the selective marker gene can be selected by culturing the cells in the presence of a suitable selectable agent, thereby selecting cells containing an additional copy of the polynucleotide.

[0225] The methods for connecting the above-mentioned elements to construct the recombinant expression vector of the present invention are well known to those skilled in the art (see, for example, Sambrook et al., 1989, above).

[0226] Generation method

[0227] The present invention also relates to a method for producing an enzyme composition, comprising: (a) culturing filamentous fungal host cells of the present invention under conditions conducive to the production of the enzyme composition; and optionally (b) recovering the enzyme composition.

[0228] Filamentous fungal host cells are cultured in a nutrient medium suitable for producing the enzyme composition using methods known in the art. For example, cells can be cultured by shake-flask culture in a suitable medium and under conditions allowing for the expression and / or isolation of the enzyme, or by small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid-state fermentation) in a laboratory or industrial fermenter. The culture is carried out in a suitable nutrient medium containing a carbon and nitrogen source and inorganic salts, using methods known in the art. Suitable media are available from commercial suppliers or can be prepared according to publicly available compositions (e.g., in the catalogue of the U.S. Center for Type Culture Collection).

[0229] The enzyme can be detected using peptide-specific methods known in the art. These detection methods include, but are not limited to, the use of specific antibodies, the formation of enzyme products, or the disappearance of enzyme substrates. For example, an enzyme assay can be used to determine activity.

[0230] The enzyme can be recovered using methods known in the art. For example, the polypeptide can be recovered from the nutrient medium using conventional methods, including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation. In one aspect, fermentation broth containing the polypeptide was recovered.

[0231] A variety of methods known in the art can be used to purify the enzyme to obtain substantially pure enzymes, including but not limited to chromatography (e.g., ion exchange, affinity, hydrophobicity, chromatographic focusing, and size exclusion), electrophoresis (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, for example, Protein Purification, Janson and Ryden, eds., VCH Publishers, New York, 1989).

[0232] use

[0233] The present invention also relates to the following processes using enzyme compositions comprising the present invention.

[0234] The present invention also relates to a process for degrading or converting cellulose materials, comprising treating the cellulose materials with an enzyme composition comprising the present invention. In one aspect, the method further comprises recovering the degraded or converted cellulose materials. The soluble products of the degradation or conversion of the cellulose materials can be separated from the insoluble cellulose materials using methods known in the art, such as, for example, centrifugation, filtration, or gravity sedimentation.

[0235] The present invention also relates to a process for producing fermentation products, comprising: (a) saccharifying a cellulose material with an enzyme composition comprising the present invention; (b) fermenting the saccharified cellulose material with one or more (e.g., several) fermenting microorganisms to produce fermentation products; and (c) recovering the fermentation products from the fermentation.

[0236] The present invention also relates to a process for fermenting cellulose materials, comprising: fermenting the cellulose material with one or more (e.g., several) fermenting microorganisms, wherein the cellulose material is saccharified with an enzyme composition comprising the present invention. In one aspect, the fermentation of the cellulose material produces a fermentation product. In another aspect, the process further comprises recovering the fermentation product from the fermentation.

[0237] The process of this invention can be used to saccharify cellulosic materials into fermentable sugars and convert these sugars into a variety of useful fermentation products, such as fuels, drinking ethanol, and / or platform chemicals (e.g., acids, alcohols, ketones, gases, etc.). The production of desired fermentation products from cellulosic materials typically involves pretreatment, enzymatic hydrolysis (saccharification), and fermentation.

[0238] The processing of the cellulose material according to the invention can be accomplished using conventional methods in the art. Furthermore, the process of the invention can be carried out using any conventional biomass processing equipment configured to operate in accordance with the invention.

[0239] Hydrolysis (saccharification) and fermentation, separately or simultaneously, include, but are not limited to, separate hydrolysis and fermentation (SHF), simultaneous saccharification and fermentation (SSF), simultaneous saccharification and co-fermentation (SSCF), mixed hydrolysis and fermentation (HHF), separate hydrolysis and co-fermentation (SHCF), mixed hydrolysis and co-fermentation (HHCF), and direct microbial conversion (DMC), sometimes also referred to as consolidated bioprocessing (CBP). SHF uses separate processing steps to first enzymatically hydrolyze the cellulose material into fermentable sugars, such as glucose, cellobiose, and pentose monomers, and then ferment the fermentable sugars into ethanol. In SSF, the enzymatic hydrolysis of the cellulose material and the fermentation of sugars to ethanol are combined in one step (Philippidis, GP, 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization, Wyman, CE ed., Taylor & Francis, Washington, DC, 179-212). SSCF involves the co-fermentation of multiple sugars (Sheehan, J., and Himmel, M., 1999, Enzymes, energy and the environment: A strategic perspective on the USDepartment of Energy's research and development activities for bioethanol, Biotechnol. Prog. 15: 817-827). HHF, in addition to simultaneous saccharification and hydrolysis, includes a separate hydrolysis step, all of which can be carried out in the same reactor. The steps in the HHF process can be performed at different temperatures; that is, high-temperature enzymatic saccharification followed by SSF at a lower temperature tolerable by the fermentation strain. DMC combines all three processes (enzyme production, hydrolysis, and fermentation) in one or more (e.g., several) steps, using the same organism to produce the enzymes used to convert cellulose into fermentable sugars and then into the final product (Lynd, LR, Weimer, PJ, van Zyl, WH, and Pretorius, IS, 2002, Microbial cellulose utilization: Fundamentals and biotechnology, Microbiol. Mol. Biol. Reviews 66:506-577).As will be understood herein, any method known in the art, including pretreatment, enzymatic hydrolysis (saccharification), fermentation, or combinations thereof, may be used to carry out the process of the present invention.

[0240] Conventional equipment may include fed-batch stirred reactors, batch stirred reactors, continuous flow stirred reactors with ultrafiltration and / or continuous plug flow column reactors (Fernanda de Castilhos Corazza, Flávio Faria de Moraes, Gisella Maria Zanin and Ivo Neitzel, 2003, Optimal control in fed-batch reactor for the cellobiose hydrolysis, Acta Scientiarum. Technology 25:33-38; Gusakov, AV, and Sinitsyn, AP, 1985, Kinetics of the enzymatic hydrolysis of cellulose: 1. A mathematical model for a batch reactor process, Enz. Microb. Technol. 7:346-352), grinding reactors (Ryu, SK, and Lee, JM, 1983, Bioconversion of waste cellulose by using an attrition). Bioreactor (Biotechnol. Bioeng. 25:53-65), or reactors with intense stirring induced by an electromagnetic field (Gusakov, AV, Sinitsyn, AP, Davydkin, IY, Davydkin, VY, Protas, OV, 1996, Enhancement of enzymatic cellulose hydrolysis using a novel type of bioreactor with intensive stirring induced by electromagnetic field, Appl. Biochem. Biotechnol. 56:141-153). Other reactor types include fluidized beds, upflow blankets, immobilized reactors, and extruder-type reactors for hydrolysis and / or fermentation.

[0241] PreprocessingIn the implementation of the process of this invention, any pretreatment process known in the art can be used to disrupt the cellulose material components of the plant cell wall (Chandra et al., 2007, Substrate pretreatment: The key to effective enzymatic hydrolysis of lignocellulosics? Adv. Biochem. Engin. / Biotechnol. 108: 67-93; Galbe and Zacchi, 2007, Pretreatment of lignocellulosic materials for efficient bioethanol production, Adv. Biochem. Engin. / Biotechnol. 108: 41-65; Hendriks and Zeeman, 2009, Pretreatments to enhance the digestibility of lignocellulosic biomass, Bioresource Technol. 100: 10-18; Mosier et al., 2005, Features of promising technologies for pretreatment of lignocellulosic biomass, Bioresource). Technol.96:673-686;Taherzadeh and Karimi,2008,Pretreatment of lignocellulosic wastes to improve ethanol and biogasproduction:A review,Int.J.of Mol.Sci.9:1621-1651;Yang and Wyman,2008,Pretreatment:the key to unlocking low-cost cellulosic ethanol,BiofuelsBioproducts and Biorefining-Biofpr. 2:26-40).

[0242] Cellulose materials can also be subjected to particle size reduction, sieving, pre-soaking, wetting, washing and / or conditioning using methods known in the art prior to pretreatment.

[0243] Conventional pretreatment methods include, but are not limited to, steam pretreatment (with or without blasting), dilute acid pretreatment, hot water pretreatment, alkali pretreatment, lime pretreatment, wet oxidation, wet blasting, ammonia fiber blasting, organic solvent pretreatment, and biological pretreatment. Other pretreatment methods include ammonia percolation, ultrasonication, electroporation, microwave, supercritical CO2, supercritical H2O, ozone, ionic liquids, and gamma radiation pretreatment.

[0244] Cellulose materials can be pretreated before hydrolysis and / or fermentation. Pretreatment is preferably carried out before hydrolysis. Alternatively, pretreatment can be performed simultaneously with enzymatic hydrolysis to release fermentable sugars such as glucose, xylose, and / or cellobiose. In most cases, the pretreatment step itself converts some biomass into fermentable sugars (even in the absence of enzymes).

[0245] Steam pretreatment. In steam pretreatment, the cellulose material is heated to break down plant cell wall components, including lignin, hemicellulose, and cellulose, making cellulose and other fractions, such as hemicellulose, accessible to enzymes. The cellulose material is passed through or through a reaction vessel in which steam is injected to increase the temperature to the desired temperature and pressure, and the reaction is maintained therein for the desired time. Steam pretreatment is preferably carried out at 140-250°C, for example 160-200°C, or 170-190°C, with the optimal temperature range depending on the addition of a chemical catalyst. The residence time for steam pretreatment is preferably 1-60 minutes, for example 1-30 minutes, 1-20 minutes, 3-12 minutes, or 4-10 minutes, with the optimal residence time depending on the temperature range and the addition of a chemical catalyst. Steam pretreatment allows for a relatively high solids loading, such that the cellulose material typically only becomes moist during the pretreatment process. Steam pretreatment is often combined with explosive discharge of the pretreated material, a process known as steam explosion, which involves a rapid flash to atmospheric pressure and turbulence of the material to increase the accessible surface area through fragmentation (Duff and Murray, 1996, Bioresource Technology 855:1-33; Galbe and Zacchi, 2002, Appl. Microbiol. Biotechnol. 59:618-628; US Patent Application No. 20020164730). During steam pretreatment, the acetyl groups of hemicellulose are cleaved, and the resulting acid-catalyzed partial hydrolysis of hemicellulose into monosaccharides and oligosaccharides occurs. Lignin is removed only to a limited extent.

[0246] Chemical pretreatment: The term "chemical treatment" refers to any chemical treatment that promotes the separation and / or release of cellulose, hemicellulose, and / or lignin. Such pretreatment can convert crystalline cellulose into amorphous cellulose. Examples of suitable chemical pretreatment processes include, for example, dilute acid pretreatment, lime pretreatment, wet oxidation, ammonia cellulose / freeze-explosion (AFEX), ammonia permeation (APR), ionic liquid and organic solvent pretreatment.

[0247] Catalysts such as H₂SO₄ or SO₂ (typically 0.3 to 5% w / w) are often added before steam pretreatment, which can reduce time, lower temperature, increase recovery, and improve enzymatic hydrolysis (Ballesteros et al., 2006, Appl. Biochem. Biotechnol. 129-132:496-508; Varga et al., 2004, Appl. Biochem. Biotechnol. 113-116:509-523; Sassner et al., 2006, Enzyme Microb. Technol. 39:756-762). In dilute acid pretreatment, cellulose material is mixed with dilute acid (typically H₂SO₄) and water to form a slurry, heated by steam to the desired temperature, and flashed to atmospheric pressure after a residence time. Many reactor designs can be used for dilute acid pretreatment, such as plug flow reactors, counterflow reactors, or continuous counterflow shrink-bed reactors (Duff and Murray, 1996, see above; Schell et al., 2004, Bioresource Technol. 91: 179-188; Lee et al., 1999, Adv. Biochem. Eng. Biotechnol. 65: 93-115).

[0248] Several pretreatment methods under alkaline conditions can also be used. These alkaline pretreatments include, but are not limited to, sodium hydroxide, lime, wet oxidation, ammonia percolation (APR), and ammonia fiber / freeze-burst (AFEX).

[0249] Lime pretreatment using calcium oxide or calcium hydroxide at temperatures of 85-150°C for periods ranging from one hour to several days (Wyman et al., 2005, Bioresource Technol. 96: 1959-1966; Mosier et al., 2005, Bioresource Technol. 96: 673-686). Pretreatment methods using ammonia are disclosed in WO 2006 / 110891, WO 2006 / 110899, WO 2006 / 110900, and WO 2006 / 110901.

[0250] Wet oxidation is a thermal pretreatment typically carried out at 180-200°C for 5-15 minutes, with the addition of an oxidant such as hydrogen peroxide or superpressure oxygen (Schmidt and Thomsen, 1998, Bioresource Technol. 64:139-151; Palonen et al., 2004, Appl. Biochem. Biotechnol. 117:1-17; Varga et al., 2004, Biotechnol. Bioeng. 88:567-574; Martin et al., 2006, J. Chem. Technol. Biotechnol. 81:1669-1677). Pretreatment is preferably carried out with 1-40% dry matter, for example 2-30% or 5-20% dry matter, and the initial pH is often increased by adding an alkali such as sodium carbonate.

[0251] A modified wet oxidation pretreatment method, called wet blasting (a combination of wet oxidation and steam blasting), can process up to 30% dry matter. In wet blasting, an oxidant is introduced after a certain residence time during the pretreatment process. The pretreatment is then terminated by flashing to atmospheric pressure (WO 2006 / 032282).

[0252] Ammonia Fiber Bursting (AFEX) involves treating cellulose materials with liquid ammonia or ammonia gas for 5-10 minutes at a mild temperature (90-150°C) and high pressure (17-20 bar), where the dry matter content can be as high as 60% (Gollapalli et al., 2002, Appl. Biochem. Biotechnol. 98:23-35; Chundawat et al., 2007, Biotechnol. Bioeng. 96:219-231; Alizadeh et al., 2005, Appl. Biochem. Biotechnol. 121:1133-1141; Teymouri et al., 2005, Bioresource Technol. 96:2014-2018). During AFEX pretreatment, cellulose and hemicellulose remain relatively intact. The lignin-sugar complex is cleaved.

[0253] Organic solvent pretreatment deligninates cellulose materials by extraction with aqueous ethanol (40-60% ethanol) at 160-200°C for 30-60 minutes (Pan et al., 2005, Biotechnol. Bioeng. 90:473-481; Pan et al., 2006, Biotechnol. Bioeng. 94:851-861; Kurabi et al., 2005, Appl. Biochem. Biotechnol. 121:219-230). Sulfuric acid is often added as a catalyst. During organic solvent pretreatment, most of the hemicellulose and lignin are removed.

[0254] Other examples of suitable pretreatment methods are described in Schell et al., 2003, Appl. Biochem and Biotechn. Vol. 105-108:69-85, and Mosier et al., 2005, Bioresource Technology 96:673-686, and U.S. Patent Publication 2002 / 0164730.

[0255] In one aspect, the chemical pretreatment is preferably carried out as a dilute acid treatment, and more preferably as a continuous dilute acid treatment. The acid is typically sulfuric acid, but other acids such as acetic acid, citric acid, nitric acid, phosphoric acid, tartaric acid, succinic acid, hydrogen chloride, or mixtures thereof may also be used. The weak acid treatment is carried out in a pH range preferably 1-5, for example 1-4, or 1-2.5. In one aspect, the acid concentration is preferably in the range of 0.01 to 10 wt% acid, for example 0.05 to 5 wt% acid or 0.1 to 2 wt% acid. The acid is contacted with the cellulose material and maintained at a temperature preferably in the range of 140-200°C, for example 165-190°C, for 1 to 60 minutes.

[0256] In another aspect, pretreatment occurs in the aqueous slurry. In a preferred aspect, the cellulose material is present during pretreatment at an amount preferably 10-80 wt%, for example 20-70 wt% or 30-60 wt%, such as about 40 wt%. The pretreated cellulose material may be left unwashed or washed using any method known in the art, for example, washing with water.

[0257] Mechanical or physical pretreatment: The terms “mechanical pretreatment” or “physical pretreatment” refer to any pretreatment that promotes a reduction in particle size. For example, such pretreatment can involve various types of grinding or milling (e.g., dry grinding, wet grinding, or vibratory ball milling).

[0258] Cellulose materials can be pretreated physically (mechanically) and chemically. Mechanical or physical pretreatment can be combined with: steam / steam explosion, hydrothermolysis, dilute or weak acid treatment, high temperature, high pressure treatment, radiation (e.g., microwave radiation), or combinations thereof. In one aspect, high pressure refers to a pressure preferably in the range of about 100 to about 400 psi, for example, about 150 to about 250 psi. In another aspect, high temperature refers to a temperature in the range of about 100 to about 300°C, for example, about 140 to about 200°C. In a preferred aspect, mechanical or physical pretreatment is carried out using a batch process with high temperature and high pressure as defined above, using a steam gun hydrolyzer system, such as the Sunds Hydrolyzer from Sunds Defibrator AB, Sweden. The physical and chemical pretreatments can be performed sequentially or simultaneously as needed.

[0259] Therefore, in a preferred aspect, cellulosic materials are subjected to physical (mechanical) or chemical pretreatment, or any combination thereof, to promote the separation and / or release of cellulose, hemicellulose, and / or lignin.

[0260] Biological pretreatment: The term “biological pretreatment” refers to any biological pretreatment that can promote the separation and / or release of cellulose, hemicellulose and / or lignin from cellulose materials.Biological pretreatment techniques may include the application of lignin-dissolving microorganisms and / or enzymes (see, for example, Hsu, T.-A., 1996, Pretreatment of biomass, in Handbook on Bioethanol: Production and Utilization, Wyman, CE, ed., Taylor & Francis, Washington, DC, 179-212; Ghosh and Singh, 1993, Physicochemical and biological treatments for enzymatic / microbial conversion of lignocellulosic biomass, Adv. Appl. Microbiol. 39:295-333; McMillan, JD, 1994, Pretreating lignocellulosic biomass: a review, in Enzymatic Conversion of Biomass for Fuels Production, Himmel, ME, Baker, JO, and Overend, RP, eds., ACS Symposium Series 566, American Chemical Society). Society, Washington, DC, Chapter 15; Gong, CS, Cao, NJ, Du, J., and Tsao, GT, 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering / Biotechnology, Scheper, T., ed., Springer-Verlag Berlin Heidelberg, Germany, 65:207-241; Olsson and Hahn-Hagerdal, 1996, Fermentation of lignocellulosic hydrolysates for ethanol production, Enz. Microb. Tech. 18: 312-331; and Vallander and Eriksson, 1990, Production of ethanol from lignocellulosic materials: State of the art, Adv. Biochem. Eng. / Biotechnol. 42: 63-95).

[0261] Glycation In the hydrolysis step, cellulose material, such as pretreated cellulose material, is hydrolyzed to break down cellulose and hemicellulose into fermentable sugars, such as glucose, cellobiose, xylose, xylulose, arabinose, mannose, galactose, and / or soluble oligosaccharides. Hydrolysis is enzymatically promoted by the enzyme composition comprising the present invention.

[0262] Enzymatic hydrolysis is preferably carried out in a suitable aqueous environment under conditions easily determined by those skilled in the art. In one aspect, hydrolysis is carried out under conditions suitable for enzyme activity, i.e., optimal for the enzyme. Hydrolysis can be carried out in a fed-batch or continuous process, in which cellulose material is gradually added, for example, to an enzyme-containing hydrolysis solution.

[0263] Saccharification is typically carried out in a stirred tank reactor or fermenter under controlled pH, temperature, and mixing conditions. Suitable processing time, temperature, and pH conditions can be readily determined by those skilled in the art. For example, saccharification can last up to 200 hours, but is generally preferred to be carried out for about 12 to about 120 hours, for example, about 16 to about 72 hours, or about 24 to about 48 hours. The temperature is preferably in the range of about 25°C to about 70°C, for example, about 30°C to about 65°C, about 40°C to about 60°C, or about 50°C to about 55°C. The pH is preferably in the range of about 3 to about 8, for example, about 3.5 to about 7, about 4 to about 6, or about 5.0 to about 5.5. The dry solids content is preferably about 5% to about 50 wt%, for example, about 10% to about 40 wt%, or about 20% to about 30 wt%.

[0264] In the process of the present invention, the enzyme composition comprising the present invention may be added before or during fermentation, for example, during saccharification or during or after the propagation of fermenting microorganisms.

[0265] The enzyme compositions comprising the present invention can be in any suitable form, such as crude fermentation broth with or without cell removal, cell lysates with or without cell debris, semi-purified or purified enzyme preparations, or Trichoderma host cells as the source of the enzyme. The enzyme compositions can be in the form of dry powder or granules, dust-free granules, liquids, stabilized liquids, or stabilized protected enzymes. Liquid enzyme preparations can be stabilized according to an established process, for example by adding stabilizers such as sugars, sugar alcohols, or other polyols, and / or lactic acid or other organic acids.

[0266] The optimal amount of Aspergillus fumigatus cellulase or hemicellulase depends on several factors, including but not limited to, the mixture of component cellulases and / or hemicellulases, the cellulose material, the concentration of the cellulose material, the pretreatment of the cellulose material, temperature, time, pH, and including the fermentation organism (e.g., yeast that simultaneously saccharifies and ferments).

