promoter

CN109072251BActive Publication Date: 2026-08-21OXFORD GENETICS
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN201780014321.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2016-03-01
Filing Date
2017-02-28
Publication Date
2026-08-21
Estimated Expiration
2037-02-28

AI Technical Summary

Technical Problem

然而,在相关基因的表达水平方面最强的启动子通常是最依赖细胞类型的启动子,即它们在它们将起作用的细胞类型方面受到限制

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN109072251B_ABST
    Figure CN109072251B_ABST
Patent Text Reader

Abstract

The present invention relates to nucleic acid molecules capable of promoting transcription of an operably linked heterologous polynucleotide in a mammalian cell. The present invention also relates to expression vectors and host cells comprising the nucleic acid molecules of the present invention. Such expression vectors are useful for the production of recombinant proteins, such as antibodies and lentivirus polypeptides.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to nucleic acid molecules capable of promoting the transcription of operablely linked heteropolynucleotides in mammalian cells. The invention also relates to expression vectors and host cells comprising the nucleic acid molecules of this invention. Such expression vectors can be used to produce recombinant proteins, such as antibodies and lentiviral peptides. Background Technology

[0002] For gene transcription to occur, RNA polymerase must bind to the gene promoter and initiate transcription. Typically, RNA polymerase I transcribes genes encoding ribosomal RNA; RNA polymerase II transcribes genes encoding messenger RNA, some small nuclear RNAs, and microRNAs; while RNA polymerase III transcribes genes encoding transfer RNA and other small RNAs.

[0003] Transcription is regulated to control when transcription occurs and how much RNA is produced. RNA polymerase regulates gene transcription through at least five mechanisms:

[0004] (i) Specificity factors alter the specificity of RNA polymerase for a given promoter or set of promoters, making it more or less able to bind to them (e.g., the σ factor used in prokaryotic transcription).

[0005] (ii) Repressors bind to operons (coding sequences on the DNA strand that are close to or overlap with the promoter region) to prevent RNA polymerase from progressing along the strand, thereby inhibiting gene expression.

[0006] (iii) Transcription factors locate RNA polymerase at the start of the protein-coding sequence and then release the polymerase to transcribe mRNA.

[0007] (iv) Activators enhance the interaction between RNA polymerase and specific promoters to promote gene expression. Enhancers are sites on the DNA helix where activators bind, thereby circularizing the DNA to allow specific promoters to enter the initiation complex.

[0008] (v) A silencer is a region of DNA sequence that can silence gene expression when it is bound by a specific transcription factor.

[0009] A typical mammalian promoter consists of a 50-100 base pair core region that binds to the basic transcription mechanism and an enhancer region that can bind to one or more transcriptional activating proteins (trans-activators). The number and type of trans-activators that can bind at the enhancer depend on the specific binding sites present. The initiation rate depends on the number and type of trans-activators that actually bind at the enhancer of the promoter. In addition to enhancers, there are also silencers that reduce gene expression when bound by different transcription factors.

[0010] Core promoters are composed of various elements, which fall into two categories: typical and atypical. Typical core promoter elements include: the TATA box, the initiator (Inr), the TFIIB recognition element (BRE), the downstream promoter element (DPE), and the downstream core element (DCE). These elements can be found in the core promoters of many, but not all, protein-coding genes. The TATA box (sequence TATAA) is typically found 20-30 bp upstream of the transcription start site (TSS) and serves as the binding site for the TFIIB general transcription factor. When the Inr element (with the concordant sequence YYANT / AYY) is present, it includes the TSS, where the first A of the concordant sequence is the first base of the transcript. The BRE element can be found either upstream (BREu concordant G / CG / CG / ACGCC) or downstream (BREd concordant G / ATT / AT / GT / GT / GT / G) of the TATA box. Although technically not a typical core promoter element, the CCAAT box (located 50-100 bp upstream of the TSS) is often included in this category. The CCAAT box also facilitates the binding of general transcription factors (TFs).

[0011] Atypical core promoter elements include CpG islands, ATG-deficient regions, and transcription initiation platforms (TIPs). CpG islands typically span 500–2000 bp of DNA and contain a relatively high proportion of CpG dinucleotides. While CpG dinucleotides are normally methylated at their C residues to reduce transcription, they remain unmethylated within CpG islands to promote transcription. ATG-deficient regions are DNA regions with a lower frequency of ATG trinucleotides than their surrounding regions. They extend approximately 1000 bp upstream and downstream of the TSS and are typically associated with promoters that do not contain a TATA box.

[0012] Strong promoters are promoters that initiate transcription at a high frequency and can be very useful tools. For example, in biochemistry, strong promoters can be used to study the transcription process or drive the production of recombinant proteins. Strong promoters can also be used in genetics: for example, they can be used to drive the expression of gene knockout shRNA or for cDNA overexpression to elucidate protein function.

[0013] Particularly effective promoters can also have medical applications: for example, in recombinant viral vaccines, higher antigen expression elicits a better immune response.

[0014] The strongest promoters used in mammalian systems are typically derived from constitutively expressed cellular genes or viral genes. However, the strongest promoters in terms of the expression level of the relevant gene are often the most cell-type dependent promoters, meaning they are limited in terms of the cell type in which they will function. Summary of the Invention

[0015] Therefore, one object of the present invention is to provide nucleic acid molecules that can promote the transcription of operablely linked heteropolynucleotides at high levels and / or in a range of mammalian cells.

[0016] Another object of the present invention is to provide expression vectors comprising the nucleic acid molecules of the present invention. Such expression vectors can be used to generate high levels of recombinant peptides, such as antibodies and lentiviral peptides.

[0017] In one embodiment, the present invention provides a nucleic acid molecule comprising:

[0018] (a) A first polynucleotide having at least 80% nucleotide sequence identity with the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or a functional fragment of the first polynucleotide; and

[0019] (b) A second polynucleotide having at least 80% nucleotide sequence identity with the nucleotide sequence shown in SEQ ID NO: 4, or a functional fragment of the second polynucleotide;

[0020] (a) and (b) are connected in this order 5'-3', and the nucleic acid molecule is capable of promoting the transcription of operablely linked heteropolynucleotides in mammalian cells.

