Dendrimer delivery systems and methods of use thereof

CN111615528BActive Publication Date: 2026-08-21JOHNS HOPKINS UNIVERSITY
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN201880086094.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2017-11-10
Filing Date
2018-11-13
Publication Date
2026-08-21
Estimated Expiration
2038-11-13

AI Technical Summary

Technical Problem

[0013]然而,尽管发表了大量关于构建体树枝状聚合物的简易且快速策略的开发的科学报告,但仍然存在重大的挑战

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure QLYQS_1
    Figure QLYQS_1
  • Figure BDA0002578439840000111
    Figure BDA0002578439840000111
  • Figure BDA0002578439840000131
    Figure BDA0002578439840000131
Patent Text Reader

Abstract

Provided are low-generation dendrimers containing a high density of surface hydroxyl groups and methods of their synthesis. In particular, oligoethylene glycol (OEG)-like dendrimers with a high surface functionality at relatively low generations (e.g., about 120 hydroxyl groups at the third generation, with a size of only 1-2 nm) are described. Also described are dendrimer formulations comprising one or more prophylactic, therapeutic, and / or diagnostic agents and methods of their use. The formulations are suitable for topical, enteral, and / or parenteral delivery for the treatment of one or more diseases, conditions, and injuries of the eye, brain, and nervous system (CNS), particularly those associated with pathological activation of microglia and astrocytes.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-reference to related applications

[0002] This application claims the benefit and priority of U.S. Application No. 62 / 584,623, filed November 10, 2017, which is incorporated herein by reference in its entirety.

[0003] Statement on Federally Funded Research

[0004] This invention was carried out with government support under license numbers NIBIB-1R01EB018306-01, NICHD-1R01HD076901-01A1, and 5R01EY025304-04 granted by the National Institutes of Health (NIH). The government enjoys certain rights to this invention.

[0005] References to sequence lists

[0006] The sequence list submitted by a text file named “JHU_C_14798_ST25.txt”, created on November 12, 2018 and of size 3,792 bytes, is hereby incorporated by reference in accordance with 37C.FR§1.52(e)(5). Technical Field

[0007] The present invention relates generally to the field of molecular delivery systems, and more specifically, to dendritic polymers for delivering preventive, therapeutic and / or diagnostic agents to the central nervous system of a subject to prevent, treat and / or diagnose diseases and / or symptoms. Background Technology

[0008] Central nervous system (CNS) disorders affect an estimated one billion people globally and are projected to become an even greater threat to the population in the future. CNS diseases are typically associated with highly complex alterations or degeneration of the human brain and pose significant challenges to scientists and clinicians. Among leading causes of death, CNS disorders are among the fastest-growing gaps between current clinical care and patient needs. This is largely due to increased life expectancy, leading to a surge in the number of people suffering from neurological disorders and resulting in an increased socioeconomic and healthcare burden worldwide (WM Padridg, Drug Discovery Today, 12, 54 (2007)). From a commercial perspective, pharmaceutical organizations should be expected to make active efforts in the discovery, development, and translation of neurotherapeutics; however, instead, many of these organizations have suspended or reduced their investment in CNS projects due to the high risk of failure in late-stage clinical trials (G. Wegener et al., International Journal of Neuropsychopharmacology, 16, 1687 (2013)). A major clinical challenge in developing therapies for CNS diseases, such as autoimmune diseases, brain tumors, and eye conditions, is achieving clinically relevant exposure of therapeutic agents to the site of injury, which is difficult to access due to CNS transport barriers. Poor transport of neuropharmaceuticals across the nearly impermeable CNS barrier limits the development of effective treatments for CNS conditions, from primary brain tumors to neurological and retinal diseases. The blood-brain barrier (BBB), a major obstacle to neuropharmaceutical development, is a dynamic and highly selective physical barrier that maintains brain homeostasis by modulating chemical uptake and limiting the entry of toxins and bloodborne pathogens (WABanks, Nature Reviews Drug Discovery, 15, 275 (2016)). Delivering drugs to other sites of the CNS presents similar challenges, such as the blood-retinal barrier (BRB) for treating eye diseases and pathology-dependent barriers (such as the barrier of traditional solid tumors).

[0009] Despite remarkable progress in neuroscience in understanding the structure, function, and role of the brain, therapeutic development in the field of neurological disorders lags behind that of other disease areas, such as infectious diseases, cancer, and cardiovascular diseases. Most brain-related disorders fall under the orphan or rare disease category identified by the U.S. Food and Drug Administration (“FDA”). The discovery and clinical development of CNS drugs presents significant challenges to pharmaceutical companies in terms of preclinical and clinical targeting, safety, efficacy, cost, and risk of failure compared to any other disease area. Consequently, numerous large pharmaceutical companies have suspended CNS drug discovery and development programs over the past decade (Wegener, G. et al., *International Journal of Neuropsychopharmacology*, 16, 1687 (2013)). Furthermore, unfavorable drug transport across the blood-brain barrier (“BBB”) limits the development of effective treatments for CNS-related disorders (Upadhyay, RK, *BioMed Research International*, 869269 (2014)). There is a great need to develop innovative approaches based on disease pathology to enable the appropriate delivery of therapeutic agents across the BBB for the treatment of neurological conditions.

[0010] Most treatments for neurological disorders require high-dose administration, leading to systemic side effects and toxicity. Conventional methods of circumventing the CNS barrier are highly invasive, causing further collateral damage and limiting the number of doses that can be administered in repeated treatment regimens due to the high risk of complications. Topically administered therapies also often exhibit poor diffusion across the brain parenchyma, resulting in limited brain distribution and requiring high doses that lead to toxicity. Recent strategies focusing on temporarily disrupting the BBB using chemical or mechanical methods are often spatially nonspecific, allowing unwanted, potentially harmful molecules to enter and potentially inducing harmful immune responses (X. Dong, *Theranostics*, 8, 1481 (2018)). The significant clinical variability in existing therapies for neurological disorders constitutes an urgent need to develop innovative, less invasive, dedicated drug delivery media that can enhance therapeutic delivery across the CNS barrier and target key diseased cells at the site of lesion.

[0011] Neuroinflammation mediated by activated microglia / ma is a major hallmark of many neurological disorders (MTHeneka et al., *Nature Reviews*, 2014, 14, 463 (2014); RMRansohoff, *Science*, 353, 777 (2016)). Pro-inflammatory mi / ma activation disrupts the BBB / BRB and may cause secondary damage by releasing apoptotic signals to neurons and glial cells. Anti-inflammatory activation promotes angiogenesis and cell growth while suppressing the immune response. Therefore, targeting both pro-inflammatory and anti-inflammatory mi / ma phenotypes with immunomodulators is an effective therapeutic strategy specific to the pathology of the disease. Nanocarriers that can effectively penetrate the CNS barrier after systemic administration, diffuse freely in brain tissue, and target key pathological cells at CNS lesion sites are extremely rare (S. Kannan et al., Science Translational Medicine, 4, 130ra46E (2012); J. Kwon et al., ACS Nano., 2016, 10, 7926; Y. Anraku et al., Nature Communications, 8, 1001 (2017)). In addition to favorable brain transport properties, a key objective in developing nanomedicine-based therapeutics for CNS conditions is to design nanostructures that can be readily translated into clinical applications. A primary criterion for potential nanoparticles for clinical use is their safety profile; other desirable characteristics include water solubility, synthetic reproducibility, and feasibility for large-scale commercial production (S. Mignani et al., Advanced Drug Delivery Reviews (2017)).

[0012] Based on their unique structural and physical characteristics, dendritic polymers have shown unprecedented potential as nanocarriers for a variety of biomedical applications, including targeted drug / gene delivery, imaging, and diagnostics (Sharma, A. et al., RSC Advances, 4, 19242 (2014); Caminade, A.-M. et al., Journal of Materials Chemistry B, 2, 4055 (2014); Esfand, R. et al., Drug Discovery Today, 6, 427 (2001); and Kannan, RM et al., Journal of Internal Medicine, 276, 579 (2014)).

[0013] However, despite numerous scientific reports on the development of simple and rapid strategies for constructing dendritic polymers, significant challenges remain. Therefore, there is still a need for improved nanomaterials for targeted delivery systems to target the CNS.

[0014] Therefore, the object of the present invention is to provide dendritic polymer compositions and methods of using the same to improve molecular delivery to CNS.

[0015] The object of this invention is to provide means of treating diseases, conditions and injuries of the brain and central nervous system, specifically those diseases, conditions and injuries associated with activated microglia and / or astrocytes.

[0016] Another objective of this invention is to provide biocompatible and inexpensive nanomaterials for the delivery of targeted drugs to the central nervous system with minimal local or systemic toxicity. Summary of the Invention

[0017] Dendritic polymers having at least one OH group per nm are described. 3 (number of hydroxyl groups / in nm) 3 (in units of volume), preferably at least 5 OH groups / nm 3 High-density hydroxyl groups. Typically, the molecular weight of these dendritic polymers is between about 500 Daltons and about 100,000 Daltons, preferably between about 500 Daltons and about 50,000 Daltons, and most preferably between about 1,000 Daltons and about 10,000 Daltons. Typically, the average diameter of these dendritic polymers is between about 1 nm and about 15 nm, preferably between about 1 nm and about 5 nm, and most preferably between about 1 nm and about 2 nm.

[0018] Dendritic polymers are described, comprising: (a) a central core; (b) one or more branching units; and (c) terminal functional groups. Exemplary chemical portions of (a), (b), and (c) are independently selected from: dipentaerythritol, pentaerythritol, 2-(aminomethyl)-2-(hydroxymethyl)propane-1,3-diol, 2-ethyl-2-(hydroxymethyl)propane-1,3-diol, 3,3',3”,3”'-silanetetramethyltetra(propane-1-thiol), 3,3-divinylpentane-1,4-diene, 3,3',3”-hypocyanotripropionic acid, 3, 3',3”-N-(2-aminoethyl)propionamide, 3,3',3”,3”'-(ethane-1,2-diylbis(azatriyl))tetrapropionamide, 3-(carboxymethyl)-3-hydroxyglutaric acid, 2,2'-((2,2-bis((2,2-hydroxyethoxy)methyl)propane-1,3-diyl)bis(oxy))bis(ethylene-1-ol), tetrakis(3-(trichlorosilyl)propyl)silane, 1-Thioglycerol, 2,2,4,4,6,6-hexachloro-1,3,5,215,415,615-triazatriphosphine heterocyclohexanetriene, 3-(hydroxymethyl)-5,5-dimethylhexane-2,4-diol, 4,4',4”-(ethane-1,1,1-triyl)triphenol, 2,4,6-trichloro-1,3,5-triazine, 5-(hydroxymethyl)benzene-1,2,3-triol, 5-(hydroxymethyl)benzene- 1,3-Diol, 1,3,5-tris(dimethyl(vinyl)silyl)benzene, carbosiloxane core, hypozoxytriethanol, ethylenediamine, propane-1,3-diamine, butane-1,4-diamine, 2,2',2'-hypozoxytris(ethylene-1-ol), α-cyclodextrin, β-cyclodextrin, γ-cyclodextrin, cucurbituril, phenyl-1,2,3,4,5,6-hexathiol, monosaccharides, disaccharides, trisaccharides, oligosaccharides, chitosan, and derivatives thereof. In some embodiments, these dendritic polymers are generation 1 (G1), G2, G3, G4, G5, G6, G7, G8, G9, or G10 dendritic polymers.

[0019] The surface hydroxyl density of these dendritic polymers is between approximately 1 hydroxyl (-OH) group / nm. 2 With 15 OH groups / nm 2 Between, between approximately 3 OH groups / nm 2 With 15 OH groups / nm 2 Between, between approximately 4 OH groups / nm 2 With 15 OH groups / nm 2 Between, between approximately 4 OH groups / nm 2 With 10 OH groups / nm 2 Between, at least one OH group / nm 2 At least 2 OH groups / nm 2At least 3 OH groups / nm 2 At least 4 OH groups / nm 2 At least 5 OH groups / nm 2 Furthermore, the molecular weight is between approximately 500 Daltons and approximately 100,000 Daltons, between approximately 500 Daltons and approximately 50,000 Daltons, between approximately 1,000 Daltons and approximately 20,000 Daltons, and between approximately 1,000 Daltons and approximately 10,000 Daltons.

[0020] Methods for calculating surface hydroxyl groups are known in the art. First, the surface area of ​​the dendritic polymer is calculated. In the case of PAMAM dendritic polymers, a spherical shape can be assumed for surface area calculation. The molecular weight of G4 hydroxyl-terminated PAMAM dendritic polymers is approximately 14,215 Daltons, and the measured diameter is... (i.e., 4.5 nm), and has 64 surface hydroxyl groups. This is achieved through the formula A = 47πr. 2 The estimated surface area of ​​the G4 PAMAM dendritic polymer, assumed to be spherical, is calculated and is therefore approximately 63.62 nm. 2 Therefore, the surface density of hydroxyl groups on the G4 PAMAM dendrimer is approximately 1.01 OH groups / nm. 2 Similarly, the molecular weight is approximately 28,826 Daltons, and the measured diameter is... (i.e., 5.4 nm) and the surface density of hydroxyl groups in the G5 hydroxyl-terminated PAMAM dendrimer with 128 surface hydroxyl groups is approximately 1.4 OH groups / nm. 2 (Based on 91.61nm) 2 (Estimated surface area). Molecular weight is approximately 58,048 Daltons, and the measured diameter is... (i.e., 6.7 nm) and the surface density of hydroxyl groups in the G6 hydroxyl-terminated PAMAM dendrimer with 256 surface hydroxyl groups is approximately 1.82 OH groups / nm. 2 (Based on 141.03nm) 2 (estimated surface area).

[0021] Compositions of dendritic polymer complexes are also provided, comprising one or more preventative, therapeutic, and / or diagnostic agents encapsulated, associated, and / or conjugated in the dendritic polymer. Typically, one or more preventative, therapeutic, and / or diagnostic agents are encapsulated, associated, and / or conjugated in the dendritic polymer complex at concentrations of about 0.01% to about 30%, preferably about 1% to about 20%, more preferably about 5% to about 20% by weight. Preferably, the preventative, therapeutic, and / or diagnostic agent is covalently conjugated to the dendritic polymer via one or more bonds selected from the group consisting of disulfides, esters, ethers, thioesters, carbamates, carbonates, hydrazines, and amides, optionally via one or more spacers. In some embodiments, the spacer is a preventative, therapeutic, and / or diagnostic agent, such as N-acetylcysteine. Exemplary active agents include anti-inflammatory drugs, chemotherapeutic agents, antiepileptic agents, vasodilators, and anti-infective agents.

[0022] Methods for treating, preventing, and / or imaging one or more symptoms of one or more diseases, conditions, and / or injuries of the eye, brain, and / or central nervous system (CNS) by administering dendritic polymers with high-density surface hydroxyl groups to a subject in need are also described. Typically, these conditions are associated with pathological activation of microglia and astrocytes. These compositions target activated microglia and astrocytes; and effectively alleviate or prevent or image one or more symptoms of these diseases, conditions, and / or injuries of the eye, brain, and / or nervous system associated with activated microglia and astrocytes. Typically, these dendritic polymer complexes are administered intravenously. Attached Figure Description

[0023] Figures 1A-1E are structural representations of (Figure 1A) a dendritic polymer (D2-OH-60) based on low-generation high-density PEG, (Figure 1B) a commercially available bis-MPA-G4-OH-64-hyperbranched polyester, (Figure 1C) a fourth-generation PAMAM dendritic polymer, (Figure 1D) an 8-arm star-shaped PEG (8-OH group), (Figure 1E) a linear PEG (2-OH group), and (Figure 1F) a branched polysaccharide dextran with multiple OH groups.

[0024] Figure 2 The bar graph shows the comparative quantitative distribution of D2-OH-60-Cy5, bis-MPA-G4-OH64-Cy5, and PAMAM-G4-OH64-Cy5 in three subregions of the brain (cortex, periventricular region, and hippocampus) in CP rabbit pups, measured as a percentage of intravenous dose per gram of tissue, at 4 hours and 24 hours postnatal day 1.

[0025] Figure 3The bar chart shows the comparative quantitative distribution of D2-OH-60-Cy5, bis-MPA-G4-OH64-Cy5, and PAMAM-G4-OH64-Cy5 in three subregions of the brain (cortex, periventricular region, and hippocampus) in CP rabbit pups relative to healthy rabbit pups, measured as a percentage of the intravenous dose per gram of tissue at a 24-hour time point on day 1 after birth.

[0026] Figure 4 The bar graph shows a comparative quantitative distribution of D2-OH-60-Cy5, bis-MPA-G4-OH64-Cy5, and PAMAM-G4-OH64-Cy5 in the major organs (heart, lungs, kidneys, and liver) and plasma of CP rabbit pups at 4 hours and 24 hours postnatal day 1, measured by percentage of intravenous dose per gram of tissue. The distribution is in three subregions of the brain (cortex, periventricular region, and hippocampus).

[0027] Figure 5 This is a bar graph showing the MTT cell viability assay results of BV-2 cells treated with increased concentrations of PEGOL-60 for 24 hours. n=3.

[0028] Figure 6A-6J The bar graph shows the anti-inflammatory and antioxidant properties of PEGOL-60 alone (i.e., drug-free) in vitro: BV2 mouse microglia were stimulated with 100 ng / ml LPS for 3 hours, followed by co-treatment with dendritic polymers for 24 hours. Figures 6A-6D This demonstrates the treatment of BV-2 cells with control, LPS, or PEGOL-60 at concentrations of 10 μg / ml, 50 μg / ml, 100 μg / ml, and 500 μg / ml for 24 hours with TNFα (…). Figure 6A ), INOS Figure 6B ), IL10 Figure 6C ) and IL6 ( Figure 6D The fold change in mRNA levels; Figure 6E-6G The study demonstrates the treatment of CD206 in BV-2 cells for 24 hours with control, LPS, or PEGOL-60 at concentrations of 10 μg / ml, 50 μg / ml, 100 μg / ml, and 500 μg / ml. Figure 6E Argl () Figure 6F ) and IL4 ( Figure 6G The fold change in mRNA levels; Figure 6H-6I The levels of secreted TNFα in BV-2 cells treated for 24 hours with control, LPS, or PEGOL-60 at concentrations of 10 μg / ml, 50 μg / ml, 100 μg / ml, and 500 μg / ml are shown. Figure 6H ) and the production of reactive species nitrite ( Figure 6I ); Figure 6J The cell viability of BV-2 cells treated with control, H2O2, or PEGOL-60 at concentrations of 10 μg / ml, 50 μg / ml, 100 μg / ml, and 500 μg / ml for 24 hours is shown.

[0029] Figures 7A-7F This is a bar graph illustrating the in vivo efficacy of PEGOL-60 in the CP model, where, in PND1, littermates of CP pups were randomly assigned to PBS, a single-dose PEGOL-60 group, or a repeated-dose PEGOL-60 group, and received PBS (PND1), PEGOL-60 (PND1), or PEGOL-60 (PND1 and PND3), respectively. Neurobehavioral tests were performed before treatment (baseline, 0 hours) and at 24, 48, and 96 hours post-treatment (n=6), including sucking and swallowing in each group at 24, 48, and 96 hours post-treatment. Figure 7A ), head movement ( Figure 7B ) and weight gain ( Figure 7C The levels of TNF-α were measured across PND5 (n=3) groups. Figure 7D ), IL-1β Figure 7E ) and IL-6 ( Figure 7F Pro-inflammatory cytokines.

[0030] Figures 8A-8B It's a bar chart. Figure 8A The quantitative biodistribution of PEGOL-60-Cy5 in three subregions of the brain (cortex, PVR, and hippocampus) in newborn rabbit pups with cerebral palsy was shown at different time points after injection (1 hour, 4 hours, and 24 hours, n=6) compared with age-matched healthy controls (n=4). Figure 8B The quantitative biodistribution of PEGOL-60-Cy5 in the major organs and plasma of neonatal cerebral palsy rabbit pups at different time points after injection (1 hour, 4 hours and 24 hours, n=6) is shown. Detailed Implementation

[0031] I. Definition

[0032] The term "pharmaceutically acceptable" refers to a compound, material, composition, and / or dosage form that, according to guidelines from agencies such as the Food and Drug Administration, is suitable for contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, and is proportionate to a reasonable benefit / risk ratio. The terms "carrier" or "excipient" refer to an inactive, organic or inorganic, natural or synthetic ingredient in a formulation, wherein one or more active ingredients are combined with it. In some embodiments, a carrier or excipient is an inert substance added to a pharmaceutical composition to facilitate the administration of the compound and / or not to cause significant irritation to the organism and not to eliminate the biological activity and properties of the administered compound.

[0033] The terms "biocompatibility" and "biocompatible" generally refer to materials that are generally non-toxic to the recipient and do not cause any significant adverse effects on the recipient, along with any of their metabolites or degradation products. Typically, biocompatible materials are those that do not elicit a significant inflammatory or immune response when administered to a patient.

[0034] The term "effective amount" or "therapeutic effective amount" refers to a non-toxic amount of a compound that is sufficient to provide the desired or reference result. For example, an effective amount can refer to a dose sufficient to alleviate or suppress one or more symptoms of the treated condition, disease, or symptom, or otherwise provide the desired pharmacological and / or physiological effect. The precise dosage will vary depending on a variety of factors, such as subject-dependent variables (e.g., age, immune system health status, etc.), the severity of the treated disease or symptom, and the route of administration and pharmacokinetics of the administered agent. The exact amount required varies from subject to subject, depending on the subject's species, age, and general condition, the severity of the treated disease, the specific compound used, and its administration method. An appropriate effective amount can be determined by those skilled in the art.

[0035] Unless otherwise specified, the term "molecular weight" generally refers to the relative average chain length of the bulk polymer. In practice, molecular weight can be estimated or characterized using various methods, including gel permeation chromatography (GPC) or capillary viscosity analysis. GPC molecular weight is reported as weight-average molecular weight (Mw), the opposite of number-average molecular weight (Mn). Capillary viscosity analysis provides an estimate of molecular weight as the intrinsic viscosity determined by diluting the polymer solution using a specific set of concentration, temperature, and solvent conditions.

[0036] The term "derivative" refers to modifications that include, but are not limited to, hydrolysis, reduction, or oxidation products of the disclosed compounds. Hydrolysis, reduction, and oxidation reactions are known in the art.

[0037] The term "hydrophilicity" refers to the property of having an affinity for water. For example, a hydrophilic polymer (or hydrophilic polymer segment) is a polymer (or polymer segment) that is primarily soluble in aqueous solutions and / or has a tendency to absorb water. Generally, the more hydrophilic a polymer is, the more likely it is to dissolve in water, mix with water, or be wetted by water.

[0038] The term "hydrophobicity" refers to the property of lacking an affinity for or repelling water. For example, the more hydrophobic a polymer (or polymer segment) is, the more likely it is to be insoluble in water, immiscible with water, or unwetted by water.

[0039] The term "therapeutic agent" refers to a medicine or agent that can be administered to prevent or treat a disease or condition. Therapeutic agents can be nucleic acids, nucleic acid analogs, small molecules, peptides, proteins, peptides, carbohydrates or sugars, lipids or surfactants, or combinations thereof.

[0040] The terms “treatment” or “prevention” refer to the occurrence of one or more symptoms of a disease, condition, or symptom in animals that may be susceptible to the disease, condition, and / or symptom but have not yet been diagnosed with it; the suppression of the disease, condition, or symptom, such as hindering its progression; and the relief of the disease, condition, or symptom, such as causing it to subside. Treating a disease or symptom includes improving at least one symptom of a particular disease or symptom, even if the underlying pathophysiology is not affected, such as treating pain in a subject by administering an analgesic, even if such an agent does not treat the cause of the pain.

[0041] The term "targeted portion" specifies a portion located at or away from a particular location. This portion can be, for example, a protein, nucleic acid, nucleic acid analogue, carbohydrate, or small molecule. The location can be a tissue, a specific cell type, or a subcellular compartment.

[0042] The terms “incorporation” and “encapsulation” refer to the incorporation, formulation, or other inclusion of a pharmaceutical agent in and / or on a composition, regardless of the manner in which the pharmaceutical agent or other materials are incorporated.

[0043] II. Composition

[0044] A. Dendritic polymers

[0045] Dendritic polymers are three-dimensional, hyperbranched, monodisperse, spherical and multivalent macromolecules containing surface end groups (Tomalia, DA et al., Biochemical Society Transactions, 35, 61 (2007); and Sharma, A. et al., ACS Macro Letters, 3, 1079 (2014)). Due to their unique structural and physical characteristics, dendritic polymers have shown unprecedented potential as nanocarriers for a variety of biomedical applications, including targeted drug / gene delivery, imaging, and diagnostics (Sharma, A. et al., RSC Progress, 4, 19242 (2014); Caminade, A.-M. et al., Journal of Materials Chemistry B, 2, 4055 (2014); Esfand, R. et al., Drug Discovery Today, 6, 427 (2001); and Kannan, RM et al., Journal of Internal Medicine, 276, 579 (2014)).

[0046] Dendritic polymers are emerging as potential candidates for a variety of biomedical applications, including drug / gene delivery, targeting, imaging, and diagnostics (oliman, GM et al., *Chem. Commun.* 2011, 47, 9572; and Tomalia, DA et al., *Proceedings of the Biochemical Society* 2007, 35, 61). Among several different types of dendritic polymers, polyaminoamine (PAMAM) dendritic polymers have been extensively explored for drug delivery applications due to their commercial availability, water solubility, and biocompatibility (Tomalia, DA et al., *Polym J* 1985, 17, 117). The small size and the presence of numerous easily tunable surface groups make these nanoparticles excellent carriers for transporting drugs to the CNS (Chemical, Natural, and Neurological Systems). Early studies have shown that non-cytotoxic, hydroxyl-terminated fourth-generation PAMAM dendrimers (approximately 4 nm in size, without any targeting ligands) can penetrate damaged BBBs and target activated microglia at the site of injury in the brain (several times more than in healthy controls) (Lesniak, WG et al., *Molecular Pharmaceutics*, 2013, 10). These dendrimers are non-toxic even at intravenous doses >500 mg / kg and are completely cleared by the kidneys. These findings have been validated in various small and large animal models (Kannan, S et al., Science Translational Medicine 2012, 4, 130ra46; Kambhampati, SP et al., Invest Ophthalmol Vis Sci 2015, 56; Nance, E et al., J. Control. Release 2015, 214, 112; Mishra, MK et al., ACS Nano 2014, 8, 2134; and Nanomedicine 2010, 5, 1317). The selective uptake and localization of these neutral dendritic polymers in activated microglia may be attributed to their ability to penetrate damaged BBBs and rapidly diffuse throughout the brain parenchyma, followed by uptake by activated glial cells that continuously phagocytose them.

[0047] Recent studies have shown that surface groups on dendritic polymers can have a significant impact on their biodistribution (Nance, E. et al., Biomaterials, 101, 96 (2016)). More specifically, in a rabbit model of cerebral palsy (CP), hydroxyl-terminated fourth-generation PAMAM dendritic polymers (approximately 4 nm in size) without any targeting ligands have shown significantly greater penetration (>20-fold) through the damaged BBB after systemic administration, compared to healthy controls, and have selectively targeted activated microglia and astrocytes (Lesniak, WG et al., Molecular Pharmaceutics, 10 (2013)). See Kannan, S. et al., Science Translational Medicine, 4, 130ra46 (2012); Iezzi, R. et al., Biomaterials, 33, 979 (2012); Mishra, MK et al., ACS Nano, 8, 2134 (2014); Kambhampati, SP et al., European Journal of Pharmaceutics and Biopharmaceutics, 95, Part B, 239 (2015); Zhang, F. et al., Controlled Release Journal, 249, 173 (2017); Guo, Y et al., PLOS ONE, 11, e0154437 (2016); and Inapagolla, R. et al., International Journal of Pharmaceutics, 399, 140 (2010).

