Compounds and compositions comprising phosphorothioated oligodeoxynucleotides and methods of use thereof
Patent Information
- Application Number
- CN201680073019.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2015-10-15
- Filing Date
- 2016-10-14
- Publication Date
- 2026-09-29
- Estimated Expiration
- 2036-10-14
Smart Images

Figure CN108367021B_ABST
Abstract
Description
[0001] Cross-references to related applications
[0002] This application claims the benefit of U.S. Provisional Application Serial No. 62 / 242,189, filed October 15, 2015, which is incorporated herein by reference in its entirety and for all purposes.
[0003] By referencing and incorporating into the sequence list The contents of a 15,873-byte txt file named 48440-588001WO_ST25.TXT, created on October 14, 2016, are incorporated into this article in their entirety by reference.
[0004] Public background Acute myeloid leukemia is characterized by the accumulation of immature bone marrow progenitor cells. Leukemia is caused by dysregulation of oncogenes, tumor suppressor factors, or transcription factors that control myeloid differentiation, self-renewal, and / or proliferation. This disclosure relates to the treatment of cancer. For example Compounds, compositions, and methods for treating AML, CML, and myelodysplastic syndromes, wherein antimiR and miRNA mimics are stable and suitable for systemic administration to prevent disseminated cancer.
[0005] Public brief On the one hand, this article provides compounds containing phosphorylated CpG oligodeoxynucleotides (CpG-ODNs) conjugated to antimicroRNA (antimiR) or microRNA (miRNA)-mimetic nucleic acid sequences (miRNA mimics).
[0006] On the other hand, this article provides compounds containing antimicroRNA (antimiR) sequences, wherein the antimiR sequence contains one or more phosphate thioester bonds and one or more chemically modified nucleotides.
[0007] On the other hand, this article provides pharmaceutical compositions comprising pharmaceutically acceptable excipients and compounds described herein.
[0008] On the other hand, this article provides a method for treating a disease in a subject in need. This method includes administering an effective amount of the compound or pharmaceutical composition described herein to the subject.
[0009] On the other hand, this article provides a method for reducing microRNA activity in cells. This method involves contacting cells with an effective amount of the compounds described herein.
[0010] Other features and advantages of this disclosure will become apparent from the following detailed description and claims.
[0011] Unless otherwise stated, all publications, references, patents and / or patent applications cited herein are incorporated herein in their entirety for all purposes. Brief description of the attached diagram Figure 1 This is a schematic diagram illustrating the design of chemically stable CpG-antimiR-126 RNA oligonucleotides. An asterisk (*) indicates a phosphate thioester bond; and mN indicates a nucleotide modified with 2'OMe.
[0013] Figure 2A-2D This is a flow cytometry histogram showing the results of an uptake assay in normal cells, umbilical cord blood cells, acute myeloid leukemia (AML), and chronic myeloid leukemia (CML) CD34+ cells. Normal (NL) cells, umbilical cord blood (CB) cells, AML, and CML34+ cells were cultured for 16 hours with CpG-randomized RNA (500 nM) and the CpG-miR126 inhibitor Cy3 (500 nm). Figure 2A This is a histogram showing the uptake in NL / CB cells with 600 CpG siRNAs. Figure 2B This is a histogram showing NL / CB cells with 500 CpG-siRNAs. Figure 2C It is a histogram showing the uptake in AML cells. Figure 2D This is a histogram showing uptake in CML cells. Uptake was measured by Cy3 expression in these cells using flow cytometry.
[0014] Figure 3A-3G This is a flow cytometry histogram showing the results of CpG-antimiR-126 uptake in AML and CML cell lines. Cells were cultured for 4 hours with nanoparticles (NPs) conjugated with transferrin (TF-200nM) containing miR126-inhibitor-Cy3 (Cy3-200nM, human CD45 (Ab-200nM)) or antagonistic miR-126-Cy3, CpG-miR126 inhibitor-Cy3 (CpG-Cy3-200nM and 500nM), and then uptake was analyzed by measuring Cy3 expression in these cells by flow cytometry. Figure 3A It is a histogram showing the uptake in K562 cells. Figure 3B This is a histogram showing the uptake in KG1A AML cells. Figure 3C This is a histogram showing uptake in MV4-11 AML cells. Figure 3D This is a histogram showing uptake in Molm13 AML cells. Figure 3E This is a histogram showing uptake in NB4 AML cells. Figure 3F It is a histogram showing the uptake in OCI AML cells. Figure 3GThis is a histogram showing uptake in HL60 AML cells.
[0015] Figure 4A-4G This is a bar graph showing miRNA 126 expression in AML and CML cell lines. NP cells were cultured for 24 hours with either miR126-inhibitor-Cy3 (Cy3-200nM, human CD45 (Ab-200nM), or transferrin (TF-200nM) conjugated with antagonistic miR-126-Cy3, CpG-miR126 inhibitor-Cy3 (CpG-Cy3-200nM and 500nM), and then miR126 and RNU44 (control) expression in these cells were analyzed by q-RTPCR. miR126 expression levels were normalized to RNU44 and compared using a comparative 2- -ΔΔCt Method calculation. Figure 4A This is a bar graph showing the expression of miRNA 126 in the K562 CML cell line. Figure 4B This is a bar graph showing the expression of miRNA126 in the KG1A AML cell line. Figure 4C This is a bar graph showing the expression of miRNA 126 in the MV4-11 AML cell line. Figure 4D This is a bar graph showing the expression of miRNA 126 in the Molm13 AML cell line. Figure 4E This is a bar graph showing the expression of miRNA 126 in the NB4 AML cell line. Figure 4F This is a bar graph showing the expression of miRNA126 in the OCI AML cell line. Figure 4G This is a bar graph showing the expression of miRNA 126 in the HL60 AML cell line.
[0016] Figure 5 This is a bar graph showing miRNA 126 expression in NL / CB, AML, and CML CD34+ cells. Normal cells, umbilical cord blood cells, AML, and CML CD34+ cells were cultured for 24 hours with CpG-randomized RNA (500 nM) and the CpG-miR 126 inhibitor Cy3 (500 nM). miR126 and RNU44 (control) expression were analyzed by qRT-PCR. miR126 expression levels were normalized to RNU44 and compared using a comparative 2- -ΔΔCt Method calculation.
[0017] Figure 6This is a bar graph showing higher miR126 expression in CML CD34+CD38- primitive progenitor cells compared to CD34+CD38- directed progenitor cells. CML CD34+, CD34+CD38+ directed, and CD34+CD38- primitive progenitor cells were sorted, and miR126 and RNU44 (control) expression in these cells were analyzed by Q-RT-PCR. miR126 expression levels were normalized to RNU44 and calculated using the comparative 2-ΔΔCt method.
[0018] Figure 7 This is a bar graph showing a significant decrease in miR126 expression in CML CD34+CD38+ directed and CD34+CD38- progenitor cells treated with a CpG-miR126 inhibitor. CML CD34+CD38+ directed and CD34+CD38- progenitor cells were cultured for 36 hours with either CpG-randomized RNA (500 nM) or a CpG-miR126 inhibitor (500 nM), and miR126 and RNU44 (control) expression in these cells were analyzed by q-RT-PCR. miR126 expression levels were normalized to RNU44 and compared using a comparative 2- -ΔΔCt Method calculation.
[0019] Figure 8 This is a series of figures showing increased apoptosis in CML CD34+, CD34+CD38+ directed, and CD34+CD38- primitive progenitor cells treated with CpG-miR126 inhibitor and nilotinib (NIL). CML CD34+, CD34+CD38+ directed, and CD34+CD38- primitive progenitor cells were cultured for 72 hours with CpG-random RNA (500 nM), CpG-miR126 inhibitor (500 nM), CpG-random RNA (500 nM) + nilotinib (5 μM), and CpG-miR126 inhibitor (500 nM) + NIL (5 μM), followed by Annexin V / DAPI staining analysis for apoptosis.
[0020] Figures 9A-9D This is a series of cell sorting maps showing increased cell cycle in CD34+CD38- cells after miR-12 knockdown. Sorting normal cells (NL; Figures 9A-9B ) and CML human CD34+CD38- cells ( Figure 9C-9D Then, cells were cultured for 72 hours with 500 nm CpG-miR126 inh-Cy3 or CpG-SCR control, and the cell cycle was analyzed by EDU / DAPi staining. Increased cell cycle was observed in human CD34+CD38- cells after miR-126 knockdown. Figure 9D).
[0021] Figure 10A -D is a series of cell sorting maps showing increased cell cycle in normal (NL) and CML LTHSCs after miR-126 knockdown. Normal (NL) and CML mouse LTHSCs (Lin-Sca-1+Kit+Fit3-CD150+CD48- cells) were sorted and then treated with a 500nm CpG-miR126 inhibitor or CpG-SCR for 72 h, followed by cell cycle analysis by EDU / DAPi staining. Increased cell cycle was observed in both NL and CML LTHSCs after miR-126 knockdown. Figure 10D ).
[0022] Figure 11A -B is a bar graph of the cell sorting experiment, showing that compared with SCR+NIL, LSCs exhibited significantly increased apoptosis and significantly decreased cell growth. Mouse CML leukemia stem cells (LSCs, Lin-Sca-1+c-kit+Fit3-CD150+CD48-) were sorted and treated with either a CpG-anti-miR-126 inhibitor or CpG-SCR (500 nM) for 48 hours, followed by further treatment with either a miR126 inhibitor + NIL or SCR + NIL for 72 hours. Apoptosis and cell growth were then measured. Compared with SCR+NIL, CpG-anti-miR126 inhibitor + NIL significantly increased apoptosis in LSCs. Figure 11A Cell growth was significantly reduced. Figure 11B ).
[0023] Figure 12A It is a scatter plot and Figure 12B-12C The bar graph shows a significant increase in cell cycle and apoptosis compared to SCR+Ara-c+Doxo, leading to decreased cell growth. AMLCD34+ cells were cultured for 48 hours with CpG-antimiR-126 or CpG-SCR (500 nM), then further cultured for 72 hours with miR126 inh+Ara-c+Doxo or SCR+A+D. Cell cycle and apoptosis were then analyzed. Figure 12B ) and cell growth ( Figure 12C Compared with SCR+Ara-c+Doxo, the combination of CpG-antimiR-126 inhibitors with Ara-c and Doxo significantly increased cell cycle and apoptosis, leading to reduced cell growth.
[0024] Figure 13A -D is a scatter plot showing the bone marrow (BM) levels in mice treated with NIL+miR126 inhibitors compared to mice treated with NIL+SCR. Figure 13C ) and spleen ( Figure 13DA decrease in spleen weight was observed in () Figure 13B ) and CML cell reduction. SCLtTA / BCR-ABL mice were treated for 3 weeks with CpG-miR-126 inhibitor (5 mg / kg, IV every other day), SCR (5 mg / kg, IV every other day), NIL (50 mg / kg, IV once daily) + SCR, NIL + miR-126 inhibitor, and then PB ( Figure 13A ), BM Figure 13C ) and spleen ( Figure 13D The remaining CML cells in the PB of mice treated with NIL+SCR showed a decrease in CML leukocytes compared to mice treated with NIL+miR126 inhibitors. Figure 13A Compared with mice treated with NIL+SCR, mice treated with NIL+miR126 inhibitors had lower BM ( Figure 13C ) and spleen ( Figure 13D A decrease in spleen weight was observed in () Figure 13B ) and CML cell reduction.
[0025] Figure 14A -D is a scatter plot showing the bone marrow (BM) levels in mice treated with NIL+miR126 inhibitors compared to mice treated with NIL+SCR. Figure 14A , 14C ) and spleen ( Figure 14B , 14D A reduction in CML LSK and LSCs was observed in mice treated with CpG-miR-126 inhibitor, SCR, NIL+SCR, and NIL+miR-126 inhibitor for 3 weeks. Residual CML LSK blast cells and LSCs in the BM and spleen were then analyzed. Compared to mice treated with NIL+SCR, mice treated with NIL+miR-126 inhibitor showed a significant reduction in BM (…). Figure 14A , 14C ) and spleen ( Figure 14B , 14D A decrease in CML LSK and LSC was observed in the study.
[0026] Figure 15 Stability of CpG-antimiR. Half-life of chemically modified CpG-antimiR in 50% human serum. CpG-antimiR was incubated in 50% human serum at 37°C for up to 7 days. Samples were then decomposed on a 7.5 M urea / 20% PAGE gel and stained with ethidium bromide. Representative gels of CpG-antimiR155 are shown. The figure shows the quantification of band intensity from three independent experiments. The estimated half-life is shown in the figure.
[0027] Figures 16A-16B CpG-mediated selective uptake of miR146a by cells. Figures 16A-16B In the absence of any transfection reagent, target immune cells and leukemia cells underwent dose- and time-dependent internalization of CpG-anti-miR146a. CpG-anti-miR146a was labeled with Cy3 for intracellular uptake in target cells, which was detected by flow cytometry. Figure 16A Human immune cells were incubated with a specified concentration of CpG-antimiR146acY3 for 1 hour. The uptake of CD14+ monocytes, CD1c+ mDCs, CD3+ T cells, and CD19+ B cells was measured using flow cytometry. Figure 16B Cultured human AML cells KG1a, MOLM13, and MOLM14 cells rapidly internalized CpG-anti-miR146aco even at low concentrations.
[0028] Figure 17A-17F CpG-inhibitory effect against miR155. Figure 17A-17F CpG-anti-miR155 treatment reduced miR-155 expression in human and mouse bone marrow cells. Mouse RAW264.7 macrophages (…) Figure 17A ) and DC2.4 (dendritic cells) Figure 17B ) and human MV4-11 AML cells ( Figure 17C Incubate with 100 nM CpG-antimiR155 or CpG-randomized RNA (negative control) for 18 hours, then treat with 1 vg / ml LPS for 4 hours. KG1a ( Figure 17D ), MOLM13 ( Figure 17E ) and MOLM14 ( Figure 17F Cells were incubated with 100 nM CpG-anti-miR155 or CpG-randomized RNA for 18 hours. Mature miR-155 expression was measured by qPCR and normalized to snoRNA234 levels. The miR-155 expression level in untreated samples was set to 1.0. Data are presented as mean ± SEM (n=3). *P<0.05.
[0029] Figures 18A-18F CpG-inhibitory effect against miR125b. Figures 18A-18F CpG-anti-miR125b treatment reduced miR-125b expression in various cell models. RAW264.7 ( Figure 18A DC2.4 Figure 18B ) and MV4-11 ( Figure 18CCells were incubated with 100 nM CpG-antimiR125b or CpG-randomized RNA (negative control) for 18 hours, then treated with 1 vg / mILPS for 4 hours. Human AML cells-KG1a ( Figure 18D ), MOLM13 ( Figure 18E ) and MOLM14 ( Figure 18F Incubate with 100 nM CpG-anti-miR125b or control CpG-randomized RNA for 18 hours. Mature miR-125b expression was measured by qPCR and normalized to snoRNA234 levels. The miR-125b expression level in untreated samples was set to 1.0. Data are presented as mean ± SEM (n=3). *P<0.05.
[0030] Figures 19A-19H CpG-inhibitory effect against miR146a. Figures 19A-19F CpG-anti-miR146a treatment reduced miR-146a expression in human and mouse bone marrow cells. Mouse RAW264.7 macrophages (…) Figure 19A ) and DC2.4 (dendritic cells) Figure 19B ) and people MV4-11 ( Figure 19C ) and KG1a AML ( Figure 19D Cells were incubated with 100 nM CpG-anti-miR146a or CpG-randomized RNA (negative control) for 18 hours, then treated with 1 vg / ml LPS for 4 hours. KG1a and MOLM13 ( Figure 19E ) and MOLM14 ( Figure 19F Cells were incubated with 100 nM CpG-antimiR146a or CpG-random RNA for 18 hours. Figure 19G-19H ) mouse CMM AML cells ( Figure 19G ) and A20 lymphoma cells ( Figure 19H Incubate with 100 nM CpG-miR146a simulant for 18 hours. The expression level of mature miR-146a was measured by qPCR and normalized to snoRNA234. The miR-146a expression level in untreated samples was set to 1.0. Data are presented as mean ± SEM (n=3). *P<0.05.
[0031] Figure 20A-20D The effect of CpG-antimiRNA on downstream targets. Figures 20A-20CCpG-anti-miR regulates downstream targets of miR155, miR125b, and miR146a. Mouse RAW264.7 or human MV4-11 cells were incubated with 250 nM or 500 nM CpG-anti-miR155, CpG-anti-miR125b, or CpG-anti-miR146a, or 500 nM CpG-disordered compound for 48 hours. Cell lysates were then collected and electrophoresed, and the lysate was analyzed by targeting SHIP1 (a miR155 target). Figure 20A ), IRF4 (miR125b target) Figure 20B ) or IRAK1 (miR146a target) Figure 20C Immunoblotting was performed using antibodies against β-actin. Band intensity was normalized and quantified against β-actin. The fold increase in induction compared to control protein levels is indicated below the blot. Figure 20D MV4-11 cells were incubated with 500 nM CpG-antimiR155, CpG-antimiR125b, CpG-antimiR146a or CpG-disordered agent for 24 hours. Cell lysates were then collected and subjected to electrophoresis and Western blotting to detect activated caspase 3, which indicates apoptosis-induced cell death.
[0032] Figures 21A-21H Compare the inhibitory effects of CpG-antimiR and GpC-antimiR. Figures 21A-21D CpG-anti-miR155, GpC-anti-miR155, CpG-anti-miR146a, and GpC-anti-miR146a treatments reduced RAW264.7 ( Figure 21A , 21C ) and A20 cells ( Figure 21B , 21D The cells expressed miR155 or miR-146a. Cells were incubated with 100 nM CpG-anti-miR or GpC-anti-miR for 18 hours. Figure 21E-21H CpG-anti-miR and GpC-anti-miR treatments modulate downstream targets of miR155 and miR146a. RAW264.7 ( Figure 21E , 21G ) or A20 cells ( Figure 21F , 21H Cells were incubated with 500 nM CpG-anti-miR155, GpC-anti-miR155 or CpG-anti-miR146a, GpC-anti-miR146a for 48 hours, and then the cell lysates were collected and immunoblotted using antibodies against SHIP1 (target of miR155) or IRAK1 (target of miR146a). Figures 22A-22E CpG-miR146a mimics attenuate LPS-induced inflammatory signaling. Figures 22A-22BCpG-miR146a mimics increased the number of cultured CMM leukemia cells. Figure 22A ) and A20 lymphoma cells ( Figure 22B miR-146a expression in ) was detected. Cells were incubated with 100 nM CpG-miR146a mimic for 18 hours. Figure 22C CpG-miR146a mimics inhibited the expression of IRAK1, a downstream target of miR146a. A20 cells were incubated with 500 nM of CpG-miR146a mimics or LPS (as a positive control) for 48 hours, and then cell lysates were collected and immunoblotted using an IRAK1-specific antibody. Figure 22D-22E RAW-Blue cells expressing the NF-KB responsive reporter gene were treated with 500 nM CpG-miR146a mimic for 24 hours, followed by treatment with 1 pg / ml LPS for another 24 hours. The culture medium was collected, and NF-KB activity was analyzed using the Quanti-Blue assay kit. Figure 22D ), using ELISA to analyze IL-6 levels ( Figure 22E ).
[0033] Figure 23A-23K The in vitro and in vivo efficacy of CpG-miR-126 inhibitors and their gene silencing effects. In K562 cells, CpG-miR-126 inhibitor-Cy3 (CpG), Ab-NP containing miR-126 inhibitor-Cy3 (Ab-NP), TF-NP (TF-NP), or naked miR-126 inhibitor-Cy3 (in...) were added. Figure 23A (and B marked as control) 4 hours ( Figure 23A ) and 24 hours Figure 23B The uptake test was then measured by flow cytometry. 。 The experiment was repeated twice. miR-126 expression in K562 cells was measured by Q-RT-PCR at 24 hours (n=3). Figure 23C The number of cells in HUVECs was measured by flow cytometry 4 hours after the addition of the CpG-miR-126 inhibitor Cy3 (500 nM). Figure 23D ), normal person ( Figure 23E ) and CML ( Figure 23F CD34 + CD38 - Cellular uptake. The results show HUVECs treated with a CpG-miR-126 inhibitor (500 nM) for 24 hours. Figure 23G ),normal( Figure 23H ) and CML ( Figure 23I CD34 + CD38 -miR-126 expression in cells (n=4). This shows the effect of treatment with a CpG-miR-126 inhibitor (500 nM) on normal cells. Figure 23J ) and CML ( Figure 23K CD34 + CD38 - One of two cell cycle assays performed in cells using EDU staining. Abbreviations: ab-NP (CD45 antibody-conjugated nanoparticles); TF-NP (transferrin (TF)-conjugated nanoparticles).
[0034] Figure 24A-24I The combination of CpG-miR-126 inhibitor knockdown of miR-126 and in vivo NIL enhanced the elimination of CML-like sclerosis cells in mice. BM cells from SCL-tTA / BCR-ABL mice (CD45.2) were transplanted into B6 mice (CD45.1, n=40) to generate a mouse population with CML-like disease. After confirming CML development 4 weeks after transplantation, mice were randomly assigned to four groups (n=10 per group) and treated for 3 weeks with CpG-miR-126 inhibitor (5 mg / kg, IV four times weekly), CpG-scrRNA (5 mg / kg, IV four times weekly), CpG-miR-126 inhibitor + NIL (50 mg / kg, IV once daily), and CpG-scrRNA + NIL. Peripheral blood (PB) was measured after 3 weeks of treatment. Figure 24A ),spleen( Figure 24B ) and bone marrow (BM)( Figure 24C The percentage of donor CML cells in the spleen () Figure 24D ) and BM ( Figure 24E The number of donor CML LSKs in ) Figure 24D ), and spleen ( Figure 24F ) and BM ( Figure 24G The number of donor CML long-term hematopoietic stem cells (LTHSCs) in the mice. Another group of mice was treated for 3 weeks, followed by a survival study 3 weeks after treatment (n=10 per group). Figure 24H BM cells (CD45.2) were collected from treated leukemia mice (3 weeks old) and 4 × 10⁻⁶ cells were added. 6 2×10 6 1×10 6 and 5×10 5 One cell / mouse was transplanted into 900 cGy-irradiated secondary congener CD45.1 recipient mice (n = 6 mice / dose / condition × 4 doses × 4 conditions = 96 mice). CML cell engraftment and leukemia development in the recipient mouse blood were monitored by WBC counts for 16 weeks. LIC frequency was quantified using L-Calc software. Figure 24IAbbreviations: NIL (nilotinib); PB (peripheral blood); BM (bone marrow); LTHSC (long-term hematopoietic stem cells); LIC (leukemia initiating cells); LSK (lineage: Sca-1+c-kit+ cells).
[0035] Figure 25A-25O In vitro and in vivo uptake and gene silencing effects of CpG-miR-126 inhibitors. Mouse CML BM, LTHSC, and EC cells were treated with the CpG-miR-126 inhibitor Cy3 (500 nM) for 4 hours, and Cy3 levels were then detected by flow cytometry. + cell( Figure 25A Cells were also collected within 24 hours, and miR-126 expression was measured by Q-RT-PCR. Figure 25B Cell cycle was measured by EDU staining 72 hours after adding a CpG-miR-126 inhibitor to CML BM LTHSC. Figure 25C One of two representative plots is shown in the figure. CML mice were treated with the CpG-miR-126 inhibitor Cy3 at a single dose (5 mg / kg, intravenously), and Cy3 uptake in BM, LTHSC, and EC was measured by flow cytometry 16 hours after treatment. Figure 25D Normal and CML mice were also treated with a CpG-miR-126 inhibitor (5 mg / kg / day, intravenously, once daily) for 3 days, and miR-126 expression was measured by sorting BM, LTHSC, and EC from the femur and then by Q-RT-PCR. Figure 25E-25F Wild-type B6 mice were treated with either CpG-scrRNA (scrRNA) or a CpG-miR-126 inhibitor (inhibitor) (5 mg / kg / day, intravenously) for 3 weeks, and BM cells were collected and analyzed. Red blood cells (RBCs) were shown. Figure 25G WBC Figure 25H ), PLT ( Figure 25I ), BM mononuclear cells ( Figure 25J ), LTHSC Figure 25K ) and EC ( Figure 25L The number of BM cells (CD45.2) from treated normal mice was transplanted into CD45.1 homologous recipient mice, and blood counts were monitored at 16 weeks. Figure 25M ) and BM and spleen ( Figure 25N Donor cell implantation in ) and BM at 16 weeks ( Figure 25O The number of donor LTHSCs. The results shown are expressed as mean ± SEM. ∗ p<0.05, ∗∗ p<0.01, ∗∗∗p<0.001. Abbreviations: EC (endothelial cells); PLT (platelets).
[0036] Figures 26A-26E miR-126 was effectively knocked down using miR-126 inhibitors conjugated with CpG, GpC, and PS, and effectively overexpressed using miR-126 mimics in K562 and MV4-11 cells. (The text repeats itself here: miR-126 inhibitors conjugated with CpG, GpC, and PS...) Figures 26A-26B ) or miR-126 simulants (615, 616 and 617) Figure 26C-26D K562 and MV4-11 cells were treated with 500 nM for 24 hours, and miR-126 expression in these cells was measured. We demonstrated that the CpG motif can be omitted from the targeting ODN sequence. GpC and fully PS-modified oligomers also successfully blocked miR-126. Incubation with miR-126 mimics (particularly GM617) significantly increased miR-126 expression in K562 and MV4-11 cells. Similar to CpG-miR-126 inhibitors, which are highly effective in reducing miR-126 in cells, we also designed miR-126 mimics that are highly effective in increasing miR-126 levels in cells without the use of any transduction agents. Figure 26E This article describes the sequence list.
[0037] Public details Among other things, this document provides compounds comprising phosphorylated CpG oligodeoxynucleotides (CpG-ODNs) conjugated to an antimicroRNA (antimiR) or a microRNA (miRNA) mimic nucleic acid sequence (miRNA mimic), or compounds comprising an antimicroRNA (antimiR) sequence, wherein the antimiR sequence contains one or more phosphate thioester bonds and one or more chemically modified nucleotides. In embodiments, the compounds described herein promote the internalization of antimiR and / or miRNA mimics. In embodiments, the modifications / conjugates used herein promote the expulsion of the compounds described herein from endosomes. In embodiments, the modifications / conjugates used herein stabilize the antimiR and / or miRNA mimics used herein.
