Method for rapidly detecting SNP of goat ADIPOQ gene and special kit

The ADIPOQ gene in goats was detected by PCR-RFLP, and the restriction endonuclease AvaII digestion and gel electrophoresis analysis solved the problems of speed and accuracy in the detection of ADIPOQ gene SNPs in goats. This provides molecular breeding markers for goat growth traits and improves breeding efficiency.

CN110643720BActive Publication Date: 2026-07-31TONGREN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
TONGREN UNIV
Filing Date
2019-11-13
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

The lack of a rapid and accurate method for detecting ADIPOQ gene SNPs in goats in the current technology leads to a slow pace of breeding and selection of superior breeds.

Method used

The goat ADIPOQ gene was detected by PCR-RFLP. After amplifying the ADIPOQ gene fragment by PCR, it was digested with the restriction endonuclease AvaII, and the single nucleotide polymorphism of the goat ADIPOQ gene was analyzed by agarose gel electrophoresis.

Benefits of technology

This method enables rapid and convenient SNP typing of the ADIPOQ gene in goats, improving the specificity and accuracy of detection, providing molecular breeding markers for goat growth traits, and shortening the breeding time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0002271849070000041
    Figure BDA0002271849070000041
  • Figure BDA0002271849070000051
    Figure BDA0002271849070000051
  • Figure BDA0002271849070000052
    Figure BDA0002271849070000052
Patent Text Reader

Abstract

This invention discloses a rapid method and dedicated kit for detecting SNPs in the goat ADIPOQ gene. Using whole-genome DNA of a goat as a template, a partial fragment of the goat ADIPOQ gene is amplified by PCR. The PCR product is digested with the restriction endonuclease AvaII and then subjected to agarose gel electrophoresis. The genotype of the single nucleotide polymorphism (SNP) site 14059C>T in the goat ADIPOQ gene is identified based on the electrophoresis results. This invention targets the SNP site in the goat ADIPOQ gene, enabling the detection of molecular markers closely related to goat body length and height at the DNA level. This allows for the use of goat-assisted selection and molecular breeding, accelerating the breeding of superior goat breeds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics and relates to the detection of single nucleotide polymorphisms (SNPs) in goat genes as molecular genetic markers, and in particular to a method for typing and applying SNPs in the ADIPOQ gene of goats. Background Technology

[0002] As third-generation molecular markers, SNP markers play an important role in molecular genetics, pharmacogenetics, and forensic medicine. Single nucleotide polymorphisms (SNPs) are polymorphisms in DNA sequences caused by mutations in a single nucleotide in the genome. They exist in the form of single base transversions, transitions, insertions, and deletions. Based on their location in the gene, SNPs can be classified into three categories: coding SNPs (cSNPs), peripheral SNPs (pSNPs), and intronic SNPs (iSNPs). From the perspective of their impact on the genetic traits of organisms, cSNPs can be divided into two types: one is synonymous cSNP, which means that the change in the coding sequence caused by the SNP does not affect the amino acid sequence of the translated protein, and the mutated base has the same meaning as the unmutated base; the other is non-synonymous cSNP, which means that the change in the base sequence can change the sequence of the protein translated from it, thereby affecting the function of the protein. This change is usually the direct cause of changes in biological traits.

[0003] Currently, SNP detection methods can be broadly categorized into two types: one is based on gel electrophoresis, represented by single-stranded conformational polymorphism (SSCP), denaturing gradient gel electrophoresis (DDGE), enzyme digestion amplification of polymorphic sequences (CAPS), and allele-specific PCR (AS-PCR); the other is high-throughput, highly automated detection methods, represented by direct sequencing, DNA microarrays, denaturing high-performance liquid chromatography (DHPLC), mass spectrometry, and high-resolution melting curve analysis (HRM). PCR-RFLP (restriction fragment length polymorphism polymerase chain reaction) is an accurate and simple method, and is currently the most commonly used method for identifying the genotype of SNP loci. It primarily utilizes restriction endonucleases to cut the amplified target fragment, followed by gel electrophoresis and analysis of genotype information. PCR-RFLP overcomes the limitations of traditional PCR-SSCP methods, such as inaccurate localization of DNA sequence variations and stringent experimental conditions. Furthermore, combining PCR with RFLP avoids the drawbacks of RFLP, such as long detection cycles, high costs, and unsuitability for large-scale molecular breeding.