[0048] The term "dendritic polymer" includes, but is not limited to, a molecular architecture having an inner core and repeating units connected to and extending from this inner core, each layer having one or more branching points and an outer surface connected to an end group of the outermost generation. In some embodiments, the dendritic polymer has a regular dendritic or "star-radial" molecular structure.

[0049] Typically, the dendritic polymer has a diameter of about 1 nm to about 50 nm, more preferably about 1 nm to about 20 nm, about 1 nm to about 10 nm, or about 1 nm to about 5 nm. In some embodiments, the diameter is between about 1 nm and about 2 nm. In a preferred embodiment, the diameter of the dendritic polymer effectively crosses the blood-brain barrier (“BBB”) and is retained for an extended period of time in target cells.

[0050] In a preferred embodiment, the dendritic polymer contains a plurality of hydroxyl groups. Some exemplary dendritic polymers containing high-density hydroxyl groups comprise commercially available polyester dendritic polymers, such as hyperbranched 2,2-bis(hydroxy-methyl)propionate polyester polymers (e.g., hyperbranched bis-MPA polyester-64-hydroxy, generation 4) and dendritic polyglycerol.

[0051] In some embodiments, the dendritic polymer containing high-density hydroxyl groups is an oligoethylene glycol (OEG)-like dendritic polymer. For example, second-generation OEG dendritic polymers (D2-OH-60) can be synthesized using efficient, robust, and atom-economical chemical reactions such as Cu(I)-catalyzed alkyne-azide click chemistry and photocatalyzed thiol-ene click chemistry. High-density polyol dendritic polymers can be obtained with very low generation rates and minimal reaction steps by using orthogonal supermonomers and supernuclear strategies. The backbone of such dendritic polymers has non-breakable polyether bonds throughout the structure to prevent disintegration in vivo and allow for the elimination of such dendritic polymers from the body as a single entity (non-biodegradable). In a preferred embodiment, the dendritic polymer is shown in Formula I below.

[0052]

[0053] Exemplary dendritic polymers include, but are not limited to, polyaminoamine (PAMAM), polyester, polylysine, polypropyleneamine (POPAM), poly(propyleneimide) (PPI), iptycene, aliphatic poly(ether), and / or aromatic polyether dendritic polymers. The dendritic polymer may have carboxyl, amine, and / or hydroxyl terminals. The dendritic polymer can be of any generation, including, but not limited to, generation 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the dendritic polymer is a PAMAM dendritic polymer used as a platform and modified with surface groups to increase the number of hydroxyl groups.

[0054] Each dendritic polymer in the dendritic polymer complex may have similar or different chemical properties from the other dendritic polymers (e.g., the first dendritic polymer may contain a PAMAM dendritic polymer, while the second dendritic polymer may contain a POPAM dendritic polymer). In some embodiments, the first or second dendritic polymer may further contain additional pharmaceutical agents. The multi-arm PEG polymer comprises polyethylene glycol having at least two branches with thiol or thiopyridine end groups; however, PEG polymers with other end groups (such as succinimidyl or maleimide ends) may be used. PEG polymers with a molecular weight range of 10 kDa to 80 kDa may be used.

[0055] Typically, the complete architecture of a dendritic polymer can be divided into a core portion, followed by radially connected branching units (i.e., branches), which are further modified with chemical functional groups with desired end groups on the outer surface of the dendritic polymer.

[0056] In some embodiments, the dendritic polymer is in the form of nanoparticles, and is described in detail in U.S. Publications No. US2011 / 0034422, US2012 / 0003155, and US2013 / 0136697.

[0057] The molecular weight of dendritic polymers can be varied to prepare polymer nanoparticles that form particles with properties optimized for specific applications, such as drug release rates. The molecular weight of the dendritic polymer can be between about 150 Da and 1 MDa. In some embodiments, the molecular weight of the polymer is between about 500 Da and about 100 kDa, more preferably between about 1 kDa and about 50 kDa, and most preferably between about 1 kDa and about 20 kDa.

[0058] In some embodiments, different variants of dendritic polymers are used as delivery mediators to deliver one or more active agents, including, but not limited to, dendritic and core-shell dendritic molecules. Dendritic molecules are dendritic wedges that include one type of function at the core (functional group, f = 1) and another type of function at the periphery (f = 8, 16, 32, etc.). Core-shell dendritic molecules typically consist of a central dendritic polymer having multiple dendritic polymers connected to its periphery. In some embodiments, active agents such as N-acetylcysteine ​​are conjugated to dendritic or core-shell dendritic molecules.

[0059] 1. Central core

[0060] The multifunctional core moiety allows for the stepwise addition of branching units (i.e., generation) around the core. The core of PAMAM is a diamine (typically ethylenediamine), which reacts with methyl acrylate and then with another ethylenediamine to produce generation 0 (G-0) PAMAM. The core moiety can be suitably replaced with different chemical moieties. For example, PAMAM dendrimers can be produced by using click chemistry to contain tetra(ethylene oxide) at the core (Han SC et al., Bulletin of the Korean Chemical Society (Bull. Korean Chem. Soc.) 33, 3501-3504 (2012)).

[0061] Table 1 lists exemplary chemical structures suitable as core components, including dipentaerythritol, pentaerythritol, 2-(aminomethyl)-2-(hydroxymethyl)propane-1,3-diol, 2-ethyl-2-(hydroxymethyl)propane-1,3-diol, 3,3',3”,3”'-silanetetramethyltetra(propane-1-thiol), 3,3-divinylpentane-1,4-diene, 3,3',3”-hypocyanotripropionic acid, 3,3', 3”-N-(2-aminoethyl)propionamide, 3,3',3”,3”'(ethane-1,2-diylbis(azatriyl))tetrapropionamide, 3-(carboxymethyl)-3-hydroxyglutaric acid, 2,2'-((2,2-bis((2-hydroxyethoxy)methyl)propane-1,3-diyl)bis(oxy))bis(ethyl-1-ol), tetrakis(3-(trichlorosilyl)propyl)silane, 1-thioglycerol, 2,2,4,4,6,6-Hexachloro-1,3,5,215,415,615-triazatriphosphine-hexacyclohexanetriene, 3-(hydroxymethyl)-5,5-dimethylhexane-2,4-diol, 4,4',4”-(ethane-1,1,1-triyl)triphenol, 2,4,6-trichloro-1,3,5-triazine, 5-(hydroxymethyl)benzene-1,2,3-triol, 5-(hydroxymethyl)benzene-1,3-diol, 1 The core portion comprises 3,5-tris(dimethyl(vinyl)silyl)benzene, a carbosiloxane core, hypozinyltriethanol, ethylenediamine, propane-1,3-diamine, butane-1,4-diamine, 2,2',2'-hypozinyltris(ethylene-1-ol), α-cyclodextrin, β-cyclodextrin, γ-cyclodextrin, cucurbita, benzene-1,2,3,4,5,6-hexathiol, monosaccharides, disaccharides, trisaccharides, oligosaccharides, or their azide-modified portions, or alkyne-modified portions. In some embodiments, the core portion is chitosan. Therefore, azide-modified chitosan or alkyne-modified chitosan is suitable for use with click chemistry and branching unit conjugation. In some embodiments, the core portion is ethylenediamine or tetra(ethylene oxide).

[0062] In some embodiments, the core portion is a straight-chain or branched polyvinylglycerol as shown in Formula II:

[0063]

[0064] X can be an amine, acid, aldehyde, alcohol, acetylene, allyl, acrylate, azide, toluenesulfonyl, methanesulfonate, thiol, N-hydroxysuccinimide-activated acid, or maleimide.

[0065] Table 1. Structural representations of various structural units (core, branching unit, surface group, monomer) in the synthesis of hydroxyl-terminated dendritic polymers

[0066]

[0067]

[0068]

[0069]

[0070]

[0071] 2. Branching unit

[0072] Table 1 lists exemplary chemical structures suitable as branching units, including dipentaerythritol, pentaerythritol, 2-(aminomethyl)-2-(hydroxymethyl)propane-1,3-diol, 2-ethyl-2-(hydroxymethyl)propane-1,3-diol, 3,3',3”,3”'-silanetetramethyltetra(propane-1-thiol), 3,3-divinylpentane-1,4-diene, 3,3',3”-hypoazinetripropionic acid, 3,3' 3”-N-(2-aminoethyl)propionamide, 3,3',3”,3”'(ethane-1,2-diylbis(azatriyl))tetrapropionamide, 3-(carboxymethyl)-3-hydroxyglutaric acid, 2,2'-((2,2-bis((2-hydroxyethoxy)methyl)propane-1,3-diyl)bis(oxy))bis(ethyl-1-ol), tetra(3-(trichlorosilyl)propyl)silane, 1-thioglycerol 2,2,4,4,6,6-Hexachloro-1,3,5,215,415,615-triazatriphosphine heterocyclohexanetriene, 3-(hydroxymethyl)-5,5-dimethylhexane-2,4-diol, 4,4',4”-(ethane-1,1,1-triyl)triphenol, 2,4,6-trichloro-1,3,5-triazine, 5-(hydroxymethyl)benzene-1,2,3-triol, 5-(hydroxymethyl)benzene-1,3-diol, 1,3,5-Tris(dimethyl(vinyl)silyl)benzene, carbosiloxane core, hypozinyltriethanol, ethylenediamine, propane-1,3-diamine, butane-1,4-diamine, 2,2',2'-hypozinyltris(ethylene-1-ol), α-cyclodextrin, β-cyclodextrin, γ-cyclodextrin, cucurbita, benzene-1,2,3,4,5,6-hexathiol, monosaccharides, disaccharides, trisaccharides, oligosaccharides, or their azide-modified portions, alkyne-modified portions. In some embodiments, the branching unit is chitosan. Therefore, azide-modified chitosan or alkyne-modified chitosan is suitable for conjugation with the core portion or other identical or different branching units using click chemistry. In some embodiments, the branching unit is methyl acrylate or ethylenediamine.

[0073] In some embodiments, the branching unit is a straight-chain or branched polyvinylglycerol as shown in Formula II.

[0074] In some embodiments, the branching unit is a supermonomer, i.e., AB nStructural units. Exemplary supermonomers comprise AB4, AB5, AB6, AB7, and AB8 structural units. The supermonomer strategy significantly increases the number of available end groups. An exemplary supermonomer is the AB5 orthorhombic supermonomer, which comprises an azide functional group and five allyl groups, prepared by reacting pentaerythritol with five allyl groups with a monotoluenesulfonated triethylene glycol azide (Scheme 2).

[0075] 3. Surface groups

[0076] Surface groups or terminal functional groups are not limited to primary amine terminals, hydroxyl terminals, carboxylic acid terminals, or thiol terminals. In some embodiments, desired surface groups can be added by one of the conjugation methods used for core and branching units.

[0077] Any of the chemical fractions listed in Table I can be used as a surface group for conjugation with one or more branching units via any of the common conjugation methods described above. In a preferred embodiment, the surface group is 1-thioglycerol, which is conjugated with one or more branching units via a photochemical thiol-ene reaction.

[0078] In some embodiments, dendritic polymers are capable of specifically targeting specific tissue regions and / or cell types, preferably cells and tissues of the central nervous system (CNS) and the eye. In some embodiments, dendritic polymers are capable of specifically targeting inflammatory sites in the body, preferably inflammatory sites in the CNS and the eye. Linear polymers and astral polymers with hydroxyl terminals do not target damaged cells in the brain and retina. However, dendritic polymers and dendritic polymers with high-density hydroxyl functional groups effectively target damaged cells in a manner independent of generation and also independent of structural units. Examples describe how newly synthesized dendritic polymers appear to target not only microglia and microphages but also other cells involved in brain injury.

[0079] In a preferred embodiment, the dendritic polymer has a plurality of hydroxyl (-OH) groups on the periphery of these dendritic polymers. The preferred surface density of the hydroxyl (-OH) groups is at least 1 OH group / nm. 2 (Number of hydroxyl surface groups / in nm) 2 (Surface area in units). For example, in some embodiments, the surface density of hydroxyl groups is greater than 2, 3, 4, 5, 6, 7, 8, 9, 10; preferably at least 10, 15, 20, 25, 30, 35, 40, 45, 50 or greater than 50. In other embodiments, the surface density of hydroxyl (-OH) groups is between about 1 and about 50, preferably 5-20 OH groups / nm. 2 (Number of hydroxyl surface groups / in nm) 2(Surface area in units), while the molecular weight is between approximately 500 Da and approximately 10 kDa.

[0080] In some embodiments, the dendritic polymer may have a portion of hydroxyl groups exposed on its outer surface, while other hydroxyl groups are located in the internal core of the dendritic polymer. In a preferred embodiment, the volume density of hydroxyl (-OH) groups in the dendritic polymer is at least 1 OH group / nm. 3 (Number of hydroxyl groups / in nm) 3 (in units of volume). For example, in some embodiments, the volume density of hydroxyl groups is 2, 3, 4, 5, 6, 7, 8, 9, 10 or greater than 10, 15, 20, 25, 30, 35, 40, 45 and 50. In some embodiments, the volume density of hydroxyl groups is between about 4 groups / nm. 3 Up to approximately 50 groups / nm 3 Between, preferably between about 5 groups / nm 3 Up to approximately 30 groups / nm 3 More preferably, the number of groups per nm is between 10. 3 Up to approximately 20 groups / nm 3 Between. In the case of second-generation high-density polyhydroxy dendritic polymers (D2-OH-60), the volume density of hydroxyl groups is approximately 14 groups / nm. 3 .

[0081] In a preferred embodiment, the dendritic polymer contains an effective number of hydroxyl groups to target activated microglia and / or astrocytes associated with diseases, conditions, or injuries of the CNS or eye.

[0082] B. Coupling agents and spacers

[0083] Dendritic polymer complexes can be formed from therapeutically active agents or compounds conjugated or linked to dendritic polymers, dendritic polymers, or hyperbranched polymers. Optionally, the active agent is conjugated to the dendritic polymer via one or more spacers / linkers through various bonds (such as disulfide bonds, ester bonds, carbonate bonds, carbamate bonds, thioester bonds, hydrazine bonds, acylhydrazine bonds, and amide bonds). In some embodiments, the linking occurs via a suitable spacer that provides a disulfide bridge between the agent and the dendritic polymer. In this case, under reducing conditions found in the body, the dendritic polymer complex is capable of rapidly releasing the agent in vivo via a thiol exchange reaction.

[0084] The term "spacer" refers to compounds used to link therapeutically preventative or diagnostic active agents to dendritic polymers. A spacer can be a single chemical entity or two or more chemical entities linked together to bridge the polymer to a therapeutic agent or imaging agent. A spacer can contain any small chemical entity, peptide, or polymer having a mercapto, thiopyridine, succinimide, maleimide, vinyl sulfone, or carbonate end.

[0085] The spacer can be selected from compounds capped with mercapto, thiopyridine, succinimide, maleimide, vinyl sulfone, and carbonate groups. The spacer can contain thiopyridine-capped compounds, such as dithiodipyridine, N-succinimide 3-(2-pyridyldithio)-propionic acid (SPDP), succinimide 6-(3-[2-pyridyldithio]-propamido)hexanoate (LC-SPDP), or sulfosuccinimide 6-(3-[2-pyridyldithio]-propamido)hexanoate (sulfonyl-LC-SPDP). Spacers can also contain peptides, which are linear or cyclic and essentially have thiol groups, such as glutathione, homocysteine, cysteine ​​and its derivatives, arg-gly-asp-cys (RGDC), cyclic (Arg-Gly-Asp-d-Phe-Cys)(c(RGDfC)), cyclic (Arg-Gly-Asp-D-Tyr-Cys), and cyclic (Arg-Ala-Asp-d-Tyr-Cys). Spacers can be thiol acid derivatives, such as 3-mercaptopropionic acid, thioacetic acid, 4-mercaptobutyric acid, thiocyclopentan-2-one, 6-mercaptohexanoic acid, 5-mercaptovalerate, and other thiol derivatives, such as 2-mercaptoethanol and 2-mercaptoethylamine. The spacer can be thiosalicylic acid and its derivatives, (4-succinimideoxycarbonyl-methyl-α-2-pyridinylthio)toluene, (3-[2-pyridinylthio]propionylhydrazine), the spacer can have a maleimide end, wherein the spacer comprises a polymer or small chemical entity, such as bis-maleimide diethylene glycol and bis-maleimide triethylene glycol, bis-maleimide ethane, bis-maleimide hexane. The spacer can contain vinyl sulfone, such as 1,6-hexane-bis-vinyl sulfone. The spacer can contain thioglycosides, such as thioglucose. The spacer can be a reducing protein (such as bovine serum albumin and human serum albumin), any thiol-terminated compound capable of forming disulfide bonds. The spacer can contain polyethylene glycol having maleimide, succinimide, and thiol ends.

[0086] In some embodiments, the spacer / linker is a γ-aminobutyric acid (GABA) linker, an allyl linker, a propargyl linker, an ethanethiol linker, or a pyridine disulfide linker. In a preferred embodiment, the spacer / linker is conjugated to the dendritic polymer via one or more of an ether bond, a thioester bond, a carbamate bond, a carbonate bond, a hydrazine bond, or an amide bond to improve stability under physiological conditions (e.g., compared to ester bonds).

[0087] In other embodiments, different linkers (e.g., allyl, propargyl, etc.) are connected to the surface of the dendritic polymer via different bonds (e.g., ether bonds, ester bonds, urethane bonds, carbonate bonds, etc.), which can participate in click chemistry for conjugating surfactants such as NAC. In yet another embodiment, the dendritic polymer is conjugated to a first surfactant via one linker and to a second surfactant via different linkers.

[0088] C. Therapeutic agents, preventative agents, and diagnostic agents

[0089] Various agents can be contained in the particles to be delivered. Agents can be proteins or peptides, sugars or carbohydrates, nucleic acids or oligonucleotides, lipids, small molecules, or combinations thereof. Nucleic acids can be oligonucleotides encoding proteins, such as DNA expression cassettes or mRNA. Representative oligonucleotides include siRNA, microRNA, DNA, and RNA. In some embodiments, the active agent is a therapeutic antibody. One or more types of active agents can be encapsulated, compounded, or conjugated to a dendritic polymer. For example, the dendritic polymer is conjugated to one or more NAC molecules via disulfide bridging bonds and to one or more antibodies via amide bonds.

[0090] Exemplary therapeutic agents include anti-inflammatory drugs, agents against malignant cell proliferation, chemotherapeutic agents, vasodilators, neuroactive agents, and anti-infective agents. In some embodiments, the dendritic polymer is linked to the target moiety, imaging agent, and / or therapeutic agent via spacers ending in disulfide, ester, ether, thioester, carbamate, carbonate, hydrazine, or amide bonds.

[0091] In some embodiments, the active agent is a targeting agent.

[0092] The targeted components include folic acid, linear or cyclic RGD peptides, TAT peptides, LHRH, and BH3.

[0093] 1. Therapeutic agents

[0094] The term "dendritic polymer complex" refers to a dendritic polymer conjugated or compounded with one or more therapeutic, preventative, or diagnostic agents. One or more therapeutic agents are compounded, covalently linked, or intramolecularly dispersed or encapsulated within the dendritic polymer. In some embodiments, two or more different therapeutic agents may associate with the dendritic polymer through covalent and / or non-covalent interactions.

[0095] When administered intravenously, dendritic polymer complexes preferentially cross the blood-brain barrier (BBB) ​​only under diseased conditions, not under normal conditions. Preferably, one or more agents are linked or conjugated to dendritic polymers that preferentially release the drug at target sites (i.e., disease sites and / or lesion sites). For example, some drugs can be released intracellularly under reducing conditions found in vivo. Dendritic polymer complexes linked to agents can be used to perform several functions, including targeting, localization to diseased sites, drug release, and imaging purposes. Dendritic polymer complexes may or may not be labeled with a targeting portion. In some embodiments, disulfide bonds are formed between the dendritic polymer and the agent or imaging agent via spacer or linker molecules.

[0096] In some embodiments, the molecule comprises an antibody, such as daclizumab or bevacizumab. Lanidomide Baliximab, ranibizumab, and pegaptanib sodium, or peptides (such as SN50), as well as NF antagonists.

[0097] In some embodiments, one or more therapeutic agents targeting the underlying cause of a disease or symptom, and one or more therapeutic agents alleviating one or more symptoms of the disease or symptom. Therefore, for the treatment of leukodystrophy, dendritic polymers can be conjugated with agents that prevent or reduce the production of very long-chain fatty acids, agents that promote peroxisome proliferation, agents that promote the removal of very long-chain fatty acids, agents that increase ABCD2 expression, or combinations thereof. One example is VBP15, a free steroid drug.

[0098] Preferred active agents include, but are not limited to: agents that prevent or reduce the production of very long-chain fatty acids, agents that promote peroxisome proliferation, agents that promote the removal of very long-chain fatty acids (e.g., phenyl 4-butyrate), agents that increase ABCD2 expression (e.g., bezafibrate), thyrotropin drugs (e.g., eprotirome, sobetirome), enzymes (e.g., galactosylceramidinase and arylsulfatase A, aspartate acylase), agents that reduce neuroinflammation (e.g., N-acetylcysteine, pioglitazone, vitamin E), and RNA oligonucleotides that interfere with gene transcription or transformation. In particularly preferred embodiments, the reagent is N-acetylcysteine, 4-phenylbutyric acid, bezafibrate, thyroid hormone (T3), subitilol, pioglitazone, resveratrol, VBP15, vitamin E, erucic acid, coenzyme Q10, chlormastine, galactosylceramidinase (GALC), aspartate acylase (ASPA), or arylsulfatase A (ARSA). Other suitable active agents include, but are not limited to, anti-inflammatory agents, neuroactive agents, and imaging agents. The dendritic polymer can be conjugated with more than one agent and more than one type of agent.

[0099] In some embodiments, the composition comprises one or more anti-stimulants and / or D-antiglutamate agents. Exemplary compounds are MK801, memantine, ketamine, and 1-MT.

[0100] a. Anti-inflammatory agents

[0101] In some embodiments, the composition comprises one or more anti-inflammatory agents. The anti-inflammatory agents reduce inflammation and may include steroidal and nonsteroidal drugs.

[0102] Preferred anti-inflammatory drugs are antioxidants containing N-acetylcysteine. Preferred NSAIDs include mefenamic acid. acid), aspirin, diflunisal, salicylate, ibuprofen, naproxen, fenofofen, ketoprofen, deacketoprofen, flurbiprofen, oxaprozin, loxoprofen, indomethacin, sulindac, etodolac, ketorolac, diclofenac, nabumetone, piroxicam, meloxicam, tenoxicam, droxicam, lornoxicam, Isoxicam, meclofenamic acid Flufenamic acid, tolfenamic acid, celecoxib, rofecoxib, valdecoxib, parecoxib, romiracoxib, etoricoxib, firocoxib, sulphonanilides, nimesulide, niflumic acid, and licofelone.

[0103] Representative small molecules include: steroids such as methylprednisone and dexamethasone; nonsteroidal anti-inflammatory agents (NSAIDs) including COX-2 inhibitors, corticosteroid anti-inflammatory agents, gold compound anti-inflammatory agents, immunosuppressants, anti-inflammatory agents, and anti-angiogenic agents; anti-excitotoxic agents such as valproic acid, D-aminophosphonovalerate, and D-aminophosphonovalerate heptaate; glutamate formation / release inhibitors such as baclofen, NMDA receptor antagonists, salicylates, and ranibizumab; and anti-VEGF agents including aflibercept and rapamycin. Other anti-inflammatory drugs include NSAIDs such as indomethacin, aspirin, acetaminophen, diclofenac sodium, and ibuprofen. Corticosteroids can be fluocinolone acetonide and methylprednisolone.

[0104] Exemplary immunomodulatory drugs include cyclosporine, tacrolimus, and rapamycin. In some embodiments, the anti-inflammatory agent is a biological agent that blocks the action of one or more immune cell types, such as T cells, or blocks proteins in the immune system, such as tumor necrosis factor-α (TNF-α), interleukin-17-A, interleukin-12, and interleukin-23.

[0105] In some embodiments, the anti-inflammatory agent is a synthetic or natural anti-inflammatory protein. Antibodies specific to selected immune components may be added to immunosuppressive therapy. In some embodiments, the anti-inflammatory agent is an anti-T cell antibody (e.g., anti-thymocyte globulin or anti-lymphocyte globulin), an anti-IL-2Rα receptor antibody (e.g., balithimab or dalizumab), or an anti-CD20 antibody (e.g., rituximab).

[0106] Many inflammatory diseases are associated with pathologically elevated signaling via lipopolysaccharide (LPS) receptors, Toll-like receptor 4 (TLR4). Therefore, there is great interest in discovering TLR4 inhibitors as potential anti-inflammatory agents. Recently, the structure of TLR4 binding to the inhibitor E5564 was resolved, enabling the design and synthesis of novel TLR4 inhibitors targeting the E5564 binding domain. These are described in U.S. Patent No. 8,889,101, the contents of which are incorporated herein by reference. As reported by Neal et al., PLOS ONE 2013; 8(6):e65779e, a similarity search algorithm combined with a limited screening method for small molecule libraries identified compounds that bind to the E5564 site and inhibit TLR4. The lead compound C34 is a compound with the formula C 17 H 27NO9's 2-acetamidopyranoside (MW 389) inhibits TLR4 in intestinal epithelial cells and macrophages in vitro and reduces systemic inflammation in mouse models of endotoxemia and necrotizing enterocolitis. Therefore, in some embodiments, the active agent is one or more TLR4 inhibitors. In preferred embodiments, the active agent is C34 and its derivatives or analogs.

[0107] In a preferred embodiment, one or more anti-inflammatory drugs are released from dendritic polymer nanoparticles after administration to a mammalian subject, and the release amount effectively inhibits inflammation for at least 1 day, 2 days, 3 days, 4 days, 5 days, or 6 days, preferably at least 1 week, 2 weeks, or 3 weeks, more preferably at least 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months.

[0108] b. Chemotherapy agents

[0109] Chemotherapy agents typically contain pharmaceutically or therapeutically active compounds that act by interfering with DNA synthesis or function in cancer cells. Based on their chemical action at the cellular level, chemotherapeutic agents can be classified into cell cycle-specific agents (effective during certain phases of the cell cycle) and cell cycle-nonspecific agents (effective during all phases of the cell cycle). Examples of chemotherapeutic agents include alkylating agents, angiogenesis inhibitors, aromatase inhibitors, antimetabolites, anthracyclines, antitumor antibiotics, platinum-based drugs, topoisomerase inhibitors, radioisotopes, radiosensitizers, checkpoint inhibitors, PD-1 inhibitors, plant alkaloids, glycolysis inhibitors, and their prodrugs.

[0110] Examples of PD-1 inhibitors include, for example, MDX-1106, a genetically engineered, fully human immunoglobulin G4 (IgG4) monoclonal antibody specific to human PD-1, and pembrolizumab, which was recently approved by the US FDA.

[0111] Representative chemotherapeutic agents include, but are not limited to: amsacrine, bleomycin, busulfan, capecitabine, carboplatin, carmustine, chlorambucil, ciplatin, cladribine, clofarabine, crisantaspase, cyclophosphamide, cytarabine, dacarbazine, dactinomycin D, daunorubicin, docetaxel, doxorubicin, epipodophyllotoxins, epirubicin, etoposide, and etoposide phosphate. Phosphate), fludarabine, fluorouracil, gemcitabine, hydroxycarbamide, idarubicin, ifosfamide, innotecan, leucovorin, liposomal doxorubicin, liposomal daunorubicindaunorubici, lomustine, nitrogen mustard, melphalan, mercaptopurine, mesna, methotrexate, mitomycin, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, pentostatin, procarbazine, raltitrexed, satraplatin In), streptozocin, teniposide, tegafur-uracil, temozolomide, teniposide, thiotepa, tioguanine, topotecan, treosulfan, vinblastine, vincristine, vindesine, vinorelbine, taxol and its derivatives, trastuzumab Cetuximab and rituximab or bevacizumab And combinations thereof. Representative apoptotic agents include, but are not limited to, fludarabinetaurosporine, cycloheximide, actinomycin D, lactosylceramide, 15d-PGJ(2)5 and combinations thereof.