[0021] In another embodiment, the present invention provides an expression vector comprising the nucleic acid molecule of the present invention.

[0022] In yet another embodiment, the present invention provides an expression vector comprising the nucleic acid molecule of the present invention, wherein the nucleic acid molecule is operatively linked to a heteropolynucleotide.

[0023] The present invention also provides mammalian host cells comprising the expression vector of the present invention.

[0024] The present invention also provides a kit comprising the expression vector of the present invention.

[0025] In some embodiments, the nucleic acid molecule is a separate nucleic acid molecule. The nucleic acid molecule of the present invention is capable of promoting the transcription of operablely linked heteropolynucleotides in mammalian cells, i.e., it functions as a promoter. In some embodiments, the nucleic acid molecule of the present invention functions as a constitutive promoter.

[0026] The nucleic acid molecule of the present invention comprises: (a) a first polynucleotide having at least 80% nucleotide sequence identity with the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. SEQ ID NO: 1-3 are given in the appended “Sequence” portion. The first polynucleotide preferably has at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. Most preferably, the first polynucleotide has the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0027] Alternatively, the nucleic acid molecule of the present invention may include a functional fragment of a first polynucleotide. As used herein, the term "functional fragment of a first polynucleotide" refers to a portion of a first polynucleotide that retains at least 20% (e.g., at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%) of the activity of the intact first polynucleotide in promoting the expression of an operablely linked heterologous polynucleotide. Methods for measuring and comparing promoter activity of nucleic acid sequences are well known in the art and are described below.

[0028] Preferably, the functional fragment of the first polynucleotide is at least 50%, 60%, 70%, 80%, 90%, or 95% of the length of the polynucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0029] The nucleic acid molecule of the present invention further includes: (b) a second polynucleotide having at least 80% nucleotide sequence identity with the nucleotide sequence shown in SEQ ID NO: 4, or a functional fragment of the second polynucleotide. The sequence of SEQ ID NO: 4 is given in the appended “Sequence” portion. Preferably, the second polynucleotide has at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the polynucleotide sequence shown in SEQ ID NO: 4. Most preferably, the second polynucleotide has the polynucleotide sequence of SEQ ID NO: 4.

[0030] Alternatively, the nucleic acid molecules of the present invention may include a functional fragment of a second polynucleotide. As used herein, the term "functional fragment of a second polynucleotide" refers to a portion of a second polynucleotide that retains at least 20% (e.g., at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%) of the activity of the complete second polynucleotide in promoting the expression of an operablely linked heterologous polynucleotide. Methods for measuring and comparing promoter activity of nucleic acid sequences are well known in the art and are described below. Preferably, the functional fragment of the second polynucleotide is at least 50%, 60%, 70%, 80%, 90%, or 95% of the length of the polynucleotide sequence shown in SEQ ID NO: 4.

[0031] SEQ ID NO:4 includes the transcription start site (TSS): the +1 site (i.e., the first base to be transcribed) is the first T in the sequence TCAGATC; this occurs at the 3' end of SEQ ID NO:4. Everything downstream of the TSS will be transcribed into RNA.

[0032] Therefore, it is preferred that the second polynucleotide or its functional fragment includes the sequence TCAGATC.

[0033] In some preferred embodiments, the nucleic acid molecule includes:

[0034] (a) A first polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; and

[0035] (b) A second polynucleotide having the nucleotide sequence shown in SEQ ID NO: 4;

[0036] Wherein (a) and (b) are 5'-3' linked, and wherein the nucleic acid molecule is capable of promoting the transcription of operablely linked heteropolynucleotides in mammalian cells.

[0037] In some preferred embodiments, the nucleic acid molecule includes:

[0038] (a) A first polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1; and

[0039] (b) A second polynucleotide having the nucleotide sequence shown in SEQ ID NO: 4;

[0040] (a) and (b) are connected sequentially in a 5'-3' configuration, and the nucleic acid molecule is capable of promoting the transcription of operablely linked heteropolynucleotides in mammalian cells.

[0041] In some preferred embodiments, the nucleic acid molecule includes:

[0042] (a) A first polynucleotide having the nucleotide sequence shown in SEQ ID NO: 2; and

[0043] (b) A second polynucleotide having the nucleotide sequence shown in SEQ ID NO: 4;

[0044] (a) and (b) are connected sequentially in a 5'-3' configuration, and the nucleic acid molecule is capable of promoting the transcription of operablely linked heteropolynucleotides in mammalian cells.

[0045] In some preferred embodiments, the nucleic acid molecule includes:

[0046] (a) A first polynucleotide having the nucleotide sequence shown in SEQ ID NO: 3; and

[0047] (b) A second polynucleotide having the nucleotide sequence shown in SEQ ID NO: 4;

[0048] (a) and (b) are connected sequentially in a 5'-3' configuration, and the nucleic acid molecule is capable of promoting the transcription of operablely linked heteropolynucleotides in mammalian cells.

[0049] The present invention also provides a nucleic acid molecule comprising:

[0050] (a) A first polynucleotide having at least 80% nucleotide sequence identity with the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or a functional fragment of the first polynucleotide;

[0051] (b) a second polynucleotide having at least 80% nucleotide sequence identity with the nucleotide sequence shown in SEQ ID NO: 4, or a functional fragment of the second polynucleotide; and

[0052] (c) A third polynucleotide having at least 80% nucleotide sequence identity with the nucleotide sequence shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, or a functional fragment of the third polynucleotide;

[0053] (a), (b) and (c) are connected in this order 5'-3', and the nucleic acid molecule is capable of promoting the transcription of operablely linked heteropolynucleotides in mammalian cells.

