Engineered chimeric guide rnas and uses thereof

Abstract

The present invention relates to engineered chimeric guide RNAs and their use in systems and methods for interfering with gene expression in eukaryotic cells. Furthermore, the present invention also relates to methods of making modified T cells using the engineered chimeric guide RNAs of the present application, as well as the modified T cells obtained. Also included are methods for adoptive therapy and treating conditions, such as cancer, infection or autoimmune disease, and pharmaceutical compositions comprising the modified T cells.

Description

Technical Field

[0001] This invention relates to engineered chimeric guide RNAs and their use in systems and methods for altering gene expression in eukaryotic cells for gene correction or disease treatment. Furthermore, the invention relates to methods for preparing modified T cells using the engineered chimeric guide RNAs of this application, and the resulting modified T cells, particularly non-allogeneic T cells for immunotherapy. It also includes methods for adoptive therapy and treatment of conditions such as cancer, infection, or autoimmune diseases, and pharmaceutical compositions comprising modified T cells. Background Technology

[0002] For over a century, immunology has been widely used to treat malignancies, employing methods such as monoclonal antibodies (mAbs), bispecific antibodies, tumor vaccines, immune checkpoint blockade, dendritic cells (DCs), cytokine-induced killer (CIK) cells, tumor-infiltrating lymphocytes (TILs), and more recently, chimeric antigen receptor T cells (CART). Among these approaches, adoptive immunotherapy, involving the transfer of ex vivo-generated autologous antigen-specific T cells, is a promising and rapidly developing strategy for treating viral infections and cancer. T cells used in adoptive immunotherapy can be generated by expanding antigen-specific T cells or by reprogramming and reorienting T cells through genetic reprogramming.

[0003] Transfer of virus antigen-specific T cells is a recognized approach for treating transplant-associated viral infections and rare virus-associated malignancies. Similarly, the isolation and transfer of tumor-specific T cells has been shown to successfully treat melanoma. Furthermore, T cell specificity has been successfully reoriented through genetic transfer of transgenic T cell receptors (TCRs) or chimeric antigen receptors (CARs). CAR-based immunotherapy has made significant progress in hematologic malignancies, including various leukemias and lymphomas, and may eventually be used to treat solid tumors (Maus et al., 2014). CARs contain extracellular single-stranded variants (ScFvs) specific to tumor cell antigens, co-stimulatory domains (CD28, 41BB, OX40, CD40, etc.), and intracellular signaling domains that drive T cell activation and kill tumor cells (Gross et al., 1989; Irving and Weiss, 1991; Maher et al., 2002; Brentjens et al., 2003; Carpenito et al., 2009). To date, the best CAR-T cell therapies involve targeting CD19, an antigen expressed by B cells and B-cell malignancies. Kymriah (CTLo19), a breakthrough immunocellular therapy for children and adolescents in dire need of new options, received FDA approval in August 2017, followed by Yescarta, a second personalized CAR-T cell therapy for diffuse large B-cell lymphoma (DLBCL), which received FDA approval in November 2017. Recent clinical studies of CAR-T cells targeting B-cell maturation antigen (BCMA) conducted by Bluebird Bio and Legend have yielded very high response rates. Several other CAR-T adoptive immunotherapies targeting solid tumor antigens such as Her2 / neu, mesothelin, c-Met, GD2, interleukin-13 receptor α2 (IL13Rα2), CEA, and EGFR are currently being evaluated at different phases of clinical trials.

[0004] Currently, most CAR-T therapies are based on the preparation of autologous T cells, which may be limited by poor T cell quality and quantity, as well as the time and cost of preparing autologous T cell products. CAR-T cell therapy can greatly benefit from universal donor T cells from allogeneic sources, as "off-the-shelf" cells can significantly increase the number of patients who can be treated with a single CAR-T cell product and shorten the time required for CAR-T cell preparation. However, endogenous TCRs on allogeneic T cells can recognize allogeneic antigens in the recipient, leading to graft-versus-host disease (GVHD). Furthermore, HLA expressed on the surface of allogeneic T cells causes rapid rejection by the host immune system. In this context, ZFN, TALEN, and CRISPR have been used to knock out endogenous T cell receptor genes in T cells, which can prevent undesirable graft-versus-host reactions (Provasi et al., 2012; Torikai et al., 2012; Poirot et al., 2015). Genome editing strategies can also be used to prevent or delay rejection of CAR-T cells by the recipient immune system by eliminating or reducing the expression of histocompatibility antigens on donor T cells. Other approaches have been developed, including knocking out antibodies or chemotherapy-sensitive genes (such as CD52 or dCK) for the proliferation of drug-resistant CAR-T cell populations.

[0005] Although ZFNs and TALENs have been used to eliminate endogenous TCRs and related genes, the overall gene knockout efficiency is far from ideal. Furthermore, the design of ZFNs and TALENs is complex and time-consuming: the function of ZFNs and TALENs requires a pair of effector proteins, making multiplex genome editing difficult; chromosomal translocations associated with TALEN gene editing in the universal CART19 (UCART19) cells used by Cellectis in its clinical studies pose a serious problem and could lead to undesirable tumorigenesis; last but equally important, the purification costs resulting from low gene editing efficiency make TALENs unsuitable for UCART cell production. Given these difficulties, their potential for large-scale genome manipulation is limited.

[0006] Recently, a novel genome engineering tool has been developed based on components of type II prokaryotic CRISPR (Clustered Regularly Interspaced Short Paraindromic Repeats). CRISPR technology originates from the type II CRISPR system, which provides bacteria with adaptive immunity to viruses, plasmids, and other exogenous nucleic acids (Barrangou et al., 2007; Horvath and Barrangou, 2010; Wiedenheft et al., 2012). The type II CRISPR system integrates sequences from invading DNA between CRISPR repeat sequences encoded as arrays within the bacterial host genome. Transcripts from the CRISPR repeat arrays are processed into CRISPR RNA (crRNA) (Deltcheva et al., 2011), each containing a variable sequence transcribed from the invading DNA (called the “protospacer” sequence) and a portion of the CRISPR repeat sequence. Each crRNA hybridizes with a second RNA called trans-activating CRISPR RNA (tracrRNA) (Deltcheva et al., 2011), and these two RNAs form a complex with the Cas9 DNA endonuclease (Jinek et al., 2012). If they are adjacent to a short sequence called a protospacer neighbor motif (PAM), the protospacer coding portion of the crRNA guides Cas9 to the complementary target DNA sequence and cleaves the DNA. The type II CRISPR system from *Streptococcus pyogenes* has been adapted for inducing sequence-specific double-strand breaks (DSBs) and targeted genome editing. In 2012, Jinek et al. first demonstrated that the Cas9 protein (SpCas9) from *Streptococcus pyogenes* can bind to the tracrRNA-crRNA RNA complex and induce DSBs in the target DNA sequence in vitro via Watson-Crick base pairing between the crRNA and the target DNA (Jinek et al., 2012). This study also showed that guiding Cas9 to bind to and cleave specific DNA sequences does not require an RNA complex. This process can be easily achieved by using designed chimeric single guide RNAs (sgRNAs). In 2013, two groups from MIT and Harvard demonstrated the feasibility of using the CRISPR / Cas9 system for human cell genome editing (Cong et al., 2013; Mali et al., 2013b).These findings paved the way and ushered in a new era for the application of CRISPR / Cas9 in genome engineering, including gene editing and gene expression regulation, epigenetic modification, and genome imaging (Cheng et al., 2013; DiCarlo et al., 2013; Gilbert et al., 2013; Hwang et al., 2013; Li et al., 2013; Maeder et al., 2013; Nekrasov et al., 2013; Perez-Pinera et al., 2013; Qi et al., 2013; Shen et al., 2013; Wang et al., 2013; Tanenbaum et al., 2014; Chavez et al., 2015; Hilton et al., 2015; Kearns et al., 2015; Konermann et al., 2015).

