SNP molecular marker for identifying taxus wallichiana var. mucronifera and application thereof

Abstract

The application discloses a SNP molecular marker for identifying Taxus wallichiana, wherein the SNP molecular marker is located at the 314th base of the sequence shown in SEQ ID NO. 1, and if the base at the 314th position is A, then the Taxus wallichiana is identified. The application establishes a system for rapidly identifying the Taxus wallichiana based on the SNP molecular marker, so that the purpose of rapidly and accurately detecting the Taxus wallichiana is achieved, and the application has great significance for species inspection work at ports.

Description

Technical Field

[0001] This invention relates to the field of molecular biological detection for the identification of wood species, and more specifically, to SNP molecular markers for Tibetan yew and their applications. Background Technology

[0002] Tibetan yew (scientific name *Taxus wallichiana* Zucc.), also known as Himalayan yew, is a plant belonging to the genus *Taxus* in the family Taxaceae. It is a tree or large shrub with green annual branches. The leaves are linear and relatively thick. It is dioecious, with solitary cones in the leaf axils; male cones are spherical with numerous spirally arranged stamens and short pedicels; female cones are almost sessile. The seeds mature in the same year, are nut-like, columnar-oblong, and borne in a fleshy, reddish, cup-shaped aril. It is endemic to Tibet and is a Class I protected wild plant in China, distributed in Afghanistan, Nepal, and Tibet, China.

[0003] Tibetan yew has the smallest distribution area and the smallest resource reserves among all species in China, yet its resources remain largely undamaged. The heartwood and sapwood are clearly distinguishable, with uniform grain, fine texture, high hardness, and strong toughness, exhibiting minimal cracking after drying. It is an excellent timber for construction, bridges, furniture, tools, and vehicles. It can also be used as an afforestation species in its producing areas.

[0004] Its precious and unique medicinal value has attracted the attention of experts at home and abroad. The paclitaxel it contains has a good effect on cancer and has certain effects on diabetes, coronary heart disease, etc., and its application and development prospects are promising.

[0005] Morphological identification is a commonly used method in the identification of Tibetan yew, but shape characteristics are easily affected by habitat, climate, physiological conditions, etc., which often leads to subjective identification bias. It is difficult to accurately identify based on morphological differences alone.

[0006] In recent years, molecular biology techniques have been used for species identification in some rare species and in inspection and quarantine. How to establish an efficient, rapid, sensitive and accurate identification method using molecular biology techniques will be one of the key technologies in the field of Tibetan yew identification. Summary of the Invention

[0007] This invention provides an SNP molecular marker for identifying Tibetan yew, wherein the SNP molecular marker is located at the 314th base of the sequence shown in SEQ ID NO.1, and if the 314th base is A, it is identified as Tibetan yew.

[0008] Application of the SNP molecular marker in the identification of Tibetan yew.

[0009] The specific applications include the identification of Tibetan yew from Southern yew, Taxus media, European yew, Tibetan yew, Northeastern yew and Yunnan yew.

[0010] The present invention provides a nucleotide sequence for identifying Tibetan yew, including SEQ ID NO.1, or the cDNA or mRNA corresponding to SEQ ID NO.1, wherein the 314th base of the sequence shown in SEQ ID NO.1 is A.

[0011] This invention provides a kit for identifying Tibetan yew, comprising one or more primers, or a combination of primers and probes, for specifically detecting the presence or absence of base A at position 314 of the sequence SEQ ID NO.1. The primers and probes are selected from:

[0012] The specific amplification primers F1 and R1, and the sequencing primers used for sequencing identification, have the following primer sequences:

[0013] Upstream primer F1: 5'-GCGGTAGGATCATTGTCG-3'

[0014] Downstream primer R1: 5'-TCCTCCGCTTATTGATATGC-3'

[0015] Sequencing primers: 5'-GCGGTAGGATCATTGTCG-3'

[0016] Alternatively, amplification-specific primers and probes for quantitative real-time PCR detection, with primer and probe sequences as follows:

[0017] Upstream primer F2: 5'-TGGGTGCACCAGCGACTC-3'

[0018] Downstream primer R2: 5'-CTGCTTTGCAGACCGGCA-3'

[0019] Probe P2: 5'-TCGAAGGGTCCCAGAAATTTCCACCT -3';

[0020] Alternatively, specific amplification primers for ARMS-PCR detection have the following primer sequences:

[0021] Upstream primer F3: 5'-CGGTCGAAGGGTCCCTGA-3'

[0022] Downstream primer R3: 5'-GCCCGGCGACACTTCA-3'

[0023] Furthermore, the kit is used to identify *Taxus chinensis* from *Taxus macrocarpa*, *Taxus media*, *Taxus thunbergii*, *Taxus tibetica*, *Taxus mandshurica*, and *Taxus yunnanensis*.

[0024] Furthermore, this also includes positive control samples and negative control samples.

[0025] This invention provides a method for preparing a kit for identifying Tibetan yew, comprising the step of preparing a detection reaction reagent, characterized in that the reaction reagent contains one or more primers, or a combination of primers and probes, for specifically detecting the presence or absence of base A at position 314 of the sequence SEQ ID NO.1.

[0026] This invention also provides oligonucleotides for identifying Tibetan yew, characterized in that the oligonucleotides are used to specifically detect the presence or absence of an A base at position 314 of the sequence SEQ ID NO.1, and the oligonucleotides are selected from specific amplification primer sequences and sequencing primer sequences used for sequencing, respectively.

[0027] Upstream primer F1: 5'-GCGGTAGGATCATTGTCG-3'

[0028] Downstream primer R1: 5'-TCCTCCGCTTATTGATATGC-3'

[0029] Sequencing primers: 5'-GCGGTAGGATCATTGTCG-3'

[0030] Alternatively, the specific upstream primer F2 sequence, downstream primer R2 sequence, and probe P2 sequence used for quantitative real-time PCR amplification are as follows:

[0031] Upstream primer F2: 5'-TGGGTGCACCAGCGACTC-3'

[0032] Downstream primer R2: 5'-CTGCTTTGCAGACCGGCA-3'

[0033] Probe P2: 5'-TCGAAGGGTCCCAGAAATTTCCACCT -3';

[0034] Alternatively, the specific upstream primer F3 sequence and downstream primer R3 sequence for ARMS-PCR amplification are as follows:

[0035] Upstream primer F3: 5'-CGGTCGAAGGGTCCCTGA-3'

[0036] Downstream primer R3: 5'-GCCCGGCGACACTTCA-3'.

[0037] Furthermore, the fluorescent group at the 5' end of probe P2 is selected from FAM, THEX, or TET, and the quenching group at the 3' end is selected from BHQ1 or TAMRA.

[0038] This invention provides a method for identifying Tibetan yew, comprising the following steps:

[0039] Extract genomic DNA from the plant to be tested;

[0040] Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed to detect whether the base A at position 314 of the SEQ ID NO.1 sequence was present.

[0041] If the SNP site is identified as A, the plant in question is determined to be a Tibetan yew.

[0042] Furthermore, the primers or probes required for PCR amplification are selected from upstream primer F1, downstream primer R1 and sequencing primer; or upstream primer F2 sequence, downstream primer R2 sequence and probe P2 sequence; or upstream primer F3 and downstream primer R3.

[0043] Compared with existing technologies, this invention has the following advantages and effects: Based on the analysis and comparison of a large amount of genetic information of Taxus chinensis, and according to sequence site polymorphism, this invention designs species-specific primers and probes for Taxus chinensis, establishing a specific real-time quantitative PCR identification and detection method for Taxus chinensis. This invention does not require the wood to have a complete morphological structure; only a very small amount of wood sample is needed to meet the detection requirements, making the operation simple. Furthermore, the identification is based on SNP molecular markers of Taxus chinensis, making the identification process objective and accurate. It overcomes the technical limitations of traditional identification methods, which mainly rely on morphological identification and must be based on the presence of a complete and easily identifiable morphological structure in the wood. This invention uses ARMS technology to perform high-precision PCR amplification of the mutant target sequence using specific primers. Simultaneously, probes are used to detect the amplification products, achieving high specificity and high sensitivity for the detection of Taxus chinensis on a real-time quantitative PCR platform. Attached Figure Description

[0044] Figure 1 This invention utilizes quantitative real-time PCR to detect the results of positive control samples (genomic DNA from leaves of Taxus chinensis var. tibetica).