[0267] In one aspect, the effective amount of cellulase or hemicellulase for cellulosic material is about 0.01 to about 50.0 mg, for example about 0.01 to about 40 mg, about 0.01 to about 30 mg, about 0.01 to about 20 mg, about 0.01 to about 10 mg, about 0.01 to about 5 mg, about 0.025 to about 1.5 mg, about 0.05 to about 1.25 mg, about 0.075 to about 1.25 mg, about 0.1 to about 1.25 mg, about 0.15 to about 1.25 mg, or about 0.25 to about 1.0 mg per gram of cellulosic material.

[0268] In another aspect, the GH61 polypeptide with cellulose-degrading-enhancing activity is used in the presence of a soluble activated divalent metal cation, such as manganese sulfate, as described in WO 2008 / 151043.

[0269] In another aspect, the GH61 polypeptide with cellulose-degrading-enhancing activity is used in the presence of dioxins, bicyclic compounds, heterocyclic compounds, nitrogen-containing compounds, quinone compounds, sulfur-containing compounds, or liquids obtained from pretreated cellulose materials (such as pretreated corn stalks (PCS)).

[0270] The dioxin may include any suitable compound containing two or more oxygen atoms. In some aspects, the dioxin contains a substituted aryl moiety as described herein. The dioxin may include one or more (e.g., several) hydroxyl groups and / or hydroxyl derivatives, but also includes substituted aryl moiety lacking hydroxyl groups and hydroxyl derivatives. Non-limiting examples of dioxins include catechol or catechin; caffeic acid; 3,4-dihydroxybenzoic acid; 4-tert-butyl-5-methoxy-1,2-benzenediol; pyrogallol; gallic acid; methyl-3,4,5-trihydroxybenzoic acid; 2,3,4-trihydroxybenzophenone; 2,6-dimethoxyphenol; sinapic acid; 3,5-dihydroxybenzoic acid; 4-chloro-1,2-benzenediol; 4-nitro-1,2-benzenediol. Bisphenol; tannic acid; ethyl gallate; methyl glycolate; dihydroxyfumaric acid; 2-butyn-1,4-diol; ketone acid; 1,3-propanediol; tartaric acid; 2,4-pentanediol; 3-ethoxy-1,2-propanediol; 2,4,4'-trihydroxybenzophenone; cis-2-buten-1,4-diol; 3,4-dihydroxy-3-cyclobuten-1,2-dione; dihydroxyacetone; acrolein acetal; methyl-4-hydroxybenzoic acid; 4-hydroxybenzoic acid; and methyl-3,5-dimethoxy-4-hydroxybenzoic acid; or their salts or solvates.

[0271] The bicyclic compound may comprise any suitable substituted fused-ring system as described herein. The compound may contain one or more (e.g., several) additional rings, and is not limited to a specific number of rings unless otherwise stated. In one aspect, the bicyclic compound is a flavonoid. In another aspect, the bicyclic compound is an optionally substituted isoflavone. In yet another aspect, the bicyclic compound is an optionally substituted floret. Flavylium ion, such as optionally substituted anthocyanins or optionally substituted anthocyanins, or derivatives thereof. Non-limiting examples of bicyclic compounds include epicatechin; quercetin; myricetin; taxifolin; kaempferol; morin; acacetin; naringenin; isorhamnetin; apigenin; cyanidin; cyanin; kuromanin; keracyanin; or their salts or solvates.

[0272] The heterocyclic compound may be any suitable compound, such as the optionally substituted aromatic or non-aromatic rings containing heteroatoms as described herein. In one aspect, the heterocycle is a compound comprising an optionally substituted heterocyclic alkyl module or an optionally substituted heteroaryl module. In another aspect, the optionally substituted heterocyclic alkyl module or the optionally substituted heteroaryl module is an optionally substituted five-membered heterocyclic alkyl module or an optionally substituted five-membered heteroaryl module. In yet another aspect, the optionally substituted heterocyclic alkyl module or the optionally substituted heteroaryl module is selected from the following optionally substituted modules: pyrazolyl, furanyl, imidazolyl, isoxazolyl, oxadiazolyl, oxazolyl, pyrroleyl, pyridinyl, pyrimidinyl, pyridazinyl, thiazolyl, triazolyl, thienyl, dihydrothieno-pyrazolyl, thionyl, carbazolyl, benzimidazolyl, benzothienyl, benzofuranyl, indolyl, quinolinyl, benzo[] Triazolyl, benzothiazolyl, benzooxazolyl, benzimidazolyl, isoquinolinyl, isoindolyl, acridineyl, benzoisazolyl, dimethylhydantoin, pyrazinyl, tetrahydrofuranyl, pyrrololinyl, pyrrolidinyl, morpholinyl, indolyl, diazepinyl, azepinyl, thiepinyl, piperidinyl, and oxepinyl. In another aspect, the optionally substituted heterocyclic alkyl module or the optionally substituted heteroaryl module is an optionally substituted furanyl. Non-limiting examples of heterocyclic compounds include (1,2-dihydroxyethyl)-3,4-dihydrofuran-2(5H)-one; 4-hydroxy-5-methyl-3-furanone; 5-hydroxy-2(5H)-furanone; [1,2-dihydroxyethyl]furan-2,3,4(5H)-trione; α-hydroxy-γ-butyrolactone; ribonucleic acid γ-lactone; aldohexuronicaldohexuronic acid γ-lactone; gluconic acid δ-lactone; 4-hydroxycoumarin; dihydrobenzofuran; 5-(hydroxymethyl)furfural; furoin; 2(5H)-furanone; 5,6-dihydro-2H-pyran-2-one; and 5,6-dihydro-4-hydroxy-6-methyl-2H-pyran-2-one; or their salts or solvates.

[0273] The nitrogen-containing compound may be any suitable compound having one or more (e.g., several) nitrogen atoms. In one aspect, the nitrogen-containing compound comprises an amine, imine, hydroxylamine, or nitrous oxide module. Non-limiting examples of nitrogen-containing compounds include acetone oxime; violeturic acid; pyridine-2-aldehyde oxime; 2-aminophenol; 1,2-phenylenediamine; 2,2,6,6-tetramethyl-1-piperidinyloxy; 5,6,7,8-tetrahydrobiopterin; 6,7-dimethyl-5,6,7,8-tetrahydropterin; and maleamic acid; or salts or solvates thereof.

[0274] The quinone compound may be any suitable compound comprising a quinone module as described herein. Non-limiting examples of quinone compounds include 1,4-benzoquinone; 1,4-naphthoquinone; 2-hydroxy-1,4-naphthoquinone; 2,3-dimethoxy-5-methyl-1,4-benzoquinone or coenzyme Q0; 2,3,5,6-tetramethyl-1,4-benzoquinone or tetramethyl-p-benzoquinone; 1,4-dihydroxyanthraquinone; 3-hydroxy-1-methyl-5,6-dihydroindoledione or adrenaline; 4-tert-butyl-5-methoxy-1,2-benzoquinone; pyrroloquinoline quinone; or their salts or solvates.

[0275] The sulfur-containing compound may be any suitable compound containing one or more (e.g., several) sulfur atoms. In one aspect, the sulfur-containing compound comprises a component selected from the group consisting of thionyl, thioether, sulfinyl, sulfonyl, sulfamide, sulfonic acid, and sulfonate. Non-limiting examples of sulfur-containing compounds include ethanethiol; 2-propanethiol; 2-propen-1-thiol; 2-mercaptoethanesulfonic acid; benzenethiol; benzene-1,2-dithiol; cysteine; methionine; glutathione; cystine; or salts or solvates thereof.

[0276] In one respect, the effective amount of this compound as described above for cellulose materials is approximately 10 in molar proportion to cellulose sugar units. -6 Approximately 10, for example, approximately 10 -6 Approximately 7.5, approximately 10 -6 About 5, about 10 -6 From approximately 2.5, approximately 10 -6 About 1, about 10 -5 About 1, about 10 -5 To about 10 -1 Approximately 10 -4 To about 10 -1 Approximately 10 -3 To about 10 -1 or about 10 -3 To about 10-2 In another aspect, the effective amount of the compound as described above is about 0.1 μM to about 1 M, for example about 0.5 μM to about 0.75 M, about 0.75 μM to about 0.5 M, about 1 μM to about 0.25 M, about 1 μM to about 0.1 M, about 5 μM to about 50 mM, about 10 μM to about 25 mM, about 50 μM to about 25 mM, about 10 μM to about 10 mM, about 5 μM to about 5 mM, or about 0.1 mM to about 1 mM.

[0277] The term "liquor" refers to the solution phase, i.e., the aqueous phase, organic phase, or a combination thereof, and its soluble contents, resulting from the treatment of lignin cellulose and / or hemicellulose material, or its monosaccharides such as xylose, arabinose, mannose, etc., in a slurry under the conditions described herein. A cellulose-enhancing liquor for GH61 peptides can be produced by treating the cellulose or hemicellulose material (or raw material) by applying heat and / or pressure, optionally in the presence of a catalyst such as an acid, optionally in the presence of an organic solvent, and optionally in combination with a phase of physical degradation of the material, followed by separation of the solution from the residual solids. These conditions determine the degree of cellulose-enhancing effect that can be achieved by combining the liquor and the GH61 peptide during the hydrolysis of the cellulose material using a cellulase preparation. The liquor can be separated from the treated material using standard methods in the art such as filtration, sedimentation, or centrifugation.

[0278] In one aspect, the effective amount of cellulose in the liquid is about 10. -6 To approximately 10g per gram of cellulose, for example, approximately 10 -6 Approximately 7.5g, approximately 10 -6 About 5, about 10 -6 Approximately 2.5g, approximately 10 -6 To approximately 1g, approximately 10 -5 To approximately 1g, approximately 10 -5 To about 10 -1 g, approximately 10 -4 To about 10 -1 g, approximately 10 -3 To about 10 -1 g, or about 10 g -3 To about 10 -2 g per gram of cellulose.

[0279] Fermentation. Fermentable sugars obtained from hydrolyzed cellulose material can be obtained by fermentation of sugars directly or indirectly into desired fermentation products by one or more (e.g., several) fermenting microorganisms capable of fermenting sugars directly or indirectly into desired fermentation products. "Fermentation" or "fermentation method" refers to any fermentation method or any method that includes a fermentation step. Fermentation methods also include those used in the consumer alcohol industry (e.g., beer and wine), the dairy industry (e.g., fermented dairy products), the leather industry, and the tobacco industry. Fermentation conditions depend on the desired fermentation product and the fermenting organism, and can be readily determined by those skilled in the art.

[0280] In the fermentation step, sugars released from the cellulose material as a result of pretreatment and enzymatic hydrolysis are fermented into products, such as ethanol, by a fermenting organism (e.g., yeast). As mentioned above, hydrolysis (saccharification) and fermentation can be done alone or simultaneously.

[0281] In the fermentation steps of this invention, any suitable hydrolyzed cellulose material can be used. The material is typically selected based on the desired fermentation product (i.e., the substance to be obtained from fermentation) and the method used, as is known in the art.

[0282] The term “fermentation medium” in this document can be understood as the medium prior to the addition of fermenting microorganisms, such as the medium produced by the saccharification process, and the medium used in the simultaneous saccharification and fermentation (SSF) method.

[0283] "Fermentation microorganisms" refers to any microorganism suitable for producing fermentation products using an ideal fermentation method, including bacterial and fungal organisms. Fermentation organisms can be hexose and / or pentose fermentation organisms, or combinations thereof. Hexose and pentose fermentation organisms are well known in the art. Suitable fermentation microorganisms can ferment (i.e., convert) sugars (such as glucose, xylose, xylulose, arabinose, maltose, mannose, galactose, and / or oligosaccharides) directly or indirectly into the desired fermentation product. Examples of ethanol-producing bacterial and fungal fermentation organisms include those described in Lin et al., 2006, Appl. Microbiol. Biotechnol. 69:627-642.

[0284] Examples of fermenting microorganisms capable of fermenting hexoses include bacteria and fungi, such as yeast. Preferred yeasts include strains of the genera *Candida*, *Kluyveromyces*, and *Saccharomyces*, such as strains of *Candida sonorensis*, *Kluyveromyces marxi*, and *Saccharomyces cerevisiae*.

[0285] Examples of fermenting organisms capable of fermenting pentoses in their natural state include bacteria and fungi, such as some yeasts. Preferred xylose-fermenting yeasts include *Candida*, preferably *Candida sheatae* or *Candida sonorensis*; and *Pichia*, preferably strains of *Pichia stipitis*, such as strain CBS 5773. Preferred pentose-fermenting yeasts include *Pachysolen*, preferably strains of *Pachysolen tannophilus*. Organisms incapable of fermenting pentoses such as xylose and arabinose can be genetically modified to ferment pentoses using methods known in the art.

[0286] Examples of bacteria that can efficiently ferment hexoses and pentoses into ethanol include, for example, Bacillus coagulans, Clostridium acetobutylicum, Clostridium thermocellum, Clostridium phytofermentans, species of Bacillus, Thermoanaerobacter saccharolyticum, and motile fermentation monoclonal bacteria (Philippidis, 1996, see above).

[0287] Other fermenting organisms include *Bacillus* species, such as *Bacillus coagulans*; *Candida* species, such as *Candida sonorensis*, *C. methanosorbosa*, *Candida diddensii*, *Candida parapsilosis*, *C. naedodendra*, *C. blankii*, *C. entomophilia*, *C. brassicae*, *Candida pseudotropicalis*, *Candida boidinii*, *Candida utilis*, and *C. scehatae*; *Clostridium* species, such as *Clostridium acetobutyricum*, *Clostridium thermofibrinosum*, and *C. phytofermentans*; *Escherichia coli*, especially genetically modified strains that promote ethanol yield; *Geobryophyte* species; and *Hansenula* species, such as *Hansenula anomala*. Klebsiella species, such as Klebsiella oxytoca; Kluyveromyces species, such as Kluyveromyces martensii, K. latic, K. thermolelerans, and Kluyveromyces brittlewall; Schizosomyces species, such as S. pombe; Thermoanaerobacter species, such as Thermoanaerobacter glycolyticus; and Fermentation Monomers species, such as strains of Fermentation Monomer motiformis.

[0288] In one preferred aspect, the yeast is *Bretannomyces*. In a more preferred aspect, the yeast is *Bretannomyces clausenii*. In another more preferred aspect, the yeast is *Candida*. In another more preferred aspect, the yeast is *Candida sonorensis*. In another more preferred aspect, the yeast is *Candida boydinii*. In another more preferred aspect, the yeast is *Candida blankii*. In another more preferred aspect, the yeast is *Candida brassicae*. In another more preferred aspect, the yeast is *Candida didensii*. In another more preferred aspect, the yeast is *Candida entomophiliia*. In another more preferred aspect, the yeast is *Candida pseudotropica*. In another more preferred aspect, the yeast is *Candida schwahatta*. In another more preferred aspect, the yeast is *Candida utilis*. In another preferred aspect, the yeast is *Clavispora*. In another more preferred aspect, the yeast is *Clavispora lusitaniae*. In another preferred aspect, the yeast is *Clavispora opuntiae*. In another preferred aspect, the yeast is *Kluyveromyces*. In another preferred aspect, the yeast is *Kluyveromyces brittle*. In another preferred aspect, the yeast is *Kluyveromyces marx*. In another preferred aspect, the yeast is *Kluyveromyces thermotolerans*. In another preferred aspect, the yeast is a species of *Saccharomyces*. In another preferred aspect, the yeast is *Saccharomyces tanninophilus*. In another preferred aspect, the yeast is *Pichia pastoris*. In another preferred aspect, the yeast is *Pichia stearosa*. In another preferred aspect, the yeast is a species of *Saccharomyces*. In another preferred aspect, the yeast is *Saccharomyces brewer's yeast*. In another preferred aspect, the yeast is *Saccharomyces distaticus*. In another preferred aspect, the yeast is *Saccharomyces uvarum*.

[0289] In one preferred aspect, the bacteria are *Bacillus*. In a more preferred aspect, the bacteria are *Bacillus coagulans*. In another more preferred aspect, the bacteria are *Clostridium*. In another more preferred aspect, the bacteria are *Clostridium acetobutanol*. In another more preferred aspect, the bacteria are *Clostridium phytofermentans*. In another more preferred aspect, the bacteria are *Clostridium thermofibrinolyticum*. In another more preferred aspect, the bacteria are species of *Bacillus*. In another more preferred aspect, the bacteria are *Anaerobic thermophilus*. In another more preferred aspect, the bacteria are *Anaerobic thermophilus*. In another more preferred aspect, the bacteria are *Fermentomonas*. In another more preferred aspect, the bacteria are *Fermentomonas motiformis*.

[0290] Commercially available yeasts suitable for ethanol production include, for example, BIOFERM. TM AFT and XR (NABC-NorthAmerican Bioproducts Corporation, GA, USA), ETHANOLRED TM Yeast (Red Star / Lesaffre, USA), FALI TM (Fleischmann's Yeast, Burns PhilpFood Inc., USA), FERMIOL TM (DSMSpecialties),GERT STRAND TM (GertStrand AB, Sweden) and SUPERSTART TM and THERMOSACC TM Fresh yeast (Ethanol Technology, WI, USA).

[0291] In a preferred aspect, the fermenting microorganisms have been genetically modified to provide the ability to ferment pentoses, such as those utilizing xylose, arabinose, and those utilizing both xylose and arabinose.

[0292] Organisms capable of converting hexoses and pentoses into ethanol (co-fermentation) have been constructed by cloning heterologous genes into various fermenting microorganisms (Chen and Ho, 1993, Cloning and improving the expression of Pichiastipitis xylose reductase gene in Saccharomyces cerevisiae, Appl. Biochem. Biotechnol. 39-40:135-147; Ho et al., 1998, Genetically engineered Saccharomyces yeast capable of effectively cofermenting glucose and xylose, Appl. Environ. Microbiol. 64:1852-1859; Kotter and Ciriacy, 1993, Xylose fermentation by Saccharomyces cerevisiae, Appl. Microbiol. Biotechnol. 38:776-783; Walfridsson et al., 1995, Xylose-metabolizing Saccharomyces cerevisiae). strains overexpressing the TKL1and TAL1genes encoding the pentose phosphate pathway enzymestransketolase and transaldolase, Appl.Environ.Microbiol.61:4184-4190; Kuyper et al., 2004, Minimal metabolic engineering of Saccharomyces cerevisiae for efficientanaerobic xylose fermentation: a proof of principle, FEMS Yeast Research 4:655-664; Beall et al., 1991, Parametric studies of ethanol production from xylose and other sugars by recombinant Escherichia coli, Biotech.Bioeng.38:296-303; Ingram et al., 1998, Metabolic engineering of bacteria for ethanol production, Biotechnol.Bioeng.58:204-214; Zhang et al., 1995, Metabolic engineering of a pentosemetabolism pathway in ethanologenic Zymomonas mobilis, Science 267:240-243; Deanda et al., 1996, Development of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering, Appl. Environ. Microbiol. 62:4465-4470; WO 2003 / 062430, Xylose Isomerase). .

[0293] In one preferred aspect, the genetically modified fermenting microorganism is *Candida sonorensis*. In another preferred aspect, the genetically modified fermenting microorganism is *Escherichia coli*. In yet another preferred aspect, the genetically modified fermenting microorganism is *Klebsiella oxytoca*. In yet another preferred aspect, the genetically modified fermenting microorganism is *Kluyveromyces martensii*. In yet another preferred aspect, the genetically modified fermenting microorganism is *Saccharomyces cerevisiae*. In yet another preferred aspect, the genetically modified fermenting microorganism is *Mammillaria molybdate*.

[0294] It is well known in the art that the aforementioned organisms can also be used to produce other substances, as described herein.

[0295] Fermenting microorganisms are typically added to the degraded cellulose material or hydrolysate, and fermentation is carried out for approximately 8 to approximately 96 hours, for example, approximately 24 to approximately 60 hours. The temperature is typically from approximately 26°C to approximately 60°C, for example, approximately 32°C or 50°C, and the pH is from approximately 3 to approximately 8, for example, approximately 4-5, 6 or 7.

[0296] In one aspect, yeast and / or another microorganism are applied to the degraded cellulose material and fermentation is carried out for about 12 to about 96 hours, such as typically 24-60 hours. In another aspect, the temperature is preferably about 20°C to about 60°C, for example about 25°C to about 50°C, and about 32°C to about 50°C, and the pH is typically about pH 3 to about pH 7, for example about pH 4 to about pH 7. However, some fermenting organisms, such as bacteria, have higher optimal fermentation temperatures. Yeast or another microorganism is preferably fermented at about 10... 5 -10 12 Preferred 10 7 -10 10 Especially about 2 x 10 8 Count live cells per ml of fermentation broth. Further guidance on using yeast for fermentation can be found, for example, in “The Alcohol Textbook” (edited by K. Jacques, T. Plyons and D. D. Kelsall, Nottingham University Press, United Kingdom 1999), which is incorporated herein by reference.

[0297] Fermentation stimulants can be used in combination with any of the processes described herein to further improve fermentation methods and, specifically, improve the performance of fermenting microorganisms, such as increased rates and ethanol yield. “Fermentation stimulant” refers to an agent that stimulates the growth of fermenting microorganisms (particularly yeast). Preferred fermentation stimulants for growth include vitamins and minerals. Examples of vitamins include multivitamins, biotin, pantothenic acid (salt), niacin, meso-inositol, thiamine, pyridoxine, para-aminobenzoic acid, folic acid, riboflavin, and vitamins A, B, C, D, and E. See, for example, Alfenore et al., Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process, Springer-Verlag (2002), which is incorporated herein by reference. Examples of minerals include minerals and mineral salts that can provide nutrients, including P, K, Mg, S, Ca, Fe, Zn, Mn, and Cu.