[0007] In previous studies, several groups reported using the CRISPR / Cas9 system to disrupt TCR, B2m, PD1, CTLA4, CCR5, CXCR4, Lag3, etc., in T cells, with efficiencies ranging from 7% to over 90% using different protocols. CRISPR could significantly advance CAR-T cell therapy in several ways. In fact, the National Institutes of Health (NIH) Recombinant DNA Advisory Committee (RAC) recently approved a clinical trial to be conducted at the University of Pennsylvania. In this clinical trial, PD1 and endogenous TCR will be knocked out in NY-ESO-1TCR-transduced T cells using CRISPR / Cas9. The first clinical trial of CRISPR / Cas9 has already been initiated. This trial used CRISPR / Cas9 to knock out PD1 in T cells from lung cancer patients; however, CAR or TCR will not be introduced into T cells in this trial (Cyranoski, 2016). Scientists are seeking to introduce CAR via HDR to eliminate the need for random integration of viral delivery systems and to control where CAR is integrated. A recent study showed that targeting the TRAC site with CAR significantly enhanced antitumor activity by reducing tetanic activation (Sadelain et al., 2011; Kalos and June, 2013).

[0008] In addition to type II CRISPR, a new type V CRISPR has been discovered in recent years. To date, experimentally tested type V CRISPR systems include those using the following effector proteins, which have been renamed Cas12a-e: Cas12a (also known as Cpf1; isotype VA), Cas12b (also known as C2c1; isotype VB), Cas12c (also known as C2c3; isotype VC), Cas12d (also known as CasY; isotype VD), and Cas12e (also known as CasX; isotype VE), all of which are evolutionarily distinct from Cas9.

[0009] Similar to Cas9, the Cpf1 protein contains a conserved RuvC nuclease domain, known for its hydrolysis of single-stranded DNA (ssDNA). However, Cpf1 possesses distinct characteristics from Cas9. It is a single RNA-guided endonuclease that recognizes thymidine-rich protospacer adjacent motifs (PAMs) and generates staggered cuts distal to the PAM site (Zetsche B et al., 2015). This type V CRISPR / Cpf1 system has demonstrated robust genome editing activity in eukaryotic cells (Zetsche B et al., 2015; Kim D et al., 2016) as well as in animals (Hur JK et al., 2016), plants (Endo A et al., 2016; Hu X et al., 2017; Kim H et al., 2017; Tang X et al., 2017; Xu R et al., 2017) and bacteria (Ungerer J et al., 2016; Jiang Y et al., 2017). Interestingly, Cpf1 is a dual nuclease that can not only cleave target DNA but also process its own CRISPR RNA (crRNA), and this processing of its own crRNA is carried out independently by the second catalytic domain of Cpf1 (Zetsche B et al., 2015; Fonfara I et al., 2016). Furthermore, crRNA maturation via Cpf1 does not require the assistance of trans-activated crRNA (tracrRNA). Due to these advantages, the Cpf1 system has recently been used for multiplex gene editing in eukaryotic cells (particularly plant cells), where Cpf1 simultaneously edits up to four genes using a single crRNA array spaced by mature direct repeat sequences (Zetsche B et al., 2017; Wang M et al., 2017).

[0010] In addition to differential selection of PAM sequences and multiplex gene editing of a single crRNA transcript, whole-genome deep sequencing shows that gene disruption via Cpf1 is very precise compared to the high off-target potential of Cas9 (Kim D et al., 2016; Kleinstiver BP et al., 2016). All these features make Cpf1 an ideal gene-modifying competitor to Cas9.

[0011] Although Cpf1 mediates efficient gene editing in eukaryotic cells, its overall activity is not as strong as that of Cas9 (Zetsche B et al., 2015; Kim D et al., 2016; Kleinstiver BP et al., 2016). Its application in primary cells, particularly in T cells, is significantly limited by the following fact:

[0012] - The low targeting efficiency of conventional crRNA and Cpf1 makes them difficult to apply to T cells;

[0013] - Introducing DNA into the cytoplasm can have an adverse effect on the quality and viability of T cells, as a high apoptosis rate can be observed when cells are transformed with DNA vectors.

[0014] Effective gene editing using the Cpf1 system requires stable expression of the Cpf1 protein in cells. However, for unknown reasons, prolonged expression of Cpf1 in living cells can lead to chromosomal defects and T cell apoptosis.

[0015] This application aims to provide solutions to these limitations in effectively interfering with gene expression in T cells. Surprisingly, the inventors have developed an engineered chimeric crRNA comprising caRNA, csRNA, and catRNA that, compared to conventional crRNAs, provides RNase resistance activity and higher gene editing efficiency in eukaryotic cells, particularly T cells, thereby enabling a simple approach to selective gene interference and a standard, affordable adoptive immunotherapy strategy.

[0016] Invention Summary

[0017] In a first aspect, the present invention relates to engineered chimeric guide RNA comprising: (1) at least one crRNA sequence; and (2) at least one additional direct repeat sequence or small RNA species, or both, wherein the crRNA sequence is capable of hybridizing to a target site, and the additional direct repeat sequence and / or small RNA species confers increased stability to the chimeric guide RNA. In one specific embodiment, the engineered chimeric guide RNA is caRNA, comprising at least one crRNA sequence and at least one direct repeat sequence. In one specific embodiment, the engineered chimeric guide RNA is csRNA, comprising at least one crRNA sequence and at least one small RNA species. In one specific embodiment, the engineered chimeric guide RNA is catRNA, comprising at least one crRNA sequence, at least one direct repeat sequence, and a small RNA species.

[0018] In one embodiment, the at least one crRNA sequence may be the same or different. In one embodiment, the at least one additional direct repeat sequence may be the same or different. In one embodiment, the at least one small RNA species sequence may be the same or different.