[0004] Adiponectin (ADIPOQ) is an adipocyte cytokine. Initially, it was thought that adiponectin protein was expressed only in adipose tissue, but subsequent studies have found its expression in skeletal muscle, brain, liver, and vascular endothelium. Adiponectin participates in physiological processes such as glucose and lipid metabolism, regulation of energy homeostasis, improvement of insulin resistance, and mitigation of oxidative stress. Scherer et al. first discovered this gene during the sequencing of mRNA reverse transcribed into cDNA from mouse 3T3-L adipocytes. Further research revealed that the mouse adiponectin gene is located on chromosome 16, B3-B4, and is approximately 20 kb in length. Currently, domestic and international research on the ADIPOQ gene mainly focuses on polymorphism detection, sequence analysis, and tissue expression, with studies primarily conducted on geese, ducks, and cattle, and relatively few studies on goats. Summary of the Invention

[0005] The purpose of this invention is to provide a method and a dedicated kit for rapid detection of ADIPOQ gene SNPs in goats, thereby accelerating the breeding of superior breeds.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A method for detecting single nucleotide polymorphisms in the goat ADIPOQ gene includes the following steps:

[0008] Using the whole genome DNA of the goat individuals to be tested as a template and primer pair P as primers, a partial fragment of the ADIPOQ gene was amplified by PCR. The amplified product was digested with the restriction endonuclease AvaII and then subjected to agarose gel electrophoresis. The genotype of the single nucleotide polymorphism (SNP) site of the ADIPOQ gene in the goat individuals was identified based on the electrophoresis results. The goat ADIPOQ gene SNP site was the 14059C>T single nucleotide mutation site in the goat ADIPOQ gene reference genome sequence NC_030808.1.

[0009] Preferably, the 14059C>T single nucleotide mutation site is located within the region amplified by primer pair P, and the sequence of primer pair P is:

[0010] Upstream primer F1: 5'-GGTTAAGCTTCTTTACCACAGAGTG-3'

[0011] Downstream primer R1: 5'-CTTCCACACTGACCGAAGTC-3'

[0012] Preferably, the PCR amplification reaction system consists of: 1 μL of 10 ng / μL template DNA, 0.5 μL each of the upstream and downstream primers corresponding to primer pair P (10 pmol / L), 5 μL of 2×Taq PCR StarMix, and 3 μL of ddH2O.

[0013] Preferably, the PCR amplification reaction program is as follows: pre-denaturation at 94-95℃ for 5 min; denaturation at 94-95℃ for 30 s, annealing at 54.1℃ for 30 s, extension at 72℃ for 25-60 s, 35 cycles; extension at 72℃ for 10 min.

[0014] Preferably, the restriction endonuclease AvaII digestion system is as follows: 5 μL of PCR amplification product, 0.5 μL of 1×NE Buffer, 0.1 μL of AvaII (10-50 U / μL), and 4.4 μL of ddH2O; the digestion conditions are: digestion in a water bath at 37°C for 40-60 min.

[0015] Preferably, the agarose gel has a mass concentration of 2.5%.

[0016] Preferably, based on the agarose gel electrophoresis results, the base polymorphism of the single nucleotide mutation site 14059C>T in the goat ADIPOQ gene (goat ADIPOQ gene reference genome sequence NC_030808.1) is determined as follows: the CC genotype shows two bands at 46bp and 272bp, the CT genotype shows three bands at 272bp, 46bp and 318bp, and the TT genotype shows one band at 318bp.

[0017] The above-mentioned method for detecting single nucleotide polymorphisms in the ADIPOQ gene of goats is applied in molecular marker-assisted selection breeding of goats.

[0018] Preferably, the CT and TT genotypes of the 14059C>T single nucleotide mutation site in the goat ADIPOQ gene reference genome sequence NC_030808.1 can be used as molecular breeding gene markers for early selection of goat growth traits (body height and body length).

[0019] A kit for detecting single nucleotide polymorphisms in the goat ADIPOQ gene, comprising the primer pair P described above, and the restriction endonuclease AvaII.

[0020] The beneficial effects of this invention are reflected in:

[0021] This invention targets the 14059C>T single nucleotide mutation site (SNP site) in the reference genome sequence NC_030808.1 of the goat ADIPOQ gene. The target fragment can be amplified by PCR, digested with a specific restriction endonuclease, and the genotyping results for this site can be obtained by gel electrophoresis analysis. The method is simple, the genotyping time is short, and the specific genotype of this site can be used as a molecular marker to improve the growth traits of goats. Thus, by detecting individual goats, a goat population with excellent genetic traits can be quickly established.