[0038] definition The following definitions are included to understand the subject matter and to construct the appended patent claims. The abbreviations used herein have their conventional meanings in the fields of chemistry and biology.
[0039] Unless otherwise defined, the technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. See, for example, Singleton et al. 2nd edition, J. Wiley & Sons (New York, NY 1994); Sambrook et al. , Cold Springs Harbor Press (Cold Springs Harbor, NY 1989). Any methods, apparatus, and materials similar or equivalent to those described herein may be used in the practice of this disclosure. The following definitions are provided to facilitate understanding of certain terms frequently used herein and are not intended to limit the scope of this disclosure.
[0040] "Nucleic acid" refers to deoxyribonucleotides or ribonucleotides in single-stranded, double-stranded, or multi-stranded form, their polymers, or their complement. The term "polynucleotide" refers to a linear nucleotide sequence. The term "nucleotide" typically refers to a single unit of a polynucleotide, i.e. monomer Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms thereof. Examples of polynucleotides considered herein include single-stranded and double-stranded DNA, single-stranded and double-stranded RNA (including siRNA), and hybrid molecules having mixtures of single-stranded and double-stranded DNA and RNA. Nucleic acids can be linear or branched. For example, nucleic acids can be linear nucleotide chains, or nucleic acids can be branched, such that the nucleic acid contains one or more nucleotide arms or branches. Optionally, branched nucleic acids repeat branching to form higher-order structures, such as dendritic polymers, etc.
[0041] Nucleic acids, including those having a thiophosphate backbone, may include one or more reactive moieties. As used herein, the term reactive moiety includes any group capable of reacting with another molecule, such as a nucleic acid or polypeptide, through covalent, non-covalent, or other interactions. For example, a nucleic acid may include an amino acid reactive moiety that reacts with amino acids on a protein or polypeptide through covalent, non-covalent, or other interactions.
[0042] The term also encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or links, which are synthetic, naturally occurring, or non-natural, have similar binding properties to the reference nucleic acid, and are metabolized in a manner similar to the reference nucleotide. Examples of such analogs include, but are not limited to, phosphodiester derivatives, including, for example, aminophosphates, diaminophosphates, thiophosphates (also known as thiophosphoryl esters), dithiophosphates, phosphonocarboxylic acids, phosphonocarboxylic esters, phosphonoacetic acids, phosphonoformic acids, methylphosphonates, borosilicates, or O-methylphosphonamide (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press), and peptide nucleic acid backbones and links. Other analog nucleic acids include those with a positive backbone; those with a nonionic backbone, modified sugar or nonribose backbone (e.g., diaminophosphate morpholine oligonucleotides or locked nucleic acids (LNAs)), including U.S. Patents 5,235,033 and 5,034,506 and Chapters 6 and 7 of ASC Symposium Series 580 edited by Sanghui and Cook. Carbohydrate Modifications in Antisense Research Those described in [the text]. Nucleic acids containing one or more carbon-cyclic sugars are also included in one definition of nucleic acids. [The definition can be modified for various reasons.] Ribose-phosphate ester backbone Modifications can be made, such as increasing the stability and half-life of these molecules in physiological environments or as probes on biochips. Mixtures of naturally occurring nucleic acids and analogues can be prepared; alternatively, mixtures of different nucleic acid analogues, as well as mixtures of naturally occurring nucleic acids and analogues, can be prepared.
[0043] As may be used herein, the terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid oligomer,” “oligonucleotide,” “nucleic acid sequence,” “nucleic acid fragment,” and “polynucleotide” are used interchangeably and are intended to include, but are not limited to, aggregates of nucleotides (deoxyribonucleotides or ribonucleotides) or their analogs, derivatives, or modifications thereof that are covalently linked together and may have different lengths. Different polynucleotides may have different three-dimensional structures and may perform a variety of known or unknown functions. Non-limiting examples of polynucleotides include genes, gene fragments, exons, introns, intergenic DNA (including but not limited to heterochromatin DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, sequence-isolated DNA, sequence-isolated RNA, nucleic acid probes, and primers. Polynucleotides that can be used in the methods of the present invention may comprise natural nucleic acid sequences and their variants, artificial nucleic acid sequences, or combinations of such sequences.
[0044] Polynucleotides typically consist of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T) (when the polynucleotide is RNA, uracil (U) replaces thymine (T)). Therefore, the term "polynucleotide sequence" is a letter representation of a polynucleotide molecule; alternatively, the term can be applied to the polynucleotide molecule itself. This letter representation can be entered into a database on a computer with a central processing unit and used for bioinformatics applications such as functional genomics and homology searches. Polynucleotides may optionally include one or more non-standard nucleotides, one or more nucleotide analogs, and / or modified nucleotides.
[0045] Unless otherwise stated, the following notes are used in the nucleic acid sequences disclosed herein: * = phosphate thioester linkage; xxxxx = any linker described herein and in embodiments xxxxx can be -(CH2) with phosphate groups bonded to both ends. n -PO4-[(CH2) n -PO4] z -(CH2) n In addition to the optional addition of terminal phosphate groups, 5'x has an OH terminus while 3'x has a -C bonded to the final phosphate group. 6 Except for the -NH2 terminus, the other bonds are phosphodiester; mN represents a nucleotide modified with 2'OMe; fN represents a nucleotide modified with 2'fluorine; and rN represents a ribonucleotide.
[0046] As used herein, the terms "antimicroRNA (antimiR)" or "antimicroRNA (antimiR) nucleic acid sequence" are used according to their simple and common meaning and refer to RNA capable of inhibiting or reducing the expression and / or activity of target microRNA. In embodiments, the antimiR oligomer may be a single-stranded oligomer of 20-30 bases. In embodiments, the antimiR oligomer may be a double-stranded oligomer of 20-30 bases. In embodiments, the antimiR oligomer may be partially double-stranded with single-stranded overhangs. In embodiments, the oligomer may have 2' chemical modifications. In embodiments, the oligomer may have chemical modifications that enhance serum stability, such as phosphate thioester nucleotide interlinking, 2'-O-methylribonucleotides, 2'-deoxy-2'-fluororibonucleotides, 2'-deoxyribonucleotides, universal base nucleotides, 5-C-methyl nucleotides, inverted deoxybasic residues incorporated into or locked nucleic acids. In embodiments, the antimiR sequence hybridizes with the corresponding miR sequence. Complete complementarity is not required; sufficient complementarity to induce hybridization is sufficient. In some implementations, when optimal alignment is performed using a suitable alignment algorithm, the complementarity between the anti-miR sequence and its corresponding miR sequence is approximately or greater than approximately 50%, 60%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. The optimal alignment can be determined using any suitable algorithm for sequence alignment, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler transform (e.g., Burrows Wheeler Aligner), ClustalW, ClustalX, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In an implementation, the anti-miR sequence has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the perfectly complementary sequence to the target miR sequence.
[0047] As used herein, “microRNA,” “microRNA nucleic acid sequence,” “miR,” and “miRNA” refer to nucleic acids that play a role in the posttranscriptional regulation of RNA silencing and gene expression. This term encompasses all forms of miRNA, such as primary, precursor, and mature forms. In this implementation, microRNA (miRNA) is a short (20-24 nucleotides) non-coding RNA that participates in the posttranscriptional regulation of gene expression in multicellular organisms by influencing mRNA stability and translation. miRNA can be transcribed by RNA polymerase II into a capped and polyadenylated primary transcript (primary miRNA), which may or may not encode proteins. The primary transcript is cleaved by Drosha ribonuclease III to produce a stem-loop precursor miRNA (precursor miRNA) of approximately 70 nt, which is further cleaved by cytoplasmic Dicer ribonuclease to produce mature miRNA and antisense miRNA star (miRNA*) products. Mature miRNAs are incorporated into the RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with miRNAs and most often leads to translational repression or destabilization of the target mRNA. In the implementation scheme, the miRNA nucleic acid sequence described herein is approximately 10 to 80 nucleotides in length (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 nucleotides). In the embodiments described herein, the miRNA nucleic acid sequence is approximately 15 to 50 nucleotides in length (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides). In the embodiments described herein, the miRNA nucleic acid sequence is approximately 18 to 25 nucleotides in length (e.g., 18, 19, 20, 21, 22, 23, 24, 25 nucleotides).
[0048] As used herein, the term “miR126” or “miR142 nucleic acid sequence” includes all forms of miR126, including primary, precursor, and mature forms of miR126, as well as its variants, homologs, modifications, and derivatives (e.g., with at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR126). In embodiments, the variants, homologs, or derivatives have at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides) compared to the naturally occurring form. In the implementation plan, miR126 is obtained through the NCBI reference sequence: NR_029695.1 or sequence: 1 cgctggcgac gggacattat tacttttggt acgcgctgtg acacttcaaa ctcgtaccgt 61 gagtaataat gcgccgtcca cggca (SEQ ID NO: 37) is the miRNA identified.
[0049] The term “anti-miR126” or “anti-miR126 nucleic acid sequence” refers to a sequence that has perfect complementarity to the target miR126 nucleic acid as defined above, with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0050] As used herein, the term “miR142” or “miR142 nucleic acid sequence” includes all forms of miR142, including primary, precursor, and mature forms of miR142, as well as its variants, homologs, modifications, and derivatives (e.g., with at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR142). In embodiments, the variants, homologs, or derivatives have at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides) compared to the naturally occurring form. In the implementation plan, miR142 is obtained through the NCBI reference sequence: NR_029683.1 or sequence: 1 gacagtgcag tcacccataa agtagaaagc actactaaca gcactggagg gtgtagtgtt 61 tcctacttta tggatgagtg tactgtg (SEQ ID NO: 38) identified miRNA.
[0051] The term “anti-miR142” or “anti-miR142 nucleic acid sequence” refers to a sequence that has perfect complementarity to the target miR142 nucleic acid as defined above, with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0052] As used herein, the term “miR155” or “miR155 nucleic acid sequence” includes all forms of miR155, including primary, precursor, and mature forms of miR155, as well as its variants, homologs, modifications, and derivatives (e.g., with at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR155). In embodiments, the variants, homologs, or derivatives have at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides) compared to the naturally occurring form. In the implementation plan, miR155 is obtained through the NCBI reference sequence: NR_030784.1 or sequence: 1 ctgttaatgc taatcgtgat aggggttttt gcctccaact gactcctaca tattagcatt 61 miRNAs identified by aacag (SEQ ID NO: 39).
[0053] The term “anti-miR155” or “anti-miR155 nucleic acid sequence” refers to a sequence that has perfect complementarity to the target miR155 nucleic acid as defined above, with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0054] As used herein, the term “miR9” or “miR9 nucleic acid sequence” includes all forms of miR9, including primary, precursor, and mature forms of miR9, as well as its variants, homologs, modifications, and derivatives (e.g., with at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR9). In embodiments, the variants, homologs, or derivatives have at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides) compared to the naturally occurring form. In the implementation plan, miR9 is obtained through NCBI reference sequence: NR_029691.1, NCBI reference sequence: NR_029692.1, or sequence: 1 cggggttggt tgttatcttt ggttatctag ctgtatgagt ggtgtggagt cttcataaag 61 ctagataacc gaaagtaaaa ataacccca (SEQ ID NO: 40); 1 ggaggcccgt ttctctcttt ggttatctag ctgtatgagt gccacagagc cgtcataaag 61 ctagataacc gaaagtagaa atgattctca (SEQ ID NO: 41) is the miRNA identified.
[0055] The term "anti-miR9" or "anti-miR9 nucleic acid sequence" refers to a sequence that is perfectly complementary to the target miR9 nucleic acid as defined above, with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0056] As used herein, the term “miR10b” or “miR10b nucleic acid sequence” includes all forms of miR10b, including primary, precursor, and mature forms of miR10b, as well as its variants, homologs, modifications, and derivatives (e.g., with at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR10b). In embodiments, the variants, homologs, or derivatives have at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides) compared to the naturally occurring form. In the implementation plan, miR10b is obtained via NCBI reference sequence: NR_029609.1 or sequence: 1ccagaggttg taacgttgtc tatatatacc ctgtagaacc gaatttgtgt ggtatccgta 61 tagtcacaga ttcgattcta ggggaatata tggtcgatgc aaaaacttca (SEQ ID NO:42) is a miRNA identified.
[0057] The term “anti-miR10b” or “anti-miR10b nucleic acid sequence” refers to a sequence that has perfect complementarity to the target miR10b nucleic acid as defined above, with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0058] As used herein, the term “miR21” or “miR21 nucleic acid sequence” includes all forms of miR21, including primary, precursor, and mature forms of miR21, as well as its variants, homologs, modifications, and derivatives (e.g., with at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR21). In embodiments, the variants, homologs, or derivatives have at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides) compared to the naturally occurring form. In the implementation plan, miR21 is obtained through the NCBI reference sequence: NR_029493.1 or sequence: 1 tgtcgggtag cttatcagac tgatgttgac tgttgaatct catggcaaca ccagtcgatg 61 ggctgtctga ca (SEQ ID NO: 43) is the miRNA identified.
[0059] The term “anti-miR21” or “anti-miR21 nucleic acid sequence” refers to a sequence that is perfectly complementary to the target miR21 nucleic acid as defined above, with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0060] As used herein, the term “miR17” or “miR17 nucleic acid sequence” includes all forms of miR17, including primary, precursor, and mature forms of miR17, as well as its variants, homologs, modifications, and derivatives (e.g., with at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR17). In embodiments, the variants, homologs, or derivatives have at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides) compared to the naturally occurring form. In the implementation plan, miR17 is identified via the NCBI reference sequence: NR_029487.1 or sequence: 1 gtcagaataa tgtcaaagtg cttacagtgc aggtagtgat atgtgcatct actgcagtga 61 aggcacttgt agcattatgg tgac (SEQ ID NO: 44) identified miRNA.
[0061] The term “anti-miR17” or “anti-miR17 nucleic acid sequence” refers to a sequence that is perfectly complementary to the target miR17 nucleic acid as defined above, with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0062] As used herein, the term “miR92” or “miR92 nucleic acid sequence” includes all forms of miR92, including primary, precursor, and mature forms of miR92, as well as its variants, homologs, modifications, and derivatives (e.g., with at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR92). In embodiments, the variants, homologs, or derivatives have at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides) compared to the naturally occurring form. In the implementation plan, miR92 is obtained through the NCBI reference sequence: NR_029508.1 or sequence: 1 ctttctacac aggttgggat cggttgcaat gctgtgtttc tgtatggtat tgcacttgtc The miRNA identified by 61 ccggcctgtt gagtttgg (SEQ ID NO: 45).
[0063] The term “anti-miR92” or “anti-miR92 nucleic acid sequence” refers to a sequence that is perfectly complementary to the target miR92 nucleic acid as defined above, with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0064] As used herein, the term “miR125b” or “miR125b nucleic acid sequence” includes all forms of miR125b, including primary, precursor, and mature forms of miR125b, as well as its variants, homologs, modifications, and derivatives (e.g., with at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR125b). In embodiments, the variants, homologs, or derivatives have at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides) compared to the naturally occurring form. In the implementation plan, miR125b is obtained via NCBI reference sequence: NR_029671.1 or sequence: 1 tgcgctcctc tcagtccctg agaccctaac ttgtgatgtt taccgtttaa atccacgggt miRNA identified by 61 taggctcttg ggagctgcga gtcgtgct (SEQ ID NO: 46).
[0065] The term “anti-miR125b” or “anti-miR125b nucleic acid sequence” refers to a sequence that is perfectly complementary to the target miR125b nucleic acid as defined above, with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0066] As used herein, the term “miR146a” or “miR146 nucleic acid sequence” includes all forms of miR146a, including primary, precursor, and mature forms of miR146a, as well as its variants, homologs, modifications, and derivatives (e.g., with at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR146a). In embodiments, the variants, homologs, or derivatives have at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides) compared to the naturally occurring form. In the implementation plan, miR146a is obtained through the NCBI reference sequence: NR_029701.1 or sequence: 1 ccgatgtgta tcctcagctt tgagaactga attccatggg ttgtgtcagt gtcagacctc The miRNA identified by 61 tgaaattcag ttcttcagct gggatatctc tgtcatcgt (SEQ ID NO: 47).
[0067] The term "anti-miR146a" or "anti-miR146a nucleic acid sequence" refers to a sequence that has perfect complementarity to the target miR146a nucleic acid as defined above, with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0068] As used herein, the term "microRNA mimic (miRNA mimic)" or "miRNA mimic nucleic acid sequence" is used in its usual, general sense and refers to single-stranded, double-stranded, or triple-stranded oligonucleotides capable of performing biological functions similar to microRNAs. In embodiments, miRNA mimics can be non-natural double-stranded miR-like RNA fragments. Such RNA fragments can be engineered with a motif at their 5' end that is complementary to a selected sequence portion of the 3'UTR unique to the target gene. Once introduced into the cell, this RNA fragment can mimic endogenous miRNAs, specifically binding to their target genes and producing post-transcriptional repression of that gene, more specifically, translational repression. Unlike endogenous miRNAs, miRNA mimics can function in a gene-specific manner. In embodiments, miRNA mimics can be double-stranded oligomers of 20-30 bases (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases). In the embodiments, the miRNA mimic can be a triplet oligomer of 20-30 bases (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases). In the embodiments, the miRNA mimic may have 2' chemical modifications. In the embodiments, the miRNA mimic may have chemical modifications that enhance serum stability, such as phosphate thioester nucleotide linkages, 2'-O-methylribonucleotides, 2'-deoxy-2'-fluororibonucleotides, 2'-deoxyribonucleotides, universal base nucleotides, 5-C-methyl nucleotides, inverted deoxybasic residues incorporated into or locked nucleic acids.
[0069] As used herein, the terms "miR126 mimic" or "miR26 mimic nucleic acid sequence" refer to oligonucleotides that are structurally similar to miR126 and capable of performing similar biological functions as miR126. In embodiments, the miR126 mimic has at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR126. In embodiments, the miR126 mimic has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with native miR126 over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides).
[0070] As used herein, the term "miR142 mimic" or "miR142 mimic nucleic acid sequence" refers to an oligonucleotide that is structurally similar to miR142 and capable of performing similar biological functions as miR142. In embodiments, the miR142 mimic has at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR142. In embodiments, the miR142 mimic has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with native miR142 over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides).
[0071] As used herein, the term "miR155 mimic" or "miR155 mimic nucleic acid sequence" refers to an oligonucleotide that is structurally similar to miR155 and capable of performing similar biological functions as miR155. In embodiments, the miR155 mimic has at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR155. In embodiments, the miR155 mimic has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with native miR155 over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides).
[0072] As used herein, the term "miR9 mimic" or "miR9 mimic nucleic acid sequence" refers to an oligonucleotide that is structurally similar to miR9 and capable of performing similar biological functions as miR9. In embodiments, the miR9 mimic has at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR9. In embodiments, the miR9 mimic has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with native miR9 over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides).
[0073] As used herein, the term "miR10b mimic" or "miR10b mimic nucleic acid sequence" refers to an oligonucleotide that is structurally similar to miR10b and capable of performing similar biological functions as miR10b. In embodiments, the miR10b mimic has at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR10b. In embodiments, the miR10b mimic has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with native miR10b over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides).
[0074] As used herein, the term "miR21 mimic" or "miR21 mimic nucleic acid sequence" refers to an oligonucleotide that is structurally similar to miR21 and capable of performing similar biological functions as miR21. In embodiments, the miR21 mimic has at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR21. In embodiments, the miR21 mimic has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with native miR21 over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides).
[0075] As used herein, the term "miR17 mimic" or "miR17 mimic nucleic acid sequence" refers to an oligonucleotide that is structurally substantially similar to miR17 and capable of performing similar biological functions as miR17. In embodiments, the miR17 mimic has at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR17. In embodiments, the miR17 mimic has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with native miR17 over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides).
[0076] As used herein, the term "miR92 mimic" or "miR92 mimic nucleic acid sequence" refers to an oligonucleotide that is structurally similar to miR92 and capable of performing similar biological functions as miR92. In embodiments, the miR92 mimic has at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR92. In embodiments, the miR92 mimic has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with native miR92 over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides).
[0077] As used herein, the term "miR125b mimic" or "miR125b mimic nucleic acid sequence" refers to an oligonucleotide that is structurally similar to miR125b and capable of performing similar biological functions as miR125b. In embodiments, the miR125b mimic has at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR125b. In embodiments, the miR125b mimic has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with native miR125b over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides).
[0078] As used herein, the term "miR146a mimic" or "miR146a mimic nucleic acid sequence" refers to an oligonucleotide that is structurally similar to miR146a and capable of performing similar biological functions as miR146a. In embodiments, the miR146a mimic has at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to native miR146a. In embodiments, the miR146a mimic has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with native miR146a over the entire sequence or a portion thereof (e.g., a portion of 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, or 80 consecutive nucleotides).
[0079] As used herein, the term "thiophosphorylated oligodeoxynucleotide (ODN)" refers to a nucleic acid sequence in which some or all of its nucleotides are linked to form a thiophosphate ester bond, such as a "CpG nucleic acid sequence" or a "GpC nucleic acid sequence." In embodiments, the thiophosphorylated oligodeoxynucleotide (ODN) is 15 to 30 bases long, single-stranded, and partially or fully thiophosphate esterified. A partially thiophosphated ODN is an ODN in which 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides are linked to form a thiophosphate ester bond.
[0080] In the implementation scheme, the term "CpG motif" in nucleic acid refers to a nucleic acid in which the 5'C nucleotide is linked to the 3'G nucleotide via a phosphodiester nucleotide link or a phosphodiester derivative nucleotide link. In the implementation scheme, the term "CpG motif" in nucleic acid refers to a nucleic acid in which the 5'G nucleotide is linked to the 3'C nucleotide via a phosphodiester nucleotide link or a phosphodiester derivative nucleotide link (also referred to as a "GpC nucleic acid sequence"). In the implementation scheme, the CpG motif includes a phosphodiester nucleotide link. In the implementation scheme, the CpG motif includes a phosphodiester derivative nucleotide link. In the implementation scheme, the CpG motif contains a phosphate thioester link.
[0081] As used herein, the terms “Class A CpG ODN”, “A-Class CpG ODN”, “D-Type CpG ODN”, or “Class A CpG DNA sequence” are used according to their common meaning in biological and chemical sciences and refer to an oligodeoxynucleotide containing a CpG motif, comprising one or more poly-G sequences at 5', 3', or both ends; an internal palindromic sequence containing the CpG motif; or one or more phosphodiester derivatives linking deoxynucleotides. In embodiments, Class A CpG ODNs include poly-G sequences at 5', 3', or both ends; an internal palindromic sequence containing the CpG motif; and one or more phosphodiester derivatives linking deoxynucleotides. In embodiments, the phosphodiester derivative is a thiophosphate. Examples of Class A CpG ODNs include ODN D19, ODN 1585, ODN 2216, and ODN 2336.
[0082] As used herein, the terms “Class B CpG ODN”, “Class B CpG ODN”, “Class K CpG ODN”, or “Class B CpG DNA sequence” are used according to their common meaning in biological and chemical sciences and refer to an oligodeoxynucleotide containing a CpG motif, comprising one or more 6-mer motifs containing a CpG motif; and a phosphodiester derivative linking all deoxynucleotides. In an embodiment, the 6-mer motif comprises 5'-PuPyCGPyPu-3' (SEQ ID NO: 15), where Pu represents a purine-containing nucleobase (e.g., A or G) and Py represents a pyrimidine-containing nucleobase (e.g., T / U or C). In an embodiment, a Class B CpG ODN comprises one or more copies of a 6-mer motif containing a CpG motif and a phosphodiester derivative linking all deoxynucleotides. In an embodiment, the phosphodiester derivative is a phosphate thioester. In an embodiment, a Class B CpG ODN comprises a 6-mer motif containing a CpG motif. In one implementation, a Class B CpG ODN comprises two copies of a 6mer motif containing a CpG motif. In another implementation, a Class B CpG ODN comprises three copies of a 6mer motif containing a CpG motif. In yet another implementation, a Class B CpG ODN comprises four copies of a 6mer motif containing a CpG motif. Examples of Class B CpG ODNs include ODN 1668, ODN 1826, ODN 2006, and ODN 2007.
[0083] As used herein, the terms “C-class CpG ODN” or “C-class CpG ODN” or “C-type CpG DNA sequence” are used according to their common meaning in biological and chemical sciences and refer to oligodeoxynucleotides comprising a palindromic sequence containing a CpG motif and a phosphodiester derivative (thiophosphate). Examples of C-class CpG ODNs include ODN 2395 and ODN M362.
[0084] The abbreviations used in this article have their conventional meanings in the fields of chemistry and biology. The chemical structures and formulas shown in this article are constructed according to the standard rules of chemical valence known in the field of chemistry.
[0085] When substituent groups are designated using their conventional chemical formula written from left to right, they also cover chemically identical substituents obtained by writing the structure from right to left; for example, -CH2O- is equivalent to -OCH2-.
[0086] Unless otherwise stated, the term "alkyl" itself, or as part of another substituent, means a straight (i.e., unbranched) or branched acyclic carbon chain (or carbon) or combination thereof, which can be fully saturated, monounsaturated, or polyunsaturated, and can include divalent and polyvalent groups (i.e., C1-C) having a specified number of carbon atoms. 10 (This refers to 1 to 10 carbons). Examples of saturated hydrocarbon groups include, but are not limited to, the following groups: methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl, (cyclohexyl)methyl, such as homologues and isomers of n-pentyl, n-hexyl, n-heptyl, n-octyl, etc. Unsaturated alkyl groups are alkyl groups having one or more double or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotonyl, 2-isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and higher homologues and isomers. An alkoxy group is an alkyl group attached to the rest of the molecule via an oxygen linker (-O-).
[0087] Unless otherwise stated, the term "alkylene" itself, or as part of another substituent, refers to a divalent group derived from an alkyl group, such as, but not limited to, -CH2CH2CH2-. Typically, an alkyl (or alkylene) group will have 1 to 24 carbon atoms. "Lower alkyl" or "lower alkylene" is a shorter-chain alkyl or alkylene group, typically having 8 or fewer carbon atoms. Unless otherwise stated, the term "alkenyl" itself, or as part of another substituent, refers to a divalent group derived from an olefin.
