Methods for detecting specific and / or non-specific adsorption of nucleic acids
Patent Information
- Application Number
- CN201711174761.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2017-11-22
- Publication Date
- 2026-08-28
- Estimated Expiration
- 2037-11-22
AI Technical Summary
这些非特异性吸附会造成测序结果错误率增加,导致测序通量和测序质量的下降
[0009] The aforementioned method for detecting non-specific adsorption of nucleic acids can qualitatively or quantitatively detect the non-specific and/or specific adsorption of target nucleic acids by probes on the substrate surface and/or on the substrate surface. By detecting the signal on the substrate surface through the detection system, it is possible to qualitatively or quantitatively distinguish between specific and non-specific adsorption, and obtain information such as the quantification and distribution of non-specific or specific adsorption. It can be used in chip manufacturing and all methods or applications involving chip-based nucleic acid detection processes, such as for evaluating the performance of empty chips (without probes) or capture chips (with probes), quality control of chip manufacturing, and prediction, analysis, and comparison of the effectiveness of chip-based nucleic acid capture.
Smart Images

Figure CN108192953B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of nucleic acid detection technology, and in particular to a method for detecting specific and / or non-specific adsorption of nucleic acids. Background Art
[0002] When performing nucleic acid detection on a chip, for example, using a chip with probes immobilized on the surface to capture nucleic acids and further analyze and detect the captured nucleic acids, including sequencing, information analysis, etc., non-specific adsorption of nucleic acids to the chip surface and / or the probes thereon will affect the amount of valid data obtained and the accuracy of detection results. Qualitative or quantitative detection of non-specific adsorption can be used to determine chip quality, chip surface modification conditions, and for detection result prediction, etc.
[0003] For example, in current nucleic acid sequencing, especially in gene sequencing using chips, non-specific situations exist when nucleic acid hybridization is performed on the chip, including non-specific adsorption of template strands by the chip surface and non-specific adsorption of template strands by probes on the chip surface. These non-specific adsorptions will increase the error rate of sequencing results, leading to a decrease in sequencing throughput and sequencing quality.
[0004] Therefore, evaluating these non-specific adsorption conditions is of great significance for chip production quality control, nucleic acid detection using chips and other fields. Summary of the Invention
[0005] Embodiments of the present invention aim to at least solve one of the technical problems existing in the prior art or at least provide a useful commercial alternative. To this end, the present invention provides a method for detecting specific and / or non-specific adsorption of nucleic acids.
[0006] According to a first aspect, a method for detecting specific and / or non-specific adsorption of nucleic acids is provided, the method comprising: reacting a nucleic acid to be tested with a first probe, wherein the first probe is immobilized on the surface of a first substrate, the nucleic acid to be tested is at least partially complementary to the first probe, the nucleic acid to be tested carries a first label, the first probe carries a second label, the first label can generate a first signal, and the second label can generate a second signal; detecting a signal on the surface of the first substrate to obtain a first detection result; reacting the nucleic acid to be tested with a second probe, wherein the second probe is immobilized on the surface of a second substrate, the second probe carries the second label, and the nucleic acid to be tested is not complementary to the second probe; detecting a signal on the surface of the second substrate to obtain a second detection result; based on the first detection result and the second detection result, detecting the specific and / or non-specific adsorption of the nucleic acid to be tested.
[0007] According to a second aspect, a method for detecting nonspecific adsorption of nucleic acids is provided. The method includes: reacting a nucleic acid to be tested with a third probe, wherein the third probe is immobilized on the surface of a third substrate, the nucleic acid to be tested is labeled with a third label, the third probe is labeled with a fourth label, the nucleic acid to be tested and the third probe are not complementary, the third label is capable of generating a third signal, and the fourth label is capable of generating a fourth signal; detecting the signal on the surface of the third substrate to obtain a third detection result; reacting the nucleic acid to be tested with a fourth substrate surface; detecting the signal on the surface of the fourth substrate to obtain a fourth detection result; and detecting nonspecific adsorption of the nucleic acid to be tested based on the third detection result and the fourth detection result.
[0008] According to a third aspect, a method for detecting specific and / or non-specific adsorption of nucleic acids is provided. The method includes: reacting a test nucleic acid with a fifth probe, wherein the fifth probe is immobilized on a fifth substrate surface, the test nucleic acid and the fifth probe are at least partially complementary, the test nucleic acid is labeled with a fifth label, and the fifth probe is labeled with a sixth label, wherein the fifth label is capable of generating a fifth signal and the sixth label is capable of generating a sixth signal; detecting the signal on the fifth substrate surface to obtain a fifth detection result; reacting the test nucleic acid with a sixth probe, wherein the sixth probe is immobilized on a sixth substrate surface, the sixth probe is labeled with the sixth label, and the test nucleic acid and the sixth probe are not complementary; detecting the signal on the sixth substrate surface to obtain a sixth detection result; reacting the test nucleic acid with a seventh substrate surface; detecting the signal on the seventh substrate surface to obtain a seventh detection result; and detecting specific and / or non-specific adsorption of the test nucleic acid based on at least two of the fifth, sixth, and seventh detection results.
[0009] The aforementioned method for detecting non-specific adsorption of nucleic acids can qualitatively or quantitatively detect the non-specific and / or specific adsorption of target nucleic acids by probes on the substrate surface and / or on the substrate surface. By detecting the signal on the substrate surface through the detection system, it is possible to qualitatively or quantitatively distinguish between specific and non-specific adsorption, and obtain information such as the quantification and distribution of non-specific or specific adsorption. It can be used in chip manufacturing and all methods or applications involving chip-based nucleic acid detection processes, such as for evaluating the performance of empty chips (without probes) or capture chips (with probes), quality control of chip manufacturing, and prediction, analysis, and comparison of the effectiveness of chip-based nucleic acid capture. Attached Figure Description
[0010] Figure 1 This is a flowchart illustrating the image processing method in an embodiment of the present invention;
[0011] Figure 2 This is another schematic diagram of the image processing method in an embodiment of the present invention;
[0012] Figure 3 This is a schematic diagram illustrating the principle of probe immobilization and nucleic acid hybridization on a substrate surface in an embodiment of the present invention;
[0013] Figure 4 This is a schematic diagram illustrating the principle of probe immobilization and nucleic acid hybridization on another substrate surface in an embodiment of the present invention;
[0014] Figure 5 This is a schematic diagram illustrating the hybridization principle of the nucleic acid to be tested on a substrate surface in another embodiment of the present invention;
[0015] Figure 6 Images of Cy3 fluorescent dots (left) and Cy5 fluorescent dots (right) in a field of view obtained by the experimental group in this embodiment of the invention;
[0016] Figure 7 The images shown are of Cy3 fluorescent dots (left) and Cy5 fluorescent dots (right) in a single field of view obtained from the control group 1 in this embodiment of the invention.
[0017] Figure 8 This is an image of a Cy5 fluorescent dot in a field of view obtained by taking a picture of control group 2 in an embodiment of the present invention. Detailed Implementation
[0018] The present invention will now be described in further detail with reference to specific embodiments and accompanying drawings. In the following embodiments, many details are described to enable a better understanding of the invention. However, those skilled in the art will recognize without creative effort that some features may be omitted in different situations, or may be replaced by other elements, materials, or methods. Those skilled in the art can implement the relevant operations based on the description in the specification and general technical knowledge in the field.