[0112] Dendritic polymer complexes comprising one or more chemotherapeutic agents may be used prior to or in combination with immunotherapies such as those inhibiting checkpoint proteins (e.g., PD-1 or CTLA-4), adoptive T-cell therapy, and / or cancer vaccines. Methods for initiating and activating in vitro T cells for adoptive T-cell cancer therapy are known in the art. See, for example, Wang et al., *Blood*, 109(11):4865-4872 (2007) and Hervas-Stubbs et al., *Journal of Immunology*, 189(7):3299-310 (2012). Examples of cancer vaccines include, for example... (Cyprus-T), a dendritic cell-based vaccine for the treatment of prostate cancer (Ledford et al., Nature, 519, 17-18 (March 5, 2015)). This vaccine, along with other compositions and methods for immunotherapy, was reviewed in Palukka et al., Nature Reviews Cancer, 12, 265-277 (April 2012).

[0113] In some embodiments, the dendritic polymer complex effectively treats, images, and / or prevents inflammation of microglia in the brain in neurodevelopmental disorders (including, for example, Rett syndrome). In preferred embodiments, the dendritic polymer complex will be used to deliver an anti-inflammatory agent (D-NAC) and an anti-excitotoxic agent and a D-antiglutamate agent. Preferred candidates are: MK801, memantine, ketamine, and 1-MT.

[0114] c. Neuroactive agents

[0115] Various drugs have been developed and used to attempt to disrupt, influence, or temporarily halt the glutamate excitotoxic cascade leading to neuronal damage. One strategy is "upstream" attempts to reduce glutamate release. These drugs include sodium channel blockers such as riluzole, lamotrigine, and lifarizine. Nimodipine, a commonly used drug, is a voltage-dependent channel (L-type) blocker. Attempts are also made to affect individual sites on the coupled glutamate receptors themselves. Some of these drugs include felbamate, ifenprodil, magnesium, memantine, and nitroglycerin. These "downstream" drugs attempt to influence intracellular events such as free radical formation, nitric oxide formation, proteolysis, endonuclease activity, and ICE-like protease formation (a key component in the process leading to programmed cell death or apoptosis).

[0116] Active agents used to treat neurodegenerative diseases are well known in the art and can vary based on the symptoms and disease to be treated. For example, routine treatment for Parkinson's disease may include levodopa (often in combination with dopa decarboxylase inhibitors or COMT inhibitors), dopamine agonists, or MAO-B inhibitors.

[0117] Treatment for Huntington's disease may include dopamine blockers to help reduce abnormal behavior and movement, or medications such as amantadine and tetrabenazine to control movement. Other medications that may help alleviate chorea include relaxants and benzodiazepines. Compounds such as amantadine or remacemide have shown preliminary positive results. Anti-Parkinson's drugs can be used to treat hypokinesia and rigidity, especially in adolescent cases, and valproic acid can be used to treat myoclonic hyperkinesia. Psychiatric symptoms can be treated with medications similar to those used in the general population. Selective serotonin reuptake inhibitors and mirtazapine are recommended for depression, while atypical antipsychotics are recommended for psychosis and behavioral problems.

[0118] Riluzole (2-Amino-6-(trifluoromethoxy)benzothiazole) (i.e., an anti-excitoxin) produced improved survival in subjects with ALS. Other drugs (mostly off-label) and interventions have alleviated symptoms caused by ALS. Some treatments have improved quality of life, and some appear to prolong life. Common ALS-related therapies are reviewed in Gordon, Aging and Disease, 4(5):295-310 (2013), see Table 1 therefor, for example. A variety of other agents have been tested in one or more clinical trials, with efficacy ranging from no effect to promising. Exemplary agents are reviewed in Carlesi et al., Archives Italianennes de Biologie, 149:151-167 (2011). For example, therapies may include: agents that reduce excitotoxicity such as talampanel (8-methyl-7H-1,3-m-dioxacyclopenteno(2,3)benzodiazepine); cephalosporins such as ceftriaxone or memantine; and agents that reduce oxidative stress such as coenzyme Q10, manganoporphyrin, KNS-760704 [(6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazol-diamine dihydrochloride, RPPX] or edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one, MCI-186). Drugs; such as histone deacetylase (HDAC) inhibitors (including valproic acid, TCH346 (dibenzo(b,f)oxopyr-10-ylmethyl-methylprop-2-acetylacetylamine), minocycline, or tauroursodeoxycholic acid (TUDCA) to reduce apoptosis; drugs that reduce neuroinflammation, such as thalidomide and celastol; neurotropic agents, such as insulin-like growth factor 1 (IGF-1) or vascular endothelial growth factor (VEGF); heat shock protein inducers, such as amoroclomol; or autophagy inducers, such as rapamycin or lithium.

[0119] Treatment for Alzheimer's disease may include, for example, acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine, or donepezil; NMDA receptor antagonists such as memantine; or antipsychotic drugs.

[0120] Treatment for Lewy body dementia may include, for example, acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine, or donepezil; N-methyl-D-aspartate receptor antagonists such as memantine; dopaminergic therapies such as levodopa or selegiline; antipsychotics such as olanzapine or clozapine; REM therapy such as clonazepam, melatonin, or quetiapine; and antidepressant and anti-anxiety therapies, such as selective... Serotonin reuptake inhibitors (citalopram, escitalopram, sertraline, paroxetine, etc.) or serotonin and norepinephrine reuptake inhibitors (venlafaxine, mirtazapine, and bupropion) (see, for example, Macijauskiene et al., Medicina (Kaunas), 48(1):1-8 (2012)).

[0121] Exemplary neuroprotective agents are also known in the art, including, for example, glutamate antagonists, antioxidants, and NMDA receptor stimulants. Other neuroprotective agents and treatments include caspase inhibitors, trophic factors, anti-protein aggregation agents, therapeutic hypothermia, and erythropoietin.

[0122] Other common active agents used to treat neurological disorders include: amantadine and anticholinergic drugs for motor symptoms, clozapine for psychosis, cholinesterase inhibitors for dementia, and modafinil for daytime sleepiness.

[0123] d. Anti-infective agents

[0124] Antibiotics include: β-lactams such as penicillin and ampicillin; cephalosporins such as cefuroxime, cefaclor, cephalexin, cephydroxil, and cepfodoxime and proxetil; tetracyclines such as doxycycline and minocycline; macrolides such as azithromycin, erythromycin, rapamycin, and clarithromycin; fluoroquinolones such as ciprofloxacin, enrofloxacin, ofloxacin, gatifloxacin, levofloxacin, norfloxacin, tobramycin, colistin, or aztreonam; and antibiotics known to have anti-inflammatory activity such as erythromycin, azithromycin, or clarithromycin.

[0125] 2. Diagnostic reagents

[0126] Dendritic polymer nanoparticles may contain diagnostic agents for determining the location of the applied particles. These agents may also be used prophylactically. Exemplary diagnostic materials include paramagnetic molecules, fluorescent compounds, magnetic molecules, and radionuclides. Suitable diagnostic agents include, but are not limited to, X-ray imaging agents and contrast agents. Radionuclides may also be used as imaging agents. Exemplary radiolabeling includes... 14 C 36 C1, 57 Co、 58 Co、 51 Cr 125 I, 131 I, 111 Ln, 152 Eu、 59 Fe、 67 Ga、 32 P, 186 Re、 35 S, 75 Se、 175 Yb. Examples of other suitable contrast agents include radiopaque gases or exhaust compounds. In some embodiments, the developer incorporated into the dendritic polymer nanoparticles is a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), or an elemental particle (e.g., gold particles).

[0127] D. Excipients and apparatus

[0128] These compositions can be administered in combination with excipients. In preferred embodiments, the composition is administered via a systemic route, such as injection. Typical carriers are sterile water, saline, phosphate-buffered saline, and other injectable carriers.

[0129] The formulation of pharmaceutical compositions for administration via parenteral (intramuscular, intraperitoneal, intravenous (IV), or subcutaneous), enteral, and local routes is described.

[0130] 1. External application

[0131] These dendritic polymers can be administered parenterally via subdural, intravenous, intrathecal, intraventricular, intraarterial, intraamniotic, intraperitoneal, or subcutaneous routes.

[0132] For liquid formulations, pharmaceutically acceptable carriers can be, for example, aqueous or non-aqueous solutions, suspensions, emulsions, or oils. Parenteral carriers (for subcutaneous, intravenous, intra-arterial, or intramuscular injection) include, for example, sodium chloride solution, Ringer's glucose, glucose and sodium chloride, lactated Ringer's, and fixed oils. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, and injectable organic esters such as ethyl oleate. Aqueous carriers include, for example, water, alcohol / aqueous solutions, cyclodextrins, emulsions, or suspensions (containing saline and buffer media). These dendritic polymers can also be applied in emulsions such as water-in-oil. Examples of oils are petroleum, animal, plant, or synthetic oils, such as peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, cod liver oil, sesame oil, cottonseed oil, corn oil, olive oil, petrolatum, and mineral oil. Suitable fatty acids for parenteral formulations include, for example, oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

[0133] Compounds suitable for parenteral administration may contain antioxidants, buffers, antibacterial agents, and solutes that make the compound isotonic with the blood of the intended recipient, as well as aqueous and non-aqueous sterile suspensions that may contain suspending agents, solubilizers, thickeners, stabilizers, and preservatives. Intravenous mediators may contain fluids and nutritional supplements, electrolyte supplements, such as Ringer's glucose-based supplements. Generally, water, saline, aqueous glucose and related sugar solutions, and ethylene glycol such as propylene glycol or polyethylene glycol are preferred liquid carriers, especially for injectable solutions.

[0134] Injectable drug carriers for use in injectable compositions are well known to those skilled in the art (see, for example, Pharmaceutics and Pharmacy Practice, JB Lippincott Company, Philadelphia, PA, eds. Banker and Chalmers, pp. 238-250 (1982), and ASHP Handbook on Injectable Drugs, Trissel, 15th edition, pp. 622-630 (2009)).

[0135] Convection-enhanced delivery (“CED”) formulations contain low molecular weight sales solutions and sugars such as mannitol.

[0136] 2. Intestinal administration

[0137] These dendritic polymers can be administered intravenously. The carrier or diluent can be a solid carrier or diluent for a solid formulation, a liquid carrier or diluent for a liquid formulation, or a mixture thereof.

[0138] For liquid formulations, pharmaceutically acceptable carriers can be, for example, aqueous or non-aqueous solutions, suspensions, emulsions, or oils. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, and injectable organic esters such as ethyl oleate. Aqueous carriers include, for example, water, alcohol / aqueous solutions, cyclodextrins, emulsions, or suspensions (containing saline and buffer media).

[0139] Examples of oils are petroleum, animal, vegetable, or synthetic oils, such as peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, cod liver oil, sesame oil, cottonseed oil, corn oil, petrolatum, and mineral oil. Suitable fatty acids for parenteral formulations include, for example, oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

[0140] The carrier includes, for example, sodium chloride solution, Ringer's glucose, glucose and sodium chloride, lactated Ringer's, and fixed oil. The formulation includes, for example, aqueous and non-aqueous isotonic sterile injectable solutions that may contain antioxidants, buffers, and antibacterial agents, and solutes that make the formulation isotonic with the blood of the intended recipient, as well as aqueous and non-aqueous sterile suspensions that may contain suspending agents, solubilizers, thickeners, stabilizers, and preservatives. The carrier may include, for example, fluids and nutritional supplements, electrolyte supplements, such as Ringer's glucose-based supplements. Generally, water, saline, aqueous glucose, and related sugar solutions are preferred liquid carriers. These carriers can also be formulated with proteins, fats, carbohydrates, and other components of infant formula.

[0141] 3. Topical application

[0142] The active agent and optional delivery medium can be applied topically. Topical application may include, for example, direct application to exposed tissues, vascular systems, or tissues or prostheses during surgical procedures. The preferred tissue for topical application is the eye.

[0143] III. Methods for preparing dendritic polymer nanoparticles

[0144] The synthesis of dendritic polymers and methods for preparing dendritic polymer nanoparticles are also described.

[0145] A. Dendritic polymers

[0146] Dendritic polymers can be prepared through a variety of chemical reaction steps. They are typically synthesized using methods that allow control over their structure at each stage of construction. Dendritic structures are primarily synthesized through two different methods: divergent or convergent.

[0147] In some embodiments, a divergent approach is used to prepare dendritic polymers, wherein the dendritic polymers are assembled from a multifunctional core that extends outward through a series of reactions (typically the Michael reaction). This strategy involves coupling monomer molecules with reactive and protective groups to the multifunctional core moiety, resulting in stepwise addition of generations around the core followed by removal of the protective groups. For example, the PAMAM-NH2 dendritic polymer is synthesized first by coupling an N-(2-aminoethyl)acrylamide monomer to an ammonia core.

[0148] In other embodiments, a convergent method is used to prepare dendritic polymers, wherein the dendritic polymers are constructed from small molecules that end up on the surface of spheres, and the reaction proceeds inward, builds inward, and eventually attaches to the core.

[0149] There are many other synthetic routes for preparing dendritic polymers, such as orthogonal methods, accelerated methods, two-stage polymerization methods or supernuclear methods, supermonomer methods or branched monomer methods, double exponential methods; orthogonal coupling methods or two-step methods, two-monomer methods, and AB2-CD2 methods.

[0150] In some embodiments, click chemistry can be used to modify the core, one or more branching units, one or more linkers / spacers, and / or one or more surface groups of dendritic polymers to allow for conjugation with additional functional groups (branching units, linkers / spacers, surface groups, etc.), monomers, and / or surfactants (Arseneault M et al., Molecules, May 20, 2015; 20(5):9263-94). In some embodiments, pre-formed dendrites are clicked onto high-density hydroxyl polymers. "Click chemistry" refers to coupling two distinct parts (e.g., a core group and a branched unit; or a branched unit and a surface group) via, for example, a 1,3-dipolar cycloaddition reaction between an alkyne moiety (or its equivalent) on the surface of a first part and an azide moiety (e.g., present on a triazine composition) (or its equivalent) (or any active end group, such as a primary amine end group, a hydroxyl end group, a carboxylic acid end group, a thiol end group, etc.) on a second part.

[0151] In some embodiments, dendritic polymer synthesis is performed in response to one or more reactions selected from the group consisting of: thiol-ene click reaction, thiol-alkyne click reaction, CuAAC, Diels-Alder click reaction, azide-alkyne click reaction, Michael addition, epoxy ring opening, esterification, silane chemistry, and combinations thereof.

[0152] In another embodiment, the PEG-based dendritic polymers were rapidly synthesized in gram quantities using fewer reaction steps with orthogonal chemistry, and exhibited a similar surface density (approximately 60 terminal hydroxyl groups) at generation 2 compared to the widely studied PAMAM dendritic polymers at generation 4.

[0153] Any existing dendritic platform can be used to prepare dendritic polymers with the desired function, i.e., high-density surface hydroxyl groups by conjugation of high hydroxyl groups containing moieties such as 1-thioglycerol or pentaerythritol. Exemplary dendritic platforms such as polyaminoamine (PAMAM), poly(propyleneimine) (PPI), poly-L-lysine, melamine, poly(ether hydroxylamine) (PEHAM), poly(ester amine) (PEA), and polyglycerol can be synthesized and explored.

[0154] B. Dendritic polymer complex

[0155] Dendritic polymer complexes can be formed from therapeutically active agents or compounds conjugated or linked to dendritic polymers, dendritic polymers, or hyperbranched polymers. Conjugation of one or more active agents to dendritic polymers is known in the art and is described in detail in U.S. Publications Nos. 2011 / 0034422, 2012 / 0003155, and 2013 / 0136697.

[0156] In some embodiments, one or more active agents are covalently linked to a dendritic polymer. In some embodiments, the active agent is linked to the dendritic polymer via a linker designed to cleave in vivo. The linker may be designed to cleave hydrolyzed, enzymatically, or in combination thereof to provide sustained release of the active agent in vivo. Both the composition of the linker and its connection point with the active agent are selected such that cleavage of the linker releases the active agent or a suitable prodrug thereof. The composition of the linker may also be selected based on the desired release rate of the active agent.

[0157] In some embodiments, the connection occurs via one or more of a disulfide bond, ester bond, ether bond, thioester bond, carbamate bond, carbonate bond, hydrazine bond, or amide bond. In a preferred embodiment, the connection occurs via a suitable spacer that provides a disulfide bridge between the drug and the dendritic polymer. In this case, under reducing conditions found in the body, the dendritic polymer complex is able to rapidly release the drug in vivo via a thiol exchange reaction. Some suitable spacers for formation are the aforementioned disulfide bridges between the drug and the dendritic polymer.

[0158] The linking portion typically contains one or more organic functional groups. Examples of suitable organic functional groups include secondary amides (-CONH-), tertiary amides (-CONR-), secondary carbamates (-OCONH-; -NHCOO-), tertiary carbamates (-OCONR-; -NRCOO-), ureas (-NHCONH-; -NRCONH-; -NHCONR-, -NRCONR-), methanol (-CHOH-, -CROH-), disulfide groups, hydrazones, hydrazides, ethers (-O-), and esters (-COO-, -CH2O2C-, CHRO2C-), where R is an alkyl, aryl, or heterocyclic group. Generally, the identity of one or more organic functional groups within the linking portion is chosen in consideration of the desired release rate of the active agent. Additionally, one or more organic functional groups can be selected to facilitate covalent bonding between the active agent and the dendritic polymer. In a preferred embodiment, the bonding can occur via a suitable spacer that provides a disulfide bridge between the agent and the dendritic polymer. Under reducing conditions found in the body, dendritic polymer complexes can rapidly release drugs in vivo via thiol exchange reactions.

[0159] In some embodiments, the linking portion comprises one or more of the organic functional groups described above in combination with the spacer group. The spacer group can consist of any assembly of atoms (including oligomers and polymer chains); however, the total number of atoms in the spacer group is preferably between 3 and 200 atoms, more preferably between 3 and 150 atoms, even more preferably between 3 and 100 atoms, and most preferably between 3 and 50 atoms. Examples of suitable spacer groups include alkyl, heteroalkyl, alkylaryl, oligomer and polyethylene glycol chains, and oligomer and poly(amino acid) chains. Variations in the spacer group provide additional control over the release of anti-inflammatory agents in vivo. In embodiments where the linking portion comprises a spacer group, one or more organic functional groups will generally be used to link the spacer group to both the anti-inflammatory agent and the dendritic polymer.

[0160] Reactions and strategies for covalently linking surfactants to dendritic polymers are known in the art. See, for example, March, *Advanced Organic Chemistry*, 5th ed., 2001, Wiley-Interscience Publication, New York, and Hermanson, *Bioconjugate Techniques*, 1996, Elsevier Academic Press, USA. Due to the compatibility of functional groups, protecting group strategies, and the presence of unstable bonds, appropriate methods for covalently linking a given surfactant can be selected based on the desired linking site and the overall structure of the surfactant and the dendritic polymer.

[0161] The optimal drug loading will necessarily depend on many factors, including the choice of drug, the structure and size of the dendritic polymer, and the tissue to be treated. In some embodiments, one or more active drugs are encapsulated, associated, and / or conjugated to the dendritic polymer at concentrations of: about 0.01% to about 45% by weight, preferably about 0.1% to about 30%, about 0.1% to about 20%, about 0.1% to about 10%, about 1% to about 10%, about 1% to about 5%, about 3% to about 20%, and about 3% to about 10% by weight. However, the optimal drug loading for any given drug, dendritic polymer, and target site can be determined by conventional methods, such as those described.

[0162] In some embodiments, the conjugation of the activator and / or linker occurs via one or more surface and / or internal hydroxyl groups. Thus, in some embodiments, the activator / linker conjugation occurs at approximately 1%, 2%, 3%, 4%, or 5% of the total available hydroxyl groups of the dendritic polymer prior to conjugation. In other embodiments, the activator / linker conjugation occurs at less than 5%, less than 10%, less than 15%, less than 20%, less than 25%, less than 30%, less than 35%, less than 40%, less than 45%, less than 50%, less than 55%, less than 60%, less than 65%, less than 70%, or less than 75% of the total available hydroxyl groups of the dendritic polymer prior to conjugation. In a preferred embodiment, the dendritic polymer complex retains an effective amount of hydroxyl groups to target microglia and / or astrocytes while conjugating an effective amount of activator to treat, prevent, and / or image diseases, conditions, and / or injuries of the eye and / or CNS.

[0163] IV. Instructions for Use

[0164] A method of using a dendritic polymer complex composition is also described. In a preferred embodiment, the dendritic polymer complex penetrates the damaged or destroyed BBB and targets activated microglia and astrocytes.

[0165] A. Treatment methods

[0166] These formulations can be used to treat conditions associated with infection, inflammation, or cancer, specifically those with systemic inflammation that extends to the nervous system, particularly the CNS.

[0167] Typically, an effective amount of a dendritic polymer complex is administered to the individual in need. This dendritic polymer complex comprises a combination of a dendritic polymer with one or more therapeutic, preventative, and / or diagnostic active agents. The dendritic polymer may also contain a targeting agent, but as the examples illustrate, these are not essential for delivery to damaged tissue in the spinal cord and brain.

[0168] In some embodiments, the dendritic polymer complex comprises a pharmaceutical agent linked or conjugated to the dendritic polymer, which is capable of preferentially releasing the drug intracellularly under reducing conditions found in vivo. The pharmaceutical agent may be covalently linked or intramolecularly dispersed or encapsulated. The amount of the dendritic polymer complex administered to the subject is selected to deliver an effective amount, compared to a control (e.g., a subject treated with an active agent without the dendritic polymer), to alleviate, prevent, or otherwise relieve one or more clinical or molecular symptoms of the disease or condition to be treated.

[0169] B. Symptoms requiring treatment

[0170] These compositions are suitable for treating one or more diseases, conditions, and injuries of the eye, brain, and nervous system, specifically those diseases, conditions, and injuries associated with pathological activation of microglia and astrocytes. These compositions can also be used to treat other diseases, conditions, and injuries (including gastrointestinal conditions and eye diseases) and to treat other tissues that act on nerves in a disease or condition. These compositions and methods are also suitable for preventative use.

[0171] Preferably, the diameter is less than 15 nm and the hydroxyl surface density is at least 3 OH groups / nm. 2 Preferably, the diameter is less than 10 nm and the hydroxyl surface density is at least 4 OH groups / nm. 2 More preferably, the diameter is less than 5 nm and the hydroxyl surface density is at least 5 OH groups / nm. 2 And most preferably, the diameter is between 1 nm and 2 nm and the hydroxyl surface density is at least 4 OH groups / nm. 2Dendritic polymer complex compositions for delivering therapeutic, preventative, or diagnostic agents selectively target microglia and astrocytes, which play a crucial role in the pathogenesis of many conditions and symptoms, including neurodevelopmental disorders, neurodegenerative diseases, necrotizing enterocolitis, and brain cancer. Therefore, these dendritic polymer complexes are administered in doses that effectively treat or alleviate symptoms associated with pathological conditions involving microglia and astrocytes. Typically, dendritic polymers deliver agents to specifically treat neuroinflammation by targeting these cells.

[0172] Microglia are a type of glial cell (glial cell) that are distributed throughout the brain and spinal cord. Microglia account for 10-15% of all cells found in the brain. As resident macrophages, microglia serve as the first and primary form of active immune defense in the central nervous system (CNS). Microglia play a crucial role after CNS injury and can exhibit both protective and detrimental effects depending on the timing and type of damage (Kreutzberg, GW, Trends in Neurosciences, 19, 312 (1996); Watanabe, H. et al., Neuroscience Letters, 289, 53 (2000); Pollazzi, E. et al., Glia, 36, 271 (2001); Mallard, C. et al., Pediatric Research, 75, 234 (2014); Faustino, JV et al., The Journal of Neuroscience: The Official Journal of the Society for Neuroscience). Neuroscience, 31, 12992 (2011); Tabas, I. et al., Science, 339, 166 (2013); and Aguzzi, A. et al., Science, 339, 156 (2013). Changes in microglia also affect normal neuronal development and synaptic pruning (Lawson, LJ et al., *Neuroscience*, 39, 151 (1990); Giulian, D. et al., *Journal of Neuroscience: Official Journal of the Society for Neuroscience*, 13, 29 (1993); Cunningham, TJ et al., *Journal of Neuroscience: Official Journal of the Society for Neuroscience*, 18, 7047 (1998); Zietlow, R. et al., *The European Journal of Neuroscience*, 11, 1657 (1999); and Paolicelli, RC et al., *Science*, 333, 1456 (2011)). Microglia undergo significant morphological changes, from branched structures to amoeba-like structures, and proliferate after injury. The resulting neuroinflammation disrupts the blood-brain barrier at the site of injury and leads to acute and chronic neuronal and oligodendrocyte death. Therefore, targeted pro-inflammatory microglia should be a powerful and effective therapeutic strategy. Damaged microglia in neuroinflammatory diseases could be used to deliver drugs carrying nanoparticles into the brain.

[0173] In a preferred embodiment, the dendritic polymer is applied in an amount that effectively treats microglial-mediated pathology in subjects in need without any associated toxicity.

[0174] In some embodiments, the subject to be treated is a human being. In some embodiments, the subject to be treated is a child or infant. All methods may include the step of identifying and selecting subjects who need treatment or who will benefit from the administration of the described composition.

[0175] 1. Eye diseases and injuries

[0176] These compositions and methods are suitable for treating eye-related discomfort, pain, dryness, excessive tearing, injury, infection, and burns.

[0177] Examples of treatable eye conditions include: amebic keratitis, fungal keratitis, bacterial keratitis, viral keratitis, onchorcercal keratitis, bacterial keratoconjunctivitis, viral keratoconjunctivitis, corneal dystrophy, Fuchs' endothelial dystrophy, meibomian gland dysfunction, anterior and posterior blepharitis, conjunctival hyperemia, conjunctival necrosis, cicatricial scarring and fibrosis, punctate epithelial keratopathy, filamentous keratitis, comeal erosions, thinning, ulceration and perforation of the cornea, Sjogren's syndrome, and Stevens-Johnson syndrome. Syndrome, autoimmune dry eye syndrome, environmental dry eye syndrome, corneal neovascularization, prevention and treatment of corneal transplant rejection, autoimmune uveitis, infectious uveitis, anterior uveitis, posterior uveitis (including toxoplasmosis), panuveitis, vitreous or retinal inflammatory diseases, prevention and treatment of endophthalmitis, macular edema, macular degeneration, age-related macular degeneration, proliferative and non-proliferative diabetic retinopathy, hypertensive retinopathy, retinal autoimmune diseases, primary and metastatic intraocular melanoma, other intraocular metastatic tumors, open-angle glaucoma, angle-closure glaucoma, pigmentary glaucoma, and combinations thereof. Other conditions include corneal injury, burns or abrasions, cataracts, and age-related ocular degeneration or related visual impairment.

[0178] In a preferred embodiment, the ocular condition to be treated is age-related macular degeneration (AMD). AMD is a neurodegenerative and neuroinflammatory disease of the macula that causes central vision loss. The pathogenesis of AMD involves chronic neuroinflammation of the choroid (the vascular layer beneath the retina), retinal pigment epithelium (RPE), the cellular layer beneath the sensory retina, Bruch's membrane, and the sensory retina itself.

[0179] 2. Neurological and neurodegenerative diseases

[0180] Neurodegenerative diseases are chronic, progressive conditions of the nervous system that affect neurological and behavioral function and involve biochemical changes that lead to diverse histopathological and clinical syndromes (Hardy H et al., Science 1998; 282:1075-9). Abnormal proteins that resist cellular degeneration accumulate within cells. The pattern of neuronal loss is selective, in the sense that one group is affected while others remain intact. Typically, these diseases have no clear precipitating cause. Classically described neurodegenerative diseases include Alzheimer's disease, Huntington's disease, and Parkinson's disease.