[0019] In one embodiment, the small RNA is selected from transfer RNA (tRNA), microRNA (mirRNA), Piwi-interacting RNA (piRNA), small interfering RNA (siRNA), small nucleolar RNA (snoRNA), tRNA-derived small RNA (tsRNA), small rDNA-derived RNA (srRNA), long non-coding RNA (lncRNA), small nuclear RNA (u-RNA), short hairpin RNA (shRNA), pre-tRNA, and messenger RNA (mRNA). Preferably, the small RNA is tRNA or pre-tRNA.

[0020] In one embodiment, the small RNA species is in a truncated form. Preferably, the small RNA species is a truncated form of pre-tRNA.

[0021] In a further embodiment, the engineered chimeric guide RNA further comprises an untranslated region (UTR), a poly-A and / or a 5'-methylguanosine cap.

[0022] In one specific implementation, the engineered chimeric guide RNA contains crRNA comprising at least one spacer sequence having a length of 10-30 bp, preferably 16-24 bp.

[0023] In one implementation, the engineered chimeric guide RNA targets one or more target sites, wherein the target sites are located in the same or different DNA sequences.

[0024] In one implementation, the engineered chimeric guide RNA exists in the form of a pool or array.

[0025] In a second aspect, the present invention relates to a CRISPR / Cpf1 system comprising:

[0026] (a) One or more engineered chimeric guide RNAs according to this application, or one or more polynucleotide sequences encoding engineered chimeric guide RNAs according to this application;

[0027] (b) Cpf1 protein or a functional variant thereof, or one or more polynucleotide sequences encoding Cpf1 protein or a functional variant thereof.

[0028] In one implementation, components (a) and (b) are polynucleotide sequences located on the same vector. Alternatively, components (a) and (b) are polynucleotide sequences located on different vectors.

[0029] In one embodiment, the system further comprises Mg 2+ Especially at concentrations of about 1 mM to about 15 mM.

[0030] In one embodiment, the Cpf1 protein or a functional variant thereof is derived from a bacterial species selected from the following: *Francisella tularensis* 1, *Francisella tularensis* subsp. Novicida, *Prevotella albensis*, *Lachnospiraceae* bacteria MC2017 1, *Butyrivibrio proteoclasticus*, *Peregrinibacteria* bacteria GW2011_GWA2_33_10, *Parcubacteria* bacteria GW2011_GWC2_44_17, *Smithella* sp. SCADC, *Acidaminococcus* sp. BV3L6, *Lachnospiraceae* bacteria MA2020, *Candidatus Methanoplasma termitum*, and *Eubacterium*. The *Cpf1* protein, or a functional variant thereof, is derived from *Eligens*, *Moraxella bovoculi* 237, *Leptospira inadai*, *Franciolus tularensis* ND2006, *Porphyromonas crevioricanis* 3, *Prevotella disiens*, and *Porphyromonas macacae*. Preferably, the Cpf1 protein or a functional variant thereof is derived from *Prevotella whiteensis* (PaCpf1), *Franciolus tularensis* ND2006 (LbCpf1), *Franciolus tularensis* subsp. *tularensis* (FnCpf1), or *AsCpf1* BV3L6.

[0031] According to this application, the engineered chimeric guide RNA hybridizes with a target sequence, wherein the target sequence is the 3' end of the protospacer adjacent motif (PAM). Preferably, the PAM contains a 5' T-rich motif.

[0032] Specifically, when the PAM sequence is TTN and N is A / C / G or T, the Cpf1 protein is FnCpf1; when the PAM sequence is TTTN and N is A / C or G, the Cpf1 protein is PaCpf1, LbCpf1 or AsCpf1.

[0033] In one implementation, the Cpf1 protein or a functional variant thereof contains one or more nuclear localization signals.

[0034] The present invention also covers cells or cell lines or their descendants comprising the systems described above according to the present invention.

[0035] In a third aspect, the present invention provides a method for modifying a target site, comprising delivering a CRISPR / Cpf1 system according to the invention to the site. Components (a) and (b) of the CRISPR / Cpf1 system are delivered together or separately.

[0036] The present invention also provides a method for altering the expression of at least one target gene, comprising introducing a CRISPR / Cpf1 system according to the invention into a cell containing the target gene. Components (a) and (b) of the CRISPR / Cpf1 system may be delivered together or separately.

[0037] In one embodiment, the target site is within a cell, such as a eukaryotic cell, like an animal, human, or plant cell. In another embodiment, the target site is contained within a DNA molecule outside the body.

[0038] In a fourth aspect, the present invention provides a method for preparing engineered T cells for immunotherapy, comprising the step of genetically modifying T cells by introducing and / or expressing a system in T cells, said system comprising at least:

[0039] -Cpf1 protein or a functional variant thereof, or one or more multinucleotide sequences encoding Cpf1 protein or a functional variant thereof;

[0040] - One or more engineered chimeric guide RNAs according to this application, or one or more polynucleotide sequences encoding engineered chimeric guide RNAs according to this application.

[0041] In one embodiment, the method for preparing engineered T cells further includes a step (b) of expanding the engineered T cells in vitro.

[0042] In one embodiment, the method for preparing engineered T cells further includes step (b) of transfecting the T cells with a chimeric antigen receptor (CAR). Specifically, step (b) is performed before, after, or simultaneously with step (a) of genetically modifying the T cells.

[0043] In one specific implementation, the T cells are derived from peripheral blood mononuclear cells (PBMCs) or umbilical cord blood. Preferably, the T cells are derived from inflammatory T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, or helper lymphocytes, especially CD4+ T lymphocytes and / or CD8+ T lymphocytes.

[0044] The present invention also provides engineered T cells, particularly allogeneic T cells, prepared according to the method described above.

[0045] In a further embodiment, the engineered T cell further comprises an exogenous recombinant polynucleotide encoding a CAR for specific cell recognition.

[0046] Specifically, the engineered T cells according to the invention are used as pharmaceutical composition products for the treatment or prevention of cancer, inflammation or autoimmune diseases, ideally as "off-the-shelf" products. Attached Figure Description

[0047] Figure 1 Examples of the structures of crRNA (A), caRNA (B), csRNA (C), and catRNA (D).

[0048] Figure 2 : A schematic diagram of using catRNA to destroy target DNA according to the present invention.

[0049] Figure 3 Gene destruction efficiency of targeting DNMT1(A), VEGFa(B), or GRIN2b(C) genes with single-guide RNA in eukaryotic cells. Error bars, SE. n=3. *, P<0.05, **, P<0.01, ***, P<0.001, ****, P<0.0001, determined by Mann-Whitney test.

[0050] Figure 4 : Schematic diagram of a catRNA pool or catRNA array used for co-activation of genes. Spa: Spacer region.

[0051] Figure 5 Gene activation was performed using the dCpf1-VP64 activator and a pool or array of guide RNAs. A and B: Locations of three target sites in the DNMT1 and VEGFa promoters, respectively. C and D: Expression of DNMT1 and VEGFa, respectively. Error bars, SE. n = 3. *, P < 0.05, **, P < 0.01, ***, P < 0.001, ****, P < 0.0001, determined by the Mann-Whitney test.