[0019] Furthermore, the features, operations, or characteristics described in the specification can be combined in any suitable manner to form various embodiments. At the same time, the steps or actions in the method description can be rearranged or adjusted in a manner obvious to those skilled in the art. Therefore, the various orders in the specification and drawings are only for the clear description of a particular embodiment and do not imply a necessary order, unless otherwise stated that a particular order must be followed.
[0020] To facilitate understanding, the embodiments of the present invention will be described in detail below with reference to the accompanying drawings and by way of examples. It should be understood that the descriptions of specific operations and operational details in the following examples are illustrative and not intended to limit the scope of the invention.
[0021] In the description of this invention, it should be understood that the terms "first," "second," "third," "fourth," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance, relative order, or implicitly specifying the number of indicated technical features. Therefore, a feature defined with "first," "second," "third," "fourth," etc., may explicitly or implicitly include one or more of the stated features. In the description of this invention, "a plurality of" means two or more, unless otherwise explicitly specified. The "nucleic acid to be tested" referred to in embodiments of this invention may be DNA and / or RNA, etc., and in some embodiments may also be referred to as a "template strand" or "hybridization strand," for example, the target DNA strand in the process of detecting nucleic acids using a chip.
[0022] The "probe" referred to in the embodiments of this invention can be DNA and / or RNA, etc., and in some embodiments it may also be called a "primer," "capture strand," or "fixed strand." The "probe" can be randomly or regularly distributed on the substrate surface, such as in an array. For example, in currently available capture chips, the probes are generally distributed in an array on the chip surface.
[0023] The term "substrate" can refer to any solid support material suitable for immobilizing nucleic acid sequences, such as nylon membranes, glass slides, plastics, silicon wafers, magnetic beads, etc. Unless otherwise specified, the chip surface and the substrate surface are interchangeable. Solid-phase probes are typically attached to / immobilized on the substrate surface via chemical bonds. Generally, the substrate surface is chemically modified with reactive groups that can connect to the probe. Surface modification and immobilization can be performed using known methods or can be custom-made or purchased directly.
[0024] The terms "non-specific adsorption" and "specific adsorption" / "specific binding" are relative. "Non-specific adsorption" generally refers to adsorption caused by non-covalent forces, including hydrophobic forces, van der Waals forces, electrostatic forces, etc. In the process of nucleic acid detection based on the principle of base complementarity on a chip with probes on its surface, nucleic acid non-specific adsorption generally refers to the non-covalent connection of nucleic acids to the chip surface and / or probes.
[0025] The term "marker" can be any physically, chemically, or biologically detectable marker. Correspondingly, the "signal" in this embodiment of the invention refers to the signal generated by the "marker" under specific conditions. A typical but not limiting "marker" is an optically detectable marker, such as a fluorescent dye, and the corresponding "signal" is a fluorescent signal. In some embodiments of the invention, the marker is a fluorescent dye, such as Cy5 and / or Cy3. Cy5 and Cy3 are both water-soluble 3H-indocyanine-type biofluorescent markers, capable of emitting red and green fluorescence under 650nm and 550nm laser irradiation, respectively.
[0026] The term "detection result" can refer to any suitable qualitative or quantitative result, such as visual inspection or instrument detection. In applications where precise quantification is not required, the non-specific adsorption of the nucleic acid to be tested can be determined by visually inspecting signals on the substrate surface, such as the distribution and intensity of fluorescence signals. In applications requiring precise quantification, the non-specific adsorption of the nucleic acid to be tested can be determined by detecting signals on the substrate surface using instruments / signal detection devices. For example, the instrument could be an optical detection device with an imaging system, including a light source, objective lens, and camera. Accordingly, the term "detection result" includes the acquisition of an image.
[0027] The term "bright spot" refers to a point or spot of light in an image, with each point or spot occupying at least one pixel. The term "pixel" is synonymous with "pixel." When using an optical detection system to detect fluorescently labeled nucleic acids, the term "bright spot detection" corresponds to the detection of the optical signal of that nucleic acid, base, or base cluster.
[0028] In one embodiment of the present invention, a method for detecting specific and / or non-specific adsorption of nucleic acids includes: S100: reacting the nucleic acid to be tested with a first probe, wherein the first probe is fixed on the surface of a first substrate, the nucleic acid to be tested and the first probe are at least partially complementary, the nucleic acid to be tested is labeled with a first label, the first probe is labeled with a second label, the first label is capable of generating a first signal, and the second label is capable of generating a second signal; S200: detecting the signal on the surface of the first substrate to obtain a first detection result; S300: reacting the nucleic acid to be tested with a second probe, wherein the second probe is fixed on the surface of a second substrate, the second probe is labeled with a second label, and the nucleic acid to be tested and the second probe are not complementary; S400: detecting the signal on the surface of the second substrate to obtain a second detection result; S500: based on the first detection result and the second detection result, detecting the specific and / or non-specific adsorption of the nucleic acid to be tested.
[0029] This method can be used to qualitatively or quantitatively detect the non-specific and / or specific adsorption of target nucleic acids by probes on the substrate surface and / or on the substrate surface. By detecting the signal on the substrate surface through the detection system, specific and non-specific adsorption can be qualitatively or quantitatively distinguished, and information such as the quantification and distribution of non-specific or specific adsorption can be obtained. It can be used in chip manufacturing and all methods or applications involving chip-based nucleic acid detection, such as for evaluating the performance of empty chips (without probes) or capture chips (with probes), quality control of chip manufacturing, and prediction, analysis and comparison of the effectiveness of chip-based nucleic acid capture.
[0030] In the above method, the first signal and the second signal are signals that can be distinguished in terms of detection, that is, it is possible to detect that the first signal and the second signal are two different signals, such as fluorescent signals of different colors.
[0031] There is no specific order requirement for S100 and S300; they can be performed sequentially or simultaneously. Similarly, the same applies to S200 and S400. In some embodiments, S100 and S300 are parallel experiments performed simultaneously.
[0032] In a parallel experimental example, the materials and surface properties (such as hydrophilicity / hydrophobicity, surface size, etc.) of the first and second substrates in S100 and S300 are essentially the same or identical. In one example, the surfaces of the first and second substrates are substrates with the same surface treatment and material properties. In another example, the surfaces of the first and second substrates are different surface regions of the same substrate with the same surface treatment. For example, the surfaces of the first and second substrates in S100 and S300 are essentially identical in all aspects except for the probes immobilized, such as surface size, probe immobilization density, probe distribution, amount of nucleic acid to be tested, and reaction conditions. The terms "essentially identical" and "essentially the same" are the same as "identical" or "identical," meaning that the differences arising from different batches of preparation, processing, and / or parallel experiments are within the allowable deviation range.