[0181] Neuroinflammation mediated by activated microglia and astrocytes is a major hallmark of various neurological disorders, making it a potential therapeutic target (Hagberg, H et al., Annals of Neurology 2012, 71, 444; Vargas, DL et al., Annals of Neurology 2005, 57, 67; and Pardo, CA et al., International Review of Psychiatry 2005, 17, 485). Multiple scientific reports have shown that targeting these cells to reduce neuroinflammation in its early stages can delay disease onset and thus provide a longer therapeutic window (Dommergues, MA et al., *Neuroscience* 2003, 121, 619; Perry, VH et al., *Nature Reviews Neurology* 2010, 6, 193; Kannan, S et al., *Science Translational Medicine* 2012, 4, 130ra46; and Block, ML et al., *Nature Reviews Neurology* 2007, 8, 57). Delivering therapeutic agents across the blood-brain barrier is a challenging task. Neuroinflammation leads to disruption of the blood-brain barrier (BBB). Drug-loaded nanoparticles can be transported across the brain by utilizing damaged BBBs in neuroinflammatory diseases (Stolp, HB et al., Cardiovascular Psychiatry and Neurology, 2011, 10; and Ahishali, B et al., International Journal of Neuroscience, 2005, 115, 151).

[0182] These compositions and methods can also be used to deliver active agents to treat neurological or neurodegenerative diseases or conditions or central nervous system disorders. In preferred embodiments, these compositions and methods are effective in treating and / or alleviating neuroinflammation associated with neurological or neurodegenerative diseases or conditions or central nervous system disorders. These methods typically involve administering an effective amount of the composition to a subject to increase cognition or reduce cognitive decline, increase cognitive function or reduce cognitive decline, increase memory or reduce memory decline, increase ability or learning ability or reduce ability or learning ability decline, or a combination thereof.

[0183] Neurodegeneration refers to the gradual loss of neuronal structure or function, including neuronal death. For example, these compositions and methods can be used to treat subjects with diseases or conditions such as Parkinson's disease (PD) and PD-related conditions, Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD) and other dementias, prion diseases such as Creutzfeldt-Jakob disease, corticobasal degeneration, frontotemporal dementia, HIV-related cognitive impairment, mild cognitive impairment, motor neuron disease (MND), spinocerebellar ataxia (SCA), spinal muscular atrophy (SMA), Friedrich's ataxia, Lewy body dementia, Alpers' disease, Batten disease, brain-ocular-facial-skeletal syndrome, corticobasal degeneration, and Gerstmann-Straussler-Scheinker disease. Diseases including: Kuru disease, Lewy's disease, unilateral muscular atrophy, multiple system atrophy, multiple system atrophy with orthostatic hypotension (Shy-Drager syndrome), multiple sclerosis (MS), neurodegeneration with brain iron deposition, strabismus-myoclonus, posterior cortical atrophy, primary progressive aphasia, progressive supranuclear palsy, vascular dementia, progressive multifocal leukoencephalopathy, Lewy body dementia (DLB), lacunar syndrome, hydrocephalus, Wemicke-Korsakoff's syndrome, post-encephalitis dementia, cancer and chemotherapy-related cognitive impairment and dementia, and dementia and pseudodementia induced by depression.

[0184] In some embodiments, the condition is peroxisome disease or leukodystrophy, characterized by a detrimental effect on the growth or maintenance of myelin sheaths in isolated nerve cells. Leukodystrophy can manifest in various ways, including, for example, 18q syndrome with myelin basic protein deficiency, acute disseminated encephalomyelitis (ADEM), acute disseminated leukoencephalitis, acute hemorrhagic leukoencephalopathy, X-linked adrenoleukodystrophy (ALD), adrenocortical neuropathy (AMN), Aicardi-Goutieres syndrome, Alexander disease, adult-onset autosomal dominant leukodystrophy (ADLD), autosomal dominant diffuse leukoencephalopathy with neuroaxonal spheroids (HDLS), autosomal dominant late-onset leukoencephalopathy, childhood ataxia with diffuse CNS myelination reduction (CACH), or vanishing white matter encephalopathy. Diseases including: Canavan disease, Cerebral autosomal dominant arteropathy with subcortical infarcts and leukoencephalopathy (CADASIL), Cerebral tendinous xanthomas (CTX), Craniometaphysical dysplasia with leukoencephalopathy, Cystic leukoencephalopathy with RNASET2, and Extensive cerebral white matter abnormalities without clinical symptoms. Familial adult-onset leukodystrophy (AALL) presenting with cerebellar ataxia and dementia; familial AALL with adult-onset dementia and abnormal glucose and lipid storage; globoid cell leukodystrophy (Krabb disease); hereditary adult-onset leukodystrophy mimicking chronic progressive multiple sclerosis; hypomyelination with basal ganglia and cerebellar atrophy (HABC); hypomyelination, gonadotropin insufficiency, hypogonadism, and incomplete tooth development (4H syndrome); lipomembranous skeletal dysplasia.Osteodysplasia with leukodystrophy (Nasu disease), metachromatic leukodystrophy (MLD), megalencephalic leukodystrophy with subcortical cysts (MLC), hereditary diffuse leukodystrophy with axonal globules (HDLS), neonatal adrenoleukodystrophy (NALD), oculodetatoldigital dysplasia with white matter abnormalities, orthochromatic leukodystrophy with pigmented gliomas, ovarian leukodystrophy syndrome, Pelizaeus Merzbacher disease (X-linked spastic paraplegia), Rifsum disease, Sjogren-Larssen syndrome, sulophilic leukodystrophy, and van der Knaap syndrome. Leukodystrophy (including vacuolar leukodystrophy with subcortical cysts or MLC), leukoablative encephalopathy (VWM) or childhood ataxia with diffuse central nervous system myelination loss (CACH), X-linked adrenoleukodystrophy (X-ALD) and Zellweger spectrum disorders including Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, leukodystrophy with spinal cord and brainstem involvement and elevated white matter lactate (LBSL) or DARS2 leukodystrophy. In a preferred embodiment, leukodystrophy is adrenoleukodystrophy (ALD) (including X-linked ALD), metachromatic leukodystrophy (MLD), Krabby's disease (globular leukodystrophy), or DARS2 leukodystrophy.

[0185] In some embodiments, the subject suffers from excitotoxicity. Excitotoxicity is the process by which nerve cells become damaged due to overstimulation. A variety of conditions, including stroke, traumatic brain injury, multiple sclerosis, amyotrophic lateral sclerosis (ALS), Alzheimer's disease, and spinal cord injury, are associated with excitotoxicity. Damage to nerve cells leads to corresponding neurological symptoms, which may vary depending on the damaged cells and the extent of the damage. Once damaged, nerve cells cannot repair themselves, and patients may experience permanent damage. Various drugs have been developed and used to attempt to interrupt, influence, or temporarily halt the glutamate excitotoxic cascade leading to neuronal damage. One strategy is to attempt "upstream" reduction of glutamate release. These drugs include riluzole, lamotrigine, and lifarizine, which are sodium channel blockers. Nimodipine, commonly used, is a voltage-dependent channel (L-type) blocker. Attempts have also been made to affect individual sites of the coupled glutamate receptors themselves. Some of these drugs include felbamate, efendil, magnesium, memantine, and nitroglycerin. These "downstream" drugs attempt to influence intracellular events such as free radical formation, nitric oxide formation, proteolysis, endonuclease activity, and ICE-like protease formation (a key component in processes leading to programmed cell death or apoptosis). Therefore, in some embodiments, the dendritic polymer complex contains one or more active agents for treating excitotoxic conditions.

[0186] In some embodiments, the subject has a neurological condition or requires neuroprotection. Exemplary conditions and / or subjects include, but are not limited to, subjects who have had, have had, or may have had or suffered from stroke, traumatic brain injury, spinal cord injury, post-traumatic stress disorder, or a combination thereof.

[0187] In some embodiments, these compositions and methods are administered to subjects in need in an effective amount to alleviate or prevent one or more molecular or clinical symptoms or one or more mechanisms causing neurodegeneration in neurodegenerative diseases.

[0188] Active agents used to treat neurodegenerative diseases are well known in the art and can vary based on the symptoms and disease to be treated. For example, routine treatment for Parkinson's disease may include levodopa (often in combination with dopa decarboxylase inhibitors or COMT inhibitors), dopamine agonists, or MAO-B inhibitors.

[0189] Treatment for Huntington's disease may include dopamine blockers to help reduce abnormal behavior and movement, or medications such as amantadine and buprofen to control movement. Other medications that may help alleviate chorea include neurasthenia gravis and benzodiazepines. Compounds such as amantadine or remdesivir have shown preliminary positive results. Anti-Parkinson's drugs can be used to treat hypokinesia and rigidity, especially in adolescent cases, and valproic acid can be used to treat myoclonic hyperkinesia. Psychiatric symptoms can be treated with medications similar to those used in the general population. Selective serotonin reuptake inhibitors and mirtazapine are recommended for depression, while atypical antipsychotics are recommended for psychosis and behavioral problems.

[0190] Riluzole (2-Amino-6-(trifluoromethoxy)benzothiazole) (i.e., an anti-excitoxin) produced improved survival in subjects with ALS. Other drugs (mostly off-label) and interventions can alleviate symptoms caused by ALS. Some treatments improve quality of life, and some appear to prolong life. Common ALS-related therapies are reviewed in Gordon, Aging and Disease, 4(5):295-310 (2013), see Table 1 therefor, for example. A variety of other agents have been tested in one or more clinical trials, with efficacy ranging from no effect to promising. Exemplary agents are reviewed in Carlesi et al., Italian Journal of Biology, 149:151-167 (2011). For example, therapies may include: agents that reduce excitotoxicity such as talampanel (8-methyl-7H-1,3-m-dioxacyclopenteno(2,3)benzodiazepine); cephalosporins such as ceftriaxone or memantine; and agents that reduce oxidative stress such as coenzyme Q10, manganese porphyrin, KNS-760704 [(6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazol-diamine dihydrochloride, RPPX] or edaravone (3-methyl-1-phenyl-2-pyrazolone-5-one, MCI-186). Drugs; such as histone deacetylase (HDAC) inhibitors (including valproic acid, TCH346 (dibenzo(b,f)oxopyr-10-ylmethyl-methylprop-2-acetylacetylamine), minocycline, or tauroursodeoxycholic acid (TUDCA) to reduce apoptosis; drugs that reduce neuroinflammation such as thalidomide and tripterygium wilfordii; neurotrophic agents such as insulin-like growth factor 1 (IGF-1) or vascular endothelial growth factor (VEGF); heat shock protein inducers such as amoromo; or autophagy inducers such as rapamycin or lithium.

[0191] Treatment for Alzheimer's disease may include, for example, acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine, or donepezil; NMDA receptor antagonists such as memantine; or antipsychotic drugs.

[0192] Treatment for Lewy body dementia may include, for example, acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine or donepezil; N-methyl-d-aspartate receptor antagonist memantine; dopaminergic therapy such as levodopa or selegiline; antipsychotics such as olanzapine or clozapine; REM therapy such as clonazepam, melatonin or quetiapine; antidepressant and anti-anxiety therapy such as selective serotonin reuptake inhibitors (citalopram, escitalopram, sertraline, paroxetine, etc.) or serotonin and norepinephrine reuptake inhibitors (venlafaxine, mirtazapine and bupropion) (see, for example, Macijauskiene et al., Traditional Medicine (Kaunas), 48(1):1-8 (2012)).

[0193] Exemplary neuroprotective agents are also known in the art, including, for example, glutamate antagonists, antioxidants, and NMDA receptor stimulants. Other neuroprotective agents and treatments include caspase inhibitors, trophic factors, anti-protein aggregation agents, therapeutic hypothermia, and erythropoietin.

[0194] Other common active agents used to treat neurological disorders include: amantadine and anticholinergic drugs for motor symptoms, clozapine for psychosis, cholinesterase inhibitors for dementia, and modafinil for daytime sleepiness.

[0195] 3. Neurodevelopmental disorders

[0196] Neurodevelopmental disorders typically mean that the brain did not develop normally from the beginning. This may involve abnormal regulation of basic neurodevelopmental processes, or damage that may manifest in various forms. Classically, autism and attention deficit hyperactivity disorder are described as neurodevelopmental disorders.

[0197] Cerebral palsy (CP) is one of the most common pediatric neurological / neurodevelopmental disorders, currently estimated to affect approximately 2 to 3 per 1,000 live births (Kirby, RS et al., Research in Developmental Disabilities, 32, 462 (2011)). CP is recognized in early childhood and its symptoms persist throughout life. The most common causes of CP include preterm birth, hypoxia-ischemia and placental insufficiency, birth asphyxia, and maternal-fetal inflammation (Dammann, O., Acta Pcediatrica, 2007, 96, 6; Yoon, BH et al., American Journal of Obstetrics and Gynecology, 2000, 182, 675; and O'Shea, TM et al., Journal of Child Neurology, 2012, 27, 22). Although CP is etiologically heterogeneous and the mechanisms of the disease are highly complex, neuroinflammation is a common pathophysiological mechanism unrelated to etiology. Targeting neuroinflammation and delivering drugs directly at the site of damage could be beneficial.

[0198] These compositions and methods can also be used to deliver active agents to treat neurodevelopmental disorders such as cerebral palsy. In preferred embodiments, these compositions and methods are effective in treating and / or alleviating neuroinflammation associated with neurodevelopmental disorders such as cerebral palsy.

[0199] In some embodiments, the dendritic polymer complex effectively treats, images, and / or prevents inflammation of microglia in the brain in neurodevelopmental disorders (including, for example, Rett syndrome). In preferred embodiments, the dendritic polymer complex will be used to deliver an anti-inflammatory agent (D-NAC) and an anti-excitotoxic agent and a D-antiglutamate agent. Preferred candidates are: MK801, memantine, ketamine, and 1-MT.

[0200] In some embodiments, the dendritic polymer complex effectively treats, images, and / or prevents inflammation of microglia in the brain in autism spectrum disorders. The term "spectrum" refers to the diverse range of symptoms, skills, and degrees of impairment or disability that a child with ASD may have. Some children are mildly impaired due to their symptoms, while others are severely disabled. The latest edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5) no longer includes Asperger's syndrome; although characteristics of Asperger's syndrome are included within a broader category of ASD.

[0201] Currently, the only FDA-approved medications for the treatment of ASD are the antipsychotics risperidone (Risperdal) and aripiprazole (Abilify). For children with ASD, some medications that can be prescribed off-label include the following:

[0202] Antipsychotic medications are more commonly used to treat severe mental illnesses such as schizophrenia. These medications may help reduce aggression and other serious behavioral problems in children, including those with ASD. They may also help reduce repetitive behaviors, hyperactivity, and attention problems.

[0203] Antidepressants such as fluoxetine or sertraline are commonly prescribed to treat depression and anxiety, but sometimes they are also prescribed to reduce repetitive behaviors. Some antidepressants can also help control aggression and anxiety in children with ASD.

[0204] For example, methylphenidate. Stimulant medications are safe and effective in treating people with attention deficit hyperactivity disorder (ADHD). Methylphenidate has also been shown to be effective in treating hyperactivity in children with ASD. However, not many children with ASD respond to treatment, and those who do respond exhibit more side effects than children with ADHD who do not have ASD.

[0205] Dendritic polymeric conjugates should be effective for the treatment and diagnosis of such individuals, especially given recent studies showing signs of neuroinflammatory activity in patients with autism, such as increased presence of activated microglia and astrocytes in post-mortem brain specimens and CSF cytokine levels. Vargas et al., Annals of Neurology, January 2005; 57(1):67-81. Annals of Neurology Errata, February 2005; 57(2):304.

[0206] 4. Brain tumor

[0207] The disclosed dendritic polymer's effective blood-brain tumor barrier (BBTB) penetration and uniform solid tumor distribution significantly enhance therapeutic agent delivery to brain tumors. High-density hydroxyl surface groups with small size and near-neutral surface charge selectively localize to cells associated with inflammation, specifically neuroinflammation.

[0208] These compositions and methods can be used to treat subjects with benign or malignant tumors by delaying or inhibiting tumor growth, reducing tumor growth or size, inhibiting or reducing tumor metastasis, and / or inhibiting or reducing symptoms associated with tumor development or growth.

[0209] The types of cancer that can be treated with these compositions and methods include, but are not limited to, brain tumors, including gliomas, glioblastomas, gliosarcomas, astrocytomas, brainstem gliomas, ependymomas, oligodendrogliomas, non-gliomas, acoustic neuromas, craniopharyngiomas, medulloblastomas, meningiomas, pineal cell tumors, pinealoblastomas, primary brain lymphomas, gangliomas, schwannomas, chordomas, and pituitary adenomas.

[0210] Dendritic polymer complexes can be administered in combination with one or more other therapeutic agents known to treat brain tumors or related symptoms.

[0211] For example, dendritic polymers can be administered intravenously or during surgery to remove all or part of a tumor. Dendritic polymers can be used to deliver chemotherapy agents, agents that enhance adjuvant therapies such as those for subjects undergoing radiotherapy, wherein hydroxyl-terminated dendritic polymers are covalently linked to at least one radiosensitizer in an amount that effectively inhibits or suppresses the activity of DDX3 in proliferative brain diseases.

[0212] Those skilled in the art will understand that, in addition to chemotherapy, surgical interventions and radiotherapy are also used to treat cancers of the nervous system. Radiotherapy refers to the application of ionizing radiation to a subject near the location of the cancer. In some embodiments, a radiosensitizer is applied in two or more doses, followed by the application of ionizing radiation to the subject near the location of the cancer. In other embodiments, the application of the radiosensitizer followed by ionizing radiation may be repeated for two or more cycles.

[0213] Typically, the dose of ionizing radiation varies with the size and location of the tumor, but the dose is in the range of 0.1 Gy to about 30 Gy, preferably in the range of 5 Gy to about 25 Gy.

[0214] In some embodiments, ionizing radiation is in the form of stereotactic ablation radiotherapy (SABR) or body stereotactic radiotherapy (SBRT).

[0215] 5. Gastrointestinal disorders

[0216] The innate immune receptor Toll-like receptor 4 (TLR4) is considered a receptor for bacterial endotoxins (lipopolysaccharide, "LPS") on both hematopoietic and non-hematopoietic cells, as well as for a variety of endogenous molecules released during inflammatory or infectious diseases. Many diseases are attributed to exaggerated TLR4 signaling involving both infectious and non-infectious processes. These include necrotizing enterocolitis (NEC), abdominal sepsis, pneumonia, arthritis, pancreatitis, and atherosclerosis. In a preferred embodiment, the disease to be treated is NEC.

[0217] In a preferred embodiment, a single dendritic polymer complex composition can simultaneously treat and / or diagnose multiple symptoms in two different locations of the human body, including the gastrointestinal tract and the central nervous system. For example, a dendritic polymer complex composition comprising a dendritic polymer linked to a therapeutic, preventative, or diagnostic agent can treat the gastrointestinal region via enteral administration while selectively targeting microglia and astrocytes after absorption into the bloodstream. Microglia and astrocytes play a crucial role in the pathogenesis of NEC.

[0218] C. Dosage and effective dose

[0219] In some in vivo methods, a dendritic polymer complex is administered to a subject in a therapeutically effective amount. The term "effective amount" or "therapeutically effective amount" refers to a dose sufficient to treat, suppress, or alleviate one or more symptoms of a condition being treated, or otherwise provide the desired pharmacological and / or physiological effect. The precise dose will vary depending on a variety of factors, such as subject-dependent variables (e.g., age, immune system health status, etc.), the disease or condition, and the treatment achieved.

[0220] Typically, the dosage of the composition can be from about 0.0001 mg / kg to about 1000 mg / kg body weight, from about 0.01 mg / kg to about 100 mg / kg body weight, from about 0.1 mg / kg to about 10 mg / kg, and from about 0.5 mg to about 5 mg / kg body weight, respectively, for the treated subject. Subjects are typically mammals, preferably humans. Generally, for intravenous injection or infusion, the dosage can be lower.

[0221] For example, the amount of the dendritic polymer complex composition effectively delivers one or more active agents to cells at or near the site of inflammation (specifically, inflammation of the central nervous system or eye). Therefore, in some embodiments, the amount of the dendritic polymer complex composition containing one or more active agents effectively improves inflammation in the subject. In a preferred embodiment, the effective amount of the dendritic polymer complex composition does not induce significant cytotoxicity in the subject's cells compared to untreated control subjects. Preferably, the amount of the dendritic polymer complex composition effectively prevents or reduces inflammation and / or other related symptoms of the disease or condition in the subject compared to untreated controls.

[0222] Typically, the timing and frequency of administration are adjusted to balance the efficacy of a given treatment or diagnostic schedule with the side effects of a given delivery system. Exemplary dosing frequencies include continuous infusion, single-dose, and multiple-dose administration, such as hourly, daily, weekly, monthly, or yearly dosing.

[0223] In some embodiments, the dose is administered to a person once, twice, or three times daily, or every other day, two days, three days, four days, five days, or six days. In some embodiments, the dose is administered about once or twice weekly, every two weeks, every three weeks, or every four weeks. In some embodiments, the dose is administered about once or twice monthly, every two months, every three months, every four months, every five months, or every six months.

[0224] A person skilled in the art will understand that a dosing regimen can be of any length of time sufficient to treat the subject’s condition. The term “chronic” means that the duration of the dosing regimen can be hours, days, weeks, months, or possibly years.

[0225] In some embodiments, the protocol comprises one or more cycles of therapy rounds followed by a medication break (e.g., no medication). Therapy rounds may be administered in the manner discussed above. Similarly, medication breaks may be 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days; or 1 week, 2 weeks, 3 weeks, 4 weeks, or 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months.

[0226] Dendritic polymer complexes can be administered in combination with one or more other therapeutic agents known to treat the symptoms or diseases discussed above.

[0227] D. Comparison

[0228] The effects of the dendritic polymer complex composition can be compared to a control. A suitable control is known in the art and comprises, for example, untreated cells or an untreated subject. In some embodiments, the control is untreated tissue from a treated or untreated subject. Preferably, the cells or tissue of the control are derived from the same tissue as the treated cells or tissue. In some embodiments, the untreated control subject has the same disease or condition as the treated subject or is at risk of having that disease or condition.

[0229] E. Combination

[0230] As part of a therapeutic or preventative treatment regimen, the dendritic polymer complex composition may be applied alone or in combination with one or more other active agents. The dendritic polymer complex composition may be applied on the same day or a different day with a second active agent. For example, the composition comprising the dendritic polymer complex composition may be applied on the first, second, third, or fourth day, or in combination thereof.

[0231] The terms “combination” or “combined” are used to refer to the concurrent, simultaneous, or sequential administration of two or more agents. Thus, a combination can be administered concurrently (e.g., as an admixture), alone but simultaneously (e.g., via a separate intravenous line into the same subject), or sequentially (e.g., by administering one of the compounds or agents first, followed by the second).

[0232] Example

[0233] Example 1: Synthesis of a second-generation high-density polyhydroxy dendritic polymer (D2-OH-60, also known as PEGOL-60)

[0234] Methods and Materials

[0235] reagents

[0236] Unless otherwise specified, all reagents were used as is. Propylene bromide solution (80 wt% in toluene), allyl bromide, sodium hydride (60% dispersion in mineral oil), 2,2-dimethoxy-2-phenylacetophenone, 1-thioglycerol, N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC), 4-(dimethylamino)pyridine (DMAP), N,N'-diisopropylethylamine (DIPEA), p-toluenesulfonyl chloride, tetraethylene glycol, trifluoroacetic acid (TFA), γ-(Boc-amino)butyric acid (BOC-GABA-OH), copper sulfate pentahydrate, sodium ascorbate, anhydrous dichloromethane (DCM), anhydrous tetrahydrofuran (THF), and anhydrous dimethylformamide (DMF) were purchased from Sigma-Aldrich (St. Louis, Missouri, USA). Cy5-mono-NHS ester and FITC were purchased from Amersham Biosciences-GE Healthcare. All other ACS-grade solvents were from Fisher Scientific. Deuterated solvents dimethyl sulfoxide (DMSO-d6), water (D2O), methanol (CD3OD), and chloroform (CDCl3) were purchased from Cambridge Isotope Laboratories, Inc. (Andover, MA). Dialysis membranes (MW cutoff 1000 Da) were obtained from Spectrum Laboratories Inc. (Rancho Domez, CA).

[0237] Synthesis of intermediates and dendritic polymers

[0238] Preparation of Compound 2: Dipentaerythritol (1) (5 g, 19.66 mmol) was dissolved in 30 mL of anhydrous dimethylformamide (DMF) and stirred at 0 °C. Sodium hydride (5.66 g, 235.83 mmol) was added slowly in portions to the stirred solution and stirred for 15 min. Then propargyl bromide (24.23 mL, 163.10 mmol, 80% w / w toluene solution) was added at 0 °C, and stirring was continued at room temperature for another 6 h. The reaction mixture was cooled and partitioned between water (40 mL) and ethyl acetate (50 mL). The organic layer was washed with water (3 × 50 mL) and brine (2 × 50 mL), then dried (Na₂SO₄), filtered, and evaporated under vacuum. The crude product was purified by rapid silica column chromatography (ethyl acetate / hexane 15:85 v / v) to give Compound 2 in 60% yield.

[0239] Preparation of Compound 3: Dipentaerythritol (1) (6 g, 23.59 mmol) was dissolved in anhydrous DMF (20 mL) and tetrahydrofuran (THF, 50 mL); and the solution was stirred at 0 °C. Sodium hydride (6.23 g, 259.55 mmol) was added slowly in portions to the stirred solution, and the mixture was stirred for 15 min. Then, allyl bromide (11.2 mL, 129.77 mmol) diluted with anhydrous THF (20 mL) was slowly added at 0 °C; and the mixture was stirred for another 30 min at 0 °C, followed by stirring at room temperature (“rt”) (25 °C) for 90 min. The reaction was continuously monitored by TLC. Once the formation of the maximum product was observed on TLC, the reaction was quenched with ice. TLC was stained with KMnO4 immersion solution. The reaction mixture was cooled and partitioned between water (40 mL) and ethyl acetate (50 mL). The organic layer was washed with water (3 × 50 mL) and brine (2 × 50 mL), then dried (Na₂SO₄), filtered, and evaporated under vacuum. The crude product was purified by rapid silica column chromatography (ethyl acetate / hexane 25:75 v / v) to give compound 3 in 40% yield. ¹H NMR (500 MHz, CDCl₃) δ 5.87 (dd, J = 22.5, 10.6, 5.4 Hz, 5H), 5.24 (dd, J = 17.2, 1.5 Hz, 5H), 5.21–5.10 (m, 5H), 4.01–3.90 (m, 10H), 3.70 (s, 2H), 3.46 (dd, J = 26.4, 13.1 Hz, 14H).

[0240] Preparation of Compound 4: At 0 °C, 80 mL of dichloromethane containing p-toluenesulfonyl chloride (10.5 g, 57 mmol) was added dropwise to a mixture of 2-(2-(2-azidoethoxy)ethoxy)ethanol-1-ol (5 g, 28.5 mmol) and triethylamine (12 mL, 85 mmol). The mixture was then stirred overnight at room temperature. After completion, the organic layer was washed three times with a dilute solution of HCl, and then washed with brine. Dichloromethane was removed under reduced pressure, and the crude material was purified by rapid chromatography on silica using hexane containing 30% ethyl acetate to give a colorless oily compound 4 in 80% yield. ¹H NMR (500 MHz, CDCl₃) δ 7.81 (d, J = 8.3 Hz, 2H), 7.35 (d, J = 8.2 Hz, 2H), 4.19–4.15 (m, 2H), 3.73–3.69 (m, 2H), 3.67–3.63 (m, 2H), 3.61 (s, 4H), 3.37 (t, J = 5.0 Hz, 2H), 2.46 (s, 3H).

