rosa plants resistant to powdery mildew

CN110913687BActive Publication Date: 2026-08-28DUEMMEN GROUP BV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN201880046492.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2017-07-10
Filing Date
2018-07-03
Publication Date
2026-08-28
Estimated Expiration
2038-07-03

Smart Images

  • Figure BDA0002363211060000091
    Figure BDA0002363211060000091
  • Figure BDA0002363211060000101
    Figure BDA0002363211060000101
  • Figure BDA0002363211060000111
    Figure BDA0002363211060000111
Patent Text Reader

Abstract

The present invention relates to rose plants, such as cut rose plants, garden rose plants and potted rose plants, comprising at least two genes providing resistance against a pathogen causing powdery mildew. In particular, the present invention relates to rose plants that are resistant to the powdery mildew causing pathogen Podosphaera pannosa, also known as Sphaerotheca pannosa var. rosa. The present invention also relates to a method for selecting a powdery mildew resistant rose plant of the present invention. The rose plants of the present invention are characterized in that they comprise in their nuclear genome at least one nucleotide sequence represented by SEQ ID No. 1 and at least one nucleotide sequence represented by SEQ ID No. 2, wherein the combination of SEQ ID No. 1 and SEQ ID No. 2 is present providing powdery mildew resistance.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] describe

[0002] This invention relates to rose plants, such as cut roses, garden roses, potted roses, and rose rootstocks, containing at least two genes that provide resistance to pathogens causing powdery mildew. Specifically, this invention relates to rose plants resistant to the powdery mildew pathogen *Podosphaera pannosa*, also known as *Sphaerotheca pannosa* var. *rosa*. The invention also relates to a method for selecting powdery mildew-resistant rose plants according to the invention.

[0003] Powdery mildew (PM) is a major foliar disease in cut rose, potted rose, and garden rose plants, caused by the obligate, biotrophic ascomycete *Sphaerotheca pannosa*. Symptoms of powdery mildew infection include stunted growth and leaf deformities due to the formation of white, powdery conidia on plant surfaces such as leaves, flowers, stems, and buds. While there are no official data on yield losses in rose plants caused by powdery mildew, controlling powdery mildew in three major greenhouse crops—cucumber, tomato, and rose—costs $6,000 per hectare in Canada.

[0004] Powdery mildew can be controlled with chemicals, but the use of fungicides is expensive, labor-intensive, and environmentally harmful. Combined with the increasingly stringent regulations on the use of chemicals in horticulture being implemented by governments worldwide, this means that developing powdery mildew-resistant rose varieties is crucial for controlling powdery mildew outbreaks and preventing the economic losses they cause.

[0005] Although *Prunus cerasus* can infect a wide range of hosts, including sour cherry (*Prunus cerasus*) and sweet cherry (*Prunus avium*), the interaction between *Prunus cerasus* and Rosa species is characterized by a high degree of specificity. For example, several pathogenic serotypes of this fungus were described half a century ago, and a recent study examining compatibility between eight monoconidial isolates and 18 host genotypes revealed high levels of specificity and varietal diversity.

[0006] Cut roses are susceptible to powdery mildew (PM). To breed PM-resistant cut roses, there is a need to identify resistance genes. Several publications have shown evidence of the genetic basis of powdery mildew resistance in the genus *Rosa*, ranging from qualitative to quantitative resistance. However, commercially important cut roses (modern roses, *Rosa hybrida*) are typically tetraploid, and quantitative trait loci (QTLs) for powdery mildew resistance are primarily found in species or varieties other than modern roses.

