Compositions and methods for programming therapeutic cells using targeted nucleic acid nanocarriers

CN109121413BActive Publication Date: 2026-09-18弗莱德哈钦森癌症中心
View PDF 38 Cites 0 Cited by

Patent Information

Application Number
CN201780023532.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2017-01-05
Filing Date
2017-04-14
Publication Date
2026-09-18
Estimated Expiration
2037-04-14

AI Technical Summary

Technical Problem

然而,电穿孔依赖于细胞膜的机械破坏和透化,由此损害细胞的存活力,使得它们不太适合于治疗用途

Benefits of technology

[0009] The compositions and methods disclosed herein have numerous applications. Examples in cultured cells include editing the genome of hematopoietic cells (including hematopoietic stem cells) with targeted nucleases; imprinting therapeutically desired phenotypes in adoptive-transferred cells by transient expression of defined transcription factors; reducing cellular senescence in adoptive-transferred cells by expression of telomerase reverse transcriptase or anti-apoptotic genes; or altering their inherent cytotropy by expression of chemokine receptors. In situ examples include enhancing vaccine potency by co-injecting a nucleic acid-loaded vector that selectively transfects dendritic cells to enhance their antigen-presenting capacity; or transfecting vaccine-induced T cells to induce a longevity memory phenotype.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0001827279380000341
    Figure BDA0001827279380000341
  • Figure BDA0001827279380000351
    Figure BDA0001827279380000351
  • Figure BDA0001827279380000361
    Figure BDA0001827279380000361
Patent Text Reader

Abstract

Compositions and methods are described for rapidly and selectively modifying hematopoietic stem cells (or cells derived therefrom) for therapeutic purposes by providing transient expression of nucleic acids. Transient expression results in permanent therapeutic changes in the modified cells, referred to herein as a "hit and run" effect.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-reference of related applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 62 / 442,890, filed January 5, 2017, and U.S. Provisional Patent Application No. 62 / 322,581, filed April 14, 2016, the entire contents of which are incorporated herein by reference. Invention Field

[0003] This disclosure provides compositions and methods for rapidly and selectively modifying hematopoietic stem cells (or cells derived therefrom) for therapeutic purposes by providing transient expression of nucleic acids. The transient expression results in permanent therapeutic changes in the modified cells, referred to herein as the "hit-and-run" effect. The methods can be performed in cultured cells or in situ. Background of the Invention

[0005] Successful genetic therapies rely on gene delivery mechanisms that successfully enter selected cells of interest. Currently, viral systems (such as those utilizing lentiviral vectors) are the most common approach to achieving long-acting genetic therapies. These therapies depend on the sustained cellular expression of proteins with therapeutic value. While such viral systems can efficiently deliver genes for genetic therapy, they are non-selective, expensive, and not widely available. Furthermore, sustained expression of therapeutic proteins may decrease over time due to cellular events.

[0006] Electroporation has also been developed as a mechanism for delivering genes into cells for genetic therapy. However, electroporation relies on the mechanical disruption and permeation of the cell membrane, thereby impairing cell viability and making it less suitable for therapeutic applications. Furthermore, similar to virus-based methods, electroporation does not selectively deliver genes from a heterologous library to a specific cell type, therefore it must be performed after cell selection and purification processes. Summary of the Invention

[0007] This disclosure provides compositions and methods for rapidly and selectively modifying hematopoietic stem cells (or cells derived therefrom) for therapeutic purposes by providing transient expression of nucleic acids. Transient expression leads to permanent therapeutic changes in the modified cells, referred to herein as the "hit-and-run" effect. Because only transient expression is required to achieve a durable therapeutic effect, concerns about the degradation of therapeutic protein expression over time are overcome. Furthermore, because the compositions and methods selectively modify chosen cell types, no cell selection or purification process is required prior to modification. This accelerates the in vitro production of therapeutic cells and also allows for targeted genetic modification of cells in vivo.

[0008] The hit-and-run effect described herein is enabled by utilizing the transient expression of nucleic acids that lead to gene editing or transient expression of proteins that permanently alter cell phenotypes. Examples of nucleic acids that lead to gene editing include TALENs, megaTALS, zinc finger nucleases, and the CRISPR-Cas system. Examples of phenotype-altering proteins include transcription factors, kinases, and cell surface receptors.

[0009] The compositions and methods disclosed herein have numerous applications. Examples in cultured cells include editing the genome of hematopoietic cells (including hematopoietic stem cells) with targeted nucleases; imprinting therapeutically desired phenotypes in adoptive-transferred cells by transient expression of defined transcription factors; reducing cellular senescence in adoptive-transferred cells by expression of telomerase reverse transcriptase or anti-apoptotic genes; or altering their inherent cytotropy by expression of chemokine receptors. In situ examples include enhancing vaccine potency by co-injecting a nucleic acid-loaded vector that selectively transfects dendritic cells to enhance their antigen-presenting capacity; or transfecting vaccine-induced T cells to induce a longevity memory phenotype. Attached Figure Description

[0010] Many of the figures submitted herein offer a better understanding of color than was not available in the patent application publication at the time of filing. The applicant considers the color versions of the figures to be part of the original filing and reserves the right to present color images of the figures in subsequent proceedings.

[0011] Figure 1A-1C To generate mRNA nanocarriers for genetically programming therapeutic T cells. Figure 1A This illustration demonstrates how cultured T cells can be programmed to express therapeutically relevant transgenes carried by polymer nanoparticles. These particles are coated with ligands that target specific cell types, enabling them to deliver their mRNA cargo and cause the target cells to express selected proteins (similar to transcription factors or genome editing agents). Figure 1B Design of nanoparticles targeting and carrying mRNA. Insets show transmission electron micrographs of representative nanoparticles; scale bar, 50 nm. Synthetic mRNA encapsulated within the nanoparticles is also depicted. Figure 1C Examples of gene editing agents, phenotypic altering proteins, target genes, and their uses that can be used in the embodiments disclosed herein.

[0012] Figure 2 Flow cytometry antibody.

[0013] Figures 3A-3C Physical properties of mRNA-loaded nanoparticles. Figure 3A A finite orbital length adjusts the size distribution of individual particles. Figure 3BTransmission electron microscopy of a single nanoparticle (left, scale bar = 100 nm) and a group of nanoparticles (right, scale bar = 2 μm). Figure 3C The zeta potential of control nanoparticles (-PGA-Ab) compared to those nanoparticles coated with PGA bound to antibodies (+PGA-Ab) was measured after diluting them 1:40 in PBS pH 7.4 (n=5).

[0014] Figures 4A-4D mRNA nanoparticle transfection requires minimal cell handling and arrangement to express robust transgenes in lymphocytes without affecting their viability. Figure 4A Primary T cells were mixed with CD3-targeting polymer nanoparticles carrying Cy5-labeled mRNA. Confocal microscopy confirmed the rapid internalization of these particles from the cell surface. The images represent 15 randomly selected fields. Figure 4B Flow cytometry analysis of T cells incubated for 24 hours with CD3-targeting nanoparticles carrying eGFP-encoded mRNA. Figure 4C , Figure 4D A comparison of the effects of electroporation and nanoparticle gene delivery on cell expansion. The left panel shows the workflow of transfection with nanoparticles (top) and electroporation (bottom). The right panel shows the fold expansion of PBMC cultures from three independent donors treated with stimulation beads on days 0 and 12. Matched cultures from each donor were not treated with CD3 / CD28-targeted nanoparticles on days 5 and 12. Figure 4C (right) or through electroporation ( Figure 4D (Right) Treatment or transfection. Each line represents a donor, and each point reflects the fold expansion of T cells. Paired differences between groups were analyzed using Student's t-test; ns, not significant; *, significant, n=3).

[0015] Figure 5A , 5B Nanoparticle transfection is rapid and does not degrade with lyophilization. Figure 5A ) Measured 10 at 5 h after untreated or after adding NPs encoding eGFP with anti-CD3 targeting. 6 eGFP expression in activated T cells. Figure 5B The transfection efficiency of NP was maintained after lyophilization and resuspension. NP was transfected at 10 samples per condition (targeted by anti-CD3 or anti-CD8 antibodies). 6 1 activated T cell, wherein the NP is freshly prepared or freeze-dried, stored at -80°C, and then resuspended to its original volume.

[0016] Figure 6 Relative viability of nanoparticle-transfected and electroporated T cells. 2 × 10⁻⁶ cells per condition. 6A sample of activated T cells was untreated, transfected with NP, or as... Figure 2 Electroporation was performed as described in section C. Cells were labeled with fluorescent dyes 18 hours post-treatment to assess viability. The results shown here represent three independent experiments.

[0017] Figures 7A-7H Nanocarriers carrying mRNA encoding a megaTAL nuclease targeting TCRα can knock out T cell receptors in CAR-programmed lymphocytes. Figure 7A Nanoparticles were transfected and integrated into the normal fabrication of CAR-T cells. Following stimulation with anti-CD3 / CD28 coated beads (day 0), CD8-targeting mRNA NPs were introduced on days 1 and 2, followed by lentiviral transduction on day 3 using a vector encoding a leukemia-specific 19-41BBζCAR. NPs carrying mRNA encoding a megaTAL nuclease plus eGFP, or control particles loaded only with eGFP mRNA, were added. Figure 7B Flow cytometry analysis of NP transfection efficiency (based on eGFP signaling) correlated with the TCR surface expression level of T cells after NP treatment (based on CD3 signaling). Figure 7C The summary figure illustrates the editing efficiency as measured by the absence of CD3 surface expression on day 14 (n=5). Figure 7D Surveyor assays confirmed disruption of the TCRα chain locus. Figure 7E Genome-edited T cells compared to lentivirus-transduced flow cytometry in control T cells. Figure 7F Proliferation of TCR+ (control) and TCR- (mTAL Np-treated) CAR-T cells co-cultured on irradiated TM-LCL leukemia cells. Figure 7G This assay was used to determine the cytotoxicity of CD19-K562 target cells via CAR-T cell lysis. Figure 7H Intracellular cytokine expression of IL-2 and IFN-γ after stimulation with PMA and iomycin (P / I).

[0018] Figures 8A-8F Nanocarriers carrying mRNA encoding the Foxo13A transcription factor induce characteristic surface markers and transcriptional patterns in CD8+ central memory T cells. Figure 8A Total Foxo1 protein expression was measured in Jurkat and primary T cells treated with CD3-targeting control (GFP+) or Foxo13A-GFP NP by intracellular labeling. Figure 8BqPCR measurements of relative Foxo13A mRNA expression over time after cell exposure to Foxo13A-eGFP NP. Effect of CD8-targeted Foxo13A-GFP NP on CD62L expression after 24 h of particle treatment. Figure 8D The percentage of sorted CD8+eGFP+ cells treated with CD8-targeted control or Foxo13A / eGFP-encoded NP at days 1, 8, and 20 after particle introduction. These results were from three independent donors. *P < 0.05; **P < 0.01 between indicative conditions calculated by ratio-paired t-test. Figure 8E Heatmap of TCM tag gene expression in TCM, primary, and control cells 8 days after treatment. Figure 8F Volcano plot of differential gene expression in Foxo13A NP-treated cells after 8 days. TCM tag genes and selected memory phenotype genes are identified. The p-value of overlap between the Foxo13A and TCM tag gene sets was determined by GSEA (using...). Figure 9B (Analysis shown in the image).

[0019] Figure 9A , 9B Gene set enrichment revealed a strong correlation between TCM and cells treated with Foxo13A nanoparticles. Figure 9A A heatmap of TCM downtag gene expression in TCM, primary, and control cells 8 days after treatment. Figure 9B Gene set enrichment analysis of differentially expressed genes in Foxo13A NP-treated cells and control NP-treated cells in the TCM-up and TCM-down tag gene set test.

[0020] Figure 10A-10D mRNA nanocarriers can specifically transfect CD34+ human hematopoietic stem cells with minimal impact on amplification or phenotype. Figure 10A Targeting CD105 specifically transfected HSC CD34+ cells obtained from mobilized PBSCs. These cells were left untreated or transfected in NPs with mRNA encoding eGFP, the NPs being coated with PGA conjugated to a nonspecific control antibody (control Ab-eGFP NP) or anti-CD105 (α-CD105 NP). Transfection efficiency was determined by flow cytometry 24 h after NP exposure. Figure 10B NP transfection efficiency from CD34+ samples from three independent donors. Figure 10C After adding a control or CD105-targeted NP, CD34+ HSCs were amplified in vitro. Figure 10A Cells were transfected as described above, and the total cell count was assessed on days 0, 4, and 8 after particle exposure. Figure 10D After 8 days of culture, flow cytometry analysis was performed on the HSC markers CD34, CD133, and CD49f in untransfected cells (dashed lines) or cells treated with anti-CD105 mRNA (solid lines). The results showed that the addition of NP did not alter the surface expression of key stem cell markers.

[0021] Figure 11 Examples of supported sequences. Detailed Implementation

[0022] Successful genetic therapies rely on gene delivery mechanisms that successfully enter selected cells of interest. Currently, viral systems (such as those utilizing lentiviral vectors) are the most common approach to achieving long-acting genetic therapies. These therapies depend on the sustained cellular expression of proteins with therapeutic value. While such viral systems can efficiently deliver genes for genetic therapy, they are non-selective, expensive, and not widely available. Furthermore, sustained expression of therapeutic proteins may decrease over time due to cellular events.

[0023] Electroporation has also been developed as a mechanism for delivering genes into cells for genetic therapy. However, electroporation relies on the mechanical disruption and permeation of the cell membrane, thereby impairing cell viability and making it less suitable for therapeutic applications. Furthermore, similar to virus-based methods, electroporation does not selectively deliver genes from a heterologous library to a specific cell type, therefore it must be performed after cell selection and purification processes.

[0024] This disclosure provides compositions and methods for rapidly and selectively modifying cells for therapeutic purposes by providing transient expression of nucleic acids. Transient expression leads to permanent therapeutic changes in the modified cells, referred to herein as the "hit-and-run" effect. Because only transient expression is required to achieve a durable therapeutic effect, concerns about the degradation of therapeutic protein expression over time are overcome. Furthermore, because the compositions and methods selectively modify chosen cell types, no cell selection or purification process is required prior to modification. This accelerates the in vitro production of therapeutic cells and also allows for targeted genetic modification of cells in vivo.

[0025] The hit-and-run effect described herein is permitted by utilizing the transient expression of nucleic acids containing proteins that cause gene editing or transient expression that permanently alter cell phenotype. Examples of nucleic acids that cause gene editing include TALENs, megaTALS, zinc finger nucleases, and the CRISPR-Cas system. Examples of proteins that permanently alter cell phenotype include transcription factors, kinases, and cell surface receptors. Transient expression refers to the production of a recombinant gene product within a short period of time following the transfer of nucleic acid into the cell. In certain embodiments, transient expression lasts from 12 hours to 20 days; 18 hours to 18 days; 24 hours to 14 days; or 36 hours to 10 days. Cell phenotype refers to its physical characteristics and / or its location in the body.

[0026] The compositions and methods disclosed herein have numerous applications. Examples include editing the genome of lymphocytes (e.g., hematopoietic stem cells (HSCs)) with targeted nucleases; enhancing vaccine potency by co-injecting a nucleic acid-loaded vector that transfects dendritic cells to enhance their antigen-presenting ability; and transfecting vaccine-induced T cells to induce a longevity memory phenotype.

[0027] Specific embodiments include nanocarriers that can target specifically selected cells and achieve dose-controlled delivery of nucleic acids simply by mixing the nanocarriers with cells in vitro or within a subject. In a specific embodiment, the nanocarrier includes: (1) a selected cell-targeting ligand; (2) a carrier; and (3) nucleic acids within the carrier. Specific embodiments include nanocarriers that include (1) a selected cell-targeting ligand; (2) a carrier; (3) nucleic acids within the carrier; and (4) a coating.

[0028] In a particular embodiment, the selected cell-targeting ligand may include a surface-anchored targeting ligand that selectively binds the nanocarrier to selected cells and induces rapid receptor-induced endocytosis for internalization. As disclosed in more detail elsewhere herein, the selected cell-targeting ligand may include antibodies, scFv proteins, DART molecules, peptides, and / or aptamers. A particular embodiment utilizes anti-CD8 antibody transfection of human T cells and targets HSCs using antibodies recognizing CD34, CD133, or CD46.

[0029] In certain embodiments, the carrier comprises a carrier molecule that aggregates and protects nucleic acids from enzymatic degradation. As disclosed in more detail elsewhere herein, the carrier may comprise positively charged lipids and / or polymers. A particular embodiment uses poly(β-amino esters).

[0030] In certain embodiments, nucleic acids are encapsulated within a vector and, upon uptake by selected cells, express gene-editing agents and / or proteins that permanently alter the cell phenotype. As disclosed in more detail elsewhere herein, nucleic acids may include synthetic mRNAs expressing megaTAL or transcription factors. Certain embodiments utilize in vitro transcribed mRNAs (see, for example, Grudzien-Nogalska et al., Methods Mol. Biol. 969, 55-72 (2013)) that express (i) the transcription factor FOXO1, which induces memory CD8 T cells; or (ii) a rarely cleaved megaTAL nuclease (see, for example, Boissel and Scharenberg, Methods Mol. Biol. 1239, 171-196 (2015)) to disrupt T cell receptor expression in lymphocytes.

[0031] In certain embodiments, the nanocarriers disclosed herein include a coating that shields the encapsulated nucleic acid and reduces or prevents off-target binding. Off-target binding is reduced or prevented by lowering the surface charge of the nanocarrier to neutral or negative. As disclosed in more detail elsewhere herein, the coating may include a neutral or negatively charged polymer- and / or liposome-based coating. Certain embodiments utilize polyglutamic acid (PGA) as a nanocarrier coating. When used, the coating does not necessarily have to cover the entire nanocarrier, but must be sufficient to reduce off-target binding of the nanocarrier.

[0032] When the disclosed nanocarriers are incorporated into heterogeneous cell mixtures (e.g., in vitro cell cultures or in vivo environments), the engineered nanocarriers bind to selected cell populations and stimulate receptor-mediated endocytosis; this process provides access for the nucleic acids they carry (e.g., synthetic mRNA), and thus the selected cells begin to express the encoded molecules ( Figure 1A Because it does not require nuclear transport and transcription of transgenes, the process is rapid and efficient. Further applications of the nanocarriers can be pursued if desired, until the desired results are achieved. In a particular embodiment, the nanocarriers are biodegradable and biocompatible, and in ex vivo cell manufacturing, the modified cells can be easily separated from the unbound nanoparticles by centrifugation before being infused into a subject for treatment.

[0033] In a particular embodiment, rapid means that the expression of the encoded nucleic acid begins within a selected cell type within 24 hours or 12 hours of the exposure of a heterogeneous sample of the cell to the nanocarrier disclosed herein. This timeline can utilize nucleic acids such as mRNA, which begin transcription into the cytoplasm of the target cell almost immediately (e.g., within minutes).

[0034] In a particular embodiment, "effective" means that the gene is transferred to >80% of target cells (e.g., primary human T cells) and phenotypic modification occurs in at least 80%, at least 90%, or 100% of these cells. In a particular embodiment, "effective" means that the gene is transferred to >80% of target cells and phenotypic modification occurs in at least 25%, at least 33%, or at least 50% of these cells. In a particular embodiment, phenotypic modification can occur in one-third of the selected cells that have taken up the nanocarrier, wherein the delivered nucleic acid encodes a nuclease.

[0035] The alternative options and implementations of this disclosure are now described in more detail.

[0036] Selected cell-targeting ligands. The disclosed nanocarriers selectively bind to immune cells of interest within a heterogeneous cell population. In a particular embodiment, the immune cells of interest are lymphocytes. Lymphocytes include T cells, B cells, natural killer (NK) cells, monocytes / macrophages, and HSCs.

[0037] Several distinct subsets of T cells have been identified, each with different functions. In specific embodiments, selected cell-targeting ligands enable selective guidance of specific lymphocyte populations via receptor-mediated endocytosis. For example, most T cells possess a T-cell receptor (TCR) that exists as a complex of several proteins. The actual T-cell receptor consists of two separate polypeptide chains produced by independent T-cell receptor α and β (TCRα and TCRβ) genes, and are referred to as the α-TCR chain and the β-TCR chain. The selected cell-targeting ligands disclosed herein bind to the α-TCR chain and / or the β-TCR chain to achieve selective delivery of nucleic acids to these T cells.

[0038] γδT cells represent a small subset of T cells that possess different T cell receptors (TCRs) on their surface. In γδT cells, the TCR consists of a γ chain and a δ chain. This group of T cells is far less common than αβT cells (2% of all T cells). Nevertheless, the selected cell-targeting ligands disclosed herein bind to the γ-TCR chain and / or the δTCR chain to achieve selective delivery of nucleic acids to these T cells.

[0039] CD3 is expressed on all mature T cells. Therefore, the selected cell-targeting ligands disclosed herein bind to CD3 to achieve selective delivery of nucleic acids to all mature T cells. Activated T cells express 4-1BB (CD137), CD69, and CD25. Therefore, the selected cell-targeting ligands disclosed herein bind to 4-1BB, CD69, or CD25 to achieve selective delivery of nucleic acids to activated T cells. CD5 and transferrin receptors are also expressed on T cells and can be used to achieve selective delivery of nucleic acids to T cells.

[0040] T cells can be further divided into helper cells (CD4+ T cells) and cytotoxic T cells (CTLs, CD8+ T cells), which include cytolytic T cells. Helper T cells assist other leukocytes in the immune process, including the maturation of B cells into plasma cells, and the activation of cytotoxic T cells and macrophages. These cells are also called CD4+ T cells because they express the CD4 protein on their surface. Helper T cells are activated when they present peptide antigens via class II MHC molecules expressed on the surface of antigen-presenting cells (APCs). Once activated, they rapidly divide and secrete small proteins called cytokines, which regulate or contribute to an active immune response. The selected cell-targeting ligands disclosed herein bind to CD4 to achieve selective delivery of nucleic acids to T helper cells.

[0041] Cytotoxic T cells destroy virus-infected cells and tumor cells, and are also involved in transplant rejection. These cells are also called CD8+ T cells because they express the CD8 glycoprotein on their surface. These cells recognize their targets by binding to antigens associated with class I MHC, which are present on the surface of almost every cell in the body. The selected cell-targeting ligands disclosed herein bind to CD8 to achieve selective delivery of nucleic acids to CTLs.

[0042] As used herein, “central memory” T cells (or “TCMs”) refer to antigen-exposed CTLs that express CD62L or CCR7 and CD45RO on their surface and do not express CD45RA or have reduced CD45RA expression compared to primordial cells. In a particular embodiment, central memory cells are positive for the expression of CD62L, CCR7, CD25, CD127, CD45RO, and CD95 and have reduced CD45RA expression compared to primordial cells. The selected cell-targeting ligands disclosed herein can bind to CD62L, CCR7, CD25, CD127, CD45RO, and / or CD95 to achieve selective delivery of nucleic acids to TCMs.

[0043] As used herein, “effective memory” T cells (or “TEM”) refer to T cells that have experienced an antigen and do not express CD62L on their surface or have reduced CD62L expression compared to central memory cells, and do not express CD45RA or have reduced CD45RA expression compared to primordial cells. In certain embodiments, effector memory cells are negative for CD62L and CCR7 expression compared to primordial or central memory cells, and have variable expression of CD28 and CD45RA. Effector T cells are positive for granzyme B and perforin compared to memory or primordial T cells. The selected cell-targeting ligands disclosed herein can bind granzyme B and / or perforin to achieve selective delivery of nucleic acids to the TEM.

[0044] Regulatory T cells (“TREGs”) are a subset of T cells that regulate the immune system, maintain tolerance to self-antigens, and eliminate autoimmune diseases. TREGs express CD25, CTLA-4, GITR, GARP, and LAP. The selected cell-targeting ligands disclosed herein bind to CD25, CTLA-4, GITR, GARP, and / or LAP to achieve selective delivery of nucleic acids to primary TREGs.

[0045] As used herein, “primitive” T cells refer to T cells that have undergone non-antigen processing, express CD62L and CD45RA, and do not express CD45RO compared to central or effector memory cells. In a particular embodiment, primitive CD8+ T lymphocytes are characterized by the expression of primitive T cell phenotypic markers, including CD62L, CCR7, CD28, CD127, and CD45RA. The selected cell-targeting ligands disclosed herein can bind to CD62L, CCR7, CD28, CD127, and / or CD45RA to achieve selective delivery of nucleic acids to primitive T cells.

[0046] Natural killer cells (also known as NK cells, K cells, and killer cells) are activated in response to interferon or macrophage-derived cytokines. They are used to suppress viral infections, while the adaptive immune response generates antigen-specific cytotoxic T cells that can clear the infection. NK cells express CD8, CD16, and CD56 but not CD3. The selected cell-targeting ligands disclosed herein bind to CD8, CD16, and / or CD56 to achieve selective delivery of nucleic acids to NK cells.