[0054] The sequences of SEQ ID NO: 5-7 are given in the appended “Sequence” section.

[0055] The third polynucleotide preferably has at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with one of the nucleotide sequences shown in SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7. Most preferably, the third polynucleotide has the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7.

[0056] Alternatively, the nucleic acid molecules of the present invention may include a functional fragment of a third polynucleotide. As used herein, the term "functional fragment of a third polynucleotide" refers to a portion of a third polynucleotide that retains at least 20% (e.g., at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%) of the activity of the intact third polynucleotide in promoting the expression of operablely linked heterologous polynucleotides. Methods for measuring and comparing promoter activity of nucleic acid sequences are well known in the art and are described below.

[0057] Preferably, the functional fragment of the third polynucleotide is at least 50%, 60%, 70%, 80%, 90%, or 95% of the length of the polynucleotide sequence shown in SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7.

[0058] In some preferred embodiments, the nucleic acid molecule includes:

[0059] (a) A first polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3;

[0060] (b) A second polynucleotide having the nucleotide sequence shown in SEQ ID NO: 4; and

[0061] (c) A third polynucleotide having the nucleotide sequence shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7;

[0062] (a), (b) and (c) are connected in this order 5'-3', and the nucleic acid molecule is capable of promoting the transcription of operablely linked heteropolynucleotides in mammalian cells.

[0063] In some preferred embodiments, the nucleic acid molecule includes:

[0064] (a) A first polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1;

[0065] (b) A second polynucleotide having the nucleotide sequence shown in SEQ ID NO: 4; and

[0066] (c) A third polynucleotide having the nucleotide sequence shown in SEQ ID NO: 5;

[0067] (a), (b) and (c) are connected sequentially in a 5'-3' configuration, and the nucleic acid molecule is capable of promoting the transcription of operablely linked heterologous polynucleotides in mammalian cells.

[0068] In some preferred embodiments, the nucleic acid molecule includes:

[0069] (a) A first polynucleotide having the nucleotide sequence shown in SEQ ID NO: 2;

[0070] (b) A second polynucleotide having the nucleotide sequence shown in SEQ ID NO: 4; and

[0071] (c) A third polynucleotide having the nucleotide sequence shown in SEQ ID NO: 6;

[0072] (a), (b) and (c) are connected sequentially in a 5'-3' configuration, and the nucleic acid molecule is capable of promoting the transcription of operablely linked heterologous polynucleotides in mammalian cells.

[0073] In some preferred embodiments, the nucleic acid molecule includes:

[0074] (a) A first polynucleotide having the nucleotide sequence shown in SEQ ID NO: 3;

[0075] (b) A second polynucleotide having the nucleotide sequence shown in SEQ ID NO: 4; and

[0076] (c) A third polynucleotide having the nucleotide sequence shown in SEQ ID NO: 7;

[0077] (a), (b) and (c) are connected sequentially in a 5'-3' configuration, and the nucleic acid molecule is capable of promoting the transcription of operablely linked heterologous polynucleotides in mammalian cells.

[0078] As used herein, the term "heteropolynucleotide" refers to a polynucleotide that encodes a desired mRNA or polypeptide. Examples of heteropolynucleotides include those that encode polypeptides (such as viral or mammalian polypeptides).

[0079] In some preferred embodiments, the heteropolynucleotide encodes proteins that enter the secretion pathway, such as membrane connectives, secretory antibodies, or other secretory proteins. Cells expressing such heteropolynucleotides are particularly suitable for the continuous production of recombinant secretory proteins in bioreactors or suspension culture vessels, where the product can be harvested from the culture medium without lysing the cells.

[0080] Other preferred heteropolynucleotides are those encoding proteins that maintain cell relevance (e.g., membrane or cytoplasmic proteins), which can be used in whole-cell settings or harvested via cell lysis. In some embodiments, the heteropolynucleotides encode antibodies. In some other preferred embodiments of the invention, the heteropolynucleotides encode viral polypeptides. Preferably, the viral polypeptide is a surface glycoprotein, such as VSV G. The VSV G polypeptide is a one-way membrane glycoprotein derived from vesicular stomatitis virus. It mediates a wide range of infectious tropism. In other embodiments, the viral polypeptide is Gag-Pol, Rev, or Tat. The term "Gag-Pol" refers to a retroviral protein that is proteolytically cleaved to produce a functional reverse transcriptase, integrase, and protease, as well as at least two proteins that are structurally important for viral assembly. Preferably, the Gag-Pol sequence is derived from lentivirus, and most preferably from HIV. The Rev protein facilitates the transport of the viral genome into the cytoplasm. Preferably, the Rev polypeptide sequence is derived from lentivirus, and most preferably from HIV. The Tat protein enhances the efficiency of viral transcription. Preferably, the Tat polypeptide sequence is derived from lentivirus, and most preferably from HIV.

[0081] The first polynucleotide, the second polynucleotide, the third polynucleotide (if present), and the heteropolynucleotide (if present) are linked in this order in the 5'-3' direction.

[0082] One or more linker nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 linker nucleotides) may be present between the first and second polynucleotides, the second and third polynucleotides, the second and heteropolynucleotides, and the third and heteropolynucleotides. When present, such linker polynucleotides should not have a significant adverse effect on the efficacy of the promoter fragment (e.g., as measured in a luciferase assay). Preferably, no linker nucleotides are present, i.e., preferably the first polynucleotide, second polynucleotide, third polynucleotide (when present), and heteropolynucleotide (when present) are linked sequentially in the 5'-3' direction.

[0083] Nucleic acid molecules can promote the transcription of operable heteropolynucleotides in mammalian cells.

[0084] The heteropolynucleotide will be operatively located downstream (i.e., 3') of the first, second, and third polynucleotides (when present) of the present invention.

[0085] In the context of this invention, the term "promoted transcription" refers to the production of an expression product of a heteropolynucleotide when the heteropolynucleotide is operatively linked or inserted downstream of the first, second, and third polynucleotides (when present) of this invention.