[0007] For example, using a population of BC1 (n=117) of diploid Rosa multiflora hybrids produced by crossing a resistant line (88 / 124-46) with a susceptible line (82 / 78-1) and backcrossing the F1 hybrid 95 / 13-90 with 82 / 78-1, the Rpp1 gene was found to be the major effector gene on linkage 3. The Rpp1 gene conferred PM resistance in a dominant single-gene pattern lasting up to 10 days post-inoculation. Using different F1 populations (n=270) of diploid Rosa multiflora hybrids produced by crossing a resistant line (95 / 13-39) with a susceptible line (Sp3 or 82 / 78-1) from the same open pollination breeding program, QTLs were mapped to resistance in six different environments. This same open pollination breeding program aimed to introgress genes from tetraploid garden Rosa species into Rosa multiflora. A total of 28 distinct QTLs were identified on linkages 1, 2, 3, 4, 6, and 7, with strong clusters of QTLs on linkages 3 and 4. These results together indicate a polygenic resistance mechanism. A large proportion (31%) of the observed resistance phenotypic variation was inherited from susceptible parents, and interestingly, the aforementioned effects of the Rpp1 gene were not observed in this population.

[0008] In a diploid hybrid (n=90) between the Rosa cultivar “Yesterday” and Rosa wichurana, nine QTLs supporting resistance lasting up to 10 days after inoculation with both varieties were identified at linkage groups 2, 3, 5, and 6. Each linkage group explained between 15% and 74% of the phenotypic variation. Only one of the nine QTLs was detected in both varieties. Although most of the resistance alleles originated from Rosa wichurana, both parents contributed to the resistance variation.

[0009] In tetraploid cut roses, the only example of resistance providing a QTL derives from the K5 population, an F1 population produced by crossing two varieties, P540 and P867, both of which exhibit only partial resistance. Resistance was scored using two distinct fungal monospore isolates and three different disease scores: disease score at 11 days post-inoculation (dpi), latency, and rate of symptom development. Although no definitive statistical support was provided, each of the three disease scores showed a marker associated with powdery mildew, ranging from 16 to 28 across all seven linkage groups. While some markers were associated with multiple distinct disease scores, none of these markers were detected for either isolate. Multivariate regression was then performed for each of the six combinations of isolates and disease scores, using four or five of the most significant markers. The phenotypic variation explained by the multivariate regression ranged from 10.4% to 22.3%, indicating that resistance in this hybrid was quantitative and controlled by multiple genes, each with only a small influence.

[0010] Therefore, although several studies have published QTLs supporting powdery mildew resistance in Rosaceae, the most important theme is the lack of consistency and consensus among the published results. For example, the range of resistance varies from single-gene to quantitative. Furthermore, the absence of shared QTLs across studies suggests that the genetic mechanisms underlying the recognition of fungal proteins and the resulting powdery mildew resistance may be heterogeneous. To some extent, this heterogeneity may be a result of genetic diversity between and even within isolates, which, along with the hypothetical gene-for-gene interaction model, explains why the location and effect size of QTLs may depend on the isolates used.

[0011] Alternatively, the lack of confirmation, often due to low sample size, low marker coverage, or a combination of both, casts doubt on the stability of the conclusions drawn. An evaluation of a diploid F1 population of *Rosa roxburghii* (Guinong 6 x Guinong 5) under natural disease stress revealed that four resistance gene analogs (RGAs) that could not be assigned to linkage groups were associated with CRPM1, a major R locus that was not assigned to the LG and explained 72% of the phenotypic variation in powdery mildew resistance.

[0012] Mold resistance based on the MLO locus has been identified for the first time as a recessive allele in barley (Hordeum vulgare), providing durable resistance against all isolates of the mildew fungus *Blumeria graminis* f. sp. *horde*. MLO-based resistance is not unique to barley, as orthologs of MLO have been found in many other plant genera, such as *Pisum*, *Arabidopsis*, and *Solanum*, where loss-of-function mutations in MLO genes have been shown to result in broad-spectrum resistance to powdery mildew. The MLO protein family consists of seven clades, and although widespread in terrestrial plants, the functions of most MLO genes remain unknown, with all MLO genes shown to be associated with powdery mildew resistance found in clade V. In apple (Malus domestica), a member of the Rosaceae family, only 3 MLO homologs (two of which belong to clade V) among 21 MLO genes were upregulated after powdery mildew infection. This indicates that detecting MLO homologs alone is insufficient to identify genes involved in powdery mildew resistance.