[0052] Figure 6 Effective gene activation was achieved using the dCpf1-VPR activator and targeting either the DNMT1 promoter (A) or the VEGFa promoter (B). Error bars, SE. n = 3. *, P < 0.05, **, P < 0.01, ***, P < 0.001, ****, P < 0.0001, determined by the Mann-Whitney test.

[0053] Figure 7 : Schematic diagram of a catRNA pool or catRNA array used for simultaneous gene activation. Spa: Spacer region.

[0054] Figure 8 Simultaneous activation of the DNMT1 and VEGFa genes using the dCpf1-VPR activator and a guide RNA pool or array. A. DNMT1 gene activation; B. VEGF1 gene activation. Error bars, SE. n=3. *, P<0.05, **, P<0.01, ***, P<0.001, ****, P<0.0001, determined by Mann-Whitney test.

[0055] Figure 9 Gene disruption was achieved using catRNAs with different spacer lengths. A. Disruption of the DNMT1 gene; B. Disruption of the VEGF1 gene. Efficiency was normalized relative to catRNAs with a 24-bp spacer. Error bars, SE. n = 3. *, P < 0.05, **, P < 0.01, ***, P < 0.001, ****, P < 0.0001, determined by Mann-Whitney test.

[0056] Figure 10 : Schematic diagram of a method for preparing genetically modified therapeutic T cells. A: Transfecting naive T cells with CAR and then performing gene editing via CRISPR; B: Performing gene editing on naive T cells via CRISPR and then transfecting with CAR; C: Performing gene editing and CAR transfection simultaneously in naive T cells.

[0057] Figure 11 Electroporation of guide RNA disrupts TRAC. A. Disruption efficiency of a single electroporation (i.e., simultaneous electroporation of Cpf1 mRNA and guide RNA); B. Disruption efficiency of two electroporations (i.e., electroporation of guide RNA followed by electroporation of Cpf1 mRNA). Error bars, SE. n=3. *, P<0.05, **, P<0.01, ***, P<0.001, ****, P<0.0001, determined by Mann-Whitney test.

[0058] Figure 12 Flow cytometry analysis of TRAC or TRBC-specific catRNAs and Cpf1 activity in T cells.

[0059] Figure 13 Flow cytometry analysis of CD52-specific catRNA and Cpf1 activity in T cells.

[0060] Figure 14 Flow cytometry analysis of TRAC / CD52 or TRBC / CD52-specific catRNAs and Cpf1 activity in T cells.

[0061] Figure 15 Flow cytometry analysis of B2m-specific catRNA and Cpf1 activity in T cells.

[0062] Figure 16 Flow cytometry analysis of TRAC / B2m or TRBC / B2m-specific catRNAs and Cpf1 activity in T cells.

[0063] Figure 17 Flow cytometry analysis of PD1-specific catRNA and Cpf1 activity in T cells.

[0064] Figure 18 : Target gene disruption of catRNA and Cpf1 protein in T cells from different donors. Invention Details

[0066] definition

[0067] The following definitions are provided to better define the present invention and to guide those skilled in the art in practicing it. Unless otherwise stated, the terms are to be understood according to their conventional usage by those skilled in the art.

[0068] The term "CRISPR" refers to clusters of regularly spaced short palindromic repeats. CRISPR was originally described as prokaryotic DNA fragments containing short, repetitive base sequences. In palindromic repeats, the nucleotide sequence is identical in both directions. Each repeat is followed by a short spacer DNA fragment derived from previously exposed foreign DNA (e.g., a virus or plasmid). A CRISPR site typically consists of a cluster of CRISPR-associated (Cas) genes and a characteristic CRISPR array—a series of repeat sequences (direct repeats) spaced by variable sequences (spacer regions) corresponding to sequences in the foreign genomic element (protospacer regions). When the Cas gene is translated into a protein, most CRISPR arrays are first transcribed into a single RNA, which is then processed into shorter CRISPR RNA (crRNA), which directs the nuclear hydrolytic activity of certain Cas enzymes to degrade the target nucleic acid.

[0069] The term "CRISPR / Cas system" refers to a prokaryotic immune system that confers resistance to foreign genomic elements (such as those present in plasmids and bacteriophages), providing a form of acquired immunity. Typically, a CRISPR / Cas system contains at least one Cas endonuclease and guide RNA. The RNA carrying the spacer sequence helps the Cas (CRISPR-associated) protein recognize and cleave foreign DNA. Therefore, when the Cas protein is Cpf1, the system is called the CRISPR / Cpf1 system.

[0070] The term "Cas9" refers to a Cas protein found in Streptococcus pyogenes. The Cas9 endonuclease is a four-component system consisting of two small RNA molecules called CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA).

[0071] The term "Cpf1" refers to an RNA-guided DNA endonuclease belonging to the class II VA subtype CRISPR system, derived from *Prevotella* and *Francisella* 1. The Cpf1 endonuclease includes a conserved RuvC nuclease domain, known for hydrolyzing single-stranded DNA (ssDNA), and a second catalytic domain responsible for the independent processing of its own crRNA. It has been reported that crRNA maturation via Cpf1 does not require the assistance of tracrRNA.

[0072] The term "guide RNA" or "gRNA" generally refers to an RNA molecule that guides a Cas endonuclease to a target site and specifically hybridizes with a complementary sequence within the target site, thereby causing a double-strand break at the target site under the action of the endonuclease. gRNA includes, but is not limited to, crRNA, sgRNA, and other chimeric guide RNAs, such as caRNA, csRNA, and catRNA according to the present invention.

[0073] In a typical CRISPR system, the guide RNA is a crRNA, which generally consists of a direct repeat sequence and a spacer region sequence. Figure 1 A) “Direct repeat sequence” refers to a repeating sequence separated by variable sequences (spacer regions) at a CRISPR site. A “spacer region” is the viral DNA inserted into the CRISPR site, generated by the invading viral or plasmid DNA (called the “protospacer region”). The spacer region of wild-type Cas9 is 20 bp in length, while the spacer region in the crRNA of wild-type Cpf1 is 24 bp in length. During subsequent invasion, the crRNA guides the Cas protein to the invading protospacer region sequence. However, the Cas protein does not cleave the protospacer region sequence unless a neighboring PAM sequence is present. The spacer region in bacterial CRISPR sites does not contain a PAM sequence and is therefore not cleaved by nucleases. However, the protospacer region in invading viruses or plasmids contains a PAM sequence and is therefore cleaved by Cas endonucleases. To edit genes, guide RNA is synthesized to recognize gene sequences with a PAM sequence at the 3' end. Figure 1 A shows an exemplary structure of crRNA.

[0074] The term "chimeric guide RNA" refers to a chimeric RNA molecule that integrates other RNA structures and modifications into a regular crRNA.