[0047] Macrophages (and their precursors, monocytes) are present in every tissue of the body (and in some cases, microglia, Kupffer cells, and osteoclasts), where they engulf apoptotic cells, pathogens, and other non-self components. Because monocytes / macrophages engulf non-self components, specific macrophage or monocyte-directing agents are not required on the nanocarriers described herein for selective uptake by these cells. Alternatively, the selected cell-targeting ligands disclosed herein may bind to CD11b, F4 / 80; CD68; CD11c; IL-4Rα; and / or CD163 to achieve selective delivery of nucleic acids to monocytes / macrophages.

[0048] Immature dendritic cells (i.e., pre-activated) engulf surrounding antigens and other non-self components, and subsequently migrate in activated form to the T-cell regions of lymphoid tissue, where they present antigens to T cells. Therefore, similar to macrophages, dendritic cell targeting does not depend on selected cell-targeting ligands. When selected cell-targeting ligands are used to selectively target dendritic cells, they can bind to the following CD antigens: CD1a, CD1b, CD1c, CD1d, CD21, CD35, CD39, CD40, CD86, CD101, CD148, CD209, and DEC-205.

[0049] B cells are distinguished from other lymphocytes by the presence of the B cell receptor (BCR). The primary function of B cells is antibody production. B cells express CD5, CD19, CD20, CD21, CD22, CD35, CD40, CD52, and CD80. The selected cell-targeting ligands disclosed herein bind to CD5, CD19, CD20, CD21, CD22, CD35, CD40, CD52, and / or CD80 to achieve selective delivery of nucleic acids to B cells. Antibodies (IgM, IgG, IgA, IgE) targeting the isotype constant region of the B cell receptor can also be used to target B cell subtypes.

[0050] Lymphocyte function-associated antigen 1 (LFA-1) is expressed by all T cells, B cells, and monocytes / macrophages. Therefore, the selected cell-targeting ligands disclosed herein bind to LFA-1 to achieve selective delivery of nucleic acids to T cells, B cells, and monocytes / macrophages.

[0051] HSCs can also be targeted for selective delivery of the nanocarriers disclosed herein. HSCs express CD34, CD46, CD133, Sca-1, and CD117. The selected cell-targeting ligands disclosed herein can bind to CD34, CD46, CD133, Sca-1, and / or CD117 to achieve selective delivery of nucleic acids to hematopoietic stem cells.

[0052] "Selective delivery" means that nucleic acids are delivered and expressed by one or more selected populations of lymphocytes. In certain embodiments, selective delivery is limited to selected populations of lymphocytes. In certain embodiments, at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the administered nucleic acid is delivered and / or expressed by selected populations of lymphocytes. In certain embodiments, selective delivery ensures that non-lymphocytes do not express the delivered nucleic acid. For example, when the target is a T-cell receptor (TCR) gene, selectivity is ensured because only T cells have the ζ-chain required for TCR expression. Selective delivery may also be based on the lack of nucleic acid uptake into unselected cells or on the presence of a specific promoter within the nucleic acid sequence. For example, transiently expressed nucleic acids may include a T-cell-specific CD3-δ promoter. Other promoters that enable selective delivery include: mouse stem cell virus promoters or distal lck promoters for T cells or HSCs; CD45 promoters, WASP promoters or IFN-β promoters for HSCs; B29 promoters for B cells; or CD14 promoters or CD11b promoters for monocytes / macrophages.

[0053] As indicated, the selected cell-targeting ligand may include a binding domain for motifs found on lymphocytes. The selected cell-targeting ligand may also include any selective binding mechanism that allows selective uptake into lymphocytes. In a particular embodiment, the selected cell-targeting ligand includes a binding domain for: T cell receptor motifs; T cell α chain; T cell β chain; T cell γ chain; T cell δ chain; CCR7; CD1a; CD1b; CD1c; CD1d; CD3; CD4; CD5; CD7; CD8; CD11b; CD11c; CD16; CD19; CD20; CD21; CD22; CD25; CD28; CD34; CD35; CD39; CD40; CD45RA; CD45RO; CD46; CD52; CD56; CD62L; CD68; CD80; CD86; CD95; CD101; CD117; CD127; CD133; CD137(4-1BB); CD148; CD163; F4 / 80; IL-4Rα; Sca-1; CTLA-4; GITR; GARP; LAP; Granulase B; LFA-1; Transferrin receptor; and combinations thereof.

[0054] In certain embodiments, the binding domain includes cell-labeling ligands, receptor ligands, antibodies, peptides, peptide aptamers, nucleic acids, nucleic acid aptamers, spiegelmers, or combinations thereof. In the context of a selected cell-targeting ligand, the binding domain includes any substance that binds to another substance to form a complex capable of mediating endocytosis.

[0055] An "antibody" is an instance of a binding domain and includes either a complete antibody or a binding fragment of an antibody, such as Fv, Fab, Fab′, F(ab′)2, Fc, and single-chain Fv fragments (scFv), or any biologically effective fragment of an immunoglobulin that specifically binds to a motif expressed by lymphocytes. Antibody or antigen-binding fragments include all or part of polyclonal antibodies, monoclonal antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, bispecific antibodies, small bodies, and linear antibodies.

[0056] Human-derived antibodies or humanized antibodies have reduced or no immunogenicity in humans compared to non-human antibodies, and have a lower number of non-immunogenic epitopes. Antibodies and their fragments are typically selected to have reduced levels or no antigenicity in human subjects.

[0057] Methods for obtaining monoclonal antibodies, phage display methods, methods for generating human or humanized antibodies, or methods using transgenic animals or plants engineered to produce antibodies as known to those skilled in the art can be used to prepare antibodies that specifically bind to motifs expressed by lymphocytes (see, for example, U.S. Patent Nos. 6,291,161 and 6,291,158). Phage display libraries of partially or fully synthesized antibodies are available, and antibodies or fragments thereof that can bind to lymphocyte motifs can be screened. For example, binding domains can be identified by screening Fab phage libraries to find Fab fragments that specifically bind to targets of interest (see Hoet et al., Nat. Biotechnol. 23:344, 2005). Phage display libraries of human antibodies are also available. Additionally, in convenient systems (e.g., mice, HuMAb...), phage display libraries can be prepared. TC mouse TM , Traditional strategies for hybridoma development using targets of interest as immunogens (such as llamas, chickens, rats, hamsters, and rabbits) can be used to develop binding domains. In specific implementations, antibodies specifically bind to motifs expressed by selected lymphocytes and do not cross-react with nonspecific components or unrelated targets. Once identified, the amino acid or nucleic acid sequence encoding the antibody can be isolated and / or determined.

[0058] In a specific embodiment, the binding domain of the selected cell-targeting ligand includes T cell receptor motif antibodies; T cell α-chain antibodies; T cell β-chain antibodies; T cell γ-chain antibodies; T cell δ-chain antibodies; CCR7 antibodies; CD1a antibodies; CD1b antibodies; CD1c antibodies; CD1d antibodies; CD3 antibodies; CD4 antibodies; CD5 antibodies; CD7 antibodies; CD8 antibodies; CD11b antibodies; CD11c antibodies; CD16 antibodies; CD19 antibodies; CD20 antibodies; CD21 antibodies; CD22 antibodies; CD25 antibodies; CD28 antibodies; CD34 antibodies; CD35 antibodies; CD39 antibodies; CD Antibodies such as CD40, CD45RA, CD45RO, CD46, CD52, CD56, CD62L, CD68, CD80, CD86, CD95, CD101, CD117, CD127, CD133, CD137(4-1BB), CD148, CD163, F4 / 80, IL-4Rα, Sca-1, CTLA-4, GITR, GARP, LAP, granzyme B, LFA-1, or transferrin receptor antibodies. These binding domains may also be composed of scFv fragments of the aforementioned antibodies.

[0059] Peptide aptamers consist of peptide loops (specific to the target protein) attached to both ends of a protein scaffold. This dual structural constraint significantly increases the binding affinity of the aptamer to levels comparable to antibodies. The variable loop length is typically 8 to 20 amino acids (e.g., 8 to 12 amino acids), and the scaffold can be any stable, soluble, small, and non-toxic protein (e.g., thioredoxin-A, Stefin A triple mutant, green fluorescent protein, eglin C, and the cellular transcription factor Spl). Peptide aptamer selection can be performed using various systems, such as the yeast two-hybrid system (e.g., the Gal4 yeast two-hybrid system) or the LexA interaction trapping system.

[0060] Nucleic acid aptamers are single-stranded nucleic acid (DNA or RNA) ligands that function by folding into a specific globular structure, which determines their binding to target proteins or other molecules with high affinity and specificity, as described by Osborne et al., Curr. Opin. Chem. Biol. 1: 5-9, 1997; and Cerchia et al., FEBS Letters 528: 12-16, 2002. In certain embodiments, aptamers are small (15 kDa; or between 15-80 nucleotides or 20-50 nucleotides). Aptamers are typically obtained from 10... 14 -10 15Isolation from a library of random oligonucleotide sequences (exponentially enriched ligand phylogenetic techniques; see, for example, Tuerk et al., Science, 249: 505-510, 1990; Green et al., Methods Enzymology, 75-86, 1991; and Gold et al., Annu. Rev. Biochem., 64: 763-797, 1995). Other methods for generating aptamers are described, for example, in U.S. Patent Nos. 6,344,318; 6,331,398; 6,110,900; 5,817,785; 5,756,291; 5,696,249; 5,670,637; 5,637,461; 5,595,877; 5,527,894; 5,496,938; 5,475,096; and 5,270,16. Spiegelmer is similar to a nucleic acid aptamer except that at least one β-ribose unit is replaced by a modified sugar unit selected from, for example, β-D-ribose, α-D-ribose, or β-L-ribose.

[0061] Other agents that can promote lymphocyte internalization and / or transfection of lymphocytes may also be used, such as poly(ethyleneimine) / DNA (PEI / DNA) complexes.

[0062] Carriers. As noted, the disclosed nanocarriers serve to aggregate and protect nucleic acids from enzymatic degradation. Particularly useful materials as carriers include positively charged lipids and / or polymers, including poly(β-amino esters).

[0063] Other examples of positively charged lipids include esters of phosphatidic acids and amino alcohols, such as esters of dipalmitoyl phosphatidic acid or distearate phosphatidic acid and hydroxyethyl ethylenediamine. More specific examples of positively charged lipids include 3β-[N-(N′,N′-dimethylaminoethyl)carbamoyl)cholesterol (DC-chol); N,N′-dimethyl-N,N′-dioctylammonium bromide (DDAB); N,N′-dimethyl-N,N′-dioctylammonium chloride (DDAC); 1,2-dioleoyloxypropyl-3-dimethyl-hydroxyethylammonium chloride (DORI); 1,2-dioleoyloxy-3-[trimethylammonium]-propane (DOTAP); N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA); dipalmitoylphosphatidylcholine (DPPC); 1,2-octadecyloxy-3-[trimethylammonium]-propane (DSTAP); and cationic lipids described, for example, in Martin et al., Current Pharmaceutical Design 2005, 11, 375-394.

[0064] Examples of positively charged polymers that can be used as carriers in this disclosure include polyamines; polyorganic amines (e.g., polyethyleneimine (PEI), polyethyleneimine cellulose); poly(acylaminoamine) (PAMAM); polyamino acids (e.g., polylysine (PLL), polyarginine); polysaccharides (e.g., cellulose, dextran, DEAE dextran, starch); spermine, spermidine, poly(vinylbenzyltrialkylammonium), poly(4-vinyl-N-alkyl-pyridinium), poly(acryloyl-trialkylammonium), and Tat proteins.

[0065] Blends of lipids and polymers at any concentration and in any ratio can also be used. Blending different polymer types in different grades and ratios can result in characteristics borrowed from each contributing polymer. A variety of terminal group chemistry can also be employed.

[0066] Without limiting the foregoing, specific embodiments disclosed herein may also utilize porous nanoparticles constructed from any material capable of forming porous networks. Exemplary materials include metals, transition metals, and metalloids. Exemplary metals, transition metals, and metalloids include lithium, magnesium, zinc, aluminum, and silica. In specific embodiments, the porous nanocarrier comprises silica. The particularly high surface area (over 1,000 m² / g) of mesoporous silica allows nucleic acid loading to exceed levels found in conventional DNA carriers such as liposomes.

[0067] The carrier can be formed in various shapes, including spherical, cubic, pyramidal, elliptical, cylindrical, and toroidal. Nucleic acids can be contained within the pores of the carrier in multiple ways. For example, nucleic acids can be encapsulated within porous nanocarriers. In other respects, nucleic acids can be associated with the surface of the porous nanocarrier (e.g., covalently and / or non-covalently) or closely adjacent to the underside of the porous nanocarrier surface. In certain embodiments, nucleic acids can be incorporated into the porous nanocarrier, for example, integrated into the material of the porous nanocarrier. For example, nucleic acids can be incorporated into the polymer matrix of a polymer nanocarrier.

[0068] Coating. In certain embodiments, the nanocarriers disclosed herein include coatings that shield the encapsulated nucleic acids and reduce or prevent off-target binding. Off-target binding is reduced or prevented by lowering the surface charge of the nanocarrier to neutral or negatively charged. As disclosed in more detail elsewhere herein, the coating may comprise a neutral or negatively charged polymer- and / or liposome-based coating. In certain embodiments, the coating is a dense surface coating of a hydrophilic and / or neutrally charged hydrophilic polymer sufficient to prevent the encapsulated nucleic acids from being exposed to the environment prior to release into selected cells. In certain embodiments, the coating covers at least 80% or at least 90% of the surface of the nanocarrier. In certain embodiments, the coating comprises polyglutamic acid (PGA).

[0069] Examples of neutrally charged polymers that can be used as coatings in embodiments of this disclosure include polyethylene glycol (PEG); poly(propylene glycol); and polyepoxide copolymers. BASF Corp., Mount Olive, NJ).

[0070] Neutral-charged polymers also include zwitterionic polymers. Zwitterions are characterized by an overall neutral charge, possessing both positive and negative charges. Zwitterionic polymers can behave similarly to cell membrane regions that resist cell and protein adhesion.

[0071] Amphoteric polymers include zwitterionic structural units comprising side groups having zwitterionic groups (i.e., groups attached to the side of the polymer backbone). Exemplary zwitterionic side groups include carboxybetaine groups (e.g., -Ra-N+(Rb)(Rc)-Rd-CO2-, where Ra is a linking group covalently coupling the polymer backbone to the cationic nitrogen center of the carboxybetaine group, Rb and Rc are nitrogen substituents, and Rd is a linking group covalently coupling the cationic nitrogen center to the carboxyl group of the carboxybetaine group).

[0072] Examples of negatively charged polymers include alginate; carboxylic acid polysaccharides; carboxymethyl cellulose; carboxymethyl cellulose-cysteine; carrageenan (e.g., 209 379); chondroitin sulfate; glycosaminoglycans; mucopolysaccharides; negatively charged polysaccharides (e.g., dextran sulfate); poly(acrylic acid); poly(D-aspartic acid); poly(L-aspartic acid); sodium poly(L-aspartic acid); poly(D-glutamic acid); poly(L-glutamic acid); sodium poly(L-glutamic acid); poly(methacrylic acid); sodium alginate (e.g., LF 120M LF 200M LF 200D); sodium carboxymethyl cellulose (CMC); sulfated polysaccharides (heparin, agarose); pectin, gelatin and hyaluronic acid.

[0073] In certain embodiments, the polymers disclosed herein may include “star polymers,” which refer to branched polymers from which two or more polymer branches extend from a core. The core is a group of atoms having two or more functional groups from which the branches can extend by polymerization.

[0074] In certain embodiments, the branches are zwitterionic or negatively charged polymer branches. For star polymers, the branched precursor can be converted into a zwitterionic or negatively charged polymers by hydrolysis, ultraviolet irradiation, or heating. The polymer can also be obtained by any polymerization method that efficiently polymerizes unsaturated monomers, including atom transfer radical polymerization (ATRP), reversible addition-fragmentation chain transfer polymerization (RAFT), photopolymerization, ring-opening polymerization (ROP), condensation, Michael addition, branching / proliferation reactions, or other reactions.

[0075] Liposomes are microscopic vesicles comprising at least one concentric lipid bilayer. The lipids forming the vesicles are selected to achieve a specific degree of fluidity or rigidity in the final complex. In a particular embodiment, the liposomes provide a lipid composition that surrounds the outer layer of porous nanoparticles.

[0076] Liposomes can be neutral (cholesterol) or bipolar and include phospholipids (such as phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and sphingomyelin (SM)) and other types of bipolar lipids, including dioleoylphosphatidylethanolamine (DOPE), having hydrocarbon chain lengths in the range of 14-22 and being saturated or having one or more double C=C bonds. Examples of lipids that can form stable liposomes alone or in combination with other lipid components are phospholipids, such as hydrogenated soybean phosphatidylcholine (HSPC), lecithin, phosphatidylethanolamine, lysophosphatidylcholine, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, cephalin, cardiolipin, phosphatidic acid, cerebroside, distearate phosphatidylethanolamine (DSPE), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), and dioleoylphosphatidylethanolamine 4-(N-maleimide-methyl)cyclohexane-1-carboxylic acid ester (DOPE-mal). Other phosphorus-free lipids that can be incorporated into liposomes include stearylamine, dodecylamine, hexadecylamine, isopropyl myristate, triethanolamine dodecyl sulfate, alkyl aryl sulfate, acetyl palmitate, glyceryl ricinoleate, hexadecyl stearate, amphoteric acrylic polymers, polyethoxylated fatty acid amides, DDAB, DODAC, 1,2-di-myristoyl-3-trimethylammonium propane (DMTAP), DOTAP, DOTMA, DC-Chol, phosphatidic acid (PA), dipalmitoyl phosphatidylglycerol (DPPG), dioleoyl phosphatidylglycerol (DOPG), and dicetyl phosphate. In certain embodiments, lipids used to generate the liposomes disclosed herein include cholesterol, hydrogenated soybean phosphatidylcholine (HSPC), and derived vesicle-forming lipids PEG-DSPE.

[0077] Methods for forming liposomes are described, for example, in U.S. Patent Nos. 4,229,360; 4,224,179; 4,241,046; 4,737,323; 4,078,052; 4,235,871; 4,501,728; and 4,837,028, as well as in Szoka et al., Ann. Rev. Biophys. Bioeng. 9:467 (1980) and Hope et al., Chem. Phys. Lip. 40:89 (1986).

[0078] Nucleic acids. The nucleic acids used in the nanocarriers disclosed herein can transiently express gene-editing agents and / or phenotypic altering proteins that regulate cell fate, differentiation, viability, and / or transport (see, for example...). Figure 1B , 1C ).

[0079] In certain embodiments, the nucleic acid includes synthetic mRNA. In certain embodiments, 5′-capping is used to engineer the synthetic mRNA to increase intracellular stability. A variety of different 5′-cap structures can be used to generate the 5′-cap of the synthetic mRNA molecule. For example, the anti-reverse cap analog (ARCA) cap contains a 5′-5′-guanine triphosphate-guanine bond, where one of the guanine nucleotides contains an N7 methyl group and a 3′-O-methyl group. The synthetic mRNA molecule can also be capped post-transcriptionally using enzymes responsible for generating the 5′-cap structure. For example, recombinant vaccinia virus capping enzymes and recombinant 2′-O-methyltransferases can form a canonical 5′-5′-triphosphate bond between the 5′-most nucleotide of the mRNA and the guanine nucleotide, wherein the guanine contains an N7 methyl group and the final 5′-nucleotide contains a 2′-O-methyl group that generates the Cap1 structure. This results in a cap with higher translational efficiency and cellular stability, as well as reduced activation of pro-inflammatory cytokines.

[0080] Synthetic mRNA or other nucleic acids can also be circular. Circularization or concatenation of synthetic mRNA can generate translationally capable molecules that facilitate the interaction between poly-A binding proteins and 5′-terminal binding proteins. Circularization or concatenation can occur through at least three different pathways: 1) chemical, 2) enzymatic, and 3) ribozyme catalysis. The newly formed 5′ / 3′ bonds can be intramolecular or intermolecular.

[0081] In the first approach, the 5′ and 3′ ends of the nucleic acid may contain chemically reactive groups that, when brought close together, form new covalently linked groups between the 5′ and 3′ ends of the molecule. The 5′ end may contain an NHS-ester reactive group, and the 3′ end may contain a 3′-amino-terminated nucleotide. This allows the 3′-amino-terminated nucleotide at the 3′ end of the mRNA molecule synthesized in an organic solvent to undergo nucleophilic attack on the 5′-NHS-ester moiety, thereby forming a new 5′- / 3′-amide bond.

[0082] In the second approach, T4 RNA ligase can be used to enzymatically link 5′-phosphorylated nucleic acid molecules to the 3′-hydroxyl group of nucleic acids, thereby forming a novel phosphodiester bond. In an example reaction, 1 μg of nucleic acid molecule can be incubated with 1 to 10 units of T4 RNA ligase (New England Biolabs, Ipswich, Mass.) at 37°C for 1 hour, depending on the manufacturer's protocol. The ligation reaction can occur in the presence of isolated oligonucleotides capable of pairing with both the juxtaposed 5′- and 3′-regions to facilitate the enzymatic ligation reaction.

[0083] In the third approach, the 5′ or 3′ end of the cDNA template encodes a ligase ribozyme sequence, allowing the resulting nucleic acid molecule to contain an active ribozyme sequence capable of ligating the 5′ end of the nucleic acid molecule to the 3′ end during in vitro transcription. The ligase ribozyme can be derived from group I introns, hepatitis D virus, hairpin ribozymes, or can be selected using SELEX (Scientific Evolutionary Ligand Systematization). The ribozyme ligase reaction can be carried out at temperatures between 0°C and 37°C for 1 to 24 hours.

[0084] In certain embodiments, nucleic acids include plasmids, cDNA, or mRNA, which may include, for example, sequences (e.g., genes) for expressing gene-editing agents or phenotypic altering proteins. Suitable plasmids include standard plasmid vectors and small circular plasmids that can be used to transfer genes into lymphocytes. Nucleic acids (e.g., small circular plasmids) may also include any additional sequence information to facilitate transient expression in selectively modified cells. For example, nucleic acids may include promoters, such as universal promoters, tissue-specific promoters, cell-specific promoters, and / or cytoplasm-specific promoters. As noted, promoters and plasmids (e.g., small circular plasmids) are generally well known in the art and can be prepared using conventional techniques.

[0085] As used herein, the term "gene" refers to a nucleic acid sequence encoding a gene-editing agent or phenotypic protein. This definition includes various sequence polymorphisms, mutations, and / or sequence variants, wherein such alterations do not affect the function of the gene-editing agent or phenotypic protein. The term "gene" may include not only coding sequences but also regulatory regions, such as promoters, enhancers, and termination regions. The term may also include all introns and other DNA sequences spliced ​​from mRNA transcripts, along with variants resulting from alternative splicing sites. The nucleic acid sequence encoding a gene-editing agent or phenotypic protein may be RNA that directs the expression of the gene-editing agent or phenotypic protein. These nucleic acid sequences include RNA sequences translated into proteins in a particular embodiment. Nucleic acid sequences include both full-length nucleic acid sequences and non-full-length sequences derived from full-length proteins. Sequences may also include degenerate codons of the native sequence or sequences that may be introduced to provide codon preference in a particular lymphocyte. Gene sequences encoding the gene-editing agents or phenotypic proteins disclosed herein are available in publicly available databases and publications. As used in this article, the term “coding” refers to the property of a sequence of nucleic acids (e.g., plasmids, genes, cDNA, mRNA) that serves as a template for the synthesis of gene-editing agents or phenotypic proteins.

[0086] Gene editing agents. As used herein, gene editing agents comprise expression products of transient nucleic acid expression as described herein, which modify or affect specific sequences of the endogenous genome of selected cells. In a particular embodiment, the modification includes the removal or disruption of an endogenous gene such that the protein encoded by the endogenous gene is no longer expressed, expressed at a reduced level, expressed as an incomplete protein, an unstable protein, a misfolded protein, and / or a nonfunctional protein. In a particular embodiment, the effect is achieved by reducing protein expression through an RNA interference mechanism. Therefore, gene editing agents can be used for genome editing, such as gene disruption, gene editing via homologous recombination, and gene therapy to insert therapeutic genes at appropriate chromosomal target sites having a human genome.

[0087] Specific implementations utilize transcription activator-like effector nucleases (TALENs) as gene editing agents. TALENs are fusion proteins that consist of a transcription activator-like effector (TALE) DNA-binding protein and a DNA cleavage domain. TALENs are used to edit genes and the genome by inducing double-strand breaks (DSBs) in DNA, which in turn induce repair mechanisms in cells. Typically, two TALENs must bind and side-joint each side of the target DNA site so that the DNA cleavage domain dimerizes and induces DSBs. DSBs are repaired in cells using exogenous double-stranded donor DNA fragments via non-homologous end joining (NHEJ) or homologous recombination (HR).

[0088] As noted, TALEN has been engineered to bind to target sequences, such as those in the endogenous genome, and to cleave DNA at the location of the target sequence. TALEN's TALE is a DNA-binding protein secreted by bacteria of the genus *Xanthomonas*. The DNA-binding domain of TALE consists of a highly conserved 33 or 34-amino acid repeat, with different residues at positions 12 and 13 of each repeat. These two positions, called repeat variable instructions (RVDs), show a strong correlation with the recognition of specific nucleotides. Therefore, targeting specificity can be improved by altering the amino acids in the RVD and incorporating unconventional RVD amino acids.