[0086] In some embodiments of the invention, nucleic acid molecules are capable of promoting the transcription of operable heterologous polypeptides in mammalian cells in an inducible manner, i.e., the nucleic acid molecules are inducible promoters. Therefore, nucleic acid molecules can include repressible or activating elements. For example, versions of the promoters disclosed herein can be modified to include binding sites for proteins that can repress or activate transcription to produce an inducible form. In one such example, the promoters disclosed herein (preferably p565 or p565i) can be modified to include 2-7 binding sites for tetracycline repressor proteins, most preferably 2-3 sites. By inserting said binding sites, the tetracycline repressor protein will be able to bind to the promoter, and doing so can prevent the assembly of gene transcription factor apparatus on the promoter, thereby preventing transcription and translation. This terminates protein expression. In the presence of doxycycline or tetracycline, the tetracycline repressor protein can no longer bind to DNA, therefore the repressor can no longer bind to the promoter, and transcription and translation can proceed unimpeded. Therefore, the transcriptional activity of the resulting promoter can be said to be induced by the presence of doxycycline or tetracycline, and thus can be classified as an inducible promoter.

[0087] As used herein, the term “expression product” means (i) one or both of the following: RNA (e.g., hnRNA, mRNA, siRNA, or miRNA) as a transcript of a heteropolynucleotide and (ii) the translation product of a heteropolynucleotide polypeptide.

[0088] Heteronucleotides can be operatively inserted downstream of the nucleic acid molecule of the present invention, such that the 5' end of the heteronucleotide is located in a region of 500 bp, 400 bp, 300 bp, 200 bp, 100 bp, 50 bp, 30 bp or 10 bp from the 3' end of the nucleic acid molecule of the present invention.

[0089] The level of transcription promoted by the nucleic acid molecules of the present invention can be determined by any suitable method. For example, for such a determination, the heteropolynucleotide can be a selectable marker gene (e.g., a neomycin resistance gene or a hygromycin B phosphotransferase gene) or an expression reporter gene (e.g., LacZ, GFP (green fluorescent protein), luciferase gene, etc.).

[0090] Preferably, promoter activity can be confirmed by using the FLuc gene.

[0091] The transcriptional activity of the nucleic acid molecule of the present invention can be measured by operatively inserting a reporter gene (e.g., the FLuc gene) downstream of the nucleic acid molecule of the present invention. The obtained transcriptional level can then be indicated by the expression level of the firefly luciferase protein. To achieve this, the desired DNA (including the nucleic acid of the present invention upstream of the Fluc gene) can be introduced into a plasmid, which is then transfected into suitable recipient cells (e.g., 293A cells) to express the firefly luciferase protein. After 24 hours, the cells can be lysed, and the luciferase in the cell lysate can be monitored using a photometer by measuring its light output in the presence of its luciferin substrate.

[0092] Nucleic acid molecules can facilitate the transcription of operablely linked heterologous polynucleotides in mammalian cells. Preferred mammalian cells include mouse cells, rat cells, hamster cells, monkey cells, and human cells. Examples of such cells include HEK cells and derivatives (e.g., HEK293, HEK293T, HEK293A), PerC6 cells, 911 cells, CHO cells, HCT116 cells, HeLa cells, COS cells, and VERO cells; cancer cells such as HepG2, A549, and MCF7; primary cells isolated from human or animal biopsies; and stem cells (including pluripotent cells, such as embryonic stem cells and induced pluripotent stem (iPS) cells; and pluripotent stem cells, such as hematopoietic stem cells, mesenchymal stem cells, etc.).

[0093] Preferred human cells include HEK293, HEK293T, and HEK293A cells; and human stem cells (including pluripotent cells, such as embryonic stem cells and induced pluripotent stem (iPS) cells; and pluripotent stem cells, such as hematopoietic stem cells, mesenchymal stem cells, etc.).

[0094] In another embodiment, the present invention provides an expression vector comprising the nucleic acid molecule of the present invention. Preferably, the expression vector is a plasmid or a viral vector. Examples of mammalian expression vectors include adenovirus vectors, pSV and pCMV series plasmid vectors, vaccinia vectors and retroviral vectors, and baculoviruses. In some embodiments, the expression vector is a lentiviral vector.

[0095] Expression vectors may also include one or more of the following: origin of replication, selective markers, and multiple cloning sites.

[0096] In yet another embodiment, the present invention provides an expression vector comprising the nucleic acid molecule of the present invention, wherein the nucleic acid molecule is operatively linked to a heteropolynucleotide.

[0097] The present invention also provides mammalian host cells comprising the expression vector of the present invention. The expression vector can be transfected into the host cells by any suitable method. Preferably, the host cells are mammalian cells (e.g., human cells), such as those mentioned above. These host cells can be isolated cells.

[0098] The present invention also provides a mammal whose genome includes the nucleic acid molecule of the present invention or the expression vector of the present invention. Preferably, the nucleic acid molecule of the present invention or the expression vector of the present invention is inserted into the genome of a mammal such that a heterologous polynucleotide operably linked to or operably inserted into the expression vector of the present invention is expressed in one or more cells of the mammal. Preferably, the mammal is a mouse or a rat. In some embodiments, the mammal is a non-human mammal.

[0099] The present invention also provides a kit comprising the expression vector of the present invention and / or host cells, optionally and one or more other components selected from the group consisting of:

[0100] (i) Helper plasmids (e.g., helper plasmids containing nucleotide sequences encoding lentiviral polypeptides under the regulation of the promoter of the present invention);

[0101] (ii) Viral genome plasmids (e.g., viral genome plasmids with packaging signals suitable for easy insertion of the desired transgene);

[0102] (iii) Buffer solution;

[0103] (iv) Restriction enzymes;

[0104] (v) Transfection medium; and

[0105] (vi) Mammalian cells.