[0045] Figure 2 This invention utilizes quantitative real-time PCR to identify the results of Tibetan yew.

[0046] Figure 3 This invention utilizes real-time quantitative PCR to identify the results of *Taxus wallichiana*.

[0047] Figure 4This invention utilizes real-time quantitative PCR to identify the results of Taxus chinensis.

[0048] Figure 5 This invention utilizes real-time quantitative PCR to identify the results of the European yew.

[0049] Figure 6 This invention utilizes real-time quantitative PCR to identify the results of *Taxus yunnanensis*.

[0050] Figure 7 This invention utilizes real-time quantitative PCR to identify the results of the identification of Taxus chinensis.

[0051] Figure 8 Results of sequencing identification of Tibetan yew.

[0052] Figure 9 Results of sequencing identification of Taxus wallichiana.

[0053] Figure 10 Results of sequencing identification of Taxus media.

[0054] Figure 11 Results of sequencing identification of the European yew.

[0055] Figure 12 Results of sequencing identification of Taxus yunnanensis.

[0056] Figure 13 Results of sequencing identification of Taxus chinensis.

[0057] Figure 14 Electrophoresis results: Lane 1 is the quality control material; Lane 2 is Tibetan yew; Lane 3 is Yunnan yew; Lane 4 is Manchurian yew; Lane 5 is European yew; Lane 6 is Yunnan yew; Lane 7 is Northeast yew; Lane 8 is a 100bp ladder maker.

[0058] Figure 15. Sequence comparison of six different varieties of yew. Detailed Implementation

[0059] The present invention will be further illustrated below with reference to specific embodiments. However, this does not limit the invention to the specific embodiments described. Conditions and methods not described in the embodiments are generally performed according to the methods commonly used by experimentalists in the relevant field: for example, the operating procedures described in Sambrook et al.'s Manual of Molecular Cloning (New York: Cold Spring Harbor Laboratory Press, 1989), or the experimental conditions recommended by the manufacturer.

[0060] Example 1: Obtaining SNP molecular markers from Taxus chinensis (Tibetan yew)

[0061] 1. Based on the ITS gene publicly available in the NCBI database, corresponding primers were designed for PCR amplification. The upstream primer F1: 5'-GCGGTAGGATCATTGTCG-3' (SEQ ID NO.2), the downstream primer R1: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO.3), and the following PCR reaction system and procedure were used. Genomic DNA from six identified Taxus species (Taxus mairei SY Hu, Taxus madia, Taxus baccata, Taxus wallichiana Zucc., Taxus cuspidata S. et Z., and Taxus yunnanensis Cheng et LK F) was used as templates for PCR amplification. The amplified products were detected by 1.5% agarose gel electrophoresis and sequenced after passing the UV gel imaging system.

[0062]

[0063] Among them, Vazyme AceTaq DNA enzyme (catalog number p401-d1 250U).

[0064] Plant genomic DNA can be extracted using traditional methods, or commercially available DNA extraction kits can be used. For example, the genomic DNA of the aforementioned Taxus species was extracted using the Plant Genomic DNA Extraction Kit (Koing) from Hangzhou Baimai Biotechnology Co., Ltd. TM Use the universal genome extraction kit (catalog number F1612) and follow the kit instructions. Store the extracted DNA at -20°C for later use.