[0298] Fermentation productsFermentation products can be any substance derived from fermentation. Fermentation products can be, but are not limited to, alcohols (e.g., arabinol, n-butanol, isobutanol, ethanol, glycerol, methanol, ethylene glycol, 1,3-propanediol (propylene glycol), butanediol, glycerol, sorbitol, and xylitol); alkanes (e.g., pentane, hexane, heptane, octane, nonane, decane, undecane, and dodecane); cycloalkanes (e.g., cyclopentane, cyclohexane, cycloheptane, and cyclooctane); alkenes (e.g., pentene, hexene, heptene, and octene); and amino acids (e.g., aspartic acid, glutamic acid, glycine, lysine, serine). Fermentation products include: acids and threonine; gases (e.g., methane, hydrogen (H2), carbon dioxide (CO2), and carbon monoxide (CO)); isoprene; ketones (e.g., acetone); organic acids (e.g., acetic acid, acetoic acid, adipic acid, ascorbic acid, citric acid, 2,5-diketo-D-gluconic acid, formic acid, fumaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, oxaloacetic acid, propionic acid, succinic acid, and xylic acid); and polyketide compounds. Fermentation products can also be proteins, which are high-value products.

[0299] In a preferred aspect, the fermentation product is an alcohol. It is understood that the term "alcohol" includes substances containing one or more (e.g., several) hydroxyl groups. In a more preferred aspect, the alcohol is n-butanol. In another more preferred aspect, the alcohol is isobutanol. In yet another more preferred aspect, the alcohol is ethanol. In yet another more preferred aspect, the alcohol is methanol. In yet another more preferred aspect, the alcohol is arabinol. In yet another more preferred aspect, the alcohol is butanediol. In yet another more preferred aspect, the alcohol is ethylene glycol. In yet another more preferred aspect, the alcohol is glycerin. In yet another more preferred aspect, the alcohol is glycerol. In yet another more preferred aspect, the alcohol is 1,3-propanediol. In yet another more preferred aspect, the alcohol is sorbitol. In yet another more preferred aspect, the alcohol is xylitol. See, for example, Gong, CS, Cao, NJ, Du, J., and Tsao, GT, 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering / Biotechnology, Scheper, T., ed., Springer-Verlag Berlin Heidelberg, Germany, 65:207-241; Silveira, MM, and Jonas, R., 2002, The biotechnological production ofsorbitol, Appl.Microbiol.Biotechnol.59:400-408; Nigam, P., and Singh, D., 1995, Processes for fermentative production of xylitol–a sugar substitute, ProcessBiochemistry 30(2):117-124; Ezeji, TC, Qureshi, N., and Blaschek, HP, 2003, Production of acetone, butanol and ethanol by Clostridium beijerinckiiBA101and in situ recovery by gas stripping, World Journal of Microbiology and Biotechnology 19(6):595-603.

[0300] In another preferred aspect, the fermentation product is an alkane. The alkane is an unbranched or branched alkane. In another more preferred aspect, the alkane is pentane. In another more preferred aspect, the alkane is hexane. In another more preferred aspect, the alkane is heptane. In another more preferred aspect, the alkane is octane. In another more preferred aspect, the alkane is nonane. In another more preferred aspect, the alkane is decane. In another more preferred aspect, the alkane is undecane. In another more preferred aspect, the alkane is dodecane.

[0301] In another preferred aspect, the fermentation product is a cycloalkane. In another more preferred aspect, the cycloalkane is cyclopentane. In another more preferred aspect, the cycloalkane is cyclohexane. In another more preferred aspect, the cycloalkane is cycloheptane. In another more preferred aspect, the cycloalkane is cyclooctane.

[0302] In another preferred aspect, the fermentation product is an olefin. The olefin may be unbranched or branched. In another more preferred aspect, the olefin is pentene. In another more preferred aspect, the olefin is hexene. In another more preferred aspect, the olefin is hepten. In another more preferred aspect, the olefin is octene.

[0303] In another preferred aspect, the fermentation product is an amino acid. In another more preferred aspect, the organic acid is aspartic acid. In another more preferred aspect, the amino acid is glutamic acid. In another more preferred aspect, the amino acid is glycine. In another more preferred aspect, the amino acid is lysine. In another more preferred aspect, the amino acid is serine. In another more preferred aspect, the amino acid is threonine. See, for example, Richard, A., and Margaritis, A., 2004, Empirical modeling of batch fermentationkinetics for poly(glutamic acid) production and other microbial biopolymers, Biotechnology and Bioengineering 87(4):501-515.

[0304] In another preferred aspect, the substance is a gas. In another more preferred aspect, the gas is methane. In another more preferred aspect, the gas is H2. In another more preferred aspect, the gas is CO2. In another more preferred aspect, the gas is CO. See, for example, Kataoka, N., A. Miya, and K. Kiriyama, 1997, Studies on hydrogen production by continuous culture system of hydrogen-producing anaerobic bacteria, Water Science and Technology 36(6-7):41-47; and Gunaselan VN in Biomass and Bioenergy, Vol.13(1-2), pp.83-114, 1997, Anaerobic digestion of biomass for methane production: A review.

[0305] In another preferred aspect, the fermentation product is isoprene.

[0306] In another preferred aspect, the fermentation product is a ketone. It should be understood that the term "ketone" encompasses any ketone containing one or more (e.g., several) ketone modules. In another more preferred aspect, the ketone is acetone. See, for example, Qureshi and Blaschek, 2003, above.

[0307] In another preferred aspect, the fermentation product is an organic acid. In another more preferred aspect, the organic acid is acetic acid. In another more preferred aspect, the organic acid is acetoic acid. In another more preferred aspect, the organic acid is adipic acid. In another more preferred aspect, the organic acid is ascorbic acid. In another more preferred aspect, the organic acid is citric acid. In another more preferred aspect, the organic acid is 2,5-diketo-D-gluconic acid. In another more preferred aspect, the organic acid is formic acid. In another more preferred aspect, the organic acid is fumaric acid. In another more preferred aspect, the organic acid is gluconic acid. In another more preferred aspect, the organic acid is glucuronic acid. In another more preferred aspect, the organic acid is glutaric acid. In another preferred aspect, the organic acid is 3-hydroxypropionic acid. In another more preferred aspect, the organic acid is itaconic acid. In another more preferred aspect, the organic acid is lactic acid. In another more preferred aspect, the organic acid is malic acid. In another preferred aspect, the organic acid is malonic acid. In another preferred aspect, the organic acid is oxalic acid. In another preferred aspect, the organic acid is propionic acid. In another preferred aspect, the organic acid is succinic acid. In another preferred aspect, the organic acid is xyloic acid. See, for example, Chen, R., and Lee, YY, 1997, Membrane-mediated extractive fermentation for lactic acid production from cellulosic biomass, Appl. Biochem. Biotechnol. 63-65:435-448.

[0308] In another preferred aspect, the substance is a polyketide.

[0309] Recycle Fermentation products can be optionally recovered from fermentation media using any method known in the art, including, but not limited to, chromatography, electrophoresis, differential solubility, distillation, or extraction. For example, alcohols can be separated and purified from fermented cellulose material by conventional distillation methods. Ethanol with a purity up to about 96 vol% can be obtained, which can be used, for example, as fuel ethanol, drinking ethanol (i.e., neutral beverage alcohol), or industrial ethanol.

[0310] The invention is further described through the following embodiments, but should not be construed as limiting the scope of the invention.

[0311] This invention relates to the following technical solutions:

[0312] 1. An enzyme composition comprising: (i) Aspergillus fumigatus cellobiose hydrolase I; (ii) Aspergillus fumigatus cellobiose hydrolase II; (iii) Aspergillus fumigatus β-glucosidase or a variant thereof; and (iv) a Penicillium species GH61 polypeptide having enhanced cellulose-degrading activity; or a homolog thereof.

[0313] 2. The enzyme composition of item 1, wherein the Aspergillus fumigatus cellobiase I or a homolog thereof is selected from the group consisting of:

[0314] (i) Cellobiose hydrolase I, which comprises or constitutes the mature polypeptide of SEQ ID NO:2;

[0315] (ii) Cellobiose hydrolase I, comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:2;

[0316] (iii) Cellobiose hydrolase I, encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:1; and

[0317] (iv) Cellobiase I, which is encoded by a polynucleotide, which hybridizes with the mature polypeptide coding sequence of SEQ ID NO:1 or its full-length complementary strand under at least high-strict conditions and very high-strict conditions.

[0318] The Aspergillus fumigatus cellobiose hydrolase II or its homologs are selected from the following group:

[0319] (i) Cellobiose hydrolase II, which comprises or constitutes the mature polypeptide of SEQ ID NO:4;

[0320] (ii) Cellobiose hydrolase II, comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:4;

[0321] (iii) Cellobiose hydrolase II, encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:3; and

[0322] (iv) Cellobiase II, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:3 or its full-length complementary strand under at least high-strict conditions and very high-strict conditions.

[0323] The Aspergillus fumigatus β-glucosidase or its homologs are selected from the following group:

[0324] (i) β-glucosidase, which comprises or constitutes the mature polypeptide of SEQ ID NO:6;

[0325] (ii) β-glucosidase comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 6;

[0326] (iii) β-glucosidase encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:5;

[0327] (iv) β-glucosidase, encoded by a polynucleotide, said polynucleotide hybridizing under at least high-strict conditions and very high-strict conditions with the coding sequence of the mature polypeptide of SEQ ID NO:5 or its full-length complementary strand; and

[0328] (v) A β-glucosidase variant comprising a substitution at one or more positions corresponding to positions 100, 283, 456, and 512 of the mature polypeptide of SEQ ID NO:6, wherein said variant has β-glucosidase activity; and

[0329] The Penicillium GH61 polypeptide or its homologs with enhanced cellulose-degrading activity are selected from the following group:

[0330] (i) A GH61 polypeptide with enhanced cellulose degradation activity, comprising or constituting a mature polypeptide of SEQ ID NO:6.

[0331] (ii) A GH61 polypeptide having cellulolytic-enhancing activity, comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:8;

[0332] (iii) A GH61 polypeptide having cellulolytic-enhancing activity, encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide-coding sequence of SEQ ID NO:7; and

[0333] (iv) A GH61 polypeptide with enhanced cellulose degradation activity, encoded by a polynucleotide that hybridizes with the coding sequence of the mature polypeptide of SEQ ID NO:7 or its full-length complementary strand under at least high-strict conditions and very high-strict conditions.

[0334] 3. The enzyme composition of item 1 or 2, wherein the β-glucosidase variant comprises one or more substitutions selected from the group consisting of G142S, Q183R, H266Q, and D703G.

[0335] 4. An enzyme composition of any one of items 1-3, further comprising one or more enzymes selected from the group consisting of: (i) Aspergillus fumigatus xylanase or a homolog thereof; (ii) Aspergillus fumigatus β-xylosidase or a homolog thereof; or (iii) a combination of (i) and (ii);

[0336] The Aspergillus fumigatus xylanase or its homologs are selected from the following group:

[0337] (i) Aspergillus fumigatus xylanase, comprising or consisting of a mature polypeptide of SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14;

[0338] (ii) a xylanase comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14;

[0339] (iii) a xylanase encoded by a polynucleotide, comprising or constituting a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide encoding sequence of SEQ ID NO:9, SEQ ID NO:11, or SEQ ID NO:13.

[0340] (iv) Xylanase, encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:9, SEQ ID NO:11, or SEQ ID NO:13 under at least high-strict conditions or very high-strict conditions; or their full-length complementary strand.

[0341] The Aspergillus fumigatus β-xylosidase or its homologs are selected from the following group:

[0342] (i) β-xylosidase, which comprises or constitutes the mature polypeptide of SEQ ID NO:16;

[0343] (ii) β-xylosidase comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 16;

[0344] (iii) β-xylosidase encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:15; and

[0345] (iv) β-xylosidase, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:15 or its full-length complementary strand under at least high-strict conditions and very high-strict conditions.

[0346] 5. The enzyme composition of any one of claims 1-4, further comprising one or more enzymes selected from the group consisting of: cellulase, GH61 polypeptide having cellulolytic-enhancing activity, hemicellulase, esterase, patulin, laccase, lignin-degrading enzyme, pectinase, peroxidase, protease, and swelling agent.

[0347] 6. A recombinant filamentous fungal host cell comprising a polynucleotide encoding: (i) Aspergillus fumigatus cellobiose hydrolase I; (ii) Aspergillus fumigatus cellobiose hydrolase II; (iii) Aspergillus fumigatus β-glucosidase or a variant thereof; and (iv) a Penicillium species GH61 polypeptide having enhanced cellulose-degrading activity; or a homolog thereof.

[0348] 7. The recombinant filamentous fungal host cell of item 6, wherein the cellobiase I or its homolog is selected from the group consisting of:

[0349] (i) Cellobiose hydrolase I, which comprises or constitutes the mature polypeptide of SEQ ID NO:2;

[0350] (ii) Cellobiose hydrolase I, comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:2;

[0351] (iii) Cellobiose hydrolase I, encoded by a polynucleotide comprising or constituting a nucleotide sequence, wherein the mature polypeptide encoding sequence of the nucleotide sequence SEQ ID NO:1 has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with; and

[0352] (iv) Cellobiase I, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:1 or its full-length complementary strand under at least high-strict conditions and very high-strict conditions.

[0353] The Aspergillus fumigatus cellobiose hydrolase II or its homologs are selected from the following group:

[0354] (i) Cellobiose hydrolase II, which comprises or constitutes the mature polypeptide of SEQ ID NO:4

[0355] (ii) Cellobiose hydrolase II, comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:4;

[0356] (iii) Cellobiose hydrolase II, encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:3; and

[0357] (iv) Cellobiase II, which is encoded by a polynucleotide that hybridizes with the coding sequence of the mature polypeptide of SEQ ID NO:3 or its full-length complementary strand under at least high-strict or at least very-high-strict conditions.

[0358] The Aspergillus fumigatus β-glucosidase or its homologs are selected from the following group:

[0359] (i) β-glucosidase, which comprises or constitutes the mature polypeptide of SEQ ID NO:6;

[0360] (ii) β-glucosidase comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 6;

[0361] (iii) a β-glucosidase encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:5; and

[0362] (iv) β-glucosidase, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:5 or its full-length complementary strand under at least very stringent conditions;

[0363] (v) A β-glucosidase variant comprising a substitution at one or more positions corresponding to positions 100, 283, 456, and 512 of the mature polypeptide of SEQ ID NO:6, wherein said variant has β-glucosidase activity; and

[0364] The Penicillium GH61 polypeptide with enhanced cellulose-degrading activity is selected from the following group:

[0365] (i) A GH61 polypeptide with enhanced cellulose degradation activity, comprising or constituting a mature polypeptide of SEQ ID NO:8.

[0366] (ii) A GH61 polypeptide having cellulolytic-enhancing activity, comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:8;

[0367] (iii) A GH61 polypeptide having cellulolytic-enhancing activity, encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide-coding sequence of SEQ ID NO:7; and

[0368] (iv) A GH61 polypeptide with enhanced cellulose degradation activity, which is encoded by a polynucleotide that hybridizes with the coding sequence of the mature polypeptide of SEQ ID NO:7 or its full-length complementary strand under at least high-strict conditions and very high-strict conditions.

[0369] 8. The recombinant filamentous fungal host cell of item 6 or 7, wherein the β-glucosidase variant comprises one or more substitutions selected from the group consisting of: G142S, Q183R, H266Q, and D703G.

[0370] 9. The enzyme composition of any one of claims 6-8, further comprising one or more polynucleotides encoding one or more enzymes selected from the group consisting of: (i) Aspergillus fumigatus xylanase, (ii) Aspergillus fumigatus β-xylosidase; or (iii) a combination of (i) and (ii);

[0371] The Aspergillus fumigatus xylanase or its homologs are selected from the following group:

[0372] (i) Aspergillus fumigatus xylanase, comprising or consisting of a mature polypeptide of SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14;

[0373] (ii) a xylanase comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14;

[0374] (iii) a xylanase encoded by a polynucleotide, comprising or constituting a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide encoding sequence of SEQ ID NO:9, SEQ ID NO:11, or SEQ ID NO:13.

[0375] (iv) a xylanase encoded by a polynucleotide, said polynucleotide hybridizing under at least high-stress conditions and very high-stress conditions with the coding sequence of a mature polypeptide of SEQ ID NO:9, SEQ ID NO:11, or SEQ ID NO:13 or its full-length complementary strand; and

[0376] The Aspergillus fumigatus β-xylosidase or homologs mentioned therein are selected from the following group:

[0377] (i) β-xylosidase, which comprises or constitutes the mature polypeptide of SEQ ID NO:16;

[0378] (ii) β-xylosidase comprising or constituting an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 16;

[0379] (iii) β-xylosidase encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:15; and

[0380] (iv) β-xylosidase, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:15 or its full-length complementary strand under at least high-strict conditions and very high-strict conditions.

[0381] 10. The recombinant filamentous fungal host cell of any one of items 6-7, which is a Trichoderma cell.

[0382] 11. The recombinant filamentous fungal host cell of item 10, which is Trichoderma reesei.

[0383] 12. The recombinant filamentous fungal host cell of any one of claims 6-11, wherein one or more cellulase genes, one or more hemicellulase genes, or a combination thereof, derived from the filamentous fungal host, have been inactivated.

[0384] 13. The recombinant filamentous fungal host cell of item 12, wherein the cellulase gene is an inactivated cellobiase I gene, wherein the cellobiase I gene encodes cellobiase I selected from the group consisting of:

[0385] (i) Cellobiose hydrolase I, which comprises or constitutes the mature polypeptide of SEQ ID NO:18;

[0386] (ii) Cellobiose hydrolase I, comprising or constituting an amino acid sequence having at least 70%, for example at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 18;

[0387] (iii) Cellobiose hydrolase I, encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:17; and

[0388] (iv) Cellobiose hydrolase I, which is encoded by a polynucleotide, which hybridizes with the mature polypeptide coding sequence of SEQ ID NO:17 or its full-length complementary strand under at least high-strict conditions and very high-strict conditions.

[0389] 14. The recombinant filamentous fungal host cell of item 12 or 13, wherein the cellulase gene is an inactivated cellobiase II gene, wherein the cellobiase II gene encodes cellobiase II selected from the group consisting of:

[0390] (i) Cellobiose hydrolase II, which comprises or constitutes the mature polypeptide of SEQ ID NO:20;

[0391] (ii) Cellobiose hydrolase II, comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:20;

[0392] (iii) Cellobiose hydrolase II, encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:19; and

[0393] (iv) Cellobiase II, which is encoded by a polynucleotide, which hybridizes with the mature polypeptide coding sequence of SEQ ID NO:19 or its full-length complementary strand under at least high-strict conditions and very high-strict conditions.

[0394] 15. A recombinant filamentous fungal host cell of any one of claims 12-14, wherein the cellulase gene is an inactivated β-glucosidase gene, wherein the β-glucosidase gene encodes a β-glucosidase selected from the group consisting of:

[0395] (i) β-glucosidase, which comprises or constitutes the mature polypeptide of SEQ ID NO:22.

[0396] (ii) β-glucosidase comprising or constituting an amino acid sequence having at least 70%, for example at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:22;

[0397] (iii) a β-glucosidase encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:21; and

[0398] (iv) β-glucosidase, encoded by a polynucleotide, which hybridizes with the mature polypeptide coding sequence of SEQ ID NO:21 or its full-length complementary strand under at least high-strict conditions and very high-strict conditions.

[0399] 16. A recombinant filamentous fungal host cell of any one of claims 12-15, wherein the hemicellulase gene is an inactivated xylanase gene, wherein the xylanase gene encodes a xylanase selected from the group consisting of:

[0400] (i) Xylanase, comprising or consisting of the mature polypeptides of SEQ ID NO:24, SEQ ID NO:26 and SEQ ID NO:28;

[0401] (ii) a xylanase comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptides of SEQ ID NO:24, SEQ ID NO:26, and SEQ ID NO:2;

[0402] (iii) A xylanase encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequences of SEQ ID NO:23, SEQ ID NO:25, and SEQ ID NO:27.

[0403] (iv) Xylanase, which is encoded by a polynucleotide, which hybridizes with the mature polypeptide coding sequences of SEQ ID NO:23, SEQ ID NO:25 and SEQ ID NO:27 or their full-length complementary strands under at least high-stress conditions and very high-stress conditions.

[0404] 17. A recombinant filamentous fungal host cell of any one of claims 12-16, wherein the hemicellulase gene is an inactivated β-xylosidase gene, wherein the β-xylosidase gene encodes a β-xylosidase selected from the group consisting of:

[0405] (i) β-xylosidase, which comprises or constitutes the mature polypeptide of SEQ ID NO:30;

[0406] (ii) β-xylosidase comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:30;

[0407] (iii) a β-xylosidase encoded by a polynucleotide comprising or constituting a nucleotide sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:29; and

[0408] (iv) β-xylosidase, which is encoded by a polynucleotide, which hybridizes with the mature polypeptide coding sequence of SEQ ID NO:29 or its full-length complementary strand under at least high-strict conditions and very high-strict conditions.

[0409] 18. A recombinant filamentous fungal host cell of any one of claims 6-17, further comprising one or more polynucleotides encoding one or more enzymes selected from the group consisting of: cellulase, GH61 polypeptide having cellulolytic-enhancing activity, hemicellulase, esterase, patulin, laccase, lignin-degrading enzyme, pectinase, peroxidase, protease, and swelling agent.