[0089] Examples of DNA cleavage domains that can be used in TALEN fusions are wild-type and variant FokI endonucleases. The FokI domain acts as a dimer, requiring two constructs with unique DNA-binding domains for the target sequence site. The FokI cleavage domain cuts within a five- or six-base-pair spacer sequence, separating the two inverted halves.

[0090] A specific implementation utilizes MegaTAL as a gene-editing agent. MegaTAL possesses a single-stranded rare cleavage nuclease structure, in which TALE is fused to the DNA cleavage domain of a macronuclease. Macronucleases, also known as homing endonucleases, are single-peptide chains that possess both DNA recognition and nuclease functions within the same domain. Unlike TALEN, megaTAL only requires the delivery of a single peptide chain for functional activity. Exemplary megaTAL proteins specific to TCRα are used as... Figure 11 SEQ ID NO: 1 is provided.

[0091] One specific implementation utilizes zinc finger nucleases (ZFNs) as gene editing agents. ZFNs are a class of site-specific nucleases engineered to bind to and cleave DNA at specific locations. ZFNs are used to introduce double-strand breaks (DSBs) at specific sites in the DNA sequence, allowing them to target unique sequences within the genome of a variety of different cells. Furthermore, following a double-strand break, homologous recombination or non-homologous end joining occurs to repair the DSB, thereby achieving genome editing.

[0092] ZFNs are synthesized by fusing zinc finger DNA-binding domains with DNA-cleaving domains. The DNA-binding domains consist of three to six zinc finger proteins that are transcription factors. The DNA-cleaving domains include, for example, the catalytic domain of a FokI endonuclease.

[0093] For example, guide RNA can be used with gene editing agents such as the CRISPR-Cas system. The CRISPR-Cas system consists of a CRISPR repeat sequence and a set of CRISPR-related genes (Cas).

[0094] CRISPR repeats (clustered, regularly spaced short palindromic repeats) consist of clusters of short, unidirectional repeats separated by spacers of short, variable sequences similar in size to the repeat sequences. The repeats range in size from 24 to 48 base pairs and exhibit some degree of double symmetry, meaning they can form secondary structures (such as hairpins), although they are not true palindromes. The spacers separating the repeats perfectly match the sequences of prokaryotic viruses, plasmids, and transposons. Cas genes encode nucleases, helicases, RNA-binding proteins, and polymerases that unwind and cleave DNA. Cas1, Cas2, and Cas9 are examples of Cas genes.

[0095] The origin of CRISPR spacers suggests that the CRISPR-Cas system plays a role in bacterial adaptive immunity. At least three types of CRISPR-Cas immune system responses exist, and the Cas1 and Cas2 genes are involved in spacer acquisition in all three. Spacer acquisition involves capturing invading viral DNA and inserting it into a CRISPR locus, which occurs in the first phase of adaptive immunity. More specifically, spacer acquisition begins with Cas1 and Cas2 recognizing the invading DNA and cleaving the prototype spacer, which is then linked to a homologous repeat sequence adjacent to the leader sequence. This is followed by single-strand extension repair and the repeating of the homologous repeat sequence.

[0096] The next stage of CRISPR-associated adaptive immunity involves CRISPR RNA (crRNA) biogenesis, which occurs differently in each type of CRISPR-Cas system. Typically, during this stage, the CRISPR transcript is cleaved by the Cas gene to produce crRNA. In type I systems, Cas6e / Cas6f cleaves the transcript. Type II systems use trans-activated (tracr) RNA to form dsRNA, which is cleaved by Cas9 and RNase III. Type III systems use Cas6 homologs for cleavage.

[0097] In the final stage of CRISPR-associated adaptive immunization, processed crRNA associates with Cas proteins to form an interference complex. In type I and II systems, the Cas protein interacts with the prototype spacer adjacent motif (PAM), a short 3-5 bp DNA sequence used to degrade invading DNA, while in the type III system, interaction with the PAM for degradation is not required. In the type III-B system, crRNA base pairs degrade mRNA rather than the target DNA.

[0098] Therefore, the CRISPR-Cas system acts as an RNAi-like immune system in prokaryotes. CRISPR-Cas technology has been used to inactivate genes in human cell lines and cells. For example, the CRISPR-Cas9 system, based on the type II system, has been used as a reagent for genome editing.

[0099] The type II system requires three components: Cas9, crRNA, and tracrRNA. The system can be simplified by combining tracrRNA and crRNA into a single synthetic guide RNA (sgRNA).

[0100] At least three different Cas9 nucleases have been developed for genome editing. The first is wild-type Cas9, which introduces DSB at specific DNA sites, leading to activation of the DSB repair mechanism. DSB can be repaired via the NHEJ pathway or via the homology-directed repair (HDR) pathway. The second is a mutant Cas9, called Cas9D10A, which possesses only cleavage enzyme activity, meaning it cleaves only one DNA strand and does not activate NHEJ. Therefore, DNA repair occurs only via the HDR pathway. The third is nuclease-deficient Cas9 (dCas9), which lacks cleavage activity but can bind to DNA. Therefore, dCas9 can target specific sequences in the genome without cleavage. By fusing dCas9 with various effector domains, dCas9 can be used as a tool for gene silencing or activation.

[0101] Gene editing agents that can target a wide range of genes for selective delivery by the nanocarriers disclosed herein. Specific examples include those targeting the Shp1 phosphatase gene (e.g., SEQ ID NO: 2), the PD1 receptor gene (e.g., SEQ ID NO: 3), the TCRα gene (e.g., SEQ ID NO: 4), the CCR5 gene (e.g., SEQ ID NO: 5), and / or the CXCR4 gene (e.g., SEQ ID NO: 6).

[0102] Shp-1 (Src homology 2-containing phosphatase-1; also known as tyrosine protein phosphatase non-receptor type 6 (PTPN6)) is encoded by the human PTPN6 gene. The N-terminal portion of Shp-1 contains two Src homology (SH2) domains, which act as protein phosphotyrosine binding domains, interacting with other cellular components to regulate their substrate interactions. Shp-1 plays a crucial role as a regulator of multiple signaling pathways involved in hematopoiesis and interacts with various phosphoproteins involved in hematopoietic cell signaling. Shp-1 connects to growth factor receptors, such as EPO, IL-3, GM-CSF, and M-CSF receptors, as well as other signaling proteins, via protein-tyrosine phosphorylation. Shp-1 also mediates inhibitory signals triggered by the immunoglobulin γFc domain (FcVRIIB1), NK cell inhibitory receptor, T cell receptor (TCR), B cell receptor (BCR), CD22, and CD72. Alternative splicing variants of the PTPN6 gene exist, encoding different isotypes. Exemplary nucleic acid sequences encoding mammalian Shp-1 can be found at the following GenBank accession numbers: NM_080549, NM_053908.1, and NM_013545.

[0103] The specific embodiments disclosed herein include targeting the Shp1 phosphatase gene to alter T cell signaling. Shp1 phosphatase activity limits the functional activity of high-affinity T cell receptors, thereby impairing the therapeutic use of these receptors for targeting rare or low-affinity tumor antigens (Hebeisen M et al., SHP-1 phosphatase activity counteracts increased T cell receptor affinity. JCI. 2013). Furthermore, Shp1 activity is associated with impaired antitumor activity of T cell therapy products in solid tumors (Moon EK et al., Multifactorial T-cell Hypofunction ThatIs Reversible Can Limit the Efficacy of Chimeric Antigen Receptor-Transduced Human T cells in Solid Tumors, Clinical Cancer Research, 2014). For these reasons, downregulation of Shp1 can enhance the specific recognition and functional activity of T cells and therapeutic T cell products.

[0104] PD-1 (programmed cell death protein 1; also known as differentiation cluster 279 (CD279)) is a cell surface receptor belonging to the immunoglobulin superfamily. It is expressed on the surface of activated T cells, B cells, and macrophages and is encoded by the PDCD gene in humans. Structurally, PD-1 comprises an extracellular IgV domain, a transmembrane region, and an intracellular tail. The intracellular tail includes two phosphorylation sites located in an immunoreceptor-tyrosine-based inhibitory motif and an immunoreceptor-tyrosine-based switch motif, indicating that PD-1 is involved in the negative regulation of TCR signaling. PD-1 is an immune checkpoint. It negatively regulates the immune system by blocking T cell activation, thereby reducing autoimmunity and promoting self-tolerance. PD-1 functions by promoting apoptosis of antigen-specific T cells in lymph nodes while reducing apoptosis in regulatory T cells (suppressive T cells). PD-1 binds to ligands PD-L1 and PD-L2. Exemplary nucleic acid sequences encoding mammalian PD-1 can be found at the following Genbank accession numbers: AY238517, NM_001106927, and KJ865858.

[0105] The specific implementation methods disclosed herein include targeting the PD1 receptor gene. PD1 antibody blockade has demonstrated strong therapeutic efficacy, but may also lead to immune-related adverse events affecting the gastrointestinal tract, liver, endocrine system, and other organs (Postow MA, Managing Immune Checkpoint-Blocking Antibody Side Effects, ASCO, 2015). By selectively removing or reducing PD1 receptor expression on infused therapeutic T cell products through gene editing, off-target inflammatory side effects can be minimized while maintaining the enhanced in vivo activity of the infused T cells.

[0106] As previously mentioned, the T cell receptor (TCR) is expressed on the surface of T lymphocytes and plays a role in recognizing antigen fragments that are peptides that bind to the major histocompatibility complex (MHC) molecule. The TCRα chain gene can be found at the following GenBank accession numbers: X04954, X72904.1, and L21699.1.

[0107] The specific embodiments disclosed herein include targeting the TCRα chain gene. Expression of endogenous TCRs can interfere with the expression of engineered T cell receptors and mediate autoimmune or allogeneic responses. Targeting the TCRα chain gene can improve the expression of engineered T cell receptors and allow for partial donor independence in T cell product manufacturing.

[0108] CCR5 (chemokine receptor type 5; also known as CD195) is expressed on the surface of T cells, macrophages, dendritic cells, eosinophils, and microglia. It is encoded by the human CCR5 gene. CCR5 is a G protein-coupled receptor belonging to the integrative β-chemokine receptor family.

[0109] Many forms of viruses (including HIV) use CCR5 as a co-receptor to enter host cells. CCR5 was designated as the co-receptor because HIV entry requires its glycoprotein (gp120) to bind to both CD4 and the co-receptor (CCR5) to enter the host cell.

[0110] Therefore, one way to interfere with viral infection is to block or reduce CCR5 expression. Several CCR5 receptor antagonists have been developed to interfere with the interaction between CCR5 and the HIV envelope glycoprotein gp120. Examples of such antagonists include PRO140 (Progenics), Vicriviroc (Schering Plough), Aplaviroc (GlaxoSmithKline), and Mara viroc (Pfizer). Examples of ligands for CCR5 include RANTES, MIP-1β, and MIP-1α. These ligands are capable of inhibiting HIV-1 infection in vitro. Exemplary nucleic acid sequences encoding mammalian CCR5 can be found at the following GenBank accessions: U66285, FJ573195, and AF022990.

[0111] The specific implementation methods disclosed herein include targeting the CCR5 gene to reduce viral entry, such as HIV entering cells.

[0112] CXCR4 (CXC chemokine receptor type 4; also known as fusionin or CD184) is encoded by the human CXCR4 gene. Similar to CCR5, CXCR4 is a common receptor for viral entry into cells, including HIV. CXCR4 is also expressed in many types of cancer cells. CXCR4 is also an α-chemokine receptor specific to matrix-derived factor-1 (SDF-1 or CXCL12), a molecule with chemotactic activity against lymphocytes. SDF-1 inhibits the replication of T-tropic HIV-1 isolates. Exemplary nucleic acid sequences encoding mammalian CCR4 can be found at the following Genbank accessions: NM_001008540, NM_022205, and NM_009911.

[0113] The specific implementations disclosed herein include targeting the CXCR4 gene to reduce viral entry, such as HIV entering cells.

[0114] As noted, the specific embodiments disclosed herein rely on the expression of phenotypic proteins. Phenotypic proteins can be regulated, for example, cell differentiation, viability, or transport. Examples of phenotypic proteins include, for example, FOXO1, LKB1, TERT, CCR2b, and CCR4.

[0115] FOXO1 (forkhead box protein O1 or forkhead in rhabdomyosarcoma) is a transcription factor encoded by the human FOXO1 gene (e.g., SEQ ID NO: 7). FOXO1 is selectively incorporated into a genetic program that regulates the response of memory CD8+ T cells to infection (Kim et al., Immunity, 2013, 39(2): 286-97). Kim et al. showed that mice lacking FOXO1 in activated CD8+ T cells had a defective secondary but non-primary response to Listeria monocytogenes infection. Ibid. Memory precursor T cells expressed higher levels of FOXO1 compared to short-lived effector T cells, which promoted the generation and maintenance of memory precursor T cells. Ibid. The transcription factor Tcf7 and the chemokine receptor CCR7 were also shown to interact with FOXO1. Ibid.

[0116] FOXO1 also plays a role in promoting effector-to-memory transition and functional maturation of memory CD4 and CD8 T cells (Tejara et al., J. of Immunology, 2013, 191(1): 187-199). Although FOXO1 is not essential for effector cell differentiation, memory CD8 T cells exhibit senescent characteristics in the absence of FOXO1, leading to impaired memory responses and poor protective immunity. Ibid. Exemplary nucleic acid sequences encoding mammalian FOXO1 are available at the following GenBank accession numbers: BC021981, NM_001191846, and NM_019739. Specific embodiments disclosed herein include FOXO1 expression.

[0117] LKB1 (hepatic kinase B1, also known as renal cell carcinoma antigen NY-REN-19 or serine / threonine kinase 11 (STK11)) is a serine / threonine protein kinase encoded by the human STK11 gene. LKB1 is a key regulator of T cell development, viability, activation, and metabolism (MacIver, J. Immunol. 2011, 187(8): 4187-4198). T cells lacking LKB1 exhibit defects in cell proliferation and viability, and altered glycolysis and lipid metabolism. Ibid. LKB1 also activates a group of kinases, including AMPK and AMPK-associated kinases, which inhibit growth and proliferation in the presence of scarce energy nutrients. AMPK, AMPK-associated kinases, and LKB1 play important roles in maintaining cell polarity and thus inhibiting tumor cell growth. Exemplary nucleic acid sequences encoding mammalian LKB1 can be found at the following GenBank accession numbers: NM_000455, NM_001108069, and AB015801. Specific embodiments disclosed herein include the expression of LKB1. An exemplary LKB1 sequence is SEQ ID NO: 8.

[0118] Transcription factor 7, T cell specific (TCF7), is a transcription activator that plays a crucial role in lymphocyte differentiation. This gene is primarily expressed in T cells. The encoded protein binds to enhancer elements and activates the CD3E gene, and it can also repress the CTNNB1 and TCF7L2 genes through feedback mechanisms. An exemplary nucleic acid sequence encoding human TCF7 can be found at the following NCBI reference sequence: NC_000005.10. Specific embodiments disclosed herein include TCF7 expression.

[0119] Eomesodermin (EOMES) is a transcription factor essential for embryonic development in the mesoderm and the central nervous system in vertebrates. It is also involved in the differentiation of effector CD8+ T cells. An exemplary nucleic acid sequence encoding human EOMES can be found at the following NCBI reference sequence: NC_000003.12 and SEQ ID NO: 9. Specific embodiments disclosed herein include EOMES expression.

[0120] DNA binding inhibitor 2, HLH protein (ID2), is a transcriptional regulator containing a helical-loop-helical (HLH) domain but not a basic domain. Members of the DNA binding family of inhibitors inhibit the function of basic helical-loop-helical transcription factors in a dominant-negative manner by inhibiting their heterodimerized partner via the HLH domain. ID2 plays a role in negatively regulating cell differentiation. An exemplary nucleic acid sequence encoding human ID2 can be found at the following NCBI reference sequence: NC_000002.12 and SEQ ID NO: 10. Specific embodiments disclosed herein include expression of ID2.

[0121] The specific implementations disclosed herein involve altering T cell differentiation through the expression of transcription factors and signaling molecules such as FOXO1, LKB1, TCF7, EOMES, and / or ID2 to generate specific cell phenotypes, such as TEM, TCM, or TREG cells, according to the desired therapeutic efficiency. TCM and TEM cells have been shown to have enhanced therapeutic efficiency in antitumor models.

[0122] Telomerase is an RNA-dependent polymerase that elongates telomeres in the DNA strand, potentially allowing senescent cells to become immortal instead of undergoing mitosis and apoptosis. The human telomerase complex comprises two telomerase reverse transcriptase (TERT) molecules, telomerase RNA (TR or TERC), and dyskerin (DKC1). TERT, together with TERC, catalyzes the addition of nucleotides in the TTAGGG sequence to the ends of telomeres. This addition of a repetitive DNA sequence prevents the degradation of chromosome ends by mitosis after cell division. Therefore, telomerase repairs and elongates telomeres, enabling senescent cells to divide and exceed the Hayflick limit between 50 and 70 cell divisions. Exemplary nucleic acid sequences encoding mammalian TERT can be found at the following GenBank accessions: NM_198253, NM_053423, NM_009354; and SEQ ID NO: 11.

[0123] Normal somatic cells do not possess detectable telomerase activity. Specific embodiments disclosed herein include TERT expression. Studies have shown that the in vivo persistence and antitumor efficacy of adoptive T cells can be enhanced by delivery of TERT mRNA (using electroporation, Cell Discovery (2015) 1, 15040).

[0124] However, increased telomerase activity has been found in malignant tumor cells. Therefore, gene editing tools as described above can be used to target TERT in malignant cancers.

[0125] CCR2b (CC chemokine receptor type 2 or CD192 (differentiation cluster 192)) is a G protein-coupled receptor. In humans, CCR2 is encoded by the CCR2 gene. This gene encodes two isoforms of the receptor, CCR2a and CCR2b, through substitutional splicing of a single gene.

[0126] CCR2b is associated with MIP-1 (RANTES receptor) and is the receptor for monocyte chemokine-1 (MCP-1), a chemokine mediating monocyte chemotaxis. CCR2 also binds to MCP-2, MCP-3, and MCP-4, but with lower affinity. The C-terminal tails of CCR2a and CCR2b differ. MCP-1 is a small chemokine belonging to the CC chemokine family. MCP-1 is involved in recruiting monocytes, memory T cells, and dendritic cells to sites of inflammation resulting from tissue damage or infection. MCP-1 is involved in monocyte infiltration in inflammatory diseases such as psoriasis, rheumatoid arthritis, atherosclerosis, and inflammatory responses to tumors. Exemplary nucleic acid sequences encoding mammalian CCR2b can be found at the following GenBank accessions: NM_001123396 and NM_009915, and SEQ ID NO: 12.

[0127] The specific implementation schemes disclosed herein include the expression of CCR2b to enhance tumor transport of therapeutic T cells (J. Immunother. 2010 Oct; 33(8): 780-8).

[0128] CCR4 (CC chemokine receptor 4 or CD194 (differentiation cluster 194)) belongs to the G protein-coupled receptor family. In humans, it is encoded by the CCR4 gene. CCR4 is the receptor for MCP-1, MIP-1, RANTES, TARC, and macrophage-derived chemokines (which are CC chemokines). CC chemokines induce the migration of monocytes and other cells, such as NK cells and dendritic cells. For example, MCP-1 induces monocytes to leave the bloodstream and enter surrounding tissues to become tissue macrophages. RANTES attract T cells, eosinophils, and basophils. Therefore, CCR4 and its ligand, CC chemokine, regulate cell transport of various types of leukocytes. Exemplary nucleic acid sequences encoding mammalian CCR4 can be found at the following GenBank accession numbers: NM_005508, NM 133532 and NM_009916.2, and SEQ ID NO: 13.

[0129] The specific implementation schemes disclosed herein include the expression of CCR4 to improve tumor homing and antitumor activity of therapeutic T cells (Blood. 2009, 18 June; 113(25): 6392-402).

[0130] Specific embodiments utilize the nanocarriers disclosed herein to deliver nucleic acids for expression in selected cells, wherein the use is independent of or other than hit-and-run effects. In specific embodiments, such embodiments can enhance the growth, survival, immune function, and / or tumor cell targeting of selected cells. Examples of genetic modifications include those that allow the expression of chimeric antigen receptors (CARs), αβT cell receptors (or modifications thereof), and / or pro-inflammatory cytokines. CAR modifications and / or αβT cell receptor modifications allow modified lymphocytes to specifically target cell types.

[0131] In one respect, genetically modified lymphocytes may have improved tumor recognition, trigger increased proliferation of natural T cells, and / or cytokine production.

[0132] "Chimeric antigen receptor" or "CAR" refers to a synthetically designed receptor that includes at least a binding domain and an effector domain, and optionally a spacer domain and / or a transmembrane domain.

[0133] Binding domains may include, in particular, any peptide that specifically binds to a marker on a target cell. Sources of binding domains include antibody variable regions from various species (which may be in the form of antibodies, sFv, scFv, Fab, scFv-based grababody, or soluble VH domains or domain antibodies). These antibodies may form antigen-binding regions using only the heavy chain variable region; that is, these functional antibodies are simply homodimers of the heavy chain (referred to as “heavy chain antibodies”) (Jespers et al., Nat. Biotechnol. 22: 1161, 2004; Cortez-Retamozo et al., Cancer Res. 64: 2853, 2004; Baral et al., Nature Med. 12: 580, 2006; and Barthelemy et al., J. Biol. Chem. 283: 3639, 2008).

[0134] Alternative sources of binding domains include sequences encoding random peptide libraries or engineered sequences encoding amino acids in the loop regions of alternative non-antibody scaffolds, such as scTCRs (see, for example, Lake et al., Int. Immunol. 11:745, 1999; Maynard et al., J. Immunol. Methods 306:51, 2005; U.S. Patent No. 8,361,794), fibrinogen domains (see, for example, Weisel et al., Science). 230:1388, 1985), Kunitz domain (see, for example, U.S. Patent No. 6,423,498), designed ankyrin repeat protein (DARPin) (Binz et al., J. Mol. Biol. 332:489, 2003 and Binz et al., Nat. Biotechnol. 22:575, 2004), fibronectin-binding domain (adnectin or monobody) (Richards et al., J. Mol. Biol. 326:1475, 2003; Parke r et al., Protein Eng. Des. Selec. 18: 435, 2005 and Hackel et al., (2008) J. Mol. Biol. 381: 1238-1252), cysteine ​​knot protein (Vita et al., (1995) Proc. Nat'l. Acad. Sci. (USA) 92: 6404-6408; Martin et al., (2002) Nat. Biotechnol. 21: 71, 2002 and Huang et al., (2005) Structure 13:755, 2005), 34-peptide repeat domains (Main et al., Structure 11:497, 2003 and Cortajarena et al., ACS Chem. Biol. 3:161, 2008), leucine-rich repeat domains (Stumpp et al., J. Mol. Biol. 332:471, 2003), lipid transporter domains (see, for example, WO 2006 / 095164, Beste et al., Proc. Nat'l. Acad. Sci. (USA) 96:1898, 1999 and... See, for example, U.S. Patent Application Publication No. 2007 / 0065431, V-like domains (see Zelensky and Gready, FEBS J. 272: 6179, 2005; Beavil et al., Proc. Nat'l. Acad. Sci. (USA) 89: 753, 1992; and Sato et al., Proc. Nat'l. Acad. Sci. (USA) 100: 7779, 2003), mAb 2 or Fcab TM (See, for example, U.S. Patent Application Publication Nos. WO 2007 / 098934; WO 2006 / 072620), armadillo repeat proteins (see, for example, Madhurantakam et al., Protein Sci. 21: 1015, 2012; PCT Patent Application Publication No. WO 2009 / 040338), affilin (Ebersbach et al., J. Mol. Biol. 372: 172, 2007), affibody, avimer, knottin, fynomer, atrimer, cytotoxic T lymphocyte-associated protein-4 (Weidle et al., Cancer Gen. Proteo. 10: 155, 2013), etc. (Nord et al., Protein Sci. 21: 1015, 2012; PCT Patent Application Publication No. WO 2009 / 040338), affilin (Ebersbach et al., J. Mol. Biol. 372: 172, 2007), etc. (Nord et al., Protein Sci. 21: 1015, 2012; PCT Patent Application Publication No. WO 2009 / 040338), affilin (Ebersbach et al., J. Mol. Biol. 372: 172, 2007), etc.) Eng. 8:601, 1995; Nord et al., Nat. Biotechnol. 15:772, 1997; Nord et al., Euro. J. Biochem. 268:4269, 2001; Binz et al., Nat. Biotechnol. 23:1257, 2005; Boersma and Plückthun, Curr. Opin. Biotechnol. 22:849 (2011).