[0033] The distribution or arrangement of the probes on the substrate surface is not limited. In this embodiment of the invention, the first probe is randomly or regularly distributed (e.g., in an array) on the first substrate surface, and similarly, the second probe is randomly or regularly distributed (e.g., in an array) on the second substrate surface. In parallel experiments, the distribution of the second probe on the second substrate surface is the same as the distribution of the first probe on the first substrate surface.
[0034] The first marker and the second marker can be different fluorescent dyes. In embodiments of the present invention, detecting signals on the surface of the first substrate to obtain a first detection result includes: taking a picture of the surface of the first substrate using an imaging system to obtain a first image; and detecting the first image to obtain the first detection result. Detecting signals on the surface of the second substrate to obtain a second detection result includes: taking a picture of the surface of the second substrate using an imaging system to obtain a second image; and detecting the second image to obtain the second detection result. The imaging system can be an optical detection device with an imaging system, including a light source, an objective lens, and a camera.
[0035] In an embodiment of the present invention, detecting a first image to obtain a first detection result further includes: detecting the first image to determine the number of locations Na1 where both a first signal and a second signal exist simultaneously on the surface of a first substrate and the number of locations Na3 where only the first signal exists; detecting a second image to obtain a second detection result further includes: detecting the second image to determine the number of locations Nb1 where both a first signal and a second signal exist simultaneously on the surface of a second substrate and the number of locations Nb3 where only the first signal exists.
[0036] Further, at least one of the following (a), (b), and (c) is performed to achieve the detection of specific and / or non-specific adsorption of the nucleic acid to be tested based on the first and second detection results: (a) determining the proportion of non-specific adsorption of the nucleic acid to be tested on the first substrate surface and the first probe using the formula (Nb1+Nb3) / (Na1+Na3); (b) determining the proportion of non-specific adsorption of the nucleic acid to be tested on the first probe using the formula Nb1 / (Na1+Na3); (c) determining the proportion of specific binding of the nucleic acid to be tested to the first probe using the formula (Na1+Na3-Nb1-Nb3) / (Na1+Na3).
[0037] The detection method for example images is described below with reference to the accompanying drawings. In this embodiment of the invention, the image contains multiple pixels. In the following example description, the detection of a first image is used as an example. It should be understood that the following image detection method is also applicable to the processing of a second image, and in parallel experiments of the same nucleic acid specific / non-specific adsorption detection example, such as the images of the experimental group and the control group of the same nucleic acid specific / non-specific adsorption detection scheme, the same processing method can be used to obtain reliable and comparable detection results.
[0038] like Figure 1 As shown, in one embodiment of the present invention, the image detection method includes: an optional image preprocessing step S11, which includes preprocessing a first image to obtain a preprocessed first image; and a bright spot detection step S12, which includes the steps of: S21, analyzing the first image to calculate a bright spot determination threshold; S22, analyzing the first image to obtain candidate bright spots; and S23, determining whether a candidate bright spot is a bright spot based on the bright spot determination threshold.
[0039] The image detection method described above processes the first image through an image preprocessing step, which reduces the computational load of the bright spot detection step. Simultaneously, by using a bright spot judgment threshold to determine whether candidate bright spots are indeed bright spots, the accuracy of bright spot detection in the image can be improved. It should be noted that the image preprocessing step S11 is employed to obtain better detection results; in other embodiments, the bright spot detection step can be performed directly on the image.
[0040] Specifically, in one example, the first image to be detected can be a 16-bit TIFF image of 512*512 or 2048*2048, and the TIFF image can be a grayscale image. This simplifies the processing of the image detection method.
[0041] In some implementations, the image preprocessing step S11 includes: performing background subtraction on the first image to obtain a preprocessed first image. This further reduces noise in the first image, improving the accuracy of the image detection method.
[0042] In some implementations, the image preprocessing step S11 includes: simplifying the first image after background subtraction to obtain a preprocessed first image. This reduces the computational load of subsequent image detection methods.
[0043] In some embodiments, the image preprocessing step S11 includes filtering the first image to obtain a preprocessed first image. Thus, filtering the first image allows for the acquisition of a preprocessed first image while preserving as many image detail features as possible, thereby improving the accuracy of the image detection method.
[0044] In some embodiments, the image preprocessing step S11 includes: performing background subtraction on the first image followed by filtering to obtain a preprocessed first image. Thus, performing background subtraction on the first image before filtering can further reduce noise in the first image, thereby improving the accuracy of the image detection method.
[0045] In some implementations, the image preprocessing step S11 includes: simplifying the first image after background subtraction and filtering to obtain a preprocessed first image. This reduces the computational load of subsequent image detection methods.
[0046] In some implementations, the image preprocessing step S11 includes: simplifying the first image to obtain a preprocessed first image. This reduces the computational load of subsequent image detection methods.
[0047] In some implementations, please refer to Figure 2 The steps for determining whether a candidate bright spot is a bright spot based on a bright spot determination threshold include: Step S31, finding pixels in the preprocessed first image that are connected to a value greater than (p*p-1) and using these pixels as the centers of the candidate bright spots. p*p corresponds one-to-one with a bright spot, and each value in p*p corresponds to a pixel. p is a natural number and is an odd number greater than 1. Step S32, determining whether the center of the candidate bright spot satisfies the following condition: I max *A BI *ceof guass >T, where I max A is the strongest intensity at the center of the p*p window. BI ceof represents the percentage of the preprocessed first image in the p*p window that is set to a certain value. guassLet be the correlation coefficient between the pixels of the p*p window and the two-dimensional Gaussian distribution, and T be the bright spot detection threshold. If the above conditions are met, in step S33, determine that the bright spot corresponding to the center of the candidate bright spot is a bright spot contained in the image to be processed; if the above conditions are not met, in step S34, discard the bright spot corresponding to the center of the candidate bright spot. In this way, bright spot detection is achieved.
[0048] Specifically, I max This can be understood as the strongest intensity at the center of the candidate bright spot. In one example, p=3, we search for pixels with connectivity greater than 8. These found pixels are then used as candidate bright spots. max The strongest intensity at the center of a 3x3 window is A. BI ceof represents the percentage of the preprocessed first image within a 3x3 window that is set to a certain value. guass The correlation coefficient is the pixel value of a 3x3 window and the two-dimensional Gaussian distribution.
[0049] The first image after preprocessing is a simplified image. For example, the first image after preprocessing can be a binarized image, meaning that the set values in the binarized image can be the values corresponding to pixels that meet set conditions. In another example, the binarized image can contain two values, 0 and 1, representing different attributes of pixels, with a set value of 1, A. BI This represents the percentage of 1s in the binarized image within a p*p window.
[0050] In another embodiment of the present invention, for the detection of captured images, each image contains multiple pixels. Taking a first image as an example, the detection of the first image includes: using a k*k matrix to detect bright spots in the first image, including determining that a bright spot corresponds to a matrix whose center pixel value is not less than any non-center pixel value, where k is an odd number greater than 1, and the k*k matrix contains k*k pixels. This method, based on the difference between the brightness / intensity of the signal generated by the marker and the brightness / intensity of the background, can simply and quickly detect images, detect and obtain signal information.
[0051] In some embodiments, the pixel value at the center of the matrix is greater than a first preset value, and any pixel value outside the center of the matrix is greater than a second pixel value.