[0088] Unless otherwise stated, the term "heteroalkyl" on its own or in combination with another term means a stable acyclic straight or branched chain or combination thereof comprising at least one carbon atom and at least one heteroatom selected from O, N, P, Si, and S, wherein the nitrogen and sulfur atoms may optionally be oxidized, and the nitrogen heteroatom may optionally be quaternized. The heteroatoms O, N, P, S, and Si may be located in any internal position of the heteroalkyl group or in a position where the alkyl group is attached to the remainder of the molecule. Examples include, but are not limited to: -CH2-CH2-O-CH3, -CH2-CH2-NH-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S-CH2-CH3, -CH2-CH2, -S(O)-CH3, -CH2-CH2-S(O)2-CH3, -CH=CH-O-CH3, -Si(CH3)3, -CH2-CH=N-OCH3, -CH=CH-N(CH3)-CH3, -O-CH3, -O-CH2-CH3, and -CN. Up to two or three heteroatoms can be consecutive, for example, -CH2-NH-OCH3 and -CH2-O-Si(CH3)3.
[0089] Similarly, unless otherwise stated, the term "heteroalkylene" itself, or as part of another substituent, refers to a divalent group derived from a heteroalkylene group, such as, but not limited to, -CH2-CH2-S-CH2-CH2- and -CH2-S-CH2-CH2-NH-CH2-. With heteroalkylene, the heteroatom may also occupy either one or both ends of the chain. For example (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, etc.). Furthermore, for alkylene and heteroalkylene linking groups, the direction in which the chemical formula of the linking group is written does not imply the orientation of that linking group. For example, the formula -C(O)2R'- represents -C(O)2R'- and -R'C(O)2-. As mentioned above, heteroalkyl groups as used herein include those groups attached to the rest of the molecule by a heteroatom, such as -C(O)R', -C(O)NR', -NR'R'', -OR', -SR', and / or -SO2R'. When the term "heteroalkyl" is used, followed by a specific heteroalkyl group such as -NR'R'', it should be understood that the terms heteroalkyl and -NR'R'' are neither redundant nor mutually exclusive. Rather, the specific heteroalkyl group is described for clarity. Therefore, the term "heteroalkyl" should not be interpreted herein as excluding specific heteroalkyl groups such as -NR'R''.
[0090] Unless otherwise stated, the terms "cycloalkyl" and "heterocycloalkyl," either alone or in combination with other terms, refer to the non-aromatic cyclic form of "alkyl" and "heteroalkyl," respectively, where the carbon atoms constituting one or more rings do not necessarily need to be bonded to hydrogen atoms due to the valence of all carbon atoms involved in non-hydrogen atom bonding. Additionally, for heterocycloalkyl, the heteroatom can occupy the position where the heterocycle is attached to the rest of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, etc. Examples of heterocycloalkyl include, but are not limited to, 1-(1,2,5,6-tetrahydropyridyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothiophen-2-yl, tetrahydrothiophen-3-yl, 1-piperazinyl, 2-piperazinyl, etc. "Cycloalkylene" and "heteroalkylene" alone or as part of another substituent refer to divalent groups derived from cycloalkylene and heteroalkylene, respectively.
[0091] Unless otherwise stated, the terms "halogenated" or "halogen" mean, either alone or as part of another substituent, a fluorine, chlorine, bromine, or iodine atom. Additionally, terms such as "halogenated alkyl" are intended to include both monohalogenated and polyhalogenated alkyl groups. For example, the term "halogenated (C1-C4)alkyl" includes, but is not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, etc.
[0092] Unless otherwise stated, the term "acyl" means -C(O)R, where R is a substituted or unsubstituted alkyl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted heteroalkyl, a substituted or unsubstituted heterocycloalkyl, a substituted or unsubstituted aryl, or a substituted or unsubstituted heteroaryl.
[0093] Unless otherwise stated, the term "aryl" refers to a polyunsaturated, aromatic hydrocarbon substituent, which can be a monocyclic or fused together (i.e., fused-ring aryl) or covalently linked (e.g., biphenyl) of multiple rings (preferably 1 to 3 rings). A fused-ring aryl refers to multiple rings fused together, wherein at least one fused ring is an aromatic ring. The term "heteroaryl" refers to an aryl group (or ring) containing at least one heteroatom such as N, O, or S, wherein the nitrogen and sulfur atoms are optionally oxidized, and one or more nitrogen atoms are optionally quaternized. Thus, the term "heteroaryl" includes fused-ring heteroaryl groups (i.e., multiple rings fused together, wherein at least one fused ring is a heteroaromatic ring). 5,6-fused-ring heteroaryl refers to two fused rings, one ring having a number of 5 and the other ring having a number of 6, and at least one of the rings being a heteroaromatic ring. Similarly, 6,6-fused-ring heteroaryl refers to two fused rings, one ring having 6 elements and the other ring having 6 elements, and at least one of the rings is a heteroaryl ring. And 6,5-fused-ring heteroaryl refers to two fused rings, one ring having 6 elements and the other ring having 5 elements, and at least one of the rings is a heteroaryl ring. The heteroaryl group can be attached to the rest of the molecule via carbon or heteroatoms. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrole, 2-pyrrole, 3-pyrrole, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isooxazolyl, 4-isooxazolyl, 5-isooxazolyl, 2-thiazolyl, 4-Thiazolyl, 5-Thiazolyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-benzothiazolyl, purinel, 2-benzimidazolyl, 5-indolyl, 1-isoquinolinyl, 5-isoquinolinyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolinyl, and 6-quinolinyl. Substituents in each of the aryl and heteroaryl ring systems mentioned above are selected from the acceptable substituents described below. "Arylidene" and "heteroarylidene," alone or as part of another substituent, refer to divalent groups derived from aryl and heteroaryl groups, respectively.Non-limiting examples of heteroaryl groups include pyridinyl, pyrimidinyl, phenylthio, thiophene, furanyl, indoleyl, benzoxadiazolyl, benzodioxolyl, benzodioxylalkyl, thianaphthanyl, pyrrolopyridinyl, indazole, quinolinyl, quinoxalinyl, pyridopyrazinyl, quinazolinone, benzoisoxazolyl, imidazopyridinyl, and benzofuranyl. Benzothiophene, benzo[a]benzylthio, phenyl, naphthyl, biphenyl, pyrrolyl, pyrazolyl, imidazoleyl, pyrazinyl, oxazolyl, isoxazolyl, thiazolyl, furanthiophene, pyridinyl, pyrimidinyl, benzothiazolyl, purine, benzimidazolyl, isoquinolinyl, thiadiazolyl, oxiadiazolyl, pyrrolyl, diazolyl, triazolyl, tetrazolyl, benzothiadiazolyl, isothiazolyl, pyrazolopyrimidinyl, pyrrolopyrimidinyl, benzotriazolyl, benzoxazolyl, or quinolinyl. The above examples can be substituted or unsubstituted, and the divalent group in each of the above heteroaryl examples is a non-limiting example of a heteroaryl group.
[0094] Fused-ring heterocyclic alkyl-aryl is an aryl group fused with a heterocyclic alkyl group. Fused-ring heterocyclic alkyl-heteroaryl is a heteroaryl group fused with a heterocyclic alkyl group. Fused-ring heterocyclic alkyl-cycloalkyl is a heterocyclic alkyl group fused with a cycloalkyl group. Fused-ring heterocyclic alkyl-heterocyclic alkyl is a heterocyclic alkyl group fused with another heterocyclic alkyl group. Fused-ring heterocyclic alkyl-aryl, fused-ring heterocyclic alkyl-heteroaryl, fused-ring heterocyclic alkyl-cycloalkyl, or fused-ring heterocyclic alkyl-heterocyclic alkyl can each be independently unsubstituted or substituted by one or more substituents described herein.
[0095] As used in this article, the term "oxo" refers to oxygen bonded to a carbon atom in a double bond.
[0096] As used herein, the term "alkylsulfonyl" means having the formula -S(O2)-R', where R' is a substituted or unsubstituted alkyl group as defined above. R' may have a specified number of carbons (e.g., "C1-C4 alkylsulfonyl").
[0097] Each of the above terms (e.g., "alkyl", "heteroalkyl", "aryl", and "heteroaryl") includes both substituted and unsubstituted forms of the specified group. Preferred substituents for each type of group are provided below.
[0098] Substituents in alkyl and heteroalkyl groups (including those often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, ynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) may be one or more selected from, but not limited to, a variety of groups including: -OR', =O, =NR', =N-OR', -NR'R'', -SR', -halogen, -SiR'R''R''', -OC(O)R', -C(O)R', -CO2R', -CONR'R'', -OC(O)NR'R'', -NR''C(O)R', -NR'- C(O)NR''R'''、-NR''C(O)2R'、-NR-C(NR'R''R''')=NR''''、-NR-C(NR'R'')=NR'''、-S(O)R'、-S(O)2R'、-S(O)2NR'R''、-NRSO2R'、-NR'NR''R'''、-ONR'R''、-NR'C=(O)NR''NR'''R''''、-CN、-NO2, with numbers ranging from 0 to (2m'+1), where m' is the total number of carbon atoms in this type of group. R, R', R'', R''', and R'''' each preferably independently refer to hydrogen, a substituted or unsubstituted heteroalkyl group, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted heterocycloalkyl group, a substituted or unsubstituted aryl group (e.g., an aryl group substituted with 1 to 3 halogens), a substituted or unsubstituted heteroaryl group, a substituted or unsubstituted alkyl group, an alkoxy group, a thioalkoxy group, or an arylalkyl group. When the compounds of the present invention include more than one R group, each R group is selected independently, just as each R', R'', R''', and R'''' group (when more than one of these groups is present). When R' and R'' are attached to the same nitrogen atom, they can combine with that nitrogen atom to form a 4-, 5-, 6-, or 7-membered ring. For example, -NR'R'' includes, but is not limited to, 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, those skilled in the art will understand that the term "alkyl" is intended to include groups containing a carbon atom bonded to a group other than a hydrogen group, such as haloalkyl (e.g., -CF3 and CH2CF3) and acyl (e.g., -C(O)CH3, -C(O)CF3, -C(O)CH2OCH3, etc.).
[0099] Similar to the substituents described for alkyl groups, the substituents for aryl and heteroaryl groups are varied and selected from, for example: -OR', -NR'R'', -SR', -halogen, -SiR'R''R''', -OC(O)R', -C(O)R', -CO2R', -CONR'R'', -OC(O)NR'R'', -NR''C(O)R'', -NR''C(O)NR''R''', -NR''C(O)2R', -NR-C(NR'R''R''')=NR'''', -NR-C(NR'R''=NR''', -S(O)R', -S(O)2R', -S(O)2N R'R'', -NRSO2R', -NR'NR''R''', -ONR'R'', -NR'C=(O)NR''NR'''R'''', -CN, -NO2, -R', -N3, -CH(Ph)2, fluoro(C1-C4)alkoxy and fluoro(C1-C4)alkyl, ranging from 0 to the total number of open valences on the aromatic ring system; and wherein R', R'', R''' and R'''' are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl. When the compounds of the present invention comprise more than one R group, for example, each R group is selected independently, just as each R', R'', R''' and R'''' group (when more than one of these groups is present).
[0100] Two or more substituents may optionally be linked to form aryl, heteroaryl, cycloalkyl, or heterocycloalkyl groups. Such so-called cyclic substituents are found to be typically (but not necessarily) attached to a cyclic base structure. In one embodiment, the cyclic substituent is attached to an adjacent member of the base structure. For example, two cyclic substituents attached to an adjacent member of the cyclic base structure produce a fused ring structure. In another embodiment, the cyclic substituent is attached to a single member of the base structure. For example, two cyclic substituents attached to a single member of the cyclic base structure produce a spirocyclic structure. In yet another embodiment, the cyclic substituent is attached to a non-adjacent member of the base structure.
[0101] The two substituents on adjacent atoms of the aromatic or heteroaromatic ring can optionally form a shape of the formula -TC(O)-(CRR'). q A -U- ring, where T and U are independently -NR-, -O-, -CRR'-, or single bonds, and q is an integer from 0 to 3. Optionally, the two substituents on adjacent atoms of the aromatic or heteroaromatic ring can optionally be of the formula -A-(CH2). rThe substituent substitution of -B-, where A and B are independently -CRR'-, -O-, -NR-, -S-, -S(O)-, -S(O)2-, -S(O)2NR'-, or a single bond, and r is an integer from 1 to 4. One of the single bonds in the newly formed ring can optionally be replaced by a double bond. Alternatively, the two substituents on adjacent atoms of the aromatic or heteroaromatic ring can optionally be of the formula -(CRR'). s -X'-(C''R''R''') d The substituents are replaced by -, wherein s and d are independently integers from 0 to 3, and X' is -O-, -NR'-, -S-, -S(O)-, -S(O)2-, or -S(O)2NR'-. The substituents R, R', R'', and R''' are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
[0102] As used herein, the term “heteroatom” or “cyclic heteroatom” is intended to include oxygen (O), nitrogen (N), sulfur (S), phosphorus (P), and silicon (Si).
[0103] As used herein, “substituent group” means a group selected from the following: (A) Oxygenated, Halogenated, -CF3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO2Cl, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF3, -OCHF2, -NHSO2CH3, -N3, Unsubstituted Alkyl, Unsubstituted Heteroalkyl, Unsubstituted Cycloalkyl, Unsubstituted Heterocycloalkyl, Unsubstituted Aryl, Unsubstituted Heteroaryl, and (B) An alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl group substituted with at least one of the following substituents: (i) oxo, halogen, -CF3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO2Cl, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF3, -OCHF2, -NHSO2CH3, -N3, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and (ii) An alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl group substituted with at least one of the following substituents: (a) Oxygenated, halogenated, -CF3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO2Cl, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF3, -OCHF2, -NHSO2CH3, -N3, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and (b) Alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl substituted with at least one of the following substituents: oxo, halogen, -CF3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO2Cl, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF3, -OCHF2, -NHSO2CH3, -N3, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl.
[0104] As used herein, “size-restricted substituent” or “size-restricted substituent group” means a group selected from all the substituents described above for “substituent group”, wherein each substituted or unsubstituted alkyl group is a substituted or unsubstituted C1-C2 alkyl group. 20Alkyl groups, each substituted or unsubstituted heteroalkyl group being a substituted or unsubstituted 2- to 20-membered heteroalkyl group, each substituted or unsubstituted cycloalkyl group being a substituted or unsubstituted C3-C8 cycloalkyl group, each substituted or unsubstituted heterocycloalkyl group being a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, and each substituted or unsubstituted aryl group being a substituted or unsubstituted C6-C8 cycloalkyl group. 10 Aryl group, and each substituted or unsubstituted heteroaryl group is a substituted or unsubstituted 5 to 10-membered heteroaryl group.
[0105] As used herein, “lower substituent” or “lower substituent group” means a group selected from all the substituents described above for “substituent group”, wherein each substituted or unsubstituted alkyl group is a substituted or unsubstituted C1-C8 alkyl group, each substituted or unsubstituted heteroalkyl group is a substituted or unsubstituted 2- to 8-membered heteroalkyl group, each substituted or unsubstituted cycloalkyl group is a substituted or unsubstituted C3-C7 cycloalkyl group, each substituted or unsubstituted heterocycloalkyl group is a substituted or unsubstituted 3- to 7-membered heterocycloalkyl group, and each substituted or unsubstituted aryl group is a substituted or unsubstituted C6-C8 cycloalkyl group. 10 Aryl, and each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5 to 9-membered heteroaryl.
[0106] In some embodiments, each substituted group described in the compounds herein is substituted with at least one substituent group. More specifically, in some embodiments, each substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene described in the compounds herein is substituted with at least one substituent group. In other embodiments, at least one or all of these groups are substituted with at least one size-restricted substituent group. In other embodiments, at least one or all of these groups are substituted with at least one lower substituent group.
[0107] In other embodiments of the compounds herein, each substituted or unsubstituted alkyl group may be a substituted or unsubstituted C1-C2 group. 20 Alkyl groups, each substituted or unsubstituted heteroalkyl group being a substituted or unsubstituted 2- to 20-membered heteroalkyl group, each substituted or unsubstituted cycloalkyl group being a substituted or unsubstituted C3-C8 cycloalkyl group, each substituted or unsubstituted heterocycloalkyl group being a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, and each substituted or unsubstituted aryl group being a substituted or unsubstituted C6-C8 cycloalkyl group. 10The aryl group, and / or each substituted or unsubstituted heteroaryl group, is a substituted or unsubstituted 5- to 10-membered heteroaryl group. In some embodiments of the compounds herein, each substituted or unsubstituted alkylene group may be a substituted or unsubstituted C1-C... 20 Alkylenes, each substituted or unsubstituted heteroalkylene is a substituted or unsubstituted 2- to 20-membered heteroalkylene, each substituted or unsubstituted cycloalkylene is a substituted or unsubstituted C3-C8 cycloalkylene, each substituted or unsubstituted heteroalkylene is a substituted or unsubstituted 3- to 8-membered heteroalkylene, and each substituted or unsubstituted arylene is a substituted or unsubstituted C6-C 10 The aryl group, and / or each substituted or unsubstituted heteroaryl group is a substituted or unsubstituted 5 to 10-membered heteroaryl group.
[0108] In some embodiments, each substituted or unsubstituted alkyl group is a substituted or unsubstituted C1-C8 alkyl group, each substituted or unsubstituted heteroalkyl group is a substituted or unsubstituted 2- to 8-membered heteroalkyl group, each substituted or unsubstituted cycloalkyl group is a substituted or unsubstituted C3-C7 cycloalkyl group, each substituted or unsubstituted heterocycloalkyl group is a substituted or unsubstituted 3- to 7-membered heterocycloalkyl group, and each substituted or unsubstituted aryl group is a substituted or unsubstituted C6-C8 cycloalkyl group. 10 The aryl group, and / or each substituted or unsubstituted heteroaryl group is a substituted or unsubstituted 5- to 9-membered heteroaryl group. In some embodiments, each substituted or unsubstituted alkylene group may be a substituted or unsubstituted C1-C8 alkylene group, each substituted or unsubstituted heteroaryl group is a substituted or unsubstituted 2- to 8-membered heteroaryl group, each substituted or unsubstituted cycloalkylene group is a substituted or unsubstituted C3-C7 cycloalkylene group, each substituted or unsubstituted heteroalkylene group is a substituted or unsubstituted 3- to 7-membered heteroalkylene group, and each substituted or unsubstituted aryl group is a substituted or unsubstituted C6-C8 alkylene group. 10 The arylene group, and / or each substituted or unsubstituted heteroarylene group is a substituted or unsubstituted 5- to 9-membered heteroarylene group. In some embodiments, the compound is of the class of chemicals described in the Examples section below.
[0109] As used herein, the term "coupling" refers to the bonding of two parts, wherein one or more bonds connecting the two parts can be covalent or non-covalent. In embodiments, the two parts are covalently bonded to each other (e.g., directly or through a covalently bonded intermediate). In embodiments, the two parts are non-covalently bonded (e.g., through ionic bonds, van der Waals bonds / interactions, hydrogen bonds, polar bonds, or combinations or mixtures thereof).
[0110] The “label” or “detectable portion” is a composition that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical, magnetic resonance imaging, or other physical means. For example, useful detectable portions include… 32 P, fluorescent dyes, electron-dense reagents, enzymes (e.g., commonly used in ELISA), biotin, digoxigenin, paramagnetic molecules, paramagnetic nanoparticles, ultrasmall superparamagnetic iron oxide ("USPIO") nanoparticles, USPIO nanoparticle aggregates, superparamagnetic iron oxide ("SPIO") nanoparticles, SPIO nanoparticle aggregates, single-crystal SPIO, single-crystal SPIO aggregates, single-crystal iron oxide nanoparticles, single-crystal iron oxide, other nanoparticle contrast agents, liposomes or other delivery media containing gadolinium chelate ("Gd-chelate") molecules, gadolinium, radioisotopes, radionuclides (e.g., carbon-11, nitrogen-13, oxygen-15, fluorine-18, rubidium-82), fluorodeoxyglucose (e.g., fluorine-18 labeled), any radionuclide emitting gamma rays, radionuclides emitting positrons, radiolabeled glucose, radiolabeled water, radiolabeled ammonia, biocolloids, microbubbles (e.g., microbubble shells containing albumin, galactose, lipids and / or polymers; microbubble gas cores containing air, heavy gases, perfluorinated carbon, nitrogen, octafluoropropane, perfluorohexane lipid microspheres, perfluoropropane, etc.), iodinated contrast agents (e.g., iohexol, iodixanol, ioversol, iopamidol, ioxilan, iopromide, diatrizoate, metrizoate, ioxaglate), barium sulfate, thorium dioxide, gold, gold nanoparticles, gold nanoparticle aggregates, fluorophores, two-photon fluorophores, or haptens and proteins, or other entities that can be made detectable, for example, by incorporating radiolabels into peptides or antibodies that specifically react with target peptides.) The detectable portion also includes any of the above-described compositions encapsulated in nanoparticles, particles, or aggregates, coated with an additional composition, and derivatized to bind to a targeting agent (e.g., a compound described herein). Any method known in the art for conjugating oligonucleotides or proteins to a label can be used, such as the method described in Hermanson, Bioconjugate Techniques 1996, Academic Press, Inc., San Diego.
[0111] As used herein, “cell” means a cell that performs metabolic or other functions sufficient to preserve or replicate its genomic DNA. Cells can be identified by methods well known in the art, including, for example, the presence of an intact membrane, staining with a specific dye, the ability to produce offspring, or, in the case of gametes, the ability to combine with a second gamete to produce viable offspring. Cells can include prokaryotic and eukaryotic cells. Prokaryotic cells include, but are not limited to, bacteria. Eukaryotic cells include, but are not limited to, yeast cells and cells derived from plants and animals, such as mammalian, insect (e.g., spodoptera) and human cells. As used herein, the term “cell” also refers to a single cell, a cell line, or a culture derived from such cells. A “culture” refers to a composition containing isolated cells of the same or different types.
[0112] In the case of two or more nucleic acid or polypeptide sequences, the term "identical" or "percentage identity" refers to the fact that, as measured using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection (see, for example, the NCBI website, etc.), two or more sequences or subsequences are identical, or that a specific percentage of amino acid residues or nucleotides are identical (i.e., when comparing and aligning maximum correspondences within a comparison window or specified region, the identity in a specific region is approximately 60%, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher). Such sequences are thus referred to as "substantially identical." This definition also refers to, or can be applied to, complementary sequences of the test sequence. The definition also includes sequences with deletions and / or additions, as well as those with substitutions. As described below, preferred algorithms may take into account vacancies, etc. Preferably, identity is present in regions of at least about 10 amino acids or 20 nucleotides in length, or more preferably in regions of 10-50 amino acids or 20-50 nucleotides in length. As used herein, percentage (%) nucleic acid sequence identity is defined as the percentage of nucleotides in the candidate sequence that are identical to nucleotides in the reference sequence after sequence alignment and the introduction of vacancies (if desired) to achieve maximum percentage sequence identity. Alignments for determining percentage sequence identity can be performed in various ways within the scope of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2, or Megalign (DNASTAR) software. Appropriate parameters for any algorithm required to measure alignment, including achieving maximum alignment across the full length of the compared sequences, can be determined by known methods.
[0113] For sequence comparisons, a reference sequence is typically used, and the test sequence is compared to it. When using a sequence comparison algorithm, the test and reference sequences are input into the computer. If necessary, the coordinates of the subsequences are specified, along with the sequence algorithm program parameters. Preferably, default program parameters can be used, or alternative parameters can be specified. The sequence comparison algorithm then calculates the percentage sequence identity of the test sequence relative to the reference sequence based on the program parameters.
[0114] The term "complementarity" or "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence via conventional Watson-Crick or other non-conventional types. For example, the sequence AGT is complementary to the sequence TCA. Percentage complementarity indicates the percentage of residues in the nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with the second nucleic acid sequence (e.g., 50%, 60%, 70%, 80%, 90%, and 100% complementarity out of 10). "Complete complementarity" means that all consecutive residues in the nucleic acid sequence will bind to the same number of consecutive residues in the second nucleic acid sequence via hydrogen bonds. As used in this article, “substantially complementary” means that the degree of complementarity in regions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%, or that the two nucleic acids hybridize under strict conditions.
[0115] As used in this paper, “strict conditions” for hybridization refer to conditions under which nucleic acids complementary to the target sequence hybridize primarily with the target sequence and substantially with non-target sequences. Strict conditions are typically sequence-dependent and vary depending on many factors. Generally, the longer the sequence, the higher the temperature at which it hybridizes specifically with its target sequence. Non-limiting examples of strict conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology—Hybridization With Nucleic Acid Probes Part 1, Chapter 2, “Overview of principles of hybridization and the strategy of nucleic acid probe assay”, Elsevier, NY.
[0116] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a stable complex via hydrogen bonds between the bases of nucleotide residues. Hydrogen bonds can occur through Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific mechanism. The complex can consist of two strands forming a double-stranded structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination thereof. Hybridization reactions can constitute steps in broader processes, such as the initiation of PCR or the cleavage of polynucleotides by enzymes. The sequence capable of hybridizing with a given sequence is called the "complement" of that given sequence.
[0117] The terms “patient,” “subject,” “patient in need,” and “subject in need” are used interchangeably herein and refer to a living organism that suffers from or is susceptible to a disease or symptom that can be treated by administration using the methods and compositions provided herein. Non-limiting examples include humans, other mammals, cattle, rats, mice, dogs, monkeys, goats, sheep, cows, deer, and other non-mammals. In some embodiments, the patient is a human. Also covered are progeny of tissues, cells, and biological entities obtained or cultured in vitro.
[0118] As used herein, the term "administration" means oral administration, administration as a suppository, local contact, intravenous administration, parenteral administration, intraperitoneal administration, intramuscular administration, intralesional administration, intrathecal administration, intrathecal administration, intranasal administration, or subcutaneous administration, or implantation of a sustained-release device (e.g., a micro-osmotic pump) into the subject. Administration can be performed via any route, including parenteral and transmucosal routes (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, for example, intravenous, intramuscular, intraarterial, intradermal, subcutaneous, intraperitoneal, intravenous, and intracranial administration. Other delivery modalities include, but are not limited to, the use of liposome formulations, intravenous infusion, transdermal patches, etc.