[0013] However, despite the persistence of MLO-based resistance, it often has detrimental pleiotropic effects, such as necrotic leaf spot and reduced vigor, thus posing an obstacle when designing breeding strategies. In Rosa species (diploid wild rose hybrids and tetraploid modern rose varieties like Pariser Charme), four MLO genes, named RhMLO1 to RhMLO4, have been identified based on their sequence homology with well-characterized sequences obtained in barley and Arabidopsis. Each gene contains between two and six alleles, consists of 15 exons, and in all cases, encodes a total sequence length of approximately 1,700 bp. The MLO genes are distributed across several linkage groups, with rhMLO3 and rhMLO4 clustered together at LG1 (40–45 cM), rhMLO2 found at LG3 (around 35 cM), and rhMLO1 found at LG5 at around 60 cM.

[0014] Currently, no loss-of-function mutants are known in the genus *Rosa*, but all four MLO homologs have been identified as belonging to clade V, the only clade known to have MLO genes that play a role in powdery mildew resistance. Compared to non-transgenic control plants, only one of the four MLO genes found in *Rosa* is functionally associated with powdery mildew resistance, as transformation of wild rose 'Baiyu' with antisense rhMLO1 provided the plant with an increased (but not absolute) level of resistance to powdery mildew (up to 15 days post-inoculation).

[0015] In view of the above, there is a need in the art for additional genes that provide resistance to powdery mildew.

[0016] Among other purposes, one object of the present invention is to satisfy the aforementioned needs in the art.

[0017] According to the present invention, among other things, the above-mentioned objectives are achieved by providing a Rosa species as outlined in the appended claims.

[0018] Specifically, among other purposes, the aforementioned objective is achieved by providing a Rosa species resistant to powdery mildew, wherein the Rosa species contains at least one nucleotide sequence represented by SEQ ID No. 1 and at least one nucleotide sequence represented by SEQ ID No. 2 in its nuclear genome, wherein the combined presence of SEQ ID No. 1 and SEQ ID No. 2 in the nuclear genome provides resistance to powdery mildew.

[0019] The inventors have unexpectedly discovered that the combination of SEQ ID No. 1 and SEQ ID No. 2 provides strong resistance to powdery mildew. According to the invention, the combination of the two resistance genes is essential because SEQ ID No. 1 cannot provide detectable powdery mildew resistance in Rosa species in the absence of SEQ ID No. 2, while SEQ ID No. 2 provides weak powdery mildew resistance in the absence of SEQ ID No. 1. The inventors have also unexpectedly discovered that the resistance genes of the present invention are dominant genes, meaning that the presence of a single copy of both genes is sufficient to provide powdery mildew resistance.

[0020] According to a preferred embodiment, the present invention relates to resistance to powdery mildew from the ascomycete plant pathogen *Monothecia pubescens* (also known as *Monothecia pubescens* rose variety). *Monothecia pubescens* is a major ascomycete pathogen causing powdery mildew in Rosa species.

[0021] According to another preferred embodiment, the *Rosa* species of the present invention are modern rose plants, and the nuclear genome of the present invention is a tetraploid genome. Particularly in polyploid genomes such as diploid, triploid, tetraploid, hexaploid, or octaploid genomes, the availability of dominant powdery mildew resistance genes provides a significant advantage, avoiding a large number of intermediate powdery mildew phenotypes dependent on the copy number of the resistance gene present. The polyploid genomes of the present invention, such as triploid, tetraploid, hexaploid, or octaploid genomes, can be suitably obtained directly or indirectly through genome doubling of SEQ ID No. 1 and SEQ ID No. 2. For example, tetraploid, hexaploid, and octaploid genomes can be readily obtained from diploid genomes containing SEQ ID No. 1 and SEQ ID No. 2, and hexaploid genomes can also be obtained through genome doubling of triploid plants.