[0022] Furthermore, by optimizing the parameters of PCR reaction conditions, reaction system, and enzyme digestion system, the detection specificity and accuracy, as well as the detection speed, have been significantly improved. Attached Figure Description

[0023] Figure 1 This is a reverse sequencing diagram of the ADIPOQ gene 14059C>T in goats; the box indicates the mutation that occurred at this site.

[0024] Figure 2 Electrophoresis image of the PCR amplified fragment of the goat ADIPOQ gene 14059C>T; lane M1 is the marker.

[0025] Figure 3 Electrophoresis results of the PCR product of the goat ADIPOQ gene 14059C>T after digestion with AvaII; lane M1 is the marker. Detailed Implementation

[0026] The present invention will now be described in detail with reference to the accompanying drawings and embodiments. These embodiments are explanations of the present invention and not limitations on the scope of protection of the present invention.

[0027] Laboratory resequencing of the goat genome revealed polymorphism in the goat ADIPOQ gene. Literature review indicates that the ADIPOQ gene plays a crucial role in fatty acid synthesis and metabolism. However, based on genotyping, gene frequency analysis, and association analysis with important growth traits of three goat breeds, this invention found that the polymorphism at the 14059C>T single nucleotide mutation site in the goat ADIPOQ gene reference genome sequence NC_030808.1 is closely associated with goat growth traits. This was verified to be a molecular marker site for auxiliary selection in goat molecular breeding, providing important evidence for goat molecular breeding and suggesting that the polymorphic site in the ADIPOQ gene plays a regulatory role in goat growth and development. Finally, this invention established a method for detecting the 14059C>T single nucleotide mutation site (verified as an SNP site) in the goat ADIPOQ gene using PCR-RFLP.

[0028] I. Cloning and Polymorphism Detection of Partial Goat ADIPOQ Gene Sequence

[0029] 1. Sample collection and genomic DNA extraction

[0030] (1) Blood sample collection (information is shown in Table 1)

[0031] Table 1. Blood Sample Collection Information

[0032]

[0033] (2) Extraction of whole blood (genomic) DNA

[0034] ① Thaw the frozen blood sample (mainly blood cells) at room temperature, pipette 500μL of blood into a 1.5mL centrifuge tube, add an equal volume of phosphate buffer (PBS), mix well, gently shake, centrifuge at 4℃ and 12000rpm for 5min, discard the supernatant, and repeat the above steps until the supernatant is clear.

[0035] ② Add 500 μL of DNA extraction buffer to the centrifuge tubes and gently pipette to detach the blood cell pellet from the centrifuge tube walls. Incubate at 37°C for 1 hour.

[0036] ③ Add proteinase K to 3 μL (20 mg / mL) and mix well. Digest in a 55°C water bath overnight (about 16 h) until the flocculent precipitate disappears and the solution becomes clear. If it is not clear, add 1 μL of proteinase K, mix well, and continue digesting until it becomes clear.

[0037] ④ Take out the sample and add 200 μL of 6 mol / L NaCl. Shake the bottom of the container 15 times to mix it thoroughly. Centrifuge at 4℃ and 12000 rpm for 10 min. Take the supernatant into a 2.0 mL centrifuge tube.

[0038] ⑤ Add 1 mL of Tris-saturated phenol, place on ice and gently shake for 20 min to mix thoroughly; centrifuge at 4℃ and 12000 rpm for 10 min, and transfer the upper aqueous phase to another sterile 2.0 mL centrifuge tube using a pipette.

[0039] ⑥ Add 0.5 mL of Tris-saturated phenol and 0.5 mL of chloroform, and gently shake on ice for 20 min; centrifuge at 4℃ and 12000 rpm for 10 min; transfer the upper aqueous phase to another sterile 2.0 mL centrifuge tube using a pipette.

[0040] ⑦ Add 1 mL of chloroform, place on ice and gently shake for 20 min; centrifuge at 4℃ and 12000 rpm for 10 min; transfer the upper aqueous phase to another sterile 1.5 mL centrifuge tube using a pipette.

[0041] ⑧ Add 1 mL of pre-cooled anhydrous ethanol (-20℃), gently tap the bottom and shake several times until DNA is precipitated, then place at -20℃ for 30 min; after removal, centrifuge at 4℃ and 12000 rpm for 10 min, and discard the ethanol.