[0119] As used herein, the term "treatment" and other grammatical equivalents include the relief, reduction, improvement, or prevention of a disease, condition, or symptom; prevention of other symptoms; improvement or prevention of the underlying metabolic cause of a symptom; inhibition of the disease or condition, such as preventing its progression; relief of the disease or condition; remission of the disease or condition; reduction of symptoms caused by the disease or condition; or termination of the symptoms of the disease or condition, and are intended to include prevention. The term also includes achieving therapeutic and / or preventive benefits. A therapeutic benefit means the eradication or improvement of an underlying condition that is being treated. Similarly, a therapeutic benefit is achieved by eradicating or improving one or more physiological symptoms associated with an underlying condition, such that improvement is observed in the patient, although the patient may still have the underlying condition.
[0120] As used herein, the term "prevention" and other grammatical equivalents include preventing the development or occurrence of symptoms of a disease or condition, inhibiting or avoiding symptoms of a disease or condition, and reducing the occurrence of symptoms. Prevention can be complete (i.e., no detectable symptoms) or partial, resulting in fewer observed symptoms than would be present without treatment. The term also includes preventive benefits. For the disease or condition to be prevented, the composition may be administered to a patient at risk of developing the specific disease or a patient reporting one or more physiological symptoms of the disease, even if the disease has not yet been diagnosed.
[0121] The term “inhibition” also means a reduction in the effect (disease state or gene / protein / mRNA expression level) relative to the state in the absence of the compounds or compositions disclosed herein.
[0122] As used in this article, “experimental compound” refers to an experimental compound used in a screening process to identify the activity, inactivity, or other regulation of a specific biological target or pathway.
[0123] "Control" or "controlled experiment," used in its ordinary sense, refers to an experiment in which the subjects or reagents are treated as in a parallel experiment, except that the procedures, reagents, or variables are omitted. In some cases, controls are used as comparative standards for evaluating experimental results. In some embodiments, a control is a measurement of protein activity in the absence of the compounds described herein (including embodiments and examples).
[0124] "Disease" or "symptom" refers to the physical condition or health status of a patient or subject who can be treated with the compounds or methods provided herein. In some cases, "disease" or "symptom" refers to "cancer".
[0125] As used herein, the term "cancer" refers to all types of cancer, growths, malignant or benign tumors found in mammals, including leukemia, carcinoma, and sarcoma. Exemplary cancers include breast cancer, ovarian cancer, colon cancer, liver cancer, kidney cancer, and pancreatic cancer. Other examples include leukemia (e.g., acute myeloid leukemia (“AML”) or chronic myeloid leukemia (“CML”)), brain cancer, lung cancer, non-small cell lung cancer, melanoma, sarcoma, and prostate cancer, cervical cancer, gastric cancer, head and neck cancer, uterine cancer, mesothelioma, metastatic bone cancer, medulloblastoma, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, neuroblastoma, rhabdomyosarcoma, essential thrombocytosis, essential macroglobulinemia, primary brain tumors, malignant islet tumors, malignant carcinoid tumors, bladder cancer, pre-exacerbating skin lesions, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenocortical carcinoma, and endocrine and exocrine pancreatic vegetations.
[0126] Autoimmune diseases are diseases in which the body's immune system attacks healthy cells. Examples of autoimmune diseases include, but are not limited to, rheumatoid arthritis, psoriasis, systemic lupus erythematosus (SLE), type II diabetes, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, multiple sclerosis (MS), Parkinson's disease (PD), Alzheimer's disease (AD), and inflammatory bowel disease (IBD).
[0127] Infectious diseases are medical conditions caused by the growth and spread of harmful organisms (such as bacteria, viruses, fungi, or parasites) within the body. Examples of infectious diseases include, but are not limited to, tuberculosis, influenza, Ebola virus, HIV, HPV infection, and hepatitis.
[0128] "Contact" is used in its ordinary sense and refers to a process that allows at least two different classes of matter (e.g., chemical compounds including biomolecules or cells) to come close enough to react, interact, or physically contact. However, it should be understood that the resulting reaction product can be generated directly from the reaction between the added reagents, or from one or more intermediates derived from the added reagents, which can be generated in the reaction mixture. In some embodiments, contact includes allowing the compounds described herein to interact with proteins or enzymes.
[0129] As used in this article, the terms “phenotype” and “phenotype” refer to observable characteristics of an organism, such as the onset or progression of disease symptoms, biochemical properties, or physiological properties.
[0130] As used herein, the term “expression” for DNA nucleic acid sequences (e.g., genes) refers to the transcription and / or translation products of that sequence. The expression level of DNA molecules in cells can be determined based on the amount of corresponding mRNA present within the cell or the amount of DNA-encoded proteins produced by the cell (Sambrook et al., 1989). Molecular Cloning: A Laboratory Manual (18.1-18.88). When referring to a polypeptide, expression includes any steps involved in the production of the polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion. Expression can be detected using conventional techniques for protein detection (e.g., ELISA, Western blotting, flow cytometry, immunofluorescence, immunohistochemistry, etc.). 。
[0131] The term "gene" refers to a segment of DNA involved in the production of proteins; this includes regions before and after the coding region (leader and tail sequences) and insertion sequences (introns) between individual coding segments (exons). Leader sequences, tail sequences, and introns comprise regulatory elements essential during gene transcription and translation. Furthermore, a "protein gene product" is a protein expressed by a specific gene.
[0132] For the specific protein described herein (e.g., CD34 or CD38), the term "named protein" includes any of the protein's native form, variants, or homologs (e.g., within a range of at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% less activity than the native protein). In some embodiments, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., 50, 100, 150, or 200 consecutive amino acids) compared to the native form. In other embodiments, the protein is a protein identified by its NCBI sequence reference. In other embodiments, the protein is a protein, its homolog, or a functional fragment identified by its NCBI sequence reference.
[0133] The term "CD34" refers to the hematopoietic progenitor cell antigen CD34 encoded by the CD34 gene in the human body, also known as the CD34 antigen. It is a cell surface glycoprotein that functions as a cell adhesion factor. As used herein, the term "CD34" includes the naturally occurring form of the CD34 protein and any homolog or variant that maintains CD34 activity (e.g., within a range of at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% less activity than the native protein). In some embodiments, the variant or homolog has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., 50, 100, 150, or 200 consecutive amino acids) compared to the naturally occurring form. In the implementation plan, the CD34 protein is a protein identified by NCBI sequence reference numbers NP_001764 or NP_001020280.1, its homologs or functional fragments.
[0134] The term "CD38" refers to cluster 38, also known as the cyclic ADP-ribohydrolase encoded by the CD38 gene in the human body. It is a cell surface glycoprotein that plays a role in cell adhesion and signal transduction. As used herein, the term "CD38" includes the native form of the CD38 protein, and any homolog or variant that maintains CD38 activity (e.g., within a range of at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% less activity than the native protein). In some embodiments, the variant or homolog has at least 50%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., 50, 100, 150, or 200 consecutive amino acids) compared to the native form. In the implementation plan, the CD38 protein is a protein identified by NCBI sequence reference number NP_001766.2, its homologs or functional fragments.
[0135] The term "amount" in relation to polynucleotides or peptides refers to the amount of a component or element detected. This amount can be measured relative to a control, for example, where an increase in the level of a particular polynucleotide or peptide compared to a control demonstrates enrichment of the polynucleotide or peptide. Thus, in embodiments, an increase in amount indicates a higher level or efficiency of transplantation of the HSPCs described herein into a host (e.g., a mouse). The term refers to both a quantitative measurement of enrichment and a qualitative measurement of an increase or decrease relative to a control.
[0136] Throughout the description and claims of this specification, the word "comprising" and other forms of the word mean, but are not intended to exclude, for example, other components.
[0137] "Similar," "analogous," or "derivative" is used according to its ordinary meaning in chemistry and biology, and refers to a chemical reagent that is structurally similar to but compositionally different from another reagent (i.e., the so-called "reference" reagent), for example, by the substitution of one atom with an atom of a different element or the presence of a specific functional group, or by the substitution of one functional group with another functional group, or by the absolute stereochemical structure of the chiral center of the reference reagent. In some embodiments, the derivative may be a conjugate with a pharmaceutically acceptable agent (e.g., a phosphate or phosphonate).
[0138] As used herein, the term "salt" refers to the acidic or basic salt of the reagents used herein. Illustrative but non-limiting examples of acceptable salts are inorganic acid salts (hydrochlorides, hydrobroms, phosphates, sulfates, etc.), organic acid salts (acetates, propionates, glutamates, citrates, etc.), and quaternary ammonium salts (iodomethane, iodoethane, etc.).
[0139] The term "pharmaceutically acceptable salt" is intended to include salts of active compounds prepared with relatively non-toxic acids or bases according to specific substituents present on the compounds described herein. When the compounds of the present invention contain relatively acidic functional groups, base addition salts can be obtained by contacting a neutral form of such compounds with a sufficient amount of the desired base in a solvent-free environment or in a suitable inert solvent. Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salts or similar salts. When the compounds of the present invention contain relatively basic functional groups, acid addition salts can be obtained by contacting a neutral form of such compounds with a sufficient amount of the desired acid in a solvent-free environment or in a suitable inert solvent. Pharmaceutically acceptable examples of acid addition salts include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, hydrocarbonic acid, phosphoric acid, phosphoric acid monohydrogen phosphate, phosphoric acid dihydrogen phosphate, sulfuric acid, hydrosulfuric acid, hydroiodic acid, or phosphorous acid; and salts derived from relatively non-toxic organic acids such as acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, succinic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-toluenesulfonic acid, citric acid, tartaric acid, and methanesulfonic acid. Also included are salts of amino acids (e.g., arginine salts) and salts of organic acids (e.g., glucuronic acid or galacturonic acid) (see, for example, Berge et al.). Journal of Pharmaceutical Science66:1-19 (1977)). Certain specific compounds of this disclosure contain both basic and acidic functional groups, which allow the compounds to be converted into base or acid addition salts. Other pharmaceutically acceptable carriers known to those skilled in the art are suitable for this disclosure. Salts tend to be more soluble in aqueous solvents or other protic solvents in the form of the corresponding free base. In other cases, the formulation may be a lyophilized powder prepared in combination with a buffer solution in 1 mM-50 mM histidine, 0.1%-2% sucrose, and 2%-7% mannitol at a pH range of 4.5 to 5.5.
[0140] Therefore, the compounds of this disclosure can exist as salts, for example, as salts formed with pharmaceutically acceptable acids. This disclosure includes such salts. Examples of such salts include hydrochlorides, hydrobromides, sulfates, methanesulfonates, nitrates, maleates, acetates, citrates, fumarates, tartrates (e.g., (+)-tartrates, (-)-tartrates, or mixtures thereof, including racemic mixtures), succinates, benzoates, and salts formed with amino acids (e.g., glutamic acid). These salts can be prepared by methods known to those skilled in the art.
[0141] "Adjuvant" (from Latin) adiuvare: (For adjuvant purposes) is a pharmacological and / or immunological reagent that alters the effects of other reagents.
[0142] A "diluent" (also known as a filler, thinner, or emulsifier) is a diluent agent. Some fluids are too viscous to be easily pumped or too thick to flow from one point to another. This can be problematic because transporting such fluids in this condition may be economically infeasible. To alleviate this restricted movement, a diluent is added. This reduces the viscosity of the fluid, thereby also reducing pumping / transportation costs.
[0143] The term "application" refers to the act of providing an individual in need of treatment with a reagent of the current implementation plan or a pharmaceutical composition comprising a reagent of the current implementation plan.
[0144] The term "co-administered" means administering the composition described herein simultaneously with, before, or immediately after the administration of another therapy. The compounds or compositions disclosed herein may be administered to a patient alone or in combination. Co-administration is intended to include the simultaneous or sequential administration of compounds (more than one compound or agent) alone or in combination. When necessary, the formulation may also be combined with other active substances (e.g., to reduce metabolic degradation).
[0145] As used herein, “sequential application” includes the application of two agents (e.g., compounds or compositions described herein) occurring either on the same day alone or not on the same day (e.g., occurring over several consecutive days).
[0146] As used herein, “simultaneous administration” includes durations that at least partially overlap. For example, when two agents (e.g., any biologically active agent or class of agents described herein) are administered simultaneously, their administration occurs within a desired timeframe. Administration of the agents can begin and end on the same day. Administration of one agent may also occur the day before administration of the second agent, provided that both agents are taken at least once on the same day. Similarly, administration of one agent may be extended beyond administration of the second agent, provided that both agents are taken at least once on the same day. Biologically active agents / reagents do not necessarily need to be taken at the same time every day to constitute simultaneous administration.
[0147] As used in this article, “intermittent administration involves administering the reagent for a period of time (which may be considered the “first administration period”), followed by a period of no administration or administration at a lower maintenance dose (which may be considered the “withdrawal period”), followed by a period of re-administration of the reagent (which may be considered the “second administration period”). Typically, during the second administration period, the dosage level of the reagent will be matched to the dosage level administered during the first administration period, but may be increased or decreased as medically necessary.”
[0148] As used herein, the term "administration" means oral administration, administration as a suppository, local contact, intravenous administration, parenteral administration, intraperitoneal administration, intramuscular administration, intralesional administration, intrathecal administration, intrathecal administration, intranasal administration, or subcutaneous administration, or implantation of a sustained-release device (e.g., a micro-osmotic pump) into the subject. Administration can be performed via any route, including parenteral and transmucosal routes (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, for example, intravenous, intramuscular, intraarterial, intradermal, subcutaneous, intraperitoneal, and intravenous administration. Other delivery modalities include, but are not limited to, the use of liposome formulations, intravenous infusion, and transdermal patches.
[0149] The compositions disclosed herein can be delivered perdermally via a local route and formulated as applicators, solutions, suspensions, emulsions, gels, creams, ointments, pastes, gels, liniments, powders, and aerosols. Oral formulations include tablets, pills, powders, sugar-coated pills, capsules, liquids, lozenges, capsules, gels, syrups, slurries, suspensions, etc., suitable for patient ingestion. Solid formulations include powders, tablets, pills, capsules, capsules, suppositories, and dispersible granules. Liquid formulations include solutions, suspensions, and emulsions, such as aqueous solutions or water / propylene glycol solutions. The compositions disclosed herein may additionally include components that provide sustained release and / or comfort. Such components include high molecular weight, anionic mucomimetic polymers, gelling polysaccharides, and finely fragmented drug carrier matrices. These components are discussed in more detail in U.S. Patent Nos. 4,911,920, 5,403,841, 5,212,162, and 4,861,760. The entire contents of these patents are incorporated herein by reference for all purposes. The compositions disclosed herein can also be used as microspheres for slow release in vivo. For example, drug-containing microspheres can be slowly released subcutaneously via intradermal injection (see Rao, J. Bioniater Sci. Polym. (ed.) 7:623-645, 1995; as a biodegradable and injectable gel formulation (see, for example, Gao Phann. Res. 12:857-863, 1995); or as microspheres for oral administration (see, for example, Eyles, J. Phann. Pharmacol. (49:669-674, 1997) to apply microspheres.
[0150] As used herein, an "effective amount" or "therapeutic effective amount" is an amount sufficient to influence the desired biological effect, such as beneficial outcomes (including clinical outcomes). Therefore, an "effective amount" depends on the circumstances under which it is administered. Effective amounts can vary based on factors known in the art, such as the disease state, age, sex, and weight of the individual being treated. As in emergency situations in treatment settings, several fractions may be administered daily or the dosage may be proportionally reduced. Furthermore, the compositions / formulations of this disclosure may be administered frequently as needed to achieve therapeutic doses.
[0151] Pharmaceutical compositions may include compositions containing a therapeutically effective amount (i.e., an amount that effectively achieves its intended purpose) of a therapeutic agent (e.g., a reagent described herein, including embodiments or examples). The actual amount effective for a particular application will depend in particular on the condition being treated. When administered in a method of treating a disease, such compositions will contain an amount of therapeutic agent that effectively achieves desired results, such as modulating the activity of target molecules and / or reducing, eliminating, or slowing the progression of disease symptoms.
[0152] The dosage and frequency (single or multiple doses) administered to mammals can vary depending on a variety of factors, such as whether the mammal has another disease and the route of administration; the recipient's size, age, sex, health, weight, body mass index, and diet; the nature and severity of the symptoms of the disease being treated, the type of concurrent treatment, complications of the disease being treated, or other health-related problems. Other treatment regimens or reagents may be used in conjunction with the methods and reagents disclosed herein. Adjustments and manipulations of the established dosage (e.g., frequency and duration) are entirely within the capabilities of those skilled in the art.
[0153] For any of the therapeutic agents described herein, the therapeutically effective amount can initially be determined from a cell culture assay. The target concentration, as measured using methods described herein or known in the art, will be the concentration of those therapeutic agents that enables the methods described herein to be implemented.
[0154] As is well known in the art, the therapeutically effective dose for human use can also be determined from animal models. For example, a human dose can be formulated to achieve a concentration that has been found to be effective in animals. As mentioned above, the human dose can be adjusted by monitoring the effectiveness of the reagent and by increasing or decreasing the dosage. Adjusting the dosage based on the methods described above and other methods to achieve maximum efficacy in humans is entirely within the capabilities of a person skilled in the art.
[0155] Dosage can vary depending on the patient's needs and the medication being administered. The dose administered to the patient should be sufficient to produce a beneficial therapeutic response over time. The dosage will also be determined by the presence, nature, and severity of any adverse side effects. Determining the appropriate dosage for a particular situation is within the practitioner's skill level. Typically, treatment begins with a smaller dose than the optimal dose of the reagent. The dose is then gradually increased until the optimal effect is achieved in a variety of situations. Dosage and time intervals can be individually adjusted to provide a level of reagent administration effective for the specific clinical indication being treated. This will provide a treatment regimen commensurate with the severity of the individual's disease state.
[0156] Unless otherwise stated, the weight percentage of a component is based on the total weight of the formulation or composition in which the component is included.
[0157] The term “excipient” is used herein to include any other reagent that may be included in or in combination with the disclosed reagents, wherein the excipient is not a therapeutic or bioactive agent / reagent. Thus, the excipient should be pharmaceutically or biologically acceptable or relevant (e.g., the excipient should generally be non-toxic to an individual). “Excipient” includes a single such reagent and is also intended to include multiple excipients. For the purposes of this disclosure, the terms “excipient” and “carrier” are used interchangeably in some embodiments of this disclosure, and the term is defined herein as “an ingredient used in the practice of formulating safe and effective pharmaceutical compositions.”
[0158] The term "about" refers to any minimal change in the concentration or amount of a reagent that does not alter its efficacy in the preparation of formulations and in the treatment of diseases or conditions. The term "about" in relation to the concentration range of reagents (e.g., therapeutic agents / active agents) of this disclosure also refers to any change in the specified amount or range that would be effective.
[0159] This document may express a range as “about” to a specific value, and / or to “about” another specific value. When expressing such a range, the other side includes from said specific value and / or to another specific value. Similarly, when a numerical value is expressed as an approximation using the antecedent “about”, it should be understood that the specific value forms the other side. It should be further understood that the endpoints of each range are significant to and independent of the other endpoint. It should also be understood that this document discloses numerous numerical values, and in addition to the value itself, each value is disclosed as “about” to that specific value. It should also be understood that throughout the application, data is provided in a variety of different formats, and that the data represents the endpoints and starting points and ranges of any combination of data points. For example, if a specific data point “10” and a specific data point “15” are disclosed, it can be understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered to be disclosed as well as between 10 and 15. It should also be understood that each unit between two specific units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13 and 14 are also disclosed.
[0160] compound On the one hand, this article provides compounds comprising phosphorylated CpG oligodeoxynucleotides (CpG-ODNs) conjugated to antimicroRNA (antimiR) or microRNA (miRNA) mimic nucleic acid sequences (miRNA mimics). In embodiments, the CpG-ODN is a single-stranded, partially or fully phosphorylated oligodeoxynucleotide of 15 to 30 bases (nucleobases) in length.
[0161] On the one hand, this article provides compounds containing antimicroRNA (antimiR) sequences, wherein the antimiR sequence comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more) phosphate thioester bonds and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more) chemically modified nucleotides.
[0162] In one embodiment, the compound comprises a nucleic acid sequence (CpG-ODN) having about 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with at least 15 consecutive nucleobases of one of SEQ ID NO: 1-14, which is conjugated to an antimiR. In another embodiment, the compound comprises a nucleic acid sequence (CpG-ODN) having about 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with one of SEQ ID NO: 1-14, which is conjugated to an antimiR. In an embodiment, this document provides a compound comprising a nucleic acid sequence (CpG-ODN) having about 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with at least 15 consecutive nucleotides of one of SEQ ID NO: 1-14, which is conjugated to a miRNA mimic. In an embodiment, the compound comprises a nucleic acid sequence (CpG-ODN) having about 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with one of SEQ ID NO: 1-14, which is conjugated to a miRNA mimic. In the implementation plan, the nucleic acid sequence (CpG-ODN) is a single-stranded, partially or fully phosphorylated oligonucleotide with a base length of 15 to 30 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30).
[0163] In embodiments, the compounds of this disclosure comprise a nucleic acid sequence (CpG-ODN) having about 80%-85%, about 85-90%, about 90-95%, or about 95%-100% sequence identity with a continuous sequence of at least 15 nucleobases of one of SEQ ID NO: 1-14, which is conjugated to an anti-miR or miRNA mimic. In embodiments, the compounds of this disclosure comprise a nucleic acid sequence (CpG-ODN) having about 80%-85%, about 85-90%, about 90-95%, or about 95%-100% sequence identity with one of SEQ ID NO: 1-14, which is conjugated to an anti-miR or miRNA mimic. In the implementation plan, the nucleic acid sequence (CpG-ODN) is a single-stranded, partially or fully phosphorylated oligonucleotide with a base length of 15 to 30 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30).
[0164] In one implementation, the anti-miR is anti-miR126. In another implementation, the anti-miR is anti-miR155. In another implementation, the anti-miR is anti-miR125b. In another implementation, the anti-miR is anti-miR146a. In another implementation, the anti-miR is anti-miR9. In another implementation, the anti-miR is anti-miR142. In another implementation, the anti-miR is anti-miR10b. In another implementation, the anti-miR is anti-miR21. In another implementation, the anti-miR is anti-miR17. In another implementation, the anti-miR is anti-miR92.
[0165] In one implementation, the miRNA mimic is miR126. In another implementation, the miRNA mimic is miR155. In another implementation, the miRNA mimic is R125b. In another implementation, the miRNA mimic is miR146a. In another implementation, the miRNA mimic is miR9. In another implementation, the miRNA mimic is miR142. In another implementation, the miRNA mimic is miR10b. In another implementation, the miRNA mimic is miR21. In another implementation, the miRNA mimic is miR17. In another implementation, the miRNA mimic is miR92.
[0166] Table 1 lists the nucleic acid sequences (CpG-ODN) of SEQ ID NO: 1-14.
[0167] Table 1. Sequences of compounds and components.
[0168] In the implementation scheme, the anti-miRNA sequences are anti-miR126, anti-miR142, anti-miR155, anti-miR125b, anti-miR146a, anti-miR9, anti-miR10b, anti-miR17, anti-miR18, anti-miR19, anti-miR20, anti-miR21, anti-miR22, anti-miR23, anti-miR24, anti-miR25, anti-miR26, anti-miR27, and anti-miR28. R28, anti-miR29, anti-miR30, anti-miR31, anti-miR32, anti-miR33, anti-miR34, anti-miR35, anti-miR36, anti-miR37, anti-miR38, anti-miR39, anti-miR40, anti-miR41, anti-miR42, anti-miR43, anti-miR44, anti-miR45, anti-miR46, anti-miR47, anti-miR48, anti-miR49, anti- miR50, anti-miR51, anti-miR52, anti-miR53, anti-miR54, anti-miR55, anti-miR56, anti-miR57, anti-miR58, anti-miR59, anti-miR60, anti-miR61, anti-miR62, anti-miR63, anti-miR64, anti-miR65, anti-miR66, anti-miR67, anti-miR68, anti-miR69, anti-miR70, anti-miR71 Nucleic acid sequences containing anti-miR72, anti-miR73, anti-miR74, anti-miR75, anti-miR76, anti-miR77, anti-miR78, anti-miR79, anti-miR80, anti-miR81, anti-miR82, anti-miR83, anti-miR84, anti-miR85, anti-miR86, anti-miR87, anti-miR88, anti-miR89, anti-miR90, anti-miR91, or anti-miR92.
[0169] In the embodiments, the mimics of the compounds disclosed herein are miR126, miR142, miR155, miR125b, miR146a, miR9, miR10b, miR17, miR18, miR19, miR20, miR21, miR22, miR23, miR24, miR25, miR26, miR27, and miR28 mimics. Items, miR29 simulacrum, miR30 simulacrum, miR31 simulacrum, miR32 simulacrum, miR33 simulacrum, miR34 simulacrum, miR35 simulacrum, miR36 simulacrum, miR37 simulacrum, miR38 simulacrum, miR39 simulacrum, miR40 simulacrum, miR41 simulacrum, miR42 simulacrum, miR43 simulacrum, miR44 simulacrum, miR45 simulacrum, miR46 simulacrum, miR47 simulacrum, miR48 simulacrum, miR49 simulacrum, miR 50 miR, 51 miR, 52 miR, 53 miR, 54 miR, 55 miR, 56 miR, 57 miR, 58 miR, 59 miR, 60 miR, 61 miR, 62 miR, 63 miR, 64 miR, 65 miR, 66 miR, 67 miR, 68 miR, 69 miR, 70 miR, 71 miR The miR72 mimic, miR73 mimic, miR74 mimic, miR75 mimic, miR76 mimic, miR77 mimic, miR78 mimic, miR79 mimic, miR80 mimic, miR81 mimic, miR82 mimic, miR83 mimic, miR84 mimic, miR85 mimic, miR86 mimic, miR87 mimic, miR88 mimic, miR89 mimic, miR90 mimic, miR91 mimic, or miR92 mimic nucleic acid sequences.