[0410] 19. A method for producing an enzyme composition, comprising: culturing a host cell of any one of items 7-18 under conditions conducive to the production of the enzyme composition.

[0411] 20. The method of item 19 further includes recovering the enzyme composition.

[0412] 21. A process for degrading cellulose material, comprising treating the cellulose material with an enzyme composition of any one of claims 1-6.

[0413] 22. A process for producing fermentation products, comprising:

[0414] (a) Saccharifying cellulose material with an enzyme composition of any one of items 1-6;

[0415] (b) Fermenting saccharified cellulose material with one or more fermenting microorganisms to produce fermentation products; and (c) Recovering fermentation products from fermentation.

[0416] 23. A method for fermenting a cellulose material, comprising: fermenting the cellulose material with one or more fermenting microorganisms, wherein the cellulose material is saccharified with an enzyme composition of any one of items 1-6. Example

[0417] strains

[0418] Trichoderma reesei strain 981-O-8(D4) is a mutagenized column of Trichoderma reesei RutC30 (ATCC 56765; Montenegrout and Eveleigh, 1979, Adv. Chem. Ser. 181:289-301).

[0419] Trichoderma reesei strain AgJg115-104-7B1 (PCT / US2010 / 061105, WO 2011 / 075677) is a Ku70 derivative of Trichoderma reesei strain 981-O-8(D4).

[0420] Culture medium and buffer solution

[0421] The 2XYT plus ampicillin plate consists of 16g ​​tryptone, 10g yeast extract, 5g sodium chloride, 15g Bacto agar, and deionized water to a final volume of 1 liter. After the steam-sterilized medium is cooled to 55°C, one ml of a 100 mg / ml ampicillin solution is added.

[0422] SOC medium consists of 20g of Bacto-tryptone, 5g of Bacto yeast extract, 0.5g of NaCl, 2.5ml of 1M KCl, and deionized water to a final volume of 1 liter. Before steam sterilization, adjust the pH to 7.0 using 10N NaOH. Then, add 20ml of sterile 1M glucose just before use.

[0423] The COVE salt solution is composed of 26g KCl, 26g MgSO4·7H2O, 76g KH2PO4, 50ml of COVE trace metal solution, and deionized water added to a final volume of 1 liter.

[0424] The COVE trace metal solution is composed of 0.04 g of NaB4O7·10H2O, 0.4 g of CuSO4·5H2O, 1.2 g of FeSO4·7H2O, 0.7 g of MnSO4·H2O, 0.8 g of Na2MoO2·2H2O, 10 g of ZnSO4·7H2O, and deionized water added to a volume of 1 liter.

[0425] COVE plates consist of 342.3g of sucrose, 20ml of COVE salt solution, 10ml of 1M acetamide, 10ml of 1.5MCsCl, 25g of Noble agar (Difco), and deionized water to a final volume of 1 liter.

[0426] COVE2 plates are made up of 30g sucrose, 20ml COVE salt solution, 10ml 1M acetamide, 25g Noble agar (Difco), and deionized water to a final volume of 1 liter.

[0427] The Trichoderma trace metal solution is composed of 216g FeCl3·6H2O, 58g ZnSO4·7H2O, 27g MnSO4·H2O, 10g CuSO4·5H2O, 2.4g H3BO3, 336g citric acid, and deionized water added to 1 liter.

[0428] CIM medium consists of 20g cellulose, 10g corn steep solids, 1.45g (NH4)2SO4, 2.08g KH2PO4, 0.28g CaCl2, 0.42g MgSO4·7H2O, 0.42ml Trichoderma trace metal solution, 1-2 drops antifoaming agent, and deionized water to a final volume of 1 liter; pH adjusted to 6.0.

[0429] YP medium consists of 10g of yeast extract, 20g of Bacto peptone, and deionized water added to 1 liter.

[0430] The PEG buffer solution is composed of 500g of polyethylene glycol 4000 (PEG 4000), 10mM CaCl2, 10mM Tris-HCl pH7.5, and deionized water to a final volume of 1 liter; then filtered and sterilized.

[0431] The PDA plate consists of 39g of Potato Dextrose agar (Difco) and deionized water added to 1 liter.

[0432] PDA-covered medium consists of 39 g of Potato Dextrose agar (Difco), 2.44 g of uridine, and deionized water added to 1 liter. The previously steam-sterilized medium is melted in a microwave oven and then cooled to 55°C before use.

[0433] STC is composed of 1M sorbitol, 10mM CaCl2, and 10mM Tris-HCl, pH 7.5; sterilized by filtration.

[0434] The TE buffer consists of 1M Tris pH 8.0 and 0.5M EDTA pH 8.0.

[0435] 20X SSC is composed of 175.3g of NaCl, 88.2g of sodium citrate, and deionized water added to 1 liter.

[0436] TrMM-G medium consists of 20 ml of COVE salt solution, 6 g of (NH4)2SO4, 0.6 g of CaCl2, 25 g of Nobel agar (Difco), 20 g of glucose, and deionized water added to a final volume of 1 liter.

[0437] The NZY+ medium consists of 5g NaCl, 3g MgSO4·7H2O, 5g yeast extract, 10g NZ amine, 1.2g MgCl2, 4g glucose, and deionized water added to a final volume of 1 liter.

[0438] Example 1: Construction of the Trichoderma reesei cbhI-Aspergillus fumigatus cbhI substitute construct pJfyS139

[0439] The coding sequence for Aspergillus fumigatus cellobiose hydrolase (cbhI) (SEQ ID NO:1 [DNA sequence] and SEQ ID NO:2 [derived amino acid sequence]) was amplified from pEJG93 (WO 2011 / 057140) using the gene-specific forward and reverse primers shown below. Italicized regions represent... The insertion site of the reaction is homologous to the vector, while the underlined part is the introduced Pac I site.

[0440] Forward primer:

[0441] 5'-cgcggactgcgcaccATGCTGGCCTCCACCTTCTCCTACC-3'(SEQ ID NO:31)

[0442] Reverse primer:

[0443] 5'-ctttcgccacggag cttaattaa CTACAGGCACTGAGAGTAATAATCA-3'(SEQ ID NO:32)

[0444] The amplification reaction consisted of 20 ng of pEJG93, 200 μM of dNTPs, 0.4 μM of primers, and 1X... Reaction Buffer (Stratagene, La Jolla, CA, USA), and 1.875 units The solution consisted of HotStart High-Fidelity DNA Polymerase (Stratagene, LaJolla, CA, USA), with a final volume of 50 μl. The amplification reaction mixture was then... The PCR products were incubated in 5333epgradient S (Eppendorf Scientific, Inc., Westbury, NY, USA) using the following procedure: one cycle at 95°C for 2 minutes; 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute per cycle; and one cycle at 72°C for 7 minutes. The PCR products were separated by 1% agarose gel electrophoresis using 40 mM Tris base, 20 mM sodium citrate, and 1 mM disodium EDTA (TAE) buffer. A 1.6 kb fragment was excised from the gel and used... The Gel Extraction Kit (QIAGEN Inc., Valencia, CA, USA) extracts according to the manufacturer's experimental protocol.

[0445] Use 1.6kb PCR product The Advantage PCR Cloning Kit (Clontech, Palo Alto, CA, USA) was inserted with Nco I / Pac I-digested pSMai155 (WO 05 / 074647) according to the manufacturer's experimental protocol. The reaction is caused by 1X Reaction Buffer (Clontech, Palo Alto, CA, USA), 125 ng Nco I / Pac I-digested pSMai155, 100 ng of the 1.6 kb PCR product, and 1 μl of Enzyme (Clontech, Palo Alto, CA, USA) was used, and the reaction volume was 10 μl. The reaction was incubated at 37°C for 15 minutes, followed by incubation at 50°C for 15 minutes. After the incubation period, 40 μl of TE buffer was added to the reaction, and ONE was converted using 2 μl aliquots according to the manufacturer's experimental protocol. TOP10 competent cells (Invitrogen, Carlsbad, CA, USA). Cells were heat-shocked at 42°C for 30 seconds and then 250 μl of SOC medium was added. The tubes were incubated at 37°C and 200 rpm for 1 hour, and 250 μl of the solution was plated onto 150 mm diameter 2XYT plus ampicillin plates and incubated overnight at 37°C. The resulting transformants were screened by sequencing, and a clone containing an insert without PCR errors was identified and named pJfyS139-A. pJfyS139-A was used for inserting the herpes simplex virus thymine kinase (tk) gene.

[0446] The herpes simplex virus thymidine kinase TK coding sequence (SEQ ID NO:33 [DNA sequence] and SEQ ID NO:34 [dextended amino acid sequence]) was released from pJfyS1579-8-6 (WO 2010 / 039840) by digestion of the plasmid with Bgl II and Bam HI. The digest was subjected to 1% agarose gel electrophoresis with TAE buffer, and a 2.3 kb band was excised from the gel and used... Extracted using a Gel Extraction Kit. The tk gene was extracted using QUICKLIGATION. TMThe kit (New England Biolabs, Inc., Ipswich, MA USA) was inserted into BamHI-digested, calf intestinal phosphatase-treated pJfyS139-A according to the manufacturer's experimental protocol. The ligation reaction consisted of 50 ng of the aforementioned BamHI-digested, calf intestinal phosphatase-treated pJfyS139-A, 50 ng of the 2.3 kb tk gene insert, and 1X QUICKLIGATION. TM Buffer solution (New England Biolabs, Inc., Ipswich, MA USA), and 5 units of quickligate. TM (New England Biolabs, Inc., Ipswich, MA USA), final volume 20 μl. The reaction was incubated at room temperature for 5 minutes, and ONE was converted using 2 μl of the reactant according to the manufacturer's experimental protocol. TOP10 competent cells. Cells were heat-shocked at 42°C for 30 seconds and 250 μl of SOC medium was added. The tubes were incubated at 37°C and 200 rpm for 1 hour, and 250 μl of the medium was plated on 150 mm diameter 2XYT plus ampicillin plates and incubated overnight at 37°C. The resulting transformants were screened by restriction digestion analysis with Xma I to determine the presence and orientation of the insert, and a clone containing the insert was identified and named pJfyS139-B. pJfyS139-B was used to insert into the flanking sequence of the 3'cbhI gene in *Trichoderma reesei*.

[0447] The 3'cbhI gene flanking sequence was amplified from the Trichoderma reesei RutC30 genomic DNA using the following forward and reverse primers. The underlined portion represents the Not I site introduced for cloning.

[0448] Forward primer:

[0449] 5'-ttagact gcggccgc GTGGCGAAAGCCTGACGCACCGGTAGAT-3'(SEQ ID NO:35)

[0450] Reverse primer:

[0451] 5'-agtagtta gcggccgc ACGGCACGGTTAAGCAGGGTCTTGC-3'(SEQ ID NO:36)

[0452] Trichoderma reesei RutC30 was grown in 50 ml of YP medium supplemented with 2% glucose (w / v) in a 250 ml shake flask with a baffle at 28 °C with stirring at 200 rpm for 2 days. Mycelium was then used... The mycelium (Calbiochem, La Jolla, CA, USA) was filtered, washed twice in deionized water, and frozen in liquid nitrogen. The frozen mycelium was then ground into a fine powder using a pestle and mortar. Total DNA was used... Isolation was performed using the Plant Maxi Kit (QIAGEN Inc., Valencia, CA, USA), with lysis incubation extended to 2 hours.

[0453] The amplification reaction consisted of 150 ng of Trichoderma reesei RutC30 genomic DNA, 200 μM dNTPs, 0.4 μM primers, and 1X... Reaction Buffer, and 1.875 units The hot-start high-fidelity DNA polymerase formulation has a final volume of 50 μl. The amplification reaction mixture is... The 5333epgradient S was incubated at room temperature as follows: 1 cycle at 95°C for 2 minutes; 30 cycles, each cycle at 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute and 30 seconds; and 1 cycle at 72°C for 7 minutes.

[0454] PCR reactants were administered according to the manufacturer's experimental protocol. Nucleotide Removal Kit (QIAGEN Inc., Valencia, CA, USA). The resulting PCR mixture was digested with Not I, and the digested PCR products were separated by 1% agarose gel electrophoresis using TAE buffer. A 1.3kb fragment containing the 3'cbhI gene flanking sequence was excised from the gel and used... Extraction was performed using a Gel Extraction Kit. The 1.3kb fragment was then processed using QUICKLIGATION. TM Kit insertion of Not I-linearized, calf intestinal phosphatase-treated pJfyS139-B. The QUICKLIGATION TM The reaction consisted of 100 ng of the aforementioned Not I-linearized, calf intestinal phosphatase-treated pJfyS139-B, 20 ng of the aforementioned 1.3 kb fragment, and 1X QUICK LIGATION. TM Buffer, and 5 units of quick liquid TMThe final volume of the reactant was 20 μl. The reactant was incubated at room temperature for 5 minutes, and 2 μl of the reactant was used to convert ONE according to the manufacturer's experimental protocol. TOP10 competent cells. Cells were heat-shocked at 42°C for 30 seconds and 250 μl of SOC medium was added. The tubes were incubated at 37°C and 200 rpm for 1 hour, and 250 μl of the medium was plated on 150 mm diameter 2XYT plus ampicillin plates and incubated overnight at 37°C. The resulting transformants were screened by restriction digestion analysis with Xma I to determine the presence and orientation of inserts, and positive clones were sequenced. A clone containing a 3'cbhI gene flanking sequence without PCR errors was named pJfyS139. Figure 1 pJfyS139 was used as a vector to replace the Trichoderma reesei cbhI gene.

[0455] Example 2: Protoplast formation and transformation of Trichoderma reesei

[0456] Protoplast preparation and transformation were performed using the modified experimental protocol of Penttila et al., 1987, Gene 61:155-164. Briefly, *Trichoderma reesei* strain AgJg115-104-7B1 (PCT / US2010 / 061105, WO 2011 / 075677) was cultured in 25 ml of YP medium supplemented with 2% (w / v) glucose and 10 mM uridine at 27°C with gentle stirring at 90 rpm for 17 h. Mycelia were collected by filtration using a Vacuum Driven Disposable Filtration System (Millipore, Bedford, MA, USA) and washed twice with deionized water and twice with 1.2 M sorbitol. Protoplasts were prepared by suspending the washed mycelia in 20 ml of medium containing 15 mg / ml of [unspecified substance]. Protoplasts were generated by incorporating 200g (Novozymes A / S, Bagsvaerd, Denmark) and 0.36 units per ml of chitosanase (Sigma Chemical Co., St. Louis, MO, USA) in 1.2M sorbitol for 15–25 minutes. Protoplasts were collected by centrifugation at 400x g for 7 minutes and washing twice with cold 1.2M sorbitol. Protoplasts were counted using a hemocytometer and resuspended in STC to 1x10⁻¹. 8 Final concentration of protoplasts per ml. Excess protoplasts were stored at -80°C in a Cryo 1°C Freezing Container (Nalgene, Rochester, NY, USA).

[0457] Approximately 100 μg of the transforming plasmid described in the examples below was digested with Pme I. The digestion reaction was purified by 1% agarose gel electrophoresis using TAE buffer. The DNA bands were excised from the gel and used... Extraction was performed using a Gel Extraction Kit (QIAGEN Inc., Valencia, CA, USA). The purified DNA was added to 100 μl of protoplast solution and gently mixed. PEG buffer (250 μl) was added, mixed, and incubated at 34 °C for 30 min. STC (3 ml) was then added, mixed, and plated onto PDA plates supplemented with 1 M sucrose. After incubation at 28 °C for 16 h, 20 ml of PDA medium supplemented with 35 μg / ml hygromycin B was added to each plate. The plates were incubated at 28 °C for 4–7 days.

[0458] Example 3: Replacing the natural Trichoderma reesei cbhI gene with the Aspergillus fumigatus cbhI coding sequence.

[0459] To replace the native cbhI gene of *Trichoderma reesei* (SEQ ID NO:17 [DNA sequence] and SEQ ID NO:18 [derived amino acid sequence]) with the *Aspergillus fumigatus* bhI coding sequence (SEQ ID NO:1 [DNA sequence] and SEQ ID NO:2 [dated amino acid sequence]), *Trichoderma reesei* strain Ku70-AgJg115-104-7B1 (PCT / US2010 / 061105, WO 2011 / 075677) was transformed with 4 x 2 μg of Pme I-modified pJfyS139 (Example 1) according to the steps described in Example 2. Seven transformants were obtained, and each was picked and transferred to a PDA plate and incubated at 28°C for 7 days. Genomic DNA was isolated from the transformants according to the steps described in Example 1, and each transformant was subjected to Southern blotting analysis.

[0460] For Southern blotting analysis, 2 μg of genomic DNA was digested with 33 units of Bgl II in 50 μl of reaction solution and subjected to 1% agarose gel electrophoresis in TAE buffer. The DNA in the gel was depurinated by a single 10-minute wash in 0.25 N HCl, denatured by two washes in 0.5 N NaOH-1.5 M NaCl, neutralized by a single 30-minute wash in 1 M TrispH 8-1.5 M NaCl, and incubated at 20X SSC for 5 minutes. The DNA was then subjected to TURBOBLOTTER. TM The system (Whatman, Inc., Florham Park, NJ, USA) was transferred to the manufacturer's experimental protocol. Supercharge membrane (Whatman, Inc., Florham Park, NJ, USA). DNA was transferred using a STRATALINKER. TM UV crosslinker (Stratagene, La Jolla, CA, USA) was used to crosslink the membrane and pre-hybridized at 42°C for 1 hour in 20 ml of DIG Easy Hyb (Roche Diagnostics Corporation, Indianapolis, IN, USA).

[0461] Probes hybridizing to the flanking sequences of the 3'cbhI gene were generated using the Dig Probe Synthesis Kit (Roche Diagnostics Corporation, Indianapolis, IN, USA) according to the manufacturer's instructions with the forward and reverse primers shown below. PCR reactions were performed using 1X... Reaction Buffer, 400 nM primers each, 200 μM M DigIG-labeled dUTP-containing dNTPs, 20 ng pJfyS139, and 1.5 units of [unclear - possibly a specific ingredient or solution]. Hot Start High-Fidelity DNA Polymerase Composition. Amplification Reactants in The 5333epgradient S was incubated at room temperature as follows: one cycle at 95°C for 2 minutes; 25 cycles, each cycle at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 40 seconds; and one cycle at 72°C for 7 minutes.

[0462] Forward primer:

[0463] 5'-AAAAAACAAACATCCCGTTCATAAC-3'(SEQ ID NO:37)

[0464] Reverse primer:

[0465] 5'-AACAAGGTTTACCGGTTTCGAAAAG-3'(SEQ ID NO:38)

[0466] The probe was purified by 1% agarose gel electrophoresis using TAE buffer, where the 0.5 kb band corresponding to the probe was cut from the gel and used... Extraction was performed using a Gel Extraction Kit. The probe was boiled for 5 minutes, cooled on ice for 2 minutes, and added to 10 ml of DIG Easy Hyb to produce a hybridization solution. Hybridization was carried out at 42°C for 15 to 17 hours. The membrane was then washed for 5 minutes at room temperature in 2X SSC with 0.1% SDS under low-tightness conditions, followed by two 15-minute washes at 65°C in 0.5X SSC with 0.1% SDS. Probe-target hybridization was detected by chemiluminescence assay (Roche Diagnostics, Indianapolis, IN, USA) according to the manufacturer's instructions. Southern spectroscopy analysis indicated that 3 out of 7 transformants contained a replacement cassette at the cbhI locus, and one transformant, *Trichoderma reesei* JfyS139-8, was selected for calibration of hpt and tk markers.

[0467] Fresh plates containing spores were prepared by transferring spores from PDA plates grown at 28°C for 7 days to PDA plates and incubating them at 28°C for 7 days. The spores were then placed in 10 ml of 0.01%... Spores were collected using a sterilized applicator at a concentration of 20 μL. The spore concentration was determined using a hemocytometer, and 10 μL was used to collect the spores. 5 One spore was spread on a 150 mm plate of TrMM-G medium supplemented with 1 μM 5-fluoro-2'-deoxyuridine (FdU).

[0468] Three hundred FdU-resistant spore isolates were obtained, and DNA was extracted from two of these isolates. Southern analysis of the isolates, as described above, was performed, and the results indicated that the hpt / tk region between the substitution and homologous repeats was excised from both spore isolates. A strain named *Trichoderma reesei* JfyS139-8A was selected to replace the cbhII gene.

[0469] Example 4: Construction of the Trichoderma oolongii cbhII substitute construct pJfyS142

[0470] To generate a construct to replace the *Trichoderma reesei* cbhII gene (SEQ ID NO:19 [DNA sequence] and SEQ ID NO:20 [derived amino acid sequence]) with the *Aspergillus fumigatus* cbhII coding sequence (SEQ ID NO:3 [DNA sequence] and SEQ ID NO:4 [derived amino acid sequence]), the *Trichoderma reesei* cbhII promoter was first amplified from the *Trichoderma reesei* RutC30 genomic DNA using the gene-specific forward and reverse primers shown below. The *Trichoderma reesei* RutC30 genomic DNA was prepared according to the steps described in Example 1.