[0065] 2. Sequence alignment and development of species-specific molecular markers

[0066] The ITS gene sequences of the six Taxus species obtained in step 1 were used to perform sequence alignment using DNAMAN software to identify suitable SNP sites. The sequence alignment results are as follows: Figure 15 As shown, analysis revealed that the base at position 314 of the ITS gene in *Taxus chinensis* is A, while the corresponding base in other *Taxus* species is C. Therefore, the base A at position 314 of SEQ ID NO.1 is the SNP site of *Taxus chinensis* (the position shown in the box in SEQ ID NO.1). The gene sequence of SEQ ID NO.1 is as follows:

[0067]

[0068] Example 2: Application of SNP molecular markers of Taxus chinensis in the identification of Taxus chinensis by fluorescent PCR amplification.

[0069] This embodiment, based on the obtained SNP site of *Taxus tibetica*, designed specific upstream primer F2, downstream primer R2, and probe P2 using Primer Premier 5.0 targeting the gene sequence containing the SNP site. The primers and probe were synthesized by Suzhou Genewiz Biotechnology Co., Ltd. Fluorescent PCR amplification and detection were performed on *Taxus spp.*, *Taxus media*, *Taxus chinensis*, *Taxus tibetica*, *Taxus mandshurica*, and *Taxus yunnanensis* using the specific primers and probe. Specifically, the sequences of the upstream primer F2, downstream primer R2, and probe P2 are as follows:

[0070] Upstream primer F2: 5'-TGGGTGCACCAGCGACTC-3' (SEQ ID NO.4)

[0071] Downstream primer R2: 5'-CTGCTTTGCAGACCGGCA-3' (SEQ ID NO.5)

[0072] Probe sequence P2: 5'-TCGAAGGGTCCCAGAAATTTCCACCT-3 (SEQ ID NO.6)

[0073] The fluorescent group at the 5' end of the probe is selected from FAM, THEX, TET, etc., and the quenching group at the 3' end is selected from BHQ1, TAMRA, etc.

[0074] For example, the probe is 5'-FAM-TCGAAGGGTCCCAGAAATTTCCACCT-BHQ1-3'.

[0075] Using genomic DNA from six Taxus species as templates, a 20 μL PCR reaction system included:

[0076]

[0077] PCR amplification procedure:

[0078]

[0079] The procedure includes the following steps: 1) Extracting genomic DNA from the plant to be tested; 2) Using the genomic DNA of the plant to be tested as a template, amplifying the ITS gene of Taxus chinensis by PCR using primers and probes; simultaneously setting up positive and negative control groups, which are amplified using templates containing and not containing the extracted genomic DNA of Taxus chinensis leaves, respectively; 3) Detecting the PCR amplification products using fluorescent PCR. If the amplification curve has a standard S-shaped curve and Ct≤36, then the plant to be tested is Taxus chinensis.

[0080] The samples used in Example 2, including Southern Yew, Taxus media, European Yew, Tibetan Yew, Northeastern Yew, and Yunnan Yew, are a different group of samples from Example 1, identified by existing methods. These samples were tested using fluorescent PCR according to the method described in this invention. The test results are as follows: Figures 1 to 7 As shown, where Figure 1 The amplification results were from a positive control sample; among the remaining samples, only the Tibetan yew showed an S-shaped curve (e.g., Figure 2 As shown), and Ct≤36, while other yew species did not show an S-shaped curve (such as...). Figures 3 to 7 As shown in the figure, this invention has extremely high specificity for the SNP site of the ITS gene of Taxus chinensis, and therefore can be used for rapid identification of Taxus chinensis.

[0081] Using the primers and sequencing methods described in Example 1, the samples of Southern Yew, Taxus media, European Yew, Tibetan Yew, Northeastern Yew, and Yunnan Yew in Example 2 were identified. The identification results are shown in […]. Figures 8 to 13 The sequencing results showed that only *Taxus chinensis* had an A base at position 314 of SEQ ID NO.1, while other *Taxus* species had a C base.