[0170] In embodiments, this document provides a compound for linking CpG-ODN to an anti-miR126 compound having the following sequence: 5' G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1) xxxxx CGC AUU AUU ACU CACGGU ACG A (SEQ ID NO: 16) 3' where xxxxx represents one or more connectors described herein. In embodiments, this document provides a compound for linking CpG-ODN to an anti-miR126 compound having the following sequence: 5' G*G*T GCA TCGATG CAGG*G*G* G*G (SEQ ID NO: 1) xxxxx mCmGmC mAmUmU mAmUmU mAmCmU mCmAmCmGmGmU mAmCmG mA (SEQ ID NO: 17) 3', where xxxxx represents one or more connectors described herein.
[0171] In embodiments, this document provides a compound for linking CpG-ODN to an anti-miR126 compound having the following sequence: 5' G*GT GCA TGC ATG CAG G*G*G*G*G (SEQ ID NO: 2) xxxxx CGC AUU AUU ACU CACGGU ACG A (SEQ ID NO: 16) 3'. In embodiments, this document provides a compound for linking CpG-ODN to an anti-miR126 compound having the following sequence: 5' G*GT GCA TGC ATG CAG G*G*G*G*G (SEQ ID NO: 2) xxxxxmCmGmC mAmUmU mAmUmU mAmCmU mCmAmC mGmGmU mAmCmG mA (SEQ ID NO: 17) 3', where xxxxx represents one or more linkers described herein.
[0172] In embodiments, this document provides a compound for linking CpG-ODN to an anti-miR126 compound having the following sequence: 5' G*G*T*G*C*A*T*C*G*A*T*G*C*A*G*G*G*G*G*G (SEQ ID NO: 3) xxxxx CGC AUU AUUACU CAC GGU ACG A (SEQ ID NO: 16) 3'. In embodiments, this document provides a compound for linking CpG-ODN to an anti-miR126 compound having the following sequence: 5' G*G*T*G*C*A*T*C*G*A*T*G*C*A*G*G*G*G*G*G (SEQ ID NO: 3) xxxxx mCmGmC mAmUmU mAmUmU mAmCmU mCmAmC mGmGmU mAmCmG mA (SEQ ID NO: 17) 3', wherein xxxxx represents one or more connectors described herein. In embodiments, this document provides for linking CpG-ODN to a compound that resists miR126 having the following sequence: 5' G*G*T*G*C*A*T*C*G*A*T*G*C*A*G*G*G*G*G*G (SEQ ID NO: 3) xxxxx mC*mG*mC* mA*mU*mU* mA*mU*mU* mA*mC*mU* mC*mA*mC* mG*mG*mU* mA*mC*mG*mA (SEQ ID NO: 48) 3', where xxxxx represents one or more connectors described herein.
[0173] Table 2 lists exemplary miR126 simulated sequences.
[0174] Table 2; Compounds including CpG-ODNs linked to miR126 mimics
[0175] In the embodiments, the connectors described herein, indicated by “xxxxx”, etc. (e.g., in Tables 2, 3, and 4 (hereinafter)), are substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted alkylene, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkylene, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted cycloalkylene, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkylene, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted arylene, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted cycloalkylene or -(CH2). n -PO4-[(CH2) n -PO4] z -(CH2) n The symbol n is an integer from 1 to 5 (e.g., 3) and the symbol z is an integer from 0 to 50 (e.g., 0 to 25, 0 to 10, or 0 to 5). In an embodiment, n is 3 and z is 0 to 5 or 1 to 5. In an embodiment, n is 3 and z is 0 to 4 or 1 to 4. In an embodiment, n is 3 and z is 0 to 3 or 1 to 3. In an example, n is 3 and z is 3. 2'Ome (2'-O-methyl nucleoside; the hydroxyl group at the 2'-position is replaced by a 2'-O-methyl group); PS is a thiophosphate ester. One non-bridging oxygen is replaced by sulfur; PS+3 represents three phosphate esters in the modified sequence, one of which is a non-bridging oxygen replaced by sulfur; PS+5 represents five phosphate esters in the modified sequence, one of which is a non-bridging oxygen replaced by sulfur.
[0176] For example, as shown below, in an embodiment, the nucleobases in the thiophosphorylated oligonucleotides of the disclosed sequence may include internucleotide links of thiophosphoryl esters. A portion of such thiophosphorylated oligonucleotides is shown below.
[0177] The linker may have the following structure, wherein one end of the linker is connected to the 3' phosphate of guanine and the other end is connected to the 5' phosphate of thymine, and the nucleobase in the antisense portion may be modified with 2'OMe.
[0178] The above formula represents a portion of the CpG-ODN linked at the 3'-OH end via a (CH2)3 adapter (also referred to herein as a C3 adapter) connected to the 5'-phosphate ester of the antisense RNA.
[0179] The linker can be a bond, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or an unsubstituted alkylene group, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or an unsubstituted heterocyclic alkylene group, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or an unsubstituted heterocyclic alkylene group, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or an unsubstituted arylene group, or a substituted or unsubstituted heteroarylene group.
[0180] In embodiments, this disclosure includes a composition of anti-miR142 linked to a phosphorylated oligonucleotide of this disclosure having the following sequence: 5' G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1) xxxxxUCCAUAAAGUAGGAAACACUACA (SEQ ID NO: 22)3'. Table 3 lists miR142 mimics: Table 3: Sequences of compounds and components.
[0181] In embodiments, this document provides compositions for linking CpG-ODN to an anti-miR155 having the following sequence: 5' G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1) xxxxxUGUUAAUGCUAAUAUGUAGGAG (SEQ ID NO: 26) 3'. In embodiments, this document provides compositions for linking CpG-ODN to an anti-miR155 having the following sequence: 5' G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1) xxxxx ACCCCTATCACAATTAGCATTAA (SEQ ID NO: 27) 3', wherein the nucleotide T in SEQ ID NO: 27 can be substituted with the nucleotide U. In embodiments, the compounds described herein comprise compositions in which CpG-ODN is linked to an anti-miR155 having the following sequence: 5' G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1)xxxxx mA*mC*mC*mC*mC*mU*mA*mU*mC*mA*mC*mA*mU*mU*mA*mG*mC*mA*mU*mU*mA*mA (SEQ ID NO: 28) 3'. In embodiments, compositions in which CpG-ODN is linked to an anti-miR155 having the following sequence are provided herein: 5' T * G * C * T * G * C * T * T * T * T * G * T * G * C * T * T * T * T * G * T * G * C * T * T (SEQ ID NO:11) xxxxx ACCCCTATCACAATTAGCATTAA (SEQ ID NO: 27) 3'. In embodiments, this document provides a composition for linking CpG-ODN to an anti-miR155 having the following sequence: 5' T * G* C * T * G * C * T * T * T * T * G * T * G * C * T * T * T * T * G * T * G * C * T * T (SEQ ID NO: 11) xxxxx mA*mC*mC*mC*mC*mU*mA*mU*mC*mA*mC*mA*mU*mU*mA*mG*mC*mA*mU*mU*mA*mA (SEQ ID NO: 28) 3'. Table 4 lists the sequences of miR155 analogs: Table 4: Sequences of compounds and components.
[0182] In the implementation scheme, the CpG(D19)-randomized RNA at the 3' of sequence 5' (G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1)xxxxx mGmUmAmGmAmAmCmCmGmUmAmCmUmCmGmUmCmAmCmUmUmA (SEQ ID NO: 32)) is used as a control ODN (included in...) Figure 1 middle).
[0183] In embodiments, this document provides compositions for linking CpG-ODN to an anti-miR125b having the following sequence: 5' G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1) xxxxxTCACAAGTTAGGGTCTCAGGGA (SEQ ID NO: 33) 3', wherein the nucleotide T in SEQ ID NO: 33 can be substituted with nucleotide U. In embodiments, this document provides compositions for linking CpG-ODN to an anti-miR125b having the following sequence: 5' G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1) xxxxx mU*mC*mA*mC*mA*mA*mG*mU*mU*mA*mG*mG*mG*mG*mU*mC*mU*mC*mA*mG*mG*mG*mA (SEQ ID NO: 34) 3'.
[0184] In embodiments, this document provides compositions for linking CpG-ODN to anti-miR146a having the following sequence: 5' G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1) xxxxxCCCATGGAATTCAGTTCTCA (SEQ ID NO: 35) 3', wherein the nucleotide T in SEQ ID NO: 35 may be substituted with nucleotide U. In embodiments, this document provides compositions for linking CpG-ODN to anti-miR125b having the following sequence: 5' G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1) xxxxx mC*mC*mC*mA*mT*mG*mG*mA*mA*mT*mT*mC*mA*mG*mT*mT*mC*mA (SEQ ID NO: 36) 3'. In embodiments, this document provides compositions for linking CpG-ODN to anti-miR146a having the following sequence: 5' G*G*T GCA TGC ATGCAGG*G*G* G*G (SEQ ID NO: 2) xxxxx CCCATGGAATTCAGTTCTCA (SEQ ID NO: 35) 3'. In embodiments, this document provides compositions for linking CpG-ODN to anti-miR146a having the following sequence: G*G*T GCATGC ATG CAGG*G*G* G*G (SEQ ID NO: 2) xxxxx mC*mC*mC*mA*mT*mG*mG*mA*mA*mT*mT*mC*mA*mG*mT*mT*mC*mA (SEQ ID NO: 36) 3'.
[0185] In the implementation scheme, the compound containing the nucleic acid sequence (CpG-ODN) is conjugated to an anti-miR or miRNA mimic sequence via one or more adapters described herein.
[0186] In the implementation, a compound comprising a nucleic acid sequence (CpG-ODN) having about 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with a continuous sequence of at least 15 nucleobases of one of SEQ ID NO: 1-14 is conjugated to an anti-miR or miRNA mimic sequence via one or more adapters described herein.
[0187] In the embodiments, a compound comprising a nucleic acid sequence (CpG-ODN) having about 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with a continuous sequence of at least 15 nucleotides of one of SEQ ID NOs: 1-14 is conjugated to a nucleic acid sequence having about 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with a continuous sequence of at least 15 nucleotides of one of SEQ ID NOs: 1-14 via one or more adapters described herein and a nucleic acid sequence conjugated to a continuous sequence of at least 15 nucleotides of one of SEQ ID NOs: 16-31, 33-36, and 48 via one of one of one of one of two of one of two of one of two of one of two of one of two of two of three of one of two of two of two of three of two ...
[0188] In the implementation scheme, a compound comprising a nucleic acid sequence (CpG-ODN) having approximately 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with a sequential sequence of at least 15 nucleobases of one of SEQ ID NO: 1-14 is coupled with one or more adapters described herein and a sequence of SEQ ID NO: 1-14. A second nucleic acid sequence conjugate having about 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity of a continuous sequence of at least 15 nucleobases of one of the following: said second nucleic acid sequence contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) thiophosphate bonds.
[0189] In the implementation scheme, a compound comprising a nucleic acid sequence (CpG-ODN) having approximately 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with a sequential sequence of at least 15 nucleobases of one of SEQ ID NO: 1-14 is coupled with one or more adapters described herein and a sequence of SEQ ID NO: 1-14. A second nucleic acid sequence conjugate comprising a continuous sequence of at least 15 nucleotides of one of 16-31, 33-36, and 48 having approximately 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity, wherein said second nucleic acid sequence contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) chemically modified nucleotides. In embodiments, the chemical modification is selected from 2'O-methyl, 2'-deoxy-2'-fluorine, 2'-deoxy, universal base, 5-C-methyl, inverted deoxy-debase residues, and locked nucleic acids.
[0190] In the embodiments, a compound comprising a nucleic acid sequence (CpG-ODN) having about 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with a continuous sequence of at least 15 nucleosides of one of SEQ ID NOs: 1-14 is conjugated via one or more adapters described herein and a second nucleic acid sequence having about 80%-100% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with a continuous sequence of at least 15 nucleosides of one of SEQ ID NOs 16-31, 33-36, and 48, wherein the second nucleic acid sequence contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, ...) The nucleotides consist of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more thiophosphates linked to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more) chemically modified nucleotides. In embodiments, the chemical modification is selected from 2'O-methyl, 2'-deoxy-2'-fluorine, 2'-deoxy, universal bases, 5-C-methyl, incorporation of reverse deoxy-debase residues, and locked nucleic acids.
[0191] In the implementation scheme, a compound comprising a nucleic acid sequence (CpG-ODN) selected from SEQ ID NO: 1-14 is conjugated to an anti-miR or miRNA mimic sequence via one or more adapters described herein.
[0192] In the embodiments, a compound comprising a nucleic acid sequence (CpG-ODN) selected from one of SEQ ID NO: 1-14 is conjugated to a nucleic acid sequence selected from SEQ ID NO 16-31, 33-36 and 48 via one or more adapters described herein.
[0193] In an embodiment, a compound comprising a nucleic acid sequence (CpG-ODN) selected from one of SEQ ID NO: 1-14 is conjugated to a second nucleic acid sequence selected from SEQ ID NO: 16-31, 33-36 and 48 via one or more adapters described herein, wherein the second nucleic acid sequence contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more) thiophosphates.
[0194] In an embodiment, a compound comprising a nucleic acid sequence (CpG-ODN) selected from one of SEQ ID NO: 1-14 is conjugated via one or more adapters described herein to a second nucleic acid sequence selected from SEQ ID NO: 16-31, 33-36, and 48, wherein the second nucleic acid sequence contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) chemically modified nucleotides. In an embodiment, the chemical modification is selected from 2'O-methyl, 2'-deoxy-2'-fluorine, 2'-deoxy, universal base, 5-C-methyl, inverse deoxy-debase residues, and locked nucleic acids.
[0195] In the implementation scheme, a compound comprising a nucleic acid sequence (CpG-ODN) selected from one of SEQ ID NO: 1-14 is coupled to one or more adapters described herein with a sequence selected from SEQ ID NO: 1-14. The second nucleic acid sequence concatenations 16-31, 33-36, and 48, wherein the second nucleic acid sequence contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) phosphate thioester bonds and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) chemically modified nucleotides. In the implementation scheme, the chemical modification is selected from 2'O-methyl, 2'-deoxy-2'-fluorine, 2'-deoxy, universal base, 5-C-methyl, incorporation of reverse deoxy-debase residues, and locked nucleic acids.
[0196] In an embodiment, a compound comprising a nucleic acid sequence (CpG-ODN) selected from one of SEQ ID NO: 1-14 is conjugated to a nucleic acid sequence selected from SEQ ID NO 16-31, 33-36 and 48 via one or more adapters described herein, wherein the second nucleic acid sequence contains a phosphate thioester linker for all internucleotide linking.
[0197] In an embodiment, a compound comprising a nucleic acid sequence (CpG-ODN) selected from one of SEQ ID NO: 1-14 is conjugated to a nucleic acid sequence selected from SEQ ID NO 16-31, 33-36 and 48 via one or more adapters described herein, wherein the second nucleic acid sequence contains all chemically modified (e.g. 2' O-methyl) nucleotides.
[0198] In an embodiment, a compound comprising a nucleic acid sequence (CpG-ODN) selected from one of SEQ ID NO: 1-14 is conjugated to a nucleic acid sequence selected from SEQ ID NO 16-31, 33-36 and 48 via one or more adapters described herein, wherein the second nucleic acid sequence contains phosphate thioester bonds for all internucleotide bonds and contains all chemically modified (e.g. 2' O-methyl) nucleotides.
[0199] In an embodiment, the compound comprises a nucleic acid sequence of an anti-miR or miRNA mimic sequence, wherein the nucleic acid sequence contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more) phosphate thioester-linked and / or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more) chemically modified nucleotides. In the implementation scheme, the chemical modification is selected from 2'O-methyl, 2'-deoxy-2'-fluorine, 2'-deoxy, universal base, 5-C-methyl, incorporation of reverse deoxy-debase residues, and locked nucleic acids.
[0200] In an embodiment, the compound comprises a nucleic acid sequence selected from SEQ ID Nos. 16-31, 33-36, and 48 of an anti-miR or miRNA mimic sequence, wherein the nucleic acid sequence contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) phosphate thioester-linked and / or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) chemically modified nucleotides. In the implementation scheme, the chemical modification is selected from 2'O-methyl, 2'-deoxy-2'-fluorine, 2'-deoxy, universal base, 5-C-methyl, incorporation of reverse deoxy-debase residues, and locked nucleic acids.
[0201] In embodiments, the linker is a covalent linker (i.e., a linker that covalently links at least two (e.g., 2) portions of a compound). In embodiments, the linker is or includes a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted alkylene or heteroalkylene linker. In embodiments, the nucleic acid conjugated to anti-miR and miRNA mimics includes one or more substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkylene linkers. Linkers may be added to the sequence during synthesis. In embodiments, heteroalkylene linkers are linked to each other via inserted phosphate ester bonds. In embodiments, the covalent linker is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkylene linker.
[0202] In embodiments, the linker is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkylene, or a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted cyclohexaalkylene. As used herein, "cyclohexaalkylene" is a heteroalkylene having one or more divalent cyclic moieties within a heteroalkylene chain. The cyclic moieties can be substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted cycloalkylene, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted arylene, or substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroarylene. In embodiments, the cyclic moiety is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted ribose (e.g., a nucleoside). In embodiments, the cyclic moiety acts as a branching point of a connector, thereby forming a branched connector. The branching point of the cyclic moiety can be used to attach additional functional moieties to the conjugates provided herein, such as detectable moieties, pharmaceutical moieties, or biomolecules. As explained in more detail below, additional functional moieties can be joined using click chemistry techniques known in the art.
[0203] In the implementation scheme, the connector is or contains a portion having the following formula: -(CH2) n -PO4-[(CH2) n -PO4] z -(CH2) n -
[0204] In the formula above, the symbol n is an integer from 1 to 5 (e.g., 3), and the symbol z is an integer from 0 to 50 (e.g., 0 to 25, 0 to 10, or 0 to 5). In one embodiment, n is 3 and z is 0 to 5 or 1 to 5. In another embodiment, n is 3 and z is 0 to 4 or 1 to 4. In yet another embodiment, n is 3 and z is 0 to 3 or 1 to 3. In a specific example, n is 3 and z is 3.
[0205] For example, the linker may have the following structure, wherein one end of the linker is connected to the 3' phosphate of guanine and the other end is connected to the 5' phosphate of thymine: In the implementation scheme, the guanidine is linked to a nucleic acid sequence (CpG-ODN), and the thymine is linked to an anti-miR or miRNA mimic sequence.
[0206] In an embodiment, the connector may include a portion selected from an azide group, a protected amino group, an N-hydroxysuccinimide (NHS) group, and a protected thiol group.
[0207] In one embodiment, the connector may include a protected thiol group partially conjugated to a group selected from divinyl sulfone derivatives, acryloyl derivatives, and / or maleimide derivatives. In another embodiment, the acryloyl derivative is acryloyl chloride.
[0208] In the implementation scheme, the connector may be partially conjugated with polyethylene glycol (PEG) or bisphosphonate.
[0209] In the implementation, the connector may contain an unsubstituted C3 heteroalkyl group.
[0210] In the implementation scheme, the connector may contain unreplaced C6-C. 12 Heteroalkyl groups.
[0211] In embodiments, the linker may be replaced by a reactive group (e.g., a click chemistry reactive group) or a protected reactive group. The reactive group may be used to conjugate CpG-ODN to anti-miR or miRNA mimics and / or to additional functional moieties as described herein, such as detectable moieties or biomolecules (e.g., targeting moieties).
[0212] Therefore, a joint may also include modifications, lacing, or attachments of additional parts.
[0213] The reactive group used to conjugate CpG-ODN to anti-miR compounds or to conjugate miRNA-mimic compounds to additional functional moieties can be any applicable reactive group useful in bioconjugation chemistry. See Hermanson. Bioconjugate Techniques 1996, Academic Press, Inc., San Diego.
[0214] In the implementation scheme, the reactive group is a click chemistry reactive group. Click chemistry refers to a group of rapid, simple, easy-to-purify, versatile, regiospecific, and high-yield reactions. There may be four different click reactions: (1) Cycloaddition - these mainly refer to 1,3-dipolar cycloaddition, but also include isoDiels-Alder cycloaddition; (2) Nucleophilic ring-opening - these refer to opening strained heterocyclic electrophilic reagents, such as aziridine, epoxides, cyclic sulfates, aziridinium ions, episulfonium ions; (3) Non-aldecorative carbonyl chemistry - examples include the formation of ureas, thioureas, hydrazones, oxime ethers, amides, and aromatic heterocycles; (4) Addition of carbon-carbon polybonds - examples include epoxidation, aziridine propanation, dihydroxylation, addition of thiohalides, addition of nitrosyl halides, and certain Michael additions. In the implementation scheme, the click reaction used can be Cu I The catalytic Huisgen 1,3-dipolar cycloaddition (HDC) of azides or terminal alkynes forms 1,2,3-triazoles. In embodiments, the click reaction can be a copper-free reaction.
[0215] In embodiments, the click chemical reactive group is or includes an azide group, an olefinic group, an amino group, an N-hydroxysuccinimide group, a thiol group, a divinyl sulfone derivative, or a maleimide derivative. Therefore, in embodiments, the connector is replaced by a reactive group (e.g., a click chemical reactive group) or a protected reactive group, the protected reactive group including, for example, a protected amino group or an N-hydroxysuccinimide group suitable for chemical conjugation by N-hydroxysuccinimide (NHS); a thiol group conjugable to divinyl sulfone; a protected thiol group conjugable to 1-alkyl-3-methylacryloyl (acryloyl) chloride or an acryloyl derivative; or a protected thiol group conjugable to a maleimide derivative.
[0216] The following provides a structural example of a cyclohexene branched connector: As shown above, the cyclohexane branch linker is connected at one end to the 3' phosphate ester of guanine and at the other end to the 5' phosphate ester of thymidine. The branch point of the cyclohexane branch linker is a 5-substituted thymidine. The thymidine at position 5 is replaced by a reactive group containing the NHS moiety, which can act as a reactive group to connect to additional functional groups. The following provides other examples of compounds that can be used as partial branch points for compounds containing reactive functional groups and protected reactive functional groups.
[0217] Fmoc amino modifier C6 dT.
[0218] S-Bz-thiol modifier C6-dT.
[0219] DBCO-dT DBCO-sulfonyl-NHS ester In implementation schemes, the junction branch point can be acyclic. Examples of compounds that can be used as acyclic partial branch points containing reactive and protected reactive functional groups within the junction are provided below.
[0220] As described above, the reactive group can be used to conjugate CpG-ODN to anti-miR or miRNA mimic nucleic acid sequences and / or to additional functional moieties, such as detectable moieties, therapeutic moieties (e.g., drug moieties), targeting moieties, or biomolecules. Additional functional moieties include fluorescent labels, targeting compounds (bone-targeting bisphosphonates), drugs, or antibodies. In embodiments, the additional moieties are chemically reactive moieties, detectable moieties, therapeutic moieties (e.g., anticancer agents or antiviral agents), nucleic acid sequences, DNA sequences, or nucleic acid analogs. In the implementation plan, the detectable portion includes fluorescent dyes, electron-dense reagents, enzymes, biotin, digoxigenin, paramagnetic molecules, paramagnetic nanoparticles, contrast agents, magnetic resonance contrast agents, X-ray contrast agents, gadolinium, radioisotopes, radionuclides, fluorodeoxyglucose, gamma-ray emitting nuclides, positron-emitting radionuclides, biocolloids, microbubbles, iodide contrast agents, barium sulfate, thorium dioxide, gold, gold nanoparticles, gold nanoparticle aggregates, fluorophores, two-photon fluorophores, haptens, proteins, or fluorescent portions. In the implementation plan, an additional portion is a therapeutic portion (e.g., anticancer agents or antiviral agents).
[0221] In some embodiments, the additional functional moiety may be a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted alkyl, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkyl, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted cycloalkyl, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heterocycloalkyl, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted aryl, or a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroaryl. In embodiments, the additional moiety is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C1-C. 40 Alkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 2- to 40-membered heteroalkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C3-C8 cycloalkyl groups, substituted or unsubstituted 3- to 8-membered heteroalkyl groups, substituted or unsubstituted C6-C 10 Aryl, or substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 5- to 10-membered heteroaryl. In embodiments, the additional moiety is substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) C1-C 40 Alkyl groups, substituted 2- to 40-membered heteroalkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) C3-C8 cycloalkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) 3- to 8-membered heterocycloalkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) C6-C 10 Aryl, or substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) 5 to 10 heteroaryl. In embodiments, the additional functional moiety is R. 1 Replacement C1-C 40 Alkyl, R 1 Substituted 2 to 40-membered heteroalkyl groups, R 1 Substituted C3-C8 cycloalkyl, R 1 Substituted 3- to 8-membered heterocyclic alkyl groups, R 1 Replacement C6-C 10Aryl, or R 1 The substituted 5- to 10-membered heteroaryl group. In the embodiments, the additional functional moiety is R. 1 Replacement C1-C 40 Alkyl group. In the embodiments, the additional functional moiety is -(unsubstituted C1-C) 40 (alkylene)-R 1 In the implementation scheme, the additional functional moiety is -(unsubstituted linear C1-C) 40 (alkylene)-R 1 In the implementation scheme, the additional functional part is -(unsubstituted C3-C) 21 (alkylene)-R 1 In the implementation scheme, the additional functional part is -(unsubstituted C3-C) 18 (alkylene)-R 1 In the implementation scheme, the additional functional moiety is -(unsubstituted linear C3-C) 15 (alkylene)-R 1 In the implementation scheme, the additional functional moiety is -(unsubstituted linear C6-C). 21 (alkylene)-R 1 In the implementation scheme, the additional functional part is -(unsubstituted linear C9-C) 21 (alkylene)-R 1 In the implementation scheme, the additional functional part is -(unsubstituted linear C9-C) 18 (alkylene)-R 1 In the implementation scheme, the additional functional part is -(unsubstituted linear C9-C) 15 (alkylene)-R 1 In the implementation scheme, the additional functional part is -(unsubstituted linear C) 12 -C 15 (alkylene)-R 1 In the implementation scheme, the additional functional part is -(unsubstituted linear C) 12 (alkylene)-R 1 In the implementation scheme, the additional functional part is -(unsubstituted linear C) 13 (alkylene)-R 1 In the implementation scheme, the additional functional part is -(unsubstituted linear C) 14 (alkylene)-R 1 In the implementation scheme, the additional functional part is -(unsubstituted linear C) 15 (alkylene)-R 1 In the implementation scheme, the additional functional part is R. 1 Substituted 2- to 40-membered heteroalkyl groups. In embodiments, the additional functional moiety is -(unsubstituted 2- to 40-membered heteroalkylene)-R 1In the implementation scheme, the additional functional moiety is -(substituted straight-chain 2 to 40-membered heteroalkylene)-R 1 In the embodiments, the additional functional moiety is -(substituted 5 to 40-membered heteroalkylene)-R 1 In the embodiments, the additional functional moiety is -(substituted 10 to 40-membered heteroalkylene)-R 1 In the embodiments, the additional functional moiety is -(substituted 15 to 40-membered heteroalkylene)-R 1 In the embodiments, the additional functional moiety is -(substituted 20 to 40-membered heteroalkylene)-R 1 In the embodiments, the additional functional moiety is -(substituted 30 to 40-membered heteroalkylene)-R 1 In the embodiments, the additional functional moiety is -(substituted 2 to 35-membered heteroalkylene)-R 1 In the embodiments, the additional functional moiety is -(substituted 2 to 30-membered heteroalkylene)-R 1 In the embodiments, the additional functional moiety is -(substituted 2 to 25-membered heteroalkylene)-R 1 In the embodiments, the additional functional moiety is -(substituted 2 to 20-membered heteroalkylene)-R 1 In the embodiments, the additional functional moiety is -(substituted 2 to 10-membered heteroalkylene)-R 1 In the implementation scheme, the additional functional moiety is -(substituted 2 to 50-membered heteroalkylene)-R 1 In the implementation scheme, the additional functional moiety is -(substituted 2 to 60-membered heteroalkylene)-R 1 In one embodiment, the additional functional moiety is a substituted 2- to 40-membered heteroalkyl group. In another embodiment, the additional functional moiety is a substituted 10- to 50-membered heteroalkyl group. In yet another embodiment, the additional functional moiety is a substituted 20- to 40-membered heteroalkyl group. In yet another embodiment, the additional functional moiety is a substituted 25- to 40-membered heteroalkyl group. In yet another embodiment, the additional functional moiety is a substituted 30- to 40-membered heteroalkyl group.