[0075] The term "caRNA" or "cage-in-crRNA" refers to a class of chimeric guide RNAs that contain at least one crRNA sequence and at least one additional direct repeat sequence. Figure 1 B shows an exemplary structure of caRNA, which has a spacer sequence flanked by two direct repeat sequences.

[0076] The term "csRNA" refers to a class of chimeric guide RNAs that contain at least one crRNA sequence and at least one small RNA linked by a linker. The linker sequence is typically 1-200 bases long. Figure 1 C illustrates an exemplary structure of csRNA, which has a crRNA sequence linked to a truncated t-RNA.

[0077] The term "catRNA" refers to a class of chimeric guide RNAs comprising at least one crRNA sequence, at least one small RNA species, and at least one additional direct repeat sequence. The small RNA is linked to the crRNA sequence via a linker, which is typically 1-200 bases in length. Figure 1 D shows an exemplary structure of catRNA, which has a truncated t-RNA linked to a crRNA sequence, followed by an additional direct repeat sequence.

[0078] The term "tracrRNA" refers to a trans-activating CRISPR RNA that hybridizes with a direct repetitive sequence of crRNA to form a double-stranded RNA that is cleaved and processed by endogenous RNase III and other unknown nucleases. The mature crRNA is then loaded into an effector protein complex for targeted recognition and decoding. In type II CRISPR systems, the crRNA-tracrRNA hybrid complexes with Cas9 to mediate interference.

[0079] The term "single guide RNA" or "sgRNA" refers to an artificially engineered RNA created by fusing crRNA and tracrRNA molecules into a "single guide RNA." When it binds to the Cas9 protein, it can find and cleave guide RNA-specific DNA targets.

[0080] The term "PAM" refers to the protospacer adjacent motif, a 2-6 base pair DNA sequence that immediately follows the DNA sequence targeted by the Cas endonuclease in the CRISPR bacterial adaptive immune system. PAM is a component of invading viruses or plasmids, but not a component of the bacterial CRISPR site. If the target DNA sequence is not following a PAM, the Cas protein will not successfully bind to or cleave it. PAM is an essential targeting component (not found in the bacterial genome) that distinguishes between bacterial self-DNA and non-self-DNA, thus preventing the CRISPR site from being targeted and destroyed by endonucleases. The Cas protein in the novel culprit *Francisella novicida* or *Streptococcus pyogenes* recognizes the standard PAM sequence 5'-NGG-3', but has been engineered to recognize PAM5'YG-3' (where Y is pyrimidine), thereby increasing the potential CAs9 target range. The Cpf1 nuclease in the novel culprit *Francisella novicida* recognizes PAM5'-TTTN-3' or 5'-YTN-3'.

[0081] The term "tRNA" refers to transfer RNA, a linker molecule composed of RNA, typically 76-90 nucleotides in length, that acts as a physical link between the amino acid sequences of mRNA and proteins. Guided by the trinucleotide sequence (codon) in messenger RNA (mRNA), tRNA carries amino acids to the protein synthesis machinery (ribosomes) in the cell to complete this physical link. Therefore, tRNA is an essential component of translation (the biosynthesis of new proteins according to the genetic code).

[0082] The term "pre-tRNA" refers to the precursor RNA of tRNA. Pre-tRNA can be cleaved from a 5' leader sequence or a 3' tail sequence to produce tRNA molecules. Cleavage enzymes include angiogenin, Dicer, RNase Z, and RNase P. Some pre-tRNAs include a 5' methylguanosine cap and a 3' poly-A tail. "Pre-tRNA" can be in a truncated form, where the receptor stem region is only about 5 bp long, while the receptor stem region of a complete pre-tRNA is typically about 7-9 bp long.

[0083] The term "gene editing" refers to genetic engineering that inserts, deletes, modifies, or replaces DNA in the genome of a living organism. In 2018, the common approach to this editing used engineered nucleases, or "molecular scissors." These nucleases create site-specific double-strand breaks at target locations in the genome. The induced double-strand breaks are repaired by non-homologous end joining (NHEJ) or homologous recombination (HR), resulting in the target mutation (editing). By 2015, four families of engineered nucleases were used: broad-spectrum nucleases, zinc finger nucleases (ZFNs), transcription factor-like effector-based nucleases (TALENs), and the clustered, regularly spaced short palindromic repeat (CRISPR) system.

[0084] The terms "pooled gRNA," "gRNA pool," or "a pool of gRNA" are used interchangeably and refer to a combination of individually expressed gRNAs that target the same or different sites in the same or different DNA sequences. In the context of this application, crRNA, caRNA, csRNA, and catRNA can all exist in the form of a pool.

[0085] The terms "arrayed gRNA," "gRNA array," or "anarray of gRNA" are used interchangeably to refer to an array of gRNAs that are specific to the same or different sites located in the same or different DNA sequences, originating from the expression or processing of a single RNA transcript. In the context of this application, crRNA, caRNA, csRNA, and catRNA can all exist in array form.

[0086] The term "small RNA" refers to RNA molecules shorter than 200 nucleotides, typically non-coding RNA molecules. Small RNAs are similar to tRNAs in that they often carry different stem-loop or hairpin structures or terminal modifications that confer RNase resistance. The small RNAs described in this article include transfer RNA (tRNA), microRNA (mirRNA), Piwi-interacting RNA (piRNA), small interfering RNA (siRNA), small nucleolar RNA (snoRNA), tRNA-derived small RNA (tsRNA), small rDNA-derived RNA (srRNA), long non-coding RNA (lncRNA), small nuclear RNA (u-RNA), short hairpin RNA (shRNA), pre-tRNA, and messenger RNA (mRNA). In this invention, small RNAs can be used alone or in combination when fused with crRNA sequences, and the small RNAs within a chimeric guide RNA can be identical or different. Furthermore, small RNAs can be used in truncated forms.

[0087] The term "mRNA" refers to messenger RNA, a large class of RNA molecules that transmit genetic information from DNA to ribosomes, where they specify the amino acid sequence of the protein product to which a gene is expressed. As summarized in the central dogma of molecular biology, after the primary transcript mRNA (called pre-mRNA) is transcribed by RNA polymerase, the processed mature mRNA is translated into an amino acid polymer: protein. Eukaryotic pre-mRNA requires further processing to confuse RNase resistance and initiate translation. This processing includes 5'-methylguanosine capping (5' cap), 3' polyadenylation (3' poly-A), and editing, which are also characteristic of pre-tRNA.