[0082] Example 3: Application of SNP molecular markers of Taxus chinensis in the identification of Taxus chinensis by arms-PCR

[0083] This embodiment, based on the obtained SNP site of *Taxus tibetica*, designed specific upstream primer F3 and downstream primer R3 for gene sequences containing the SNP site using PrimerPremier 5.0. The primers and probes were synthesized by Suzhou Genewiz Biotechnology Co., Ltd. Fluorescent PCR amplification and detection were performed on samples of *Taxus macrocarpa*, *Taxus media*, *Taxus chinensis*, *Taxus tibetica*, *Taxus mandshurica*, and *Taxus yunnanensis* using the specific primers and probes. Specifically, the sequences of the upstream primer F3 and downstream primer R3 are as follows:

[0084] Upstream primer F3: 5'-CGGTCGAAGGGTCCCTGA-3' (SEQ ID NO.7)

[0085] Downstream primer R3: 5'-GCCCGGCGACACTTCA-3' (SEQ ID NO.8)

[0086] Using genomic DNA from six Taxus species as templates, a 20 μL PCR reaction system included:

[0087]

[0088] Arms-PCR reaction procedure:

[0089]

[0090] The procedure includes the following steps: 1) Extracting genomic DNA from the plant to be tested; 2) Using the genomic DNA of the plant to be tested as a template, amplifying the ITS gene of Taxus chinensis by arms-PCR using primers and probes; 3) Detecting the PCR amplification products by electrophoresis. The electrophoresis of Taxus chinensis in Tibet showed obvious bands, while other Taxus chinensis showed no amplification bands.

[0091] The Southern Yew, Media Yew, European Yew, Tibetan Yew, Northeastern Yew, and Yunnan Yew used in Example 2 are also a different group of samples from Example 1, identified by existing methods. The test results are as follows: Figure 14 As shown, the amplification results for *Taxus tibetica* showed a significant amplification band; the amplification results for other *Taxus* species showed no amplification band. This indicates that the SNP site of the *Taxus tibetica* ITS gene in this invention has extremely high specificity, and therefore can be used for rapid identification of *Taxus tibetica*.

[0092] The summary table of identification results for Examples 2 and 3 is shown below:

[0093]

[0094] The reaction system, reaction procedure, and detection steps listed in the embodiments described in this application are only specific implementation methods. Those skilled in the art can make adaptive adjustments to the reaction system, reaction procedure, etc., according to actual needs. sequence list <110> Hangzhou Baimai Biotechnology Co., Ltd. <120> SNP molecular markers for identifying Tibetan yew and their applications <130> 201707 <150> 2017108141463 <151> 2017-09-11 <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1076 <212> DNA <213> Taxus wallichiana Zucc. <400> 1 tacgttcaga gatgggcgtg ttcggcacgt ccggcgcgtc tcctccccgt cccccgctct 60 tgcgggagtt tggactggag ttccggatgc ttttcccttt gcaatgcctc gggggtcccc 120 tccgctggct ttctctcggg tgggcgttcg ggtcttcgca agttgttctc ctgcggttcg 180 ggttattaca agggcgagtg ccagtgtcgt ctacagtgtg gctatgcgag gggctcgttt 240 ttcggctgca gtgggtgcac cagcgactct gttcgtctgg cagtcctgct cctttgcggt 300 cgaagggtcc cagaaatttc cacctgctag gcggttcctt gcaaacgccc gtggctgctt 360 tgcagaccgt tgaacatttg ccggtctgca aagcagctgc aaccccctga agtgtcgccg 420 ggcaggtaat gccgtacaga ttatttcgtg cctttggacg ggtgcacctg cgtacgtcgc 480 cgggcgggcc gaccgtccac tggttccgtt cccatctgtt cggtctccgg cctttcgaca 540 ctccggggcg gggacaccct ttctccgatt ttcccccacg gggcatcgcc tctggttgca 600 ggggggcgtc gagtggaggt gcgtgtcata acactcaacg catcggtgcg gattgcacca 660 aggatctgat aaatagctgt gcgggctgcg cgccatgcgc gcgtcggact cacggcgcca 720 attaaacacg actctcggca acggatatct cggctctcgc cacgatgaag aatgtagcga 780 aatgcgatac ttagtgtgaa ttgcagaatc ccgtgaatca tcgagtcttt gaacgcaagt 840 tgcgcccgag gcctcggccg agggcacgtc tgcttgggcg tcgcactcta aaatcgactt 900 cccccgttcc tcggcgggag gatcggagat ggctgtccgt gcccaccagc ggcgcggtcg 960 gctaaatggg cacgagattt gtggccgatg tcacgatgaa cggtggccaa tgttggtcgg 1020 cgttggattg tggcccaagg tcccggattt gtgcggaact ttactcgttg ttattc 1076 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <400> 2 gcggtaggat cattgtcg 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 tcctccgctt attgatatgc 20 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <400> 4 tgggtgcacc agcgactc 18 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <400> 5 ctgctttgca gaccggca 18 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <400> 6 tcgaagggtcccagaaatttccacct 26 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <400> 7 cggtcgaagg gtccctga 18 <210> 8 <211> 16 <212> DNA <213> Artificial Sequence <400> 8 gcccggcgac acttca 16