[0471] Forward primer:

[0472] 5'-acgaattgtttaaacgtcgacCCAAGTATCCAGAGGTGTATGGAAATATCAGAT-3'(SEQ IDNO:39)

[0473] Reverse primer:

[0474] 5'-cgcgtagatctgcggccatGGTGCAATACACAGAGGGTGATCTT-3'(SEQ ID NO:40)

[0475] The amplification reaction consisted of 20 ng of Trichoderma reesei RutC30 genomic DNA, 200 μM dNTPs, 0.4 μM primers, and 1X... Reaction Buffer, and 1.875 units The hot-start high-fidelity DNA polymerase formulation has a final volume of 50 μl. The amplification reaction mixture is... The incubation was performed at medium temperature as follows: one cycle at 95°C for 2 minutes; 25 cycles, each cycle consisting of 30 seconds at 95°C, 30 seconds at 55°C, and 1 minute 30 seconds at 72°C; and one cycle at 72°C for 7 minutes. PCR products were separated by 1% agarose gel electrophoresis using TAE buffer, with the 1.6 kb fragment excised from the gel and used... Extraction using a Gel Extraction Kit.

[0476] Use 1.6kb PCR product The Advantage PCR Cloning Kit was inserted with Nco I / Sal I-digested pSMai155 (WO 05 / 074647) according to the manufacturer's experimental protocol. The reaction is caused by 1X Reaction Buffer, 125 ng of Nco I / Sal I-digested pSMai155, 100 ng of the 1.6 kb PCR product, and 1 μl of... The enzyme composition was prepared in a 10 μl reaction volume. The reaction was incubated at 37°C for 15 minutes and then at 50°C for 15 minutes. After the incubation period, 40 μl of TE was added to the reaction. Two μl aliquots were used to convert ONE according to the manufacturer's experimental protocol. TOP10 competent cells. Cells were heat-shocked at 42°C for 30 seconds and 250 μl of SOC medium was added. The tubes were incubated at 37°C and 200 rpm for 1 hour, and 250 μl of the culture was plated on 150 mm diameter 2XYT plus ampicillin plates and incubated overnight at 37°C. The resulting transformants were screened by restriction digestion with Pci I and forward clones were sequenced to ensure the absence of PCR errors. A clone containing an insert without PCR errors was identified and named pJfyS142-A. Plasmid pJfyS142-A was used to insert into the *Trichoderma reesei* cbhII terminator.

[0477] The cbhII was amplified from the Trichoderma reesei RutC30 genomic DNA using the gene-specific forward and reverse primers shown below. Italicized regions represent... The vector is homologous to the insertion site of the reaction.

[0478] Forward primer:

[0479] 5'-atctacgcgtactagttaattaaGGCTTTCGTGACCGGGCTTCAAACA-3'(SEQ IDNO:41)

[0480] Reverse primer:

[0481] 5'-gcggccgttactagtggatccACTCGGAGTTGTTATACGCTACTCG-3'(SEQ IDNO:42)

[0482] The amplification reaction consisted of 150 ng of Trichoderma reesei RutC30 genomic DNA, 200 μM dNTPs, 0.4 μM primers, and 1X... Reaction Buffer, and 1.875 units The hot-start high-fidelity DNA polymerase formulation has a final volume of 50 μl. The amplification reaction mixture is... The incubation was performed at medium temperature as follows: one cycle at 95°C for 2 minutes; 25 cycles, each cycle consisting of 30 seconds at 95°C, 30 seconds at 54°C, and 50 seconds at 72°C; and one cycle at 72°C for 7 minutes. The PCR products were separated by 1% agarose gel electrophoresis with TAE buffer, where a 0.3 kb fragment was excised from the gel and... Extraction using a Gel Extraction Kit.

[0483] The 0.3kb PCR product was used The Advantage PCR Cloning Kit was inserted with Pac I / Bam HI-digested pJfyS142-A according to the manufacturer's experimental protocol. The reaction is caused by 1X Reaction Buffer, 150 ng of PacI / BamHI-digested pJfyS142-A, 50 ng of the 0.3 kb PCR product, and 1 μl of... The enzyme composition was prepared in a 10 μl reaction volume. The reaction was incubated at 37°C for 15 minutes and then at 50°C for 15 minutes. After the incubation period, 40 μl of TE was added to the reaction. Two μl aliquots were used to convert ONE according to the manufacturer's experimental protocol. TOP10 competent cells. Cells were heat-shocked at 42°C for 30 seconds and then 250 μl of SOC medium was added. The tubes were incubated at 37°C and 200 rpm for 1 hour, and 250 μl of the medium was plated onto 150 mm diameter 2XYT plus ampicillin plates and incubated overnight at 37°C. Transformants were screened by sequence analysis to identify positive clones and ensure the absence of PCR errors. A clone containing an insert without PCR errors was identified and named pJfyS142-B. Plasmid pJfyS142-B was used for insertion into the herpes simplex tk gene.

[0484] The herpes simplex virus tk gene was released from pJfyS1579-8-6 (WO 2010 / 039840) by digestion of the plasmid with Bgl II and BamHI. The digest was subjected to 1% agarose gel electrophoresis with TAE buffer, and a 2.3 kb band was excised from the gel and used for... Extract using a Gel Extraction Kit. Use the QUICKLIGATION QUICKLIGATION QK box. TM Kit inserts BamHI-digested, dephosphorylated calf intestinal phosphatase pJfyS142-B according to the manufacturer's experimental protocol. The ligation reaction consists of 50 ng of the BamHI-digested, dephosphorylated calf intestinal phosphatase pJfyS142-B, 50 ng of the 2.3 kb tk gene insert, and 1X QUICK LIGATION. TM Buffer, and 5 units of quick liquid TM The composition, with a binding volume of 20 μl, involves incubating the reactants at room temperature for 5 minutes and then using 2 μl of the reactants to convert ONE according to the manufacturer's experimental protocol. TOP10 competent cells. Cells were heat-shocked at 42°C for 30 seconds and then 250 μl of SOC medium was added. The tubes were incubated at 37°C and 200 rpm for 1 hour, and 250 μl of the culture was plated on 150 mm diameter 2XYTplus ampicillin plates and incubated overnight at 37°C. The resulting transformants were screened by restriction digestion with Xma I and Bam HI to determine the presence and orientation of the insert, and clones containing the insert were identified and named pJfyS142-C. Plasmid pJfyS142-C was used to insert into the flanking sequence of the 3'cbhII gene in *Trichoderma reesei*.

[0485] The 3'cbhII gene flanking sequence was amplified from the genomic DNA of *Trichoderma reesei* RutC30 using the forward and reverse primers shown below. Italicized regions represent... The vector is homologous to the insertion site of the reaction.

[0486] Forward primer:

[0487] 5'-atccatcacactggcggccgcGCTTCAAACAATGATGTGCGATGGT-3'(SEQ IDNO:43)

[0488] Reverse primer:

[0489] 5'-gatgcatgctcgagcggccgcCTACCTTGGCAGCCCTACGAGAGAG-3'(SEQ IDNO:44)

[0490] The amplification reaction consisted of 150 ng of Trichoderma reesei RutC30 genomic DNA, 200 μM dNTPs, 0.4 μM primers, and 1X... Reaction Buffer, and 1.875 units The hot-start high-fidelity DNA polymerase formulation has a final volume of 50 μl. The amplification reaction mixture is... The incubation was performed at medium temperature as follows: one cycle at 95°C for 2 minutes; 30 cycles, each consisting of 30 seconds at 95°C, 30 seconds at 56°C, and 1 minute 50 seconds at 72°C; and one cycle at 72°C for 7 minutes. The PCR reaction was then subjected to 1% agarose gel electrophoresis using TAE buffer, from which the 1.5 kb band was excised from the gel and... Extracted using a gel extraction kit. The flanking sequence of the 3'cbhII gene was then extracted using... The Advantage PCR Cloning Kit was inserted with Not I-linearized pJfyS142-C according to the manufacturer's experimental protocol. The reaction is caused by 1X Reaction Buffer, 150 ng of pJfyS142-C, 80 ng of the 1.5 kb PCR product, and 1 μl of... The enzyme composition was prepared in a 10 μl reaction volume. The reaction was incubated at 37°C for 15 minutes and then at 50°C for 15 minutes. After the incubation period, 40 μl of TE was added to the reaction. Two μl aliquots were used to convert ONE according to the manufacturer's experimental protocol. TOP10 competent cells. Cells were heat-shocked at 42°C for 30 seconds and 250 μl of SOC medium was added. The tubes were incubated at 37°C and 200 rpm for 1 hour, and 250 μl of the culture was plated on 150 mm diameter 2XYT plus ampicillin plates and incubated overnight at 37°C. The resulting transformants were screened by restriction digestion with Bgl II, and positive clones were sequenced to ensure the absence of PCR errors. A clone containing an insert without PCR errors was identified and named pJfyS142. Figure 2 The plasmid pJfyS142 was inserted into the coding sequence of Aspergillus fumigatus cbhII.

[0491] Example 5: Construction of the Trichoderma reesei cbhII-Aspergillus fumigatus cbhII substitute construct pJfyS144

[0492] The Aspergillus fumigatus cbhII coding sequence (SEQ ID NO:3 [DNA sequence] and SEQ ID NO:4 [derived amino acid sequence]) was amplified from pAlLo33 (WO 2011 / 057140) using the forward and reverse primers shown below. Italicized regions represent... The vector is homologous to the insertion site of the reaction.

[0493] Forward primer:

[0494] 5'-ctctgtgtattgcaccATGAAGCACCTTGCATCTTCCATCG-3'(SEQ ID NO:45)

[0495] Reverse primer:

[0496] 5'-ccggtcacgaaagccTTAATTAAAAGGACGGGTTAGCGTT-3'(SEQ ID NO:46)

[0497] The amplification reaction consisted of 20 ng of pAlLo33, 200 μM of dNTPs, 0.4 μM of primers, and 1 mM of... Reaction Buffer, and 1.875 units The hot-start high-fidelity DNA polymerase formulation has a final volume of 50 μl. The amplification reaction mixture is... The medium-temperature incubation procedure is as follows: one cycle at 95°C for 2 minutes; 30 cycles, each cycle at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 2 minutes; and one cycle at 72°C for 7 minutes.

[0498] The PCR reaction was subjected to 1% agarose gel electrophoresis with TAE buffer, and the 1.7kb band was excised from the gel and used... Extraction was performed using a Gel Extraction Kit. The 1.7kb PCR product was then processed using... The Advantage PCR Cloning Kit was inserted into Nco I / Pac I-digested pJfyS142 according to the manufacturer's experimental protocol (Example 4). The reaction is caused by 1X Reaction Buffer, 120 ng of Nco I / Pac I-digested pJfyS142, 70 ng of the 1.7 kb PCR product, and 1 μl of... The enzyme composition was prepared in a 10 μl reaction volume. The reaction was incubated at 37°C for 15 minutes and then at 50°C for 15 minutes. After the incubation period, 40 μl of TE was added to the reaction. Two μl aliquots were used to convert ONE according to the manufacturer's experimental protocol. TOP10 competent cells. Cells were heat-shocked at 42°C for 30 seconds and then 250 μl of SOC medium was added. The tubes were incubated at 37°C and 200 rpm for 1 hour, and 250 μl of the solution was plated on 150 mm diameter 2XYT plus ampicillin plates and incubated overnight at 37°C. The resulting transformants were sequenced to ensure the absence of PCR errors and to identify the presence of inserts. A clone with an error-free sequence was identified and named pJfyS144. Figure 3 The plasmid pJfyS144 was used to replace the natural cbhII gene with a cbhII coding sequence from Aspergillus fumigatus.

[0499] Example 6: Replacing the natural Trichoderma reesei cbhII gene with the Aspergillus fumigatus cbhII coding sequence.

[0500] To replace the native *Trichoderma reesei* cbhII gene (SEQ ID NO:19 [DNA sequence] and SEQ ID NO:20 [derived amino acid sequence]) with the *Aspergillus fumigatus* cbhII coding sequence (SEQ ID NO:3 [DNA sequence] and SEQ ID NO:4 [dated amino acid sequence]), *Trichoderma reesei* JfyS139-8A (Example 3) was transformed with 2 μg of PmeI-linearized and gel-purified pJfyS144 (Example 5) according to the steps described in Example 2. Seven transformants were obtained, each of which was picked and transferred to a PDA plate and incubated at 28°C for 7 days. Transformants carrying the gene substitution were screened using the fungal spore PCR method described below, which used a forward primer annealed to the region upstream of the 5' cbhII gene flanking sequence beyond the integration region, and a reverse primer annealed to the *Aspergillus fumigatus* cbhII coding sequence, as shown below.

[0501] Forward primer:

[0502] 5'-AGCCACATGCCGCATATTGACAAAG-3'(SEQ ID NO:47)

[0503] Reverse primer:

[0504] 5'-AGGGATTCAGTGTGCTACAGGCTGC-3'(SEQ ID NO:48)

[0505] A 1.8kb PCR product is generated only when the exact gene substitution occurs at the cbhII locus. If the cassette integrates elsewhere in the genome, it will not lead to amplification.

[0506] A small amount of spores from each transformant was suspended in 25 μl of TE buffer and microwaved on "high" for 1 minute. Each microwaved spore suspension was used as a template in the PCR reaction. The reaction consisted of 1 μl of the microwaved spore suspension, 1 μl of 10 mM dNTPs, and 12.5 μl of 2X buffer. GC-Melt LA buffer (Clontech, Mountain View, CA, USA), 25 pmol forward primer, 25 pmol reverse primer, 1.25 units It consists of GC Genome LA Polymerase Mix (Clontech, Mountain View, CA, USA) and 9.25 μl of water. The reaction is carried out in... The 5333epgradientS was incubated in the following sequence: one cycle at 95°C for 10 minutes; 35 cycles, each cycle consisting of 30 seconds at 95°C, 30 seconds at 56°C, and 1 minute 40 seconds at 72°C; one cycle at 72°C for 7 minutes; and maintenance at 4°C. The PCR reactions were subjected to 1% agarose gel electrophoresis using TAE buffer. Spore PCR indicated that four of the seven transformants contained the substituted cassette at the targeted locus, and Southern blotting analysis was performed on three of them to confirm that the substituted cassette was a single copy.

[0507] Genomic DNA was isolated from three transformants according to the steps described in Example 1, and each transformant was subjected to Southern blotting analysis. For Southern blotting analysis, 2 μg of genomic DNA was digested with 50 units of Dra I in a 50 μl reaction volume and subjected to 1% agarose gel electrophoresis in TAE buffer. The DNA in the gel was depurinated by washing once in 0.25 N HCl for 10 min, denatured by washing twice in 0.5 N NaOH-1.5 M NaCl, neutralized by washing once in 1 M TrispH 8-1.5 M NaCl for 30 min, and incubated in 20X SSC for 5 min. The DNA was then transferred to Supercharge membrane. DNA is used with STRATALINKER. TM UV Crosslinker UV crosslinked to the membrane and pre-hybridized at 42°C in 20 ml of DIG Easy Hyb for 1 hour.

[0508] Probes hybridizing to the flanking sequences of the 3'cbhII gene were generated using the Dig Probe Synthesis Kit according to the manufacturer's instructions with the forward and reverse primers shown below. The PCR reaction was performed using 1X... Reaction Buffer, 400 nM primers each, 200 μM DIG-labeled dNTPs containing dUTP-, 150 ng Trichoderma reesei RutC30 genomic DNA, and 1.5 units of... Hot Start High-Fidelity DNA Polymerase. Amplification reaction products in The 5333epgradient S was incubated at room temperature as follows: one cycle at 95°C for 2 minutes; 30 cycles, each cycle at 95°C for 30 seconds, 51°C for 30 seconds, and 72°C for 40 seconds; and one cycle at 72°C for 7 minutes.

[0509] Forward primer:

[0510] 5'-AAAAAACAAACATCCCGTTCATAAC-3'(SEQ ID NO:49)

[0511] Reverse primer:

[0512] 5'-AACAAGGTTTACCGGTTTCGAAAAG-3'(SEQ ID NO:50)

[0513] The probe was purified by 1% agarose gel electrophoresis using TAE buffer, where the 0.5 kb band corresponding to the probe was cut from the gel and used... Extraction was performed using a Gel Extraction Kit. The probe was boiled for 5 minutes, cooled on ice for 2 minutes, and added to 10 ml of DIG Easy Hyb to produce a hybridization solution. Hybridization was carried out at 42 °C for approximately 17 hours. The membrane was then washed for 5 minutes at room temperature in 2X SSC with 0.1% SDS under low-tightness conditions, followed by two 15-minute washes at 65 °C in 0.5X SSC with 0.1% SDS. Probe-target hybridization was detected by chemiluminescence assay (Roche Diagnostics, Indianapolis, IN, USA) according to the manufacturer's instructions. Southern spectroscopy analysis indicated that the three transformants contained the substituted cassette at the cbhII locus, and all three (named JfyS139 / 144-5, -6, and -10) were selected for correction of the hpt and tk markers.

[0514] Fresh plates from which spores have been generated are transferred from PDA plates grown at 28°C for 7 days to fresh PDA plates and incubated at 28°C for 7 days. The spores are then placed in 10 ml of 0.01%... Spores were collected using a sterilized applicator at a concentration of 20 μL. The spore concentration was determined using a hemocytometer, and 10 μL was used to collect the spores. 5 and 10 4 One spore was spread onto a 150 mm plate containing TrMM-G medium supplemented with 1 μM FdU.

[0515] From containing 10 5 Plates containing 10 spores yielded approximately 500 FdU-resistant spore isolates per transformant, compared to plates containing 10 spores. 4A plate of 1 spores yielded approximately 100 FdU-resistant spore isolates for each transformant. Eight spore isolates were picked for strains JfyS139 / 144-5 and -6, and four for strain JfyS139 / 144-10. Isolates 1 through 8 from primary transformant 5 were named JfyS139 / 144-5A through -5H. Isolates 1 through 8 from primary transformant 6 were named JfyS139 / 144-6A through -5H. For isolates 1 through 4, isolates from primary transformant 6 were named JfyS139 / 144-10A through 10D. Spore PCR was performed as described above, using the forward and reverse primers shown below to confirm that the hpt and tk markers were correctly excised.

[0516] Forward primer:

[0517] 5'-GTTAAGCATACAATTGAACGAGAATGG-3'(SEQ ID NO:51)

[0518] Reverse primer:

[0519] 5'-GATGATATAATGGAGCAAATAAGGG-3'(SEQ ID NO:52)

[0520] The PCR reaction was performed as described above with the following cycling parameters: 1 cycle at 95°C for 2 minutes; 30 cycles, each cycle consisting of 30 seconds at 95°C, 30 seconds at 55°C, and 6 minutes at 72°C; and 1 cycle at 72°C for 7 minutes.

[0521] cbhII gene substitution was performed using primers annealed to the 5' (forward) and 3' (reverse) flanking sequences. Strains that correctly excised the htp / tk cassette showed a 3.5 kb fragment, while those with intact markers showed an 8 kb fragment. PCR screening indicated that all spore isolates had correctly excised the htp / tk cassette.

[0522] For each primary transformant, DNA was extracted from spore isolates A and B and subjected to Southern blotting analysis as described above. Southern blotting confirmed that the htp / tk cassette was correctly excised from each spore isolate. The selected spore isolate *Trichoderma reesei* JfyS139 / 144-10B represents a strain containing both *Trichoderma reesei* cbhI and cbhII genes replaced by corresponding homologs from *Aspergillus fumigatus*.

[0523] Example 7: Generation of Trichoderma reesei ku70 gene repair plasmid pTH239

[0524] Use four DNA fragments The Advantage PCR Cloning Kit was used to generate a construct in which the disrupted *Trichoderma reesei* ku70 coding sequence was replaced with the natural *Trichoderma reesei* ku70 coding sequence (SEQ ID NO:53 [DNA sequence] and SEQ ID NO:54 [dextended amino acid sequence]). An ampicillin resistance marker region containing the prokaryotic origin of replication was amplified from pJfyS139-B (Example 4) using the sequence-specific forward and reverse primers shown below (SEQ ID NO:55 and 56). The upstream sequence of the *Trichoderma reesei* ku70 gene (consisting of 989 bp upstream of the ku70 coding sequence and the first 1010 bp of the ku70 coding sequence) was amplified from *Trichoderma reesei* 981-O-8 genomic DNA using the sequence-specific forward and reverse primers shown below (SEQ ID NO:57 and 58). The downstream sequence of the *Trichoderma reesei* ku70 gene (consisting of a 500 bp segment with a 3' repeat of a 1010 bp segment of the ku70 coding sequence amplified from the upstream PCR product, a 1067 bp segment containing the remaining ku70 coding sequence, and a 461 bp segment downstream of the ku70 coding sequence) was amplified from the *Trichoderma reesei* 981-O-8 genomic DNA using the sequence-specific forward and reverse primers shown below (SEQ ID NO: 59 and 60). The *Trichoderma reesei* 981-O-8 genomic DNA was prepared according to the steps described in Example 1.