[0088] As used herein, a “functional variant” of Cpf1 refers to a biologically active variant, i.e., one that incorporates one or more functional properties of Cpf1. In the context of this invention, a “variant” of Cpf1 has at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity with the amino acid sequence of Cpf1's RuvC. A “variant” of Cpf1 also includes those having at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity with the amino acid sequence of Cpf1's RuvC. Functional variants of the Cpf1 protein can be obtained by mutating the wild-type Cpf1 protein, the mutation resulting in the addition, deletion, or substitution of one or more amino acids. Mutation methods are known in the art, such as random mutagenesis or site-directed mutagenesis. For example, dead LbCpf1 is a functional variant of LbCpf1 that contains the D832A mutation, resulting in the loss of its DNA endonuclease catalytic activity. "Functional variants" of Cpf1 also include chimeric Cpf1 proteins that comprise a first fragment from a first Cpf1 protein and a second fragment from a second Cpf1 protein, wherein the first and second Cpf1 proteins are distinct.

[0089] The term "CAR," or "chimeric antigen receptor," refers to an engineered receptor that can be implanted with arbitrary specificity onto immune effector cells (T cells). Typically, these receptors are used to implant specific monoclonal antibodies onto T cells, where the transfer of their coding sequences is facilitated by retroviral vectors. These receptors are called chimeras because they consist of parts from different sources.

[0090] The term "CAR T cell" or "chimeric antigen receptor T cell" refers to engineered T cells with chimeric antigen receptors that exhibit predefined specificity for selected targets. Once encountering target cells, such as cancer cells, CAR T cells destroy cancer cells through mechanisms such as: broadly stimulated cell proliferation, increased cytotoxicity of the cells to other living cells (i.e., cytotoxicity), and increased production of factors secreted by cells in the immune system that affect other cells in the organism.

[0091] The term "antigen" or "Ag" is defined as a molecule that elicits an immune response. This immune response may involve antibody production, or activation of specific immune-active cells, or both. Those skilled in the art will understand that any macromolecule (including virtually all proteins or peptides) can serve as an antigen. Additionally, antigens can be derived from recombinant or genomic DNA. Therefore, those skilled in the art will understand that any DNA containing a nucleotide sequence or a portion of a protein encoding an immune response encodes an "antigen" as used herein. Furthermore, those skilled in the art will understand that an antigen does not necessarily need to be encoded solely by the full-length nucleotide sequence of a gene. It is apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Furthermore, those skilled in the art will understand that an antigen does not necessarily need to be encoded by a "gene". It is apparent that antigens can be produced or synthesized, or can be obtained from biological samples. Such biological samples may include, but are not limited to, tissue samples, tumor samples, cells, or biological fluids.

[0092] Engineered chimeric guide RNA

[0093] The present invention provides an engineered chimeric guide RNA comprising: (1) at least one crRNA sequence; and (2) at least one additional direct repeat sequence or small RNA species or both, wherein the crRNA sequence is capable of hybridizing to a target site, and the additional direct repeat sequence and / or small RNA species confers increased stability to the chimeric guide RNA.

[0094] In one specific embodiment, the engineered chimeric guide RNA is a caRNA, comprising at least one crRNA sequence and at least one additional direct repeat sequence. In another specific embodiment, the engineered chimeric guide RNA is a csRNA, comprising at least one crRNA sequence and at least one small RNA species. In a further embodiment, the engineered chimeric guide RNA is a catRNA, comprising at least one crRNA sequence, at least one direct repeat sequence, and a small RNA species.

[0095] In one implementation, the small RNA species are selected from transfer RNA (tRNA), microRNA (mirRNA), Piwi-interacting RNA (piRNA), small interfering RNA (siRNA), small nucleolar RNA (snoRNA), tRNA-derived small RNA (tsRNA), small rDNA-derived RNA (srRNA), long non-coding RNA (lncRNA), small nuclear RNA (u-RNA), short hairpin RNA (shRNA), pre-tRNA, and messenger RNA (mRNA). These small RNA species share common structures, such as stem-loop or hairpin structures or terminal modifications.

[0096] Transport RNAs (tRNAs) are among the most stable RNA molecules because they possess multiple hairpins (or stem-loops) and a 3' tail, which confer resistance to a variety of RNase molecules. Pre-tRNAs are occasionally capped at their 5' end with methylguanosine (Vakiloroavaei A et al., 2017). A recent study in *Saccharomyces cerevisiae* found that the methylguanosine cap protects pre-tRNA from RNase degradation, and that the cap structure may act as a barrier protecting pre-tRNA during maturation (Ohira T et al., 2016). Pre-tRNA is processed into mature tRNA by removing the 5' leader sequence with RNase P and then cleaving it at the 3' end with RNase Z. Since the 7–9 base pair acceptor stem structure is crucial for RNase P recognition and cleavage, disruption of the acceptor stem will limit RNase P leader sequence cleavage and tRNA maturation (Brillante N et al., 2016; Werner et al., 1998). Furthermore, since RNase Z only accepts tRNA precursors with mature 5' ends, inhibiting RNase P processing will also lead to RNase Z cleavage failure (Kunzmann A et al., 1998). Therefore, the inventors designed an RNase-resistant catRNA comprising a truncated pre-tRNA with a 5' cap and a 3' tail, and demonstrated that robust gene editing can be achieved in mammalian cells.

[0097] In one embodiment, the other small RNA species may be truncated forms, provided that such truncation does not adversely affect the activity of the chimeric guide crRNA compared to the corresponding full form. For example, in this invention, a truncated form of pre-tRNA containing a truncated stem region may be used. Specifically, the length of the same receptor stem region in the truncated pre-tRNA is only about 5 bp, compared to the full pre-tRNA with a receptor stem region length of about 7-9 bp.

[0098] If a chimeric guide RNA contains multiple crRNA or small RNA species, they can be the same or different from each other. The crRNA sequence and small RNA species can be arranged in any order.

[0099] In another embodiment, the engineered chimeric guide RNA further comprises one or more elements selected from the untranslated region (UTR), poly-A, and 5'-methylguanosine cap. These elements protect the chimeric RNA from RNase degradation, thus increasing the half-life of the chimeric RNA.

[0100] In one specific embodiment, the engineered chimeric guide RNA is caRNA, which comprises a crRNA sequence and an additional direct repeat sequence. In another specific embodiment, the engineered chimeric guide RNA is csRNA, which comprises a crRNA sequence and a small RNA, such as tRNA or pre-tRNA or a truncated form thereof. In yet another specific embodiment, the engineered chimeric guide RNA is catRNA, which comprises a crRNA sequence, an additional direct repeat sequence, and a small RNA, wherein the small RNA may be tRNA or pre-tRNA or a truncated form thereof.

[0101] Engineered chimeric guide RNAs can target one or more sites, said sites being located in the same or different DNA sequences. For example, multiple engineered chimeric guide RNAs according to the invention can be used together in a pool, wherein each chimeric guide RNA is transcribed from an independent RNA molecule and targets the same site in a gene, a different site in a gene, or different sites in different genes. Furthermore, engineered chimeric guide RNAs according to the invention can also be used in an array, transcribed from a single RNA molecule and containing multiple crRNAs and / or one or more direct repeat sequences and / or one or more small RNA species, said multiple crRNAs targeting the same site in a gene, a different site in a gene, or different sites in different genes.