[0052] The first and second preset values can be set based on experience or pixel / intensity data of normal bright spots in a certain amount of normal images. "Normal images" and "normal bright spots" can refer to images that appear normal to the naked eye, such as clear images, clean backgrounds, and uniform bright spot size and intensity. In one embodiment, the first and second preset values are related to the average pixel value of the image. For example, setting the first preset value to 1.4 times the average pixel value of the image and the second preset value to 1.1 times the average pixel value of the image can eliminate interference and obtain better bright spot detection results.
[0053] Specifically, in one example, the first image is a color image. A pixel in a color image has three pixel values. This color image can be converted to a grayscale image before image detection to reduce the computational load and complexity of the detection process. Methods for converting non-grayscale images to grayscale can be chosen, but are not limited to, using floating-point algorithms, integer methods, shift methods, or averaging methods. Alternatively, color images can be detected directly. The comparison of pixel values mentioned above can be viewed as a comparison of three-dimensional values or the size of an array with three elements. The relative sizes of multiple multi-dimensional values can be customized based on experience and needs. For example, if any two dimensions of a three-dimensional value 'a' are larger than the corresponding dimensions of a three-dimensional value 'b', then three-dimensional value 'a' can be considered greater than three-dimensional value 'b'.
[0054] In another example, the first image is a grayscale image, where the pixel values of the grayscale image are one-dimensional numerical values, and the pixel values of the grayscale image are the same as the grayscale values.
[0055] In one example, such as Figure 3 As shown, on a substrate surface, also known as the chip surface, which is a surface modified with epoxy groups, a probe (DNA capture strand-1, Capture DNA-1) labeled with Cy3 fluorescent dye at the end is added. The probe is an aminated probe with an amino group at the end. The probe reacts with the epoxy groups on the chip surface through -NH3 and is fixed to the substrate surface, that is, DNA capture strand-1 is chemically linked to the chip surface. Then, the chip surface is passivated with a passivation solution to block the unreacted epoxy groups.
[0056] The template strand, i.e. the nucleic acid to be tested, is added. The template strand is a DNA hybridization strand (target DNA) with Cy5 fluorescent dye molecules at the end and complementary to the base of the DNA capture strand-1. After hybridization, the surface is photographed by a fluorescence microscope such as total internal reflection fluorescence microscopy (TIRF) to obtain an image with signal spots / patches. (1) If two fluorescent signals are observed at the same location, it indicates that there is a fixed hybridized DNA double strand or a small amount of on-strand adsorption at that location, with a quantity of Na1; (2) If only a green fluorescent signal is observed, it indicates that there is only a capture strand and no hybridization strand at that location, with a quantity of Na2; (3) If only a red fluorescent signal is observed, it indicates that there is only a hybridization strand at that location, which is a case of non-specific adsorption of the hybridization strand on the substrate surface and fluorescence quenching of a very small amount of capture strand, with a quantity of Na3.
[0057] like Figure 4 As shown, on a substrate surface, also known as a chip surface, which is a surface modified with epoxy groups, another probe is fixed on the surface using the same reaction system and time. This probe is a DNA strand labeled with Cy3 fluorescent dye (DNA capture DNA-2), whose sequence is not complementary to the DNA hybridization strand.
[0058] Add the same hybridization template strand as above, i.e., the nucleic acid to be tested, and perform hybridization. After hybridization, the surface is imaged and photographed using a total internal reflection fluorescence microscope (TIRF) to obtain an image with fluorescent signal spots / spots. (1) If two fluorescent signals are observed at the same location, it indicates that there is a DNA double strand present at that location, which is a specific adsorption on the hybridization template strand, with a quantity of Nb1; (2) If only a green fluorescent signal is observed, it indicates that there is only a capture strand and no hybridization strand at that location, with a quantity of Nb2; (3) If only a red fluorescent signal is observed, it indicates that there is only a hybridization strand at that location, which is a non-specific adsorption of the hybridization strand on the substrate surface, with a quantity of Nb3.
[0059] Based on the above information, specific and non-specific adsorption can be quantitatively distinguished, and the non-specific adsorption of the nucleic acid to be tested on the chip surface and / or probe can be evaluated. For example, the ratio of non-specific adsorption of the nucleic acid to be tested on the first substrate surface and the first probe can be determined using the formula (Nb1+Nb3) / (Na1+Na3); the ratio of non-specific adsorption of the nucleic acid to be tested on the first probe can be determined using the formula Nb1 / (Na1+Na3); and the effective hybridization ratio of the nucleic acid to be tested and the first probe can be determined using the formula (Na1+Na3-Nb1-Nb3) / (Na1+Na3).
[0060] In another embodiment of the present invention, a method for detecting nonspecific adsorption of nucleic acids includes: S1000: reacting the nucleic acid to be tested with a third probe, wherein the third probe is fixed on the surface of a third substrate, the nucleic acid to be tested is labeled with a third label, the third probe is labeled with a fourth label, the nucleic acid to be tested and the third probe are not complementary, the third label can generate a third signal, and the fourth label can generate a fourth signal; S2000: detecting the signal on the surface of the third substrate to obtain a third detection result; S3000: reacting the nucleic acid to be tested with the surface of a fourth substrate; S4000: detecting the signal on the surface of the fourth substrate to obtain a fourth detection result; S5000: detecting the nonspecific adsorption of the nucleic acid to be tested based on the third detection result and the fourth detection result.
[0061] This method can be used to qualitatively or quantitatively detect the non-specific adsorption of target nucleic acids by probes on the substrate surface and / or on the substrate surface. By detecting the signal on the substrate surface through the detection system, non-specific adsorption can be qualitatively or quantitatively distinguished, and information such as the quantification and distribution of non-specific adsorption can be obtained. It can be used in chip manufacturing and all methods or applications involving chip-based nucleic acid detection, such as for evaluating the performance of empty chips (without probes) or capture chips (with probes), quality control of chip manufacturing, and prediction, analysis and comparison of the effectiveness of chip-based nucleic acid capture.
[0062] In the above method, the third signal and the fourth signal are distinguishable signals in terms of detection, that is, it is possible to detect that the third signal and the fourth signal are two different signals, such as fluorescent signals of different colors.
[0063] There is no specific order requirement for performing S1000 and S3000; they can be performed sequentially or simultaneously. Similarly, there is no order restriction for performing S2000 and S4000. In some embodiments, S1000 and S3000 are parallel tests and are performed simultaneously.
[0064] In a parallel experimental example, the materials and surface properties (such as hydrophilicity / hydrophobicity, surface size, etc.) of the third and fourth substrates in S1000 and S3000 are substantially the same or identical. In one example, the surfaces of the third and fourth substrates are substrates with the same surface treatment and material properties. In another example, the surfaces of the third and fourth substrates are different surface regions of the same substrate with the same surface treatment. For example, the surfaces of the third and fourth substrates in S1000 and S3000 are substantially identical in all aspects except for whether or not a probe is fixed, such as surface size, amount of nucleic acid to be tested, reaction conditions, etc. The fourth substrate surface differs from the third substrate surface in that it does not have a fixed probe; for example, it can be an empty substrate surface, i.e., a substrate surface without a probe. The terms "substantially identical" and "substantially the same" are the same as "identical" or "identical," meaning that the differences arising from different batches of preparation, treatment, and / or parallel experiments are within the allowable deviation range.