[0022] According to yet another preferred embodiment, the present invention relates to powdery mildew-resistant Rosa species, wherein the powdery mildew-resistant Rosa species contain in their nuclear genome at least one, preferably two, more preferably three, or even more preferably four nucleotide sequences represented by SEQ ID No. 1, such as 2, 3, 4, 5 or 6 in the case of a hexaploid genome, or 2, 3, 4, 5, 6, 7 or 8 in the case of an octoploid genome, and / or at least one, preferably two, more preferably three, or even more preferably four nucleotide sequences represented by SEQ ID No. 2, such as 2, 3, 4, 5 or 6 in the case of a hexaploid genome, or 2, 3, 4, 5, 6, 7 or 8 in the case of an octoploid genome.

[0023] According to yet another preferred embodiment, the present invention relates to powdery mildew-resistant Rosa species, wherein the powdery mildew-resistant Rosa species contain in its nuclear genome at least one, preferably three, more preferably four nucleotide sequences represented by SEQ ID No. 1, such as 2, 3, 4, 5 or 6 in the case of a hexaploid genome, or 2, 3, 4, 5, 6, 7 or 8 in the case of an octoploid genome, or at least one, preferably two, more preferably three, and even more preferably four nucleotide sequences represented by SEQ ID No. 2, such as 2, 3, 4, 5 or 6 in the case of a hexaploid genome, or 2, 3, 4, 5, 6, 7 or 8 in the case of an octoploid genome.

[0024] According to yet another preferred embodiment, the present invention relates to powdery mildew-resistant Rosa species, wherein the powdery mildew-resistant Rosa species contain in their nuclear genome at least one, preferably two, more preferably three and even more preferably four nucleotide sequences represented by SEQ ID No. 1, such as 2, 3, 4, 5 or 6 in the case of a hexaploid genome, or 2, 3, 4, 5, 6, 7 or 8 in the case of an octoploid genome, and at least one, preferably two, more preferably three and even more preferably four nucleotide sequences represented by SEQ ID No. 2, such as 2, 3, 4, 5 or 6 in the case of a hexaploid genome, or 2, 3, 4, 5, 6, 7 or 8 in the case of an octoploid genome.

[0025] According to a particularly preferred embodiment, the powdery mildew-resistant Rosa species of the present invention are selected from the group consisting of cut-flower Rosa species, potted Rosa species, Rosa rootstocks and garden Rosa species, and preferably cut-flower Rosa species.

[0026] According to yet another particularly preferred embodiment, the powdery mildew-resistant Rosa species of the present invention exhibit a dominant phenotype.

[0027] In view of the beneficial properties of powdery mildew resistance provided by the synergistic epistatic effect between two dominant genes, the present invention also relates to a method for selecting powdery mildew-resistant Rosa plants as defined above, the method comprising the following steps:

[0028] a) Isolate nuclear genomic DNA from Rosa species;

[0029] b) Determine the presence of SEQ ID No. 1 and SEQ ID No. 2 in the isolated nuclear genomic DNA;

[0030] c) Determine the powdery mildew phenotype of the Rosa species, wherein the presence of SEQ ID No. 1 and SEQ ID No. 2 indicates a powdery mildew resistance phenotype.

[0031] The present invention will be described in further detail in the embodiments below. In the embodiments, reference is made to the accompanying drawings, in which:

[0032] Figure 1 The image shows a boxplot illustrating the roles of individual and tandem resistance alleles SEQ ID No. 1 and SEQ ID No. 1. The presence of a resistance allele is indicated by a "+", while the absence of a resistance allele is indicated by a "-". Plants with two resistance alleles are highly resistant.

[0033] Figure 2The copy numbers of SEQ ID No. 1 and SEQ ID No. 2 required to provide powdery mildew resistance of the present invention in Rosa species are shown. Example

[0034] introduction

[0035] Here, we investigated the number, effect size, and genetic location of QTLs that establish PM resistance in a tetraploid F1 population of *Rosa* (modern roses). We present our results, showing that major-effect QTLs on linkage 1 and linkage 5 explain 20% and 90% of the phenotypic variation in PM resistance, respectively. We also show that the effect of QTLs is only observed when the resistance allele is present in both QTLs, as plants with resistance alleles in both QTLs exhibit high resistance up to 15 weeks post-inoculation, while plants with only one or zero resistance alleles show PM symptoms during this time period.