[0525] Forward primer:

[0526] 5'-GTGTGCGGCCGCTCGAGCATGCATGTTTAAACAGCTTGGCACTGGCCGTCGTTTT-3'(SEQ IDNO:55)

[0527] Reverse primer:

[0528] 5'-ATCAGCCCCGAGACGGCGCCGCGTTTAAACAATTCGTAATCATGGTCATAGCTGT-3'(SEQ IDNO:56)

[0529] Forward primer:

[0530] 5'-CATGATTACGAATTGTTTAAACGCGGCGCCGTCTCGGGGCTGATCTTGTCGAGGA-3'(SEQ IDNO:57)

[0531] Reverse primer:

[0532] 5'-GGCGGCCGTTACTAGTGGATCCAGCCCTTGACAGTGATCTTGAGTCCAGGTGCAA-3'(SEQ IDNO:58)

[0533] Forward primer:

[0534] 5'-TGCAGATATCCATCACACTGGCGGCCGCAGTTTCCATGTCCAACGTGTTGTTTTGCGC-3'(SEQID NO:59)

[0535] Reverse primer:

[0536] 5'-GCCAGTGCCAAGCTGTTTAAACATGCATGCTCGAGCGGCCGCACACGCCCTCTCCTCG-3'(SEQID NO:60)

[0537] To amplify ampicillin resistance markers and the prokaryotic origin of replication region, the reaction consisted of 100 ng of Trichoderma reesei 981-O-8 genomic DNA, 200 μM dNTPs, 1 μM of each primer (SEQ ID NO: 55 and 56), and 1X High-Fidelity Hot Start DNA Polymerase Buffer (New England Biolabs, Inc., Ipswich, MA, USA), and 1.0 unit of High-Fidelity Hot Start DNA Polymerase (New England Biolabs, Inc., Ipswich, MA, USA) was used, with a final volume of 50 μl. The amplification reaction mixture was... The PCR products were incubated in 5333epgradient S at the following temperature: one cycle at 98°C for 30 seconds; 30 cycles, each cycle consisting of 10 seconds at 98°C, 30 seconds at 55°C, and 1 minute 30 seconds at 72°C; and one cycle at 72°C for 7 minutes. The PCR products were separated by 1% agarose gel electrophoresis using TAE buffer, with the 2.692 kb fragment excised from the gel and used... Extraction using a Gel Extraction Kit.

[0538] To amplify the upstream or downstream sequence of the ku70 gene, the reaction consists of 100 ng of pJfyS139-B, 200 μM dNTPs, 1 μM of each primer (SEQ ID NO: 57 and 58, or 59 and 60, respectively), and 1X High-Fidelity Hot Start DNA Polymerase Buffer, and 1.0unit of The high-fidelity hot-start DNA polymerase was used to construct a final volume of 50 μl. The amplification reaction was carried out in... The 5333epgradient S was incubated at the following temperature: one cycle at 98°C for 30 seconds; 30 cycles, each cycle consisting of 10 seconds at 98°C, 30 seconds at 55°C, and 1 minute 30 seconds at 72°C; and one cycle at 72°C for 7 minutes. PCR products were separated by 1% agarose gel electrophoresis in TAE buffer, with the 1.999kb and 2.028kb fragments excised from the gel and used... Extraction using Gel Extraction Kit.

[0539] The fourth DNA fragment was generated by digestion of pJfyS139-B with restriction enzymes using Not I and Bam HI. The reaction consisted of 5 μg of pJfyS139-B, 10 units of Not I, 20 units of Bam HI, and 20 μl of Restriction Enzyme Buffer 2 (New England Biolabs, Inc., Ipswich, MA, USA), for a total volume of 50 μl. The reaction was incubated at 37°C for 1 hour, and then separated by 1% agarose gel electrophoresis using TAE buffer. The 4.400 kb fragment was excised from the gel and used... Extraction using a Gel Extraction Kit.

[0540] Three PCR products of 2,028 bp, 1,999 bp, and 2,692 bp were used... The AdvantagePCR Cloning Kit inserts Not I and Bam HI-digested pJfyS139-B according to the manufacturer's experimental protocol. The reaction is caused by 1X Reaction Buffer, 50 ng of Not I / Bam HI-digested pJfyS139-B, 50 ng of 1.999 kb upstream PCR product of the ku70 gene, 50 ng of 2.028 kb downstream PCR product of the ku70 gene, 50 ng of 2.692 kb ampicillin resistance marker and prokaryotic origin of replication PCR product, and 1 μl of The enzyme composition was prepared in a 10 μl reaction volume. The reaction was incubated at 37°C for 15 minutes, followed by incubation at 50°C for 15 minutes. After the incubation period, 40 μl of TE was added to the reaction. 3 μl aliquots of the sample were used to transform *E. coli* XL10 according to the manufacturer's experimental protocol. Competent cells (Stratagene, La Jolla, CA, USA). Cells were heat-shocked at 42°C for 30 seconds, followed by the addition of 500 μl of NZY+ medium preheated to 42°C. The tubes were incubated at 37°C with shaking at 200 rpm for 40 minutes, then plated on 150 mm diameter 2XYT plus ampicillin plates and incubated overnight at 37°C. Transformants were screened by restriction digestion with Hind III and Xba I, and forward clones were sequenced to ensure the absence of PCR errors. A clone containing an insert without PCR errors was identified and named pTH239.

[0541] Example 8: Repair of the ku70 gene replacement strain JfyS139 / 144-10B in Aspergillus fumigatus cbh1 and cbh2

[0542] The natural *Trichoderma reesei* ku70 gene was repaired in strain *Trichoderma reesei* JfyS139 / 144-10B (Example 6) to assist strain manipulation, requiring the function of the ku70 gene in non-homologous end ligation. *Trichoderma reesei* JfyS129 / 144-10B was transformed with 23 x 2 μg of Pme I-linearized pTH239 (Example 7) according to the steps described in Example 2. Nineteen transformants were obtained, each transferred to a PDA plate and incubated at 28°C for 7 days.

[0543] All nineteen transformants were screened by PCR to confirm homologous integration of the pTH239Pme I fragment into the disrupted ku70 gene locus. For each transformant, spores were collected from 7-day-old PDA plates using a sterile inoculation loop. Spores were transferred to tubes containing 25 μl of 1 mM EDTA-10 mM Tris buffer and microwaved on “high” for 1 minute. A 1 μl aliquot of the microwaved spore mixture was added directly to the PCR reaction as template DNA. A set of PCR primers, as shown below, was designed to amplify the disrupted region of the entire ku70 coding sequence to distinguish between the host genome with disruption in the ku70 coding sequence (848 bp) and the pTH239-targeted strain of interest (606 bp). The PCR reaction was performed using 1X... Genome LA Polymerase Reaction Buffer (Clontech, Mountain View, CA, USA), 400 nM primers, 200 μM dNTPs, 1 μl of microwave-treated TE-spore mixture (as described above), and 1.0 unit of The genome is composed of LA Polymerase (Clontech, Mountain View, CA, USA). The amplification reaction products are... The 5333epgradient S was incubated at room temperature as follows: one cycle at 95°C for 10 minutes; 30 cycles, each cycle at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 60 seconds; and one cycle at 72°C for 7 minutes.

[0544] Forward primer:

[0545] 5'-CAATGACGATCCCGCACGCGT-3'(SEQ ID NO:61)

[0546] Reverse primer:

[0547] 5'-CAATGACGATCCCGCACGCGT-3'(SEQ ID NO:62)

[0548] Only one of the nineteen transformants (#19) was positive for the 606bp PCR product and negative for the 848bp PCR product, indicating a strain containing the pTH239PmeI fragment homologously integrated at the ku70 locus.

[0549] Spores from 7-day-old PDA plates of transformant #19 were placed in 10 ml of 0.01%... Collected using a sterilized applicator at a concentration of 20. Spore concentration was confirmed using a hemocytometer, and 10 were... 6 One spore was plated on 150 mm plates of TrMM-G medium supplemented with 1 μM 5-fluoro-2'-deoxyuridine (FdU) and incubated at 28°C for 5 days. Twenty-two FdU-resistant spore isolates were obtained and transformed into PDA plates, which were then incubated at 28°C for 5 days.

[0550] All twenty-two spore isolates (#19A-V) were screened by PCR for excision of the hpt / tk marker region between homologous repeats of the ku70 coding sequence within the repair cassette. For each spore isolate, spores were collected from 7-day-old PDA plates using a sterile inoculation loop. Spores were transferred to tubes containing 25 μl of 1 mM EDTA-10 mM Tris buffer and microwaved on “high” for 1 minute. A 1 μl aliquot of the spore mixture was added directly to the PCR reaction as template genomic DNA. A set of PCR primers shown below was used to amplify the entire hpt / tk region to distinguish between the presence (6 kb) or absence (1.1 kb) of the hpt / tk region. The PCR reaction was performed using 1X... Genome LA Polymerase Reaction Buffer, 400 nM primers (see below), 200 μM dNTPs, 1 μl of microwave-treated TE-spore mixture (as described above), and 1.0 unit of... Genomic LAPolymerase composition. Amplification reactants in The 5333epgradient S was incubated at room temperature as follows: one cycle at 95°C for 10 minutes; 30 cycles, each cycle at 95°C for 30 seconds, 50°C for 30 seconds, and 72°C for 6 minutes; and one cycle at 72°C for 7 minutes.

[0551] Forward primer:

[0552] 5'-GACACTCTTTTCTCCCATCT-3'(SEQ ID NO:63)

[0553] Reverse primer:

[0554] 5'-GAGGAGCAGAAGAAGCTCCG-3'(SEQ ID NO:64)

[0555] All twenty-two spore isolates were negative for the 6kb PCR product corresponding to the hpt / tk marker region.

[0556] Spores from 7-day-old PDA plates of isolates #19A and #19L were spread on 10 ml of 0.01% PDA plate using a sterile spreader. Collected from 20 samples. Spore concentration was determined using a hemocytometer, and 10 were... 3 10 2 , and 10 1One spore was spread on a 150 mm PDA plate containing 1 M sucrose and incubated at 28°C for 3 days. For strains #19A and #19L, ten spore isolates were selected from the PDA plate and transferred to fresh PDA plates and incubated at 28°C.

[0557] Genomic DNA was extracted from six spore isolates of both #19L and #19A according to the steps described in the examples, and Southern blotting was performed on them.

[0558] For Southern blotting analysis, 2 μg of genomic DNA was digested in a 50 μl reaction volume with the following methods: (1) 5 and 10 units of Asc I and Xho I, respectively, or (2) 5 and 25 units of Asc I and Apa I, respectively, and subjected to 1% agarose gel electrophoresis with TAE buffer. The DNA in the gel was depurinated by a single 10-minute wash in 0.25 N HCl, denatured by two washes in 0.5 N NaOH-1.5 M NaCl, neutralized by a single 30-minute wash in 1 M Tris pH 8-1.5 M NaCl, and incubated in 20X SSC for 5 minutes. The DNA was then transferred to the TURBOBLOTTER™ System according to the manufacturer's experimental protocol. Supercharge membrane. DNA was crosslinked to the membrane using STRATALINKER™ UV Crosslinker UV and pre-hybridized at 42°C in 20 ml of DIG Easy Hyb for 1 hour.

[0559] Probes hybridizing to the 3' end of the ku70 coding sequence were generated using a PCR Dig Probe Synthesis Kit (Roche Diagnostics Corporation, Indianapolis, IN, USA) according to the manufacturer's instructions with the forward and reverse primers shown below. To generate pure slabs for probe PCR reactions, the 3' end of the ku70 coding sequence was amplified from the genomic DNA of *Trichoderma reesei* 981-O-8. The PCR reaction was performed using 1X... High-Fidelity Hot Start DNA Polymerase Buffer, 1 μM primers, 200 μM dNTPs, 165 ng Trichoderma reesei 981-O-8 genomic DNA, and 1.0 unit of... High-Fidelity Hot Start DNA Polymerase is composed of [a specific component]. The amplification reaction [is / is / etc.]. The 5333epgradient S was incubated at room temperature as follows: one cycle at 98°C for 30 seconds; 35 cycles, each cycle at 98°C for 10 seconds, 60°C for 30 seconds, and 72°C for 15 seconds; and one cycle at 72°C for 10 minutes.

[0560] Forward primer:

[0561] 5'-GCATATATAACCCACTCAAGTA-3'(SEQ ID NO:65)

[0562] Reverse primer:

[0563] 5'-ATTATCTTGGACCGGCCGCAGG-3'(SEQ ID NO:66)

[0564] The 0.5 kb probe board was purified by electrophoresis on a 1% agarose gel in TAE buffer and cut from the gel, and then... Extraction was performed using a gel extraction kit. The purified PCR product was used to generate a DIG-labeled probe using the primers and amplification conditions indicated above, as per the manufacturer's instructions. The 0.5 kb DIG-labeled probe was purified by 1% agarose gel electrophoresis with TAE buffer and excised from the gel. Extraction was performed using a GelExtraction Kit. The probe was boiled for 5 minutes, cooled on ice for 2 minutes, and added to 10 ml of DIG Easy Hyb to produce a hybridization solution. Hybridization was carried out at 42°C for 15 to 17 hours. The membrane was then washed for 5 minutes at room temperature in 2X SSC with 0.1% SDS under low-tightness conditions, followed by two 15-minute washes at 65°C in 0.5X SSC with 0.1% SDS. Probe-target hybridization was detected by chemiluminescence assay (Roche Diagnostics, Indianapolis, IN, USA) according to the manufacturer's instructions. Southern spectroscopy analysis indicated that all spore isolates contained a repair / replacement cassette at the ku70 locus and corrected for hpt and tk markers. A strain named *Trichoderma reesei* 981-O-8.5#10B+Ku70#19L3 was selected for further transformation.

[0565] Example 9: Construction of pDM286 expressing Penicillium GH61A polypeptide

[0566] The polypeptide coding sequence of *Penicillium emersonii* GH61A (SEQ ID NO:7 [DNA sequence] and SEQ ID NO:8 [dextended amino acid sequence]) was amplified from plasmid pGH61D23Y4 (WO2011 / 041397) using the gene-specific forward and reverse primers shown below. Italicized regions represent... The vector is homologous to the insertion site of the reaction.

[0567] Forward primer:

[0568] 5'-CGGACTGCGCACCATGCTGTCTTCGACGACTCGCAC-3'(SEQ IDNO:67)

[0569] Reverse primer:

[0570] 5'-TCGCCACGGAGCTTATCGACTTCTTCTAGAACGTC-3'(SEQ ID NO:68)

[0571] The amplification reaction consisted of 30 ng of pGH61D23Y4 DNA, 50 pmol of each of the aforementioned primers, 1 μl of a 10 mM blend of dATP, dTTP, dGTP, and dCTP, 1X PHUSION™ High-Fidelity Hot Start DNA Polymerase Buffer, and 1 unit of PHUSION™ High-Fidelity Hot Start DNA Polymerase, for a final volume of 50 μl. The amplification reaction was carried out in… The PCR products were incubated in 5333epgradient S at the following incubation schedule: one cycle at 98°C for 30 seconds; 35 cycles at 98°C for 10 seconds, 60°C for 30 seconds, and 72°C for 30 seconds; and one cycle at 72°C for 10 minutes. The PCR products were separated by 1% agarose gel electrophoresis using TAE buffer, from which approximately 0.9 kb fragments were excised from the gel and... The GelExtraction Kit extracts according to the manufacturer's experimental protocol.

[0572] Plasmid pMJ09 (WO 2005 / 047499) was digested with Nco I and Pac I, separated by 1.0% agarose gel electrophoresis in 1 mM EDTA disodium salt-50 mM Tris base-50 mM borate (TBE) buffer, excised from the gel, and used... The Gel Extraction Kit extracts according to the manufacturer's experimental protocol.

[0573] The 0.9kb PCR product was processed using IN-FUSION. TM The Advantage PCR Cloning Kit inserts gel-purified, Nco I / Pac I-digested pMJ09 according to the manufacturer's experimental protocol. IN-FUSION TM The reaction is caused by 1X IN-FUSION TM Reaction Buffer, 180 ng of gel-purified, Nco I / Pac I-digested pMJ09, 108 ng of 0.9 kb PCR product, and 1 μl of in-fusion buffer. TM The enzyme composition was prepared, with a final reaction volume of 10 μl. The reaction was incubated at 37°C for 15 minutes and then at 50°C for 15 minutes. After the incubation period, 40 μl of TE was added to the reaction. ONE was converted using 2 μl aliquots according to the manufacturer's experimental protocol. TOP10 competent cells. E. coli transformation was plated on 2XYT ampicillin-treated plates. Transformants were screened by sequencing, and a clone containing an insert without PCR errors was identified and named pDM286. Figure 4 The plasmid pDM286 can be digested with Pme I to generate a fragment of approximately 5.4 kb for transformation with *Trichoderma reesei*. This 5.4 kb fragment contains an expression cassette consisting of the *Trichoderma reesei* Cel7A cellobiase I gene promoter, the *P. emersonii* GH61A polypeptide coding sequence, and the *Trichoderma reesei* Cel7A cellobiase I gene terminator. The 5.4 kb fragment also contains the *Aspergillus nidulans* acetamase (amdS) gene.

[0574] Example 10: Generation of a Trichoderma reesei expression vector encoding the Aspergillus fumigatus β-glucosidase (Cel3A) mutant gene

[0575] Variants of Aspergillus fumigatus family 3A β-glucosidase containing substituted G142S, Q183R, H266Q, and D703G were obtained through the use of The multi-site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) was used to construct the oligomers by localized mutagenesis of pEJG97 ​​(WO 2005 / 074647). A summary of the oligomers used for localized mutagenesis is shown in Table 1.

[0576] The resulting variant plasmid pDFng128-6 was used The plasmid was prepared using a 9600 (QIAGEN Inc., Valencia, CA, USA). The variant plasmid construct was sequenced using an Applied Biosystems 3130xl GeneticAnalyzer (Applied Biosystems, Foster City, CA, USA) to verify the changes.

[0577] Table 1

[0578]

[0579] Two synthetic oligonucleotide primers, shown below, were designed to PCR amplify the coding sequence of the Aspergillus fumigatus β-glucosidase mutant from plasmid pDFng128-6. IN-FUSION was used. TM The Cloning Kit directly clones the fragment into the expression vector pMJ09. Bold letters represent the coding sequence. The remaining sequence is homologous to the insertion site in pMJ09.

[0580] Forward primer:

[0581] 5'-CGGACTGCGCACCATGAGATTCGGTTGGCTCGA-3'(SEQ ID NO:73)

[0582] Reverse primer:

[0583] 5'-TCGCCACGGAGCTTACTAGTAGACACGGGGCAGAG-3'(SEQ ID NO:74)

[0584] Fifty picomol of each of the above primers was used in a PCR reaction, the reaction consisting of 50 ng of pDFng128-6 and 1X containing MgCl2. High Fidelity PCR Buffer (Roche Diagnostics Corporation, Indianapolis, IN, USA), 0.25 mM each of dATP, dTTP, dGTP, and dCTP, and 2.6 units of... The mixture was composed of High Fidelity Enzyme Mix (Roche Diagnostics Corporation, Indianapolis, IN, USA) with a final volume of 50 μl. Amplification was performed in... The reaction was performed in 5333epgradient S with the following procedure: 1 cycle at 94°C for 2 minutes; 30 cycles, each cycle consisting of 15 seconds at 94°C, 30 seconds at 65°C, and 1 minute at 68°C; and a final extension at 68°C for 7 minutes. The heating block was then immersed in a 4°C cycle. The reaction products were separated by 0.7% agarose gel electrophoresis in TBE buffer, where a band of approximately 3.1 kb was observed on the gel. PCR reactions were then performed using... The Gel Extraction Kit purifies the gel according to the manufacturer's instructions.

[0585] Plasmid pMJ09 was digested with Nco I and Pac I, separated by electrophoresis on a 1.0% agarose gel in TBE buffer, excised from the gel, and then... The Gel Extraction Kit extracts according to the manufacturer's instructions.

[0586] The 3.1kb gene fragment and the digested vector were used in IN-FUSION TM The Cloning Kits are connected together to obtain pDFng113-3( Figure 5 The transcription of the β-glucosidase mutant coding sequence is regulated by the *Trichoderma reesei* cbhI gene. The ligation reaction (20 μl) was performed using 1X IN-FUSION. TM Buffer, 1X BSA, 1μl IN-FUSION TM The reaction consisted of an enzyme (diluted 1:10), 200 ng of gel-purified NcoI / Pac I-digested pMJ09, and 172.2 ng of purified 3.1 kb PCR product. The reaction was incubated at 37°C for 15 minutes, followed by incubation at 50°C for 15 minutes. Two μl of the reaction was used to transform *E. coli* XL10. Gold Supercompetent cells (Stratagene, La Jolla, CA, USA). E. coli transformation was plated on 2XYT plates supplemented with ampicillin. E. coli transformants containing pDFng133-3 were prepared using 9600. The Aspergillus fumigatus β-glucosidase mutant insert in pDFng133 was confirmed by DNA sequencing.

[0587] Example 11: Construction of plasmid pSMai139

[0588] To construct pSMai139, the full-length coding region of the specific *Pythium spp.* endoglucanase V was amplified by PCR from pMJ05 (US 2004 / 0248258 A1) as a template using the primers shown below. The underlined portions represent the Sph I and Hind III sites introduced by the Car-F2 sense primer. The bold portions represent the Eco RI sites introduced by the Car-R2 antisense primer.

[0589] Car-F2 meaningful primer:

[0590] 5'-TAT AAGCTT AA GCATGC GTTCCTCCCCCCTC-3'(SEQ ID NO:75)

[0591] Car-R2 antisense primer:

[0592] 5'-CTGCAGAATTCTACAGGCACTGATGGTACCAG-3'(SEQ ID NO:76)

[0593] The amplification reaction (50 μl) consisted of 1X ThermoPol Reaction Buffer (New England Biolabs, Inc., Ipswich, MA USA), 0.3 mM dNTPs, 10 ng pMJ05 DNA, 0.3 μM Car-F2 sense primer, 0.3 μM Car-R2 antisense primer, and 2.5 units of [unspecified substance]. DNA polymerase (New England Biolabs, Inc., Ipswich, MA USA). The reaction will be carried out in... The sample was incubated in 5333epgradient S at the following procedure: 30 cycles, each cycle consisting of 30 seconds at 94°C, 30 seconds at 55°C, and 60 seconds at 72°C (with a final extension of 15 minutes). The reaction products were separated by 1.0% agarose gel electrophoresis using TAE buffer, with the 900bp product band cleaved from the gel and used... The gel extraction kit was used to purify the PCR fragment according to the manufacturer's instructions. The 900bp PCR fragment was then digested with Eco RI and Hind III, and administered according to the manufacturer's experimental protocol. PCR Purification Kit (QIAGEN Inc., Valencia, CA, USA).