[0106] The BLAST alignment method can be used to obtain percentage amino acid sequence identity and nucleotide sequence identity (Altschul et al. (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402; and http: / / www.ncbi.nlm.nih.gov / BLAST). Preferably, standard or default alignment parameters are used.

[0107] Standard protein-protein BLAST (blastp) can be used to find similar sequences in protein databases. Like other BLAST programs, blastp aims to find similar local regions. When sequence similarity spans the entire sequence, blastp will also report the overall alignment, which is preferred for protein identification purposes. Preferably, standard or default alignment parameters are used. In some cases, the "low complexity filter" can be removed.

[0108] BLAST protein searches can also be performed using the BLASTX program with a score of 50 and a word length of 3. To obtain vacancy alignments for comparative purposes, vacancy BLAST (in BLAST 2.0) can be used as described by Altschul et al. (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform iterative searches to detect long-distance relationships between molecules. (See Altschul et al. (1997), ibid.). When using BLAST, vacancy BLAST, or PSI-BLAST, the default parameters for each program can be used.

[0109] For nucleotide sequence comparison, MEGABLAST, discontinuous megablast, and blastn can be used to achieve this goal. Preferably, standard or default alignment parameters are used. MEGABLAST is specifically designed to efficiently find long alignments between very similar sequences. Discontinuous MEGABLAST can be used to find nucleotide sequences that are similar to but not identical to the nucleic acids of this invention.

[0110] The BLAST nucleotide algorithm searches for similar sequences by breaking down a query into short subsequences called words. The procedure first identifies exact matches (word hits) with the query word. The BLAST procedure then expands these word hits in multiple steps to generate a final gap alignment. In some implementations, the BLAST nucleotide search can be performed using the BLASTN procedure with a score of 100 and a word length of 12.

[0111] One of the important parameters controlling the search sensitivity of BLAST is the word size. The most important reason why blastn is more sensitive than MEGABLAST is that it uses a shorter default word size (11). Therefore, blastn outperforms MEGABLAST in finding and aligning relevant nucleotide sequences from other organisms. The word size can be adjusted in blastn and can be reduced from the default value to a minimum of 7 to improve search sensitivity.

[0112] More sensitive searches can be achieved by using the newly introduced discontinuous megablast page (www.ncbi.nlm.nih.gov / Web / Newsltr / FallWinter02 / blastlab.html). This page uses an algorithm similar to that reported by Ma et al. (Bioinformatics. 2002 Mar; 18(3):440-5). Instead of requiring precise word matches as the source of alignment expansion, discontinuous megablast uses discontinuous words within a longer template window. In the encoding mode, the third base wobble is considered by focusing on finding matches at the first and second codon positions while ignoring mismatches at the third position. Searching in discontinuous MEGABLAST with the same word size is more sensitive and efficient than using standard blastn with the same word size. The parameters unique to discontinuous megablast are:

[0113] Character size: 11 or 12; Template: 16, 18 or 21; Template type: encoded (0), non-encoded (1) or both (2). Attached Figure Description

[0114] Figure 1 : pSF-SnapFast FLuc report carrier background map.

[0115] Figure 2 A graph comparing the recombinant promoter fragment to a series of standard promoters. Error bars indicate standard errors. Experiments were performed in triplicate.

[0116] Figure 3 : A graph comparing the three highest-performing recombinant promoters (p565, p567, and p576) with a range of standard high-expression promoters in time-process assays.

[0117] Figure 4 Protein expression levels driven by the recombinant promoter p565.

[0118] Figure 5Proteins were overexpressed in HEK293 cells derived from the CMV promoter and the OxfordGenetics “hybrid” prom-565 promoter, respectively, using plasmid vectors pcDNA3.1 and SnapFast Pro1v. (pcDNA3.1 is a protein expression vector available from Life Technologies. The plasmid vector includes an immediate early CMV promoter, a T7 promoter, a bovine growth factor (BgH) polyadenylation signal accompanying the F1 initiation for the formation of single-stranded DNA, and an SV40 promoter and SV40 polyadenylation signal driving the expression of neomycin-kanamycin phosphotransferase (aminoglycoside-3'-phosphotransferase). If the pcDNA3.1 vector is used to express a foreign protein of interest, the coding sequence of the protein needs to be inserted downstream (3') of the CMV and T7 promoters but upstream (5') of the BgH polyadenylation signal in the 5' to 3' direction. The plasmid also contains an ampicillin resistance gene for selection in bacterial cells. SnapFast ProV1 is a protein expression vector designed by Oxford Genetics Ltd that contains a promoter referred to herein as p565i prior to the SV40 polyadenylation signal. If SnapFast To express the exogenous protein of interest, the ProV1 vector requires the coding sequence of the protein to be inserted downstream (3') of the p565i promoter but upstream (5') of the SV40 polyadenylation signal in the 5' to 3' direction. The plasmid also contains a kanamycin resistance gene for selection in bacterial cells. HEK293 cells were transfected with pcDNA3.1 or SnapFast Pro1v expressing various FLAG-tagged fusion proteins. Protein Simple Wes was used. TM The automated Western blotting system was used to determine protein levels in culture supernatant or cell lysates 72 hours post-transfection. FLAG-labeled fusion proteins were detected using mouse anti-FLAG primary antibody and rabbit anti-mouse IgG-HRP secondary antibody.

[0119] Figure 6 Proteins were overexpressed in HEK293 cells derived from the CMV promoter and the Oxford Genetics "hybrid" prom-565 promoter, respectively, using plasmid vectors pcDNA3.1 and SnapFast Pro1v. HEK293 cells were transfected with pcDNA3.1 or SnapFast Pro1v expressing various FLAG-tagged fusion proteins. Protein Simple Wes was used. TMThe automated Western blotting system was used to determine protein levels in culture supernatant or cell lysates 72 hours post-transfection. FLAG-labeled fusion proteins were detected using mouse anti-FLAG primary antibody and rabbit anti-mouse IgG-HRP secondary antibody.