[0042] ⑨ Add 1 mL of 70% ethanol and gently shake for 10 min; then centrifuge at 4℃ and 12000 rpm for 10 min, discard the ethanol; repeat the rinsing once.

[0043] ⑩ Place the container open at room temperature for 15 minutes, then place it in a 60℃ oven for 30 seconds to allow the ethanol to evaporate completely. Add 50 μL of ultrapure water and store at 4℃ until the DNA is completely dissolved. After measuring the concentration with a spectrophotometer, store at -80℃.

[0044] The OD values ​​and DNA content of the DNA sample at 260 nm and 280 nm were determined using a UV spectrophotometer. If the OD260 / OD280 ratio was less than 1.6, it indicated that the sample contained a large amount of protein or phenol, and purification should be performed. If the ratio was greater than 1.8, RNA removal and purification should be considered. After DNA detection, a certain amount was diluted to 10 ng / μL.

[0045] 2. Amplification primer design

[0046] This invention, through searching the goat ADIPOQ gene sequence in the NCBI database, determined that the goat ADIPOQ gene sequence (NC_030808.1) was used as a reference to select suitable primer fragments for design. Specifically, Primer 5.0 software was used to design PCR primer pair P that can amplify the first intron of the goat ADIPOQ gene. The primer sequences are as follows:

[0047] Upstream primer F1: 5'-GGTTAAGCTTCTTTACCACAGAGTG-3'25nt

[0048] Downstream primer R1: 5'-CTTCCACACTGACCGAAGTC-3'20nt

[0049] 3. PCR amplification

[0050] The PCR reaction system is shown in Table 2.

[0051] Table 2. PCR reaction system

[0052]

[0053] The PCR reaction procedure is shown in Table 3.

[0054] Table 3. PCR reaction procedure (primer pair P)

[0055]

[0056]

[0057] 4. PCR product sequencing verification

[0058] The amplified PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results of the target fragment of the goat ADIPOQ gene were compared with the reference sequence. Figure 1 The study found a 14059C>T mutation in the goat ADIPOQ gene (position 14059 of NC_030808.1, located within the P amplification region of primer pair and possessing a natural restriction enzyme site) in the blood sample genome.

[0059] 5. Enzyme digestion and RFLP detection of PCR products

[0060] Genomic DNA was extracted from the blood sample of the goat to be tested, and the product after PCR amplification (primer pair P) was analyzed. Figure 2 First, the restriction enzyme AvaII was used for digestion. Then, the genotype of the individual was determined based on the electrophoresis results, and the polymorphism (SNP) of the mutation site was verified.

[0061] The 10 μL AvaII digestion system and conditions were as follows: 5 μL PCR product, 0.5 μL 1×NEBuffer, 0.1 μL ApaII (50 U / μL), and 4.4 μL ddH2O. Digestion was carried out in a water bath at 37°C for 40–60 min.

[0062] Electrophoresis: Prepare a 2.5% agarose gel (with added nucleic acid dye), spot the sample, and electrophores at 120V for 40 minutes. Once DNA fragments of different molecular weights are clearly separated, image them using a BIO-RAD Gel Doc 2000 gel imaging system. Determine the genotype based on the electrophoretic band images.

[0063] Since the primer pair P amplification product does not contain other restriction enzyme sites, the goat ADIPOQ gene 14059C>T polymorphism is as follows: the CC genotype shows two bands at 46 bp and 272 bp, the CT genotype shows three bands at 272 bp, 46 bp, and 318 bp, and the TT genotype shows one band at 318 bp. However, because the 46 bp fragment is too small to be visualized, only one band at 272 bp is visible for the CC genotype, two bands at 272 bp and 318 bp are visible for the CT genotype, and one band at 318 bp is visible for the TT genotype. Figure 3 ).

[0064] II. Frequency statistics of SNP sites in the goat ADIPOQ gene and their association with growth traits

[0065] 1. Gene and genotype frequencies

[0066] Genotype frequency refers to the ratio of different genotypes at a given locus in a population. The calculation formula is as follows:

[0067] P BB =N BB / N

[0068] Where P BB N represents the frequency of the BB genotype at a specific locus; BB This represents the number of individuals in the population with the BB genotype; N is the total number of individuals in the population being tested.