[0222] R 1The alkyl group can be oxo, halogen, -CN, -CF3, -NH2, -OH, -SH, or -N3. It can be substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted; heteroalkyl group can be substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted; cycloalkyl group can be substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted; heterocycloalkyl group can be substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted; aryl group can be substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted; or substituted or unsubstituted heteroaryl group. In embodiments, R in the additional functional part... 1 It is a detectable or therapeutic component. In the implementation scheme, R in the additional functional component... 1 This is the detectable portion. In the implementation scheme, the detectable portion includes fluorescent dyes, electron-dense reagents, enzymes, biotin, digoxigenin, paramagnetic molecules, paramagnetic nanoparticles, contrast agents, magnetic resonance contrast agents, X-ray contrast agents, gadolinium, radioactive isotopes, radionuclides, fluorodeoxyglucose, nuclides emitting gamma rays, radionuclides emitting positrons, biocolloids, microbubbles, iodinated contrast agents, barium sulfate, thorium dioxide, gold, gold nanoparticles, gold nanoparticle aggregates, fluorophores, two-photon fluorophores, haptens, proteins, or fluorescent portions. In the implementation scheme, the R in the additional functional portion... 1 It is the therapeutic component (e.g., an anticancer agent or an antiviral agent). In the implementation scheme, R in the additional functional component... 1 It is H. In the embodiment, the additional functional moiety is an oxo group. In the embodiment, the additional functional moiety is oxygen. In the embodiment, the additional functional moiety is sulfur. In the embodiment, the additional functional moiety is =S.
[0223] In embodiments, additional linking substituents include substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted alkylene groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkylene groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkylene groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted arylene groups, or substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroarylene groups. Additional linking substituents may include a PEG moiety attached to a reactive group or additional portion.
[0224] In some embodiments, the connector comprises an unsubstituted C3 alkylene group (e.g., as described above). In others embodiments, the connector may be an unsubstituted C3 alkylene group. 15 Alkylene. In the embodiments, the connector comprises unsubstituted C6-C. 16 Alkylene. In embodiments, the connector may be a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted alkylene, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkylene, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkylene, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted arylene, or a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroarylene. In embodiments, the connector can be substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C1-C. 40Alkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 2- to 40-membered heteroalkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C3-C8 cycloalkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 3- to 8-membered heteroalkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C6-C 10 The arylene group, or a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 5- to 10-membered heteroarylene group. In embodiments, the linker may be an unsubstituted C1-C... 40 Alkylene, unsubstituted 2- to 40-membered heteroalkylene, unsubstituted C3-C8 cycloalkylene, unsubstituted 3- to 8-membered heteroalkylene, unsubstituted C6-C 10 The arylene or unsubstituted 5- to 10-membered heteroarylene. In embodiments, the linker may be a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) 2- to 40-membered heteroalkyl.
[0225] The linker can be a bond, a nucleic acid sequence, two nucleic acid sequences, a DNA sequence, two DNA sequences, a nucleic acid analog sequence, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted alkylene, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heterocyclic alkylene, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heterocyclic alkylene, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted arylene, or a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroarylene.
[0226] In embodiments, the linker is or contains a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted alkylene, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkylene, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkylene, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted arylene, or a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroarylene. In embodiments, the linker is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C1-C. 20 Alkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 2- to 20-membered heteroalkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C3-C8 cycloalkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 3- to 8-membered heteroalkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C6-C 10 The aryl group, or a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 5- to 10-membered heteroaryl group. In an embodiment, the linker is an unsubstituted C1-C. 20 Alkylene, unsubstituted 2- to 20-membered heteroalkylene, unsubstituted C3-C8 cycloalkylene, unsubstituted 3- to 8-membered heteroalkylene, unsubstituted C6-C 10 Arylene or unsubstituted 5- to 10-membered heteroaryl compounds. In embodiments, the connector is an unsubstituted C1-C... 20 Alkylene. In embodiments, the connector is either substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C1-C. 40Alkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 2- to 40-membered heteroalkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C3-C8 cycloalkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 3- to 8-membered heteroalkylenes, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C6-C 10 The arylene group, or a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 5- to 10-membered heteroarylene group. In embodiments, the linker is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C1-C. 40 Alkylene. In embodiments, the linker is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 2- to 40-membered heteroalkylene. In embodiments, the linker is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) 2- to 40-membered heteroalkylene. In embodiments, the linker comprises an alkyl phosphate ester (e.g., propyl phosphate). In embodiments, the linker has an alkyl phosphate ester (e.g., propyl phosphate) bonded at both ends to the remainder of the compound via phosphate esters. In embodiments, the linker has 1-5 alkyl phosphate esters (e.g., propyl phosphate) bonded at both ends to the remainder of the compound via phosphate esters. In embodiments, the linker has 1-4 alkyl phosphate esters (e.g., propyl phosphate) bonded at both ends to the remainder of the compound via phosphate esters. In embodiments, the linker has 4 alkyl phosphate esters (e.g., propyl phosphate) bonded at both ends to the remainder of the compound via phosphate esters. Those skilled in the art will recognize that a joint having alkyl phosphates, with the phosphate groups bonded to the remainder of the compound at both ends by phosphate groups, will have one more alkyl group than the phosphate group (e.g., a joint having four alkyl phosphates, with the phosphate groups and alkyl groups alternating).
[0227] In embodiments, anti-miR and miRNA mimics may include modifications such as 2'O-methyl, 2'-deoxy-2'-fluorine, 2'-deoxy, universal base, 5-C-methyl, inverse deoxy-debase residues incorporated into or locked nucleic acids, or any one or more combinations thereof. In embodiments, the anti-miR and miRNA mimics may have modifications located at the terminal nucleobases of the anti-miR and miRNA mimics. In embodiments, the anti-miR and miRNA mimics may not have modifications located at the terminal nucleobases of the anti-miR and miRNA mimics. In embodiments, the modifications to the anti-miR and miRNA mimics protect the compound from serum-derived nucleases (e.g., nuclease resistance).
[0228] In the implementation, the (CpG-ODN) conjugated to anti-miR or miRNA mimics has a terminal portion. The terminal portion is a chemically reactive portion, a detectable portion, a therapeutic portion (e.g., an anticancer agent or antiviral agent), a nucleic acid sequence, a DNA sequence, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted alkyl group, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkyl group, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted cycloalkyl group, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heterocycloalkyl group, a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted aryl group, or a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroaryl group.
[0229] In the implementation plan, the terminal portion can be a chemically reactive portion, a detectable portion, a therapeutic portion (e.g., an anticancer agent or antiviral agent), a nucleic acid sequence, a DNA sequence, a nucleic acid analog, or an R... 1 -Substituted or unsubstituted alkyl groups, R 1 -Substituted or unsubstituted heteroalkyl, R 1 -substituted or unsubstituted cycloalkyl, R 1 -Substituted or unsubstituted heterocyclic alkyl groups, R 1 -Substituted or unsubstituted aryl or R 1 -Substituted or unsubstituted heteroaryl groups.
[0230] In one embodiment, the CpG-ODN nucleic acid sequence conjugated to an anti-miR or miRNA mimic conjugate includes a terminal portion, wherein said terminal portion is a detectable portion. In another embodiment, the CpG-ODN conjugated to an anti-miR or miRNA mimic includes a terminal detectable portion such as a fluorescent dye, electron-dense reagent, enzyme, biotin, digoxigenin, paramagnetic molecule, paramagnetic nanoparticle, contrast agent, magnetic resonance contrast agent, X-ray contrast agent, gadolinium, radioisotope, radionuclide, fluorodeoxyglucose, gamma-ray emitting nuclide, positron-emitting radionuclide, biocolloid, microbubble, iodinated contrast agent, barium sulfate, thorium dioxide, gold, gold nanoparticles, gold nanoparticle aggregates, fluorophore, two-photon fluorophore, hapten, protein, or fluorescent moiety. In yet another embodiment, the CpG-ODN conjugated to an anti-miR or miRNA mimic includes a terminal portion that is a therapeutic moiety (e.g., an anticancer agent or antiviral agent).
[0231] In the implementation, the CpG-ODN conjugated with an anti-miR or miRNA mimic includes a terminal portion, said terminal portion being a hydrogen, oxo group, halogen, -CN, -CF3, -NH2, -OH, -SH, -N3, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted alkyl group, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkyl group, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted heteroalkyl group, substituted (e.g. Cycloalkyl groups (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted; heterocycloalkyl groups (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted; aryl groups (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted; or heteroaryl groups (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted. In embodiments, the CpG-ODN conjugated to an antimiR or miRNA mimic includes a terminal portion, which is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C1-C1 group. 40 Alkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 2- to 40-membered heteroalkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C3-C8 cycloalkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 3- to 8-membered heteroalkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted C6-C10 Aryl, or substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) or unsubstituted 5- to 10-membered heteroaryl. In embodiments, the CpG-ODN conjugated to an antimiR or miRNA mimic includes a terminal portion that is substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) C1-C 40 Alkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group); 2- to 40-membered heteroalkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group); C3-C8 cycloalkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group); 3- to 8-membered heterocycloalkyl groups, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group); C6-C... 10 Aryl, or substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) 5 to 10 heteroaryl. In embodiments, the terminal portion is R. 1 Replacement C1-C 40 Alkyl, R 1 Substituted 2 to 40-membered heteroalkyl groups, R 1 Substituted C3-C8 cycloalkyl, R 1 Substituted 3- to 8-membered heterocyclic alkyl groups, R 1 Replacement C6-C 10 Aryl, or R 1 The substituted 5- to 10-membered heteroaryl group. In the embodiment, the terminal portion is R. 1 Replacement C1-C 40 Alkyl group. In the embodiments, the terminal portion is -(unsubstituted C1-C) 40 (alkylene)-R 1 In the implementation, the terminal portion is -(unsubstituted linear C1-C) 40 (alkylene)-R 1 In the implementation scheme, the terminal portion is -(unsubstituted C3-C) 21 (alkylene)-R 1 In the implementation scheme, the terminal portion is -(unsubstituted C3-C) 18 (alkylene)-R 1 In the implementation, the terminal portion is -(unsubstituted linear C3-C) 15 (alkylene)-R 1 In the implementation scheme, the terminal portion is -(unsubstituted linear C6-C) 21 (alkylene)-R 1In the implementation scheme, the terminal portion is -(unsubstituted linear C9-C) 21 (alkylene)-R 1 In the implementation scheme, the terminal portion is -(unsubstituted linear C9-C) 18 (alkylene)-R 1 In the implementation scheme, the terminal portion is -(unsubstituted linear C9-C) 15 (alkylene)-R 1 In the implementation, the terminal portion is -(unsubstituted linear C) 12 -C 15 (alkylene)-R 1 In the implementation, the terminal portion is -(unsubstituted linear C) 12 (alkylene)-R 1 In the implementation, the terminal portion is -(unsubstituted linear C) 13 (alkylene)-R 1 In the implementation, the terminal portion is -(unsubstituted linear C) 14 (alkylene)-R 1 In the implementation, the terminal portion is -(unsubstituted linear C) 15 (alkylene)-R 1 In the implementation scheme, the end portion is R. 1 Substituted 2- to 40-membered heteroalkyl groups. In embodiments, the terminal portion is -(unsubstituted 2- to 40-membered heteroalkylene)-R 1 In the embodiments, the terminal portion is -(substituted straight-chain 2 to 40-membered heteroalkylene)-R 1 In the embodiments, the terminal portion is -(substituted 5 to 40-membered heteroalkylene)-R 1 In the embodiments, the terminal portion is -(substituted 10 to 40-membered heteroalkylene)-R 1 In the embodiments, the terminal portion is -(substituted 15 to 40-membered heteroalkylene)-R 1 In the embodiments, the terminal portion is -(substituted 20 to 40-membered heteroalkylene)-R 1 In the embodiment, the terminal portion is -(substituted 30 to 40-membered heteroalkylene)-R 1 In the embodiments, the terminal portion is -(substituted 2 to 35-membered heteroalkylene)-R 1 In the embodiments, the terminal portion is -(substituted 2 to 30-membered heteroalkylene)-R 1 In the embodiments, the terminal portion is -(substituted 2 to 25-membered heteroalkylene)-R 1 In the embodiments, the terminal portion is -(substituted 2 to 20-membered heteroalkylene)-R 1In the embodiments, the terminal portion is -(substituted 2 to 10-membered heteroalkylene)-R 1 In the embodiments, the terminal portion is -(substituted 2 to 50-membered heteroalkylene)-R 1 In the embodiments, the terminal portion is -(substituted 2 to 60-membered heteroalkylene)-R 1 .
[0232] In one embodiment, the CpG-ODN conjugated with an anti-miR or miRNA mimic includes a terminal portion that is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) 2 to 40-membered heteroalkyl group. In another embodiment, the CpG-ODN conjugated with an anti-miR or miRNA mimic includes a terminal portion that is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) 10 to 50-membered heteroalkyl group. In yet another embodiment, the CpG-ODN conjugated with an anti-miR or miRNA mimic includes a terminal portion that is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) 20 to 40-membered heteroalkyl group. In one embodiment, the CpG-ODN conjugated with an anti-miR or miRNA mimic includes a terminal portion that is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) 25 to 40-membered heteroalkyl group. In another embodiment, the CpG-ODN conjugated with an anti-miR or miRNA mimic includes a terminal portion that is a substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) 30 to 40-membered heteroalkyl group.
[0233] In the implementation scheme, the CpG-ODN conjugated with anti-miR or miRNA mimics includes those with R 1 The terminal portion of the group, where R 1 It is a detectable or therapeutic component. In the implementation scheme, R in the CpG-ODN conjugates with anti-miR or miRNA mimics... 1 This includes the terminal portion that is a detectable part. In the implementation, R in the CpG-ODN conjugates with anti-miR or miRNA mimics... 1The detection component includes a detectable portion, which may be a fluorescent dye, an electron-dense reagent, an enzyme, biotin, digoxigenin, a paramagnetic molecule, a paramagnetic nanoparticle, a contrast agent, a magnetic resonance contrast agent, an X-ray contrast agent, gadolinium, a radioactive isotope, a radionuclide, fluorodeoxyglucose, a radionuclide emitting gamma rays, a radionuclide emitting positrons, a biocolloid, a microbubble, an iodide contrast agent, barium sulfate, thorium dioxide, gold, gold nanoparticles, gold nanoparticle aggregates, a fluorophore, a two-photon fluorophore, a hapten, a protein, or a fluorescent portion. In an embodiment, R in the CpG-ODN conjugated with an anti-miR or miRNA mimic is... 1 This includes the terminal portion, which is a therapeutic component (e.g., an anticancer agent or antiviral agent). In one embodiment, the R in the CpG-ODN conjugates with an antimiR or miRNA mimic is... 1 Includes the terminal portion of H. In the implementation, R in the CpG-ODN conjugate with anti-miR or miRNA mimics 1 This includes the oxygen group as the terminal portion. In the embodiment, the R group in the CpG-ODN conjugates with anti-miR or miRNA mimics... 1 This includes oxygen as the terminal portion. In the implementation, R in CpG-ODN conjugated with anti-miR or miRNA mimics 1 This includes sulfur as a terminal portion. In the embodiments, R in CpG-ODN conjugated with anti-miR or miRNA mimics... 1 Including =S as the terminal part.
[0234] In the embodiments, the CpG-ODN nucleic acid sequence of the compound includes an unmethylated CpG motif (e.g., a CpG nucleic acid sequence or a GpC nucleic acid sequence). In the embodiments, the CpG-ODN nucleic acid sequence includes a class A CpG nucleic acid sequence, a class B CpG nucleic acid sequence, or a class C C CpG nucleic acid sequence.
[0235] In one embodiment, the compound comprises CpG-ODN, wherein C and G are nucleotides linked by an inter-nucleotide bond of a phosphodiester derivative. In another embodiment, the compound comprises CpG, wherein C and G are nucleotides linked by an inter-nucleotide bond of a phosphodiester derivative. In another embodiment, the CpG motif is unmethylated. In another embodiment, C and G are linked at a 5'CG 3' configuration. In another embodiment, C and G are linked at a 5'GC 3' configuration.
[0236] In one embodiment, the Toll-like receptor (TLR)-binding DNA substituent is a class A CpG oligodeoxynucleotide (ODN). In another embodiment, the TLR-binding DNA substituent is a class B CpG oligodeoxynucleotide (ODN). In yet another embodiment, the TLR-binding DNA substituent is a class C CpG oligodeoxynucleotide (ODN). In yet another embodiment, the TLR-binding DNA substituent (e.g., the TLR9-binding DNA substituent) is formed by a deoxyribonucleic acid having an A, G, C, or T base and a phosphodiester bond and / or a phosphodiester derivative. For example (one or more thiophosphate esters are linked).
[0237] In an embodiment, the compound binds to an endosome TLR. In an embodiment, the compound preferentially binds to an endosome TLR than other TLRs. In an embodiment, the compound specifically binds to an endosome TLR. In an embodiment, the compound binds to TLR3. In an embodiment, the compound preferentially binds to TLR3 than other TLRs. In an embodiment, the compound specifically binds to TLR3. In an embodiment, the compound binds to TLR7. In an embodiment, the compound preferentially binds to TLR7 than other TLRs. In an embodiment, the compound specifically binds to TLR7. In an embodiment, the compound binds to TLR8. In an embodiment, the compound preferentially binds to TLR8 than other TLRs. In an embodiment, the compound specifically binds to TLR8. In an embodiment, the compound binds to TLR9. In an embodiment, the compound preferentially binds to TLR9 than other TLRs. In an embodiment, the compound specifically binds to TLR9. In an embodiment, the compound includes CpG, wherein C and G are nucleotides linked by a phosphodiester nucleotide linking or a phosphodiester derivative nucleotide linking.
[0238] In one embodiment, the TLR-binding DNA substituent is a class A CpG oligodeoxynucleotide (ODN). In another embodiment, the TLR-binding DNA substituent is a class B CpG oligodeoxynucleotide (ODN). In yet another embodiment, the TLR-binding DNA substituent is a class C CpG oligodeoxynucleotide (ODN). In yet another embodiment, the TLR-binding DNA substituent is ODN 1585, ODN 2216, ODN D19, or ODN 2336. In yet another embodiment, the TLR-binding DNA substituent is ODN 1668, ODN 1826, ODN 2006, or ODN 2007. In yet another embodiment, the TLR-binding DNA substituent is ODN 2395 or ODN M362. In the implementation scheme, the TLR-binding DNA substituent is a derivative of ODN 1585, ODN 2216, ODN D19, ODN 2336, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2395, or ODN M362. In the implementation scheme, the derivative of ODN 1585, ODN 2216, ODN D19, ODN 2336, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2395, or ODN M362 comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide substitutions (e.g., A, C, G, or T are substituted with different nucleotides). In the implementation, the derivatives of ODN 1585, ODN 2216, ODN D19, ODN 2336, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2395 or ODN M362 include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) internucleotide bond substitutions (e.g., phosphate diester replaced by phosphate diester derivative or phosphate diester derivative replaced by phosphate diester).In the implementation scheme, derivatives of ODN 1585, ODN 2216, ODN D19, ODN 2336, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2395, or ODN M362 include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50). 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotide deletions. In the implementation, derivatives of ODN 1585, ODN 2216, ODN D19, ODN 2336, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN2395, or ODN M362 include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide additions.
[0239] In embodiments, the compound comprises phosphate diester derivative linkages (e.g., aminophosphate linkages, diaminophosphate linkages, thiophosphate linkages, dithiophosphate linkages, phosphonocarboxylic acid linkages, phosphonocarboxylic acid ester linkages, phosphonoacetic acid linkages, phosphonoformic acid linkages, methylphosphonate linkages, borosophosphonate linkages, or O-methylphosphonamide linkages). In embodiments, the compound comprises multiple phosphate diester derivative linkages (e.g., aminophosphate linkages, diaminophosphate linkages, thiophosphate linkages, dithiophosphate linkages, phosphonocarboxylic acid linkages, phosphonocarboxylic acid ester linkages, phosphonoacetic acid linkages, phosphonoformic acid linkages, methylphosphonate linkages, borosophosphonate linkages, O-methylphosphonamide linkages, or combinations thereof). In embodiments, the compound comprises phosphodiester derivative links (e.g., aminophosphate links, diaminophosphate links, thiophosphate links, dithiophosphate links, phosphonocarboxylic acid links, phosphonocarboxylic acid ester links, phosphonoacetic acid links, phosphonoformic acid links, methylphosphonate links, borosilicate links, or O-methylphosphonamide links) in the TLR-binding nucleic acid (e.g., endosome TLR-, TLR3-, TLR7-, TLR8-, or TLR9-binding nucleic acid) substituents.
[0240] In the embodiments, the phosphate diester derivatives in the compound may be linked by aminophosphate, diaminophosphate, thiophosphate, dithiophosphate, phosphonocarboxylic acid, phosphonocarboxylic acid ester, phosphonoacetic acid, phosphonoformic acid, methylphosphonate, borosophosphonate, or O-methylphosphonamide.
[0241] In the embodiments, the internucleotide linkages of one or more nucleic acids in the compound are phosphodiester derivative linkages (e.g., aminophosphate linkages, diaminophosphate linkages, thiophosphate linkages, dithiophosphate linkages, phosphonocarboxylic acid linkages, phosphonocarboxylic acid ester linkages, phosphonoacetic acid linkages, phosphonoformic acid linkages, methylphosphonate linkages, borosophosphonate linkages, or O-methylphosphonamide linkages), (e.g., the internucleotide linkages of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the nucleotides in the compound are phosphodiester derivative linkages (e.g., aminophosphate linkages, diaminophosphate linkages, thiophosphate linkages, dithiophosphate linkages, phosphonocarboxylic acid linkages, phosphonocarboxylic acid ester linkages, phosphonoacetic acid linkages, phosphonoformic acid linkages, methylphosphonate linkages, borosophosphonate linkages, O-methylphosphonamide linkages, or combinations thereof)).
[0242] In the implementation scheme, this document provides compounds for linking CpG-ODN to miRNA miRNA mimics targeting miR-126 or miR-142.
[0243] In the implementation scheme, this document provides compounds for linking CpG-ODN to anti-miR compounds targeting miR-155.
[0244] In the implementation scheme, this document provides compounds for linking CpG-ODN to anti-miR targets miR-125b.
[0245] In the implementation scheme, this document provides compounds for linking CpG-ODN to anti-miR or miR-146a miRNA mimics that target miR-146a.
[0246] In the implementation scheme, CpG-ODN conjugated to anti-miR or miRNA mimics is present in the cytoplasm (and nucleus).
[0247] Pharmaceutical Composition On one hand, this document provides pharmaceutical compositions comprising pharmaceutically acceptable excipients and compounds disclosed herein. In embodiments, the compositions comprise a second therapeutic agent. In embodiments, the second therapeutic agent is an antitumor or anticancer agent, an anti-angiogenic agent, a cytotoxic agent, a cell inhibitor, an anti-inflammatory agent, an analgesic, an anti-infective agent, a growth inhibitor, an immunogenic agent, an immunomodulator, or a chemokine. In embodiments, the antitumor or anticancer agent in the pharmaceutical compositions disclosed herein is a cell death promoter.
[0248] In embodiments, the second therapeutic agent in the pharmaceutical composition of this disclosure includes, for example, ctinomycin D / dactinomycin, bleomycin, daunorubicin, doxorubicin, doxorubicin (pegylated liposomes), epirubicin, idarubicin, mitomycin, mitoxantrone, etoposide, docetaxel, irinotecan, paclitaxel, topotecan, vincristine, and vinblastine. Cristine, Vinorelbine, Carboplatin, Cisplantin, Oxaliplatin, Alemtuzamab, BCG, Bevacizumab, Cetuximab, Denosumab, Erlotinib, Gefitinib, Imatinib, Interferon, Ipilimumab, Lapatinib, Monomethyl auristatin E (MMEA), Mertansine (DM1), Rituximab, Sunitinib, Sorafenib, Temsirolimus, Trastuzumab, or any combination thereof.