[0120] Figure 7 Proteins were overexpressed in Chinese hamster ovary (CHO) cells derived from the CMV promoter and the Oxford Genetics "hybrid" prom-565 promoter, respectively, using plasmid vectors pcDNA3.1 and SnapFast Pro1v. CHO cells were transfected with pcDNA3.1 or SnapFast Pro1v expressing various FLAG-tagged fusion proteins. Protein SimpleWes was used. TM The automated Western blotting system was used to determine protein levels in culture supernatant or cell lysates 72 hours post-transfection. FLAG-labeled fusion proteins were detected using mouse anti-FLAG primary antibody and rabbit anti-mouse IgG-HRP secondary antibody.

[0121] Figure 8 Proteins were overexpressed in Chinese hamster ovary (CHO) cells derived from the CMV promoter and the Oxford Genetics "hybrid" prom-565 promoter, respectively, using plasmid vectors pcDNA3.1 and SnapFast Pro1v. CHO cells were transfected with pcDNA3.1 or SnapFast Pro1v expressing various FLAG-tagged fusion proteins. Protein SimpleWes was used. TM The automated Western blotting system was used to determine protein levels in culture supernatant or cell lysates 72 hours post-transfection. FLAG-labeled fusion proteins were detected using mouse anti-FLAG primary antibody and rabbit anti-mouse IgG-HRP secondary antibody.

[0122] Figure 9 : Expression level of GFP driven by the promoter of the present invention in HCT116 cells.

[0123] Figure 10 : Expression level of GFP driven by the promoter of the present invention in A549 cells. Detailed Implementation

[0124] Example

[0125] The invention is further illustrated by the following examples, wherein, unless otherwise stated, parts and percentages are by weight and degrees are in degrees Celsius. It should be understood that these examples, while illustrating preferred embodiments of the invention, are given by way of illustration only. From the foregoing discussion and these examples, those skilled in the art can determine the essential characteristics of the invention, and various changes and modifications can be made to adapt it to various uses and conditions without departing from its spirit and scope. Therefore, various modifications to the invention, in addition to those shown and described herein, will be apparent to those skilled in the art based on the foregoing description. These modifications are also intended to fall within the scope of the appended claims.

[0126] The publicly available information of each reference mentioned in this article is incorporated into this article in its entirety through citation.

[0127] Example 1: Recombinant promoter fragment

[0128] Generate a recombinant promoter fragment consisting of the sequences identified in Table 1.

[0129] Table 1: Sequences of Recombinant Promoter Fragments

[0130] Starter name First polynucleotide Second polynucleotide Third polynucleotide p567 SEQ ID NO:3 SEQ ID NO:4 p567i SEQ ID NO:3 SEQ ID NO:4 SEQ ID NO:7 p576 SEQ ID NO:2 SEQ ID NO:4 p576i SEQ ID NO:2 SEQ ID NO:4 SEQ ID NO:6 p565 SEQ ID NO:1 SEQ ID NO:4 p565i SEQ ID NO:1 SEQ ID NO:4 SEQ ID NO:5

[0131] The first, second, and third polynucleotides (if present) are linked sequentially in the promoter fragment described above.

[0132] Example 2: Constructing an expression vector including a promoter

[0133] The following is a report vector for firefly luciferase assay.

[0134] Preparation of carrier

[0135] use Figure 1 The SnapFast (SF) vector is shown. The backbone of the SnapFast vector consists of the pUC bacterial origin of replication, the ampicillin resistance gene, and a multiple cloning site. The firefly luciferase coding sequence was cloned into the multiple cloning site between the NcoI restriction site and the XbaI restriction site (see [link to documentation]). Figure 1 The luciferase coding sequence includes the Kozak ribosome binding site.

[0136] The reporter plasmid was linearized using BglII and then dephosphorylated to prevent re-ligation of the vector backbone. The cleaved vector was isolated from the uncut vector by gel extraction followed by column-based purification. The recombinant promoter fragment (from Example 1) was then ligated into the BglII-cleaved vector.

[0137] The vector was transformed into a standard *E. coli* clone and placed on LB kanamycin-selected plates, resulting in one recombinant promoter per colony. Colonies were picked for microscale plasmid preparation. These promoter clones were then transfected into HEK293 cells for subsequent luciferase expression assays.

[0138] Example 3: Determination of promoter activity

[0139] Materials and methods

[0140] Plasmid DNA was purified from colonies containing each recombinant promoter. Reporter vectors containing the recombinant promoters were transfected into HEK293 cells in multiple 96-well plates. Transfected cells were incubated at 37°C for 24 hours. Luciferase activity in each well was measured using a luciferase assay kit (Promega, Wisconsin, USA).

[0141] In summary, each assay was performed as follows: Culture medium was removed from each well. 100 μl of report lysis buffer was added to the cells in each well. The microtiter plate was incubated at -20°C for 30 min to lyse the cells, and then thawed by incubating at room temperature for 30 min. The cell lysates were homogenized by up-and-down pipetting. 25 μl of each lysate sample was transferred to a photometer tube. The luciferase assay reagent was reconstituted by adding luciferase assay buffer. The samples were analyzed on a LumatLB 9507 photometer (EG&G Berthold). The photometer was set to inject 25 μl of luciferase assay reagent, and the emitted light was recorded (duration 2 seconds). The photometer output is given in relative light units.

[0142] The selection of recombinant promoters was compared with that of standard high-expression promoters.

[0143] result

[0144] The results show Figure 2 In this assay, the recombinant promoter fragments p567 and p576 outperformed CMV (the current gold standard).

[0145] Example 4: Time Process Experiment

[0146] Three recombinant promoters (p565, p567, and p576) were selected for time-process experiments. The results are as follows: Figure 3 As shown.

[0147] The results showed that the recombinant promoter produced highly consistent high-luciferase expression from 24 to 72 hours after transfection.