[0065] There are no restrictions on the distribution or arrangement of the third probe on the surface of the third substrate. In this embodiment of the invention, the third probe is randomly or regularly distributed (e.g., in an array) on the surface of the third substrate.
[0066] In one example, the first and second markers are different fluorescent dyes. In embodiments of the present invention, detecting signals on the surface of the third substrate to obtain a third detection result includes: taking a picture of the surface of the third substrate using an imaging system to obtain a third image; and detecting the third image to obtain the third detection result. Detecting signals on the surface of the fourth substrate to obtain a fourth detection result includes: taking a picture of the surface of the fourth substrate using an imaging system to obtain a fourth image; and detecting the fourth image to obtain the fourth detection result. The imaging system may be an optical detection device with an imaging system, including a light source, an objective lens, and a camera.
[0067] In an embodiment of the present invention, detecting the third image to obtain a third detection result further includes: detecting the third image to determine the number Nc3 of locations on the third substrate surface where only the third signal exists; detecting the fourth image to obtain a fourth detection result further includes: detecting the fourth image to determine the number Nd of locations on the fourth substrate surface where the third signal exists. Image detection can refer to the above example of detecting the first image.
[0068] The change in non-specific adsorption of the nucleic acid to be tested before and after the probe is fixed on the chip surface can be determined by the formula (Nc3-Nd) / Nc3, so as to realize the detection of non-specific adsorption of the nucleic acid to be tested based on the third and fourth detection results.
[0069] In one example, such as Figure 4As shown, on a substrate surface, also known as the chip surface, which is a surface modified with epoxy groups, a probe (DNA capture strand-2, Capture DNA-2) with Cy3 fluorescent dye labeled at the end is added. Its sequence is not complementary to the DNA hybridization strand. The probe is a single strand of DNA with terminal amino modification. It reacts with the epoxy groups on the chip surface modified with -NH3 to chemically link the DNA capture strand-2 to the chip surface. Then, the chip surface is passivated with a passivation solution to block the unreacted epoxy groups.
[0070] Then, a hybridization template strand, i.e., the nucleic acid to be tested, is added. The template strand is a Cy5 fluorescent dye molecule at the end, and hybridization is performed. After hybridization, the surface is photographed by a fluorescence microscope, including a total internal reflection fluorescence microscope (TIRF), and an image with a fluorescent signal can be obtained. (1) If two fluorescent signals are observed at the same location, it indicates that there is a DNA double strand present at that location, which is a specific adsorption on the hybridization template strand, with a quantity of Nc1; (2) If only a green fluorescent signal is observed, it indicates that there is only a capture strand and no hybridization strand at that location, with a quantity of Nc2; (3) If only a red fluorescent signal is observed, it indicates that there is only a hybridization strand at that location, which is a non-specific adsorption of the hybridization strand on the substrate surface, with a quantity of Nc3.
[0071] like Figure 5 As shown, on a substrate surface, also known as the chip surface, which is a surface modified with epoxy groups, the reaction system and reaction time are the same as the substrate surface described above, except that it does not contain a probe. Figure 4 Same example.
[0072] Next, the hybridization template strand, i.e., the nucleic acid to be tested, is added, and hybridization is performed. After hybridization, the surface can be imaged using a fluorescence microscope, including a total internal reflection fluorescence microscope (TIRF), to obtain images with fluorescence signals. These fluorescence signals reflect the non-specific adsorption of the nucleic acid to be tested on the chip surface, and the quantity Nd.
[0073] Then, the adsorption changes of the nucleic acid to be tested before and after the probe was immobilized on the substrate surface were evaluated and determined using the formula (Nc3-Nd) / Nc3.
[0074] In another embodiment of the present invention, the method for detecting specific and / or non-specific adsorption of nucleic acids includes: S10000: reacting the nucleic acid to be tested with a fifth probe, wherein the fifth probe is fixed on the surface of a fifth substrate, the nucleic acid to be tested and the fifth probe are at least partially complementary, the nucleic acid to be tested is labeled with a fifth label, the fifth probe is labeled with a sixth label, the fifth label is capable of generating a fifth signal, and the sixth label is capable of generating a sixth signal; S20000: detecting the signal on the surface of the fifth substrate to obtain a fifth detection result; S30000: reacting the nucleic acid to be tested with a sixth probe, wherein the sixth probe is fixed on the surface of a sixth substrate, the sixth probe is labeled with a sixth label, and the nucleic acid to be tested and the sixth probe are not complementary; S40000: detecting the signal on the surface of the sixth substrate to obtain a sixth detection result; S50000: reacting the nucleic acid to be tested with a seventh substrate surface; S60000: detecting the signal on the surface of the seventh substrate to obtain a seventh detection result; S70000: detecting the specific and / or non-specific adsorption of the nucleic acid to be tested based on at least two of the fifth detection result, the sixth detection result, and the seventh detection result.
[0075] This method can be used to qualitatively or quantitatively detect the non-specific and / or specific adsorption of target nucleic acids by probes on the substrate surface and / or on the substrate surface. By detecting the signal on the substrate surface through the detection system, specific and non-specific adsorption can be qualitatively or quantitatively distinguished, and information such as the quantification and distribution of non-specific or specific adsorption can be obtained. It can be used in chip manufacturing and all methods or applications involving chip-based nucleic acid detection, such as for evaluating the performance of empty chips (without probes) or capture chips (with probes), quality control of chip manufacturing, and prediction, analysis and comparison of the effectiveness of chip-based nucleic acid capture.
[0076] In the above method, the fifth signal and the sixth signal are distinguishable signals in terms of detection, that is, it is possible to detect that the fifth signal and the sixth signal are two different signals, such as fluorescent signals of different colors.
[0077] There is no specific order requirement for performing S10000, S30000, and S50000; they can be performed sequentially or simultaneously. Similarly, there is no order restriction for performing S20000, S40000, and S60000. In some embodiments, S10000, S30000, and S50000 are parallel tests and are performed simultaneously.
[0078] In a parallel experimental example, the materials, surface properties (such as hydrophilicity / hydrophobicity, surface size, etc.) of the fifth, sixth, and seventh substrates in S10000, S30000, and S50000 are basically the same or identical. In one example, the fifth, sixth, and seventh substrates are substrates with the same surface treatment and the same material properties. In another example, the fifth, sixth, and seventh substrates are different surface regions of the same substrate with the same surface treatment. For example, the surfaces of the fifth and sixth substrates in S10000 and S30000 are basically the same in terms of surface size, probe fixation density, probe distribution, amount of nucleic acid to be tested, and reaction conditions, except that the probes fixed to them are different. At the same time, the seventh substrate in S50000 is basically the same as the surfaces of the fifth and sixth substrates in S10000 and S30000, except that there are no fixed probes. The terms "basically consistent" and "basically identical" are the same as "consistent" or "identical," meaning that the differences arising from different batches of preparation, processing, and / or parallel testing are within the allowable deviation range.