[0135] In a particular implementation, the binding domain is a single-chain T-cell receptor (scTCR), which includes V α / β and C α / β Chain (e.g., V) α -C α V β -C β V α -V β ) or include V specific to the target of interest (e.g., peptide-MHC complex). α -C α V β -C β V α -Vβ right.

[0136] Exemplary CAR expression targets ligand-binding domains of, for example, mesothelin, Her2, WT-1, and / or EGRF. Exemplary T-cell receptor modification targets melanoma-associated antigen (MAGE) A3 TCR.

[0137] By including binding domains for relevant cellular markers within the extracellular components of TCRs or CARs, specific cancers can be targeted:

[0138]

[0139] Without limiting the foregoing, cell markers also include A33; BAGE; Bc1-2; β-catenin; B7H4; BTLA; CA125; CA19-9; CD3; CD5; CD19; CD20; CD21; CD22; CD25; CD28; CD30; CD33; CD37; CD40; CD52; CD44v6; CD45; CD56; CD79b; CD80; CD81; CD86; CD123; CD134; CD137; CD151; CD171 CD276; CEA; CEACAM6; c-Met; CS-1; CTLA-4; Cyclin B1; DAGE; EBNA; EGFR; EGFRvIII; Hepatocyte ligand B2; ErbB2; ErbB3; ErbB4; EphA2; Estrogen receptor; FAP; Ferritin; Alpha-fetoprotein (AFP); FLT1; FLT4; Folate-binding protein; Curly protein; GAGE; G250; GD-2; GHRHR; GHR; GITR; GM2; gp75; gp100 (Pmel 17); gp130; HLA; HER-2 / neu; HPV E6; HPV E7; hTERT; HVEM; IGF1R; IL6R; KDR; Ki-67; Lewis A; Lewis Y; LIFRβ; LRP; LRP5; LTβR; MAGE; MART; mesothelin; MUC; MUC1; MUM-1-B; myc; NYESO-1; O-acetyl GD-2; O-acetyl GD3; OSMRβ; p53; PD1; PD-L1; PD-L2; PRAME; progesterone receptor; PSA; PSMA; PTCH1; RANK; ras; Robo1; ROR1; survivin; TCRα; TCRβ; tendin; TGFBR1; TGFBR2; TLR7; TLR9; TNFR1; TNFR2; TNFRSF4; TWEAK-R; TSTA tyrosinase; VEGF; and WT1.

[0140] Specific cancer cell markers include:

[0141]

[0142]

[0143]

[0144] In certain embodiments, the binding domain may bind to PSMA. Many antibodies specific to PSMA are known to those skilled in the art, and their sequence, epitope binding, and affinity can be readily characterized. In certain embodiments, the binding domain may include anti-mesothelin ligands (associated with the treatment of ovarian cancer, pancreatic cancer, and mesothelioma); anti-WT-1 (associated with the treatment of leukemia and ovarian cancer); anti-HIV-gag (associated with the treatment of HIV infection); or anti-cytomegalovirus (associated with the treatment of CMV diseases such as herpesvirus).

[0145] In a particular embodiment, the binding domain may bind to CD19. In a particular embodiment, the binding domain is a single-stranded Fv fragment (scFv) that includes VH and VL regions specific to CD19. In a particular embodiment, V... H and V L The district is a person. Example V H and V L The region includes a fragment of the anti-CD19 specific monoclonal antibody FMC63. In a particular embodiment, the scFV is a human or humanized scFV comprising a variable light chain, said variable light chain comprising the CDRL1 sequence of RASQDISKYLN (SEQ ID NO: 22), the CDRL2 sequence of SRLHSGV (SEQ ID NO: 23), and the CDRL3 sequence of GNTLPYTFG (SEQ ID NO: 24). In a particular embodiment, the scFV is a human or humanized scFV comprising a variable heavy chain, said variable heavy chain comprising the CDRHI sequence of DYGVS (SEQ ID NO: 25), the CDRH2 sequence of VTWGSETTYYNSALKS (SEQ ID NO: 26), and the CDRH3 sequence of YAMDYWG (SEQ ID NO: 27). Other CD19-targeting antibodies (such as SJ25C1 and HD37) are known. (SJ25C1: Bejcek et al., Cancer Res 2005, PMID 7538901; HD37: Pezutto et al., JI 1987, PMID 2437199). SEQ ID NO: 28 provides an anti-CD19 scFv(VH-VL)FMC63 DNA sequence, and SEQ ID NO: 29 provides an anti-CD19 scFv(VH-VL)FMC63 amino acid sequence.

[0146] In certain embodiments, the binding domain can bind to RORI. In certain embodiments, the scFV is a human or humanized scFV comprising a variable light chain, said variable light chain comprising the CDRL1 sequence of ASGFDFSAYYM (SEQ ID NO: 30), the CDRL2 sequence of TIYPSSG (SEQ ID NO: 31), and the CDRL3 sequence of ADRATYFCA (SEQ ID NO: 32). In certain embodiments, the scFV is a human or humanized scFV comprising a variable heavy chain, said variable heavy chain comprising the CDRH1 sequence of DTIDWY (SEQ ID NO: 33), the CDRH2 sequence of VQSDGSYTKRPGVPDR (SEQ ID NO: 34), and the CDRH3 sequence of YIGGYVFG (SEQ ID NO: 35). Many antibodies specific to RORI are known to those skilled in the art, and their sequence, epitope binding, and affinity can be readily characterized.

[0147] In a particular embodiment, the binding domain includes a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to the amino acid sequence of the TCR Vα, Vβ, Cα, or Cβ, wherein each CDR includes zero variations or at most one, two, or three variations from the TCR or a fragment or derivative thereof specifically bound to the target of interest.

[0148] In a particular embodiment, the binding domains Vα, Vβ, Cα, or Cβ may be derived from or based on Vα, Vβ, Cα, or Cβ of a known TCR (e.g., a high-affinity TCR) and, when compared with Vα, Vβ, Cα, or Cβ of a known TCR, contain one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) insertions, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) deletions, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) amino acid substitutions (e.g., conserved or non-conserved amino acid substitutions), or a combination of the above variations. Insertion, deletion, or substitution may be made anywhere in the Vα, Vβ, Cα, or Cβ region, including at the amino or carboxyl terminus or both ends of these regions, provided that each CDR includes zero or at most one, two, or three variations, and that the binding domain containing the modified Vα, Vβ, Cα, or Cβ region still binds to its target with similar affinity to the wild type.

[0149] In certain embodiments, the binding domain VH region of this disclosure may be derived from or based on the VH of a known monoclonal antibody, and when bound to the VH of a known monoclonal antibody... H In comparison, it may contain one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) insertions, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) deletions, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) amino acid substitutions (e.g., conserved or non-conserved amino acid substitutions), or combinations of the above variations. Insertions, deletions, or substitutions may be included in V H Any location within the region, including at the amino or carboxyl terminus or both ends of this region, provided that each CDR includes zero or at most one, two, or three variations, and provides a modified V H The binding domain of the region can still bind to its target with similar affinity as the wild-type binding domain.

[0150] In a particular embodiment, the VL region in the binding domain of this disclosure is derived from or based on the VL of a known monoclonal antibody, and when compared with the VL of a known monoclonal antibody, contains one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) insertions, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) deletions, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) amino acid substitutions (e.g., conserved amino acid substitutions), or combinations of the above variations. Insertions, deletions, or substitutions may be anywhere in the VL region, including at the amino terminus or carboxyl terminus or both ends of this region, provided that each CDR includes zero variations or at most one, two, or three variations, and that the binding domain containing the modified VL region still binds to its target with similar affinity to the wild-type binding domain.

[0151] In a particular embodiment, the binding domain comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to the amino acid sequence of the light chain variable region (VL) or the heavy chain variable region (VH), or both, wherein each CDR comprises zero variations or at most one, two, or three variations from a monoclonal antibody or fragment or derivative thereof that specifically binds to the target of interest.

[0152] The effector domain is capable of transmitting functional signals to the cell. In a particular embodiment, the effector domain directly or indirectly promotes a cellular response by associating with one or more other proteins that directly promote a cellular response. The effector domain may, upon binding to a marker expressed on a target cell, provide activation of at least one function of a transduced lymphocyte expressing a CAR. Lymphocyte activation may include one or more of proliferation, differentiation, activation, or other effector functions. In a particular embodiment, the delivered polynucleotide encodes the effector domain.

[0153] Effector domains may include one, two, three or more receptor signaling domains, intracellular signaling domains, co-stimulatory domains or combinations thereof. Any intracellular effector domain, co-stimulatory domain or both from any plurality of signaling molecules (e.g., signal transduction receptors) may be used in the CAR of this disclosure.

[0154] Exemplary effect subdomains include those from 4-1BB, CD3ε, CD3δ, CD3ζ, CD27, CD28 (e.g., SEQ ID NO: 36), CD79A, CD79B, CARD11, DAP10, FcRα, FcRβ, FcRγ, Fyn, HVEM, ICOS, Lck, LAG3, LAT, LRP, NOTCH1, Wnt, NKG2D, OX40, ROR2, Ryk, SLAMF1, Slp76, pTα, TCRα, TCRβ, TRIM, Zap70, PTCH2, or any combination thereof.

[0155] T cell activation can be mediated by two distinct types of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation and provide T cell receptor-like signals (primary cytoplasmic signaling sequences) and those that function in an antigen-independent manner to provide secondary or co-stimulatory signals (secondary cytoplasmic signaling sequences). Primary cytoplasmic signaling sequences that function in a stimulatory manner may contain signaling motifs, known as receptor-tyrosine-based activation motifs or iTAMs. Examples of iTAMs containing primary cytoplasmic signaling sequences include those derived from CD3ζ, FeRγ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d.

[0156] In a particular embodiment, the effector domain includes a cytoplasmic portion associated with a cytoplasmic signaling protein, wherein the cytoplasmic signaling protein is a lymphocyte receptor or its signaling domain, a protein comprising a variety of ITAMs, a co-stimulatory factor, or any combination thereof.

[0157] Examples of intracellular signal transduction domains include cytoplasmic sequences of the CD3ζ chain, and / or co-receptors that function together to initiate signal transduction upon CAR binding, as well as any derivatives or variants of these sequences and any synthetic sequences having the same functional capabilities. In a particular embodiment, the intracellular signal transduction domain of the CAR may be designed to include an intracellular signal transduction domain in combination with any other desired cytoplasmic domain. For example, the intracellular signal transduction domain of the CAR may include an intracellular signal transduction domain and a co-stimulatory signal transduction region. A co-stimulatory signal transduction region refers to a portion of the CAR that includes an intracellular domain containing a co-stimulatory molecule. A co-stimulatory molecule is a cell surface molecule other than an expressed labeling ligand that is required for the lymphocyte's response to the label. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds to CD83.

[0158] Spacer regions can be customized for each marker on the target to optimize target recognition. In certain implementations, the spacer length can be selected based on the location of the marker epitope, the antibody affinity for the epitope, and / or the ability of CAR-expressing lymphocytes to proliferate in vitro and / or in vivo in response to marker recognition.

[0159] A spacer region is typically found between the binding domain and the transmembrane domain of the CAR. The spacer region provides flexibility for the binding domain and allows for high expression levels in modified cells. In certain embodiments, the spacer region may have at least 10 to 250 amino acids, at least 10 to 200 amino acids, at least 10 to 150 amino acids, at least 10 to 100 amino acids, at least 10 to 50 amino acids, or at least 10 to 25 amino acids, and includes any integer between the endpoints of any of the listed ranges. In certain embodiments, the spacer region has 250 amino acids or less; 200 amino acids or less; 150 amino acids or less; 100 amino acids or less; 50 amino acids or less; 40 amino acids or less; 30 amino acids or less; 20 amino acids or less; or 10 amino acids or less.

[0160] In certain embodiments, the spacer region may be derived from the hinge region of an immunoglobulin-like molecule, such as all or part of the hinge region of human IgG1, human IgG2, human IgG3, or human IgG4. The hinge region may be modified to avoid undesirable structural interactions, such as dimerization. In certain embodiments, all or part of the hinge region may be combined with one or more domains of an immunoglobulin constant region. For example, a portion of the hinge region may be combined with all or part of a CH2 or CH3 domain or a variant thereof.

[0161] The CAR disclosed herein may also include a transmembrane domain. In a particular embodiment, the CAR polynucleotide encodes a transmembrane domain. The transmembrane domain provides anchorage of the CAR in the lymphocyte membrane. The transmembrane domain may be derived from a natural or synthetic source. When the source is natural, the domain may be derived from any membrane-bound or transmembrane protein. The transmembrane region includes at least the transmembrane region of the α, β, or ζ chain of the T cell receptor; CD28, CD3, CD45, CD4, CDDS, CD9, CD16, CD22; CD33, CD37, CD64, CD80, CD86, CDI34, CDI37, and CD154. In a particular embodiment, the synthetic or variant transmembrane domain primarily includes hydrophobic residues such as leucine and valine.

[0162] In a particular embodiment, the CAR comprises a P28z fusion receptor consisting of a single-chain antibody (scFv) specific to the extracellular domain of PSMA (J591) and CD28 and CD3ζ cytoplasmic signaling domains. In a particular embodiment, the CAR comprises the P28z CAR of SEQ ID NO: 37. SEQ ID NO: 37 comprises a mouse component. Amino acid positions 1-797 comprise an anti-PSMA scFv (J592), while positions 797-1477 comprise a mouse CD8 transmembrane domain, a mouse CD28 signaling domain, and a mouse CD3ζ signaling domain. Any P28z domain may be individually replaced with an optimized domain. In a particular embodiment, the transmembrane domain and signaling domain within positions 797-1477 of SEQ ID NO: 37 may be specifically replaced with domains optimized for human or other animals. In a particular embodiment, any whole or portion of the binding domain, any whole or portion of the effector domain, any whole or portion of the spacer domain, and / or any whole or portion of the transmembrane domain may be optimized for use in humans or other animals. In a particular embodiment, the P28z CAR is optimized for use in humans. When optimized for humans, the P28z CAR exhibits reduced immunogenicity in humans and has a lower number of non-immunogenic epitopes compared to non-human antibodies.

[0163] In a particular implementation, ROR1-specific and CD19-specific CARs can be constructed using VL and VH segments of 2A2, R12, and R11 mAh (ROR1) and FMC63 mAb (CD19). The variable region sequences of R11 and R12 are provided in Yang et al., PlosOne 6(6): e21018, June 15, 2011. Each scFV can be linked via a (Gly4Ser)3 (SEQ ID NO: 38) protein to a spacer domain derived from IgG4-Fc (UniProt database: P01861, SEQ ID NO: 39) including sequences comprising 'hinge-CH2-CH3' (229AA, SEQ ID NO: 40), 'hinge-CH3' (119AA, SEQ ID NO: 41), or 'hinge' only (12AA, SEQ ID NO: 42). All spacers may contain an S→P substitution within the hinge domain at position 108 of the native IgG4-Fc protein and may be linked to the 27 AA transmembrane domain of human CD28 (SEQ ID NO: 43, see UniProt: P10747 for an exemplary full-length CD28) and may be linked to an effector domain signal transduction module comprising (i) a 41 AA cytoplasmic domain of human CD28, wherein an LL→GG substitution is located at position 186-187 of the native CD28 protein (SEQ ID NO: 44) or (ii) a 42 AA cytoplasmic domain of human 4-1BB (UniProt: Q07011, SEQ ID NO: 45), wherein each may be linked to the 112 AA cytoplasmic domain of isotype 3 of human CD3ζ (UniProt: P20963, SEQ ID NO: 46). The construct encodes a T2A ribosomal jumping element (SEQ ID NO: 47) and a tEGFR sequence (SEQ ID NO: 48) downstream of the chimeric receptor. tEGFR can be tagged with a binding sequence cassette (such as STREP). II (SEQ ID NO: 49), Myc tag (SEQ ID NO: 50), V5 tag (SEQ ID NO: 51), The tag (SEQ ID NO: 52), His tag, or other peptides or molecules disclosed herein) can be replaced or supplemented. Codon-optimized gene sequences encoding each transgene can be synthesized (Life Technologies) and cloned into the epHIV7 lentiviral vector using NheI and Not1 restriction sites. The epHIV7 lentiviral vector can be derived from the pHIV7 vector by replacing the pHIV7 cytomegalovirus promoter with the EF-1 promoter. Packaging vectors pCHGP-2, pCMV-Rev2, and pCMV-G can be used. The transfection reagent (Clontech) produces lentiviruses encoding ROR1-chimeric receptor, CD19-chimeric receptor, tEGFR, or tag boxes in 293T cells.

[0164] HER2-specific chimeric receptors can be constructed using the VL and VH segments of HER2-specific mAbs that recognize proximal membrane epitopes on HER2, and scFV can be linked to the IgG4 hinge / CH2 / CH3, IgG4 hinge / CH3, and IgG4-only hinge extracellular septal domains, as well as to the CD28 transmembrane domain, 4-1BB, and CD3ζ signaling domains.

[0165] The CD19 chimeric receptor may comprise, alone or in tandem, a single-stranded variable fragment corresponding to the sequence of the CD19-specific mAb FMC63 (scFv: VL-VH), a spacer derived from IgG4-Fc including a 'hinge-CH2-CH3' domain (229AA, long spacer) or a 'hinge' domain only (12AA, short spacer), and a CD3ζ signaling module having a proximal membrane CD28 or 4-1BB co-stimulatory domain. The transgenic cassette may include a truncated EGFR (tEGFR) downstream of the chimeric receptor gene and may be separated by cleavable T2A elements for use as a tag sequence for transduction, selection, and in vivo tracking of chimeric receptor-modified cells. tEGFR may be available using ExoCBM-binding tag cassettes (such as STREP). II (SEQ ID NO: 49), Myc tag (SEQ ID NO: 50), V5 tag (SEQ ID NO: 51), Replace or supplement the tag (SEQ ID NO: 52), His tag or other peptides or molecules disclosed herein).

[0166] Different potential CAR nucleic acid constructs encoding different ligand-binding domains, different spacer lengths, different intracellular binding domains, and / or different transmembrane domains can be tested in vivo (in animal models) and / or in vitro to identify CARs that exhibit improved function compared to non-genetically modified lymphocytes and / or other CARs. In certain embodiments, the CAR is expressed independently of or in addition to the hit-and-run effect described herein.

[0167] The dimensions of the nanocarriers disclosed herein can vary over a wide range and can be measured in different ways. For example, the nanocarriers of this disclosure may have a minimum size of 100 nm. The nanocarriers of this disclosure may also have minimum sizes equal to or less than 500 nm, less than 150 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 40 nm, less than 30 nm, less than 20 nm, or less than 10 nm. In a particular embodiment, the nanocarrier may have a minimum size in the ranges between 5 nm and 500 nm, between 10 nm and 100 nm, between 20 nm and 90 nm, between 30 nm and 80 nm, between 40 nm and 70 nm, and between 40 nm and 60 nm. In a particular embodiment, the size is the diameter of the nanoparticle or coated nanoparticle. In certain embodiments, the nanocarrier groups of this disclosure may have an average minimum size equal to or less than 500 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 40 nm, less than 30 nm, less than 20 nm, or less than 10 nm. In certain embodiments, the nanocarrier groups in the compositions of this disclosure may have an average diameter in the ranges between 5 nm and 500 nm, between 10 nm and 100 nm, between 20 nm and 90 nm, between 30 nm and 80 nm, between 40 nm and 70 nm, and between 40 nm and 60 nm. The size of the nanocarriers can be determined using, for example, conventional techniques such as dynamic light scattering and / or electron microscopy.

[0168] In vitro application. The nanocarriers disclosed herein can be used for in vitro cell fabrication (see, for example, Figure 1A and 4C For example, the method may include obtaining lymphocytes from a subject. Lymphocytes may be obtained from a subject, for example, using any procedure known in the art.

[0169] Lymphocytes can be obtained from umbilical cord blood, placental blood, and peripheral blood. Methods for the collection, anticoagulation, and processing of blood samples are known. See, for example, Alsever et al., 1941, NY St. J. Med. 41: 126; De Gowin et al., 1940, J. Am. Med. Ass. 114: 850; Smith et al., 1959, J. Thorac. Cardiovasc. Surg. 38: 573; Rous and Turner, 1916, J. Exp. Med. 23: 219; and Hum, 1968, Storage of Blood, Academic Press, New York, pp. 26–160. Lymphocyte sources also include bone marrow from appropriately aged donors (see Kodo et al., 1984, J. Clin Invest. 73: 1377-1384), embryonic cells, cells derived from aortic-gonadal-mesonephric cells, lymphocytes, liver, thymus, and spleen. Unwanted components of all collected lymphocyte samples can be screened and discarded, processed, or used according to then-recognized current standards.

[0170] In certain implementations, no further collection or separation of lymphocytes is required prior to exposing lymphocytes to the nanocarriers disclosed herein, because the nanocarriers selectively target selected cell types within a heterogeneous cell population.

[0171] In certain embodiments, it may be beneficial to perform some further cell collection and separation prior to exposure to the nanocarriers disclosed herein. Lymphocytes can be collected and separated from the sample using any suitable technique. Suitable collection and separation procedures include magnetic separation; fluorescence-activated cell sorting (FACS; Williams et al., 1985, J. Immunol. 135: 1004; Lu et al., 1986, Blood 68(1): 126-133); affinity chromatography; adding the agent to or in combination with a monoclonal antibody; “panning” with antibodies adhered to a solid matrix (Broxmeyer et al., 1984, J. Clin. Invest. 73: 939-953); selective agglutination using lectins such as soybean (Reisner et al., 1980, Proc. Natl. Acad. Sci. USA 77: 1164); etc. Certain embodiments may utilize limited separation. Limited separation refers, for example, crude cell enrichment by removing red blood cells and / or adhering phagocytes.

[0172] In certain embodiments, a magnetic cell separator may be used, for example, by using anti-CD8 or anti-CD34 antibodies directly or indirectly conjugated to magnetic particles. A cell separation system (Miltenyi Biotec, Bergisch Gladbach, Germany) processes subject samples (e.g., blood samples) to select / enrich CD8+ T cells or CD34+ HSPCs. Similarly, cells expressing any of the aforementioned markers (e.g., T cell α chain; T cell β chain; T cell γ chain; T cell δ chain; CCR7; CD1a; CD1b; CD1c; CD1d; CD3; CD4; CD5; CD7; CD8; CD11b; CD11c; CD16; CD19; CD20; CD21; CD22; CD25; CD28; CD34; CD35; CD40; CD39; CD45RA; CD45RO; CD46; CD52; CD56; CD45RA; CD45RO; CD46; CD52; CD56; CD45RA; CD45RO; CD45RA ... Lymphocytes containing 62L; CD68; CD69; CD80; CD86; CD95; CD101; CD117; CD127; CD133; CD137(4-1BB); CD148; CD163; CD209; DEC-205; F4 / 80; IL-4Rα; Sca-1; CTLA-4; GITR; GARP; LAP; granzyme B; LFA-1; transferrin receptor) can be isolated and enriched for use with antibodies or other binding domains for these markers.

[0173] In a particular embodiment, the nanocarrier binds to lymphocytes prior to or in the early stages of the amplification process. This method allows for the modification of a small number of cells, with the modification spreading throughout the cell population as the cells expand. In a particular embodiment, the amplification of modified lymphocytes can occur upon exposure to the nanocarrier disclosed herein, which provides a hit-and-run effect based on transient expression.

[0174] Amplification can occur in the presence of one or more growth factors, such as: angiopoietin-like proteins (Angpt1, e.g., Angpt12, Angpt13, Angpt17, Angpt15, and Mfap4); erythropoietin; fibroblast growth factor-1 (FGF-1); Flt-3 ligand (Flt-3L); granulocyte colony-stimulating factor (G-CSF); granulocyte-macrophage colony-stimulating factor (GM-CSF); insulin-like growth factor-2 (IFG-2); interleukin-3 (Il-3); interleukin-6 (Il-6); interleukin-7 (Il-7); interleukin-11 (IL-11); stem cell factor (SCF; also known as c-kit ligand or mast cell growth factor); thrombopoietin (TPO); and analogues thereof (wherein the analogues include any structural variant of the growth factor having the biological activity of a naturally occurring growth factor; see, for example, WO (2007 / 1145227 and U.S. Patent Publication No. 2010 / 0183564).

[0175] In a particular implementation, the amount or concentration of growth factors suitable for expanding lymphocytes is an amount or concentration that effectively promotes proliferation. Preferably, the lymphocyte population is expanded until a sufficient number of cells are obtained to provide at least one typically approximately 10 4 cells / kg to 10 9 One cell / kg was infused into human subjects.

[0176] The amount or concentration of growth factors suitable for lymphocyte expansion depends on the activity of the growth factor formulation and the species compatibility between the growth factor and lymphocytes. Typically, when the growth factor and lymphocytes belong to the same species, the total amount of growth factor in the culture medium ranges from 1 ng / ml to 5 μg / ml, 5 ng / ml to 1 μg / ml, or 5 ng / ml to 250 ng / ml. In specific embodiments, the amount of growth factor can be in the range of 5-1000 or 50-100 ng / ml.