[0069] Gene frequency refers to the ratio of a particular gene to its alleles within a population. The formula for calculation can be written as:

[0070] P B =(2N) BB +N Bb1 +N Bb2 +N Bb3 +N Bb4 +……+N Bbn ) / 2N

[0071] In the formula, P B N represents the frequency of allele B. BBThe numbers represent the number of individuals with the BB genotype in the population, NBbi represent the number of individuals with the Bbi genotype, and b1 to bn are the n distinct multiple alleles of allele B. The statistical results of gene frequencies and genotype frequencies for each goat breed population are shown in Table 4.

[0072] Table 4. Population genetic analysis of the 14059th SNP in the ADIPOQ gene of goats

[0073]

[0074] 2. Correlation Analysis Statistical Model

[0075] The correlation between gene loci and growth traits was analyzed using SPSS (20.0) software. First, descriptive statistical analysis was performed to identify outliers. Based on data characteristics, t-analysis, ANOVA, or multiple linear models were used to analyze genotype effects. During data processing, considering environmental effects, age, genotype effects, and related interaction effects, a fixed model was used for analysis, taking into account the different factors affecting growth and development indicators such as body weight. However, some models were omitted based on actual circumstances. The complete model is as follows:

[0076] Y ijk =μ+G j +E ijk

[0077] Where: Yijk is the individual phenotypic record; μ is the population mean; Gj is the genotypic effect at each point; and Eijk is the random error.

[0078] The relevant data were statistically analyzed using the methods described above, and the results are shown in Table 5.

[0079] Table 5. Association analysis of different genotypes at position 14059 of the ADIPOQ gene in goats with growth traits.

[0080]

[0081] Note: The same letter indicates no significant difference (P>0.05), while different letters indicate a significant difference (P<0.05).

[0082] The results showed that association analysis between different genotypes at the 14059C>T single nucleotide polymorphism site (reference sequence NC_030808.1) in the goat ADIPOQ genome and goat growth traits indicated that the C-to-T base mutation at this site significantly affected body height and body length, with CT and TT genotypes having significantly higher rates than CC genotype individuals. This suggests that the T allele at this mutation site (14059C>T) in the ADIPOQ gene is closely related to goat growth traits (body height and body length). Therefore, the CT and TT genotypes at the 14059C>T site can serve as molecular breeding gene markers for early selection of goat growth traits. <110> Tongren University <120> A method and dedicated kit for rapid detection of ADIPOQ gene SNPs in goats <160> 2 <210> 1 <211> 25 <212> DNA <213> Artificial synthesis <400> 1 ggttaagcttctttaccacagaggtg 25 <210> 2 <211> 25 <212> DNA <213> Artificial synthesis <400> 2 cttccacact gaccgaagtc 20

Claims

1. A method for detecting goats ADIPOQ The application of gene single nucleotide polymorphism (SNP) methods in marker-assisted selection breeding of goat growth traits is characterized by: The goat being tested ADIPOQ The method for detecting single nucleotide polymorphisms (SNPs) in genes includes the following steps: Using goat genomic DNA as a template, PCR amplification was performed. ADIPOQ A portion of the gene was amplified, and the amplified product was subjected to restriction endonuclease. AvaII After enzyme digestion, agarose gel electrophoresis was performed to identify goats based on the electrophoresis results. ADIPOQ Genotype of a single nucleotide polymorphism (SNP) site; Amplification of the ADIPOQ The primer pairs for partial gene segments are: Upstream primer F1: 5'-GGTTAAGCTTCTTTACCACAGAGTG-3' Downstream primer R1: 5'-CTTCCACACTGACCGAAGTC-3'; The goat ADIPOQ The electrophoretic identification results of single nucleotide polymorphism sites were as follows: the CC genotype showed two bands of 46 bp and 272 bp, the CT genotype showed three bands of 272 bp, 46 bp and 318 bp, and the TT genotype showed one band of 318 bp. The growth traits were body height and body length, with goat individuals of the CT and TT genotypes showing significantly higher growth rates than those of the CC genotype.

2. The application according to claim 1, characterized in that: The PCR amplification reaction system includes 1 μL of 10 ng / μL template DNA and 0.5 μL each of 10 pmol / L upstream and downstream amplification primers.

3. The application according to claim 1, characterized in that: The PCR amplification reaction program used was as follows: pre-denaturation at 94-95℃ for 5 min; denaturation at 94-95℃ for 30 s, annealing at 54.1℃ for 30 s, extension at 72℃ for 25-60 s, 35 cycles; extension at 72℃ for 10 min.

4. The application according to claim 1, characterized in that: The agarose gel has a mass concentration of 2.5%.