[0241] Preparation of Compound 5: Compound 3 (1 g, 2.19 mmol) was dissolved in anhydrous DMF (15 mL) and stirred at 0 °C. Sodium hydride (132 mg, 5.47 mmol) was slowly added in portions to the stirred solution, and the solution was stirred for 15 min. Then, 4-methylbenzenesulfonic acid 2-(2-(2-azidoethoxy)ethoxy)ethyl ester 4 (862 mg, 2.63 mmol) was slowly added, and stirring was continued at 0 °C for another 180 min. The reaction was monitored by TLC. The reaction was quenched with saturated ammonium chloride solution and extracted with ethyl acetate. The organic layer was washed with water (3 × 50 mL) and brine (2 × 50 mL), then dried (Na₂SO₄), filtered, and evaporated under vacuum. TLC was stained with KMnO₄ immersion solution. The crude product was purified by silica rapid column chromatography (ethyl acetate / hexane 25:75 v / v) to give compound 5 in 70% yield. 1 H NMR(500MHz, CDCl3)δ5.92(ddt,J=21.5,10.6,5.3Hz,5H),5.38-5.23(m,5H),5.18(dd,J =10.5,1.2Hz,5H),4.06-3.90(m,10H),3.82-3.55(m,10H),3.55-3.34(m,18H).HRMS(ESI + -TOF)m / z:C 31 H 53 N3O9[M+H] + Calculated value: 612.7770; Found value: 612.3852.

[0242] Preparation of Compound 6: Compound 2 (1 equivalent) of hexa-propylated compound and the azide derivative (per acetylene equivalent) were suspended in a 1:1 mixture of DMF and water in a 5 mL microwave-safe vial equipped with a magnetic stir bar. CuSO4·5H2O (0.5 equivalent per acetylene) and sodium ascorbate (0.5 equivalent per acetylene) dissolved in a minimal amount of water were added. The vial was sealed, and the reaction was microwave-safe at 50 °C for 6 hours. The reaction was monitored for completion by TLC, and after completion, the reaction mixture was diluted with ethyl acetate (60 mL). The organic layer was washed (3–4 times) with a saturated EDTA solution and dried over anhydrous sodium sulfate, followed by concentration under vacuum. This procedure has been widely proven to remove trace amounts of copper salts. The desired compound was purified by column chromatography using DCM containing 3% methanol as the eluent to give a clear, oily compound in 65% yield. 1HNMR (500MHz, CDCl3) δ7.69 (s, 6H), 5.94-5.77 (m, 30H), 5.18 (dd, J = 57.0, 13.8Hz, 60H), 4.5 1(s,24H),3.96-3.84(m,72H),3.68-3.49(m,52H),3.51-3.27(m,108H).(MALDI-TOF)m / z:C 24 H 352 N 18 O 61 Calculated value: 4153.2400; Found value: 4153.4610.

[0243] Preparation of Compound 8: 4 mL of DMF containing olefin-terminated dendritic polymer 6 (370 mg, 0.08 mmol) and 1-thioglycerol 7 (1.54 mL, 17.8 mmol) was placed in a 10 mL glass vial. 2,2-Dimethoxy-2-phenylacetophenone (140 mg, 0.53 mmol) was added, and the reaction mixture was stirred under UV light (365 nm) for 12 hours. After 12 hours, the reaction was stopped, and the reaction mixture was precipitated using diethyl ether. The formed precipitate was washed several times with diethyl ether to remove excess 1-thioglycerol. The residue was dissolved in DMF and dialyzed relative to DMF for 6 hours, followed by dialysis with water using a dialysis membrane corresponding to 1000 MWCO for 8 hours. The purified product was then lyophilized to obtain a clear oil in 70% yield. 1H NMR(500MHz,MeOD)δ8.01(s,6H),4.58(d,28H),3.95(s,12H),3.80-3.73(m,32H),3.65(s,36H),3.62(d,36H),3.56(m,56H),3.54-3.51 (m,60H),3.48-3.44(m,30H),3.40(s,50H),3.37(s,60H),2.73(dd,30H),2.67(t,J=7.0Hz,60H),2.60(dd,28H),1.95-1.76(m,60H).13C NMR(126MHz,MeOD)δ144.7,124.3,73.1,71.4,70.5,70.1,69.4,64.6,63.9,50.0,47.1,45.6,42.1,35.0,29.6,29.1,26.8.(MALDI-TOF)m / z:C 304 H 592 N 18 O 121 S 30Calculated value: 7397.8850; Found value: 7425.4480. HPLC purity: 95.4%, retention time: 8.0 min.

[0244] Dynamic light scattering (DLS) and zeta potential (ζ)

[0245] The size and zeta potential distribution of PEGOL-60 were determined by dynamic light scattering (DLS) using a Zetasizer Nano ZS (Malvern Instrument Ltd., Worcester, UK) equipped with a 50 mW He-Ne laser (633 nm). The dendritic polymer was dissolved in deionized water (18.2 Ω) to a concentration of 0.5 mg / mL. The solution was filtered through a 0.2 μm cellulose acetate membrane (PALL Life Science) and DLS measurements were performed in triplicate at 25 °C and a scattering angle of 173°. For zeta potential measurements, the dendritic polymer was dissolved in a 10 mM sodium chloride solution to obtain a concentration of 0.1 mg / mL. Readings were performed in triplicate, and the average value was recorded.

[0246] Nuclear magnetic resonance (¹H and ¹³C{¹H}NMR)

[0247] ¹H and ¹³C {¹H} NMR spectra were recorded at ambient temperature on a Bruker 500 MHz spectrometer. Chemical shifts were reported in ppm relative to tetramethylsilane (TMS) as an internal standard. Residual proton solvents of CDCl₃ (¹H, δ 7.27 ppm; ¹³C, δ 77.0 ppm (center resonance of triplet state)), D₂O (¹H, δ 4.79 ppm), and CD₃OD (¹H, δ 3.31 ppm and ¹³C, δ 49.0 ppm) were used for chemical shift calibration. Resonance multiplicity in ¹H NMR spectra is indicated by “s” (single), “d” (doublet), “t” (triplet), and “m” (multiplex). Broad resonances are indicated by “b”.

[0248] High-performance liquid chromatography (HPLC)

[0249] The purity of the compounds was analyzed using HPLC (Waters Corporation, Milford, Massachusetts). The HPLC system was equipped with a 1525 binary pump, an in-line degasser (AF), a 717 autosampler, a 2998 photodiode array detector, and a 2475 multi-λ fluorescence detector interfaced with Waters Empower software. A symmetric C18 reversed-phase column (Waters) with a particle size of 5 μm, a length of 25 cm, and an inner diameter of 4.6 mm was used. The HPLC chromatogram was monitored at 210 nm using a PDI detector, and the fluorescently labeled conjugates were monitored at 650 nm and 210 nm using both PDI and fluorescence detectors. A gradient flow was used, starting at 90:10 (H2O / ACN), gradually increasing to 10:90 (H2O / ACN) over 20 min, and returning to 90:10 (H2O / ACN) over 25 min to maintain a flow rate of 1 mL / min.

[0250] mass spectrometry

[0251] Accurate mass measurements (HRMS) were performed using positive mode ESI on a Bruker microTOF-II mass spectrometer, with the sample directly introduced into a CH3CN:H2O (9:1) solvent system. Protonated molecular ions [M+nH]n+ or adducts [M+nX]n+ (X = Na, K, NH4) were used for empirical confirmation. MALDI-TOF experiments were conducted on a Bruker Autoflex MALDI-TOF instrument using linear positive mode and 55–100% laser power. Sinapic acid was used as the matrix.

[0252] result

[0253] It is hypothesized that the presence of a high density of hydroxyl groups on the surface of dendritic polymers could be a driving force for the accumulation of these dendritic polymers targeting neuroinflammatory sites. Based on this hypothesis, PEG-based dendritic polymers with a high density of surface hydroxyl groups were prepared. Second-generation PEG dendritic polymer nanoparticles targeting neuroinflammatory sites were developed by end-capping 60 hydroxyl groups (PEGOL-60) using biocompatible, inexpensive, and water-soluble structural units via efficient click chemistry-based chemical conversion.

[0254] The particles broke through the damaged BBB and accumulated in activated microglia, astrocytes, and other cells at the site of damage in the brain / retina. Commercially available bi-MPA hyperbranched polyester dendritic macromolecules with comparable hydroxyl surface density (64 OH groups) were also evaluated.

[0255] The synthesis of the PEG-based dendritic polymer D2-OH-60 (also known as PEGOL-60) was accomplished using a supernuclear and supermonomer strategy, resulting in a large number of end groups with minimal synthetic steps and low generation. Dendritic polymers are constructed using efficient and robust chemical reactions such as copper(I)-catalyzed alkyne azide click (CuAAC) and thiol-ene click chemistry (Sharma, A. et al., ACS Macro Letters, 3, 1079 (2014); and Rostovtsev, VV et al., Angewandte Chemie International Edition, 41, 2596 (2002)). The supernuclear 2 was synthesized by propargylation of dipentaerythritol 1 in the presence of NaH and propargyl bromide to obtain the hexapropargylated product in 60% yield (Scheme 1). NMR spectroscopy clearly showed the presence of six propargyl protons.

[0256]

[0257] Scheme 1. Synthesis of supernucleus (2)

[0258] Supermonomer 5 (Scheme 2) was prepared in two synthetic steps. In the first step, dipentaerythritol 1 was allylated to selectively obtain an AB5 monomer with five allyl groups, thus retaining one hydroxyl arm intact. Pure product 3 was separated from a mixture of tri, tetra, penta, and hexaallylated products by column chromatography. Compound 3 was then reacted with monotoluenesulfonated triethylene glycol azide 4 to obtain an AB5 orthogonal supermonomer 5 with one azide functional group and five allyl groups. The azide group was intended to participate in the CuAAC click reaction on core 2, while the olefin group could be used for a photocatalytic thiol-olefin click reaction with the thiolized monomer.

[0259]

[0260] Scheme 2. Synthesis of supermonomer (5)

[0261] Then, supernucleus 2 and supermonomer 5 were subjected to a CuAAC click reaction to produce a first-generation dendritic polymer (6) with 30 terminal olefin functional groups. 1 ¹H NMR revealed the presence of allyl protons at 5.8 ppm, 5.2 ppm, and 3.9 ppm, while showing a significant disappearance of propargyl protons at 2.4 ppm. Additionally, a distinct peak for triazole protons appeared at 7.69 ppm. 1In HNMR, the theoretical molecular weight of compound (6) is 4153.24 Da, and MALDI-ToF analysis revealed a peak at 4156.49 Da, confirming the formation of the product. Compound 6 (D1-allyl 30) was reacted with 1-thioglycerol (7) via a thiol-ene click reaction to produce a second-generation dendritic polymer (D2-OH-60 or PEGOL-60,8) with 60 hydroxyl groups on its surface. 1 ¹H NMR showed complete disappearance of the allyl end group, and the presence of a proton in the thioglycerol group (2.8-2.5 ppm) and a characteristic methylene proton at 1.8 ppm. Typically, due to the presence of overlapping signals from multiple protons, dendritic polymers exhibit… 1 While H NMR characterization is challenging, the sequential appearance and complete disappearance of characteristic allyl and propargyl signals in the construction of PEGOL-60 allows for simple and robust characterization tools to accurately confirm its structure.

[0262]

[0263] Scheme 3. Synthesis of a second-generation dendritic polymer (8) with 60 terminal hydroxyl groups.

[0264] HPLC further confirmed purity, with the products showing significant shifts in retention time at each step. D1-allyl 30 (compound 6) had a retention time of 12.8 min, and the relatively more polar final dendritic polymer PEGOL-60 (compound 8) had a retention time of 7.1 min at 210 nm. MALDI-TOF spectroscopy showed a peak at 7433 Da, which was in excellent agreement with the theoretical molecular weight of PEGOL-60 at 7398 Da. PEGOL-60 had a size of 1.9 ± 0.2 nm and a near-neutral zeta potential (-1.90 ± 0.67 mV). All other intermediates and the final compound were characterized using 1H NMR, MALDI-ToF, HRMS, and HPLC.

[0265] To overcome the traditional challenges of scaling up the synthesis of dendritic polymers, synthetic strategies have been developed to produce complex dendritic structures with high purity and efficiency. For the construction of PEGOL-60, a combination of supernucleus-supermonomer and orthogonal methods was used, and an accelerated scheme was developed to construct this dendritic polymer with a high density of surface hydroxyl groups at lower generations (64 hydroxyl groups at 4 generations compared to 60 at 2 generations for PAMAM dendritic polymers) (R. Sharma et al., Polymer Chemistry, 5, 4321 (2014); R. Sharma et al., Chemical Communications, 2014, 50, 13300). Using this accelerated approach, PEGOL-60 was synthesized from the core in four reaction steps via efficient and orthogonal chemical transformations based on Cu(I)-catalyzed alkyne azides (CuAAC) and thiol-ene click chemistry (VVRostovtsev et al., Angewandte Chemie International Edition, 41, 2596 (2002); Hoyle CE et al., Angewandte Chemie International Edition, 2010, 49, 1540). The key to generating defect-free dendritic polymers lies in employing chemical transformations that couple structural units in a layer-by-layer manner. Conventional coupling reactions, which appear efficient at lower generations, become retarded at higher generations with a higher number of reaction ends due to spatial congestion, leading to structural defects and asymmetries. Click chemistry has emerged as a valuable synthetic tool, encompassing reaction pools that are easy to execute, highly robust, high-yielding, atom-economical, and modular. Among the list of click transformations, CuAAC and thiol-ene clicks are the two most powerful and widely used due to their high selectivity, orthogonality, and stereoselectivity. These click transformations have been successfully used in polymer chemistry, biological conjugation reactions, dendritic polymer synthesis, and the generation of vast libraries of chemical entities (Moses JE et al., Chemical Society Reviews, 2007, 36, 1249).

[0266] Example 2: Combination of fluorescent imaging agents with dendritic polymer nanoparticles

[0267] Methods and Materials

[0268] Synthesis of intermediates and dendritic polymers

[0269] Preparation of Compound 9: BOC-GABA-OH (85 mg, 0.41 mmol) was added to a stirred solution of dendritic polymer 8 (620 mg, 0.08 mmol) in DMF (10 mL), followed by EDC (160 mg, 0.83 mmol) and DMAP (103 mg, 0.83 mmol). The reaction mixture was then stirred at RT for 24 hours. After completion, the reaction mixture was dialyzed against DMF for 6 hours, followed by dialyzed against water for 12 hours, with the water changed every 4 hours. The aqueous solution was then lyophilized to produce compound 9. ¹H NMR (500 MHz, MeOD): δ 7.94 (s, 7H), 4.54–4.48 (m, 24H), 3.88 (s, 16H), 3.75–3.63 (m, 29H), 3.60–3.53 (m, 66H), 3.53–3.47 (m, 44H), 3.47–3.42 (m, 56H), 3.41–3.36 (m, 24H), 3.33 (s, 55H), 3.26 (s, 38H), 2.71–2.45 (m, 122H), 1.78 (dd, J = 20.4, 14.4 Hz, 68H), 1.39 (s, 45H). HPLC purity: 95.4%, retention time: 18.2 min.

[0270] Preparation of Compound 10: Trifluoroacetic acid (0.6 mL) was added dropwise to a stirred solution of Compound 9 (620 mg, 0.08 mmol) in anhydrous DCM (3 mL). The reaction mixture was stirred overnight at RT. The solvent was then evaporated, and the reaction mixture was diluted with methanol, followed by evaporation on a rotary evaporator. This process was repeated several times to remove trace amounts of TFA. The solvent was evaporated to give Compound 10 in quantitative yield as a grayish-white hygroscopic solid.

[0271] Preparation of Compound 11: DIPEA (0.2 mL, to adjust the pH of the solution to 7.4) was added to a stirred solution of Compound 10 (600 mg, 0.07 mmol) in DMF (5 mL), followed by the addition of Cy5 NHS ester (55 mg, 0.15 mmol) dissolved in 1 mL of DMF. Stirring was continued at RT for 12 h. The reaction mixture was dialyzed against DMF for 12 h, with the DMF replaced every 4 h, followed by dialyzed against water for 6 h. The aqueous solution was then lyophilized to give Compound 11 as a blue solid in a specific yield (%). 1H NMR (500MHz, DMSO) δ8.37 (t, J=12.9Hz, Cy5 H), 8.00 (s, triazole H), 7.82 (s, Cy5H), 7.64 (t, J=6.9Hz, Cy5H), 7.33 (d, J=8.3Hz, Cy5 H), 6.59 (t, J=12.3Hz, Cy5 H),6.31(d,J=7.6Hz,Cy5 4.76-4.65 (m, dendritic polymer H), 4.64-4.39 (m, dendritic polymer H), 4.14 (m, dendritic polymer H), 3.82 (s, dendritic polymer H), 3.69-3.12 (m, dendritic polymer H), 2.72-2.30 (m, dendritic polymer H), 1.80-1.61 (m, dendritic polymer H), 1.32-1.14 (m, Cy5 H), 1.10 (t, J = 7.0 Hz, Cy5 H), 0.99 (t, J = 7.2 Hz, Cy5 H). HPLC purity: 92.3%, retention time: 12.1 min.

[0272] Preparation of Compound 13: BOC-GABA-OH (280 mg, 1.36 mmol) was added to a stirred solution of G4-64OH-polyester-hyperbranched-bis-MPA 12 (2 g, 0.27 mmol) in DMF (20 mL), followed by EDC (470 mg, 2.5 mmol) and DMAP (305 mg, 2.5 mmol). The reaction mixture was then stirred at RT for 24 h. After stirring, the reaction mixture was dialyzed against DMF for 12 h, followed by dialyzed against water for 12 h, with the water changed every 3 h. The aqueous solution was then lyophilized to give Compound 13. Yield: 76%. 1 ¹H NMR (500MHz, DMSO) δ 4.25–4.10 (m, dendritic H), 3.59–3.34 (m, dendritic H), 1.63 (dt, J = 13.8, 6.7 Hz, Gaba linker H), 1.37 (s, BOC H), 1.15–0.95 (m, dendritic H).

[0273] Preparation of Compound 14: TFA (1.5 mL) was added dropwise to a stirred solution of Compound 13 (1 g, 0.13 mmol) in anhydrous DCM (2 mL). The reaction mixture was stirred overnight at RT. The solvent was then evaporated, and the reaction mixture was diluted with methanol, followed by evaporation on a rotary evaporator. This process was repeated several times to remove trace amounts of TFA. The solvent was evaporated to obtain Compound 14 in quantitative yield.

[0274] Preparation of Compound 15: DIPEA (0.1 mL, to adjust pH to 7.4) was added to a stirred solution of Compound 14 (200 mg, 0.02 mmol) in DMF (3 mL), followed by the addition of Cy5 NHS ester (18.43 mg, 0.03 mmol) dissolved in 1 mL of DMF. Stirring was continued at RT for 12 h. The reaction mixture was dialyzed against DMF for 12 h, with the DMF replaced every 4 h, followed by dialyzed against water for 24 h. The aqueous solution was then lyophilized to give Compound 15 as a blue solid in 82% yield. 1 ¹H NMR (500MHz, DMSO) δ 9.41 (s, CY₅H), 8.37 (t, J = 12.8Hz, CY₅H), 7.80 (d, J = 22.5Hz, CY₅H), 7.63 (t, J = 7.6Hz, CY₅H), 7.32 (d, J = 8.0Hz, CY₅H), 6.58 (t, J = 12.2Hz, CY₅H), 6.31 (d, J = 13.6Hz, CY₅H), 5.04–4.94 (m, dendritic H), 4.70–4.56 (m, dendritic H), 4.31–3.97 (m, dendritic H), 3.70–3.38 (m, dendritic H), 1.69 (s, CY₅H), 1.35–0.88 (m, CY₅& dendritic H). HPLC purity: 100%, retention time: 11.5 minutes

[0275] Preparation of compound 17: BOC-GABA-OH (61 mg, 0.3 mmol) was added to a stirred solution of 8-arm star-shaped PEG 10K(16) (1 g, 0.1 mmol) in DMF (15 mL), followed by EDC (115 mg, 0.6 mmol) and DMAP (74 mg, 0.6 mmol). The reaction mixture was then stirred at RT for 24 h. After completion, the reaction mixture was dialyzed against DMF for 12 h, followed by dialyzed against water for 12 h, with the water changed every 3 h. The aqueous solution was then lyophilized to give compound 17. Yield: 70%. 1 ¹H NMR (400MHz, DMSO) δ 4.17–4.08 (m, PEG H), 3.62–3.45 (m, PEG H), 1.66–1.56 (m, linker H), 1.37 (s, BOC H).

[0276] Preparation of Compound 18: TFA (3 mL) was added dropwise to a stirred solution of Compound 17 (1 g, 0.1 mmol) in anhydrous DCM (4 mL). The reaction mixture was stirred overnight at RT. The solvent was then evaporated, and the reaction mixture was diluted with methanol, followed by evaporation on a rotary evaporator. This process was repeated several times to remove trace amounts of TFA. The solvent was evaporated to obtain Compound 18 in quantitative yield.

[0277] Preparation of Compound 19: DIPEA (0.1 mL, to adjust pH to 7.4) was added to a stirred solution of Compound 18 (250 mg, 0.02 mmol) in DMF (5 mL), followed by the addition of fluorescein isothiocyanate (18 mg, 0.04 mmol) dissolved in 1 mL of DMF. Stirring was continued at RT for 12 h. The reaction mixture was dialyzed against DMF for 12 h, with the DMF replaced every 4 h, followed by dialyzed against water for 24 h. The aqueous solution was then lyophilized to give Compound 19 as a yellow solid in quantitative yield. ¹H NMR (500 MHz, DMSO): δ 6.73–6.49 (m, FITC H), 4.57 (t, J = 5.5 Hz, PEG H), 4.13 (dd, J = 9.3, 5.0 Hz, PEG H), 3.70–3.44 (m, PEG H), 1.82–1.68 (m, linker H).

[0278] result

[0279] To study biodistribution using fluorescence spectroscopy and confocal microscopy, the fluorescent tag cyanin 5 (Cy5) was conjugated to the dendritic polymer D2-OH-60 (compound 8). The fluorophore was attached only to two arms of the dendritic polymer to maintain its intrinsic properties and avoid any impact on biodistribution. For conjugation of the imaging dye, D2-OH-60 (compound 8) was coupled with γ-(Boc-amino)butyric acid (GABA) using EDC and DMAP to obtain dendritic polymer 9, D-GABA-NHBOC. The BOC group was then deprotected using trifluoroacetic acid / DCM (1 / 5) to obtain the amino-containing dendritic polymer 10. Finally, dendritic polymer 10, with two amino groups as a TFA salt, was reacted with Cy5 monoNHS ester at pH 7.0–7.5 to obtain Cy5-labeled dendritic polymers D2-OH-60-Cy5 or PEGOL-60-Cy5 (compound 11, scheme 4). 11H NMR clearly revealed the presence of Cy5 protons in the conjugated aromatic region, and HPLC chromatograms showed a significant change in retention time from 8.4 min for D-GABA-NHBOC (compound 9, 210 nm) to 7.6 min for PEGOL-60-Cy5 (compounds 11, 210 nm and 650 nm).

[0280] Using a similar approach, Cy5 was also linked to commercially available bis-MPA-G4-OH-64-polyester-hyperbranched polymers (compound 12, scheme 5) and G4-PAMAM-OH-64. Using (scheme 6, compound 18), fluorescein isothiocyanate (FITC) was coupled to an 8-arm star-shaped PEG using a similar approach. Linear PEG FITC and dextran FITC were used.

[0281]

[0282] Scheme 4. Synthesis of Cy5-labeled dendritic polymer 11.

[0283]

[0284] Scheme 5. Synthesis of Cy5-labeled hyperbranched bis-MPA polyester 15.

[0285]

[0286] Scheme 6. Synthesis of FITC-labeled 8-arm star-shaped PEG (compound 19).

[0287] Example 3: Quantitative brain distribution of D2-OH-60-Cy5

[0288] Methods and Materials

[0289] CP rabbit model and application of D2-OH-60-cy5

[0290] Timely-pregnant New Zealand white rabbits were purchased from Robinson Services Inc. (North Carolina, USA) and arrived at the facility one week prior to the surgery. All animals were housed under controlled environmental conditions (22°C, 50% relative humidity, and a 12-hour light / dark cycle), and necessary precautions were taken throughout the study to minimize pain and stress associated with the experimental treatment. The experimental procedures were approved by the Johns Hopkins University Committee on Animal Conservation and Utilization (IACUC). After a week of acclimatization, pregnant rabbits underwent laparotomy on day 28 of gestation (G28) and were injected with a total of 3,200 EU of lipopolysaccharide (LPS, E. coli serotype O127:B8, Sigma Aldrich, St. Louis, Missouri) along the uterine wall, as previously described (Saadani-Makki, F. et al., *American Journal of Obstetrics and Gynecology*, 199, 651el (2008); and Kannan, S. et al., *Journal of Cerebral Blood Flow and Metabolism: Official Journal of the International Society of Cerebral Blood Flow and Metabolism*, 31, 738 (2011)). Pups were born naturally on day 31 (full term) and were kept in an incubator at approximately 32°C–35°C and approximately 50%–60% relative humidity. Offspring from doe rabbits injected with LPS are defined as cerebral palsy (CP) offspring.

[0291] Immunohistochemistry

[0292] In PND1, animals received intravenous (iv) administration of D2-OH-60-cy5 (55 mg / kg, 200 μL) and were sacrificed 24 hours post-injection. Rabbits were anesthetized and perfused cardiacally with PBS, followed by perfusion with 10% formalin. All major organs (kidneys, lungs, liver, heart) and plasma were isolated and rapidly frozen. The brain was removed and divided in half. One half was rapidly frozen for quantitative fluorescence, and the other half was fixed overnight in 10% formalin and cryoprotected in fractionated sucrose solution. Coronal sections (30 μm, 1:6 series) were blocked by 0.1 M phosphate-buffered saline (PBS) containing 3% normal donkey serum. The sections were then incubated overnight at 4°C with goat anti-IBA1 (1:500, Abeam, Massachusetts, USA). The sections were then washed and incubated at room temperature for 2 hours with a fluorescent secondary antibody (1:250; 1:250; Life Technologies, Massachusetts, USA). Next, the slides were incubated with DAPI (1:1000, Invitrogen) for 15 minutes. After washing, the slides were dried and covered with a mounting medium (Dako, Capitol, California, USA). Confocal images were acquired using a Zeiss ZEN LSM 710 (Zeiss, California, USA) and processed using ZEN software.

[0293] result

[0294] To assess the in vivo distribution of D2-OH-60, D2-OH-60-Cy5 (55 mg / kg) was systematically (iv) injected into CP pups on day 1 after birth (PND1). Twenty-four hours post-injection, the distribution of D2-OH-60-Cy5 in different brain regions, such as the periventricular white matter (corpus callosum, lateral ventricular angles, and internal capsule) and the cortex, was analyzed. D2-OH-60-Cy5 was widely distributed throughout the brain, but higher concentrations were observed in the periventricular regions (such as the fornix and lateral ventricles).