Claims

1. A reagent kit for identifying Tibetan yew, characterized in that, Includes primers, or combinations of primers and probes, for the specific detection of the presence or absence of an A base relative to position 314 of the SEQ ID NO.1 sequence, wherein the primers are: Specific amplification primers for ARMS-PCR detection, with the following primer sequences: Upstream primer F3: 5'-CGGTCGAAGGGTCCCTGA-3' Downstream primer R3: 5'-GCCCGGCGACACTTCA-3'; Alternatively, the combination of primers and probes may be: Amplification-specific primers and probes for quantitative real-time PCR detection, with the following sequences: Upstream primer F2: 5'-TGGGTGCACCAGCGACTC-3' Downstream primer R2: 5'-CTGCTTTGCAGACCGGCA-3' Probe P2: 5'-TCGAAGGGTCCCAGAAATTTCCACCT -3'.

2. The reagent kit according to claim 1, characterized in that, The kit also includes a positive control and a negative control.

3. An oligonucleotide for identifying Tibetan yew, characterized in that, The oligonucleotide is used to specifically detect the presence or absence of an A base at position 314 relative to SEQ ID NO.

1. The oligonucleotide is: The specific upstream primer F2 sequence, downstream primer R2 sequence, and probe P2 sequence used for real-time PCR amplification are as follows: Upstream primer F2: 5'-TGGGTGCACCAGCGACTC-3' Downstream primer R2: 5'-CTGCTTTGCAGACCGGCA-3' Probe P2: 5'-TCGAAGGGTCCCAGAAATTTCCACCT -3'; Alternatively, the specific upstream primer F3 sequence and downstream primer R3 sequence for ARMS-PCR amplification are as follows: Upstream primer F3: 5'-CGGTCGAAGGGTCCCTGA-3' Downstream primer R3: 5'-GCCCGGCGACACTTCA-3'.

4. A method for identifying Tibetan yew, comprising the following steps: Extract genomic DNA from the plant to be tested; Using the genomic DNA extracted in the above steps as a template, PCR amplification was performed to detect whether the base A at position 314 relative to the sequence of SEQ ID NO.1 was present. If the SNP site is identified as A, the plant in question is determined to be a Tibetan yew.

5. The method according to claim 4, characterized in that, The specific upstream primer F2 sequence, downstream primer R2 sequence, and probe P2 sequence used for real-time PCR amplification are as follows: Upstream primer F2: 5'-TGGGTGCACCAGCGACTC-3' Downstream primer R2: 5'-CTGCTTTGCAGACCGGCA-3' Probe P2: 5'-TCGAAGGGTCCCAGAAATTTCCACCT -3'.

6. The method according to claim 4, characterized in that, The PCR amplification process also includes the amplification of positive and negative control groups, which are amplified using genomic DNA extracted from Taxus chinensis leaves as templates, respectively. If the amplification curve has a standard S-shaped curve and Ct≤36, then the plant to be tested is Taxus chinensis.

Images