[0148] Example 5: Expression levels from recombinant promoters

[0149] Protein expression levels driven by the recombinant promoter p565 of this invention are shown in Figure 4 In the figure, CMV promoter expression is shown as a control. The expression of the p565 promoter and the standard CMV promoter for four different commercially useful antigens (proteins "W", "X", "Y", and "Z") was compared. For each antigen, the coding sequence was cloned into an equivalent of... Figure 1 The vector shown is downstream of the CMV or p565 promoter in the carrier.

[0150] On day 1, HEK293Ad cells were seeded in 300 μl of serum-free medium in 48-well microtiter plates at a density of 30,000 cells per well. On day 2, cells in each well were transfected with 0.75 μg of DNA for each expression vector. Cells were transfected using branched-chain polyethyleneimine (PEI) at a ratio of 3 μg per μg of DNA. The DNA was incubated with PEI at room temperature for 20 minutes before being added to the cells to form a DNA:PEI complex. Three days after transfection, the supernatant was harvested from each well and the amount of expressed antigen was analyzed by Western blotting.

[0151] Example 6: Expression level in HEK293 cells

[0152] Various human genes were overexpressed in human embryonic kidney cells (HEK293) from the CMV promoter or promoter P565i using a transient transfection method with branched PEI (25 kDa) (see Table 2).

[0153] Table 2: Human genes overexpressed in HEK293 cells

[0154]

[0155] Prior to plasmid DNA transfection, HEK293 cells were seeded at a density of 25,000 cells / well in 48-well (Sigma Aldrich) tissue cultures for 24 hours. Each plasmid DNA (750 ng) expressing a FLAG-tagged human gene from the CMV promoter or promoter P565i was mixed with branched-chain PEI (25 kDa) at a 1:3 ratio, and the DNA:PEI complex was transiently transfected into each well of the 48-well plates seeded with HEK293 cells. Immunoassay was performed using mouse anti-FLAG primary antibody and second rabbit anti-mouse IgG-HRP via automated Western blotting 72 hours post-transfection. TM Protein Simple analysis was used to analyze the expression of each FLAG-tagged human protein from transient transfection. Results showed... Figure 5 and Figure 6 middle.

[0156] Example 7: Expression level in CHO cells

[0157] Various human genes were overexpressed in CHO K1 cells from the CMV promoter or promoter P565i using a transient transfection method with branched PEI (25 kDa) (see Table 3).

[0158] Table 3: Human genes overexpressed in CHO cells

[0159]

[0160]

[0161] Prior to plasmid DNA transfection, CHO K1 cells were seeded at a density of 20,000 cells / well in 48-well (Sigma Aldrich) tissue cultures for 24 hours. Each plasmid DNA (750 ng) expressing a FLAG-tagged human gene from the CMV promoter or promoter P565i was mixed with branched-chain PEI (25 kDa) at a 1:3 ratio, and the DNA:PEI complex was transiently transfected into each well of the 48-well plates seeded with CHO K1 cells. Immunoassay was performed using mouse anti-FLAG primary antibody and second rabbit anti-mouse IgG-HRP via automated Western blotting 72 hours post-transfection. TM Protein Simple analysis was used to analyze the expression of each FLAG-tagged human protein from transient transfection. Results showed... Figure 7 and Figure 8 middle.

[0162] Example 8: Expression level in HCT116 cells

[0163] Green fluorescent protein (GFP) was expressed in HCT116 cells from the CMV, P565i, P565, P576, and P567 promoters using a transient transfection method with branched PEI (25 kDa).

[0164] Prior to plasmid DNA transfection, HCT116 cells were seeded at a density of 25,000 cells / well in treated 48-well (Sigma Aldrich) tissue cultures for 24 hours. Each plasmid DNA (750 ng) from the CMV, P565i, P565, P576, or P567 promoter for enhanced green fluorescent protein expression was mixed with branched-chain PEI (25 kDa) at a 1:3 ratio, and the DNA:PEI complex was transiently transfected into HCT116 cells. Enhanced green fluorescent protein expression determined by MFI in HCT116 cells was measured by flow cytometry 48 hours post-transfection. Results are as follows: Figure 9 As shown.

[0165] Example 9: Expression level in A549 cells

[0166] Green fluorescent protein (GFP) was expressed in A549 cells from the CMV, P565i, P565, P576, and P567 promoters using a transient transfection method with branched PEI (25 kDa).

[0167] Prior to plasmid DNA transfection, A549 cells were seeded at a density of 25,000 cells / well in treated 48-well (Sigma Aldrich) tissue cultures for 24 hours. Each plasmid DNA (750 ng) from the CMV, P565i, P565, P576, or P567 promoter expressing enhanced green fluorescent protein was mixed with branched-chain PEI (25 kDa) at a 1:3 ratio, and the DNA:PEI complex was transiently transfected into A549 cells. Enhanced green fluorescent protein expression determined by MFI in A549 cells was measured by flow cytometry 48 hours post-transfection. Results are as follows: Figure 10 As shown.

[0168] sequence

[0169] SEQ ID NO:3

[0170] AGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCC

[0171] SEQ ID NO:2

[0172] CTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGGCGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATT

[0173] SEQ ID NO:1

[0174] CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCACTAGTCGCCGTGAACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGCTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCC

[0175] SEQ ID NO:4

[0176] ATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATC

[0177] SEQ ID NO:7

[0178] GTTGTTCGCTTTGATAAACTTCCAGGATTCGGAGACAGTATTGAAGCTCAGGTACAGAAATAATTTCACCTTTCTTTCTCTTTCTATTCAGTGTGGCACATCTGTAAACGTTCACTCTTCACTTAGAGACATCCTCAACCAAATCACCAAACCAA