[0249] In embodiments, this disclosure includes compositions of the compounds of this disclosure in combination with one or more additional anticancer therapies, such as anti-VEGF antibodies or anti-STAT agents.
[0250] In any implementation of the method and use, this disclosure includes treating cancer by administering an effective amount of the disclosed compound and a chemotherapeutic agent to a subject diagnosed with cancer. Various chemotherapeutic agents may be used in the combined treatment methods and uses of this disclosure. In one implementation, the chemotherapeutic agent may be temolozolomide. In another implementation, the chemotherapeutic agent may be administered concurrently with radiotherapy.
[0251] In one instance, combination therapy may involve administration, including simultaneous administration using a single formulation or a single-drug formulation, and sequential administration in either order, where there may be a period of time during which both (or all) active agents exert their biological activity simultaneously. The preparation and administration regimens of such chemotherapeutic agents may be used according to the manufacturer's instructions or determined by a skilled practitioner based on experience. Preparation and administration regimens of chemotherapy are also described in Chemotherapy Service Ed., MC Perry, Williams & Wilkins, Baltimore, Md. (1992). Chemotherapy agents may be administered before or after the administration of the compounds or compositions disclosed herein, or may be administered concurrently with them.
[0252] In any embodiment of the method and use, other therapeutic agents that may be used in combination with the compounds of this disclosure for the treatment of tumors include antagonists of other factors involved in tumor growth, such as VEGF, EGFR, ErbB3, ErbB4, STAT, or TNF. Sometimes, administration of one or more cytokines to the subject may also be beneficial. In embodiments, the compounds or compositions of this disclosure are administered in combination with growth inhibitors. For example, a growth inhibitor may be administered first, followed by the compounds or compositions of this disclosure. However, simultaneous or prior administration of the compounds or compositions of this disclosure is possible. Appropriate doses of growth inhibitors are those currently used, and may be reduced due to the combined effect (synergistic effect) of the growth inhibitors and the compounds of this disclosure.
[0253] The compositions described herein may also contain one or more active compounds essential for the specific indication being treated, such as those with complementary activities that do not adversely affect each other. For example, it may be desirable to further provide in one of the formulations an agent that binds EGFR, VEGF (e.g., antibodies that bind different or the same epitopes on VEGF), VEGFR, or ErbB2. Such molecules may suitably be present in combination in amounts effective for the intended purpose.
[0254] In embodiments of the methods and uses described herein, other therapeutic agents, including other anti-angiogenic agents, may be used in combination with the compounds or compositions of this disclosure for cancer treatment. Many anti-angiogenic agents have been identified and are known in the art, including those listed by Carmeliet and Jain (2000). In embodiments, the compounds or compositions of this disclosure are used in combination with another miR antagonist, a neutralizing antibody against a miR complex, a low molecular weight inhibitor of miR, and any combination thereof.
[0255] This disclosure includes compositions having an effective dose of the disclosed compounds. An effective dose can be from about 0.001 mg / kg to about 100 mg / kg of the reagent (e.g., 0.001, 0.005, 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, ...). 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 ,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100mg / kg).
[0256] In the implementation scheme, an effective dose of a compound comprising an antimiR (e.g., antimiR126) of the present disclosure is administered to a subject in need to treat a disease (e.g., cancer, autoimmune disease, or infectious disease). The antimiR inhibits the expression / activity of miRs (e.g., miR126) in cells and induces cancer cells (e.g., leukemia stem cells (LSCs)) to undergo the cell cycle, making the cancer cells (e.g., LSs) more sensitive to chemotherapy.
[0257] In the implementation, an effective dose of a compound comprising a miR mimic of the present disclosure (e.g., a miR142 mimic) is administered to a subject in need to treat a disease (e.g., cancer, autoimmune disease, or infectious disease). The miR mimic blocks the development of cancer (e.g., leukemia).
[0258] It can be expressed in the form of about 0.001 mg / kg to about 0.01 mg / kg of compound, about 0.01 mg / kg to about 0.1 mg / kg of compound, about 0.1 mg / kg to about 1.0 mg / kg of compound, about 1.0 mg / kg to about 5.0 mg / kg of compound, about 5.0 mg / kg to about 10 mg / kg of compound, about 10 mg / kg to about 15 mg / kg of compound, about 15 mg / kg to about 20 mg / kg of compound, about 20 mg / kg to about 25 mg / kg of compound, about 25 mg / kg to about 30 mg / kg of compound, about 30 mg / kg to about 35 mg / kg of compound, about 35 mg / kg to about 40 mg / kg of compound, about 40 mg / kg to about 45 mg / kg of compound. The compound is administered to the subject in need at doses of approximately 45 mg / kg to approximately 50 mg / kg, approximately 50 mg / kg to approximately 55 mg / kg, approximately 55 mg / kg to approximately 60 mg / kg, approximately 60 mg / kg to approximately 65 mg / kg, approximately 65 mg / kg to approximately 70 mg / kg, approximately 70 mg / kg to approximately 75 mg / kg, approximately 75 mg / kg to approximately 80 mg / kg, approximately 80 mg / kg to approximately 85 mg / kg, approximately 85 mg / kg to approximately 90 mg / kg, approximately 90 mg / kg to approximately 95 mg / kg, or approximately 95 mg / kg to approximately 100 mg / kg.
[0259] In embodiments, this disclosure includes compositions having an effective dose of the compounds of this disclosure, wherein the compounds may be from about 0.1% to about 20% w / v of the composition.
[0260] For example, the effective dose of the compounds disclosed herein may be about 0.001% to about 0.01%, about 0.01% to about 0.1%, about 0.1% to about 1.0%, about 1.0% to about 2.0%, about 2.0% to about 3.0%, about 3.0% to about 4.0%, about 4.0% to about 5.0%, about 5.0% to about 6.0%, about 6.0% to about 7.0%, about 7.0% to about 8.0%, about 8.0% to about 9.0%, about 9.0% to about 10%, about 10% to about 11%, about 11% to about 12%, about 12% to about 13%, about 13% to about 14%, about 14% to about 15%, about 15% to about 16%, about 16% to about 17%, about 17% to about 18%, about 18% to about 19%, or about 19% to about 20% w / v of the composition.
[0261] Treatment or usage methods This document provides a method for treating a disease in a subject in need, the method comprising administering to the subject an effective amount of a compound or a pharmaceutical composition comprising a compound disclosed herein. In embodiments, the disease is cancer, an autoimmune disease, or an infectious disease.
[0262] In the implementation plan, the cancer can be a hematopoietic cell carcinoma. In the implementation plan, the cancer is not a hematopoietic cell carcinoma. In the implementation plan, the cancer is myeloma or acute or chronic myeloid leukemia. In the implementation plan, the cancer is prostate cancer, breast cancer, glioblastoma, ovarian cancer, lung cancer, head and neck cancer, esophageal cancer, skin cancer, melanoma, brain cancer, colorectal cancer, leukemia, lymphoma, or myeloma.
[0263] In the implementation plan, the autoimmune disease is rheumatoid arthritis, psoriasis, systemic lupus erythematosus (SLE), type II diabetes, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, multiple sclerosis (MS), Parkinson's disease (PD), Alzheimer's disease (AD), or inflammatory bowel disease (IBD).
[0264] In the implementation plan, the infectious disease is tuberculosis, influenza, Ebola, HIV, HPV infection, or hepatitis.
[0265] In the embodiments, the compound or composition is administered to the subject via intravenous, parenteral, subcutaneous, intramuscular, transdermal, intraperitoneal, intranasal, aerosol, oral, or topical administration. In the embodiments, the treatment is dose-dependent on the compound or composition. In the embodiments, the compound is administered to the subject at amounts from about 0.001 mg / kg to about 100 mg / kg. All figures and ranges within this range are also implied.
[0266] This document provides methods for inhibiting miRs (e.g., miR126) in cells, the methods comprising contacting the cells with an effective amount of the compounds or pharmaceutical compositions disclosed herein. This document also provides methods for inhibiting cell growth, comprising contacting the cells with an effective amount of the compounds or pharmaceutical compositions disclosed herein.
[0267] In the embodiments, the cells are cancer cells. In the embodiments, the cells are acute myeloid lymphoid (AML) cells or chronic myeloid leukemia (CML) cells. In the embodiments, the AML cells are derived from bone marrow. In the embodiments, the cells are cells cultured in vitro; the cells are in situ in a host; the cells are in vitro cultured tissue. In the embodiments, the contact step does not involve viral transduction. In the embodiments, the contact step does not involve viral transduction and contacts the cells with the compounds of this disclosure or pharmaceutical compositions comprising the compounds of this disclosure. In the implementation scheme, the cells are reacted with approximately 1 nanomolar to approximately 100 nanomolars (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 4...). Compound contacts at 9, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, and 100 nm. This also implies all the numbers within this range and the individual ranges.
[0268] In the implementation scheme, the heteroalkyl linker allows for further modification, conjugation, or attachment of additional portions after synthesis is complete, while the oligonucleotide remains attached to the support.
[0269] In the embodiments, this document provides CpG-ODNs conjugated with anti-miR or miRNA mimics using substituted (e.g., substituted with substituent groups, size-restricted substituent groups, or lower substituent groups) heteroalkyl linkers, which allow for further modification, conjugation, or attachment during synthesis while simultaneously attaching oligonucleotides to a support.
[0270] In embodiments, substituted (e.g., substituted with a substituent group, a size-restricted substituent group, or a lower substituent group) heteroalkyl linkers are modified, conjugated, or attached to the substituents. Modification may include converting the original substituent to a different substituent. For example, a bromoalkane substituent may be converted to an azide-alkane. Conjugation may result in two large parts being bonded together. For example, an NHS derivative may be conjugated to PEG-NH2. Peptides may also be conjugated to oligonucleotides, or antibodies may be conjugated to oligonucleotides. Attachment may result in a small molecule being bonded to a large molecule. For example, an NHS-ester of biotin may be attached to an amino derivative of an oligonucleotide.
[0271] In the embodiments, this document provides compounds having a CpG-ODN conjugated to an anti-miR or miRNA mimic via a linker, wherein the linker is a plurality of different linkers, a plurality of identical linkers, or a substitution of linkers selected from the group consisting of: It can be further used as a functionalized Fmoc amino modifier C6 dT (introducing amino groups) by reacting with NHS esters and divinyl sulfone and their analogues.
[0272] It can be further used as a functionalized S-Bz-thiol-modifier C6-dT (introducing thiol groups) by reacting with divinyl sulfone and acrylic acid analogs.
[0273] It can be further used as a functionalized amino modifier, serine phosphoramide (introducing amino groups), by reacting with NHS esters and diethylene sulfones and their analogues.
[0274] It can be further used with azide-based reactants for the functionalization of DBCO-dT (introducing alkynes, copper-free click chemistry). DBCO-sulfonyl-NHS ester (introducing alkynes through reaction with amino groups, copper-free click chemistry) Example Example 1: Uptake of CpG-antimiR126 inhibitor in normal cells, umbilical cord blood cells, AML and CML CD34+ cells Normal cells, umbilical cord blood cells, AML and CML CD34+ cells were cultured with CpG-antimiR126 inhibitor-Cy3 or antimiR126 inhibitor-Cy3 for 16 hours, and uptake was measured by flow cytometry based on Cy3 expression in the cells. Figure 2A-2D All cells tested efficiently internalized CpG-antimiR126-Cy3 instead of antimiR126-Cy3.
[0275] Example 2: Uptake and expression of CpG-antimiR126 inhibitor in AML and CML cell lines CML(K562)( Figure 3A ) and AML cell lines (KG1A, MV4-11, Molm13, NB4, OCI, and HL60) Figure 3B-3GUptake was analyzed by culturing cells at two concentrations (200 nM and 500 nM) of either the anti-miR126 inhibitor Cy3 alone, human CD45 (Ab-200 nM) or transferrin (TF-200 nM) conjugated with anti-miR126-Cy3, or unformulated CpG-anti-miR126 inhibitor Cy3 for 4 hours. Cy3 expression in these cells was measured by flow cytometry. Bone marrow cell-specific CpG-anti-miR126 conjugates were rapidly and dose-dependently internalized in vitro in various human AML and CML cell lines. The level of CpG-anti-miR126 internalization in the absence of any transfection reagents exceeded that of all other oligonucleotides, including the NP-formulated anti-miR126 inhibitor. Evaluation of miRNA126 expression in AML and CML lineages. CML(K562)( Figure 4A ) and AML cell lines (KG1A, MV4-11, Molm13, NB4, OCI, and HL60) Figure 4B-4G Cells were cultured for 24 hours with the anti-miR126 inhibitor Cy3 (Cy3 control, 200 nM), human CD45 cells containing anti-miR-126-Cy3 (Ab-NP, 200 nM), transferrin (TF-NP, 200 nM), or CpG-anti-miR126 inhibitor Cy3 (CpG-200 nM and 500 nM), and then the expression of miR126 and RNU44 (control) in these cells was analyzed by Q-RT-PCR. In all human AML and CML cell lines tested in vitro, the bone marrow cell-specific CpG-anti-miR-126 conjugate (500 nM) was the most effective at downregulating miRNA126, reducing target miRNA expression by more than 50% in HL60, K562, MV4-11, MOLM13, and OCI cells. Example 3: miRNA126 expression in NL / CB, AML and CML CD34+ cells.
[0276] Normal cells, umbilical cord blood cells, AML and CML CD34+ cells were cultured for 24 hours with CpG-randomized RNA (500 nM) and CpG-antimiR126 inhibitor Cy3 (500 nM), and then the expression of miR126 and RNU44 (control) in these cells was analyzed by Q-RT-PCR. Figure 5 The miR126 expression level was normalized to RNU44 and compared using a comparative 2-factor algorithm. -ΔΔCt Methods were used to calculate the effects of a bone marrow cell-specific CpG-antimiR-126 conjugate (500 nM) on the rapid internalization of AML and CMLCD34+ cells from various primary disease patients in vitro, and a significant reduction in miR126 expression (60%-90%) was observed in these cells.
[0277] Example 4: CML CD34+CD38- primitive progenitor cells showed higher miR126 expression than CD34+CD38+ directed progenitor cells. CML cells were sorted into CD34+, CD34+CD38+ directed, and CD34+CD38- primitive progenitor cells, and then the expression of miR126 and RNU44 (control) in these cells was analyzed by Q-RT-PCR. miR126 expression levels were normalized to RNU44 and compared using a comparative 2- -ΔΔCt Method calculation ( Figure 6 CML CD34+CD38- primitive progenitor cells showed higher miR126 expression than CD34+CD38+ directed progenitor cells.
[0278] Example 5: Increased apoptosis in CML CD34+, CD34+CD38+ directed, and CD34+CD38- progenitor cells treated with CpG-antimiR126 inhibitors and NIL. CML CD34+, CD34+CD38+ directed, and CD34+CD38- progenitor cells were cultured for 72 hours using CpG-randomized RNA (500 nM), CpG-anti-miR126 inhibitor (500 nM), CpG-randomized RNA (500 nM) + nilotinib (NIL, 5 μM), and CpG-anti-miR126 inhibitor (500 nM) + NIL (5 μM). Cell cycle and apoptosis were then analyzed by EDU / DAPi and annexin V / DAPi staining. In cells treated with CpG-anti-miR126 inhibitor, miR126 expression was reduced by more than 90%. Figure 7 Compared with cells treated with CpG-disordered substances and NIL, increased apoptosis was observed in CMLCD34+, CD34+CD38+ directed, and CD34+CD38- primitive progenitor cells treated with CpG-antimiR126 inhibitors and NIL. Figure 8 Increased cell cycle was observed in normal and CML CD34+CD38- primitive progenitor cells treated with a CpG-antimiR126 inhibitor (Fig. 9).
[0279] Furthermore, compared with CpG-Scr, incubation with the CpG-anti-miR-126 inhibitor (500 nM) resulted in increased cell cycle entry in long-term hematopoietic stem cells (LTHSCs, Lin-Sca-1+c-kit+Fit3-CD150+CD48-) from normal and CML mice, as measured by EDU / DAPi staining (Figure 10). The combination of the CpG-anti-miR126 inhibitor and NIL also significantly increased apoptosis in LSCs compared with CpG-SCR+NIL treatment. Figure 11A And cell growth was significantly reduced. Figure 11B ).
[0280] Example 6: Compared to each treatment alone, silencing miR126 via CpG-antimiR-126 inhibitors combined with arabinose-c and Doxo significantly increased apoptosis in LSCs. Compared with Ara-c and Doxo alone, the CpG-antimiR-126 inhibitor (500 nM) combined with Ara-c and Doxo significantly increased cell cycle silencing of miR-126 in human AML CD34+ cells. Figure 12A ) and apoptosis ( Figure 12B This leads to reduced cell growth. Figure 12C ).
[0281] Example 7: In vivo effects of CpG-antimiR126 on growth and treatment response in primary AML and CML LSC SCLtTA / BCR-ABL mice were treated for 3 weeks with CpG-miR-126 inhibitor (5 mg / kg, IV every other day), SCR (5 mg / kg, IV every other day), NIL (50 mg / kg, IV once daily) + SCR, and NIL + miR-126 inhibitor. Residual CML cells in the PB, BM, and spleen were then analyzed. Compared with mice treated with NIL + SCR, mice treated with NIL + miR-126 inhibitor showed a reduction in CML leukocytes in the PB. Figure 13A Compared with mice treated with NIL+SCR, mice treated with NIL+miR126 inhibitors showed a reduction in spleen weight. Figure 13B Compared with mice treated with NIL+SCR, mice treated with NIL+miR126 inhibitors showed a reduction in CML cells, CML LSK, and CML LTHSC in the BM and spleen. Figure 13C -D、 Figure 14A The effects of CpG-antimiR-126 on the growth and treatment response of primary AML LSCs in vivo are still under investigation. These observations suggest that blocking miR-126 with bone marrow cell-specific CpG-antimiR-126 ODN inhibitors is highly effective, in addition to other compounds disclosed herein, and therefore represents a novel therapeutic approach targeting miRNAs in leukemia and other types of cancer disclosed herein.
[0282] Example 8: CpG-antimiRNA uptake and inhibition The sequences of the exemplary compounds used in the study are as follows: CpG-antimiR155: 5'G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1) xxxxx mA*mC*mC*mC*mC*mU*mA*mU*mC*mA*mC*mA*mA*mU*mU*mA*mG*mC*mA*mU*mU*mA*mA (SEQ ID NO: 28) 3'; CpG-antimiR125b: and CpG-antimiR146a: 5' G*G*T GCA TCG ATG CAGG*G*G* G*G (SEQ ID NO: 1) xxxxx mC*mC*mC*mA*mU*mG*mG*mA*mA*mU*mU*mC*mA*mG*mU*mU*mC*mU*mC*mA (SEQ ID NO: 36) 3', Where * indicates a phosphate thioester bond, mN indicates a nucleotide modified with 2'OMe, and x indicates a linker described in this paper.
[0283] CpG-antimiRNAs were labeled with Cy3 to detect intracellular uptake in target cells using flow cytometry. Human immune cells were incubated with specified concentrations of CpG-antimiR146a, CpG-antimiR155, or CpG-antimiR125b, and uptake of these compounds was observed in the cells. Figures 16A-16B Treatment with these compounds reduced the expression of the corresponding miRs in human and mouse bone marrow cells. Figure 17A-17F 18A-18F, 19A-19H).
[0284] miR-126 was effectively knocked down using miR-126 inhibitors conjugated with CpG, GpC, and PS, and effectively overexpressed using miR-126 mimics in K562 and MV4-11 cells. (The text repeats itself here: miR-126 inhibitors conjugated with CpG, GpC, and PS...) Figures 26A-26B ) or miR-126 simulants (615, 616 and 617) Figure 26C-26DK562 and MV4-11 cells were treated with 500 nM for 24 hours, and miR-126 expression in these cells was measured. We demonstrated that the CpG motif can be omitted from the targeting ODN sequence. GpC and fully PS-modified oligomers also successfully blocked miR-126. Incubation with miR-126 mimics (particularly GM617) significantly increased miR-126 expression in K562 and MV4-11 cells. Similar to CpG-miR-126 inhibitors, which are highly effective in reducing miR-126 in cells, we also designed miR-126 mimics that are highly effective in increasing miR-126 levels in cells without the use of any transduction agents.
[0285] Example 9: Effects of CpG-antimiRNA on downstream targets CpG-antimiR-regulated downstream targets of miR155, miR125b and miR146a ( Figure 20A Mouse RAW264.7 or human MV4-11 cells were incubated for 48 hours with 250 nM or 500 nM CpG anti-miR155, CpG-anti-miR125b, or CpG-anti-miR146a, or 500 nM CpG-disordered compound. Cell lysates were then collected and electrophoresed, and the lysates were analyzed by targeting SHIP1 (a miR155 target). Figure 20A ), IRF4 (miR125b target) Figure 20B ) or IRAK1 (miR146a target) Figure 20C Immunoblotting was performed using antibodies against β-actin. Band intensity was normalized and quantified against β-actin. The fold increase in induction compared to control protein levels is indicated below the blot. Figure 20D MV4-11 cells were incubated with 500 nM CpG-anti-miR155, CpG-anti-miR125b, CpG-anti-miR146a, or CpG-disordered agent for 24 hours. Cell lysates were then collected and subjected to electrophoresis and Western blotting to detect activated caspase 3, an indicator of apoptosis-induced cell death. Both SHIP1 and IRAK1 were upregulated after CpG-anti-miR treatment.
[0286] Example 10: Comparison of the inhibitory effects of CpG-antimiR and GpC-antimiR CpG-anti-miR155, GpC-anti-miR155, CpG-anti-miR146a, and GpC-anti-miR146a treatments reduced RAW264.7 ( Figure 21A , 21C ) and A20 cells ( Figure 21B , 21DThe cells expressed miR155 or miR-146a. Cells were incubated with 100 nM pG-anti-miR or GpC-anti-miR for 18 hours. Figure 21E-21H CpG-anti-miR and GpC-anti-miR treatments modulate downstream targets of miR155 and miR146a. RAW264.7 ( Figure 21E , 21G ) or A20 cells ( Figure 21F , 21H Cells were incubated with 500 nM CpG-anti-miR155, GpC-anti-miR155, or CpG-anti-miR146a, GpC-anti-miR146a for 48 hours. Cell lysates were then collected and immunoblotted using antibodies against SHIP1 (target of miR155) or IRAK1 (target of miR146a). These results demonstrate that both CpG and GpC nucleic acid sequences are effective in the compounds described herein.
[0287] Example 11: CpG-miR146a mimic attenuates LPS-induced inflammatory signaling CpG-miR146a mimics increased the number of cultured CMM leukemia cells ( Figure 22A ) and A20 lymphoma cells ( Figure 22B miR-146a expression in ) was detected. Cells were incubated with 100 nM CpG-miR146a mimic for 18 hours. Figure 22C CpG-miR146a mimics inhibited the expression of IRAK1, a downstream target of miR146a. A20 cells were incubated with 500 nM of CpG-miR146a mimics or LPS (as a positive control) for 48 hours, and then cell lysates were collected and immunoblotted using an IRAK1-specific antibody. Figure 22D-22E RAW-Blue cells expressing the NF-κB responsive reporter gene were treated with 500 nM CpG-miR146a mimic for 24 hours, followed by treatment with 1 pg / ml LPS for another 24 hours. Culture medium was collected and NF-κB activity was analyzed using the Quanti-Blue assay kit. Figure 22D ), using ELISA to analyze IL-6 levels ( Figure 22E ).
[0288] Example 12: CpG-miR-126 inhibitors in vitro and in vivo Effective intake and gene silencing effect Add CpG-miR-126 inhibitor-Cy3, Ab-NP or TF-NP containing miR-126 inhibitor-Cy3, or naked miR-126 inhibitor-Cy3 to K562 cells for 4 hours. Figure 23A) and 24 hours Figure 23B The uptake test was then measured by flow cytometry. 。 The experiment was repeated twice. miR-126 expression in K562 cells was measured by Q-RT-PCR at 24 hours (n=3). Figure 23C ). Flow cytometry measurements were performed on HUVECs 4 hours after the addition of the CpG-miR-126 inhibitor Cy3 (500 nM). Figure 23D ), normal person ( Figure 23E ) and CML ( Figure 23F CD34 + CD38 - Cellular uptake. The results show HUVECs treated with a CpG-miR-126 inhibitor (500 nM) for 24 hours. Figure 23G ),normal( Figure 23H ) and CML ( Figure 23I CD34 + CD38 - miR-126 expression in cells (n=4). This shows the effect of treatment with a CpG-miR-126 inhibitor (500 nM) on normal cells. Figure 23J ) and CML ( Figure 23K CD34 + CD38 - One of two cell cycle experiments performed in cells using EDU staining.
[0289] Mouse CML BM, LTHSC, and EC cells were treated with the CpG-miR-126 inhibitor Cy3 (500 nM) for 4 hours, and then Cy3 was detected by flow cytometry. + cell( Figure 25A Cells were also collected within 24 hours, and miR-126 expression was measured by Q-RT-PCR. Figure 25B Cell cycle was measured by EDU staining 72 hours after adding a CpG-miR-126 inhibitor to CML BM LTHSC. Figure 25C One of two representative plots is shown in the figure. CML mice were treated with the CpG-miR-126 inhibitor Cy3 at a single dose (5 mg / kg, intravenously), and Cy3 uptake in BM, LTHSC, and EC was measured by flow cytometry 16 hours after treatment. Figure 25D Normal and CML mice were also treated with a CpG-miR-126 inhibitor (5 mg / kg / day, intravenously, once daily) for 3 days, and miR-126 expression was measured by sorting BM, LTHSC, and EC from the femur and then by Q-RT-PCR. Figure 25E-25FWild-type B6 mice were treated with either CpG-scrRNA (scrRNA) or a CpG-miR-126 inhibitor (inhibitor) (5 mg / kg / day, intravenously) for 3 weeks, and BM cells were collected and analyzed. Red blood cells (RBCs) were shown. Figure 25G WBC Figure 25H ), PLT ( Figure 25I ), BM mononuclear cells ( Figure 25J ), LTHSC Figure 25K ) and EC ( Figure 25L The number of BM cells (CD45.2) from treated normal mice was transplanted into CD45.1 homologous recipient mice, and blood counts were monitored at 16 weeks. Figure 25M ) and BM and spleen ( Figure 25N Donor cell implantation in ) and BM at 16 weeks ( Figure 25O The number of donor LTHSCs. The results shown are expressed as mean ± SEM. ∗ p<0.05, ∗∗ p<0.01, ∗∗∗ p<0.001. Abbreviations: EC (endothelial cells); PLT (platelets).