[0177] In certain embodiments, the growth factors are present at the following concentrations under amplification culture conditions: 25-300 ng / ml SCF, 25-300 ng / ml Flt-3L, 25-100 ng / ml TPO, 25-100 ng / ml IL-6, and 10 ng / ml IL-3. In certain embodiments, 50, 100, or 200 ng / ml SCF; 50, 100, or 200 ng / ml Flt-3L; 50 or 100 ng / ml TPO; 50 or 100 ng / ml IL-6; and 10 ng / ml IL-3 may be used.

[0178] Lymphocytes can be expanded in tissue culture dishes and bound to extracellular matrix proteins, such as fibronectin (FN) or fragments thereof (e.g., CH-296 (Dao et al., 1998, Blood 92(12): 4612-21)) or (Recombinant human fibronectin fragment; (Clontech Laboratories, Inc., Madison, WI).

[0179] Notch agonists are particularly useful for amplifying HSCs. In certain embodiments, HSCs can be amplified by exposing HSCs to: immobilized Notch agonists and 50 ng / ml or 100 ng / ml SCF; immobilized Notch agonists and 50 ng / ml or 100 ng / ml each of Flt-3L, IL-6, TPO, and SCF; or immobilized Notch agonists and 50 ng / ml or 100 ng / ml each of Flt-3L, IL-6, TPO, and SCF, and 10 ng / ml IL-11 or IL-3.

[0180] As noted, the lymphocytes are obtained from the subject. In a particular embodiment, the inject-and-run modified and expanded lymphocytes are reintroduced at a therapeutically effective amount into the same subject from whom the original sample was obtained. In a particular embodiment, the inject-and-run modified and expanded lymphocytes are administered at a therapeutically effective amount to different subjects. Therapeuticly effective amounts are described in more detail elsewhere herein.

[0181] In these embodiments, spike-and-run modified and expanded lymphocytes can be formulated into cell-based compositions for administration to subjects. A cell-based composition refers to expanded cells prepared using a pharmaceutically acceptable carrier for administration to subjects. In certain embodiments, after expansion and formulation administration are completed, the cell-based composition is administered to subjects in need as soon as reasonably possible.

[0182] In certain implementations, cryopreservation of cells may be necessary or beneficial. The terms "frozen" and "cryopreserved" are used interchangeably. Freezing includes freeze-drying.

[0183] As will be understood by those skilled in the art, cell freezing can be destructive (see Mazur, P., 1977, Cryobiology 14: 251-272), but many procedures are available to prevent such damage. For example, damage can be avoided by (a) using cryoprotectants, (b) controlling the freezing rate, and / or (c) storing at sufficiently low temperatures to minimize degradation reactions. Exemplary cryoprotectants include dimethyl sulfoxide (DMSO) (Lovelock and Bishop, 1959, Nature 183: 1394-1395; Ashwood-Smith, 1961, Nature 190: 1204-1205), glycerol, polyvinylpyrrolidone (Rinfret, 1960, Ann. NYAcad. Sci. 85: 576), polyethylene glycol (Sloviter and Ravdin, 1962, Nature 196: 548), albumin, dextran, sucrose, ethylene glycol, erythritol, D-ribitol, D-mannitol (Rowe et al., 1962, Fed. Proc. 21: 157), D-sorbitol, iodotitanol, D-lactose, choline chloride (Bender et al., 1960, J. Appl. Physiol. 15: 520), amino acids (Phan The Tran and Bender, 1960, Exp. Cell Res. 20: 651), methanol, acetamide, glyceryl monoacetate (Lovelock, 1954, Biochem. J. 56: 265), and inorganic salts (Phan The Tran and Bender, 1960, Proc. Soc. Exp. Biol. Med. 104: 388; Phan The Tran and Bender, 1961, in Radiobiology, Proceedings of the Third Australian Conference on Radiobiology, edited by Ilbery, Butterworth, London, p. 59). In certain embodiments, DMSO may be used. The protective effect of DMSO can be enhanced by adding plasma (e.g., at a concentration of 20%-25%). After the addition of DMSO, cells can be held at 0°C until freezing, as a 1% concentration of DMSO may be toxic at temperatures above 4°C.

[0184] In cell cryopreservation, a slowly controlled cooling rate can be critical, and different cryoprotectants (Rapatz et al., 1968, Cryobiology 5(1): 18-25) and different cell types have different optimal cooling rates (see, for example, Rowe and Rinfret, 1962, Blood 20: 636; Rowe, 1966, Cryobiology 3(1): 12-18; Lewis et al., 1967, Transfusion 7(1): 17-32; and Mazur, 1970, Science 168: 939-949 for effects of cooling velocity on survival of stem cells and on their transplantation potential). The heat generated during the melting phase of water turning into ice should be minimized. The degree of cooling can be determined by using, for example, a programmable cryostat or a methanol bath procedure. Programmable cryostats allow for the determination of the optimal cooling rate and facilitate standard, reproducible cooling.

[0185] In a particular embodiment, DMSO-treated cells can be pre-cooled on ice and transferred to a tray containing cold methanol, which is then placed in a mechanical freezer (e.g., Harris or Revco) at -80°C. Thermocouple measurements of the methanol bath and the sample suggest that a cooling rate of 1°C to 3°C / min is likely preferred. After at least two hours, the sample reaches a temperature of -80°C and can be placed directly in liquid nitrogen (-196°C).

[0186] After complete freezing, cells can be rapidly transferred to long-term cryogenic storage containers. In certain embodiments, samples can be stored cryogenically in liquid nitrogen (-196°C) or vapor (-1°C). The availability of high-efficiency liquid nitrogen freezers facilitates this storage.

[0187] Further considerations and procedures for handling, cryopreservation, and long-term cell storage can be found in the following exemplary references: U.S. Patent Nos. 4,199,022; 3,753,357; and 4,559,298; Gorin, 1986, Clinics In Haematology 15(1): 19-48; Bone-Marrow Conservation, Culture and Transplantation, Proceedings of a Panel, Moscow, July 22-26, 1968, International Atomic Energy Agency, Vienna, pp. 107-186; Livesey and Linner, 1987, Nature 327: 255; Linner et al., 1986, J. Histochem. Cytochem. 34(9): 1123-1135; Simione, 1992, J. Parenter. Sci. Technol. 46(6): 226-32).

[0188] After cryopreservation, the frozen cells can be thawed for use according to methods known to those skilled in the art. The frozen cells are preferably thawed rapidly and refrigerated immediately after thawing. In a particular embodiment, the vial containing the frozen cells can be immersed in a warm water bath up to its neck; gentle rotation will ensure that the cell suspension mixes during thawing and increase heat transfer from the warm water to the internal ice. Once the ice has completely melted, the vial can be placed on ice immediately.

[0189] In certain implementations, methods may be used to prevent cell aggregation during thawing. Exemplary methods include adding (Spitzer et al., 1980, Cancer 45:3075-3085) low molecular weight dextran and citrate, hydroxyethyl starch (Stiff et al., 1983, Cryobiology 20:17-24), etc., before and / or after DNase freezing.

[0190] As will be understood by those skilled in the art, if a cryoprotectant that is toxic to humans has been used, it should be removed before therapeutic use. DMSO is not seriously toxic.

[0191] Exemplary carriers and administration methods for cells are described on pages 14-15 of U.S. Patent Publication No. 2010 / 0183564. Other pharmaceutical carriers are described in Remington: The Science and Practice of Pharmacy, 21st Edition, edited by David B. Troy, Lippicott Williams & Wilkins (2005).

[0192] In certain embodiments, cells can be harvested from the culture medium and washed and concentrated into a carrier at a therapeutically effective amount. Exemplary carriers include saline, buffered saline, physiological saline, water, Hanks' solution, Ringer's solution, Nonnosol-R (Abbott Labs), and Plasma-Lyte. (Baxter Laboratories, Inc., Morton Grove, IL), glycerol, ethanol, and combinations thereof.

[0193] In certain embodiments, the carrier may be supplemented with human serum albumin (HSA) or other human serum components or fetal bovine serum. In certain embodiments, the carrier for infusion comprises a buffered saline containing 5% HAS or dextran. Additional isotonic agents include polyols, including ternary or higher sugar alcohols, such as glycerol, erythritol, aritol, xylitol, sorbitol, or mannitol.

[0194] The carrier may include buffers such as citrate buffers, succinate buffers, tartrate buffers, fumarate buffers, gluconate buffers, oxalate buffers, lactate buffers, acetate buffers, phosphate buffers, histidine buffers, and / or trimethylamine salts.

[0195] Stabilizers are a broad category of excipients, ranging from extenders to additives, that help prevent cells from adhering to the container walls. Typical stabilizers may include polyols; amino acids such as arginine, lysine, glycine, glutamine, asparagine, histidine, alanine, ornithine, L-leucine, 2-phenylalanine, glutamic acid, and threonine; organic sugars or sugar alcohols such as lactose, trehalose, stachyose, mannitol, sorbitol, xylitol, ribitol, myoinisitol, galactitol, glycerol, and cyclic alcohols such as inositol; PEG; amino acid polymers; sulfur-containing reducing agents such as urea, glutathione, lipoic acid, sodium thioacetate, thioglycerol, α-thioglycerol, and sodium thiosulfate; low molecular weight peptides (i.e., <10 residues); proteins such as HSA, bovine serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; monosaccharides such as xylose, mannose, fructose, and glucose; disaccharides such as lactose, maltose, and sucrose; trisaccharides such as raffinose; and polysaccharides such as dextran.

[0196] Where necessary or beneficial, cell-based compositions may include local anesthetics, such as lidocaine, to relieve pain at the injection site.

[0197] Exemplary preservatives include phenol, benzyl alcohol, m-cresol, methylparaben, propylparaben, octadecyl dimethyl benzyl ammonium chloride, benzalkonium chloride, hexamethyl diammonium chloride, alkyl benzoates such as methylparaben or propylparaben, catechol, resorcinol, cyclohexanol, and 3-pentanol.

[0198] The therapeutically effective amount of cells in the cell-based composition can be greater than 10. 2 Cells, greater than 10 3 Cells, greater than 10 4 Cells, greater than 10 5 Cells, greater than 10 6 Cells, greater than 10 7 Cells, greater than 10 8 Cells, greater than 10 9 Cells, greater than 10 10 One cell or more than 10 11 indivual.

[0199] In the cell-based compositions disclosed herein, the cells are typically in volumes of 1 liter or less, 500 mL or less, 250 mL or less, or 100 mL or less. Therefore, the density of cells applied is typically greater than 10. 4 cells / mL, 10 7 'cells / mL or 10 8 Cells / mL.

[0200] The cell-based compositions disclosed herein can be prepared for administration by means of, for example, injection, infusion, perfusion, or lavage. The cell-based compositions can be further formulated for intramedullary, intravenous, intradermal, intraarterial, intranodal, intralymphatic, intraperitoneal, intralesional, intraprostatic, intravaginal, intrarectal, local, intrathecal, intratumoral, intramuscular, intracystic, and / or subcutaneous injection.

[0201] Compositions for in vivo administration. The nanocarriers disclosed herein can also be formulated into compositions for direct administration to a subject, wherein selective targeting and hit-and-run modifications occur in vivo (as will be understood by those skilled in the art, the ex vivo and in vivo methods described herein are not mutually exclusive and can be combined). These compositions are referred to herein as nanocarrier-based compositions.

[0202] In a particular embodiment, the nanocarrier is provided as part of a nanocarrier-based composition, which may include at least 0.1% w / v or w / w nanocarriers; at least 1% w / v or w / w nanocarriers; at least 10% w / v or w / w nanocarriers; at least 20% w / v or w / w nanocarriers; at least 30% w / v or w / w nanocarriers; at least 40% w / v or w / w nanocarriers; at least 50% w / v or w / w nanocarriers; at least 60% w / v or w / w nanocarriers; at least 70% w / v or w / w nanocarriers; at least 80% w / v or w / w nanocarriers; at least 90% w / v or w / w nanocarriers; at least 95% w / v or w / w nanocarriers; or at least 99% w / v or w / w nanocarriers.

[0203] The nanocarrier-based compositions disclosed herein can be formulated for administration by injection, inhalation, infusion, perfusion, lavage, or uptake. The nanocarrier-based compositions disclosed herein can be further formulated for intravenous, intradermal, intraarterial, intranodular, intralymphatic, intraperitoneal, intralesional, intraprostatic, intravaginal, intrarectal, local, intrathecal, intratumoral, intramuscular, intracystic, oral, and / or subcutaneous administration, and more particularly by intravenous, intradermal, intraarterial, intranodular, intralymphatic, intraperitoneal, intralesional, intraprostatic, intravaginal, intrarectal, local, intrathecal, intratumoral, intramuscular, intracystic, oral, and / or subcutaneous injection.

[0204] For injection, the nanocarrier-based composition can be formulated as an aqueous solution, such as in a buffer solution including Hanks' solution, Ringer's solution, or physiological saline. The aqueous solution may contain formulations such as suspending agents, stabilizers, and / or dispersants. Alternatively, the formulation may be in lyophilized and / or powder form for use prior to preparation with a suitable medium (e.g., sterile pyrogen-free water).

[0205] For oral administration, nanocarrier-based compositions can be formulated into tablets, pills, sugar-coated pills, capsules, liquids, gels, syrups, slurries, suspensions, etc. For oral solid dosage forms, such as powders, capsules, and tablets, suitable excipients include binders (guar gum, gum arabic, corn starch, gelatin), fillers such as sugars (e.g., lactose, sucrose, mannitol, and sorbitol); dicalcium phosphate, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate; cellulose formulations such as corn starch, wheat starch, rice starch, potato starch, gelatin, guar gum, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose-methylcellulose, and / or polyvinylpyrrolidone (PVP); granulating agents; and binders. If desired, disintegrants such as corn starch, potato starch, alginate, croscarmellose, agar, or alginate or its salts, such as sodium alginate, can be added. If desired, solid dosage forms can be sugar-coated or enteric-coated using standard techniques. Flavorings such as peppermint, wintergreen oil, cherry flavoring, and orange flavoring can also be used.

[0206] For inhalation administration, nanocarrier-based compositions can be formulated as aerosol sprays from pressurized packaging or nebulizers, using a suitable propellant (e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gases). In the case of pressurized aerosols, the dosage unit can be determined by providing a valve to deliver a measured amount. Gelatin capsules and cartridges containing a powder mixture of a therapeutic agent and a suitable powder matrix (such as lactose or starch) can be formulated for use in inhalers or blowpipes.

[0207] Any nanocarrier-based composition formulation disclosed herein may advantageously include any other pharmaceutically acceptable carrier, including those that do not produce significant adverse effects, allergic reactions, or other adverse reactions beyond the benefit of administration, whether for research, prophylaxis, and / or therapeutic use. Exemplary pharmaceutically acceptable carriers and formulations are disclosed in Remington's Pharmaceutical Sciences, 18th edition, Mack Printing Company, 1990. Furthermore, formulations may be prepared to meet the sterility, pyrogenicity, general safety, and purity standards required by the U.S. FDA Office of Biostandards and / or other relevant foreign regulatory agencies.

[0208] Exemplary pharmaceutically acceptable carriers commonly used include any and all extenders or fillers, solvents or co-solvents, dispersion media, coatings, surfactants, antioxidants (e.g., ascorbic acid, methionine, vitamin E), preservatives, isotonic agents, absorption delay agents, salts, stabilizers, buffers, chelating agents (e.g., EDTA), gels, binders, disintegrants, and / or lubricants.

[0209] Exemplary buffers include citrate buffers, succinate buffers, tartrate buffers, fumarate buffers, gluconate buffers, oxalate buffers, lactate buffers, acetate buffers, phosphate buffers, histidine buffers, and / or trimethylamine salts.

[0210] Exemplary preservatives include phenol, benzyl alcohol, m-cresol, methylparaben, propylparaben, octadecyl dimethyl benzyl ammonium chloride, benzalkonium chloride, hexamethyl diammonium chloride, alkyl benzoates such as methylparaben or propylparaben, catechol, resorcinol, cyclohexanol, and 3-pentanol.

[0211] Exemplary isotonic agents include polyols, including ternary or higher sugar alcohols such as glycerol, erythritol, arbutin, xylitol, sorbitol, or mannitol.

[0212] Exemplary stabilizers include organic sugars, polyols, polyethylene glycol; sulfur-containing reducing agents, amino acids, low molecular weight peptides, proteins, immunoglobulins, hydrophilic polymers, or polysaccharides.

[0213] The nanocarrier-based compositions can also be formulated into reservoir formulations. Reservoir formulations can be formulated with suitable polymers or hydrophobic materials (e.g., formulated as emulsions in acceptable oils) or ion exchange resins, or as slightly soluble derivatives, such as slightly soluble salts.

[0214] Furthermore, compositions based on nanocarriers can be formulated into sustained-release systems utilizing a semi-permeable matrix of a solid polymer containing at least one active ingredient. Various sustained-release materials have been developed, and these materials are well known to those skilled in the art. Depending on their chemical properties, sustained-release systems can release the active ingredient several weeks after application, up to more than 100 days.

[0215] Methods of Use. The methods disclosed herein include treating subjects (humans, veterinary animals, livestock, and research animals) with the cell-based compositions and nanocarrier-based compositions disclosed herein. As noted, the compositions can treat a wide range of conditions, from cancer to infectious diseases. The compositions can also be used as vaccine adjuvants.

[0216] Treatment subjects include those receiving a therapeutically effective dose. A therapeutically effective dose can provide an effective dose, preventative treatment, and / or therapeutic treatment.

[0217] "Effective dose" is the amount of a compound necessary to produce the desired physiological changes in a subject. Effective doses are frequently used for research purposes. The effective dose disclosed in this article alters the phenotype of cells as an effect of gene editing or phenotypic alteration of protein expression.

[0218] "Preventive treatment" refers to treatment administered to subjects who have not yet shown signs or symptoms of a disease or condition, or who only show early signs or symptoms of a disease or condition, so that the treatment is administered for the purpose of reducing, preventing, or mitigating the risk of further development of the disease or condition. Therefore, preventive treatment functions as a preventative measure against a disease or condition. Vaccines are an example of preventive treatment.

[0219] In certain embodiments, prophylactic treatment is administered to treat viral infections, such as HIV. For example, the composition may be prophylactically administered to subjects at risk of developing a viral infection or to subjects already exposed to the virus, to prevent, reduce, or delay the development of a viral infection or disease. For example, the composition may be administered to subjects who may have been exposed to a virus (e.g., HIV) or to subjects at high risk of exposure to the virus.

[0220] "Therapeutic treatment" includes treatments administered to subjects who exhibit symptoms or signs of a disease or symptom, and are administered to subjects in order to reduce or eliminate such symptoms or signs of a disease or symptom.

[0221] Preventive and therapeutic treatments do not require complete prevention or cure of disease or symptoms, but can provide some benefits.

[0222] In the context of cancer, effective therapeutic doses can reduce the number of tumor cells, reduce the number of metastases, reduce tumor volume, increase life expectancy, induce apoptosis in cancer cells, induce cancer cell death, induce chemo or radiosensitivity in cancer cells, inhibit angiogenesis near cancer cells, inhibit cancer cell proliferation, inhibit tumor growth, prevent metastasis, prolong the life of subjects, reduce cancer-related pain, reduce the number of metastases, and / or reduce cancer recurrence or recurrence after treatment.

[0223] In the case of a virus, an effective therapeutic dose can reduce the number of virus-infected cells and reduce one or more symptoms associated with the viral infection, such as fever, chills, vomiting, joint pain, etc.

[0224] In the case of HIV, effective therapeutic doses can reduce the number of HIV-infected cells, increase the number of T cells in the subject, reduce the incidence, frequency or severity of infection, increase life expectancy, prolong the subject's life and / or reduce HIV-related pain or cognitive impairment.

[0225] In the context of vaccine adjuvants, vaccines increase a subject's immunity to a specific disease, and vaccine adjuvants enhance and / or prolong this increase. Those skilled in the art will understand that the immune system is generally capable of producing innate and adaptive immune responses. An innate immune response is typically characterized as being substantially non-antigen-specific and / or not producing immune memory. An adaptive immune response is characterized as being substantially antigen-specific, maturing over time (e.g., increasing antigen affinity and / or cohesion), and typically producing immune memory. Although these and other functional differences between innate and adaptive immunity can be discerned, those skilled in the art will understand that the innate and adaptive immune systems can integrate and therefore work synergistically.

[0226] For administration, the therapeutically effective dose (also referred to as the dose in this document) can be initially estimated based on the results of in vitro assays and / or animal model studies. This information can be used to more accurately determine the useful dose in subjects of interest.

[0227] The actual dose administered to a specific subject can be determined by a physician, veterinarian, or researcher by considering parameters such as the subject’s physical and physiological factors, including target, weight, severity of symptoms, disease type, prior or concurrent treatment interventions, idiopathic nature, and route of administration.

[0228] Useful dosages of cell-based compositions are provided elsewhere in this document. Useful dosages of nanocarrier-based compositions may include 0.1 to 5 μg / kg or 0.5 to 1 μg / kg. In other examples, the dosage of the nanocarrier-based composition may include, for example, 1 μg / kg, 10 μg / kg, 20 μg / kg, 30 μg / kg, 40 μg / kg, 50 μg / kg, 60 μg / kg, 70 μg / kg, 80 μg / kg, 90 μg / kg, 100 μg / kg, 150 μg / kg, 200 μg / kg, 250 μg / kg, 350 μg / kg, 400 μg / kg, 450 μg / kg, 500 μg / kg, 550 μg / kg, 600 μg / kg, 650 μg / kg, 700 μg / kg, 750 μg / kg, 800 μg / kg, 850 μg / kg, 900 μg / kg, 950 μg / kg, 1000 μg / kg, 0.1 to 5 mg / kg, or 0.5 to 1 mg / kg. In other non-limiting examples, the dosage may include 1 mg / kg, 10 mg / kg, 20 mg / kg, 30 mg / kg, 40 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 150 mg / kg, 200 mg / kg, 250 mg / kg, 350 mg / kg, 400 mg / kg, 450 mg / kg, 500 mg / kg, 550 mg / kg, 600 mg / kg, 650 mg / kg, 700 mg / kg, 750 mg / kg, 800 mg / kg, 850 mg / kg, 900 mg / kg, 950 mg / kg, 1000 mg / kg or more.

[0229] The effective dose can be achieved by administering a single or multiple doses during the treatment regimen (e.g., daily, every other day, every 3 days, every 4 days, every 5 days, every 6 days, weekly, every 2 weeks, every 3 weeks, monthly, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, or annually).

[0230] Unless otherwise indicated, the practices described herein may employ conventional techniques of immunology, molecular biology, microbiology, cell biology, and recombinant DNA. These methods are described in the following publications. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition (1989); F.M.A. Susubel et al., Current Protocols in Molecular Biology, (1987); the series Methods IN Enzymology (Academic Press, Inc.); M. MacPherson et al., PCR: A Practical Approach, IRPress at Oxford University Press (1991); MacPherson et al., eds. PCR 2: Practical Approach, (1995); Harlow and Lane, eds. Antibodies, A Laboratory Manual, (1988); and R.Freshney, ed., Animal Cell Culture (1987).

[0231] Sequence information available from public databases can be used to identify target gene sequences and nucleic acid sequences encoding phenotypic alteration proteins, as disclosed herein. Exemplary sequences are provided in... Figure 11 middle.

[0232] This also includes variants of the sequences disclosed and cited herein. Protein variants may include those proteins having one or more conserved amino acid substitutions. As used herein, “conserved substitution” refers to a substitution found in one of the following groups of conserved substitutions: Group 1: alanine (Ala), glycine (Gly), serine (Ser), threonine (Thr); Group 2: aspartic acid (Asp), glutamic acid (Glu); Group 3: asparagine (Asn), glutamine (Gln); Group 4: arginine (Arg), lysine (Lys), histidine (His); Group 5: isoleucine (Ile), leucine (Leu), methionine (Met), valine (Val); and Group 6: phenylalanine (Phe), tyrosine (Tyr), tryptophan (Trp).

[0233] Additionally, amino acids can be grouped into conservative substitution groups based on similar functions or chemical structures or compositions (e.g., acidic, basic, aliphatic, aromatic, sulfur-containing). For example, the aliphatic group can include Gly, Ala, Val, Leu, and Ile for substitution purposes. Other groups containing amino acids considered to have conservative substitutions include: sulfur-containing: Met and cysteine ​​(Cys); acidic: Asp, Glu, Asn, and Gln; small aliphatic nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gln; polar, positively charged residues: His, Arg, and Lys; large aliphatic nonpolar residues: Met, Leu, Ile, Val, and Cys; and large aromatic residues: Phe, Tyr, and Trp. Further information can be found in Creighton (1984), Proteins, W.H. Freeman, and Company.

[0234] As noted elsewhere, variants of gene sequences may include codon-optimized variants, sequence polymorphisms, splicing variants, and / or mutations that do not affect the function of the encoded product to a statistically significant extent.

[0235] Variants of the protein, nucleic acid, and gene sequences disclosed herein also include sequences having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the protein, nucleic acid, or gene sequences disclosed herein.