[0079] The distribution or arrangement of the probes on the substrate surface is not limited. In this embodiment of the invention, the fifth probe is randomly or regularly distributed (e.g., in an array) on the fifth substrate surface, and similarly, the sixth probe is randomly or regularly distributed (e.g., in an array) on the sixth substrate surface. In parallel experiments, the distribution of the sixth probe on the sixth substrate surface is the same as that of the fifth probe on the fifth substrate surface.
[0080] The fifth and sixth markers can be different fluorescent dyes. In embodiments of the present invention, detecting signals on the surface of the fifth substrate to obtain a fifth detection result includes: taking a picture of the surface of the fifth substrate using an imaging system to obtain a fifth image; and detecting the fifth image to obtain the fifth detection result. Detecting signals on the surface of the sixth substrate to obtain a sixth detection result includes: taking a picture of the surface of the sixth substrate using an imaging system to obtain a sixth image; and detecting the sixth image to obtain the sixth detection result. Detecting signals on the surface of the seventh substrate to obtain a seventh detection result includes: taking a picture of the surface of the seventh substrate using an imaging system to obtain a seventh image; and detecting the seventh image to obtain the seventh detection result. The imaging system can be an optical detection device with an imaging system, including a light source, an objective lens, and a camera.
[0081] In embodiments of the present invention, detecting the fifth image to obtain a fifth detection result further includes: detecting the fifth image to determine the number of locations on the fifth substrate surface where both the fifth signal and the sixth signal coexist, Ne1, and the number of locations where only the fifth signal exists, Ne3. Detecting the sixth image to obtain a sixth detection result further includes: detecting the sixth image to determine the number of locations on the sixth substrate surface where both the fifth signal and the sixth signal coexist, Nf1, and the number of locations where only the fifth signal exists, Nf3. Detecting the seventh image to obtain a seventh detection result further includes: detecting the seventh image to determine the number of locations on the seventh substrate surface where the fifth signal exists, Ng. The image detection can refer to the above example of detecting the first image.
[0082] Further, at least one of the following (a), (b), (c), and (d) is performed to detect the specific and / or non-specific adsorption of the nucleic acid to be tested based on at least two of the fifth, sixth, and seventh detection results: (a) determining the proportion of the nucleic acid to be tested non-specifically adsorbed on the fifth substrate surface and the fifth probe using the formula (Nf1+Nf3) / (Ne1+Ne3); (b) determining the proportion of the nucleic acid to be tested non-specifically adsorbed on the fifth probe using the formula Nf1 / (Ne1+Ne3); (c) determining the proportion of the nucleic acid to be tested specifically bound to the fifth probe using the formula (Ne1+Ne3-Nf1-Nf3) / (Ne1+Ne3); and (d) evaluating the change in the adsorption of the nucleic acid to be tested before and after immobilizing the probe on the substrate surface using the formula (Nf3-Ng) / Nf3.
[0083] In one example, such as Figure 3 As shown, on a substrate surface, also known as the chip surface, which is a surface modified with epoxy groups, a probe (DNA capture strand-1, Capture DNA-1) labeled with Cy3 fluorescent dye at the end is added. The probe is an aminated probe with an amino group at the end. The probe reacts with the epoxy groups on the chip surface through -NH3 and is fixed to the substrate surface, that is, DNA capture strand-1 is chemically linked to the chip surface. Then, the chip surface is passivated with a passivation solution to block the unreacted epoxy groups.
[0084] The template strand, i.e. the nucleic acid to be tested, is added. The template strand is a DNA hybridization strand (target DNA) with Cy5 fluorescent dye molecules at the end and complementary to the base of the DNA capture strand-1. After hybridization, the surface is photographed by a fluorescence microscope such as total internal reflection fluorescence microscopy (TIRF) to obtain an image with signal spots / spots. (1) If two fluorescent signals are observed at the same location, it indicates that there is a fixed hybridized DNA double strand or a small amount of on-strand adsorption at that location, with a quantity of Ne1; (2) If only a green fluorescent signal is observed, it indicates that there is only a capture strand and no hybridization strand at that location, with a quantity of Ne2; (3) If only a red fluorescent signal is observed, it indicates that there is only a hybridization strand at that location, which is a case of non-specific adsorption of the hybridization strand on the substrate surface and fluorescence quenching of a very small amount of capture strand, with a quantity of Ne3.
[0085] like Figure 4 As shown, on a substrate surface, also known as a chip surface, which is a surface modified with epoxy groups, another probe is fixed on the surface using the same reaction system and time. This probe is a DNA strand labeled with Cy3 fluorescent dye (DNA capture DNA-2), whose sequence is not complementary to the DNA hybridization strand.
[0086] Add the same hybridization template strand as above, i.e., the nucleic acid to be tested, and perform hybridization. After hybridization, the surface is imaged and photographed using a total internal reflection fluorescence microscope (TIRF) to obtain an image with fluorescent signal spots / spots. (1) If two fluorescent signals are observed at the same location, it indicates that there is a DNA double strand present at that location, which is a specific adsorption on the hybridization template strand, with a quantity of Nf1; (2) If only a green fluorescent signal is observed, it indicates that there is only a capture strand and no hybridization strand at that location, with a quantity of Nf2; (3) If only a red fluorescent signal is observed, it indicates that there is only a hybridization strand at that location, which is a non-specific adsorption of the hybridization strand on the substrate surface, with a quantity of Nf3.
[0087] like Figure 5 As shown, on a substrate surface, also known as the chip surface, which is a surface modified with epoxy groups, the reaction system and reaction time are the same as the substrate surface described above, except that it does not contain a probe. Figure 4 Same example.
[0088] Next, the hybridization template strand, i.e., the nucleic acid to be tested, is added, and hybridization is performed. After hybridization, the surface can be imaged using a fluorescence microscope, including a total internal reflection fluorescence microscope (TIRF), to obtain images with fluorescence signals. These fluorescence signals reflect the non-specific adsorption of the nucleic acid to be tested on the chip surface, in terms of quantity (Ng).
[0089] Based on the above information, specific and non-specific adsorption can be quantitatively distinguished, and the non-specific adsorption of the target nucleic acid on the chip surface and / or probe can be evaluated. For example, the proportion of the target nucleic acid non-specifically adsorbed on the substrate surface and probe can be determined using the formula (Nf1+Nf3) / (Ne1+Ne3); the proportion of the target nucleic acid non-specifically adsorbed on the probe can be determined using the formula Nf1 / (Ne1+Ne3); the proportion of the target nucleic acid specifically bound to the probe can be determined using the formula (Ne1+Ne3-Nf1-Nf3) / (Ne1+Ne3); and the adsorption change of the target nucleic acid before and after the probe is fixed on the substrate surface can be evaluated using the formula (Nf3-Ng) / Nf3.
[0090] The technical solution of the present invention is described in detail below through embodiments. It should be understood that the embodiments are merely exemplary and should not be construed as limiting the scope of protection of the present invention. Unless otherwise specified, the materials, reagents, and sequences involved can be obtained through self-preparation and synthesis or commercially available means.