[0102] The chimeric guide RNA contains a crRNA that includes a spacer region sequence of 10-30 bp in length, preferably about 16-24 bp. For example, the spacer region length can be 10 bp, 11 bp, 12 bp, 13 bp, 14 bp, 15 bp, 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, or 30 bp. In some embodiments, when Cpf1 is LbCpf1, it requires a spacer region sequence of at least 16 nt to achieve detectable DNA cleavage and at least 17 nt to achieve efficient DNA cleavage in vitro.

[0103] According to this application, the engineered chimeric guide RNA hybridizes with a target sequence, wherein the target sequence is the 3' of the protospacer adjacent motif (PAM). Preferably, the PAM contains a 5' T-rich motif.

[0104] For example, when the PAM sequence is TTN and N is A / C / G or T, the Cpf1 protein is FnCpf1; when the PAM sequence is TTTN and N is A / C or G, the Cpf1 protein is PaCpf1, LbCpf1 or AsCpf1.

[0105] CRISPR / Cpf1 system

[0106] Clustered, regularly spaced short palindromic repeats, or CRISPR / Cpf1, from *Prevotella* and *Francisella* 1, are DNA editing technologies similar to the CRISPR / Cas9 system. Cpf1 is an RNA-guided endonuclease of the class II CRISPR / Cas system. This acquired immune mechanism is found in *Prevotella* and *Francisella*. It prevents gene damage from viruses. The Cpf1 gene is associated with a CRISPR site and encodes an endonuclease that uses guide RNA to locate and cut viral DNA. Cpf1 is a smaller and simpler endonuclease than Cas9, overcoming some limitations of the CRISPR / Cas9 system. CRISPR / Cpf1 has various applications, including the treatment of genetic diseases and degenerative conditions.

[0107] Figure 2 This is a schematic flowchart illustrating the function of catRNA according to the present invention. Clearly, catRNA binds to the Cpf1 protein to form a complex, and then, under the action of RNases, the Cpf1 protein processes the catRNA by cleaving small RNA species (e.g., truncated pre-tRNA) and additional direct repeat sequences with poly-T and / or poly-A. The processed mature crRNA, still bound to the Cpf1 protein, is obtained, and then hybridizes to the target sequence via base pairing and cleaves the target sequence with the aid of DNases.

[0108] Cas9 requires two RNA molecules to cut DNA, while Cpf1 only needs one. This protein also cuts DNA at different locations, giving researchers more options when choosing editing sites. Cas9 cuts both strands of a DNA molecule at the same location, leaving blunt ends. Cpf1 leaves one strand longer than the other, producing sticky ends. Sticky ends facilitate the integration of new DNA sequences, making Cpf1 more efficient than Cas9 for gene insertion. While the CRISPR / Cas9 system can effectively disable genes, inserting genes or generating knock-ins is challenging. Cpf1 lacks tracrRNA, utilizing T-rich PAM and cutting DNA via interleaved DNA DSBs.

[0109] In summary, the key difference between Cpf1 and Cas9 systems is that Cpf1 can:

[0110] - Identifying different PAMs makes new targets possible;

[0111] - Unlike the blunt ends produced by Cas9, it produces sticky ends of 4-5 nt in length, which enhances the efficiency and specificity of gene insertion during NHEJ or HDR;

[0112] - Cutting target DNA at a location further away from PAM, which is farther than the cleavage site of Cas9, opens up new possibilities for DNA cutting.

[0113] Therefore, the present invention provides a CRISPR / Cpf1 system comprising:

[0114] (a) One or more engineered chimeric guide RNAs according to this application, or one or more polynucleotide sequences encoding engineered chimeric guide RNAs according to this application;

[0115] (b) Cpf1 protein or a functional variant thereof, or one or more polynucleotide sequences encoding Cpf1 protein or a functional variant thereof.

[0116] When components (a) and (b) are polynucleotide sequences, they can exist in the same or different vectors.

[0117] The system may further contain Mg 2+ The preferred concentration is from about 1 mM to about 5 mM. Mg 2+ The presence of [something] forms a complex with endonuclease, stabilizing the latter to enhance hybridization activity.

[0118] The Cpf1 protein can be the wild-type Cpf1 protein or a functional Cpf1 variant thereof that retains the endonuclease activity of the wild-type Cpf1 protein, such as a functional Cpf1 mutant or chimeric Cpf1 protein. Those skilled in the art can obtain functional Cpf1 variants using any known method (e.g., directed or random mutagenesis or DNA recombination). The effectiveness of the obtained Cpf1 variants can be verified using well-known methods (e.g., DNA cleavage analysis).

[0119] Cpf1 protein or its functional variants can be derived from organisms selected from: Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacterium, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, and Clostridium difficile. Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium, and Acidaminococcus.Preferably, the Cpf1 protein or a functional variant thereof is derived from organisms selected from: *Streptococcus mutans*, *Streptococcus agalactiae*, *Streptococcus equisimilis*, *Streptococcus sanguinis*, *Streptococcus pneumoniae*, *C. jejuni*, *C. coli*, *N. salsuginis*, *N. tergarcus*, *S. auricularis*, *S. carnosus*, etc. S. carnosus); Neisseria meningitidis, Neisseria gonorrhoeae; Listeria monocytogenes, Listeria ivanovii; Clostridium botulinum, Clostridium difficile, Clostridium tetani, Clostridium sordellii; Francisella tularensis 1, Prevotella alba, Trichophyton family bacteria MC2017 1. *Vibrio butyricum*, *Peregrinibacteria* GW2011_GWA2_33_10, *Parcubacteria* GW2011_GWC2_44_17, *Smithia spp.* SCADC, *Aminococcus* spp. BV3L6, *Trichophyton* spp. MA2020, *Mycoplasma methanogene* (candidate), *Eubacterium tumefaciens*, *Moraxella bovis* 237, *Leptospira oryzae*, *Trichophyton* spp. ND2006, *Porphyromonas canis* 3, *Prevotella glycolytica*, and *Porphyromonas rhesus*. Most preferably, the Cpf1 protein or a functional variant thereof is derived from *Prevotella whiteis* (PaCpf1), *Trichophyton* spp. ND2006 (LbCpf1), *Francisella tularensis* subsp. *tularensis* (FnCpf1), or *Aminococcus* spp. BV3L6 (AsCpf1).

[0120] Cpf1 mutants can be used to expand the applications of this protein. For example, the utility of commonly used AsCpf1 and LbCpf1 is limited by their requirement for the neighboring motif (PAM) of the TTTN protospacer region in DNA substrates. To address this limitation, engineered AsCpf1 variants carrying the mutations S542R / K607R and S542R / K548V / N552R have been developed, recognizing TYCV and TATV PAMs respectively, and exhibiting enhanced in vitro and human cell activity. Similarly, introducing identified PAM-interacting mutations at the corresponding positions in LbCpf1 alters its PAM specificity. Furthermore, by introducing the mutations G532R / K595R and G532R / K538V / Y542R respectively, LbCpf1 has been engineered to recognize TYCV and TATV PAMs. In summary, these variants increase the targeting range of Cpf1 in the human coding sequence by approximately 3-fold to one cleavage site every 11 bp. Detailed descriptions of these variations can be found, for example, in International Patent Publication WO2017184768A1, the entire contents of which are incorporated herein by reference.