[0295] To evaluate the in vivo distribution of D2-OH-60 compared to bis-MPA-G4-OH64, D2-OH-60-cy5 and bis-MPA-G4-OH64-cy5 (55 mg / kg) were systematically (iv) injected into CP pups in PND1. At 24 hours post-injection, the distribution of D2-OH-60-cy5 and bis-MPA-G4-OH64-cy5 in the periventricular white matter regions (corpus callosum, lateral ventricular angle, and internal capsule), where the most severe brain injury occurred and activated glial cells accumulated in the brains of CP pups, was analyzed. D2-OH-60-cy5 co-localized with activated microglia (IBA1-positive cells) in CP pups, similar to bis-MPA-G4-OH64-cy5. D2-OH-60-cy5 primarily co-localizes with activated microglia in the periventricular white matter regions (including the corpus callosum, lateral ventricular horns, and internal capsule) of CP infants. Additionally, the distribution of D2-OH-60-cy5 and bis-MPA-G4-OH64-cy5 in the cortex was assessed. The co-localization of D2-OH-60-cy5 with branched microglia (dormant microglia) in the cortex was similar to that of bis-MPA-G4-OH64-cy5.

[0296] Next, the in vivo distribution of D2-OH-60 compared to PAMAM-G4-OH64 was evaluated. In PND1, D2-OH-60-cy5 and PAMAM-G4-OH64-cy3 (55 mg / kg) were systemically (iv) injected into CP pups. Twenty-four hours post-injection, the distribution of D2-OH-60-cy5 and PAMAM-G4-OH64-cy3 in the periventricular white matter regions (corpus callosum, lateral ventricular angle) was analyzed. Both D2-OH-60-cy5 and PAMAM-G4-OH64-cy3 co-localized with activated microglia in CP pups. Both D2-OH-60-cy5 and PAMAM-G4-OH64 co-localized with activated microglia in the periventricular white matter regions of CP pups, such as the corpus callosum and lateral ventricular angle.

[0297] The in vivo distribution of linear PEG, astrocyte PEG, and dextran was also evaluated. In PND1, linear PEG, astrocyte PEG, and dextran (55 mg / kg) were systematically (iv) injected into CP pups. Twenty-four hours post-injection, the distribution of linear PEG, astrocyte PEG, and dextran in the periventricular white matter regions (corpus callosum, lateral ventricular angles) was analyzed. No linear PEG, astrocyte PEG, or dextran was found in the periventricular regions (including the corpus callosum and lateral ventricular angles) of CP pups, indicating that linear PEG, astrocyte PEG, and dextran did not cross the blood-brain barrier.

[0298] Example 4: Comparison of quantitative biodistribution of D2-OH-60-Cy5, bis-MPA-G4-OH64-Cy5, and PAMAM-G4-OH64-Cy5 in the brain and major organs

[0299] Methods and Materials

[0300] All three dendritic polymer-based nanoparticles (D2-OH-60-Cy5, bis-MPA-G4-OH64-Cy5, and PAMAM-G4-OH64-Cy5) were administered intravenously to cerebral palsy (CP) pups on day 1 postnatal day (PND). Pups were euthanized at 4 and 24 hours post-injection. Pups were perfused with PBS. All major organs (heart, lungs, liver, kidneys) and plasma were isolated and rapidly frozen. The brain was removed as described in the quantitative biodistribution section, and half was rapidly cryopreserved for quantitative fluorescence imaging, while the other half was preserved for confocal imaging.

[0301] To assess and quantify the distribution of dendritic polymers in the brain using fluorescence spectroscopy, the brain was further microdissected into three subregions: the cortex, the periventricular region (PVR), and the hippocampus. Figure 2 Comparative brain distributions of D2-OH-60-Cy5, commercially available bis-MPA-G4-OH64-Cy5, and PAMAM-G4-OH64-Cy5 in these three subregions are shown. All three dendritic polymers with high-density surface hydroxyl groups were able to cross the damaged blood-brain barrier (BBB) ​​and were present in similar amounts in the cortex, PVR, and hippocampus. Although more bis-MPA appeared to be present at the 4-hour time point, no difference was shown at 24 hours. Unlike PAMAM, which showed more accumulation in the PVR region, D2-OH-60-Cy5 and bis-MPA-G4-OH64-Cy5 showed similar distributions in all three subregions. Compared to healthy controls, both D2-OH-60-Cy5 and bis-MPA-G4-OH64-Cy5 showed several-fold higher uptakes in the cortex, PVR, and hippocampus of PND1 CP calves. Figure 3 Aside from the kidneys and plasma, all three dendritic polymers showed similar distributions in all other major organs (heart, lungs, liver). Compared to PAMAM-G4-OH64-Cy5, the amounts of D2-OH-60-Cy5 and bis-MPA-G4-OH64-Cy5 in the kidneys and plasma were significantly lower at both 4 and 24 hours, indicating shorter circulation times and faster renal clearance. Figure 4 ).

[0302] Example 5: Quantitative distribution of PEGOL-60-Cy5 in the eye

[0303] Methods and Materials

[0304] AMD model in rats with lipid injection and administration of PEGOL-60-Cy5

[0305] This experimental AMD model used 8-week-old Spratly-Dowley (SD) rats. These studies were conducted according to ARVO guidelines and a Johns Hopkins-approved animal protocol. Rats were housed under environmental conditions (22°C, 50% relative humidity, and a 12-hour light / dark cycle). On day 0, 0.5 M borate buffer (20 μg / mL) containing 2 μL of HpODE (lipid) was injected subretinally using a microinjector to create bubbles in the subretinal space. To assess ocular biodistribution of D2-OH-60-Cy5 on day 3 following lipid injection, D2-OH-60-Cy5 was reconstituted into sterile saline (200 μL) and administered intravenously at a concentration of 20 mg / kg. Rats were sacrificed 48 hours and 7 days after administration of the dendritic polymer. Eyes were enucleated at appropriate time points after euthanasia, and smear and cross-sectional analyses were performed.

[0306] Tissue processing, immunohistochemistry, and confocal imaging.

[0307] Prep: The eyeball was incubated in ice with PBS for 1 hour, and the anterior segment containing the lens was removed. The retina and choroid were separated and fixed in 2% PFA for 12 hours, followed by blocking with goat serum for 6 hours. Microglia / macrophages were stained with anti-rabbit Iba-1 at 4°C for 12 hours, and then stained again with Cy3-labeled goat anti-rabbit antibody. FITC-labeled lectins were used to label and stain blood vessels and monocytes. Prep was prepared using four radial relaxation cuts, mounted on coverslips, and imaged under a confocal 710 microscope using the tile and Z-stacking functions. Images were processed using Zeiss software.

[0308] Cross-section: The eyeball was fixed in 2% PFA containing 5% sucrose for 3 hours, and the anterior segment containing the lens was removed. The posterior segment was then subjected to a sucrose gradient treatment up to 20%. The tissue was cryopreserved using OCT and sectioned along the optic nerve (10 μm sections). Sections were blocked with goat serum, and microglia / macrophages were stained with Iba-1, blood vessels and monocytes were stained with lectins, and cell nuclei were stained with DAPI. The stained sections were imaged under a confocal 710 microscope.

[0309] result

[0310] In addition to brain penetration, the colocalization of PEGOL-60-Cy5 with activated mi / ma in a subretinal lipid injection-induced age-related macular degeneration (AMD) model was examined to determine its ability to cross the blood-retinal barrier for application in posterior ocular diseases (Baba T, The American Journal of Pathology, 2010, 176, 3085).

[0311] AMD is a multifactorial ocular degenerative disease involving multiple activated mi / ma-mediated pathologies, including oxidative stress, inflammation, and angiogenesis (Madeira MH, Mediators of Inflammation, 2015, 15). Pathological accumulation of toxic lipids leads to vision loss, and there are currently no viable treatments available for dry and early-stage AMD.

[0312] In a dry AMD rat model induced by subretinal lipid injection, the targeting ability of PEGOL-60-Cy5 was tested to induce cell damage, leading to a neovascularization region known as a bubble. Confocal imaging of choroidal flaps showed that PEGOL-60-Cy5 signals, localized with activated mi / ma, were specifically located in the bubble region after systemic administration to healthy tissue with minimal signal.

[0313] Both spread and cross-sectional images showed that the PEGOL-60-Cy5 dendritic polymer targeted and remained in inflammatory areas of both the retina and choroidal tissue. In the retinal tissue, PEGOL-60-Cy5 was found to localize in microglia that accumulated near radial vessels and capillaries at the bubble edges. Blood vessels were stained with lectin, microglia / macrophages with Iba-1, the dendritic polymer (PEGOL-60-Cy5) was labeled with Cy5, and cell nuclei were stained with DAPI. 5X magnification showed that intravenously administered dendritic polymer was located only in inflammatory areas. Higher magnification images (40X) showed that PEGOL-60-Cy5 was co-localized in activated microglia / macrophages near leaking vessels in the bubble region of the retina. The high magnification images clearly showed that PEGOL-60-Cy5 co-localized in retinal microglia associated with the damaged area, confirming the targeted localization.

[0314] In the choroidal tissue, dendritic polymers were found only in activated macrophages and hypertrophic retinal pigment epithelium (RPE) within damaged areas corresponding to bubble regions in the choroid. The lectins (blood vessels), microglia / macrophages in the choroidal tissue were stained with Iba-1 and the dendritic polymer (D2-OH-60-Cy5). A 20X image shows the presence of dendritic polymers in the bubble regions, and higher magnification images (40X images) confirm the co-localization of the dendritic macromolecules in activated macrophages and hypertrophic retinal pigment epithelium (RPE) within the bubble regions.

[0315] Cross-sectional analysis of the posterior segment (retinal + choroidal complex) was performed to obtain detailed biodistribution. Sections revealed that dendritic polymers co-localized in activated microglia, Müller glial cells (based on localization), and monocytes in the retina. A 10-micron section of the rat posterior segment was stained for lectins (vessels), microglia / macrophages (Iba-1), cell nuclei (DAPI), and dendritic polymers labeled with Cy5 (PEGOL-60-Cy5). 5X images revealed the entire posterior segment section, with bubble regions exhibiting inflammatory characteristics (accumulated cells labeled as Iba-1 positive). Higher magnification 20X images showed that dendritic polymers were co-localized only in inflammatory areas of activated microglia / macrophages in the choroid and retina, and Müller cells in the retina. Therefore, cross-sections confirmed these findings, showing PEGOL-60 localized in activated mi / ma and CNV vessels in the retina and choroid, in bubble regions rather than in healthy areas of the eye.

[0316] In summary, PEGOL-60 demonstrated a pathodependent biodistribution in the retina and choroid of a rat model of AMD following systemic administration. These results suggest that PEGOL-60 is a promising drug carrier for systemic targeted therapy of AMD, in which few feasible therapeutic interventions are available, as well as in other posterior segment eye diseases such as diabetic retinopathy, retinopathy of preterm birth, retinitis pigmentosa, and uveitis (M. Karlstetter et al., Progress in Retinal and Eye Research, 45, 30 (2015)).

[0317] Example 6: Tumor-associated macrophages in a PEGOL-60-Cy5-targeted glioblastoma (GBM) mouse model

[0318] Methods and Materials

[0319] GBM mouse model and administration of PEGOL-60-Cy5

[0320] Six- to eight-week-old C57BL / 6 mice were purchased from Jackson Laboratories (Barr Harbor, Maine, USA), and experimental procedures were performed according to ACUC-approved protocols. GL261 murine GBM tumor cells were grown at 37°C and 5% CO2 in a low-glutamine RPMI (Gibco Laboratories, Gaithersburg, Maryland) supplemented with 10% heat-inactivated FBS (Gibco Laboratories), 1% pen / strep antibiotic (Gibco Laboratories), and 1% 1-glutamine (Gibco Laboratories). Cells were collected for seeding via trypsin detachment (Corning Inc., New York). Mice were anesthetized by intraperitoneal injection of a mixture of 100 mg / kg ketamine (Henry Schein, Melville, NY) and 10 mg / kg toluidine (VetOne, Boise, Idaho) in saline (Quality Biological Inc., Gaithersburg, Maryland). An incision was made along the midline of the skull, and a burr hole was drilled for insertion of a Hamilton syringe (Hamilton Company, Reno, Nevada). 2 μL of culture medium containing 100,000 GL261 cells was injected into the striatum of the right hemisphere at a rate of 0.2 μL / min using a stereotactic frame and an automated infusion pump (Stoelting, Wooddale, Illinois). The mice were then sutured (Ethicon Inc.; Somerville, NJ), and surgical recovery was monitored. To administer PEGOL-60-Cy5, mice were intravenously injected with 55 mg / kg PEGOL-60-Cy5 on day 15 post-vaccination. Twenty-four hours after administration, the mice were perfused and their brains were collected.

[0321] Immunohistochemistry and confocal imaging of GBM model

[0322] On day 14 post-tumor inoculation, animals were administered 55 mg / kg PEGOL-60-Cy5 intravenously, and brains were collected 24 hours later. The brains were fixed in 10% formalin (Sigma-Aldrich) for 24 hours, followed by fixation at 10% to 30% sucrose gradients for 24 hours each. The brains were then frozen and coronally sectioned into 30 μm sections. At room temperature, the brain sections were blocked for 4 hours in 1x TBS (Gibco Laboratories) supplemented with 0.1% Triton-X (Sigma-Aldrich), 1% bovine serum albumin (Sigma-Aldrich), and 5% normal goat serum (Sigma-Aldrich). Microglia were labeled with tomato lectin (1:1000, Vector Laboratories; Burlingame, CA) and nuclei were labeled with NucBlue DAPI staining (Ingenieur). Covers were then prepared with mounting medium (Darkel). Confocal images were acquired on a Zeiss ZEN LSM710 and processed using ZenLite software.

[0323] result

[0324] PEGOL-60 was further evaluated in a mouse model of GBM to estimate whether this specific co-localization with activated mi / ma in pro-inflammatory diseases also extends to targeted anti-inflammatory M2 phenotype mi / ma, and whether it can be uniformly distributed across solid tumors. These target tumor-associated macrophages (TAMs) are host macrophages with induced anti-inflammatory phenotypes that promote tumor growth and suppress tumor-killing immune responses through secretory signals from cancer cells, thus making them ideal therapeutic targets for immunomodulatory repolarization into anti-cancer agents (Yang Y et al., Hematol Oncol 2017, 10, 58).

[0325] Despite the discovery of many potent new anticancer therapies, clinical outcomes have not translated into GBM because these treatments cannot penetrate the BBB and reach solid brain tumors in clinically relevant amounts, thus requiring high doses that result in systemic toxicity. The tumor-targeting ability of PEGOL-60-Cy5 in a GL261 intracranial injection mouse model of GBM was explored. This model has been extensively characterized and is known to closely generalize human immune characteristics (Jacobs VL et al., *ASN Neuro*, 2011, 3, AN20110014).

[0326] GL261 mouse GBM cells were inoculated into the striatum of mice, and PEGOL-60-Cy5 was administered intravenously on day 15 post-inoculation.

[0327] Following systemic administration, PEGOL-60-Cy5 selectively targets tumor-associated macrophages (TAMs). Brain tissue was collected 24 hours post-administration, and confocal images of dendritic polymers (Cy5), cell nuclei (DAPI), and TAMs (lectins) were collected and examined. PEGOL-60 co-localized with TAMs within the tumor, while minimal dendritic polymer signaling was observed in healthy brain tissue from the contralateral hemisphere. Confocal images also showed that PEGOL-60 completely penetrated the tumor center and was uniformly distributed throughout the tumor among the TAMs. Dendritic polymer uptake clearly delineated the tumor boundaries, with dendritic polymer signaling within the TAMs within the tumor, while minimal signaling was observed in the peritumoral region.

[0328] In summary, PEGOL-60-Cy5 has been demonstrated to specifically target TAMs within solid tumors after systemic administration, while exhibiting minimal signal in the contralateral hemisphere. The dendritic polymer is able to completely penetrate solid tumors and permeate their distribution, overcoming both the BBB and conventional barriers to solid tumor delivery, such as vascular dysplasia and high interstitial fluid pressure. The signal of PEGOL-60-Cy5 clearly delineates the tumor region, demonstrating its specificity for TAMs exceeding mi / ma in healthy brain sites (even in the peritumoral region). These findings suggest that PEGOL-60 provides an ideal nanoplatform for the specific and systemic delivery of immunotherapy to solid tumors within GBM without compromising healthy brain tissue.

[0329] Example 7: In vitro evaluation of the antioxidant and anti-inflammatory activities of PEGOL-60

[0330] Methods and Materials

[0331] Cell Culture

[0332] BV2 mouse microglia were obtained from the cell culture facility at Michigan Children's Hospital. Cells were cultured at 37°C and 5% CO2 in a DMEM (Gibco Laboratories) incubator supplemented with 10% heat-inactivated fetal bovine serum and 1% pen / strep. Cells were maintained by trypsin dissociation and passage every 3 days. At 80%–90% confluence, cells were harvested and seeded in 24-well plates for experiments.

[0333] Cytotoxicity assessment

[0334] The BV-2 mouse microglia cell line was cultured as described in the experimental section and seeded at a concentration of 10,000 cells per well in alternating wells of a 96-well plate (Sigma). Cell adhesion and growth were then allowed for 24 hours. A stock solution of 1000 μg / mL PEGOL-60 was prepared in DMEM medium supplemented with 10% HI-FBS and 1% penicillin-streptomycin, and subjected to vortexing, sonication, and sterile filtration. This solution was then diluted in medium to prepare stock solutions of 100 μg / mL, 10 μg / mL, 1 μg / mL, and 0.1 μg / mL PEGOL-60. Medium was aspirated from all wells of the 96-well plate, and the cells were replaced with medium containing PEGOL-60 or fresh medium, allowing for a further 24 hours of culture. A stock solution of 12 mM MTT (Ingenieur, Carlsbad, CA) in sterile PBS was prepared and mixed by vortexing and sonication. Remove the culture medium from all wells and add 100 μL of fresh culture medium and an additional 10 μL of MTT solution, mixed with the medium by pipetting, to each well. Allow the cells to incubate in MTT for four hours, after which remove 85 μL of MTT medium and replace it with 150 μL of DMSO (Corning Corporation), mixed completely by pipetting. Incubate the DMSO with the cells at 37°C for 10 minutes, then mix the wells again by pipetting before reading the absorbance of each well at λ = 540 nm using a Cooperative Mx microplate reader (BioTek, Winuschi, Vermont) running Gen5 software. After subtracting the background from the culture medium control, convert all absorbance to a ratio to untreated cells. Use three plates, processing in triplicate on each plate, and average the results to produce a single data point.

[0335] LPS stimulation and assessment

[0336] BV2 mouse microglia were seeded in 24-well plates. Cells were stimulated for 3 hours in serum-free medium with 100 ng / ml LPS (Sigma-Aldrich), followed by incubation with PEGOL-60 and 100 ng / ml LPS for 24 hours. PEGOL-60 was dissolved in the medium and filtered through a 20 μm pore filter. Medium was collected by Griess reaction and nitrite production was analyzed (Promega Corporation, Madison, Wisconsin), and TNFα secretion was analyzed by ELISA (Biolegend, San Diego, California).

[0337] Cells were collected in 1 mL of Trizol (Ingenieur) for PCR analysis. Briefly, 200 μL of chloroform (Thermo Fisher Scientific) was added, and the sample was shaken and incubated on ice for 15 minutes. The sample was then centrifuged at 12,000 rpm for 15 minutes, and the aqueous fraction was collected. 500 μL of isopropanol (Thermo Fisher Scientific) was added to each sample, mixed, and incubated on ice for 10 minutes. The sample was again centrifuged at 12,000 rpm for 15 minutes and washed with DEPC water containing 75% ethanol (Ingenieur). The samples were analyzed using nanodrop (Thermo Fisher Scientific) to determine RNA concentration and converted to cDNA (Applied Biosystems, Foster City, CA). The samples were measured on a StepOne Plus real-time PCR system (Applied Biosystems) using the green Syber reagent on a rapid PCR plate (Thermo Fisher Scientific). Relative expression was determined by 2-ΔΔCT calculations normalized relative to untreated, unstimulated control samples. PCR primers for IL10, iNOS, and CD204 were obtained from Bio-Rad Laboratories in Hercules, California. TNFα (F: CCA GTG TGG GAAGCT GTC TT (SEQ ID NO:1); R: AAG CAA AAG AGG AGG CAA CA (SEQ ID NO:2), IL6 (F: TCAGT TGC CTT CTT GGG AC (SEQ ID NO:3); R: GTG TAA TTA AGC CTC CGA CTT G (SEQ ID NO:4)), Argl (F: TCA TGG AAG TGA ACC CAA CTC TTG (SEQ ID NO:5); R: TCA GTC CCT GGCTTA TGG TTA CC (SEQ ID NO:6)), IL4 (F: TGT AGG GCT TCC AAG GT (SEQ ID NO:7); R: GAAAGA GTC TCT GCA GCT PCR primers for C (SEQ ID NO:8) and GAPDH (F:TGT CGT GGA GTC TAC TGG TGTCTT C (SEQ ID NO:9); R:CGT GGT TCA CAC CCA TCA CAA (SEQ ID NO:10)) were purchased from Integrated DNA Technologies (Integrated DNA Technologies, Coralville, Iowa).

[0338] Oxidative stress-induced cell death

[0339] BV2 mouse microglia were pretreated with D2-OH-60 for 24 hours, followed by oxidative stress damage with 500 μM H2O2 (Sigma-Aldrich) for 3 hours. Cells were collected by trypsinization, mixed 1:1 with trypan blue (Corning), and cell viability was counted.

[0340] result

[0341] The inherent antioxidant and anti-inflammatory effects of PEGOL-60 were investigated (Posadas I et al., Proceedings of the National Academy of Sciences, 2017, 114, E7660; Chauhan AS et al., Biomacromolecules, 2009, 10, 1195). First, MTT assays showed that PEGOL-60 had no cytotoxicity at concentrations up to at least 1000 μg / mL after 24 hours of exposure. Figure 5 (n=3, p<0.05).

[0342] To estimate the therapeutic efficacy of PEGOL-60, BV2 murine microglia were attacked with LPS to induce a pro-inflammatory state, followed by co-treatment with LPS and PEGOL-60, and biomarkers of inflammation and oxidative stress were estimated. Treatment with PEGOL-60 resulted in the presence of TNF-α, IL-6, IL-10, and iNOS (in the absence of any added antioxidants or anti-inflammatory agents). Figures 6A-6D The expression of pro-inflammatory cytokines was significantly reduced, and the anti-inflammatory markers CD-206, Arg-1, and IL-4 were upregulated in a typical dose-dependent manner. Figure 6E-6G Treatment with high concentrations of 500 μg / ml PEGOL-60 restored both pro-inflammatory and anti-inflammatory markers to near-healthy levels. At the protein level, this led to the extracellular secretion of TNFα (…). Figure 6H (p<0.001) and nitrite ions ( Figure 6I (p<0.001) significantly reduced.

[0343] Based on this powerful antioxidant effect, the efficacy of PEGOL-60 after oxidative stress damage was also estimated. Pretreatment with PEGOL-60 following H2O2 attack resulted in decreased cell viability ( Figure 6J(p<0.001) Significant improvement. This antioxidant effect is consistent with results observed in both in vitro and in vivo for several other dendritic constructs without therapeutic payloads (Neibert K et al., *Molecular Pharmaceutics* 2013, 10, 2502; Posadas I et al., *Proceedings of the National Academy of Sciences* 2017, 114, E7660; Chauhan AS et al., *Biomacromolecules* 2009, 10, 1195). This antioxidant effect is likely due to the free electrons in the dendritic polymer backbone acting as scavengers of reactive oxygen species (ROS). The entry of these scavenger pairs (ROS) in the backbone may be sterically inhibited by the branched arms, with each successive layer further shielding the interior. PEGOL-60 possesses ideal properties as an excellent nanocarrier because it achieves a high density of hydroxyl groups with a relatively low number of layers, thus allowing the backbone to be used for ROS scavenging.

[0344] Example 8: In vivo efficacy and safety characteristics of PEGOL-60

[0345] Methods and Materials

[0346] In vivo administration of PEGOL-60

[0347] In PND1, littermates from the CP group were randomly assigned to three subgroups: PBS, single-dose PEGOL-60, and repeated-dose PEGOL-60. Rabbits in the single-dose PEGOL-60 group received a single intravenous injection of PEGOL-60 (100 mg / kg, 200 μL) in PND1. Rabbits in the repeated-dose PEGOL-60 group received intravenous injections of PEGOL-60 (100 mg / kg, 200 μL) in both PND1 and PND3. Rabbits in the PBS group received a single intravenous injection of PBS (200 μL) in PND1. All solutions used for administration were 0.2 μm in diameter prior to injection. The syringe filter (Pall Corporation, Port Washington, New York) was sterilized.

[0348] Behavioral testing

[0349] The overall physical condition (e.g., weight gain, food intake, etc.) of the animals (n=6) was monitored daily. Neurobehavioral tests were performed on PND1 by uninformed personnel before drug administration (baseline, 0 hours) and at 24, 48, and 96 hours after drug administration.

[0350] Each animal was videotaped for 10 minutes, and head movement was rated on a 0-3 scale (0 = worst; 3 = best), as previously described for rabbits (E. Nance et al., Biomaterials, 101, 96 (2016); Z. Zhang et al., Neurobiology of Disease, 94, 116 (2016)). Pups were fed with Wombaroo rabbit milk replacer (Perfect Pets Inc., Belleville, Michigan), and sucking / swallowing was estimated on a 0-3 scale (worst-best) (J. Yang et al., Chemical Reviews, 115, 5274 (2015)). To minimize the impact of disease phenotypic variability, the efficacy of the treatment was assessed using changes in behavioral scores for each pup before treatment (0 hours) and at 24, 48, and 96 hours after treatment. Specifically, the behavioral score of each pup on PND1 before treatment (0 hours) was used as the baseline score. Changes in the neurobehavioral scores of each pup at 24, 48, and 96 hours after treatment were calculated as follows:

[0351] Changes from baseline (48) =Rating (48小时) -score (0小时) Or from the change in baseline (96) =Rating (96小时) -score (0小时)

[0352] The changes in all calves in each group are averaged, and the results are compared between groups.

[0353] Real-time PCR

[0354] At PND5, pups from all groups (n=3) were euthanized. Brains were rapidly collected and stored in RNAlater solution (Grand Island Life Technologies, NY, USA). Microscopic dissection (approximately 50 mg) was performed on the periventricular region (PVR) white matter and cerebellar white matter. Total RNA was extracted using TRIZOL (Grand Island Life Technologies, NY, USA) according to the manufacturer's instructions. RNA samples were quantified using a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Vauxville, NY, Maryland). Single-stranded complementary DNA (cDNA) was first reverse transcribed from the total RNA samples using a high-capacity cDNA reverse transcription kit containing an RNase inhibitor (Grand Island Life Technologies, NY, USA). PowerPCR was then performed using a Rapid 7500 Real-Time PCR system (Grand Island Life Technologies, NY, USA). Real-time PCR was performed using Green PCR Master Mix (Life Technologies, Grand Island, NY, USA). Amplification conditions included 30 min at 48°C, 10 min at 95°C, 40 cycles at 95°C for 15 seconds each, and 1 min at 60°C. Primers were custom-designed and ordered from Integrated DNA Technologies, Iowa, USA. The comparative Ct method was used to estimate differential gene expression. Gene expression levels for each sample were normalized relative to the expression levels of the housekeeping gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) within a given sample (ΔCt); the difference between the treatment group and the healthy control group was used to determine ΔΔCt. -△△Ct The relative fold change in gene expression is given. The primers are:

[0355] TNF-α (positive) TAGTAGCAAACCCGCAAGTG (SEQ ID NO:11);

[0356] TNF-alpha (reverse)CTGAAGAGAACCTGGGAGTAGA (SEQ ID NO: 12).

[0357] IL-1β (positive)TGCCAACCCTACAACAAGAG (SEQ ID NO:13);

[0358] IL-1β (reverse)AAAGTTCTCAGGCCGTCATC (SEQ ID NO:14).

[0359] IL-6 (positive)CATCAAGGAGCTGAGGAAAGAG (SEQ ID NO:15);

[0360] IL-6 (reverse) CCTTGGAAGGTGCAGATTGA (SEQ ID NO:16).