[0594] Plasmid pMJ05 was digested with Eco RI and Hind III, separated by electrophoresis on a 0.7% agarose gel in TAE buffer, excised from the gel, and then... The Gel Extraction Kit extracts according to the manufacturer's instructions.

[0595] A 900bp PCR fragment digested with Eco RI and Hind III was ligated into pMJ05 digested with Eco RI and Hind III using T4 DNA ligase (Roche, Indianapolis, IN, USA). The ligation reaction consisted of 50 ng of pMJ05 digested with Eco RI and Hind III, 33 ng of a 0.9kb PCR fragment digested with Eco RI and Hind III, 1X Ligase Buffer (Roche, Indianapolis, IN, USA), and 2 units of T4 DNA ligase, with a final volume of 20 μl. The reaction was incubated at 15°C for 17 hours, and 2 μl of the reaction mixture was used to transform ONE according to the manufacturer's experimental protocol. TOP10 transformed cells. Cells were heat-shocked at 42°C for 30 seconds and 250 μl of SOC medium was added. The tubes were incubated at 37°C and 200 rpm for 1 hour, and 250 μl of the solution was plated on 150 mm diameter 2XYT ampicillin-containing plates and incubated overnight at 37°C. The resulting transformants were screened by restriction digestion analysis using Sph I and Bam HI to determine the presence and removal of inserts, and positive clones were sequenced. The clone containing the specific humic pyrogallase V coding region and without PCR errors was named pSMai139. Figure 6 ).

[0596] Example 12: Construction of pSMai143 plasmid

[0597] Plasmid pSMai143 was constructed by diffusing a 620 bp fragment of the *Trichoderma reesei* cellobiose hydrolase Cel6A promoter from the *Trichoderma reesei* RutC30 genomic DNA using primers 994148 and 994149 shown below. The underlined portion is the Sal I site introduced by primer 994148. The bold portion is the “CAT” sequence introduced by primer 994149.

[0598] Primer 994148:

[0599] 5'-ACGC GTCGAC GAATTCTAGGCTAGGTATGCGAGGCA-3'(SEQ ID NO:77)

[0600] Primer 994149:

[0601] 5'-CATGGTGCAATACACAGAGGGTG-3'(SEQ ID NO:78)

[0602] The amplification reaction (50 μl) consisted of 1X ThermoPol Reaction Buffer, 0.3 mM dNTPs, 100 ng Trichoderma reesei RutC30 genomic DNA, 0.3 μM 994148 sense primer, 0.3 μM 994149 antisense primer, and 2.5 units of Vent DNA polymerase. The reaction was carried out in... The sample was incubated in 5333epgradientS using the following procedure: 30 cycles, each cycle consisting of 60 seconds at 94°C, 60 seconds at 55°C, and 60 seconds at 72°C (with a final extension of 15 minutes). The reaction products were separated by 1.0% agarose gel electrophoresis using TAE buffer, with the 620bp product band cleaved from the gel and used... The Gel Extraction Kit purifies according to the manufacturer's instructions.

[0603] Plasmid pSMai139 was digested with Sph I, its 3' overhanging end was blunted with T4 DNA polymerase, and then digested with Sal I. The digested DNA was separated by electrophoresis on a 0.7% agarose gel in TAE buffer, excised from the gel, and used... The Gel Extraction Kit extracts according to the manufacturer's instructions.

[0604] A 620 bp Sal ​​I-digested PCR fragment was ligated into Sph I and Sal I-digested pSMai139 using T4 DNA ligase. The ligation reaction consisted of 50 ng of Sph I and Sal I-digested pSMai139, 22 ng of Sal I-digested 0.62 kb PCR fragment, 1X Ligase Buffer, and 2 units of T4 DNA ligase, with a final volume of 20 μl. The reaction was incubated at 15 °C for 17 hours, and 2 μl of the reaction mixture was used to transform ONE according to the manufacturer's experimental protocol. TOP10 competent cells. Cells were heat-shocked at 42°C for 30 seconds and 250 μl of SOC medium was added. The tubes were incubated at 37°C and 200 rpm for 1 hour, and 250 μl of the medium was spread onto 150 mm diameter 2XYT ampicillin-containing plates and incubated overnight at 37°C. Transformants were screened using EcoRI restriction digestion analysis to determine the presence and removal of inserts, and positive clones were screened. The clone containing the Trichoderma reesei cellobiose hydrolase Cel6A promoter without PCR errors was named pSMai143. Figure 7 ).

[0605] Example 13: Construction of plasmid pAG121

[0606] The expression vector pAG121 with an Nco I restriction site was used by The Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) was used to construct pSMai143 (Example 12) by localization mutagenesis using the primer pairs shown below. Mutagenesis was performed using 20 ng of plasmid pAG121 and 12.5 μM primers, as recommended by the manufacturer, with a final volume of 50 μl.

[0607] Smai143SDM Fwd:

[0608] gtgtattgcaccatggcgttcctcccccctcc(SEQ ID NO:79)

[0609] Smai143SDM Rev

[0610] ggaggggggaggaacgccatggtgcaataca(SEQ ID NO:80)

[0611] The resulting variant plasmid pAG121 was used Preparation of 9600. The variant plasmid construct was sequenced using an Applied Biosystems 3130xl Genetic Analyzer to validate the changes.

[0612] Example 14: Construction of the Trichoderma reesei expression vector pSMai229 encoding the Aspergillus fumigatus β-glucosidase (Cel3A) mutant gene

[0613] The Trichoderma reesei expression vector pSMai229, which encodes the Aspergillus fumigatus β-glucosidase (Cel3A) mutant sequence of Example 9, was constructed from pDFng133-3 (Example 10) and pAG121 (Example 13).

[0614] The coding sequence of the Aspergillus fumigatus β-glucosidase (Cel3A) mutant was amplified by PCR from pDFng133-3 using primers 0611689 and 0611690 as shown below. Bold regions represent... The pAG121 vector is homologous to the insertion site of the reaction.

[0615] Primer 0611689:

[0616] CACCCTCTGTGTATTGCACCATGAGATTCGGTTGGCTCGA(SEQ ID NO:81)

[0617] Primer 0611690:

[0618] TTCGCCACGGAGCTACTAGTCTAGTAGACACGGGGCAGAG(SEQ ID NO:82)

[0619] The amplification reaction consisted of 25 ng of pDFng133-3 DNA, 200 μm dNTPs, 0.4 μM primers, and 1X... Buffer, and 1 unit Hot Start High Fidelity DNA polymerase was used, with a final volume of 50 μl. The amplification reaction was carried out in... The 5333epgradient S was incubated at room temperature as follows: one cycle at 98°C for 30 seconds; 30 cycles, each cycle consisting of 30 seconds at 98°C, 30 seconds at 56°C, and 3 minutes and 30 seconds at 72°C; and one cycle at 72°C for 15 minutes.

[0620] PCR products were separated by 1% agarose gel electrophoresis using TAE buffer, in which a 3100bp fragment was excised from the gel and used... The Gel Extraction Kit was used to purify the gel according to the manufacturer's instructions. The fragments were then infused with the extract. TM The Advantage PCR Cloning Kit was used to clone the largest fragment of pAG121 digested with NcoI and SpeI, yielding pSMai229. Figure 8 The bonding reactant (10 μl) was prepared by 1X in-fusion. TM Buffer, 1 μl of in-fusion TM The reaction mixture consisted of 100 ng of pAG121 digested with Nco I and Spe I, and 142 ng of 3100 bp purified PCR product. The reaction was incubated at 37°C for 15 min, followed by incubation at 50°C for 15 min. After diluting the reaction mixture with 50 μl of TE buffer (pH 8), 2.5 μl of the reaction mixture was used to transform *E. coli* ONE according to the manufacturer's protocol. TOP10 competent cells. E. coli transformants containing pSMai229 were detected by restriction digestion, and... Plasmid DNA was prepared using a 9600-fold process. The Aspergillus fumigatus β-glucosidase (Cel3A) mutant insert from pSMai229 was confirmed by DNA sequencing.

[0621] Example 15: pDM286 and pSMai229 were co-transformed into Trichoderma reesei 981-O-8.5#10B+Ku70#19L3

[0622] The preparation and transformation of protoplasts of Trichoderma reesei strain 981-O-8.5#10B+Ku70#19L3 were carried out as described in Example 2.

[0623] Approximately 100 μg of pDM286 and pSMai229 were digested with Pme I. Each digestion reaction was purified by 1% agarose gel electrophoresis in TAE buffer, and the DNA bands were excised from the gel and used... Extraction was performed using a Gel Extraction Kit. Transformation was performed by adding 0.7–1.7 μg of Pme I-digested and gel-purified pSMai229 and 0.7–2.0 μg of pDM286 to 100 μl of *Trichoderma reesei* 981-O-8#10B+Ku70#19L3 protoplast solution and gently mixing. PEG buffer (250 μl) was added, mixed, and incubated at 34 °C for 30 min. STC (4 ml) was then added, mixed, and plated onto COVE plates. The plates were incubated at 28 °C for 7–10 days. After one round of spore purification on COVE2 plates with 10 mM uridine, 362 transformants were grown for 5 days at 28 °C with stirring at 200 rpm in 125 ml baffled shake flasks containing 25 ml of cellulase induction medium. Five days after inoculation, the culture medium sample was removed, centrifuged at 2000 rpm for 20 minutes, and the supernatant was transferred to a new container and stored at -20°C until enzyme assay.

[0624] β-glucosidase activity was determined in the supernatant using p-nitrophenyl-β-glucopyranoside as a substrate. In short, the culture supernatant was appropriately prepared in 0.1M succinate-0.01%... Dilute in X-100 pH 5.0 buffer (sample buffer), followed by serial dilutions from 0-fold to 1 / 3-fold to 1 / 9-fold. The *Trichoderma reesei* RutC30 fermentation broth was initially diluted 1 / 64, then diluted 2-fold in sample buffer to 16-fold to establish the linear range of the assay. A total of 20 μl of each dilution was transferred to a 96-well plate. 1 mg / mL of p-nitrophenyl-β-D-glucopyranoside substrate in 200 μL of 0.1 M succinate pH 5.0 buffer was added to each well, and the plate was incubated at ambient temperature for 45 minutes. After the incubation period, 50 μl of quenching solution (1 M Tris pH 9 buffer) was added to each well. Density measurements were performed at 405 nm for the 96-well plate. Sample activity was determined according to the following formula: (((OD405 / ec)*1x10) 6 () / incubation time) / sample volume, where ec = 17,749, incubation time = 45 minutes, and sample volume = 0.02 ml.

[0625] Multiple transformants showed β-glucosidase activity several times higher than that of *Trichoderma reesei* 981-O-8.5#10B+Ku70#19L3. All samples with β-glucosidase activity values ​​greater than 7000 μM / min / ml were tested using a [specific method / technology]. Cell (Bio-Rad Laboratories, Inc. Hercules, CA, USA) SDS-PAGE analysis of 8–16% Tris-HCl gel (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was performed to determine the expression of the Penicillium emersonii GH61A peptide. Five μl of Day 5 samples were suspended in 2X Laemmli Sample Buffer (Bio-Rad Laboratories, Hercules, CA, USA) and heated at 95°C for 5 min in the presence of 5% β-mercaptoethanol. All samples were then loaded onto… Electrophoresis was performed on 8-16% Tris-HCl and in 1X Tris / Glycine / SDS run buffer (Bio-Rad Laboratories, Hercules, CA, USA). The resulting gel was then subjected to... Coomassie Stain (Bio-Rad Laboratories, Hercules, CA, USA) staining. SDS-PAGE profiles of the cultures show Aspergillus fumigatus β-glucosidase variants and Penicillium emersonii GH61A in samples #1, 64, 79, 82, 83, 116, 147, 167, 193, 198, 210, 219, 908, 922, 928, 930, 935, 951, 963, and 980.

[0626] Example 16: Construction of pAG57

[0627] The Aspergillus fumigatus strain NN051616GH3 β-xylosidase (SEQ ID NO:15 [DNA sequence] and SEQ ID NO:16 [dextended amino acid sequence]) was recombinantly prepared according to the following method.

[0628] Two synthetic oligonucleotide primers, shown below, were designed to amplify the Aspergillus fumigatus β-xylosidase gene from genomic DNA by PCR. The genomic DNA was prepared as described in Example 1. IN-FUSION was used. TMThe Advantage PCR Cloning Kit directly clones the fragment into the expression vector pAILo2 (WO 2005 / 074647) without restriction digestion and ligation.

[0629] Forward primer:

[0630] 5'-ACTGGATTTACCATGGCGGTTGCCAAATCTATTGCT-3'(SEQ ID NO:83)

[0631] Reverse primer:

[0632] 5'-TCACCTCTAGTTAATTAATCACGCAGACGAAATCTGCT-3'(SEQ ID NO:84)

[0633] Bold letters represent the coding sequence. The remaining sequence is homologous to the insertion site of pAlLo2.

[0634] Each of the above primers, at 15 picomol values, was used in a PCR reaction containing 250 ng of Aspergillus fumigatus genomic DNA and 1X MgCl2. High Fidelity PCR Buffer, 1 μl of a 10 mM blend of dATP, dTTP, dGTP, and dCTP, and 0.75 units of... High Fidelity Enzyme Mix, final volume 50 μl. The amplification used... The 5333epgradient S was used, with the following procedure: 1 cycle at 94°C for 2 minutes; 10 cycles, each cycle at 94°C for 15 seconds, 56.5°C for 30 seconds, and 72°C for 2 minutes; and 20 cycles, each cycle at 94°C for 15 seconds, 56.5°C for 30 seconds, and 72°C for 2 minutes, plus an additional 5 seconds per cycle. The heated block was then held at 72°C for 7 minutes, followed by a 4°C immersion cycle.

[0635] The reaction products were separated by electrophoresis on a 1.0% agarose gel in TAE buffer, where a 2.4 kb product band was cleaved from the gel and used... The Gel Extraction Kit purifies according to the manufacturer's instructions.

[0636] Then use IN-FUSION on the fragment. TMThe vector was cloned into pAlLo2 using the Advantage PCR Cloning Kit. The vector was digested with Nco I and Pac I. The fragment was purified by 1% agarose gel electrophoresis using TAE buffer, excised from the gel, and then... Extraction was performed using a gel extraction kit. The gene fragment and digested vector were combined in the reaction to obtain the expression plasmid pAG57, in which transcription of the Aspergillus fumigatus β-xylosidase coding sequence was regulated by the NA2-tpi promoter (a hybrid of the promoters for Aspergillus niger neutral α-amylase and Aspergillus oryzae triose phosphate isomerase genes). The reaction (20 μl) was performed using a 1X infusion kit. TM Buffer, 1X BSA, 1μl IN-FUSION TM The reaction consisted of Enzyme (diluted 1:10), 182 ng of pAlLo2 digested with Nco I and Pac I, and 97.7 ng of purified PCR product from Aspergillus fumigatus β-xylosidase. The reaction was incubated at 37°C for 15 min, followed by incubation at 50°C for 15 min. The reaction was diluted with 40 μl of TE buffer, and 2.5 μl of the diluted reaction was used to transform *E. coli* TOP10 competent cells. Restriction enzyme digestion identified cells containing pAG57 (…). Figure 9 E. coli transformants, and used Plasmid DNA was prepared using a 9600-meter array. The pAG57 plasmid construct was sequenced using an Applied Biosystems 3130xl Genetic Analyzer to validate the sequence.

[0637] Example 17: Construction of pDFng124-1 expressing Aspergillus fumigatus β-xylosidase

[0638] Two synthetic oligonucleotide primers, shown below, were designed to amplify Aspergillus fumigatus β-xylosidase from pAG57 PCR (Example 16). IN-FUSION was used. TM The Advantage PCR Cloning Kit directly clones the fragment into the expression vector pMJ09, followed by restriction digestion and ligation.

[0639] Forward primer:

[0640] 5'-CGGACTGCGCACCATGGCGGTTGCCAAATC-3'(SEQ ID NO:85)

[0641] Reverse primer:

[0642] 5'-TCGCCACGGAGCTTATCACGCAGACGAAATCT-3'(SEQ ID NO:86)

[0643] Bold letters represent the coding sequence. The remaining sequence is homologous to the insertion site of pMJ09.

[0644] Each of the above primers was used in a PCR reaction at a concentration of 50 picomol, the reaction consisting of 100 ng of pAG57 and 1X containing MgCl2. High Fidelity PCR buffer, 0.25 mM each of dATP, dTTP, dGTP, and dCTP, and 2.6 units of... The mixture consists of an Enzyme Mix, with a final volume of 50 μl. Amplification is performed using... The 5333epgradient S was subjected to the following procedure: 1 cycle at 94°C for 2 minutes; 30 cycles, each cycle consisting of 15 seconds at 94°C, 30 seconds at 65°C, and 2 minutes at 72°C; and a final extension at 72°C for 7 minutes. The heated block was then subjected to a 4°C immersion cycle.

[0645] The reaction products were separated by electrophoresis on a 0.7% agarose gel in TBE buffer, where a 2.4 kb product band was cleaved from the gel and used... The Gel Extraction Kit purifies according to the manufacturer's instructions.

[0646] Plasmid pMJ09 was digested with Nco I and Pac I, separated by 0.7% agarose gel electrophoresis in TBE buffer, and then... The Gel Extraction Kit purifies according to the manufacturer's instructions.

[0647] Gene fragments and digested vectors were used with IN-FUSION TM The Advantage PCR Cloning Kit was used to ligate the cells together to obtain pDFng124-1 ( Figure 10 The transcription of the β-xylosidase encoding sequence is regulated by the promoter of the *Trichoderma reesei* cbhI gene. The ligation reaction mixture (20 μl) was prepared by 1X IN-FUSION. TM Buffer, 1 μl of in-fusion TM Enzyme (diluted 1:10), 200 ng of pMJ09 digested with Nco I and Pac I, and 100 ng of purified β-xylosidase PCR product constituted the reaction. The reaction was incubated at 37°C for 15 min, followed by incubation at 50°C for 15 min. Two μl of the reaction mixture was used to transform *E. coli* XL10 according to the manufacturer's instructions. Gold Supercompetent cells. Used E. coli transformants containing pDFng124-1. Preparation of 9600. The Aspergillus fumigatus β-xylosidase insert in pDFng124-1 was confirmed by DNA sequencing.

[0648] Example 18: Construction of pSaMe-AFGH10 expressing Aspergillus fumigatus xylanase

[0649] Two synthetic oligonucleotide primers, shown below, were designed to amplify Aspergillus fumigatus GH10 xylanase from pHyGe001 (WO 2006 / 078256) by PCR. IN-FUSION was used. TM The Advantage PCR Cloning Kit clones fragments directly into the expression vector pMJ09 without restriction digestion and ligation.

[0650] Forward primer:

[0651] 5'-CGGACTGCGCACCATGGTCCATCTATCTTCATT-3'(SEQ ID NO:87)

[0652] Reverse primer:

[0653] 5'-TCGCCACGGAGCTTATTACAGGCACTGTGAGTACC-3'(SEQ ID NO:88)

[0654] Bold letters represent the coding sequence. The remaining sequence is homologous to the insertion site of pMJ09.

[0655] Each of the above primers was used in a PCR reaction at 50 picomol concentrations, consisting of 50 ng of pHYGE001, 1 μl of a 10 mM blend of dATP, dTTP, dGTP, and dCTP, and 5 μl of 10X ACCUTAQ. TM DNA Polymerase Buffer (Sigma-Aldrich, St. Louis, MO, USA), and 5 units of ACCUTAQ TM DNA Polymerase (Sigma-Aldrich, St. Louis, MO, USA) was used, with a final volume of 50 μl. The 5333 epgradient S amplification of DNA fragments followed the procedure as follows: one cycle at 95°C for 2 minutes; and 30 cycles, each consisting of 15 seconds at 94°C, 30 seconds at 55°C, and 1 minute at 68°C. After 30 cycles, the reaction was incubated at 72°C for 10 minutes, then cooled to 4°C until further processing.

[0656] The reaction products were separated using a 1.0% agarose gel viscometer with TAE buffer, wherein a 1.4 kb product band was excised from the gel and used... The Gel Extraction Kit purifies according to the manufacturer's instructions.

[0657] Then the 1.4kb fragment was infused with infusion. TM The pMJ09 plasmid was cloned using a Cloning Kit. The pMJ09 plasmid was digested with NcoI and PacI and purified by agarose gel electrophoresis as described above. The gene fragment and the digested vector were ligated together in a reaction to obtain the expression plasmid pSaMe-AfGH10, in which the transcription of the xylanase-encoding sequence is regulated by the Trichoderma reesei cbh1 gene promoter. The ligation reaction (50 μl) was performed using a 1X IN-FUSION kit. TM Buffer, 1X BSA, 1μl IN-FUSION TM The reaction consisted of an enzyme (diluted 1:10), 100 ng of pMJ09 digested with Nco I and Pac I, and 100 ng of purified PCR product from Aspergillus fumigatus xylanase. The reaction was incubated at room temperature for 30 minutes. One μl of the reaction was used to transform *E. coli* XL10. Gold cells. Restriction enzyme digestion revealed the presence of pSaMe-AfGH10 (…). Figure 11 E. coli transformants, and used Plasmid DNA was prepared using a 9600-fold process. DNA sequencing of the xylanase-encoding sequence from pSaMe-AfGH10 Aspergillus fumigatus was performed using dye terminator chemistry (Giesecke et al., 1992, Journal of Virology Methods 38:47-60) and primer walking strategy.