[0236] "Sequence identity %" refers to the relationship between two or more sequences as determined by comparing sequences. In this art, "identity" also means the degree of sequence correlation between protein, nucleic acid, or gene sequences as determined by matching such sequence strings. "Identity" (often referred to as "similarity") can be readily calculated using known methods, including (but not limited to) those described in: Computational Molecular Biology (edited by Lesk, AM), Oxford University Press, NY (1988); Biocomputing: Informatics and Genome Projects (edited by Smith, DW), Academic Press, NY (1994); Computer Analysis of Sequence Data, Part I (edited by Griffin, AM, and Griffin, HG), Humana Press, NJ (1994); Sequence Analysis in Molecular Biology (edited by Von Heijne, G.), Academic Press (1987); and Sequence Analysis Primer (edited by Gribskov, M. and Devereux, J.), Oxford University Press, NY (1992). Preferred methods for determining identity are designed to obtain the best match between the sequences being tested. Methods for determining identity and similarity are written in publicly available computer programs. Sequence alignment and identity percentage calculations can be performed using the Megalign program of the LASERGENE Bioinformatics Computing Suite (DNASTAR, Inc., Madison, Wisconsin). Multiple alignment of sequences can also be performed using the Clustal alignment method (Higgins and Sharp CABIOS, 5, 151-153 (1989)) with default parameters (gap penalty = 10, gap length penalty = 10).Related programs also include the GCG program suite (Wisconsin Package version 9.0, Genetics Computer Group (GCG), Madison, Wisconsin); BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol. 215: 403-410 (1990)); DNASTAR (DNASTAR, Inc., Madison, Wisconsin); and the FASTA program incorporating the Smith-Waterman algorithm (Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Conference Dates 1992, 111-20. Editors: Suhai, Sandor. Publisher: Plenum, New York, NY). In the context of this disclosure, it will be understood that when sequence analysis software is used for analysis, the results of the analysis are based on the “default values” of the cited programs. As used herein, “default values” will mean any set of values ​​or parameters initially loaded by the software during initial initialization.

[0237] Exemplary Implementation

[0238] 1. A method for preparing a selected population of hematopoietic cells for administration to a subject, comprising:

[0239] Samples are obtained from the subject, wherein the samples comprise a heterogeneous mixture of cells, the heterogeneous mixture of cells comprising selected hematopoietic cell populations;

[0240] The sample was exposed to a synthetic nanocarrier, the nanocarrier comprising...

[0241] (i) a synthetic nucleic acid encapsulated in a positively charged carrier, wherein the synthetic nucleic acid encapsulates a gene editing agent or a phenotypic altering protein;

[0242] (ii) a neutral or negatively charged coating on the outer surface of the carrier; and

[0243] (iii) Selected cell-targeting ligands extending from the coating surface;

[0244] The exposure results in the selective delivery of the nanocarrier to a selected cell population, thereby leading to the modification of cells within the selected cell population and the amplification of cells within the sample.

[0245] The selected cell population is thus prepared for administration to the subject.

[0246] 2. The method as described in embodiment 1, wherein the amplified cells within the sample comprise modified cells of the selected cell population.

[0247] 3. The method as described in embodiment 1 or 2, further comprising formulating the selected cell population prepared into a cell-based composition.

[0248] 4. The method of embodiment 3, further comprising administering the cell-based composition to the subject.

[0249] 5. The method as described in any one of embodiments 1-4, wherein prior to the exposure, no separation step is taken or only a limited separation step is taken to increase the percentage of the selected cell population in the heterogeneous mixture of cells.

[0250] 6. The method of any one of embodiments 1-5, wherein the synthesized nucleic acid encodes a gene editing agent selected from transcription activator-like effector nucleases (TALENs); megaTALs; and / or zinc finger nucleases.

[0251] 7. The method of embodiment 6, wherein the synthesized nucleic acid encodes megaTAL of SEQ ID NO: 1.

[0252] 8. The method of any one of embodiments 1-7, wherein the gene editing agent destroys endogenous genes encoding Shp-1 phosphatase, PD1 receptor, T cell receptor (TCR), CCR5 and / or CXCR4.

[0253] 9. The method of any one of embodiments 1-8, wherein the gene editing agent destroys the endogenous gene encoding the TCRα chain.

[0254] 10. The method of any one of embodiments 1-9, wherein the synthesized nucleic acid encodes a phenotypic protein selected from transcription factors, kinases, and / or cell surface receptors.

[0255] 11. The method of embodiment 10, wherein the phenotypic altering protein is selected from FOXO1, LKB1, TCF7, EOMES, ID2, TERT, CCR2b and / or CCR4.

[0256] 12. The method of any one of embodiments 1-11, wherein the selected cell-targeting ligand selectively binds to lymphocytes within a heterogeneous cell population.

[0257] 13. The method of embodiment 12, wherein the heterogeneous cell population is an in vitro cell culture.

[0258] 14. The method as described in embodiment 12, wherein the heterogeneous cell population is in vivo.

[0259] 15. The method of any one of embodiments 1-14, wherein the selected cell-targeting ligand selectively binds to T cells, NK cells, monocytes, macrophages, dendritic cells, B cells, hematopoietic stem cells, or combinations thereof.

[0260] 16. The method of any one of embodiments 1-15, wherein the selected cell-targeting ligand comprises a binding domain selected from lymphocyte receptor ligands, lymphocyte receptor antibodies, lymphocyte receptor peptide aptamers, lymphocyte receptor nucleic acid aptamers, lymphocyte receptor Spiegelmer, or combinations thereof.

[0261] 17. The method as described in any one of embodiments 1-16, wherein the selected cell-targeting ligand selectively binds to the following T-cell receptor motifs: T-cell α chain; T-cell β chain; T-cell γ chain; T-cell δ chain; CCR7; CD1a; CD1b; CD1c; CD1d; CD3; CD4; CD5; CD7; CD8; CD11b; CD11c; CD16; CD19; CD20; CD21; CD22; CD25; CD28; CD34; CD35; CD39; CD40 CD45RA; CD45RO; CD46, CD52; CD56; CD62L; CD68; CD69; CD80; CD86; CD95; CD101; CD117; CD127; CD133; CD137(4-1BB); CD148; CD163; CD209; DEC-205; F4 / 80; IL-4Rα; Sca-1; CTLA-4; GITR; GARP; LAP; Granulase B; LFA-1; or transferrin receptor.

[0262] 18. The method of any one of embodiments 1-17, wherein the selected cell-targeting ligand selectively binds to CD1a; CD1b; CD1c; CD1d; CCR7; CD3; CD4; CD5; CD8; CD16; CD19; CD20; CD21; CD22; CD25; CD28; CD35; CD40; CD45RA; CD45RO; CD46; CD52; CD69; CD62L; CD80; CD95; CD127; CD137; CD209; or DEC-205.

[0263] 19. The method of any one of embodiments 1-18, wherein the selected cell-targeting ligand comprises a binding domain selected from: T cell α-chain antibody; T cell β-chain antibody; T cell γ-chain antibody; T cell δ-chain antibody; CCR7 antibody; CD1a antibody; CD1b antibody; CD1c antibody; CD1d antibody; CD3 antibody; CD4 antibody; CD5 antibody; CD7 antibody; CD8 antibody; CD11b antibody; CD11c antibody; CD16 antibody; CD19 antibody; CD20 antibody; CD21 antibody; CD22 antibody; CD25 antibody; CD28 antibody; CD34 antibody; CD35 antibody; CD39 antibody; CD40 antibody; CD45RA antibody; CD45RO antibody; CD46 antibody; CD52 antibody; CD56 antibody; CD62L antibody; CD68 antibody; CD69 antibody; CD80 antibody; CD86 antibody; CD95 antibody; CD101 antibody; CD1 17 antibody; CD127 antibody; CD133 antibody; CD137(4-1BB) antibody; CD148 antibody; CD163 antibody; CD209 antibody; DEC-205 antibody; F4 / 80 antibody; IL-4Rα antibody; Sca-1 antibody; CTLA-4 antibody; GITR antibody; GARP antibody; LAP antibody; granzyme B antibody; LFA-1 antibody; or transferrin receptor antibody.

[0264] 20. The method according to any one of embodiments 1-19, wherein the binding domain comprises or is substantially composed of scFv fragments of the following: T cell α chain antibody; T cell β chain antibody; T cell γ chain antibody; T cell δ chain antibody; CCR7 antibody; CD1a antibody; CD1b antibody; CD1c antibody; CD1d antibody; CD3 antibody; CD4 antibody; CD5 antibody; CD7 antibody; CD8 antibody; CD11b antibody; CD11c antibody; CD16 antibody; CD19 antibody; CD20 antibody; CD21 antibody; CD22 antibody; CD25 antibody; CD28 antibody; CD34 antibody; CD35 antibody; CD39 antibody; CD40 antibody. CD45RA antibody; CD45RO antibody; CD46 antibody; CD52 antibody; CD56 antibody; CD62L antibody; CD68 antibody; CD69 antibody; CD80 antibody; CD86 antibody; CD95 antibody; CD101 antibody; CD117 antibody; CD127 antibody; CD133 antibody; CD137(4-1BB) antibody; CD148 antibody; CD163 antibody; CD209 antibody; DEC-205 antibody; F4 / 80 antibody; IL-4Rα antibody; Sca-1 antibody; CTLA-4 antibody; GITR antibody; GARP antibody; LAP antibody; granzyme B antibody; LFA-1 antibody; or transferrin receptor antibody.

[0265] 21. The method of any one of embodiments 1-20, wherein the synthesized nucleic acid is synthesized mRNA.

[0266] 22. The method of any one of embodiments 1-21, wherein the carrier comprises a positively charged lipid or polymer.

[0267] 23. The method of embodiment 22, wherein the positively charged polymer comprises poly(β-amino ester, poly(L-lysine), poly(ethyleneimine) (PEI), poly(acylaminoamine) dendrimer (PAMAM), poly(amino-co-ester), poly(dimethylaminoethyl methacrylate) (PDMAEMA), chitosan, poly-(L-lactide-co-L-lysine), poly[α-(4-aminobutyl)-L-glycolic acid] (PAGA) or poly(4-hydroxy-L-proline ester) (PHP).

[0268] 24. The method of any one of embodiments 1-23, wherein the coating comprises a neutral or negatively charged lipid or polymer.

[0269] 25. The method of embodiment 24, wherein the neutral or negatively charged coating comprises polyglutamic acid (PGA), poly(acrylic acid), alginate, or cholesterol hemisuccinate / 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine.

[0270] 26. The method as described in embodiment 24 or 25, wherein the neutral or negatively charged coating comprises a zwitterionic polymer.

[0271] 27. The method of any one of embodiments 24-26, wherein the neutral or negatively charged coating comprises liposomes.

[0272] 28. The method of embodiment 27, wherein the liposomes comprise 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), 1,2-di-O-octadecenyl-3-trimethylammonium-propane (DOTMA), 3β-[N-(N′,N′-dimethylaminoethane)-carbamoyl]cholesterol (DC-Chol), octadecyl-aminoglycyl spermine (DOGS), cholesterol, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), or 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC).

[0273] 29. The method of any one of embodiments 1-28, wherein the selected cell-targeting ligand selectively binds to CD4 and / or CD8.

[0274] 30. The method of any one of embodiments 1-29, wherein the selected cell-targeting ligand comprises a binding domain selected from CD4 antibodies and / or CD8 antibodies.

[0275] 31. The method of any one of embodiments 1-30, wherein the selected cell-targeting ligand comprises a binding domain of an scFv fragment selected from CD4 antibodies and / or CD8 antibodies.

[0276] 32. The method of any one of embodiments 1-31, wherein the carrier comprises poly(β-amino ester).

[0277] 33. The method of any one of embodiments 1-32, wherein the coating comprises polyglutamic acid (PGA).

[0278] 34. The method of any one of embodiments 1-33, wherein the selected cell-targeting ligand comprises a binding domain selected from CD4 antibodies and / or CD8 antibodies; the carrier comprises poly(β-amino ester); and the coating comprises polyglutamic acid (PGA).

[0279] 35. A method for preparing cells to treat a subject, comprising:

[0280] Lymphocytes were obtained from the subjects;

[0281] The lymphocytes are combined with a synthetic nanocarrier, the synthetic nanocarrier comprising...

[0282] (i) a synthetic nucleic acid encapsulated in a positively charged carrier, wherein the synthetic nucleic acid encapsulates a gene editing agent or a phenotypic altering protein;

[0283] (ii) a neutral or negatively charged coating on the outer surface of the carrier; and

[0284] (iii) Selected cell-targeting ligands extending from the coating surface;

[0285] After the merging process, the nanocarrier is selectively incorporated into the lymphocytes, enabling the lymphocytes to transiently express the nucleic acid.

[0286] 36. The method of embodiment 35, further comprising amplifying the lymphocytes.

[0287] 37. The method as described in embodiment 35 or 36, further comprising formulating the lymphocytes into a cell-based composition.

[0288] 38. The method as described in any one of embodiments 35-37, wherein prior to the exposure, no separation step is taken or only a limited separation step is taken to increase the percentage of the selected cell population in the heterogeneous mixture of cells.

[0289] 39. The method of any one of embodiments 35-38, wherein the synthesized nucleic acid encodes a gene editing agent selected from transcription activator-like effector nucleases (TALENs); megaTALs; and / or zinc finger nucleases.

[0290] 40. The method of any one of embodiments 35-39, wherein the synthesized nucleic acid encodes the megaTAL of SEQ ID NO: 1.

[0291] 41. The method of any one of embodiments 35-40, wherein the gene editing agent destroys endogenous genes encoding Shp-1 phosphatase, PD1 receptor, T cell receptor (TCR), CCR5 and / or CXCR4.

[0292] 42. The method of any one of embodiments 35-41, wherein the gene editing agent destroys the endogenous gene encoding the TCRα chain.

[0293] 43. The method of any one of embodiments 35-42, wherein the synthesized nucleic acid encodes a phenotypic protein selected from transcription factors, kinases, and / or cell surface receptors.

[0294] 44. The method of embodiment 43, wherein the phenotypic altering protein is selected from FOXO1, LKB1, TCF7, EOMES, ID2, TERT, CCR2b and / or CCR4.

[0295] 45. The method of any one of embodiments 35-44, wherein the selected cell-targeting ligand selectively binds to lymphocytes within a heterogeneous cell population.

[0296] 46. ​​The method of embodiment 45, wherein the heterogeneous cell population is an ex vivo cell culture.

[0297] 47. The method of embodiment 45, wherein the heterogeneous cell population is in vivo.

[0298] 48. The method of any one of embodiments 35-47, wherein the selected cell-targeting ligand selectively binds to T cells, NK cells, monocytes, macrophages, dendritic cells, B cells, hematopoietic stem cells, or combinations thereof.

[0299] 49. The method of any one of embodiments 35-48, wherein the selected cell-targeting ligand comprises a binding domain selected from lymphocyte receptor ligands, lymphocyte receptor antibodies, lymphocyte receptor peptide aptamers, lymphocyte receptor nucleic acid aptamers, lymphocyte receptor Spiegelmer, or combinations thereof.

[0300] 50. The method as described in any one of embodiments 35-49, wherein the selected cell-targeting ligand selectively binds to the following T cell receptor motifs: T cell α chain; T cell β chain; T cell γ chain; T cell δ chain; CCR7; CD1a; CD1b; CD1c; CD1d; CD3; CD4; CD5; CD7; CD8; CD11b; CD11c; CD16; CD19; CD20; CD21; CD22; CD25; CD28; CD34; CD35; CD39; CD4 0; CD45RA; CD45RO; CD46, CD52; CD56; CD62L; CD68; CD69; CD80; CD86; CD95; CD101; CD117; CD127; CD133; CD137(4-1BB); CD148; CD163; CD209; DEC-205; F4 / 80; IL-4Rα; Sca-1; CTLA-4; GITR; GARP; LAP; Granulase B; LFA-1; or transferrin receptor.

[0301] 51. The method as described in any one of embodiments 35-50, wherein the selected cell-targeting ligand selectively binds to CD1a; CD1b; CD1c; CD1d; CCR7; CD3; CD4; CD5; CD8; CD16; CD19; CD20; CD21; CD22; CD25; CD28; CD35; CD40; CD45RA; CD45RO; CD46; CD52; CD62L; CD69; CD80; CD95; CD127; CD137; CD209; or DEC-205.

[0302] 52. The method according to any one of embodiments 35-51, wherein the selected cell-targeting ligand comprises a binding domain selected from: T cell α-chain antibody; T cell β-chain antibody; T cell γ-chain antibody; T cell δ-chain antibody; CCR7 antibody; CD1a antibody; CD1b antibody; CD1c antibody; CD1d antibody; CD3 antibody; CD4 antibody; CD5 antibody; CD7 antibody; CD8 antibody; CD11b antibody; CD11c antibody; CD16 antibody; CD19 antibody; CD20 antibody; CD21 antibody; CD22 antibody; CD25 antibody; CD28 antibody; CD34 antibody; CD35 antibody; CD39 antibody; CD40 antibody; CD45RA antibody; CD45RO antibody; CD46 antibody; CD52 antibody; CD56 antibody; CD62L antibody; CD68 antibody; CD69 antibody; CD80 antibody; CD86 antibody; CD95 antibody; CD101 antibody; CD1 17 antibody; CD127 antibody; CD133 antibody; CD137(4-1BB) antibody; CD148 antibody; CD163 antibody; CD209 antibody; DEC-205 antibody; F4 / 80 antibody; IL-4Rα antibody; Sca-1 antibody; CTLA-4 antibody; GITR antibody; GARP antibody; LAP antibody; granzyme B antibody; LFA-1 antibody; or transferrin receptor antibody.

[0303] 53. The method as described in any one of embodiments 35-52, wherein the binding domain comprises or is substantially composed of scFv fragments of the following: T cell α-chain antibody; T cell β-chain antibody; T cell γ-chain antibody; T cell δ-chain antibody; CCR7 antibody; CD1a antibody; CD1b antibody; CD1c antibody; CD1d antibody; CD3 antibody; CD4 antibody; CD5 antibody; CD7 antibody; CD8 antibody; CD11b antibody; CD11c antibody; CD16 antibody; CD19 antibody; CD20 antibody; CD21 antibody; CD22 antibody; CD25 antibody; CD28 antibody; CD34 antibody; CD35 antibody; CD39 antibody; CD40 antibody. The following antibodies are indicated: CD45RA antibody; CD45RO antibody; CD46 antibody; CD52 antibody; CD56 antibody; CD62L antibody; CD68 antibody; CD69 antibody; CD80 antibody; CD86 antibody; CD95 antibody; CD101 antibody; CD117 antibody; CD127 antibody; CD133 antibody; CD137(4-1BB) antibody; CD148 antibody; CD163 antibody; CD209 antibody; DEC-205 antibody; F4 / 80 antibody; IL-4Rα antibody; Sca-1 antibody; CTLA-4 antibody; GITR antibody; GARP antibody; LAP antibody; granzyme B antibody; LFA-1 antibody; or transferrin receptor antibody.

[0304] 54. The method of any one of embodiments 35-53, wherein the synthesized nucleic acid is synthesized mRNA.

[0305] 55. The method of any one of embodiments 35-54, wherein the carrier comprises a positively charged lipid or polymer.

[0306] 56. The method of embodiment 55, wherein the positively charged lipid or polymer comprises poly(β-amino ester, poly(L-lysine), poly(ethyleneimine) (PEI), poly(acylaminoamine) dendrimer (PAMAM), poly(amino-co-ester), poly(dimethylaminoethyl methacrylate) (PDMAEMA), chitosan, poly-(L-lactide-co-L-lysine), poly[α-(4-aminobutyl)-L-glycolic acid] (PAGA) or poly(4-hydroxy-L-proline ester) (PHP).

[0307] 57. The method of any one of embodiments 35-56, wherein the coating comprises a neutral or negatively charged lipid or polymer.

[0308] 58. The method of embodiment 57, wherein the neutral or negatively charged coating comprises polyglutamic acid (PGA), poly(acrylic acid), alginate, or cholesterol hemisuccinate / 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine.

[0309] 59. The method as described in embodiment 57 or 58, wherein the neutral or negatively charged coating comprises an amphoteric polymer.

[0310] 60. The method of any one of embodiments 57-59, wherein the neutral or negatively charged coating comprises liposomes.

[0311] 61. The method of embodiment 60, wherein the liposomes comprise 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), 1,2-di-O-octadecenyl-3-trimethylammonium-propane (DOTMA), 3β-[N-(N′,N′-dimethylaminoethane)-carbamoyl]cholesterol (DC-Chol), octadecyl-aminoglycyl spermine (DOGS), cholesterol, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), or 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC).

[0312] 62. The method as described in any one of embodiments 35-61, wherein the selected cell-targeting ligand selectively binds to CD4 and / or CD8.

[0313] 63. The method of any one of embodiments 35-62, wherein the selected cell-targeting ligand comprises a binding domain selected from CD4 antibodies and / or CD8 antibodies.

[0314] 64. The method of any one of embodiments 35-63, wherein the selected cell-targeting ligand comprises a binding domain of an scFv fragment selected from CD4 antibodies and / or CD8 antibodies.

[0315] 65. The method of any one of embodiments 35-64, wherein the carrier comprises poly(β-amino ester).

[0316] 66. The method of any one of embodiments 35-65, wherein the coating comprises polyglutamic acid (PGA).

[0317] 67. The method of any one of embodiments 35-66, wherein the selected cell-targeting ligand comprises a binding domain selected from CD4 antibodies and / or CD8 antibodies; the carrier comprises poly(β-amino ester); and the coating comprises polyglutamic acid (PGA).

[0318] 68. A method for treating a subject in need, comprising administering a therapeutically effective amount of cells, said cells being modified by transient expression of nucleic acids selectively delivered to said cells by a nanocarrier, said nanocarrier comprising:

[0319] (i) The nucleic acid encapsulated in a positively charged carrier, wherein the synthetic nucleic acid encapsulates a gene editing agent or a phenotypic altering protein;

[0320] (ii) a neutral or negatively charged coating on the outer surface of the carrier; and

[0321] (iii) Selected cell-targeting ligands extending from the coating surface;

[0322] Following the merging process, the nanocarrier is selectively incorporated into the lymphocytes, enabling the lymphocytes to transiently express the nucleic acid.

[0323] This allows for the treatment of the subjects in need.

[0324] 69. A method for preparing a selected cell population for administration to a subject, comprising:

[0325] A sample is obtained from the subject, wherein the sample comprises a heterogeneous mixture of cells, the heterogeneous mixture of cells comprising selected cell populations;

[0326] The sample was exposed to a synthetic nanocarrier, the nanocarrier comprising...

[0327] (i) a synthetic nucleic acid encapsulated in a positively charged carrier, wherein the synthetic nucleic acid encapsulates a gene editing agent or a phenotypic altering protein;

[0328] (ii) a neutral or negatively charged coating on the outer surface of the carrier; and

[0329] (iii) Selected cell-targeting ligands extending from the coating surface;

[0330] The exposure resulted in the selective delivery of the nanocarrier to a selected cell population, leading to modification of cells within the selected cell population; and amplification of cells within the sample; and

[0331] Amplify the cells in the sample;

[0332] The selected cell population is thus prepared for administration to the subject.

[0333] 70. A synthetic nanocarrier comprising:

[0334] (i) Synthetic nucleic acids encapsulated in a positively charged carrier, wherein the nucleic acids encode gene editing agents or phenotypic altering proteins;

[0335] (ii) a neutral or negatively charged coating on the outer surface of the carrier; and

[0336] (iii) Selected cell-targeting ligands extending from the coating surface;

[0337] 71. The synthetic nanocarrier as described in embodiment 70, wherein the synthetic nucleic acid encodes a gene editing agent selected from transcription activator-like effector nucleases (TALENs); megaTALs; and / or zinc finger nucleases.

[0338] 72. The synthetic nanocarrier as described in embodiment 70 or 71, wherein the synthetic nucleic acid encodes megaTAL of SEQ ID NO: 1.

[0339] 73. The synthetic nanocarrier as described in any one of embodiments 70-72, wherein the gene editing agent disrupts endogenous genes encoding Shp-1 phosphatase, PD1 receptor, T cell receptor (TCR), CCR5 and / or CXCR4.

[0340] 74. The synthetic nanocarrier as described in any one of embodiments 70-73, wherein the gene editing agent disrupts the endogenous gene encoding the TCRα chain.

[0341] 75. The synthetic nanocarrier as described in any one of embodiments 70-74, wherein the synthetic nucleic acid encodes a phenotypic altered protein selected from transcription factors, kinases, and / or cell surface receptors.

[0342] 76. The synthetic nanocarrier as described in embodiment 75, wherein the phenotypic altering protein is selected from FOXO1, LKB1, TCF7, EOMES, ID2, TERT, CCR2b and / or CCR4.

[0343] 77. The synthetic nanocarrier as described in any one of embodiments 70-76, wherein the selected cell-targeting ligand selectively binds to lymphocytes within a heterogeneous cell population.

[0344] 78. The synthetic nanocarrier as described in embodiment 77, wherein the heterogeneous cell population is an ex vivo cell culture.

[0345] 79. The synthetic nanocarrier as described in embodiment 77, wherein the heterogeneous cell population is in vivo.