[0361] GAPDH (forward)TGACGACATCAA GAA GGTGGTG (SEQ ID NO: 17);

[0362] GAPDH (reverse) GAAGGTGGAGGAGTGGGTGTC (SEQ ID NO: 18).

[0363] result

[0364] On day 1 postnatal day (PND), litters of rabbits in the CP group were randomly assigned to three subgroups: PBS, single-dose PEGOL-60, and repeated-dose PEGOL-60. Rabbits in the single-dose PEGOL-60 group received a single dose of 200 μL sterile PBS containing PEGOL-60 at 100 mg / kg via intravenous injection at PND1. Rabbits in the repeated-dose PEGOL-60 group received 200 μL sterile PBS containing PEGOL-60 at 100 mg / kg via intravenous injection at PND1 and PND3. Rabbits in the PBS group received a single dose of PBS (200 μL) via intravenous injection at PND1. The overall condition, neurobehavior, and weight of the rabbit pups were monitored daily. It should be noted that there were no significant differences in sucking and swallowing, head movement, and weight gain between the groups. Figure 7A -C). Furthermore, there were no significant changes in cytokine expression among the groups ( Figure 7D These results indicate that PEGOL-60 does not further impair neurobehavioral scores in CP pups, suggesting that PEGOL-60 is a non-toxic carrier for in vivo use.

[0365] Example 9: Quantitative brain distribution of PEGOL-60-Cy5 biodistribution in a neonatal rabbit model of cerebral palsy (CP).

[0366] Methods and Materials

[0367] CP rabbit model and application of PEGOL-60-Cy5

[0368] New Zealand white rabbits were purchased from Robinson Services (North Carolina, USA) and arrived at the facility two weeks prior to breeding. All animals were housed under controlled environmental conditions (22°C, 50% relative humidity, and a 12-hour light / dark cycle), and necessary precautions were taken throughout the study to minimize pain and stress associated with experimental treatments. The experimental procedures were approved by the Johns Hopkins University Committee on Animal Conservation and Utilization (IACUC). On day 28 of gestation (G28), rabbits with scheduled pregnancies underwent laparotomy and received a total of 3,200 EU of lipopolysaccharide (LPS, E. coli serotype O127:B8, Sigma-Aldrich, St. Louis, Missouri) along the uterine wall as previously described (F. Saadani-Makki et al., American Journal of Obstetrics and Gynecology, 199, 65l.el (2008); S. Kannan et al., Developmental Neuroscience, 33, 231 (2011); S. Kannan et al., Dev Neurosci-Basel, 33 (2011)). At G30, the lipopolysaccharide was administered intravenously. Rabbits were induced with PEGOL-60-Cy5 (0.5 units / kg) (JHP Pharmaceuticals, Rochester, Michigan). After parturition, the rabbit pups were kept in an incubator at a temperature of approximately 32°C–35°C and a relative humidity of approximately 50%–60%, and fed rabbit milk replacer (Wombaroo, South Australia) three times daily. On day 1 postnatal day (PND1), healthy controls and CP pups received a single intravenous injection of PEGOL-60-Cy5 (55 mg / kg, 200 μL). CP pups were sacrificed at 1 hour, 4 hours, and 24 hours post-injection. Healthy controls were sacrificed 24 hours post-injection. All solutions used for administration were prepared using 0.2 μm solutions prior to injection. The syringe filter (Pall Corporation, Port Washington, New York) was sterilized.

[0369] Immunohistochemistry of CP model

[0370] In PND1, animals received intravenous (iv) administration of PEGOL-Cy5 (55 mg / kg, 200 μL) and were sacrificed 24 hours post-injection. Rabbits were anesthetized and perfused with PBS via the heart. All major organs (kidneys, lungs, liver, heart) and plasma were isolated and rapidly frozen. The brain was removed and divided in half. One half was rapidly frozen for quantitative fluorescence, and the other half was post-fixed in 10% formalin for 48 hours and cryoprotected in fractionated sucrose solution. Coronal sections (30 μm, 1:6 series) were blocked by 0.1 M phosphate-buffered saline (PBS) containing 3% normal donkey serum. For colocalization of PEGOL-60-Cy5 and microglia, sections were incubated overnight at 4°C with goat anti-IBA1 (1:250, Abbin Biosciences, SMAB, USA). Sections were then washed and incubated at room temperature for 2 hours with a fluorescent secondary antibody (1:250; Life Technologies, SMAB, USA). Next, the slides were incubated with DAPI (1:1000, Ingenium) for 15 minutes. After washing, the slides were dried and covered with a mounting medium (Carpintria Daco, California, USA). Confocal images were acquired using a ZeissZEN LSM 710 (Zeiss Corporation, California, USA) and processed using ZEN software.

[0371] CP infant brain microanatomy procedure

[0372] Following euthanasia and perfusion, one hemisphere of the brain from each rabbit pup was rapidly frozen and stored at -80°C until microdissection was performed following the steps outlined in the recently published manuscript. Briefly, the brain was warmed in a disposable Petri dish on a bed of dry ice and then cut into five equal-thickness sections with a clean razor blade. The brainstem and the anterior portion with the olfactory bulb were discarded, and the remaining cortex was removed with a state-of-the-art scalpel and placed in pre-weighed 1.5 mL Eppendorf tubes. The hippocampus and periventricular region were then isolated from the remaining tissue under a magnifying glass and placed in separate pre-weighed 1.5 mL Eppendorf tubes. Each Eppendorf tube was weighed again to determine sample mass, and all samples were stored at -80°C until downstream processing via homogenization and extraction. Three cortical samples, two PVR samples, and one hippocampal sample were obtained from each brain. These samples were averaged together to provide a dendritic polymer uptake value for each brain subunit.

[0373] Dendritic polymers were extracted from tissue samples.

[0374] In short, organs (heart, lungs, liver, kidneys, brain) were removed from -80°C, slowly thawed on ice, and weighed. The organs were dissected to obtain known amounts of tissue samples (3 from the liver, lungs, and kidneys, and 2 from the heart). The cerebral hemispheres were further microdissected using a recently published protocol to separate the cortex, hippocampus, and periventricular region. Known amounts of tissue samples were obtained from these subregions of the brain (3 from the cortex, 2 from the PVR, and 1 from the hippocampus). The tissue samples were homogenized for 10 minutes at a 1 mL:100 mg tissue ratio using 0.9 mm–2.0 mm stainless steel homogenizing beads in methanol on a Bullet Blender Storm 24 tissue homogenizer (Next Advantage Inc., Afrique Park Village, NY). The power level was 6 for the brain and 12 for all other major organs at 4°C. The homogenized samples were then centrifuged at 15,000 rpm for 10 minutes at 4°C. The clarified supernatant was transferred to protein lo-bind Ependorf tubes and stored at -80°C.

[0375] Quantitative fluorescence

[0376] The supernatant was thawed, centrifuged again, and 130 μL of supernatant was transferred to a microvolume cuvette (Starna Cell Inc., Atascadero, CA) for measurements. The fluorescence intensity of Cy5 in each sample (λex = 645 nm, λem = 662 nm) was determined using an RF5301PC fluorescence spectrophotometer running Panorama3 software (Shimadzu Scientific Instruments, Columbia, MD). Background fluorescence was adjusted based on fluorescence values ​​from healthy control tissues. The fluorescence intensity values ​​were then converted to dendritic polymer concentrations using a calibration curve for D2-OH-60-Cy5 to obtain the appropriate slit width. Plasma was diluted 10-fold in dPBS (Corning), passed through a 0.2 μm pore PES filter, and measured as described above for organ samples.

[0377] result

[0378] The in vivo BBB penetration and targeting neuroinflammation ability of PEGOL-60-Cy5 in a neonatal rabbit cerebral palsy model were assessed qualitatively and quantitatively using confocal microscopy and fluorescence spectroscopy, respectively. Cerebral palsy (CP) is caused by damage / impairment to the developing brain (including maternal infection / inflammation) and leads to motor, sensory, and cognitive impairments in offspring (Rosenbaum PN et al., *Developmental Medicine & Child Neurology*, 49, 8 (2007)). Periventricular leukomalacia, characterized by diffuse microglial and astrocyte activation in immature white matter, is one of the pathophysiological markers of human CP (Haynes RL et al., *Journal of Neuropathology & Experimental Neurology*, 62, 441 (2003)). In addition to white matter damage, CP also involves neuronal damage in gray matter regions, including the cerebral cortex and hippocampus of CP patients (Andiman SE et al., Brain Pathology, 20, 803 (2010); CR Pierson CR et al., Acta Neuropathologica, 114, 619 (2007)).

[0379] In a lapine model of cerebral palsy induced by maternal uteroin, uptake of PEGOL-60-Cy5 in the corpus callosum (white matter), hippocampus, and cortex was investigated at 1, 4, and 24 hours following a single systemic administration. This model summarizes the markers of pro-inflammatory activation of microglia and astrocytes, as well as characteristic behavioral markers such as lower limb rigidity and spasticity, observed in human patients. In PND1, CP pups (n=3) received intravenous administration of PEGOL-60-Cy5 (55 mg / kg) and were sacrificed at 1, 4, and 24 hours post-injection, and compared with healthy controls (n=3) sacrificed 24 hours after intravenous administration of the same dose. The colocalization of PEGOL-60-Cy5 with activated mi / ma in the corpus callosum, hippocampus, and cortex of CP pups (indicated by the shortened process of amoeba bodies) strongly suggests the accumulation of dendritic polymers in activated microglia at these damaged sites in the brain (Reid SM et al., Medical Development and Pediatric Neurology 57, 1159 (2015)). PEGOL-60-Cy5 was primarily distributed in the perinuclear cytoplasm of these activated mi / ma. PEGOL-60-Cy5 was shown to be able to leak from the blood vessels and rapidly localize in activated mi / ma in damaged brain regions of the corpus callosum, hippocampus, and cortex within 1 hour. The signal intensity of PEGOL-60-Cy5 increased in activated mi / ma for 4 hours and remained at a similar level 24 hours post-injection, demonstrating the potential for localized sustained release from nanoparticle accumulation at the site of injury. In contrast, no mi / ma colocalization was observed in healthy controls at 24 hours post-injection.

[0380] Next, quantitative brain and organ biodistribution of PEGOL-60-Cy5 was investigated in CP larvae (n=6) at three different time points (1 hour, 4 hours, and 24 hours) and compared with age-matched healthy controls (n=5). Instead of measuring whole-brain dendritic polymer levels as is routine, the brain was microdissected to isolate the periventricular region (PVR), hippocampus, and cortex in order to measure local uptake in these regions where activated microglia are present in this model (A. Sharma et al., Controlled Release Journal 2018, 283, 175 (2018)). Previous studies have shown that activated mi / ma are highly involved in the PVR, which may be due to the role of the ventricle as a pathway for macrophage recruitment to the brain (WG Lesniak et al., Nance, Mol Pharm, 10 (2013), I. Corraliza, Frontiers in Cellular Neuroscience 8, 262 (2014)). The hippocampus and cortex are regions involved in the pathology of cerebral palsy due to their roles in learning, memory, and motor functions (Reid SM et al., *Medical Development and Pediatric Neurology*, 57, 1159 (2015)). This microscopic dissection allowed for the assessment of local dendritic polymer uptake in these clinically relevant subregions of the brain, rather than the overall brain volume. To avoid interference from blood and dendritic polymer entrapment in blood vessels, calves were perfused with PBS. A significant increase in dendritic polymer uptake was detected in the brains of CP animals compared to healthy controls. Figure 8A (p<0.01, compared with healthy controls, Student's T test). The selective uptake of PEGOL-60 in the damaged brain regions of CP animals can be explained by its ability to: i) cross the damaged BBB; ii) diffuse efficiently within the brain parenchyma due to its neutral charge; and iii) be absorbed by mi / ma activated by phagocytes.

[0381] A major concern in the clinical translation of nanomedicine-based therapeutics is its unwanted accumulation in organs outside the disease area. The biodistribution of PEGOL-60-Cy5 in all major organs (heart, lung, liver, spleen, and kidney) and plasma was estimated. Results showed that the dendritic polymer was rapidly cleared from the body, accumulating less than 1% of the injected dose in any major organ at all time points. Figure 8BA similar trend was observed in all organs, with peak accumulation at 4 hours and clearance at 24 hours. Results were obtained by fluorescence spectroscopy of homogenized tissue extracts and reported as a percentage of the injected dose to the total organ (or total plasma volume). The presence of less than 0.2% dendritic polymers in serum at 24 hours post-injection indicates rapid clearance of the dendritic polymers from circulation. Interestingly, this dendritic polymer showed levels similar to those previously observed in CP models of nanoparticles with PAMAM-D4-OH, having similar size, shape, and number of surface hydroxyl groups, but exhibited a much faster rate of clearance from circulation and other vital organs (WG Lesniak et al., Nance, Moore Pharmaceuticals, 10 (2013), I. Corraliza). This rapid rate of clearance from the body within 24 hours, coupled with persistent cellular aggregation in the damaged brain regions of neonatal CP rabbits, makes this dendritic polymer an excellent platform for designing therapies for pediatric neuroinflammatory diseases.

[0382] Early studies have shown that systemically applied hydroxyl-terminated fourth-generation poly(amidoamine) dendritic macromolecules (PAMAM-D4-OH) with 64 terminal hydroxyl groups cross the damaged CNS barrier and specifically accumulate in activated mi / ma at brain injury sites, while exhibiting minimal accumulation in healthy brain tissue across various neurodegenerative disease-sized animal models (S. Kannan et al., Science Translational Medicine, 4, 130ra46 (2012); SP. Kambhampati et al., Research in Ophthalmology and Visual Sciences, 56 (2015)). No similar neuroinflammatory targeting has been observed with cationic and anionic dendritic polymers of similar size and backbone (Nance, E. et al., Biomaterials, 101, 96 (2016)). Theoretically, this inherent targeting ability is likely due to the high density of surface hydroxyl groups that dendritic polymers may possess, resulting from the unique branched structure of these dendritic polymers (in fourth-generation PAMAM, per nm...). 2 It has approximately one hydroxyl end group, which is difficult to achieve with other polymer nanoparticles.

[0383] Inspired by these findings, hydroxyl-functionalized PEG-based dendritic polymer nanocarriers have been designed and developed for systemic targeting of mi / ma activated in CNS conditions. This construct is designed to exhibit a greater hydroxyl surface density at lower generations than PAMAM dendritic polymers, thus achieving similar neuroinflammation targeting capabilities with a lower synthetic burden (approximately 5 hydroxyl end groups per nm² at generation 2). Considering the requirements of clinical translation, this dendritic polymer was developed into a monodisperse, defect-free dendritic polymer using water-soluble, inexpensive, and biocompatible structural units through efficient click chemistry-based chemical transformation with minimal reaction steps. This construct (designated D2-OH-60 or PEGOL-60) is composed of PEG-based structural units and, compared to PAMAM-D4-OH which has 64 hydroxyl surface groups achieved in eight synthetic steps at generation 4, this construct has 60 hydroxyl (neutral) surface groups generated in four reaction steps at generation 2. The PEGOL-60 dendritic polymer backbone is designed to consist primarily of stable ether bonds to prevent enzymatic degradation or breakdown in biological systems, thus allowing it to be excreted intact through the kidneys. PEGOL-60 is designed to be excreted through its per nm 2 The high-density surface hydroxyl end groups of the five groups exhibit inherent neuroinflammatory targeting, and are small in size, near-neutral in charge, water-soluble and biocompatible, thereby simplifying the transformation process by eliminating the need for post-synthetic modifications.

[0384] In three different CNS disease models, the ability of PEGOL-60 to target relevant cells at neuroinflammatory sites was validated in vivo using quantitative and confocal microscopy based on fluorescence spectroscopy to estimate its ability to cross both the BBB and BRB, penetrate solid tumors, and target disease-associated microglia and macrophages. For this purpose, a rabbit model of maternal uterine inflammation-induced cerebral palsy (CP), a mouse model of glioblastoma (GBM), and a rat model of subretinal lipid-induced age-related macular degeneration (AMD) were used. Upon systemic administration, PEGOL-60 successfully crossed the damaged CNS barrier and specifically localized to activated microglia / macrophages, tumor-associated macrophages, and / or retinal pigment epithelial cells in the rabbit cerebral palsy model, mouse glioblastoma model, and rat AMD model, while being rapidly cleared from peripheral organs.

[0385] Based on previous findings that certain dendritic polymers exhibit antioxidant and anti-inflammatory effects without the addition of therapeutic payloads, the inherent therapeutic properties of PEGOL-60 were explored in vitro (M. Hayder et al., Science Translational Medicine, 3, 81ra35 (2011); K. Neibert et al., Molecular Pharmaceutics, 10, 2502 (2013)). PEGOL-60 also exhibited potent inherent antioxidant and anti-inflammatory effects in microglia exposed to an inflammatory environment, with no side effects observed in vitro or in vivo. Finally, the effects of PEGOL-60 on neurobehavioral responses in CP pups were investigated.

[0386] This hydroxyl PEG dendritic polymer can serve as an excellent nanocarrier for various neuroinflammatory diseases, enabling the specific delivery of therapies to the site of brain injury, thereby improving treatment efficacy.

[0387] Example 10: Robust Synthetic Strategies for Large-Scale Dendritic Polymer-Drug Synthesis

[0388] NAC is an N-acetyl derivative of the naturally occurring amino acid L-cysteine ​​and acts as an antioxidant and anti-inflammatory agent. NAC has been widely used in pediatric and adult clinical practice for decades. NAC is a glutamate modulator and helps restore the body's natural antioxidant, glutathione. Neuroinflammation leads to glutathione depletion in glial cells, resulting in loss of their neuroprotective function. Due to the presence of thiol groups that can bind to proteins, NAC is often administered in high doses due to its poor bioavailability. Targeted delivery of NAC using a dendritic polymer platform not only selectively delivers NAC to activated glial cells at the site of injury but also helps reduce neurotoxicity. Dendritic polymer-NAC (D-NAC) is 100 times better than free drug and has shown significant efficacy in rabbit CP models, mouse hypoxic-ischemic models, and other neuroinflammation models in various animals (Kannan S et al., *Journal of Controlled Release*, 2015, 214, 112).

[0389] To meet the clinical trial requirements of D-NAC, a well-established, highly reproducible, and robust method is needed to construct this kilogram-scale conjugate. Different synthetic strategies for the large-scale synthesis of D-NAC are described.

[0390] These synthetic strategies are illustrated using the G4 PAMAM dendrimer-NAC as an example. The synthetic methods described herein are generally applicable to the dendrimers described above and other agents to be delivered.

[0391] Methods and Materials

[0392] Synthesis of intermediates and dendritic polymer-drug conjugates

[0393] G4-(OH) 39 (GABA-NHBOC) 25 Preparation of (Compound 22): Boc-GABA-OH (2.498 g) and DMAP (1.67 g) were added to a stirred solution of PAMAM G4-OH (4.85 g; Compound 21) in anhydrous DMF (50 mL), and the mixture was stirred at room temperature (RT) for 5 minutes to prepare a clear solution. EDC.HCl (2.94 g) was added in portions to the reaction mixture over a 30-minute period. The reaction mixture was stirred at RT for 36 hours. The reaction mixture was transferred to a 1 kD MW cut-off cellulose dialysis tubing and dialyzed against water for 24 hours, changing the water 3 to 4 times periodically. The contents of the dialysis tubing were transferred to a pre-weighed 50 mL falcon tube and lyophilized to give the desired product, Compound 22, as a white, fluffy, hygroscopic solid. Yield: 85%, 5.3 g.

[0394] G4-(OH) 39 (GABA-NHTFA) 25 Preparation of (Compound 23): In a flame-dried 250 mL round-bottom flask, BOC-protected dendritic polymer, compound 22 (5.3 gm), was added, and 30 mL of DCM was added under a nitrogen atmosphere to dissolve the compound. The solution was sonicated for 15 minutes to prepare a homogeneous solution, and 10 mL of TFA was added dropwise while stirring. The reaction mixture was stirred at RT for 12 hours. The color of the reaction changed from colorless to light brown. Once complete, the DCM was evaporated. The reaction mixture was diluted with methanol and evaporated using a rotary evaporator. This procedure was repeated until excess TFA was completely eliminated. The reaction mixture was placed under high vacuum for 3 hours to remove any trace solvent, yielding compound 23 as a white, fluffy, hygroscopic material, which could be used directly in the next step without any further purification.

[0395] Preparation of compounds 24, 25 and 26: Compound 24 was purchased from Sigma-Aldrich and used as is. Compounds 25 and 26 were synthesized using previously disclosed protocols (Navath, RS; Kurtoglu, YE; Wang, B.; Kannan, S.; Romero, R.; Kannan, RM, Bioconjug Chem, 2008, 19, 2446).

[0396] Preparation of N-acetyl-S-((3-(((2,5-dioxopyrrolid-1-yl)oxy)-3-oxopropyl)thio)cysteine ​​[SPDP-NAC linker] (compound 27): In a flame-dried 100 mL round-bottom flask, N-succinimide 3-(2-pyridyldithio)propionic acid (SPDP, compound 26) (5 g, 16.02 mmol) was added and dissolved in anhydrous tetrahydrofuran (THF, 15 mL) under an inert atmosphere. A solution of N-acetylcysteine ​​(NAC, 2.87 g, 17.62 mmol, 1.1 equivalents) dissolved in THF (15 mL) was added dropwise. The reaction mixture turned yellow within minutes. The reaction mixture was stirred at RT for 4 hours. The reaction was monitored by TLC, and the solvent was removed using a rotary evaporator once the starting material (SPDP) was consumed. Using the high-performance redisep gold Rf pre-packaged on the CombiFlash system TM The crude product was purified by an 80 g silica column at a flow rate of 60 mL / min. The column was started in DCM, and the pure, desired product was collected as a white powder in dichloromethane containing 4% MeOH in 75.4% yield (4.4 g).

[0397] Preparation of Compound 28 (D-NAC): Compound 23 (6 g) was added to a flame-dried 500 mL round-bottom flask and dissolved in anhydrous DMF (40 mL) under an inert atmosphere. The flask was sonicated and vortexed until a clear solution was formed. The pH of the reaction mixture was adjusted to 7.0–7.5 by adding diisopropylethylamine. The reaction mixture was stirred for 30 min, and once the pH stabilized, Compound 27 (4.76 g, 35 equivalents) dissolved in DMF (20 mL) was slowly added. The reaction mixture was stirred at room temperature under nitrogen for 12 h. The reaction mixture was transferred to a 1000 tampere dialysis bag and dialyzed against DMF for 6 h, followed by dialyzed against water for 24 h, with the solvent changed periodically every 2 to 3 hours. The contents of the dialysis tube were transferred to a pre-weighed 50 mL Falcon tube and lyophilized to obtain a dendritic polymer-NAC conjugate, compound 28, as a white, fluffy powder, with a yield of 90% and a yield of 7.0 g. The degree of final conjugation was calculated by comparing the NH protons of the dendritic polymer (between 8 and 7.5 ppm) with the N-acetyl protons of NAC (at 1.8 ppm) and the -CH protons of NAC (at approximately 4.4 ppm).

[0398] Preparation of compound 29 (D-Allyl): NaH (200 mg, 8.33 mmol) was added fractionally to a stirred solution of PAMAM-G4-OH (compound 21, 530 mg, 0.037 mmol) in anhydrous DMF (15 mL) at 0 °C. After 15 minutes, allyl bromide (0.127 mL, 1.48 mmol) was added, and stirring was continued at RT for 24 hours. The solution was then dialyzed against DMF, followed by dialyzing with water for 24 hours. The aqueous solution was lyophilized to give the product as a white powder.

[0399] Preparation of compound 30: 2-(boc-amino)ethanethiol (200 mg, 1.12 mmol) was added to a stirred solution of compound 29 (192 mg, 0.012 mmol) in DMF (5 mL), followed by a catalytic amount of 2,2-dimethoxy-2-phenylacetophenone (DMPAP). The reaction mixture was stirred under UV light for 24 hours. The reaction was dialyzed against DMF, followed by dialyzed against water for 24 hours. The aqueous solution was lyophilized to give the product as a white powder.

[0400] Preparation of compound 31: Trifluoroacetic acid (2 mL) was added to a stirred solution of compound 30 (200 mg) in DCM (2.5 mL), and stirring was continued for 4 hours. The reaction was quenched with methanol, and the solvent was evaporated under reduced pressure. Methanol was added and evaporated several times to remove TFA. The residue was dried under reduced pressure to give a hygroscopic solid in quantitative yield.

[0401] Preparation of D-NAC via ether linkers a (Compound 28a): Compound 31 (300 mg, 0.018 mmol) was charged into a flame-dried 500 mL round-bottom flask and dissolved in anhydrous DMF (10 mL) under an inert atmosphere. The flask was sonicated and vortexed until a clear solution was formed. The pH of the reaction mixture was adjusted to 7.0–7.5 by adding diisopropylethylamine. The reaction mixture was stirred for 30 minutes, and once the pH stabilized, Compound 27 (331 mg, 0.909 mmol) dissolved in DMF (10 mL) was slowly added. The reaction mixture was stirred at room temperature under nitrogen for 12 hours. The reaction mixture was transferred to a 1000 tampere dialysis bag and dialyzed against DMF for 6 hours, followed by dialyzed against water for 24 hours, with the solvent changed periodically every 2 to 3 hours. The contents of the dialysis tube were transferred to a pre-weighed 50 mL Falcon tube and lyophilized to give a white, fluffy powder of a dendritic polymer-NAC conjugate, compound 28b.

[0402] Preparation of compound 32: Compound 32, which has mixed hydroxyl and amine surface groups, was purchased from Dendritech and used as is.

[0403] D-NAC b Preparation of (Compound 28b): In a flame-dried 500 mL round-bottom flask, the bifunctional dendritic polymer, Compound 32 (1 g, 0.071 mmol), was charged and dissolved in anhydrous DMF (20 mL) under an inert atmosphere. The flask was sonicated and vortexed until a clear solution was formed. The pH of the reaction mixture was adjusted to 7.0–7.5 by adding diisopropylethylamine. The reaction mixture was stirred for 30 min, and once the pH stabilized, Compound 27 (910 mg, 2.5 mmol) dissolved in DMF (10 mL) was slowly added. The reaction mixture was stirred at room temperature under nitrogen for 12 h. The reaction mixture was transferred to a 1000 tampere dialysis bag and dialyzed against DMF for 6 h, followed by dialyzed against water for 24 h, with the solvent changed periodically every 2 to 3 hours. The contents of the dialysis tube were transferred to a pre-weighed 50 mL falcon tube and lyophilized to obtain a dendritic polymer-NAC conjugate, compound 28b, as a white, fluffy powder.

[0404] Preparation of compound 33: Aldrithiol-2 (6.19 g) was added to a round-bottom flask and dissolved in 25 mL of methanol. Then, 2-mercaptoethanol dissolved in methanol (5 mL) was added dropwise. The reaction was continued overnight at room temperature. All volatiles were then evaporated under reduced pressure. The residue was purified by column chromatography by elution with a mixture of hexane and ethyl acetate. The obtained product (compound 33) was collected as a pure, pale yellow oil (2.14 g, 75% yield).

[0405] Preparation of Compound 34: 2.30 g of 4-nitrophenyl chloroformate dissolved in 10 mL of anhydrous DCM (10 mL) was added to a round-bottom flask dried in an oven under N2 atmosphere at room temperature. Then, a mixture of 2-pyridyl disulfonyl ethanol (2.14 g) and pyridine (0.9 mL) dissolved in anhydrous DCM (5 mL) was added to the solution. After 6 hours, a further mixture of 1.16 g of 4-nitrophenyl chloroformate and pyridine (0.5 mL) dissolved in anhydrous DCM (10 mL) was prepared and added to the reaction mixture. After stirring overnight at room temperature, the reaction medium was diluted with DCM (ACS grade, 10 mL) and washed three times with 1 M HCl (60 mL). The collected organic layer was dried over anhydrous Na2SO4 and filtered. All volatile organic compounds were evaporated under vacuum, and the residues were purified by column chromatography, eluented with a mixture of hexane and ethyl acetate. The product (compound 34) was collected as a pure yellow oily product (3.08 g, 76.2% yield).