[0036] method

[0037] A tetraploid F1 modern rose population was established by artificial pollination of the tetraploid cut-flower rose RS-1183 (“Avalanche”, hereinafter referred to as P1) with pollen from tetraploid garden roses. An F2 population was generated by self-pollination of one of the resulting F1 progeny. The parents, 235 F1 progeny, and 42 F2 plants were screened for resistance to PM (Phyllium glomeratum). The isolates were initially obtained from Rosa plants infected in a horticultural greenhouse, and the inoculum was obtained from previous PM trials. Inoculation was performed in a block design, with six cuttings from each variety randomly assigned to six blocks. Bioassays were conducted under long-day conditions, with nighttime and daytime temperatures set at 20°C and 23°C, respectively. Relative humidity alternated between 60% during the day and 85% at night. The infection level of each plant in the F1 population was scored at 1, 3, 6, 9, 12 and 15 weeks post-infection, and the infection level of each plant in the F2 population was scored at 6 and 12 weeks post-infection. The infection level of plants in both populations was scored on a scale between 1 and 9, where 1 represents the most susceptible individual and 9 represents a fully resistant individual.

[0038] All plants were genotyped using the WagRhSNP Axiom SNP array. This array contained 68,893 SNPs, targeted from each direction by two probes. Quality control was performed using the R package FitPoly, and 67,779 markers were retained for 51,685 SNPs. After removing SNPs with more than 5% missing data, 42,143 markers were retained. A total of 232 F1 individuals were successfully genotyped, of which 3 were removed due to being genetic outliers, and 1 was removed due to missing phenotypic data. Further quality control was performed by examining parental genotype reproducibility, unexpected segregation, genotype outliers, skewed markers, invalid alleles, and differences between plates.

[0039] These related SNPs were mapped to linkage groups (LGs) and genetic locations using previously obtained genetic maps (using the K5 population). All related SNPs were segregated based on the assumption that resistant parents are simplexes and susceptible parents are nulliplexes. For chromosomes where QTLs were found, linkage maps were constructed in a JoinMap using markers for simplexes at P2 and nulliplexes at P1, and QTL analysis was performed in MapQTL.

[0040] For each genomic region significantly associated with PM resistance, KASP primers were designed to target the most significantly associated SNP as well as one SNP on either side. KASP primers were designed using flanking sequences of probes targeting associated SNPs on the WagRhSNP Axiom SNP array.

[0041] Genotyping was performed on all SNPs using KASP assays on the parents and a total of 48 randomly selected F1 plants. Genotypes were scored based on the number of resistance alleles carried by the individual. Since resistant parents had one copy of the resistance allele at each relevant SNP, while susceptible parents had zero copies of the resistance allele at each relevant SNP, the genotype dose in the F1 was limited to 0 (non-dominant combination for the resistance allele) and 1 (single dominant combination for the resistance allele).

[0042] result

[0043] A total of 267 markers showed a correlation >0.35 with PM resistance. All highly correlated markers were found on linkage groups 1 and 5 on the genetic map obtained using the K5 population. The order of the markers included in our genetic map and in the map obtained using the K5 population was conserved, confirming the successful construction of linkage maps for these two linkage groups.

[0044] Three weeks post-inoculation, SNP M23333_428 on homolog 5.2 explained up to 90% of the phenotypic variation (LOD = 114.2). At 15 weeks post-inoculation, a second SNP, G54183_559, was found at 60.5 cM on LG1 (LOD = 23.1) and homolog 1.1, explaining 20.3% of the phenotypic variation. Combined QTL analysis using a multiple QTL model showed that absolute resistance at 15 weeks required QTLs on both homolog 5.2 and homolog 1.1. Genotyping was performed on a total of 86 plants with PM resistance data using KASP assays, including 48 F1 progeny, 29 F2 plants (full-sib progeny of a self-pollinated F1 plant), and 4 P1 and P2 plants (including duplicates of both).