[0346] 80. The synthetic nanocarrier as described in any one of embodiments 70-79, wherein the selected cell-targeting ligand selectively binds to T cells, NK cells, monocytes, macrophages, dendritic cells, B cells, hematopoietic stem cells, or combinations thereof.

[0347] 81. The synthetic nanocarrier as described in any one of embodiments 70-80, wherein the selected cell-targeting ligand comprises a binding domain selected from lymphocyte receptor ligands, lymphocyte receptor antibodies, lymphocyte receptor peptide aptamers, lymphocyte receptor nucleic acid aptamers, lymphocyte receptor Spiegelmer, or combinations thereof.

[0348] 82. The synthetic nanocarrier as described in any one of embodiments 70-81, wherein the selected cell-targeting ligand selectively binds to T cell receptor motifs; T cell α chain; T cell β chain; T cell γ chain; T cell δ chain; CCR7; CD1a; CD1b; CD1c; CD1d; CD3; CD4; CD5; CD7; CD8; CD11b; CD11c; CD16; CD19; CD20; CD21; CD22; CD25; CD28; CD34; CD35; CD39; C D40; CD45RA; CD45RO; CD46, CD52; CD56; CD62L; CD68; CD69; CD80; CD86; CD95; CD101; CD117; CD127; CD133; CD137(4-1BB); CD148; CD163; CD209; DEC-205; F4 / 80; IL-4Rα; Sca-1; CTLA-4; GITR; GARP; LAP; granzyme B; LFA-1; or transferrin receptor.

[0349] 83. The synthetic nanocarrier as described in any one of embodiments 70-82, wherein the selected cell-targeting ligand selectively binds to CD1a; CD1b; CD1c; CD1d; CCR7; CD3; CD4; CD5; CD8; CD16; CD19; CD20; CD21; CD22; CD25; CD28; CD35; CD40; CD45RA; CD45RO; CD46; CD52; CD62L; CD69; CD80; CD95; CD127; CD137; CD209; or DEC-205.

[0350] 84. The synthetic nanocarrier as described in any one of embodiments 70-83, wherein the selected cell-targeting ligand comprises a binding domain selected from: T cell α-chain antibody; T cell β-chain antibody; T cell γ-chain antibody; T cell δ-chain antibody; CCR7 antibody; CD1a antibody; CD1b antibody; CD1c antibody; CD1d antibody; CD3 antibody; CD4 antibody; CD5 antibody; CD7 antibody; CD8 antibody; CD11b antibody; CD11c antibody; CD16 antibody; CD19 antibody; CD20 antibody; CD21 antibody; CD22 antibody; CD25 antibody; CD28 antibody; CD34 antibody; CD35 antibody; CD39 antibody; CD40 antibody. CD45RA antibody; CD45RO antibody; CD46 antibody; CD52 antibody; CD56 antibody; CD62L antibody; CD68 antibody; CD69 antibody; CD80 antibody; CD86 antibody; CD95 antibody; CD101 antibody; CD117 antibody; CD127 antibody; CD133 antibody; CD137(4-1BB) antibody; CD148 antibody; CD163 antibody; CD209 antibody; DEC-205 antibody; F4 / 80 antibody; IL-4Rα antibody; Sca-1 antibody; CTLA-4 antibody; GITR antibody; GARP antibody; LAP antibody; granzyme B antibody; LFA-1 antibody; or transferrin receptor antibody.

[0351] 85. The synthetic nanocarrier as described in any one of embodiments 70-84, wherein the binding domain is composed of or substantially composed of scFv fragments of the following: T cell α chain antibody; T cell β chain antibody; T cell γ chain antibody; T cell δ chain antibody; CCR7 antibody; CD1a antibody; CD1b antibody; CD1c antibody; CD1d antibody; CD3 antibody; CD4 antibody; CD5 antibody; CD7 antibody; CD8 antibody; CD11b antibody; CD11c antibody; CD16 antibody; CD19 antibody; CD20 antibody; CD21 antibody; CD22 antibody; CD25 antibody; CD28 antibody; CD34 antibody; CD35 antibody; CD39 antibody; CD4 0 antibody; CD45RA antibody; CD45RO antibody; CD46 antibody; CD52 antibody; CD56 antibody; CD62L antibody; CD68 antibody; CD69 antibody; CD80 antibody; CD86 antibody; CD95 antibody; CD101 antibody; CD117 antibody; CD127 antibody; CD133 antibody; CD137(4-1BB) antibody; CD148 antibody; CD163 antibody; CD209 antibody; DEC-205 antibody; F4 / 80 antibody; IL-4Rα antibody; Sca-1 antibody; CTLA-4 antibody; GITR antibody; GARP antibody; LAP antibody; granzyme B antibody; LFA-1 antibody; or transferrin receptor antibody.

[0352] 86. The synthetic nanocarrier as described in any one of embodiments 70-85, wherein the synthetic nucleic acid is synthetic mRNA.

[0353] 87. The synthetic nanocarrier as described in any one of embodiments 70-86, wherein the carrier comprises a positively charged lipid or polymer.

[0354] 88. The synthetic nanocarrier as described in embodiment 87, wherein the positively charged lipid or polymer comprises poly(β-amino ester, poly(L-lysine), poly(ethyleneimine) (PEI), poly(acylaminoamine) dendrimer (PAMAM), poly(amino-co-ester), poly(dimethylaminoethyl methacrylate) (PDMAEMA), chitosan, poly-(L-lactide-co-L-lysine), poly[α-(4-aminobutyl)-L-glycolic acid] (PAGA) or poly(4-hydroxy-L-proline ester) (PHP).

[0355] 89. The synthetic nanocarrier as described in any one of embodiments 70-88, wherein the coating comprises a neutral or negatively charged lipid or polymer.

[0356] 90. The synthetic nanocarrier as described in embodiment 89, wherein the neutral or negatively charged coating comprises polyglutamic acid (PGA), poly(acrylic acid), alginate, or cholesterol hemisuccinate / 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine.

[0357] 91. The synthetic nanocarrier as described in embodiment 89 or 90, wherein the neutral or negatively charged coating comprises a zwitterionic polymer.

[0358] 92. The synthetic nanocarrier as described in any one of embodiments 89-91, wherein the neutral or negatively charged coating comprises liposomes.

[0359] 93. The synthetic nanocarrier as described in embodiment 92, wherein the liposomes comprise 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), 1,2-di-O-octadecenyl-3-trimethylammonium-propane (DOTMA), 3β-[N-(N′,N′-dimethylaminoethane)-carbamoyl]cholesterol (DC-Chol), octadecyl-aminoglycyl spermine (DOGS), cholesterol, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), or 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC).

[0360] 94. The synthetic nanocarrier as described in any one of embodiments 70-93, wherein the selected cell-targeting ligand selectively binds CD4 and / or CD8.

[0361] 95. The synthetic nanocarrier as described in any one of embodiments 70-94, wherein the selected cell-targeting ligand comprises a binding domain selected from CD4 antibodies and / or CD8 antibodies.

[0362] 96. The synthetic nanocarrier as described in any one of embodiments 70-95, wherein the selected cell-targeting ligand comprises a binding domain of an scFv fragment selected from CD4 antibodies and / or CD8 antibodies.

[0363] 97. The synthetic nanocarrier as described in any one of embodiments 70-96, wherein the carrier comprises poly(β-amino ester).

[0364] 98. The synthetic nanocarrier as described in any one of embodiments 70-97, wherein the coating comprises polyglutamic acid (PGA).

[0365] 99. The synthetic nanocarrier as described in any one of embodiments 70-98, wherein the selected cell-targeting ligand comprises a binding domain selected from CD4 antibodies and / or CD8 antibodies; the carrier comprises poly(β-amino ester); and the coating comprises polyglutamic acid (PGA).

[0366] 100. A composition comprising a synthetic nanocarrier as described in any one of embodiments 70-99.

[0367] 101. A method of treating a subject in need, comprising administering a therapeutically effective amount of a nanocarrier as described in any one of embodiments 70-99 or a composition as described in embodiment 100, thereby treating the subject in need.

[0368] 102. The uses of the nanocarriers disclosed herein for the selective delivery of nucleic acids encoding CARs or TCRs to selected cell types.

[0369] Example 1. Introduction. Genetically engineering T cells to express chimeric antigen receptors (CARs) or T-cell receptors (TCRs) to guide immune responses against cancer is a therapy that is beginning to produce significant results, and important clinical trials are on the horizon. The process of bioengineering T cells into ‘living drugs’ that can increase in number, continuously destroy tumor cells, and eventually differentiate into long-lived memory T cells requires the stable integration of receptor transgenes into the genome of lymphocytes. Despite the time and cost required for their production, and the limitations on the size and number of genes they can package, viral vectors are currently the most effective means of programming these cells with tumor-recognizing capabilities for application (Zhang et al., Nat Commun 6, 7639 (2015); Cribbs et al., BMC Biotechnol 13, 98 (2013)).

[0370] In addition to these chronic gene expression systems, phenotypic changes in cells can also be induced by transient expression of macromolecules targeting hit-and-run mechanisms. In most of these transient applications, the permanent expression of therapeutic transgenes is undesirable and potentially dangerous (Wurm et al., Exp Hematol 42, 114-125 e114 (2014)); examples include the use of transcription factors to control cell differentiation (Themeli et al., Nat Biotechnol 31, 928-933 (2013); Costa et al., Development 142, 1948-1959 (2015)), and the use of sequence-specific nuclease expression to engineer genomes (Cox et al., Nat Med 21, 121-131 (2015)).

[0371] While transient gene therapy is increasingly used to significantly enhance the curative potential of engineered T cells, currently available methods (similar to the chronic expression methods described above, which are primarily based on viral vectors) are complicated by the cost of the sophisticated protocols required for transduction (Nightingale et al., Mol Ther 13, 1121-1132 (2006)). Electroporation has been developed as an alternative transfection method, but the mechanopermeability of the plasma membrane impairs T cell viability, meaning these methods are not suitable for scale-up applications. Furthermore, similar to virus-based methods, electroporation cannot selectively transfect specific cell types from a heterologous library, therefore it must be performed after cell purification.

[0372] This example describes the generation of transient gene expression in cultured T cells without the use of the involved protocols or complex auxiliary devices. Appropriately designed mRNA nanocarriers can easily achieve dose-controlled delivery of functional macromolecules to lymphocytes by simply mixing the reagent with the cells in vitro. Figure 1A ).

[0373] These nanoparticles (NPs) can bind to targeted cell subtypes and stimulate receptor-mediated endocytosis, providing entry for their carried synthetic mRNA and enabling lymphocytes to express the encoded molecules. This process is rapid and efficient because it does not require nuclear transport and transcription of transgenes. How this novel platform can be implemented to produce high-quality CAR-T cell products for clinical use is illustrated in at least two examples. In the first application, the targeted mRNA nanocarrier is used as a genome editing tool for T cells. Delivery of mRNA encoding a rarely cleaved megaTAL nuclease (Boissel et al., Methods MolBiol 1239, 171-196 (2015)) effectively disrupts T cell receptor expression in lymphocytes. In the second application, Foxo1, a key regulator of reprogrammed effector cell differentiation into functionally competitive memory cells (Tejera et al., J Immunol 191, 187-199 (2013); Kim et al., Immunity 39, 286-297 (2013)), was transiently expressed. The results indicate that exposure to engineered nanoparticles biases T cells towards a central memory phenotype.

[0374] The most significant benefit of this system is the simplicity of achieving genetic modification of therapeutic cells on a clinical scale: all that is required is mixing appropriate nanoparticle reagents with lymphocytes. This method contrasts sharply with current methods for transient genetic material delivery, which are less efficient and involve numerous specialized, expensive, and proprietary procedures that limit their availability. Beyond T-cell therapy, the transient gene delivery platform can be easily integrated into existing manufacturing processes for other therapeutic cell types, such as natural killer cells, dendritic cells, hematopoietic stem cells, or mesenchymal stem cells, to significantly enhance their curative potential without increasing processing time, risk, or complexity.

[0375] Materials and Methods. Research Design. The aim of this project was to develop a nanomaterial for targeted mRNA delivery to primary T cells in vitro. Pilot experiments were conducted using cells obtained from individual donors to optimize nanocarrier-mediated delivery for a specific application, followed by replication of the optimized protocol using samples from multiple donors.

[0376] Synthesis of PBAE 447. This polymer was synthesized using a method similar to that described by Mangraviti et al. (Mangraviti et al., ACS Nano 9, 1236-1249 (2015)). 1,4-Butanediol diacrylate and 4-amino-1-butanol were combined at a diacrylate to amine monomer molar ratio of 1.1:1. The mixture was heated to 90 °C for 24 h with stirring to produce acrylate-capped poly(4-amino-1-butanol-co-1,4-butanediol diacrylate). 2.3 g of this polymer was dissolved in 2 ml of tetrahydrofuran (THF). To form the piperazine-capped 447 polymer, 786 mg of 1-(3-aminopropyl)-4-methylpiperazine dissolved in 13 ml of THF was added to the polymer / THF solution. The resulting mixture was stirred at RT for 2 h, and then the capped polymer was precipitated with 5 volumes of diethyl ether. After pouring out the solvent, wash the polymer with 2 volumes of fresh ether, and then dry the residue under vacuum for 2 days before use to form a stock solution of 100 mg / ml in DMSO, which is then stored at -20°C.

[0377] PGA-antibody conjugation. 15 kD polyglutamic acid (from Alamanda Polymers) was dissolved in water to form a concentration of 20 mg / ml and sonicated for 10 min. An equal volume of 4 mg / ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (Thermo Fisher) in water was added, and the solution was mixed at RT for 5 min. The resulting activated PGA was then combined with the antibody in phosphate-buffered saline (PBS) at a 4:1 molar ratio and mixed at RT for 6 h. To remove unconjugated PGA, the solution was passed through a 50,000 NMWCO membrane (Millipore) and exchanged three times with PBS. Antibody concentrations were determined using a NanoDrop 2000 spectrophotometer (ThermoScientific). The antibodies used for T-cell assays were anti-CD3 (clone OKT3), anti-CD4 (clone OKT4), anti-CD8 (clone OKT8), and anti-CD28 (clone 9.3, all from BioXCell). Clone C1.18.4 was used as a control antibody. For HSC transduction, polyclonal goat anti-mouse IgG and polyclonal goat anti-mouse CD105 antibody (Fisher) were used.

[0378] mRNA synthesis. TriLink Biotechnologies produced mRNAs with codons optimized for eGFP, Foxo1, Trex2, and TRAC-megaTAL, completely substituted with modified ribonucleotides pseudouridine (Ψ) and 5-methylcytidine (m5C) and capped with ARCA. We conjugated Ψ and m5C-modified eGFP mRNAs with cy5 (also from TriLink) for tracking the delivery of these transcripts.

[0379] Nanoparticle preparation. The mRNA stock solution was diluted to 100 μg / ml in sterile, nuclease-free 25 mM sodium acetate buffer (pH 5.2) (NaOAc). The PBAE-447 polymer in DMSO was diluted to 6 mg / ml in NaOAc and added to the mRNA at a 60:1 (w:w) ratio. The resulting mixture was vortexed at medium speed for 15 sec and then incubated at room temperature for 5 min to form NPs. To add targeting elements to the nanoparticles, a PGA-linked antibody was diluted to 250 μg / ml in NaOAc and added to the mRNA at a 2.5:1 (w:w) ratio. The resulting mixture was vortexed at medium speed for 15 sec and then incubated at room temperature for 5 min to allow the PGA-Ab to bind to the NPs.

[0380] The nanoparticles were lyophilized by mixing them with 60 mg / ml D-sucrose as a cryoprotectant, rapidly freezing them in liquid nitrogen, and then processing them in a FreeZone 2.5L lyophilization system (Labconco). The lyophilized NPs were stored at -80°C until use. For application, the lyophilized NPs were resuspended in a volume of sterile water to restore their original concentration.

[0381] Nanoparticle characterization. The hydrodynamic radius of the generated particles was measured using a Nanosite (Malvern) instrument, and their zeta potential was determined using dynamic light scattering detected with a Zetapals instrument (Brookhaven Instrument Corporation). Particles were diluted 1:400 (v / v) in PBS (pH 7.4) for size measurements and 1:40 for zeta potential quantification. For transmission electron microscopy, 25 μl nanoparticle samples were individually applied to glow discharge-activated 200-mesh carbon / formvar-coated copper grids. After 30 seconds, the grids were sequentially contacted with one drop of 1 / 2 Kamovsky's fixative, one drop of 0.1 M dimethylarsyl salt buffer, eight drops of dH₂O, and then 1% (w / v) filtered uranium acetate was added. These samples were examined using a JEOL JEM-1400 transmission electron microscope (JEOL USA).

[0382] Cell lines and culture media. K562-CD19 and control K562 cells were provided by Dr. Stanley Riddell (Fred Hutchinson Cancer Research Center). TM-LCL is a CD19+ EBV-transformed lymphoblastoid cell line that has been optimized for use as feeder cells for T cell expansion (36). The Jurkat-E6 T cell line was available from the American Type Culture Collection. These cell lines were cultured in T cell medium (TCM): RPMI-1640 containing 10% fetal bovine serum, 0.8 mM L-glutamine, 25 mM HEPES buffer, and 1% penicillin-streptomycin.

[0383] As indicated, primary human peripheral blood mononuclear cells (PBMCs) and T cells were cultured in TCM supplemented with 50 IU IL-2 / ml (Preprotech) or in ImmunoCult-XF T cell expansion medium (XFSFM) (Stemcell).

[0384] T cell mRNA transfection. PBMCs from normal donors were thawed dropwise by adding warm TCM, followed by centrifugation. CD8 T cells were isolated via negative selection (Stemcell) as indicated. Cells were then centrifuged at 10... 6 Cells / ml were cultured in TCM+IL-2 at a ratio of 1:1 bead:cell. Stimulation was performed using CD3 / CD28 beads (Dynabeads, Life Technologies). For those involving... Experiments on CD3-targeted nanoparticle transduction were conducted by removing the beads 24 hours before adding NP.

[0385] For NP-mediated transfection, T cells were resuspended in XFSFM to a concentration of 2 × 10⁻⁶. 6 / ml. Contains 2.5μg mRNA / 10 6 The antibody-targeted NPs for each cell type were added to this suspension and exposed at 37°C for 2 hours, followed by washing the cells with 3 volumes of TCM + IL-2. The control NPs contained eGFP mRNA. The NPs that edited the TCRα gene contained TRAC-megaTAL, Trex2, and eGFP mRNA in a 42:42:16 w:w:w ratio. Foxo1 3A NP contains Foxo1 at a ratio of 84:16 w:w 3A and eGFP mRNA.

[0386] For electroporation, use 2×10 6 Each T cell was washed twice with PBS containing 0.5% bovine serum albumin (BSA), resuspended in 100 μl of T cell electroporation medium (Lonza) containing 3 μg eGFP mRNA, transferred to electroporation cuvettes, and processed using program T-20 on a Nucleofector (Lonza) instrument. The perforated cells were then transferred to a plate containing 2 ml of antibiotic-free TCM + IL-2.

[0387] NP transduction of CD34+ cells. CD34+ cells, purified from PBSC previously mobilized from normal donors, were obtained from the Hematopoietic Cell Processing and Repository Core at the Fred Hutchinson Cancer Research Center. After thawing, cells were counted and then transduced in HSC medium at 10⁻⁶. 6Cells were cultured overnight at a concentration of 2.5 × 10⁶ ml in StemSpan SFEMII serum-free medium supplemented with 50 ng / ml human stem cell factor (Scf), 50 ng / ml mouse Flt3 / Flk-2 ligand, and 25 ng / ml human thrombopoietin (Stemcell Technologies). The next day, cells were harvested, counted, and cultured in 96-well tissue culture plates (Costar) at a concentration of 2.5 × 10⁶ ml. 4 Cells / well were resuspended in 100 μl of cytokine-free HSC. Cells were either left untreated or treated with CD105-targeted or control anti-mouse-targeted NP containing 1 μg eGFP mRNA per well. Cells were treated with NP for 1 h, then washed twice with 1 ml of cytokine-free HSC medium. The washed cells were then transferred to 500 μl of complete HSC medium in 24-well tissue culture plates; after 48 h, cells were labeled for CD34 and CD105 (BioLegend) for analysis by flow cytometry.

[0388] PCR amplification and insertion / deletion (Indel) detection of TCRα. Insertion / deletion detection was performed using the Geneart Genomic Cleavage Detection Kit (Invitrogen) according to the manufacturer's instructions. Briefly, T cells were lysed, and genomic DNA side-linked to the TCRα MegaTAL target site was amplified by PCR using these primers: TRAC-forward CCCGTGTCATTCTCTGGACT (SEQ ID NO: 53) and TRAC-reverse ATCACGAGCAGCTGGTTTCT (SEQ ID NO: 54). The PCR products were denatured, annealed, and treated with a detection enzyme, allowing for the assessment of insertion / deletion formation by comparing the density of gel bands relative to the specific cleavage bands.

[0389] Lentiviral transduction and T cell expansion were performed using 19-41BBζCAR. As described (Liu et al., Nat Biotechnol 34, 430-434 (2016)), a single StrepTag was used to modify the 19-41BB CAR containing the 41BB and CD3ζ signaling domains. Human anti-CD19 CAR constructs were generated and transferred into the epHIV7 lentiviral vector. VSVG pseudotyped lentivirus was generated by calcium phosphate transfection (Invitrogen) of Lenti-X 293T cells (Clontech) using the epHIV7 lentiviral vector and viral packaging plasmids pCMVdR8.91 and pMD2.G. For lentiviral transduction, T cells were transferred at a 5:1 MOI to fibronectin-coated plates (Takara) containing 8 μg / ml polybrene and lentivirus encoding 19-41BBζ-CAR, and then infected by rotation at 800×g for 1 h at 34°C. To selectively expand 19-41BBζ-transduced cells, lymphocytes were stimulated in TCM+Il-2 at a 1:7 ratio with irradiated (7000 rads) CD19+TM-LCL cells.

[0390] Cell sorting and flow cytometry. Data were acquired using a BD LSR Fortessa or FacsCanto II cell analyzer running FACSDIVA software, sorted on a BD FACS ARIA-II, and analyzed using FlowJo v10.1. Antibodies used in flow cytometry are listed below. Figure 2 middle.

[0391] Intracellular cytokine staining. Cells were cultured in TCM for 6 h with 3 μg / ml brevidin A+ / - 20 ng / ml PMA and 1 μg / ml iomycin (Sigma-Aldrich). Prior to fixation, anti-CD8 and anti-CD3 staining was used to identify TCR+CD8+ and TCR-CD8+ cell subsets. Then, anti-... Before labeling with IL-2 mAb (BioLegend), cells were subjected to the Fix and Perm kit (BD Biosciences).

[0392] Intracellular staining of Foxo1. 10 cells were transfected with anti-CD3-targeting NP containing either 3 μg eGFP mRNA or 2.5 μg Foxo13A and 0.5 μg eGFP mRNA. 6 Jurkat T cells were collected. After 24 h, the cells were fixed with 4% paraformaldehyde in PBS, washed once, and permeabilized with 90% ice-cold methanol for 30 min. The samples were blocked with 0.5% BSA in PBS at room temperature, then stained with rabbit anti-Foxo1 (clone C29H4) or isotype (clone DAE1), followed by staining with anti-rabbit IgG F(aB′)2Alexa-647 (Cell Signaling).

[0393] CAR T-cell killing assay. Specific cell lysis of CAR target cells was determined by flow cytometry. Target K562-CD19 cells were labeled with low (0.4 μM) fluorescein succinimide (CFSE) at 37 °C, and control K562 cells were labeled with high (4.0 μM) CFSE for 15 min. Both samples were washed in serum-containing complete medium, mixed at a 1:1 ratio, and then co-cultured with 19-41BBζ at a specified effector:target ratio. To assess specific cell lysis, T cells were identified by anti-CD8 mAb (BioLegend) staining and excluded by 7AAD staining under each condition, and analyzed by flow cytometry. Specific cell killing was assessed by measuring the ratio of surviving CD19+ target cells (low CFSE) to control CD19-K562 cells (high CFSE).

[0394] Microscopy. 400 μl of XFSFM containing 10... 6 T cells were treated with anti-CD3-targeting NP containing 3 μg cy5-labeled eGFP mRNA at 4°C for 1 h for surface binding, followed by incubation at 37°C for 2 h for internalization. After these treatments, the cells were washed three times with cold PBS and loaded onto poly-L-lysine (Sigma)-coated slides at 4°C for 30 min. The samples were fixed in 2% paraformaldehyde in ProLong Gold Antifade reagent (Invitrogen) and imaged using a Zeiss LSM 780NLO laser scanning confocal microscope.

[0395] RNA purification, RT-PCR, sequencing, and bioinformatics analysis were performed. Total RNA was isolated by column-based DNA digestion using the DirectZol kit (Zymo) after T cell lysis in Trizol reagent (Ambion). For real-time quantitative PCR (qPCR), cDNA was prepared using a high-capacity cDNA kit (Applied Biosystems). The expression levels of endogenous FOXO1 and codon-optimized FOXO13A relative to the housekeeping gene B2M were measured using PrimeTime qPCR assay (integrated DNA technology) and a QuantStudio 5 machine (Applied Biosystems). Primers for detecting codon-optimized Foxo13A were selected to avoid cross-detection of endogenous Foxo1 mRNA.