[0091] Example 1: Investigating the effect of nonspecific adsorption during DNA hybridization
[0092] Chip: Glass with epoxy groups on the surface (purchased from Schott);
[0093] Fixed strand 1 (EKB-6P-Cy3): A synthetically produced short DNA sequence with a -NH3 terminal and a fluorescent Cy3 dye. The specific sequence is as follows:
[0094] TTTTTTTTTTTACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAG-3' (SEQ IDNO: 1);
[0095] Fixed strand 2 (EKB-7P-Cy3): A synthetically produced short DNA sequence with a -NH3 terminal and a fluorescent Cy3 dye. The specific sequence is as follows:
[0096] TTTTTTTTTTCCACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCC TAC-3' (SEQID NO: 2);
[0097] Hybrid strand (EKB-6T-Cy5): A synthetically produced short DNA sequence that is complementary to fixed strand 1 and not complementary to fixed strand 2, containing the 35 bp test sequence and ending with the fluorescent Cy5 group. The sequence is as follows:
[0098] 5'-GATCACAGATTTTGGGCTGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTA-3' (SEQ ID NO: 3).
[0099] Experimental procedure:
[0100] Experimental group: After cleaning and drying the glass, it was placed in 150mM K2HPO4 and a solution containing 1.0M amino-modified fixed chain 1 (EKB-6P-Cy3) nucleic acid probe. The reaction was carried out at 37℃ for 0.5 hours. After washing with 3XSSC solution (containing 0.1% Triton), 3XSSC, and 0.15M K2HPO4 solution, 1M K2HPO4 was added and passivated at 37℃ for 17 hours.
[0101] Control group 1: After cleaning and drying the glass, it was placed in a solution of 150 mM K2HPO4 containing 1.0 M amino-modified immobilized chain 2 (EKB-7P-Cy3) nucleic acid probe and reacted at 37 °C for 0.5 hours. After washing with 3X SSC solution (containing 0.1% Triton), 3X SSC, and 0.15 M K2HPO4 solution, 1 M K2HPO4 was added and passivated at 37 °C for 17 hours.
[0102] Control group 2: After cleaning and drying the glass, it was placed in 150mM K2HPO4 solution and reacted at 37°C for 0.5 hours. After cleaning with 3XSSC solution (containing 0.1% Triton), 3XSSC, and 0.15M K2HPO4 solution in sequence, 1M K2HPO4 was added and passivated at 37°C for 17 hours.
[0103] Flow cell assembly: assembling passivated glass with other substrates or substrates to form a multi-channel chip.
[0104] Hybridization of the hybridization chain: The assembled multichannel flow cell was added to Rinse buffer (1XSSC + 150mM HEPES + 0.1% SDS) and reconstituted at 55°C for 0.5 hours. Then, a 1nM 3XSSC solution of the hybridization chain (EKB-6T-Cy5) was added and reacted at 55°C for 0.5 hours. The channels were then flushed sequentially with Rinse buffer (1XSSC + 150mM HEPES + 0.1% SDS) and Buffer H (150mM HEPES + 150mM NaCl).
[0105] Photographic inspection: TIRF is used to simultaneously photograph the chip surface.
[0106] The image was inspected using the method described above, including the identification, localization, and counting of bright spots / bright patches. The results are as follows:
[0107] The results of the experimental group are as follows Figure 6 As shown, the left image shows a Cy3 fluorescent spot in one field of view, and the right image shows a Cy5 fluorescent spot in the same field of view, with an overlap of approximately 80%.
[0108] Results of control group 1 are as follows Figure 7 As shown, the left image displays Cy3 fluorescent spots in one field of view, and the right image displays Cy5 fluorescent spots in the same field of view, with an overlap ratio of %.
[0109] Results of control group 2 are as follows Figure 8 As shown in the figure, this figure displays a Cy5 fluorescent spot in a field of view. The Cy5 fluorescent spot in this experiment is a non-specific adsorption of hybrid chains on the chip surface.
[0110] The above examples illustrate the present invention only to aid in understanding it and are not intended to limit the scope of the invention. Those skilled in the art can make various simple deductions, modifications, or substitutions based on the ideas of this invention. SEQUENCE LISTING <110> Shenzhen HanHai Gene Biotechnology Co., Ltd. <120> Methods for detecting specific and / or nonspecific adsorption of nucleic acids <130> 17I24937 <160> 3 <170> PatentIn version 3.3 <210> 1 <211> 56 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 1 tttttttttt ttactttgcc tccttctgca tggtattctt tctcttccgc acccag 56 <210> 2 <211> 60 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 2 tttttttttt tccacaaaat gattctgaat tagctgtatc gtcaaggcac tcttgcctac 60 <210> 3 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 3 gatcacagat tttgggctgg ccaaactgct gggtgcggaa gagaaagaat accatgcaga 60 aggaggcaaa gta 73
Claims
1. A method for detecting specific and / or non-specific adsorption of nucleic acids, characterized in that, The method includes: The nucleic acid to be tested is reacted with a first probe, the first probe is fixed on the surface of a first substrate, the nucleic acid to be tested is at least partially complementary to the first probe, the nucleic acid to be tested is labeled with a first label, the first probe is labeled with a second label, the first label is capable of generating a first signal, and the second label is capable of generating a second signal. Detect the signal on the surface of the first substrate to obtain a first detection result. The first detection result includes the number of locations on the surface of the first substrate where both the first signal and the second signal exist simultaneously, Na1, and the number of locations where only the first signal exists, Na3. The nucleic acid to be tested is reacted with the second probe, the second probe is fixed on the surface of the second substrate, the second probe is marked with the second label, and the nucleic acid to be tested and the second probe are not complementary; Detect the signal on the surface of the second substrate to obtain a second detection result. The second detection result includes the number of locations on the surface of the second substrate where both the first signal and the second signal exist simultaneously, Nb1, and the number of locations where only the first signal exists, Nb3. Based on the first detection result and the second detection result, detecting the specific and / or non-specific adsorption of the nucleic acid to be tested includes performing at least one of the following (a), (b) and (c): (a) The ratio of the nonspecific adsorption of the nucleic acid to be tested on the first substrate surface and the first probe is determined using the formula (Nb1+Nb3) / (Na1+Na3); (b) The proportion of the nucleic acid to be tested nonspecifically adsorbed on the first probe is determined using the formula Nb1 / (Na1+Na3); (c) The ratio of the nucleic acid to be tested to specifically bind to the first probe is determined using the formula (Na1+Na3-Nb1-Nb3) / (Na1+Na3).
2. A method for detecting nonspecific adsorption of nucleic acids, characterized in that, The method includes: The nucleic acid to be tested reacts with a third probe, which is fixed on the surface of a third substrate. The nucleic acid to be tested is labeled with a third label, and the third probe is labeled with a fourth label. The nucleic acid to be tested and the third probe are not complementary. The third label can generate a third signal, and the fourth label can generate a fourth signal. The signal on the surface of the third substrate is detected to obtain a third detection result, which includes the number of locations Nc3 on the surface of the third substrate where only the third signal exists. The nucleic acid to be tested reacts with the surface of the fourth substrate; The signal on the fourth substrate surface is detected to obtain a fourth detection result, the fourth detection result including the number Nd of locations where the third signal exists on the fourth substrate surface; Based on the third and fourth detection results, the detection of non-specific adsorption of the nucleic acid to be tested includes using the formula (Nc3-Nd) / Nc3 to determine the change in non-specific adsorption of the nucleic acid to be tested before and after the probe is fixed on the chip surface.