[0406] Compound 35 and D-NAC c Preparation of the carbonate linker (compound 28c): 1.00 g of PAMAM G6-OH dissolved in 15 mL of anhydrous DMF was added to a 250 mL round-bottom flask dried in an oven. After stirring the solution in an oil bath at 40 °C under N2 atmosphere, DMAP dissolved in 5 mL of anhydrous DMF was added. Then, the carbonate linker dissolved in 10 mL of anhydrous DMF was added to the solution, and the reaction mixture was stirred at 40 °C for 48 hours. At the end of the reaction, the solution was transferred for dialyzing against DMF using a dialysis membrane (MWCO 8kD) by changing the solvent at least three times. The dialysate containing compound 35 was then transferred to a round-bottom flask, and 0.44 g of NAC dissolved in 4 mL of anhydrous DMF was added dropwise to the solution. After stirring overnight at room temperature, the solution was transferred for dialyzing against DMF using a dialysis membrane (MWCO 8kD), with the solvent changed at least twice. After adding the solution to anhydrous diethyl ether (100 mL), the precipitate as a solid product was collected and dried under reduced pressure overnight. As a final step, the resulting solid was dissolved in DPBS (45 mL) and dialyzed against DI water (MWCO 8 kD) for 4 hours. The dialyzed solution was lyophilized to obtain a dendritic polymer-NAC conjugate, D-NAC (compound 28c), as a grayish-white solid (1.54 g).

[0407] Preparation of compound 36: Compound 25 (94.8 mg, 0.41 mmol) was dissolved in 1.0 mL of anhydrous DMF, and DMAP (25.2 mg, 0.21 mmol) and pyBOP (322.7 mg, 0.62 mmol) dissolved in 3.0 mL of anhydrous DMF were added to the clear solution. After stirring the reaction mixture at 0 °C for 30 min, G6-OHPAMAM dendritic polymer (200.0 mg, 3.44 μmol) dissolved in 2.0 mL of anhydrous DMF was added, and the reaction was stirred at room temperature for 2 days. The crude product was then dialyzed relative to DMF to remove byproducts and excess reactants, followed by precipitation in diethyl ether to remove DMF. The finally purified product was redissolved in H2O, lyophilized, and yielded a yellow compound (240.0 mg).

[0408] D-NAC d Preparation of the ester linker (28d): Compound 36 (200 mg, 5.02 μmol) was dissolved in 3.0 mL of anhydrous DMF, and then NAC (54.6 mg, 0.334 mmol) dissolved in 2.0 mL of anhydrous DMF was added to a round-bottom flask. The reaction mixture was stirred at room temperature for 24 hours. All volatiles were then evaporated, and the crude product was purified by dialysis relative to DMF to remove byproducts and excess reactants, followed by dialysis with water to remove all organic solvents. Finally, it was lyophilized to give a pale yellow compound (180.0 mg).

[0409] Preparation of D-NAC-NAC (Compound 37): NAC dimer (363 mg, 1.12 mmol), EDC (300 mg, 1.562 mmol), and DMAP (136 mg, 1.114 mmol) were added to a stirred solution of Compound 21 (400 mg, 0.027 mmol) in DMF (10 mL). The reaction mixture was stirred at 40 °C for 48 hours. The reaction mixture was transferred to a 1000-count dialysis bag and dialyzed against DMF for 24 hours, followed by dialyzed against water for 24 hours, with the solvent changed periodically every 2 to 3 hours. The contents of the dialysis tube were transferred to a pre-weighed 50 mL Falcon tube and lyophilized to obtain D-NAC-NAC conjugate 37 as a pale yellow powder.

[0410] Preparation of compound 38: N-acetylcysteine ​​was reacted with excess 2,2'-dithiodipyridine in methanol overnight, and the crude product was purified by column chromatography using an ethyl acetate:hexane (90:10) elution system. 1 The purified pale yellow compound (compound 38) was characterized by 1H NMR spectroscopy.

[0411] Preparation of compound 39: Compound 38 (919.64 mg, 3.38 mmol) was dissolved in 4.0 mL of anhydrous DMF, and DMAP (206.27 mg, 1.69 mmol) and pyBOP (2.64 g, 5.07 mmol) dissolved in 8.0 mL of anhydrous DMF were added to the clear solution. After stirring the reaction mixture at 0 °C for 30 min, G4-PAMAM dendritic polymer (0.40 mg, 28.14 μmol) dissolved in 8.0 mL of anhydrous DMF was added, and the reaction was continued at room temperature for 3 days. The crude product was then diluted with DMF and dialyzed relative to DMF to remove byproducts and excess reactants, followed by purification with H2O to remove any organic solvents. The final purified product was lyophilized to obtain a pale yellow solid (358.0 mg) (theoretical molecular weight of the product: 20319 gmol-1, NAC / PAMAM #: 24, NAC% (w / w): 19.2, purity % derived from HPLC: 90.64, Hd: 2.38 ± 0.26 nm, PDI: 0.74, zeta potential: 4.41 ± 0.61 mV).

[0412] Preparation of D-NAC-NAC (Compound 40): Compound 39 (300.0 mg, 14.76 μmol) and N-acetylcysteine ​​(115.6 mg, 0.71 mmol) were dissolved in 15.0 mL of DMF. After stirring at room temperature for 24 hours, the reaction mixture was diluted with DMF and dialyzed relative to DMF to remove excess free drug molecules, and then purified with H2O to remove any organic solvent. After precipitation of the product in cold diethyl ether, the final dendritic polymer-drug conjugate was lyophilized to obtain a pale yellow solid (Compound 40) (250.0 mg). The theoretical molecular weight of the product: 21568 gmol-1, NAC / PAMAM #: 48, NAC% (w / w): 36.3, purity % derived from HPLC: 98.47, Hd: 4.90 ± +0.24 nm, PDI: 0.48, zeta potential: 3.64 ± +1.14 mV.

[0413] result

[0414] Dendritic polymer-NACs are undergoing clinical translation. To meet preclinical / clinical needs, highly optimized and systematic synthetic protocols are required that can produce kilogram-scale quantities of D-NACs with high reproducibility, purity, and yield with a minimal number of reaction steps. In this example, a scalable protocol for D-NAC synthesis (Strategy 1) is described. It has been validated in academic research laboratories at the 10-gram scale and in kilogram-scale by contract research laboratories. Furthermore, several other convenient and readily available synthetic methods for constructing modified D-NACs in linkers on dendritic polymers have been developed (Strategies 2 through 6).

[0415] Strategy 1: D-NAC via ester linkers

[0416] The goal was to develop and design a near-perfect synthetic route with the potential to reduce costs at multiple levels. A scalable method for the synthesis of D-NAC (Scheme 7) was developed and validated, and has been transferred to a potential cGMP manufacturer. This synthetic route: (1) reduces synthesis time by half, (2) uses "manufacturability-friendly" solvents and reagents, and (3) improves purity and reduces solvent usage.

[0417] One of the most expensive components of the synthetic scheme is the synthesis of the dendritic polymer (e.g., the fourth-generation PAMAM dendritic polymer), and there is some yield loss of the dendritic polymer during purification at each synthetic step. To overcome this loss, the number of reaction steps on the dendritic polymer in the scheme is minimized. Half of the reaction steps involve the synthesis of small molecules, which is indeed less complex and more expensive than dealing with dendritic polymers.

[0418] D-NAC is a conjugate of a fourth-generation hydroxyl-terminated PAMAM dendrimer covalently conjugated to NAC molecules linked via disulfide bonds. D-NAC contains an average of 22 ± 3 NAC molecules linked to the dendrimer. The synthesis proceeds in a semi-polymeric manner and involves the construction of two main intermediates: 1) a bifunctional dendrimer (compound 23, scheme 7); 2) an NAC-SPDP-NHS(N-acetyl-S-((3-((2,5-dioxopyrrolidone-1-yl)oxy)-3-oxopropyl)thio)cysteine) linker (compound 27, scheme 7). The final step involves suturing these two intermediates to produce the final conjugate (compound 28).

[0419] More specifically, during the first step, a BOC-protected bifunctional dendritic polymer (compound 22) was constructed using an esterification reaction in the presence of BOC-GABA-OH and coupling agents (EDC and DMAP). Integration from different regions within the conjugate was compared. 1¹H NMR revealed linkages of 22 to 25 linkers. Deprotection of BOC using anhydrous dichloromethane (DCM) containing 25% trifluoroacetic acid (TFA) yielded bifunctional dendritic polymers (compound 23) with 22 to 25 terminal amines. Proton NMR clearly showed the disappearance of the peak corresponding to the BOC protons.

[0420] On the other hand, the synthesis of the NAC-SPDP-NHS-linker (compound 27) was achieved in three steps. First, 3-mercaptopropionic acid was reacted with 2,2'-dipyridyl disulfide (compound 24) via thiol-disulfide exchange to give 2-carboxyethyl 2-pyridyl disulfide (compound 25). Subsequently, N,N'-dicyclohexylcarbodiimide was esterified with N-hydroxysuccinimide to introduce a highly reactive N-succinimide ester, thereby giving compound 26. Finally, N-acetylcysteine ​​was added via thiol-disulfide exchange to generate N-acetyl-S-((3-(((2,5-dioxopyrrolidone-1-yl)oxy)-3-oxopropyl)thio)cysteine ​​(compound 27).

[0421] During the final ligation step, a bifunctional amine-terminated dendritic polymer (compound 23) and activated NAC-SPDP-NHS (compound 27) were coupled using Hunig's base at pH 7.5 to 8 to generate D-NAC (compound 28). 1 All intermediates and the final conjugate were well characterized by 1H NMR and mass spectrometry (LCMS / MALDI-ToF). The purity of the intermediates and the final D-NAC conjugate was obtained by HPLC. The size of the D-NAC was 5.649 nm, as measured by dynamic light scattering, and the neutral zeta potential of this conjugate was 3.92 ± 1.18 mV.

[0422]

[0423] Scheme 7: Key steps in the synthetic route of D-NAC (compound 28). Reagents and conditions: (i) EDC, DMAP, DMF, 36 h, RT, 85%; (ii) DCM:TFA (3:1), RT, 12 h, quantitative yield; (iii) 3-mercaptopropionic acid, acetic acid, anhydrous ethanol, 2 h, RT, 78%; (iv) DCC, N-hydroxysuccinimide, DCM, 0 °C to RT, 3 h, 82%; (v) N-acetyl-L-cysteine, anhydrous THF, 2 h, 65%; (vi) N,N-diisopropylethylamine, pH 7.5, DMF, RT, 24 h, 90%.

[0424]

[0425] Scheme 8. Previous strategies for D-NAC synthesis.

[0426] Reproducibility of NAC load

[0427] The first step in the previous scheme (Scheme 8) used Fmoc-γ-Abu-OH, which required deprotection under alkaline conditions (piperidine / DMF). This deprotection step was critical and affected the final drug loading efficiency. Because the ester bond between the dendritic polymer and the linker is readily hydrolyzed under alkaline conditions, excess piperidine / DMF used for deprotection also led to partial cleavage of the linker, resulting in inconsistencies in the final drug loading across different batches. In the newly developed method (Scheme 9), Fmoc-γ-Abu-OH is replaced with BOC-GABA-OH. The BOC protecting group can be easily removed under mildly acidic conditions using DCM containing 25% TFA, thus preserving the integrity of the ester bond. This step was reproduced several times on a 10g scale, with consistent results showing no ester hydrolysis.

[0428] shorten synthesis time

[0429] Previous methods for synthesizing D-NAC involved three steps: dialysis relative to DMF for at least 24 hours, followed by dialysis with water for an additional 24 hours after each step (fmoc-γ-Abu-OH conjugation, fmoc-deprotection, and NAC conjugation) to remove excess reagents and byproducts. In the newly developed method, this requires only one step: dialysis relative to both DMF and water (the final step after NAC-SPDP conjugation). Furthermore, in the previous strategy, each step was performed on a dendritic polymer. Each step on the dendritic polymer required at least two days of dialysis, followed by two days of lyophilization, resulting in a synthesis timeframe of three to four weeks. However, in the new method, the SPDP-NAC linker is synthesized individually within hours. This significantly reduces the synthesis time to 7 to 10 days.

[0430] Economic and industrial friendly solutions

[0431] In previous schemes, excessive linkers were required for high loading to compensate for ester hydrolysis during the deprotection step. The improved method is more robust and does not require high linker loading because there is no linker hydrolysis during the deprotection step, thus saving costs. Furthermore, since there is only one step in the new scheme requiring DMF dialysis, the synthesis is more environmentally friendly, economical, and industrially friendly. Dendritic polymers are the most expensive material in the synthesis. Each dialysis step results in some dendritic polymer loss. In the new scheme, the number of synthetic steps on the dendritic polymer is reduced, leading to lower costs.

[0432] Strategy 2: D-NAC via ether linkers and copper-free thiol-ene click chemistry

[0433] In the search for simplified chemistry to prepare dendritic polymer-NAC conjugates, highly robust chemical transformations are sought, such as thiol-ene clicks, thiol-alkyne clicks, or copper-catalyzed alkyne-azide clicks (Sharma, R et al., Chemical Communications, 2014, 50, 13300; Sharma, R et al., Polymer Chemistry, 2014, 5, 4321; Sharma, R et al., Polymer Chemistry, 2015, 6, 1436; Sharma, R et al., Nanoscale, 2016, 8, 5106; Sharma, A et al., Progress in RSC, 2014, 4, 19242; Sharma, A et al., ACS). Click chemistry has revolutionized the field of synthetic chemistry over the past decade and has made significant contributions to the construction of highly complex polymer structures and dendritic structures. (See Macro Letters, 2014, 3, 1079; Sharma, R et al., Macromolecule, 2011, 44, 521; and Nguyen, PT et al., RSC Progress, 2016, 6, 76360).

[0434] In the next attempt, a photochemical-thiol-ene click reaction was used to eliminate the ester linkages that connect the linker to the dendritic polymer via this reaction in the first step of Strategy 1. Although the ester bond on the dendritic polymer surface is blocked and not easily cleaved by esterases, it is desirable to develop a more robust conjugate with indestructible bonds other than the cleavable disulfide bond. To this end, the linker is conjugated to the dendritic polymer via an indestructible ether bond in the first step (Scheme 9). The ether bond is robust, does not undergo hydrolysis, and is not a substrate for esterases.

[0435] More specifically, G4-OH (compound 21) reacts with allyl bromide in the presence of sodium hydride. The number of linkers conjugated on the dendritic surface is readily calculated by proton NMR through a comparative integral of the BOC protons of the linker with the internal amide protons of the dendritic polymer. The BOC is then deprotected using TFA under similar conditions as described in Strategy 2 to yield a bifunctional ether-linked dendritic polymer (compound 30). Proton NMR clearly reveals the disappearance of the BOC protons in the spectrum. The bifunctional dendritic polymer conjugate, compound 30, is ultimately reacted with the SPDP-NAC-linker (compound 27) to yield a D-NAC with ether bonds on the dendritic surface. a (Compound 28a). Through... 1 All intermediates and final conjugates were characterized by 1H NMR and HPLC.

[0436] The presence of ether bonds in the conjugate is highly stable and does not interfere with the release of NAC. Furthermore, the use of ether bonds instead of ester bonds may improve the stability of the conjugate and thus its shelf life.

[0437]

[0438] Scheme 9: Key steps in the synthetic pathway of D-NACa via ether linker (8a). Reagents and conditions: (i) allyl bromide, NaH, DMF, 24 h; (ii) BOC-aminoethanethiol, DMPAP, UV, RT, 24 h, quantitative yield; (iii) DCM, TFA, RT, 24 h; (iv) N,N-diisopropylethylamine, pH 7.5, DMF, RT, 24 h.

[0439] Strategy 3: D-NAC via amide linkers (no GABA linkers)

[0440] The synthesis of D-NAC described in Strategy 1 is efficient in terms of scalability and provides readily available bulk materials. Simultaneously, an important objective is to develop a perfect synthetic design that has the potential to reduce costs at multiple levels. To minimize the number of reaction steps on the dendritic polymer and to reduce the total number of reaction steps, Strategy 3 (Scheme 10) was designed. In this strategy, a fully polymeric approach is used; wherein the SPDP-NAC-linker (compound 27) is directly conjugated to a commercially available bifunctional dendritic polymer in a single synthetic step without a GABA linker. The amine is an intrinsic part of the dendritic polymer surface. The main advantages of this method include a significant reduction in the number of reaction steps, with most of the reaction steps involving the synthesis of relatively inexpensive small molecules. Only one reaction step exists on the dendritic polymer. The SPDP-NAC linker (7) was synthesized as previously described in this report, and further, the amino groups of a commercially available bifunctional PAMAM dendrimer (60% OH / 40% NH2, compound 32) were reacted in DMF at pH 7.5 to give the desired dendrimer-NAC conjugate, compound 28b. All intermediates and the final compound were extensively characterized using NMR spectroscopy, high-resolution mass spectrometry, HPLC, and MALDI-TOF mass spectrometry.

[0441]

[0442] Option 10: D-NAC b (Compound 28b) Key steps in the synthetic pathway without the GABA linker. Reagents and conditions: (i) N,N-diisopropylethylamine, pH 7.5, DMF, RT, 24 h.

[0443] Strategy 4: D-NAC via carbonate linkers (no GABA linkers)

[0444] In another attempt to improve the synthesis of dendritic polymer-NAC, 2-pyridyl dithioethyl carbonate (PDEC) was used as a linker to construct D-NAC. c (Strategy 4). This novel method for synthesizing D-NAC (compound 28c) has several advantages. The scheme eliminates the use of SPDP crosslinking agents. Although SPDP is widely used for bioconjugation, it is economically disadvantageous for large-scale synthesis ($4,500 / 5-g, according to Toronto Research Chemicals). PDEC linkers are used because they can be readily synthesized using cheaper reagents. Aldrithiol is reacted with mercaptoethanol to obtain compound 33 (Scheme 11). The hydroxyl focus of compound 33 is reacted with 4-nitrobenzene chloroformate to obtain compound 34, which reacts directly with PAMAM-OH to link the linker via carbonate bonds on a dendritic polymer (compound 35). Finally, NAC is introduced via a disulfide exchange reaction (compound 28c).

[0445]

[0446] Option 11: D-NAC c (Compound 28c) Key steps in the synthetic pathway via carbonate linkers. Reagents and conditions: (i) 2-mercaptoethanol, anhydrous methanol, 3 h, RT, 75%; (ii) 4-nitrobenzenechloroformate, pyridine, anhydrous DCM, 24 h, RT, 76%; (iii) DMAP, anhydrous DMF, 48 h, 40 °C; (iv) N-acetyl-L-cysteine, anhydrous DMF, 24 h, RT.

[0447] Strategy 5: D-NAC via ester linkers (no GABA linkers)

[0448] To reduce the number of steps and reagents and thus lower costs, compound 25 was used directly as a linker. Instead of conjugating GABA-BOC-OH as described in Strategy 1 and then deprotecting it to obtain a free amine, the pyridine disulfide linker (compound 25) was directly reacted via ester bonds on the dendritic polymer to give compound 36 (Scheme 12). Compound 36 was then subjected to a sulfide exchange reaction with NAC to obtain a GABA-free ester-linked dendritic polymer-NAC conjugate (D-NAC). d(Compound 28d). This strategy significantly reduces the number of synthetic steps in the scheme, thus reducing time and making the synthetic method more economical.

[0449]

[0450] Option 12: D-NAC d (8d) Key steps in the synthetic pathway via ester linkers. Reagents and conditions: (i) PyBOP, DMAP, anhydrous DMF, 2 days, 0°C to RT; (ii) N-acetyl-L-cysteine, anhydrous DMF, 24 hours, RT.

[0451] Strategy 6: D-NAC-NAC (Direct Combination)

[0452] To increase NAC loading while maintaining the inherent targeting capability of the dendritic polymer (using minimal surface hydroxyl groups for conjugation), a strategy was designed and developed to link two NAC molecules to hydroxyl sites on each dendritic polymer (Scheme 13). This strategy has several advantages: 1) using a similar number of hydroxyl groups on the dendritic polymer, the NAC loading can be doubled; 2) half of the NAC molecules are conjugated via glutathione-sensitive disulfide bonds, while the other half are linked via ester bonds that require esterase hydrolysis to release the free drug. This may result in sustained release of NAC. To construct D-NAC-NAC, N,N'-diacetyl-L-cysteine ​​(NAC dimer) was directly conjugated to the surface of the hydroxyl groups via ester bonds using EDC and DMAP to obtain D-NAC-NAC (Compound 37), wherein half of the NAC molecules are conjugated via ester bonds on the surface of the dendritic polymer, and the other half are conjugated to another NAC molecule via disulfide bonds.

[0453]

[0454] Scheme 13: Key steps in the synthetic pathway of D-NAC-NAC. Reagents and conditions: (i) N,N'-diacetyl-L-cysteine, EDC, DMAP, DMF, 48 hours

[0455] Strategy 7: D-NAC-NAC

[0456] Another synthetic route for D-NAC-NAC was developed (Scheme 14). NAC was reacted with aldrithiol (compound 24) via a disulfide exchange reaction to yield compound 38. The free groups of NAC in compound 38 were then reacted with the hydroxyl groups of the dendritic polymer to form an ester bond in the conjugate (compound 39). The conjugate, compound 39, was then reacted with another NAC molecule via a second disulfide exchange reaction to yield the final conjugate D-NAC-NAC (compound 40).

[0457]

[0458] Scheme 14: Key steps in the synthetic pathway of D-NAC-NAC. Reagents and conditions: (i) N-acetyl-L-cysteine, anhydrous methanol, 3 h, RT, 75%; (ii) PyBOP, DMAP, anhydrous DMF, 3 days, 0oC-RT; (iii) N-acetyl-L-cysteine, anhydrous DMF, 24 h, RT.

[0459] The synthetic scheme designed here for constructing D-NAC is highly robust and reproducible, involves industrially friendly solvents, and readily provides rapid synthesis of the final conjugate. The improved synthesis of D-NAC also allows for the production of D-NACs with additional linking and structural units. sequence list <110> Johns Hopkins University <120> Dendritic polymer delivery systems and their applications <130> JHU C 14798 PCT <150> 62 / 584,623 <151> 2017-11-10 <160> 18 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 1 ccagtgtggg aagctgtctt 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 2 aagcaaaaga ggaggcaaca 20 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 3 tccagttgcc ttcttgggac 20 <210> 4 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 4 gtgtaattaa gcctccgact tg 22 <210> 5 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 5 tcatggaagt gaacccaact cttg 24 <210> 6 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 6 tcagtccctg gcttatggtt acc 23 <210> 7 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 7 tgtagggctt ccaaggt 17 <210> 8 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 8 gaaagagtct ctgcagctc 19 <210> 9 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 9 tgtcgtggag tctactggtg tcttc 25 <210> 10 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 10 cgtggttcac acccatcaca a 21 <210> 11 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 11 tagtagcaaa cccgcaagtg 20 <210> 12 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 12 ctgaagagaa cctgggagta ga 22 <210> 13 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 13 tgccaaccct acaacaagag 20 <210> 14 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 14 aaagttctca ggccgtcatc 20 <210> 15 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 15 catcaaggag ctgaggaaag ag 22 <210> 16 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 16 ccttggaagg tgcagattga 20 <210> 17 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 17 tgacgacatc aagaaggtgg tg 22 <210> 18 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> 18 gaaggtggag gagtgggtgt c 21

Claims

1. A composition comprising a dendritic polymer, comprising: Central core, one or more branching units, and terminal functional groups. The central core is prepared from dipentaerythritol; The one or more branched units comprise linear polyethylene glycol; The dendritic polymer comprises 60 terminal functional groups, wherein the terminal functional groups contain a plurality of hydroxyl (OH) groups; The surface density of the hydroxyl groups in the dendritic polymer is at least 3 OH groups / nm. 2 It is measured through dynamic light scattering; The dendritic polymer mentioned above is a second-generation dendritic polymer. One or more preventive, therapeutic, or diagnostic agents are encapsulated in, associated with, and / or conjugated to the dendritic polymer, and the dendritic polymer is selectively taken up by activated macrophages and microglia.

2. The composition according to claim 1, wherein the dendritic polymer is shown in the following formula: 。 3. The composition according to claim 1, wherein the central core is prepared from alkyne-modified dipentaerythritol.

4. The composition according to claim 1, wherein the one or more branching units are prepared from one or more supermonomers.

5. The composition according to claim 4, wherein the one or more supermonomers is an AB5 orthogonal supermonomer, the orthogonal supermonomer comprising an azide functional group and five allyl groups, the orthogonal supermonomer being prepared by reacting dipentaerythritol having five allyl groups with a monotoluenesulfonated triethylene glycol azide.

6. The composition according to claim 1, wherein the surface density of the hydroxyl groups of the dendritic polymer is between 5 and 20 OH groups / nm. 2 between.

7. The composition according to claim 1, wherein the surface density of the hydroxyl groups of the dendritic polymer is at least 7 OH groups / nm. 2 .

8. The composition of claim 1, wherein the molecular weight of the dendritic polymer is between 500 Daltons and 100,000 Daltons.

9. The composition of claim 1, wherein the molecular weight of the dendritic polymer is between 500 Daltons and 50,000 Daltons.

10. The composition of claim 1, wherein the molecular weight of the dendritic polymer is between 1,000 Daltons and 10,000 Daltons.

11. The composition of claim 1, wherein the dendritic polymer is in the form of dendrites.

12. The composition of claim 1, wherein the dendritic polymer is further organized into a core-shell structured dendritic polymer.

13. The composition of claim 1, wherein the one or more preventive agents, therapeutic agents and / or diagnostic agents are encapsulated in, associated with and / or conjugated to the dendritic polymer at a concentration between 0.01% and 30% by weight.

14. The composition of claim 1, wherein the one or more preventive agents, therapeutic agents and / or diagnostic agents are encapsulated in, associated with and / or conjugated to the dendritic polymer at a concentration between 1% and 20% by weight.

15. The composition of claim 1, wherein the one or more preventive agents, therapeutic agents and / or diagnostic agents are optionally covalently conjugated to the dendritic polymer via one or more spacers.

16. The composition of claim 1, wherein the one or more preventive agents, therapeutic agents and / or diagnostic agents are covalently conjugated to the dendritic polymer via one or more bonds selected from the group consisting of: disulfides, esters, ethers, thioesters, carbamates, carbonates, hydrazines and amides.

17. The composition of claim 15, wherein the spacer is a preventative agent, a therapeutic agent, and / or a diagnostic agent.

18. The composition of claim 17, wherein the spacer is N-acetylcysteine.

19. The composition of claim 1, wherein the one or more therapeutic agents are selected from the group consisting of: anti-inflammatory agents, chemotherapeutic agents, vasodilators, and anti-infective agents.

20. The use of the composition according to claim 1 in the preparation of a medicament for treating, preventing and / or imaging one or more diseases, symptoms and / or injuries of the eye, brain and / or nervous system.

21. The application of claim 20, wherein the one or more diseases, symptoms and / or injuries of the eye, the brain and / or the nervous system are diseases, symptoms or injuries associated with activated microglia and astrocytes, and the dendritic polymer targets the activated microglia and astrocytes.

Citation Information

Patent Citations

  • Dendrimers for sustained release of compounds

    US20110034422A1

  • Dendrimer based nanodevices for therapeutic and imaging purposes

    US20120003155A1

  • Injectable dendrimer hydrogel nanoparticles

    US20130136697A1

  • Dendrimer based nanodevices for therapeutic and imaging purposes

    US8889101B2

  • Dendritic polymers with enhanced amplification and interior functionality

    CN101443048A