[0396] Foxo13A forward: GGACAGCCTAGAAAGAGCAG (SEQ ID NO: 55)

[0397] Foxo13A probe: AGGTCGGCGTAGCTCAGATTGC (SEQ ID NO: 56)

[0398] Foxo13A Reverse: CTCTTGACCATCCACTCGTAG (SEQ ID NO: 57)

[0399] For RNA-seq analysis, RNA samples were isolated from CD8+ cells cultured in vitro after 3 and 8 days of in vitro culture, treated with control NP- and Foxo13A NP-, and compared with sorted reference primordial (CD8+CD45RA+CD62L+CCR7+) and TCM (CD8+CD45RA-CD62L+CCR7+) cells from cryopreserved PBMC samples matched by two independent donors. RNA-seq libraries were prepared using the TruSeq Sample Preparation Kit (Illumina) according to the manufacturer's instructions. The libraries were sequenced for 50 cycles (paired ends) using the HiSeq platform (Illumina). Results were compared using TopHat v2.1.0 with Illumina's base calling and quality filters through the human hg38 genome. Execution was performed in "cross-strict" overlap mode, and counts for each gene were generated using htseq-counting (v0.6.1p1). The GLM method in edgeR was used for data normalization and differential expression analysis. The TCM tag gene set was defined as the top 500 genes ranked statistically significantly, whose expression at day 8 was either higher (TCM up) or lower (TCM down) in CD8+ T cells treated with donor-matched control NP. Gene set enrichment was analyzed using a gene list ranked by sign: fold change × 1 / (p-value) (37). Raw and processed data from the RNA-seq analysis are deposited in NCBI's GeneExpression Omnibus, GEO Series Accession No. GSE89134. (38)

[0400] Statistical analysis. Unless otherwise stated, graphs show the mean ± standard error of the mean. Statistical analysis was performed using Prism software (Graphpad).

[0401] Results. mRNA nanocarriers were designed to program robust transgene expression in T cells. To generate agents capable of genetically modifying primary T lymphocytes (a process notoriously difficult to control with non-viral transfection methods), polymer nanoparticles comprising the following four functional components were bioengineered. Figure 1B(i) Surface-anchored targeting ligands that selectively bind nanoparticles to T cells and induce rapid receptor-induced endocytosis for internalization. Anti-CD3 and anti-CD8 antibodies were used in the experiments; (ii) a negatively charged coating that shields the nanoparticles by reducing their surface charge to minimize off-target binding. Polyglutamate (PGA) was chosen for this purpose because it is widely used as a drug delivery platform; (iii) a carrier matrix that aggregates and protects nucleic acids from enzymatic degradation while they are in the endosomes, but releases them once the particles are transported to the cytoplasm, enabling transcription of the encoded proteins. For this purpose, a biodegradable poly(β-amino ester) (PBAE) polymer formulation with a half-life of 1 to 7 hours under aqueous conditions was used; and (iv) nucleic acids encapsulated within the carrier that result in gene editing or transient expression of proteins that permanently alter the T cell phenotype. mRNA is an ideal platform for transient therapeutic protein expression because it does not have the potential for genome integration and does not require nuclear localization for expression. However, unmodified mRNA can activate intracellular bell-like receptors, thereby limiting protein expression and leading to toxicity (Kariko et al., Immunity 23, 165-175 (2005)). To improve stability and reduce the immunogenic potential of delivered mRNA, synthetic versions incorporating modified nucleotides are used. For example, replacing uridine with engineered base pseudouridine and 5-methylcytidine, cytidine synergistically blocks recognition by innate pattern recognition receptors and increases mRNA translation.

[0402] NPs were fabricated using a two-step charge-driven self-assembly process. First, synthesized mRNA was complexed with a positively charged PBAE polymer, which condensed the mRNA into a nanoscale complex. Figure 3A (3B). Following this step, antibody-functionalized PGA is added, which shields the positive charge of the PBAE-mRNA particles and confers lymphocyte targeting. The resulting mRNA nanocarrier has a size of 109.6 ± 26.6 nm and an almost neutral surface charge (1.1 ± 5.3 mV ζ potential). Figure 3C ).

[0403] mRNA nanocarriers achieve T-cell transfection efficiency similar to electroporation without compromising viability. The goal is to simplify the fabrication of cell-based therapies; therefore, the first step was to test whether simply adding targeted mRNA nanocarriers to established human lymphocyte cultures was sufficient to orchestrate robust transfection. When CD3-targeting NPs carrying mRNA encoding reporter proteins (enhanced green fluorescent protein, eGFP) are co-incubated with these cells, they not only bind to the cells but also stimulate receptor-mediated endocytosis, thereby facilitating entry of the gene carried by the particle (…). Figure 4A In a single NP application (NP:T cell ratio = 2 × 10⁻⁶),4 Following a :1) transfection, transgene expression was observed as early as 5 hours post-transfection in 85% of these primary T cells (routine transfection). Figure 4B ()( Figure 5A Therefore, this process is quick and efficient. Importantly, it is not necessary to prepare mRNA NPs fresh for each application; instead, they can be lyophilized before use without altering their properties or efficacy. Figure 5B ).

[0404] Next, the effect of targeted mRNA-carrying NPs on T cell expansion was evaluated. Because malignancies often progress rapidly, it is important that engineered T cells can be rapidly expanded to clinically relevant scales. A widely used method in clinical laboratories for various polyclonal lymphocytes is to incubate them with beads coated with antibodies against TCR / CD3 and the co-stimulatory CD28 receptor. This involves repeated transfection with CD3-targeted NPs (NP:T cell ratio: 2 × 10⁻⁶). 4 ∶1) It also did not interfere with the proliferation of T cells stimulated by these coated beads. Figure 4C This result contrasts sharply with the parallel test of T-cell electroporation. Electroporation not only adds complex cell processing steps (such as culture medium exchange and centrifugation cycles), Figure 4D This method also impairs the viability of lymphocytes. Figure 6 This reduced T cell production by 60 times. Figure 4D (See right image).

[0405] Nanoparticle transfection is seamlessly integrated into the CAR-T cell manufacturing workflow to achieve efficient genome editing. This method was tested in clinically relevant applications by incorporating NP-mediated mRNA transfection into the manufacture of leukemia-specific 19-41BBζCAR T cells. Figure 7ACD19-targeted receptors are currently the most studied CAR-T cell products, with nearly 30 ongoing clinical trials internationally (Sadelain et al., J Clin Invest 125, 3392-3400 (2015)). The current ability to perform genome engineering offers the potential to improve the safety and efficacy of CAR-T cells. For example, the expression of endogenous TCRs can be eliminated to avoid graft-versus-host disease. Furthermore, immune checkpoint genes can be selectively deleted to enhance their activity in suppressive tumor environments (Menger et al., Cancer Res 76, 2087-2093 (2016); Torikai et al., Blood 119, 5697-5705 (2012)). However, the use of electroporation to deliver genome editing agents into cells poses a substantial obstacle to the scale-up of T cell production. Therefore, the ability of NPs to deliver gene editing agents targeting the constant region (TRAC) of the TCRα gene was measured by preparing particles carrying mRNA-encoded megaTAL nucleases. Leveraging the flexibility offered by the NP formulation method, including mRNA encoding the DNA repair endonuclease TREX2 and eGFP mRNA for tracking transfection, knockout efficiency is improved. Control particles are loaded with only eGFP mRNA. This is in contrast to eGFP transfection (which does not affect TCR expression); Figure 7B Conversely, adding TCRα-megaTAL particles to T cell cultures up to day 5 effectively disrupted TCR expression, an effect maintained even after mRNA loss by day 12. Figure 7B (Bottom row). Compared with the control, the mean TCR level was 60.8% (±17.7%; Figure 73C), which corresponds to the percentage of insertion / deletion frequency determined using Surveyor assay (a measure of targeting efficiency). Figure 7D Importantly, the presence of nanoparticles carrying mRNA did not affect virus-mediated gene transfer of tumor-specific CARs, as equivalent transduction efficiencies to those of lentiviral vectors encoding 19-41BBζCARs were achieved in both NP-transfected and untransfected T cells. Figure 7E Following NP-mediated genome editing and lentiviral transduction, CAR-programmed T cells fully maintained their ability to proliferate, secrete cytokines, and kill leukemia target cells. Figure 7F-7H In summary, these findings confirm that lymphocyte-targeted mRNA nanocarriers can mediate effective genome editing of CAR-T cells without impairing their function.

[0406] NP-encoding the transcription factor Foxo1 is delivered to imprint memory CAR-T cells with mRNA. The next step is to examine whether lymphocyte-targeting mRNA NPs can improve the therapeutic activity of CAR-T cells by delivering mRNAs that are programmed to produce a favorable phenotype. Clinical findings have established that T cell products derived from CD62L+ central memory T cells (TCMs) demonstrate improved engraftment and function in animal models, and the fraction of CD62L+ TCM phenotype cells in the infused product is associated with successful CAR therapy (Louis et al., Blood 118, 6050-6056 (2011); Sommermeyer et al., Leukemia 30, 492-500 (2016)). However, to achieve therapy-relevant lymphocyte numbers, these cells must undergo multiple rounds of in vitro stimulation / expansion—a process that drives cells away from the TCM lineage and into terminal differentiation and senescence (Wang et al., Journal of Immunotherapy 35, 689-701 (2012)). To address this issue, T-cell-targeting NPs loaded with mRNA encoding the forkhead family transcription factor Foxo1 were created, which controls the effector-to-memory transition in CD8 T cells (Tejera et al., J Immunol 191, 187-199 (2013); Kim et al., Immunity 39, 286-297 (2013)). During in vitro stimulation / expansion, TCR and cytokine signaling activate AKT kinase. This enzyme phosphorylates Foxo1, leading to its cytoplasmic dissociation and blocking of transcriptional activity. To maintain Foxo1 in cultured T cells, an AKT-insensitive variant of the factor was used, in which three key phosphorylated residues were mutated to alanine (Foxo13A). It is hypothesized that the addition of Foxo13A-containing NPs to the T-cell culture medium during in vitro expansion will promote CD62L+ with improved therapeutic potential. TCM cell development. The effects of transcription factors on reprogramming are sensitive to the magnitude and duration of their expression. To determine these values ​​after Foxo13A-NP addition, Foxo1 protein and mRNA expression in nanoparticle-treated cells were measured. In the Jurkat T cell line, endogenous Foxo1 expression was low, as measured by intracellular markers, and Foxo13A-NP treatment resulted in a significant increase in the total expression of this factor. Figure 8A (Left figure). In primary T cells, the expression level of Foxo1 protein was already high, and Foxo13A-NP only resulted in a modest increase. This indicates that NP treatment can induce near-physiological levels of active Foxo13A transcription factor. Figure 8A(See right figure). To determine the mRNA dynamics after NP transfection into activated proliferating T cells, Foxo13A expression was measured using real-time quantitative PCR specific to engineered mRNA. mRNA expression peaked on day 1 and approached baseline on day 8 post-transfection. Figure 8B Treatment with Foxo13A NP after in vitro T cell priming rapidly increased CD62L expression. Figure 8C Foxo13A is a major surface marker distinguishing TCM from effectors and effector memory populations (Sallusto et al., Nature 401, 708-712 (1999)). To determine whether transient expression of Foxo13A leads to persistent alterations in CD8+ T cell differentiation, cells from three independent donors were treated with CD8-targeted Foxo13A-eGFP NPs, sorted based on eGFP expression, and maintained in vitro. An increased frequency of CD62L+ cells was observed 24 hours after transfection, and this was maintained even at 8 and 20 days after NP addition. Figure 8D ).

[0407] To understand the Foxo13A-induced genetic regulatory network and its connection to the TCM lineage, RNA-Seq was performed on isolated primordial CD8, TCM CD8, and in vitro cultured CD8T cells treated with Foxo13A-encoded NPs or control particles. TCM tags (consisting of the top 500 genes expressed at higher or lower levels in TCM compared to the average CD8 T cells) were identified. Figure 8E and Figure 9A Most of these genes are coordinatedly regulated in primary CD8 T cells, consistent with the close transcriptional relationship between primary and TCM (Kaech and Cui, Immunol 12, 749-761 (2012)). Foxo13A-coding NP treatment resulted in differential expression of a large number of genes. As expected, these included those encoding the key memory transcriptional effector KLF2, as well as surface molecules SELL (CD62L), CD28, and S1PR1, all of which are key mediators of CD8 TCM transport and function. Figure 8F (Skon et al., Nature Immunology 14, 1285-1293 (2013); Boesteanu et al., Seminars in Immunology 21, 69-77 (2009)). Overlaying TCM gene tags onto a Foxo13A volcano plot revealed strong transcript homogeneity: TCM-tagged genes were upregulated in Foxo13A-programmed CD8 cells. Gene set enrichment analysis confirmed the strong association between Foxo13A-regulated transcripts and TCM-related gene expression. Figure 9BIn summary, these results indicate that Foxo13A-encoding NPs induce persistent changes in surface markers and are transcribed toward a TCM-like phenotype.

[0408] Discussion. This example demonstrates that properly designed mRNA nanocarriers can transiently program gene expression in primary lymphocytes. As examples, memory phenotype induction and therapeutic genome editing are shown, demonstrating how cell function and / or differentiation can be permanently reprogrammed by simply adding bioengineered nanoparticles to T cell cultures. This nanotechnology platform requires no special cell handling, thus it can be easily integrated into established protocols for manufacturing therapeutic T cells without altering workflows or the equipment used in the process. This could be a significant advantage in manufacturing compared to RNA electroporation, currently the preferred method for hit-and-run gene therapy in T cells (Schumann et al., Proc Natl Acad Sci US A 112, 10437-10442 (2015); Wang et al., Nucleic Acids Res 44, e30 (2016); Bai et al., Cell Discovery, (2015)). Figure 2 As shown, in addition to involving expensive equipment, electroporation requires numerous culture medium changes, centrifugation steps, and washing cycles. Each of these steps is prone to error, increasing the risk of contamination and impairing the output of disease-fighting lymphocytes. Even state-of-the-art flow cytometry devices reduce T cell viability and thus reduce product yield and quality (Koh et al., Mol Ther Nucleic Acids 2, e114 (2013); Liu et al., Cancer Res 75, 3596-3607 (2015)). The method described does not rely on the mechanopermeability of the cell membrane to deliver transgenes. Instead, engineered nanoparticles bind to T cells and stimulate receptor-mediated endocytosis—a physiological process that allows the RNA they carry to enter without impairing cell viability. Figure 4C ).

[0409] Cell-penetrating peptides (CPPs) are small proteins that facilitate the uptake of various molecular cargoes by cells and have been used to deliver therapeutic drugs into primary T cells (Copolovici, ACS Nano 8, 1972–1994 (2014)). This approach can even be used to introduce large proteins containing CPP domains into the cytoplasm. However, it is not possible to specifically target selected cell types with CPPs, and protein transfer is relatively inefficient (Liu et al., PLoS One 9, e85755 (2014); Liu et al., Mol TherNucleic Acids 4, e232 (2015)). The duration of therapeutic effects also largely depends on the half-life of the transferred protein. In contrast, targeting specific cells with nanocarriers loaded with synthetic mRNA allows each delivered RNA molecule to serve as a template for the translation of multiple protein copies.

[0410] In these experiments, the targeted CD3 and CD8 molecules are just two of many antigens that can be used to selectively penetrate mRNA into lymphocytes. To selectively modify only a defined subset of T cells (such as antigen-experienced lymphocytes), activation markers (e.g., CD25, 4-1BB, OX40, or CD40L) can be targeted. Furthermore, the choice of core polymer and charge-eliminating coating material is flexible and will likely be optimized prior to production in a clinical setting. Regarding the former, a group of cationic polymers, including hyperbranched STAR polymers, polyethylene glycol-grafted polyethyleneimine, and mesoporous silica nanoparticles, were tested, with PBAE 447 selected based on its excellent transfection efficiency in primary T cells and low biomaterial-mediated cytotoxicity. The latter is a result of the formulation's high biodegradability, exhibiting a half-life of 1 to 7 hours under aqueous conditions (Mangraviti et al., ACS Nano 9, 1236-1249 (2015)). This timeframe is ideal for gene therapy because the polymer aggregates and effectively protects the mRNA from degradation, while it is encapsulated in endosomes but rapidly released after translocation to the cytoplasm, thus enabling transcription of the encoded protein. Importantly, in all tested nanoparticle designs, a negatively charged nanoparticle coating was required to shield the positive charge of the RNA / PBAE complex and prevent off-target binding.

[0411] Beyond T-cell therapy, the use of CD105-targeting mRNA nanocarriers to produce more effective hematopoietic stem cell (HSC) products has been explored using the described methods (Figure 10). In particular, strategies to improve the self-renewal properties of HSCs or modulate their fate determination have significant clinical appeal (Galeev et al., Cell Rep 14, 2988-3000 (2016); Rentas et al., Nature 532, 508-511 (2016)). Similar to the field of adoptive T-cell therapy, where pharmacological compounds are tested as supplements for producing lymphocytes with longer lifespans and / or in vivo efficacy, high-throughput screening libraries have identified small molecules that can alter stem cell expansion (Nikiforow and Ritz, Cell Stem Cell 18, 10-12 (2016). However, many chemical compounds only inhibit protein function, and their specificity for the desired targets is often controversial (Schenone et al., Nat Chem Biol). 9, 232-240 (2013). Furthermore, the use of small molecules makes it impossible to control a wide variety of protein types. In contrast, targeted mRNA nanocarriers can selectively induce the expression of almost any known protein (or combination of proteins). Moreover, the nucleotides they carry can be readily fabricated based on published sequences.

[0412] In summary, Example 1 demonstrates that a single nanoparticle reagent added to a leukocyte culture can effectively reprogram T cells for therapeutic purposes using "hit-and-run" genetic modification. This platform does not increase manufacturing complexity because it requires no special equipment or training. Therefore, it can substantially simplify the manufacturing of genetically engineered cell-based therapies at a clinical scale, meaning that treating patients with genetically engineered T cells can be more cost-effective and more widely applicable.

[0413] As will be understood by those skilled in the art, each embodiment disclosed herein may include, substantially consist of, or comprise of the elements, steps, components, or ingredients specifically stated herein. The transitional terms “comprise” or “comprises” as used herein mean, but are not limited to, and allow the inclusion of unspecified elements, steps, components, or ingredients, even in large quantities. The transitional phrase “consisting of” excludes any unspecified elements, steps, components, or ingredients. The transitional phrase “substantially consists of” limits the scope of the embodiments to the specified elements, steps, components, or ingredients and those that do not materially affect the embodiments. As used herein, material effects will result in a statistically significant reduction in the ability of the nanocarriers disclosed herein to alter the phenotype of selected cell types after exposure to the nanocarriers for 48 hours.

[0414] Unless otherwise indicated, all figures representing quantities of components, such as molecular weight, characteristics of reaction conditions, etc., as used in the specification and claims should be understood to be modified by the term "about" in all cases. Therefore, unless otherwise indicated, the numerical parameters stated in the specification and appended claims are approximate values ​​that may vary according to the desired properties sought to be obtained according to the invention. To the minimum extent necessary and without attempting to limit the scope of equivalence to the claims, each numerical parameter should be interpreted at least based on the reported significant figures and by applying ordinary rounding techniques. When further clarification is required, the term “about” when used in conjunction with a stated numerical value or range has the meaning reasonably attributable to it by a person skilled in the art, meaning slightly greater than or slightly less than the stated value or range as within the following ranges: ±20% of the stated value; ±19% of the stated value; ±18% of the stated value; ±17% of the stated value; ±16% of the stated value; ±15% of the stated value; ±14% of the stated value; ±13% of the stated value; ±12% of the stated value; ±11% of the stated value; ±10% of the stated value; ±9% of the stated value; ±8% of the stated value; ±7% of the stated value; ±6% of the stated value; ±5% of the stated value; ±4% of the stated value; ±3% of the stated value; ±2% of the stated value; or ±1% of the stated value.

[0415] Although the numerical ranges and parameters that illustrate the broad scope of the invention are approximate, the values ​​described in specific examples are reported as precisely as possible. However, any numerical value inherently contains some error that must be introduced by the standard deviation found in their respective test measurements.

[0416] Unless otherwise indicated herein or clearly contrary to the context, the terms “a,” “the,” and similar pronouns used in the context of describing the invention (especially in the context of the appended claims) should be interpreted to cover both singular and plural pronouns. The ranges of numerical values ​​listed herein are intended only as a convenient way to individually refer to each individual value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into this specification as if each individual value were individually listed herein. All methods described herein may be performed in any suitable order unless otherwise indicated herein or clearly contradicted by the context. Any and all embodiments or exemplary language (e.g., “such as”) provided herein are intended only to better illustrate the invention and do not constitute a limitation on the scope of the invention as otherwise claimed. The language in this specification should not be construed as indicating that any unclaimed element is necessary to practice the invention.

[0417] The grouping of alternative elements or embodiments of the invention disclosed herein should not be construed as limiting. Each member of a group may be mentioned and claimed individually or in any combination with other members of the group or other elements discovered herein. For convenience and / or patentability reasons, it is contemplated that one or more members of a group may be included in or removed from the group. When any such inclusion or removal occurs, this specification is deemed to include the modified group and thus satisfy the written description of all Markush groups as used in the appended claims.

[0418] This document describes certain embodiments of the invention, including the best mode known to the inventors for carrying out the invention. Of course, variations of these embodiments will become apparent to those skilled in the art upon reading the foregoing description. The inventors anticipate that those skilled in the art will readily adopt such variations, and that the invention can be practiced in ways other than those specifically described herein. Therefore, the invention includes all modifications and equivalents of the subject matter set forth in the appended claims, permissible under applicable law. Furthermore, unless otherwise indicated herein or clearly contradicted by the context, any combination of the foregoing elements in all possible variations is covered within the scope of this invention.

[0419] Furthermore, this specification makes numerous citations to patents and printed publications. Each of the above-cited references and printed publications is incorporated herein by reference individually for its specific citation instruction.

[0420] Finally, it should be understood that the embodiments of the invention disclosed herein are illustrative of the principles of the invention. Other possible modifications are also within the scope of the invention. Therefore, alternative configurations of the invention can be utilized, for example, but not limited to, according to the teachings herein. Consequently, the invention is not limited to the embodiments explicitly shown and described.

[0421] The details shown herein are by way of example and are for illustrative purposes only, illustrating preferred embodiments of the invention. These details are presented to provide the most useful and readily understood description of the principles and concepts of the various embodiments of the invention. In this regard, no further structural details of the invention are intended to be shown except as necessary for a basic understanding of the invention; the description, aided by the accompanying drawings and / or embodiments, will make it clear to those skilled in the art how several forms of the invention can be practiced.

[0422] Unless explicitly and unequivocally modified in the following embodiments or when the application of meaning renders any construction meaningless or substantially meaningless, the definitions and interpretations used in this disclosure are intended to control any future constructions. Where the construction of a term would render it meaningless or substantially meaningless, the definition should be obtained from Webster's Dictionary, 3rd edition, or a dictionary known to those skilled in the art such as the Oxford Dictionary of Biochemistry and Molecular Biology (ed. Anthony Smith, Oxford University Press, Oxford, 2004).

Claims

1. A method for selectively modifying a population of T cells, comprising: T-cell-targeting synthetic nanocarriers are applied to a heterogeneous mixture of in vitro cells containing the T-cell population, thereby selectively modifying the T-cell population. The T-cell-targeting synthetic nanocarrier includes: (A) Synthetic mRNA encapsulated in poly-β-amino ester PBAE; (B) A neutral or negatively charged coating containing PGA on the outer surface of the PBAE; and (C) An antibody that extends from the outer surface of the neutral or negatively charged coating and is attached to the PGA located within the neutral or negatively charged coating; The antibody mentioned above comprises an anti-CD3 antibody or an anti-CD8 antibody, wherein the anti-CD3 antibody is a clone of OKT3 and the anti-CD8 antibody is a clone of OKT8; The PBAE is a piperazine-capped PBAE447 polymer; and The synthetic mRNA described therein is an mRNA that has been completely replaced with modified ribonucleotides pseudouridine (Ψ) and 5-methylcytidine (m5C) and optimized with codons of Foxo13A or TRAC-megaTAL capped by ARCA.

2. The method of claim 1, wherein the PGA is a 15 kDa PGA.

3. The method according to claim 1, wherein, No cell selection or purification process is performed prior to the modification.

Citation Information

Patent Citations

  • V-like domain binding molecules

    US20070065431A1

  • Compounds that expand hematopoietic stem cells

    US20100183564A1

  • Method and apparatus for the preservation of cells and tissues

    US3753357A

  • Large unilamellar vesicles (LUV) and method of preparing same

    US4078052A

  • Method of freezing living cells and tissues with improved subsequent survival

    US4199022A