3. The method according to claim 1 or 2, characterized in that, The distribution of the first probe on the first substrate surface is selected from at least one of random distribution and regular distribution, and the distribution of the second probe on the second substrate surface is the same as the distribution of the first probe on the first substrate surface; and / or The distribution state of the third probe on the third substrate surface is selected from at least one of random distribution and regular distribution.
4. The method according to claim 1 or 2, characterized in that, (i) Detecting the signal on the first substrate surface to obtain the first detection result includes: taking a picture of the first substrate surface using an imaging system to obtain a first image; and detecting the first image to obtain the first detection result; The step of detecting the signal on the second substrate surface to obtain the second detection result includes: taking a picture of the second substrate surface using the imaging system to obtain a second image; and detecting the second image to obtain the second detection result; and / or (ii) The detection of the signal on the third substrate surface to obtain the third detection result includes: taking a picture of the third substrate surface using an imaging system to obtain a third image; and detecting the third image to obtain the third detection result; The step of detecting the signal on the fourth substrate surface to obtain the fourth detection result includes: taking a picture of the fourth substrate surface using the imaging system to obtain a fourth image; and detecting the fourth image to obtain the fourth detection result.
5. The method according to claim 4, characterized in that, (i) Detecting the first image to obtain the first detection result includes: detecting the first image to determine the number of locations Na1 where both the first signal and the second signal exist simultaneously on the first substrate surface and the number of locations Na3 where only the first signal exists. Detecting the second image to obtain the second detection result includes: detecting the second image to determine the number Nb1 of locations on the second substrate surface where both the first signal and the second signal coexist, and the number Nb3 of locations where only the first signal exists; and / or (ii) Detecting the third image to obtain the third detection result includes: detecting the third image to determine the number Nc3 of locations where only the third signal exists on the third substrate surface; Detecting the fourth image to obtain the fourth detection result includes: detecting the fourth image to determine the number Nd of locations where the third signal exists on the fourth substrate surface.
6. The method according to claim 4 or 5, characterized in that, In (i), the first image and / or the second image contains a plurality of pixels, and detecting the first image and / or detecting the second image includes: Bright spot detection is performed on the first image and / or the second image using a k*k matrix, including determining that a bright spot corresponds to a matrix whose center pixel value is not less than any non-center pixel value of the matrix, where k is an odd number greater than 1 and the k*k matrix contains k*k pixels. and / or In (ii), the third image and / or the fourth image contains multiple pixels, and detecting the third image and / or detecting the fourth image includes: Bright spot detection is performed on the third image and / or the fourth image using a k*k matrix, including determining that a bright spot corresponds to a matrix whose pixel value at the center of the matrix is not less than any pixel value outside the center of the matrix, where k is an odd number greater than 1, and the k*k matrix contains k*k pixels.
7. The method according to claim 6, characterized in that, In (i), the center pixel value of the matrix is greater than a first preset value, and any non-center pixel value of the matrix is greater than a second preset value.
8. The method according to claim 7, characterized in that, The first preset value and the second preset value are related to the average pixel value of the image.
9. The method according to claim 6, characterized in that, In (ii), the pixel value at the center of the matrix is greater than a first preset value, and the pixel value at any non-center of the matrix is greater than a second preset value.
10. The method according to claim 9, characterized in that, The first preset value and the second preset value are related to the average pixel value of the image.
11. The method according to claim 4 or 5, characterized in that, In (i), the first image and / or the second image contains a plurality of pixels, and detecting the first image and / or detecting the second image includes: The bright spot detection step includes: analyzing the first image and / or analyzing the second image to calculate a bright spot determination threshold; analyzing the first image and / or the second image to obtain candidate bright spots; determining whether the candidate bright spots are the bright spots based on the bright spot determination threshold; and / or In (ii), the third image and / or the fourth image contains multiple pixels, and detecting the third image and / or detecting the fourth image includes: The bright spot detection step includes: analyzing the third image and / or analyzing the fourth image to calculate a bright spot determination threshold, analyzing the third image and / or the fourth image to obtain candidate bright spots, and determining whether the candidate bright spots are the bright spots based on the bright spot determination threshold.
12. The method according to claim 11, characterized in that, The bright spot detection steps (i) and / or (ii) also include the following: The image preprocessing step includes preprocessing the first image, the second image, the third image and / or the fourth image to obtain the preprocessed first image, the preprocessed second image, the preprocessed third image and / or the preprocessed fourth image. The image preprocessing step includes performing at least one of the following (a), (b), (c), (d), (e), and (f): (a) Perform background reduction processing on the first image, the second image, the third image and / or the fourth image to obtain the preprocessed first image, the preprocessed second image, the preprocessed third image and / or the preprocessed fourth image; (b) Simplify the first image after background reduction processing, the second image after background reduction processing, the third image after background reduction processing and / or the fourth image after background reduction processing to obtain the preprocessed first image, the preprocessed second image, the preprocessed third image and / or the preprocessed fourth image. (c) Filter the first image, the second image, the third image and / or the second image to obtain a preprocessed first image, a preprocessed second image, a preprocessed third image and / or a preprocessed fourth image; (d) Perform background reduction processing on the first image, the second image, the third image and / or the fourth image and then perform filtering processing to obtain the preprocessed first image, the preprocessed second image, the preprocessed third image and / or the preprocessed fourth image; (e) Simplify the first image after background reduction and filtering, the second image after background reduction and filtering, the third image after background reduction and filtering, and / or the fourth image after background reduction and filtering to obtain the preprocessed first image, the preprocessed second image, the preprocessed third image, and / or the preprocessed fourth image. (f) Simplify the first image, the second image, the third image and / or the fourth image to obtain a preprocessed first image, a preprocessed second image, a preprocessed third image and / or a preprocessed fourth image.
13. The method according to any one of claims 12(b), (e), and (f), characterized in that, The step of determining whether the candidate bright spot is the bright spot according to the bright spot determination threshold includes: finding a pixel point that is connected to a value greater than (p*p-1) in the preprocessed first image, preprocessed second image, preprocessed third image and / or preprocessed fourth image, and taking the found pixel point as the center of the candidate bright spot, where p is a natural number and is an odd number greater than 1; Determine whether the center of the candidate bright spot meets the following condition: I max *A BI *ceof guass >T, where I max A is the strongest intensity at the center of the p*p window. BI The percentage of the preprocessed first image, preprocessed second image, preprocessed third image, and / or preprocessed fourth image in the p*p window, where a set value is represented, ceof guass Let T be the correlation coefficient between the pixels of the p*p window and the two-dimensional Gaussian distribution, and let T be the bright spot determination threshold. If the above conditions are met, the candidate bright spot is determined to be a bright spot.
Citation Information
Patent Citations
Microarray and method of designing negative control probes
CN101970693A