[0290] Example 13: Combination of the compound described herein with another therapeutic agent The knockdown of miR-126 by a CpG-miR-126 inhibitor, combined with in vivo NIL, enhanced the elimination of CML LSCs in mice. BM cells from SCL-tTA / BCR-ABL mice (CD45.2) were transplanted into B6 mice (CD45.1, n=40) to generate a group of mice with CML-like disease. After confirming CML development 4 weeks after transplantation, mice were randomly assigned to four groups (n=10 per group) and treated for 3 weeks with CpG-miR-126 inhibitor (5 mg / kg, IV four times weekly), CpG-scrRNA (5 mg / kg, IV four times weekly), CpG-miR-126 inhibitor + NIL (50 mg / kg, IV once daily), and CpG-scrRNA + NIL. Peripheral blood (PB) was measured after 3 weeks of treatment. Figure 24A ),spleen( Figure 24B ) and bone marrow (BM)( Figure 24C The percentage of donor CML cells in the spleen () Figure 24D ) and BM ( Figure 24E The number of donor CML LSKs in the spleen () Figure 24F ) and BM ( Figure 24G The number of donor CML long-term hematopoietic stem cells (LTHSCs) in the mice. Another group of mice was treated for 3 weeks, followed by a survival study after 3 weeks of treatment (n=10 per group). Figure 24H BM cells (CD45.2) were collected from treated leukemia mice (3 weeks old) and 4 × 10⁻⁶ cells were added. 6 2×10 6 1×10 6 and 5×10 5 One cell / mouse was transplanted into 900 cGy-irradiated secondary congener CD45.1 recipient mice (n = 6 mice / dose / condition × 4 doses × 4 conditions = 96 mice). CML cell engraftment and leukemia development in the recipient mouse blood were monitored by WBC counts for 16 weeks. LIC frequency was quantified using L-Calc software. Figure 24I Abbreviations: NIL (nilotinib); PB (peripheral blood); BM (bone marrow); LTHSC (long-term hematopoietic stem cells); LIC (leukemia initiating cells); LSK (lineage: Sca-1+c-kit+ cells).
[0291] Other implementation plans It should be understood that although this disclosure has been described in conjunction with specific embodiments thereof, the foregoing description is intended to illustrate and not limit the scope of this disclosure, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
[0292] The implementation schemes disclosed in this article include the following implementation schemes P1 to P51.
[0293] Implementation scheme P1. An isolated compound comprising a phosphorylated oligodeoxynucleotide (ODN) conjugated to an antimicroRNA (antimiR) sequence.
[0294] Implementation Scheme P2. The compound according to Implementation Scheme P1, wherein the anti-miR sequence is an anti-miR126, anti-miR142, anti-miR155, anti-miR9, anti-miR10b, anti-miR21, anti-miR17 or anti-miR92 nucleic acid sequence.
[0295] Implementation scheme P3. An isolated compound comprising a phosphorylated oligodeoxynucleotide (ODN) conjugated to a microRNA (miRNA) mimic nucleic acid sequence (miRNA mimic).
[0296] Implementation Scheme P4. The compound according to Implementation Scheme P3, wherein the mimic is a miR126 mimic, miR142 mimic, miR155 mimic, miR9 mimic, miR10b mimic, miR21 mimic, miR17 mimic, or miR92 mimic nucleic acid sequence. Implementation scheme P5. The compound according to any one of implementation scheme P1 or implementation scheme P3 further comprises one or more covalent linkers between the ODN and the antimiR or miRNA mimic sequence.
[0297] Implementation Scheme P6. The compound according to Implementation Scheme P5, wherein the connector is a substituted or unsubstituted alkylene or heteroalkylene connector.
[0298] Implementation Scheme P7. The compound according to Implementation Scheme P6, wherein the substituted alkylene or heteroalkylene linker comprises a portion selected from an azide group, a protected amino group, an N-hydroxysuccinimide (NHS) group, and a protected thiol group.
[0299] Implementation Scheme P8. The compound according to Implementation Scheme P7, wherein a substituted alkylene or heteroalkylene linker comprising a protected thiol group is partially conjugated to a group selected from divinyl sulfone derivatives, acryloyl derivatives and maleimide derivatives.
[0300] Implementation Scheme P9. The compound according to Implementation Scheme P8, wherein the acryloyl derivative is acryloyl chloride.
[0301] Implementation Scheme P10. The compound according to Implementation Scheme P6, wherein the substituted alkylene or heteroalkylene linker is partially conjugated with polyethylene glycol (PEG) or a bisphosphonate.
[0302] Implementation Scheme P11. The compound according to Implementation Scheme P6, wherein the alkylene or heteroalkylene linker comprises an unsubstituted C3 heteroalkylene.
[0303] Implementation Scheme P12. The compound according to Implementation Scheme P6, wherein the alkylene or heteroalkylene linker comprises an unsubstituted C6-C12 heteroalkylene.
[0304] Implementation Scheme P13. The compound according to Implementation Scheme P5, wherein the connector is a substituted or unsubstituted alkylene, a substituted or unsubstituted heteroalkylene, a substituted or unsubstituted cycloalkylene, a substituted or unsubstituted heterocycloalkylene, a substituted or unsubstituted arylene, or a substituted or unsubstituted heteroarylene.
[0305] Implementation Scheme P14. The compound according to Implementation Scheme P5, wherein the connector is a substituted or unsubstituted C1-C40 alkylene, a substituted or unsubstituted 2-40 heteroalkylene, a substituted or unsubstituted C3-C8 cycloalkylene, a substituted or unsubstituted 3-8 heteroalkylene, a substituted or unsubstituted C6-C10 arylene, or a substituted or unsubstituted 5- to 10-membered heteroarylene.
[0306] Implementation Scheme P15. The compound according to Implementation Scheme P5, wherein the connector is an unsubstituted C1-C40 alkylene, an unsubstituted 2- to 40-membered heteroalkylene, an unsubstituted C3-C8 cycloalkylene, an unsubstituted 3- to 8-membered heteroalkylene, an unsubstituted C6-C10 arylene, or an unsubstituted 5- to 10-membered heteroarylene.
[0307] Implementation Scheme P16. The compound according to Implementation Scheme P5, wherein the connector is a substituted 2 to 40-membered heteroalkylene group.
[0308] Implementation Scheme P17. The compound according to any one of Implementation Scheme P1 or Implementation Scheme P3, wherein the antimiR or miRNA mimic sequence is chemically modified.
[0309] Implementation Scheme P18. The compound according to Implementation Scheme P17, wherein the antimiR or miRNA mimic sequence comprises chemical modifications selected from the group consisting of: 2'O-methyl, 2'-deoxy-2'-fluorine, 2'-deoxy, universal base, 5-C-methyl, incorporation of reverse deoxy-debase residues, and locked nucleic acid.
[0310] Implementation Scheme P19. The compound according to Implementation Scheme P18, wherein the modification is located at the terminal nucleobase of the antimiR or miRNA mimic sequence, respectively.
[0311] Implementation scheme P20. The compound according to implementation scheme P18, wherein the modification is not located at the terminal nucleobase of the antimiR or miRNA mimic sequence.
[0312] Implementation scheme P21. The compound according to implementation scheme P18, wherein the modification prevents serum-derived nucleases.
[0313] Implementation Scheme P22. The compound according to Implementation Scheme P1 or Implementation Scheme P3, wherein the ODN sequence comprises a CpG-ODN nucleic acid sequence selected from the following: Class A CpG-ODN nucleic acid sequence, Class B CpG-ODN nucleic acid sequence, and Class C CpG-ODN nucleic acid sequence.
[0314] Implementation scheme P23. The compound according to implementation scheme P1 or P3, wherein the ODN comprises a phosphate diester derivative bond.
[0315] Implementation Scheme P24. The compound according to Implementation Scheme P23, wherein the phosphodiester derivative bond in the CpG nucleic acid sequence is selected from: aminophosphate bond, diaminophosphate bond, thiophosphate bond, dithiophosphate bond, phosphonocarboxylic acid bond, phosphonocarboxylic acid ester bond, phosphonoacetic acid bond, phosphonoformic acid bond, methylphosphonate bond, borosophosphonate bond, and O-methylphosphonamide bond.
[0316] Implementation Scheme P25. A pharmaceutical composition comprising a pharmaceutically acceptable excipient and a compound according to any one of Implementation Scheme P1 or Implementation Scheme P3.
[0317] Implementation Scheme P26. The pharmaceutical composition according to Implementation Scheme P25 further comprises a second therapeutic agent.
[0318] Implementation Scheme P27. The pharmaceutical composition according to Implementation Scheme P26, wherein the second therapeutic agent is selected from: antitumor agents or anticancer agents, cytotoxic agents, cell inhibitors, anti-inflammatory agents, analgesics, anti-infective agents, growth inhibitors, immunogens, immunomodulators, and chemokines.
[0319] Implementation Scheme P28. The pharmaceutical composition according to Implementation Scheme P27, wherein the anticancer agent is a cell death promoter.
[0320] Implementation Scheme P29. The pharmaceutical composition according to Implementation Scheme P27, wherein the second therapeutic agent is selected from: actinomycin D / dextrin, bleomycin, daunorubicin, doxorubicin, doxorubicin (pegylated liposome), epirubicin, idarubicin, mitomycin, mitoxantrone, etoposide, docetaxel, irinotecan, paclitaxel, topotecan, vincristine, vinorelbine, carboplatin, cisplatin, oxaliplatin, alenzusab, BCG, bevacizumab, cetuximab, denosumab, erlotinib, gefitinib, imatinib, interferon, ipilimumab, lapatinib, monomethylaurestatin E (MMEA), maytansine (DM1), rituximab, sunitinib, sorafenib, sirolimus, and trastuzumab, or any one or more combinations thereof.
[0321] Implementation Scheme P30. A method for treating cancer in a subject in need, the method comprising administering to the subject an effective amount of a compound according to any one of Implementation Scheme P1 or Implementation Scheme P3, or a pharmaceutical composition according to Implementation Scheme P25.
[0322] Implementation Scheme P31. The method according to Implementation Scheme P30, wherein the compound according to any one of Implementation Scheme P1 or Implementation Scheme P3 or the pharmaceutical composition according to Implementation Scheme P25 respectively comprises an anti-miR126 sequence or a miR142 mimic.
[0323] Implementation Plan P32. The method according to Implementation Plan P30, wherein the cancer is hematopoietic cell carcinoma.
[0324] Implementation Plan P33. The method described in Implementation Plan P30, wherein the cancer is not a hematopoietic cell carcinoma.
[0325] Implementation Plan P34. The method described in Implementation Plan P30, wherein the cancer is myeloma or acute myeloid leukemia.
[0326] Implementation Plan P35. The method described in Implementation Plan P30, wherein the cancer is prostate cancer, breast cancer, glioblastoma, ovarian cancer, lung cancer, head and neck cancer, esophageal cancer, skin cancer, melanoma, brain cancer, colorectal cancer, lymphoma or myeloma, pancreatic cancer, chronic myeloid leukemia (CML) or myelodysplastic syndrome (MDS).
[0327] Implementation Scheme P36. The method according to any one of Implementation Schemes P30–P35, wherein the compound or composition is administered to the subject via intravenous, parenteral, subcutaneous, intramuscular, transdermal, intraperitoneal, intranasal, aerosol, oral, or topical administration.
[0328] Implementation Scheme P37. The method according to any one of Implementation Schemes P30–P36, wherein the treatment is dose-dependent of the compound or composition.
[0329] Implementation Scheme P38. The method according to any one of Implementation Schemes P30–P36, wherein the subject is administered about 0.001 mg / kg to about 100 mg / kg of the compound.
[0330] Implementation Scheme P39. The method according to any one of Implementation Schemes P30–P35, wherein the cancer is a cancer that has recurred after chemotherapy.
[0331] Implementation scheme P40. The method according to implementation scheme P39, wherein the recurrent cancer is resistant to chemotherapy.
[0332] Implementation Scheme P41. The method according to any one of Implementation Schemes P30–P40, wherein the compound or the composition promotes cell cycle entry of cancer stem cells, thereby treating the cancer.
[0333] Implementation Plan P42. The method according to Implementation Plan P41, wherein the cancer stem cells are leukemia stem cells (LSC).
[0334] Implementation scheme P43. The method according to implementation scheme P42, wherein the LSC is a CD34+CD38+ directed progenitor cell or a primitive CD34+CD38- progenitor cell.
[0335] Implementation Scheme P44. A method for reducing microRNA activity in cells, comprising contacting the cells with an effective amount of the compound according to Implementation Scheme P1.
[0336] Implementation Scheme P45. The method according to Implementation Scheme P44, wherein the cell is a cancer cell.
[0337] Implementation Plan P46. The method described in Implementation Plan P45, wherein the cells are acute myeloid lymphoid (AML) cells, prostate cancer cells, breast cancer cells, glioblastoma cells, ovarian cancer cells, lung cancer cells, head and neck cancer cells, esophageal cancer cells, skin cancer cells, melanoma cells, brain cancer cells, colorectal cancer cells, lymphoma cells, myeloma cells, pancreatic cancer cells, chronic myeloid leukemia (CML) cells, or myelodysplastic syndrome (MDS) cells.
[0338] Implementation scheme P47. The method according to implementation scheme P46, wherein the AML cells are derived from bone marrow.
[0339] Implementation Scheme P48. The method according to any one of Implementation Schemes P44–P47, wherein the cells are cells cultured in vitro.
[0340] Implementation scheme P49. The method according to any one of implementation schemes P44–P47, wherein the cells are in situ in the host.
[0341] Implementation scheme P50. The method according to any one of implementation schemes P44–P47, wherein the cells are in tissue cultured in vitro.
[0342] Implementation scheme P51. The method according to any one of implementation schemes P44–P47, wherein the contact step does not involve viral transduction.
[0343] Implementation scheme P52. The method according to any one of implementation schemes P44–P47, wherein the contact step does not involve viral transduction and the cells are contacted with the compound according to implementation scheme P1.
[0344] Implementation scheme P53. The method according to any one of implementation schemes P44–P52, wherein the cells are contacted with the compound at a concentration of about 1–100 nanomolars. sequence list <110> City of Hope Kortylewski, Marcin T. Swiderski, Piotr M. Marcucci, Guido Zhang, Bin Kuo, Ya-Huei <120> Compounds and compositions containing phosphorylated oligodeoxynucleotides and methods of using thereof <130> 48400-588001WO <150> US 62 / 242,189 <151> 2015-10-15 <160> 48 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(2) <223> thiophosphate modified residues <220> <221> Unclassified features <222> (16) (19) <223> Thiophosphate modified residues <400> 1 ggtgcatcga tgcagggggg 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(2) <223> Thiophosphate modified residues <220> <221> Unclassified features <222> (16) (19) <223> Thiophosphate modified residues <400> 2 ggtgcatgca tgcagggggg 20 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(19) <223> Thiophosphate modified residues <400> 3 ggtgcatcga tgcagggggg 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(19) <223> Thiophosphate modified residues <400> 4 tccatgacgt tcctgatgct 20 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(1) <223> Thiophosphate modified residues <220> <221> Unclassified features <222> (2)..(2) <223> Optionally modified residues of thiophosphate <220> <221> Unclassified features <222> (15)..(19) <223> Thiophosphate modified residues <400> 5 ggggtcaacg ttgagggggg 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(1) <223> Thiophosphate modified residues <220> <221> Unclassified features <222> (2)..(2) <223> Optionally modified residues of thiophosphate <220> <221> Unclassified features <222> (15)..(19) <223> Thiophosphate modified residues <400> 6 gggggacgat cgtcgggggg 20 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(1) <223> Thiophosphate modified residues <220> <221> Unclassified features <222> (2)..(2) <223> Optionally modified residues of thiophosphate <220> <221> Unclassified features <222> (16) (19) <223> Thiophosphate modified residues <400> 7 ggtgcatcga tgcagggggg 20 <210> 8 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(2) <223> Thiophosphate modified residues <220> <221> Unclassified features <222> (3)..(3) <223> Optionally modified residues of thiophosphate <220> <221> Unclassified features <222> (16) (20) <223> Thiophosphate modified residues <400> 8 ggggacgacg tcgtgggggg g 21 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(19) <223> Thiophosphate modified residues <400> 9 tccatgacgt tcctgatgct 20 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(19) <223> Thiophosphate modified residues <400> 10 tccatgacgt tcctgacgtt 20 <210> 11 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(23) <223> Thiophosphate modified residues <400> 11 tcgtcgtttt gtcgttttgt cgtt 24 <210> 12 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(21) <223> Thiophosphate modified residues <400> 12 tcgtcgttgt cgttttgtcg tt 22 <210> 13 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(21) <223> Thiophosphate modified residues <400> 13 tcgtcgtttt cggcgcgcgc cg 22 <210> 14 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(24) <223> Thiophosphate modified residues <400> 14 tcgtcgtcgt tcgaacgacg ttgat 25 <210> 15 <211> 6 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 15 rycgyr 6 <210> 16 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 16 cgcauuauua cucacgguac ga 22 <210> 17 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(22) <223> 2'-O-methyl modified residues <400> 17 cgcauuauua cucacgguac ga 22 <210> 18 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 18 ucguaccgug aguaauaaug cguu 24 <210> 19 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (23)..(24) <223> Fluorine-modified residues <400> 19 ucguaccgug aguaauaaug cguu 24 <210> 20 <211> twenty one <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(1) <223> Fluorine-modified residues <220> <221> Unclassified features <222> (3)..(4) <223> Fluorine-modified residues <220> <221> Unclassified features <222> (6)..(6) <223> Fluorine-modified residues <220> <221> Unclassified features <222> (10)..(10) <223> Fluorine-modified residues <220> <221> Unclassified features <222> (13)..(13) <223> Fluorine-modified residues <220> <221> Unclassified features <222> (16)..(16) <223> Fluorine-modified residues <220> <221> Unclassified features <222> (18)..(18) <223> Fluorine-modified residues <220> <221> Unclassified features <222> (20) (21) <223> Fluorine-modified residues <400> 20 uaccgugagu aauaaugcgu u 21 <210> twenty one <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> twenty one cgcauuauua cucacgguac ga 22 <210> twenty two <211> twenty three <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> twenty two uccauaaagu aggaaacacu aca 23 <210> twenty three <211> 25 <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> twenty three uguaguguuu ccuacuuuu ggauu 25 <210> twenty four <211> 25 <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (24)..(25) <223> Fluorine-modified residues <400> twenty four uguaguguuu ccuacuuuu ggauu 25 <210> 25 <211> twenty three <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 25 uccauaaagu aggaaacacu aca 23 <210> 26 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 26 uguuaaugcu aauauguagg ag 22 <210> 27 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (6)..(6) <223> The residue is t or u <220> <221> Unclassified features <222> (8)..(8) <223> The residue is t or u <220> <221> Unclassified features <222> (14) (15) <223> The residue is t or u <220> <221> Unclassified features <222> (20) (21) <223> The residue is t or u <400> 27 acccctatca caattagcat taa 23 <210> 28 <211> twenty three <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(22) <223> Thiophosphate modified residues <220> <221> Unclassified features <222> (1)..(23) <223> 2'-O-methyl modified residues <400> 28 accccuauca caauuagcau uaa 23 <210> 29 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 29 cuccuacaua uuagcauuaa cauu 24 <210> 30 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (23)..(24) <223> Fluorine-modified residues <400> 30 cuccuacaua uuagcauuaa cauu 24 <210> 31 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 31 uguuaaugcu aauauguagg ag 22 <210> 32 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(22) <223> 2'-O-methyl modified residues <400> 32 guagaaccgu acucgucacu ua 22 <210> 33 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(1) <223> The residue can be t or u <220> <221> Unclassified features <222> (8)..(9) <223> The residue can be t or u <220> <221> Unclassified features <222> (14)..(14) <223> The residue can be t or u <220> <221> Unclassified features <222> (16)..(16) <223> The residue can be t or u <400> 33 tcacaagtta gggtctcagg ga 22 <210> 34 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(21) <223> Thiophosphate modified residues <220> <221> Unclassified features <222> (1)..(22) <223> 2'-O-methyl modified residues <400> 34 ucacaaguua gggucucagg ga 22 <210> 35 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (5)..(5) <223> The residue can be t or u <220> <221> Unclassified features <222> (10) (11) <223> The residue can be t or u <220> <221> Unclassified features <222> (15) (16) <223> The residue can be t or u <220> <221> Unclassified features <222> (18)..(18) <223> The residue can be t or u <400> 35 cccatggaat tcagttctca 20 <210> 36 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(19) <223> Thiophosphate modified residues <220> <221> Unclassified features <222> (1)..(20) <223> 2'-O-methyl modified residues <400> 36 cccatggaat tcagttctca 20 <210> 37 <211> 85 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 37 cgctggcgac gggacattat tacttttggt acgcgctgtg acacttcaaa ctcgtaccgt 60 gagtaataat gcgccgtcca cggca 85 <210> 38 <211> 87 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <400> 38 gacagtgcag tcacccataa agtagaaagc actactaaca gcactggagg gtgtagtgtt 60 tcctacttta tggatgagtg tactgtg 87 <210> 39 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <400> 39 ctgttaatgc taatcgtgat aggggttttt gcctccaact gactcctaca tattagcatt 60 aacag 65 <210> 40 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <400> 40 cggggttggt tgttatcttt ggttatctag ctgtatgagt ggtgtggagt cttcataaag 60 ctagataacc gaaagtaaaa ataacccca 89 <210> 41 <211> 90 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 41 ggaggcccgt ttctctcttt ggttatctag ctgtatgagt gccacagagc cgtcataaag 60 ctagataacc gaaagtagaa atgattctca 90 <210> 42 <211> 110 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 42 ccagaggttg taacgttgtc tatatatacc ctgtagaacc gaatttgtgt ggtatccgta 60 tagtcacaga ttcgattcta ggggaatata tggtcgatgc aaaaacttca 110 <210> 43 <211> 72 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 43 tgtcgggtag cttatcagac tgatgttgac tgttgaatct catggcaaca ccagtcgatg 60 ggctgtctga ca 72 <210> 44 <211> 84 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 44 gtcagaataa tgtcaaagtg cttacagtgc aggtagtgat atgtgcatct actgcagtga 60 aggcacttgt agcattatgg tgac 84 <210> 45 <211> 78 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 45 ctttctacac aggttgggat cggttgcaat gctgtgtttc tgtatggtat tgcacttgtc 60 ccggcctgtt gagtttgg 78 <210> 46 <211> 88 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 46 tgcgctcctc tcagtccctg agaccctaac ttgtgatgtt taccgtttaa atccacgggt 60 taggctcttg ggagctgcga gtcgtgct 88 <210> 47 <211> 99 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 47 ccgatgtgta tcctcagctt tgagaactga attccatggg ttgtgtcagt gtcagacctc 60 tgaaattcag ttcttcagct gggatatctc tgtcatcgt 99 <210> 48 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <220> <221> Unclassified features <222> (1)..(21) <223> Thiophosphate modified residues <220> <221> Unclassified features <222> (1)..(22) <223> 2'-O-methyl modified residues <400> 48 cgcauuauua cucacgguac ga 22
Claims
1. Use of phosphorylated CpG oligodeoxynucleotides conjugated to antimicroRNA126 and chemotherapeutic agents in the preparation of medicaments for the treatment of acute or chronic myeloid leukemia. The thiophosphorylated CpG oligodeoxynucleotides described herein consist of the nucleic acid sequences described in any one of SEQ ID NO: 1-14. The antimicroRNA126 is composed of the nucleic acid sequence of SEQ ID NO: 16, SEQ ID NO: 17 or SEQ ID NO: 48, and The thiophosphorylated CpG oligodeoxynucleotide and antimicroRNA126 are conjugated via a covalent linker.
2. The use as claimed in claim 1, wherein the thiophosphorylated CpG oligodeoxynucleotide is composed of the nucleic acid sequence described in SEQ ID NO: 1, and the antimicroRNA126 is composed of the nucleic acid sequence described in SEQ ID NO:
17.
3. The use as claimed in claim 1, wherein the connector is an unreplaced C1-C 40 Alkylene, unsubstituted 2- to 40-membered heteroalkylene, unsubstituted C3-C8 cycloalkylene, unsubstituted 3- to 8-membered heteroalkylene, unsubstituted C6-C 10 A aryl or unsubstituted 5 to 10 aryl compounds.
4. The use as claimed in claim 1, wherein the antimicroRNA126 comprises a chemically modified 2'O-methyl group.
5. The use as claimed in claim 1, wherein the chemotherapeutic agent is selected from the group consisting of: nilotinib, actinomycin D / dextrin, bleomycin, daunorubicin, doxorubicin, epirubicin, idarubicin, mitomycin, mitoxantrone, etoposide, docetaxel, irinotecan, paclitaxel, topotecan, vincristine, vinorelbine, carboplatin, cisplatin, oxaliplatin, alenzusumab, BCG, bevacizumab, cetuximab, denosumab, erlotinib, gefitinib, imatinib, interferon, ipilimumab, lapatinib, monomethylaurestatin E, maytansine, rituximab, sunitinib, sorafenib, sirolimus, trastuzumab, and one or more combinations thereof.
6. The use as described in claim 1, wherein the chemotherapeutic agent is nilotinib, cetuximab, erlotinib, gefitinib, imatinib, sunitinib, sorafenib, or trastuzumab.
7. The use as described in claim 1, wherein the chemotherapeutic agent is nilotinib.
8. The use as claimed in claim 1, wherein the treatment increases CD34 in chronic myeloid leukemia. + Targeted progenitor cells, CD34 in chronic myeloid leukemia + CD38 + Directed progenitor cells or primitive CD34 + CD38 - Apoptosis of progenitor cells.
Citation Information
Patent Citations
Ophthalmological composition of the type which undergoes liquid-gel phase transition
US4861760A
Sustained release, comfort formulation for glaucoma therapy
US4911920A
Uncharged morpholino-based polymers having achiral intersubunit linkages
US5034506A
Use of combinations gelling polysaccharides and finely divided drug carrier substrates in topical ophthalmic compositions
US5212162A
Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5235033A