[0045] We first analyzed the association between SNP genotype and PM resistance in the F1 population. Genotyping call rates varied between 87% (for G8670_490) and 100%. Observing the association between KASP genotype and PM resistance, the presence of the resistance allele at the most closely associated SNP on both homologs strongly indicated PM resistance 15 weeks post-inoculation. All plants with this genotypic combination showed a PM score greater than 8 (high resistance). Figure 1 Plants with a resistance genotype at a single locus, or plants without a resistance genotype at all, are never highly resistant but primarily highly susceptible. Figure 2 Analysis using ANOVA showed that the co-epistatic effect was very significant (Table 1). Further genomic analysis of Rosa species yielded SEQ ID No. 1 and SEQ ID No. 2, which are directly associated with the resistance gene that established this resistance.

[0046] Table 1: Parameter estimates of the effects of SEQ ID No. 1: TTTGTTCATTATAAACTCATTCCTCGCTTCCTCAACCTTCTCTGAAACGACC and SEQ ID No. 2: GGCTTTTCGCCCTGCGTCTTGCTCTCCAAAAACTCACTACTAATTTGTCA (15 weeks post-inoculation) on powdery mildew resistance from linear models. Positive parameter estimates indicate that the resistant genotype is more resistant than the susceptible genotype. Positive interaction terms indicate co-epistatic effects: the effect of carrying a resistant genotype on one homolog is stronger when a resistant genotype is also present on another homolog.

[0047]

[0048] After demonstrating that resistance genes are required at both loci for conferring resistance, we then examined whether the mode of action at each locus was completely dominant; in other words, whether there was no difference in PM resistance between plants with one resistance allele at each locus and plants with multiple resistance alleles at each locus. To this end, we combined data from the F2 population with data from the parents and the F1 population. The F2 population was a self-pollinated population obtained by self-pollinating F1 plants with one resistance allele at each locus; therefore, assuming polysomy, we expected to obtain plants with 0, 1, and 2 copies at each locus in the resulting dataset. PM resistance in the F2 population was measured only up to 12 weeks post-inoculation. PM resistance at 12 weeks post-inoculation was strongly correlated with PM resistance at 15 weeks post-inoculation (r = 0.98), meaning that limiting our analysis to data from 12 weeks post-inoculation did not materially affect our conclusions.

[0049] Furthermore, it has been clearly shown that one resistance allele at each locus is sufficient to induce complete resistance 12 weeks after inoculation, and the presence of multiple resistance alleles at each locus does not substantially confer additional resistance. Figure 2 This is clear evidence that the resistance allele is dominant over the susceptibility allele.

[0050]

[0051] sequence list <110> Domo Group <120> Powdery mildew resistant Rosa species <130> 4 / 2XH16 / 22 <150> NL2019209 <151> 2017-07-10 <160> 2 <170> BiSSAP 1.3.6 <210> 1 <211> 52 <212> DNA <213> Rosa (genus) <400> 1 tttgttcatt ataaactcat tcctcgcttc ctcaaccttc tctgaaacga cc 52 <210> 2 <211> 50 <212> DNA <213> Rosa (genus) <400> 2 ggcttttcgc cctgcgtctt gctctccaaa aactcactac taatttgtca 50

Claims

1. A method for selecting powdery mildew-resistant Rosa species, the method comprising the following steps: a) Isolating nuclear genomic DNA from Rosa species; b) Determine the presence of SEQ ID No. 1 and SEQ ID No. 2 in the isolated nuclear genomic DNA; c) Determine the powdery mildew phenotype of the aforementioned Rosa species, wherein the presence of SEQ ID No. 1 and SEQ ID No. 2 indicates a powdery mildew resistance phenotype. The rose species mentioned therein are modern roses.

Citation Information

Patent Citations

  • Rapid identification method of physiological race of Chinese rose powdery mildew bacterium

    CN105925660A

  • Disease resistant cucumber plants

    CN101351116A

  • InDel molecular marker co-separated with cucumber powdery mildew resistance main effect gene

    CN104152450A