[0658] Example 19: Generation of *Trichoderma reesei* strain RutC30 expressing *Aspergillus fumigatus* xylanase and *Aspergillus fumigatus* β-xylosidase

[0659] The preparation and transformation of protoplasts of Trichoderma reesei strain RutC30 were carried out as described in Example 2.

[0660] Approximately 100 μg of pSaMe-AFGH10 and pDFng124-1 were digested with Pme I. Each digestion reaction was purified by 0.65% agarose gel electrophoresis in TAE buffer. DNA bands were excised from the gel and used... Extraction was performed using a Gel Extraction Kit. Transformation was performed by adding 2 μg of Pme I-digested and gel-purified pDFng124-1 and 1.72 μg of pSaMe-AfGH10 to 100 μl of Trichoderma reesei strain RutC30 protoplast solution and gently mixing. PEG buffer (250 μl) was added, mixed, and incubated at 34 °C for 30 min. STC (6 ml) was then added, mixed, and plated onto COVE plates. The plates were incubated at 28 °C for 7–10 days. After one round of spore purification on COVE2 plates with 10 mM uridine, 200 transformants were grown for 5 days at 28 °C with stirring at 200 rpm in 125 ml baffled shake flasks containing 25 ml of cellulase induction medium. Five days after inoculation, the culture sample was removed, centrifuged at 2000 rpm for 20 min, and the supernatant was transferred to a new embassy and stored at -20 °C until enzyme assay.

[0661] Combine 3–5 μl of each supernatant with 5–6 μl of Laemelli sample buffer (Bio-Rad Laboratories, Hercules, CA, USA) containing 5% β-mercaptoethanol in a 0.2 ml microcentrifuge tube and incubate at 95°C. Boil in 5333epgradient S for 2 minutes. The sample was then processed using 10 μl of PRECISION PLUS. TM All Blue Protein Standards (Bio-Rad Laboratories, Hercules, CA, USA) and SDS-PAGE analysis of 8-16% Tris-HCl gel was performed according to the manufacturer's instructions. The gel was then subjected to... Coomassie Stain staining.

[0662] Four strains were selected based on the high expression of β-xylosidase and xylanase peptides, and the spores collected on a 10 μl inoculation loop were added to 1.5 ml of 0.01% [amount of spores]. Spore purification was performed on 20 strains. Spore dilutions of 1:1500 and 1:150 were plated on 150 mm COVE plates and incubated at 28°C for 4 days. Four spore isolates were obtained from each strain (a total of 16 isolates), and these were transferred to COVE 2+10 mM uridine plates and incubated at 28°C for 9 days. The flask and SDS-PAGE steps were repeated for the first round of spore isolates. Eight strains were selected based on the high expression of β-xylosidase and xylanase peptides, and a second spore purification was performed as described above, yielding four spore isolates from each strain (a total of 32 isolates). The shake-flask and SDS-PAGE steps were repeated for the second round of spore isolates. The final strain was selected based on the high expression of β-xylosidase and xylanase peptides and named O6HY4.

[0663] Example 20: Hydrolysis determination of pretreated corn stalks

[0664] Corn stalks were pretreated at the US Department of Energy National Renewable Energy Laboratory (NREL) with 1.4 wt% sulfuric acid at 165 °C and 107 psi for 8 minutes. The water-insoluble solids in the pretreated corn stalks (PCS) contained 56.5% cellulose, 4.6% hemicellulose, and 28.4% lignin. Cellulose and hemicellulose were determined by two-stage sulfuric acid hydrolysis, followed by high-performance liquid chromatography (HPLC) analysis using NREL Standard Analytical Procedure #002. Lignin was determined by gravimetric analysis using NREL Standard Analytical Procedure #003 after hydrolysis of the cellulose and hemicellulose fractions with sulfuric acid.

[0665] The milled, unwashed PCS was prepared by milling full slurry PCS in a Cosmos ICMG 40 wet multipurpose mill (EssEmmCorporation, Tamil Nadu, India).

[0666] Hydrolysis of PCS was performed using 2.2 mL deep-well plates (Axygen, Union City, CA, USA) in a total reaction volume of 1.0 mL. Hydrolysis was carried out using a multi-enzyme composition with various protein loadings (expressed as mg protein per gram of cellulose), consisting of 50 mg of insoluble PCS solid per mL of 50 mM sodium acetate pH 5.0 buffer containing 1 mM manganese sulfate and 50 mg of insoluble PCS solid per mL. The enzyme compositions were prepared and then simultaneously added to all wells in volumes ranging from 50 μL to 200 μL, to a final volume of 1 mL for each reaction. The reaction was then performed using ALPS-300. TMPlate heat sealers (Abgene, Epsom, United Kingdom) were used to seal the plates, thoroughly mix the mixture, and incubate at a specific temperature for 72 hours. All reported reactions were repeated three times.

[0667] After hydrolysis, 0.45μm was used. Samples were filtered using a 96-well filter plate (Millipore, Bedford, MA, USA), and the sugar content of the filtrate was analyzed as described below. When not used immediately, the filtered aliquots were frozen at -20°C. The sugar concentration of samples diluted in 0.005M H₂SO₄ was measured as follows: using a 4.6 x 250 mm plate. HPX-87H column (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used for elution at 65°C with 0.05% w / w benzoic acid - 0.005M H2SO4 at a flow rate of 0.6 mL per min, and detection was performed by measuring the refractive index corrected from a pure sugar sample. The glucose, cellobiose, and xylose signals obtained were quantified using 1100 HPLC (Agilent Technologies, Santa Clara, CA, USA). The percentage of cellulose conversion was calculated for each reaction using the obtained glucose and cellobiose equivalents.

[0668] Glucose, cellobiose, and xylose were measured separately. The measured sugar concentrations were adjusted according to appropriate dilution factors. In the case of unwashed PCS, the net sugar concentration produced by the enzymatic process was determined by adjusting the measured sugar concentrations to the corresponding background sugar concentrations in the unwashed PCS at time zero. All HPLC data processing was performed using Microsoft Excel. TM The software (Microsoft, Richland, WA, USA) is used.

[0669] The degree of cellulose conversion to glucose is calculated using the following formula: %conversion = (glucose concentration / glucose concentration in digestion) x 100. To calculate the total conversion, glucose and cellobiose values ​​are combined. The degree of total cellulose conversion is calculated using the following formula: %conversion [glucose concentration] / [(glucose concentration in restricted digestion) x 100]. To calculate the %conversion, a 100% conversion point is set based on a cellulase control (50 mg of Trichoderma reesei cellulase per gram of cellulose), and all values ​​are divided by this value and then multiplied by 100. The average of three replicate data points is taken, and the standard deviation is calculated.

[0670] An enzyme composition comprising Aspergillus fumigatus cellobiase I; Aspergillus fumigatus cellobiase II; Aspergillus fumigatus β-glucosidase variant; Penicillium GH61 polypeptide with enhanced cellulolytic activity, Aspergillus fumigatus xylanase, and Aspergillus fumigatus β-xylosidase (designated "Enzyme Composition #1") is compared with an enzyme composition comprising Aspergillus echinospora GH10 xylanase (WO 94 / 021785) and Trichoderma reesei cellulase preparation (containing Aspergillus fumigatus β-glucosidase (WO 2005 / 047499) and Ascomycota citrinum GH61A polypeptide (WO2005 / 074656)) (designated "Enzyme Composition #2").

[0671] After the hydrolysis assay was completed, a graph was generated showing protein loading (mg EP / g cellulose) versus percentage conversion (%). Linear interpolation was used to determine the protein loading required to achieve a specific percentage conversion. In this case, the equivalent of 80% conversion of dextran to glucose was selected to determine the relative improvement of enzyme composition 2 compared to enzyme composition 3. The results of this assay are shown in... Figure 12 The indicator enzyme composition 1 achieved 80% conversion at 4.1 mg EP / g cellulose, while enzyme composition 2 achieved the same conversion target at 7.3 mg EP / g cellulose. This reflects a 1.78-fold improvement in protein performance per milligram for composition 1 compared to composition 2, or a 1.78-fold reduction in protein required to achieve 80% conversion.

[0672] The present invention is further described in the following numbered paragraphs.

[0673] [1] An enzyme composition comprising (i) Aspergillus fumigatus cellobiose hydrolase I; (ii) Aspergillus fumigatus cellobiose hydrolase II; (iii) Aspergillus fumigatus β-glucosidase or a variant thereof; and (iv) a Penicillium species GH61 polypeptide having enhanced cellulose-degrading activity; or a homolog thereof.

[0674] [2] The enzyme composition of segment 1, wherein the Aspergillus fumigatus cellobiose hydrolase I or its homolog is selected from the group consisting of: (i) cellobiose hydrolase I comprising or constituting the mature polypeptide of SEQ ID NO:2; (ii) cellobiose hydrolase I comprising or constituting an amino acid sequence having at least 70%, for example at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:2; (iii) cellobiose hydrolase I encoded by a polynucleotide comprising or constituting a nucleotide sequence that is identical to the sequence of SEQ ID NO:2. The mature polypeptide coding sequence of NO:1 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) cellobiase I, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:1 or its full-length complementary strand under at least high-strength conditions, for example, very high-strength conditions.

[0675] [3] The enzyme composition of segment 1, wherein the Aspergillus fumigatus cellobiase II or its homolog is selected from the group consisting of: (i) cellobiase II comprising or constituting the mature polypeptide of SEQ ID NO:4; (ii) cellobiase II comprising or constituting an amino acid sequence having at least 70%, for example at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:4; (iii) cellobiase II encoded by a polynucleotide comprising or constituting a nucleotide sequence having an amino acid sequence identical to that of SEQ ID NO:4. The mature polypeptide coding sequence of NO:3 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) cellobiase II, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:3 or its full-length complementary strand under at least high-strength conditions, for example, very high-strength conditions.

[0676] [4] The enzyme composition of segment 1, wherein the Aspergillus fumigatus β-glucosidase or its homolog is selected from the group consisting of: (i) β-glucosidase comprising or constituting the mature polypeptide of SEQ ID NO:6; (ii) β-glucosidase comprising or constituting an amino acid sequence having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO:6; (iii) β-glucosidase encoded by a polynucleotide comprising or constituting a nucleotide sequence having an amino acid sequence identical to that of SEQ ID NO:6. The mature polypeptide coding sequence of NO:5 has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; and (iv) β-glucosidase, which is encoded by a polynucleotide, said polynucleotide hybridizing with the mature polypeptide coding sequence of SEQ ID NO:5 or its full-length complementary strand under at least high stringent conditions, for example, very high stringent conditions.

[0677] [5] The enzyme composition of segment 1, wherein the β-glucosidase variant contains a substitution at one or more positions corresponding to positions 100, 283, 45...

Claims

1. An enzyme composition comprising: (i) *Aspergillus fumigatus* cellobiose hydrolase I having at least 99% sequence identity with the amino acid sequence of amino acids 27 to 532 of SEQ ID NO:2, derived from *Aspergillus fumigatus* and having cellobiose hydrolase I activity; (ii) *Aspergillus fumigatus* cellobiose hydrolase II having at least 99% sequence identity with the amino acid sequence of amino acids 20 to 454 of SEQ ID NO:4, derived from *Aspergillus fumigatus* and having cellobiose hydrolase II activity; (iii) *Aspergillus fumigatus* β-glucosidase variant having at least 99% sequence identity with the amino acid sequence of amino acids 20 to 863 of SEQ ID NO:6, wherein the amino acids corresponding to F100, S283, N456 and F512 are substituted with F100D, S283G, N456E and F512Y, derived from *Aspergillus fumigatus* and having β-glucosidase activity; (iv) ... The following are examples of cellulose-enhancing peptides: *Penicillium emersonii* GH61 polypeptide, derived from *Penicillium emersonii* and possessing GH61 peptidase activity, having at least 99% sequence identity with amino acid sequences 26 to 253 of SEQ ID NO:8; *Aspergillus fumigatus* xylanase, derived from *Aspergillus fumigatus* and possessing xylanase activity, having at least 99% sequence identity with amino acid sequences 20 to 397 of SEQ ID NO:14; and *Aspergillus fumigatus* β-xylosidase, derived from *Aspergillus fumigatus* and possessing β-xylosidase activity, having at least 99% sequence identity with amino acid sequences 21 to 792 of SEQ ID NO:

16.

2. The enzyme composition of claim 1, further comprising Trichoderma reesei endoglucanase I of the amino acid sequence SEQ ID NO:90, Trichoderma reesei endoglucanase II of the amino acid sequence SEQ ID NO:92, or Trichoderma reesei endoglucanase I of the amino acid sequence SEQ ID NO:90 and Trichoderma reesei endoglucanase II of the amino acid sequence SEQ ID NO:

92.

3. The enzyme composition of claim 1, further comprising one or more enzymes selected from the group consisting of: cellulase, GH61 polypeptide having cellulose-enhancing activity, hemicellulase, esterase, patulin, laccase, lignin-degrading enzyme, pectinase, peroxidase, protease, and swelling agent.

4. The enzyme composition of claim 3, wherein the cellulase is one or more enzymes selected from the group consisting of: endoglucanase, cellobiase and β-glucosidase.

5. The enzyme composition of claim 4, wherein the endoglucanase is endoglucanase I.

6. The enzyme composition of claim 4, wherein the endoglucanase is endoglucanase II.

7. The enzyme composition of claim 3, wherein the hemicellulase is one or more enzymes selected from the group consisting of xylanase, acetylxylan esterase, ferulic acid esterase, arabinofuranylase, xylosidase, and glucuronyl glycosidase.

8. A recombinant filamentous fungal host cell comprising a polynucleotide encoding: (i) an Aspergillus fumigatus cellobiase I having at least 99% sequence identity with the amino acid sequence of amino acids 27 to 532 of SEQ ID NO:2, derived from Aspergillus fumigatus and having cellobiase I activity; (ii) an Aspergillus fumigatus cellobiase II having at least 99% sequence identity with the amino acid sequence of amino acids 20 to 454 of SEQ ID NO:4, derived from Aspergillus fumigatus and having cellobiase II activity; (iii) an Aspergillus fumigatus β-glucosidase variant having at least 99% sequence identity with the amino acid sequence of amino acids 20 to 863 of SEQ ID NO:6, wherein the amino acids corresponding to F100, S283, N456 and F512 are substituted with F100D, S283G, N456E and F512Y, derived from Aspergillus fumigatus and having β-glucosidase activity; (iv) an Aspergillus fumigatus cellobiase I having at least 99% sequence identity with the amino acid sequence of amino acids 27 to 532 of SEQ ID NO:2, derived from Aspergillus fumigatus and having β-glucosidase activity; (iv) an Aspergillus fumigatus cellobiase II having at least 99% sequence identity with the amino acid sequence of amino acids 20 to 863 of SEQ ID NO:6, wherein the amino acids corresponding to F100, S283, N456 and F512 are substituted with F100D, S283G, N456E and F512Y, derived from Aspergillus fumigatus and having β-glucosidase activity; (iv) an Aspergillus fumigatus cello The following are examples of cellulose-enhancing peptides: *Penicillium emersonii* GH61 polypeptide, derived from *Penicillium emersonii* and possessing GH61 peptidase activity, having at least 99% sequence identity with amino acid sequences 26 to 253 of SEQ ID NO:8; *Aspergillus fumigatus* xylanase, derived from *Aspergillus fumigatus* and possessing xylanase activity, having at least 99% sequence identity with amino acid sequences 20 to 397 of SEQ ID NO:14; and *Aspergillus fumigatus* β-xylosidase, derived from *Aspergillus fumigatus* and possessing β-xylosidase activity, having at least 99% sequence identity with amino acid sequences 21 to 792 of SEQ ID NO:

16.

9. The recombinant filamentous fungal host cell of claim 8, further comprising encoding the following polynucleotides: Trichoderma reesei endoglucanase I of the amino acid sequence of SEQ ID NO: 90, Trichoderma reesei endoglucanase II of the amino acid sequence of SEQ ID NO: 92, or Trichoderma reesei endoglucanase I of the amino acid sequence of SEQ ID NO: 90 and Trichoderma reesei endoglucanase II of the amino acid sequence of SEQ ID NO:

92.

10. The recombinant filamentous fungal host cell of claim 8 or claim 9, wherein the recombinant filamentous fungal host cell is a Trichoderma cell.

11. The recombinant filamentous fungal host cell of claim 10, wherein Trichoderma reesei is present.

12. The recombinant filamentous fungal host cell of claim 8, wherein one or more cellulase genes, one or more hemicellulase genes, or a combination thereof, originating from the filamentous fungal host cell have been inactivated.

13. The recombinant filamentous fungal host cell of claim 12, wherein the cellulase gene is an inactivated cellobiase I gene; wherein the cellobiase I gene encodes cellobiase I of the amino acid sequence 18 to 514 of SEQ ID NO:

18.

14. The recombinant filamentous fungal host cell of claim 12, wherein the cellulase gene is an inactivated cellobiase II gene; wherein the cellobiase II gene encodes cellobiase II of the amino acid sequence SEQ ID NO:20, amino acid sequence 19 to 471.

15. The recombinant filamentous fungal host cell of claim 12, wherein the cellulase gene is an inactivated β-glucosidase gene; wherein the β-glucosidase gene encodes a β-glucosidase of the amino acid sequence 20 to 744 of SEQ ID NO:

22.

16. The recombinant filamentous fungal host cell of claim 12, wherein the hemicellulase gene is an inactivated xylanase gene; wherein the xylanase gene encodes a xylanase of amino acid sequence 20 to 229 of SEQ ID NO:24, amino acid sequence 20 to 223 of SEQ ID NO:26, or amino acid sequence 17 to 347 of SEQ ID NO:

28.

17. The recombinant filamentous fungal host cell of claim 12, wherein the hemicellulase gene is an inactivated β-xylosidase gene; wherein the β-xylosidase gene encodes a β-xylosidase of the amino acid sequence 21 to 797 of SEQ ID NO:

30.

18. The recombinant filamentous fungal host cell of claim 8, further comprising one or more polynucleotides encoding one or more enzymes selected from the group consisting of: cellulase, GH61 polypeptide having cellulose-enhancing activity, hemicellulase, esterase, patulin, laccase, lignin-degrading enzyme, pectinase, peroxidase, protease, and swelling agent.

19. The recombinant filamentous fungal host cell of claim 18, wherein the cellulase is one or more enzymes selected from the group consisting of: endoglucanase, cellobiase, and β-glucosidase.

20. The recombinant filamentous fungal host cell of claim 19, wherein the endoglucanase is endoglucanase I.

21. The recombinant filamentous fungal host cell of claim 19, wherein the endoglucanase is endoglucanase II.

22. The recombinant filamentous fungal host cell of claim 18, wherein the hemicellulase is one or more enzymes selected from the group consisting of xylanase, acetylxylan esterase, ferulic acid esterase, arabinofuranylase, xylosidase, and glucuronyl glycosidase.

23. A process for producing an enzyme composition, comprising: The recombinant filamentous fungal host cells of any one of claims 8-22 are cultured under conditions conducive to the production of the enzyme composition.

24. The process of claim 23, further comprising recovering the enzyme composition.

25. A method for degrading cellulose materials, comprising treating the cellulose material with an enzyme composition according to any one of claims 1-7.

26. The method of claim 25, wherein the cellulose material is pretreated.

27. The method of claim 25 or 26, further comprising recycling the degraded cellulose material.

28. The method of claim 27, wherein the degraded cellulose material is sugar.

29. The method of claim 28, wherein the sugar is selected from the group consisting of glucose, xylose, mannose, galactose, and arabinose.

30. A process for producing fermentation products, comprising: (a) Saccharifying cellulose material with the enzyme composition of any one of claims 1-7; (b) Fermenting saccharified cellulose material with one or more fermenting microorganisms to produce fermentation products; and (c) Recover fermentation products from fermentation.

31. The process of claim 30, wherein the cellulose material is pretreated.

32. The process of claim 30, wherein steps (a) and (b) are carried out simultaneously in concurrent saccharification and fermentation.

33. The process of claim 30, wherein the fermentation product is an alcohol, alkane, cycloalkanes, olefin, gas, ketone, organic acid, or polyketide compound.

34. The process of claim 33, wherein the organic acid is an amino acid.

35. The process of claim 33, wherein the olefin is isoprene.

36. A process for fermenting cellulose materials, comprising: The cellulose material is fermented with one or more fermenting microorganisms, wherein the cellulose material is saccharified with an enzyme composition of any one of claims 1-7.

37. The process of claim 36, wherein the fermentation of the cellulose material produces fermentation products.

38. The process of claim 37, further comprising recovering fermentation products from fermentation.

39. The process of claim 37, wherein the fermentation product is an alcohol, alkane, cycloalkanes, olefin, gas, ketone, organic acid, or polyketide compound.

40. The process of claim 39, wherein the organic acid is an amino acid.

41. The process of claim 39, wherein the olefin is isoprene.

42. The process of any one of claims 36-41, wherein the cellulose material is pretreated prior to saccharification.

Citation Information

Patent Citations

  • Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus

    EP0238023A2

  • Procedure for the production of ethanol from lignocellulosic biomass using a new heat-tolerant yeast

    US20020164730A1

  • Methods for producing secreted polypeptides

    US20040248258A1

  • Thermostable purified endoglucanas from acidothermus cellulolyticus ATCC 43068

    US5275944A

  • Gene coding for the E1 endoglucanase

    US5536655A