[0179] SEQ ID NO:6

[0180] GCCCAGGAAGTACACGAGAAGCTCCGAGGATTGGCTGAAGTCCAACGTCTCTGATTGCGGTGGCTCAGAGCACCCGTATCATTTTGGAGGTGAGTGGCTTTGGTTCCCGGCTGAGGTGGAGTGGGCTGAGGACTAGACTGAGCCCTCGGACATGGAGGTGGGGATG GGGCAGACTCATCCCATTCTTGACCAAGCCCTTGTTCTGCTCCCTTCCCAGGCTCTGTGACTGGGGCAACCTGCAAGGAGCTGGCCAGCCAGCCTGACGTGGACGGCTTCCTTGTGGGTGGTGCTTCCCTCAAGCCCGAATTCGTGGACATCATCAACGCCAAACAA

[0181] SEQ ID NO:5

[0182] TGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAG

[0183] Unordered list text

[0184] <223> Synthesized promoter elements. sequence list <110> Oxford Genetics Ltd. <120> promoter <130> FP1V181522ZX <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 433 <212> DNA <213> Artificial Sequence <220> <223> Synthesized promoter elements <400> 1 cgtgaggctc cggtgcccgt cagtgggcag agcgcacatc gcccacagtc cccgagaagt 60 tggggggagg ggtcggcaat tgaaccggtg cctagagaag gtggcgcggg gtaaactggg 120 aaagtgatgt cgtgtactgg ctccgccttt ttcccgaggg tgggggagaa ccgtatataa 180 gtgcactagt cgccgtgaac gtcaatggaa agtccctatt ggcgttacta tgggaacata 240 cgtcattatt gacgtcaatg acggtaaatg gcccgcctgg cattatgccc agtacatgac 300 cttatgggac tttcctactt ggcagtacat ctacgtatta gtcatcgcta ttaccatgct 360 gatgcggttt tggcagtaca tcaatgggcg tggatagcgg tttgactcac ggggatttcc 420 aagtctccac ccc 433 <210> 2 <211> 172 <212> DNA <213> Artificial Sequence <220> <223> Synthetic promoter element <400> 2 ctaccgggta ggggaggcgc ttttcccaag gcagtctgga gcatgcgctt tagcagcccc 60 gctgggcact tggcgctaca caagtggcct ctggcctcgc acacattcca catccaccgg 120 taggcgtcaa tggaaagtcc ctattggcgt tactatggga acatacgtca tt 172 <210> 3 <211> 106 <212> DNA <213> Artificial Sequence <220> <223> Synthesized promoter elements <400> 3 agtaatcaat tacggggtca ttagttcata gcccatatat ggagttccgc gttacataac 60 ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc ccgccc 106 <210> 4 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> Synthesized promoter elements <400> 4 attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc aaaatgtcgt 60 aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga ggtctatata 120 agcagagctg gtttagtgaa ccgtcagatc 150 <210> 5 <211> 157 <212> DNA <213> Artificial Sequence <220> <223> Synthesized promoter elements <400> 5 tgaagttggt ggtgaggccc tgggcaggtt ggtatcaagg ttacaagaca ggtttaagga 60 gaccaataga aactgggcat gtggagacag agaagactct tgggtttctg ataggcactg 120 actctctctg cctattggtc tattttccca cccttag 157 <210> 6 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Synthesized promoter elements <400> 6 gcccaggaag tacacgagaa gctccgagga ttggctgaag tccaacgtct ctgattgcgg 60 tggctcagag cacccgtatc attttggagg tgagtggctt tggttcccgg ctgaggtgga 120 gtgggctgag gactagactg agccctcgga catggaggtg gggatggggc agactcatcc 180 cattcttgac caagcccttg ttctgctccc ttcccaggct ctgtgactgg ggcaacctgc 240 aaggagctgg ccagccagcc tgacgtggac ggcttccttg tgggtggtgc ttccctcaag 300 cccgaattcg tggacatcat caacgccaaa caa 333 <210> 7 <211> 155 <212> DNA <213> Artificial Sequence <220> <223> Synthesized promoter elements <400> 7 gttgttcgct ttgataaact tccaggattc ggagacagta ttgaagctca ggtacagaaa 60 taatttcacc tttctttctc tttctattca gtgtggcaca tctgtaaacg ttcactcttc 120 acttagagac atcctcaacc aaatcaccaa accaa 155

Claims

1. A nucleic acid molecule composed of (a) and (b): (a) A first polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2; and (b) A second polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 4; (a) and (b) are connected sequentially in this order 5'-3', and the nucleic acid molecule is capable of promoting the transcription of operablely linked heterologous polynucleotides in mammalian cells.

2. A nucleic acid molecule is composed of (a), (b), and (c): (a) A first polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1; and (b) A second polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 4; and (c) A third polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 5; (a), (b) and (c) are connected sequentially in this order 5'-3', and the nucleic acid molecule is capable of promoting the transcription of operablely linked heterologous polynucleotides in mammalian cells.

3. An expression vector comprising a nucleic acid molecule according to any one of the preceding claims, wherein: (i) The expression vector is an adenovirus vector, pSV or pCMV plasmid vector, vaccinia vector or retrovirus vector, baculovirus vector or lentivirus vector; and / or (ii) The nucleic acid molecule is operatively linked to a heteropolynucleotide.

4. A mammalian host cell comprising the expression vector according to claim 3.

5. A kit comprising the expression vector according to claim 3 and / or the host cell according to claim 4, optionally and one or more other components selected from the group consisting of: (i) Helper plasmids; (ii) Viral genome plasmid; (iii) Buffer solution; (iv) Restriction enzymes; (v) Transfection medium; and (vi) Mammalian cells.

Citation Information

Patent Citations

  • Transcriptional regulatory elements of biological pathways tools, and methods

    US20090018031A1

  • Genetic element that enhances protein translation

    WO2013063348A1

  • Nucleic acid fragments from a ribosomal protein promoter for enhancing gene expression

    CN103180443A

  • Mammalian vectors for high-level expression of recombinant proteins

    WO2007081336A1