[0121] The chimeric Cpf1 protein comprises a first fragment from a first Cpf1 protein and a second fragment from a second Cpf1 protein, wherein the first and second Cpf1 proteins are different.

[0122] In one implementation, the Cpf1 protein or a functional variant thereof contains one or more nuclear localization signals.

[0123] The present invention also covers cells or cell lines or their descendants comprising the systems described above according to the present invention.

[0124] Gene editing methods

[0125] Currently, there are generally four systems used for gene editing: systems based on a wide range of nucleases, systems based on zinc finger nucleases (ZFNs), transcription factor-like effector nucleases (TALENs), and CRISPR systems.

[0126] Large-scale nucleases are typically found in microbial species and possess the unique property of having very long recognition sequences (>14 bp), making them naturally highly specific. However, there is little chance of finding the exact large-scale nuclease required to act on a specific DNA sequence. To overcome this challenge, mutagenesis and high-throughput screening methods have been used to generate large-scale nuclease variants that recognize unique sequences. Others have been able to fuse various large-scale nucleases and generate hybrid enzymes that recognize new sequences. Still others have attempted to design sequence-specific large-scale nucleases by altering the DNA-interacting amino acids of large-scale nucleases using a method called rational design of large-scale nucleases.

[0127] Zinc finger nucleases (ZFNs) recognize target DNA in a modular manner: each protein consists of at least three zinc finger domains, each of which interacts with a 3-bp sequence, making it an ideal programmable sequence-specific DNA-binding protein.

[0128] In 2011, TALEN emerged as a competing alternative to ZFN. Unlike zinc fingers, each repeating domain in the TALEN protein recognizes a single base. Four different repeating domains can be mixed and matched to create novel DNA-binding proteins, which can be linked to FokI domains to generate new classes of programmable target DNA nucleases. These molecules can precisely locate and cleave at specific genomic sites to create double-strand breaks (DSBs), followed by non-homologous end joining (NHEJ) or homology-directed repair (HDR) mediated repair, enabling precise genome editing.

[0129] Research using ZFNs and TALENs has yielded significant scientific discoveries and therapeutic advances. In fact, ZFN-based HIV therapy, which disables the HIV co-receptor CC chemokine receptor type 5 (CCR5) in primary human T cells, is currently in clinical trials and has shown great promise. However, the recognition of target DNA sequences by these protein-based genome engineering systems is determined by the protein sequence. Therefore, tedious and complex protein engineering and optimization are required for each specific target DNA sequence, and delivering many of these proteins into cells for simultaneous multiplex genetic manipulation is challenging. Given these difficulties, their use for large-scale genome manipulation or genetic screening is limited.

[0130] As described above, CRISPRs are genetic elements used by bacteria as acquired immunity to protect against viruses. They consist of short sequences derived from viral genomes and integrated into the bacterial genome. Cas (a CRISPR-associated protein) processes these sequences and cuts matching viral DNA sequences. By introducing plasmids containing the Cas gene and specifically constructed CRISPRs into eukaryotic cells, the eukaryotic genome can be cut at any desired location.

[0131] Therefore, the present invention provides a method for editing a target site, comprising delivering a CRISPR / Cpf1 system comprising the following to the site:

[0132] (a) one or more engineered chimeric guide RNAs according to this application, or one or more polynucleotide sequences encoding engineered chimeric guide RNAs according to this application; and

[0133] (b) Cpf1 protein or a functional variant thereof, or one or more polynucleotide sequences encoding Cpf1 protein or a functional variant thereof.

[0134] The target site is located within a cell, such as a eukaryotic cell, like an animal, human, or plant cell. In another embodiment, the target site is contained within a DNA molecule outside the body.

[0135] The present invention also provides a method for altering the expression of at least one target gene, comprising delivering a CRISPR / Cpf1 system to a cell containing the target gene, said CRISPR / Cpf1 system comprising:

[0136] (a) one or more engineered chimeric guide RNAs according to this application, or one or more polynucleotide sequences encoding engineered chimeric guide RNAs according to this application; and

[0137] (b) Cpf1 protein or a functional variant thereof, or one or more polynucleotide sequences encoding Cpf1 protein or a functional variant thereof.

[0138] The cell is a eukaryotic cell, such as an animal, human, or plant cell.

[0139] Components (a) and (b) of the CRISPR / Cpf1 system can be delivered together or separately. For example, when components (a) and (b) are polynucleotides, they can be delivered in the following manner:

[0140] - A single vector containing two or more expression cassettes as follows: promoter-Cpf1 encoding nucleic acid molecule-terminator; promoter-gRNA1-terminator; promoter-gRNA2-terminator; promoter-gRNA(N)-terminator (up to vector size limitations); or

[0141] - Dual vectors, wherein vector 1 contains an expression cassette for driving Cpf1 expression: promoter-Cpf1-encoded nucleic acid molecule-terminator; vector 2 contains one or more expression cassettes for driving the expression of one or more chimeric guide RNAs according to the invention: promoter-gRNA1-terminator; promoter-gRNA(N)-terminator (up to the size limit of the vector).

[0142] In addition to the single and dual viral vector methods described above, additional vectors can be used to deliver homology-guided repair templates.

[0143] The CRISPR / Cas system can be delivered by any method known in the art, for example, by direct application of the system to human cells via transfection with plasmids encoding Cas and sgRNA. Viral delivery of CRISPR components has been extensively demonstrated using lentiviruses and retroviruses. Gene editing using CRISPR encoded by non-integrating viruses (e.g., adenoviruses and adenovirus-associated viruses (AAVs)) has also been reported. The recently discovered smaller Cas proteins have made it possible to combine this technology with vectors (e.g., AAV vectors) that have achieved increasing success in terms of safety and efficiency. Due to their relatively low immunogenicity, AAVs are generally chosen for in vivo gene delivery in somatic cell gene therapy. CRISPR delivery via Cas ribonucleoproteins (RNPs) has also demonstrated efficient gene editing in human cells. Further examples of delivery methods for the CRISPR / Cpf1 system can be found in U.S. Patent US9790490B2, the entire contents of which are incorporated herein by reference.

[0144] To date, electroporation is the most commonly used method for delivering genetic material, including DNA, RNA, and proteins, into T cells. Electroporation is a microbiological technique in which an electric field is applied to the cell to increase the permeability of the cell membrane, thereby allowing the introduction of chemicals, drugs, DNA, RNA, or proteins into the cell.

[0145] Due to the low transduction efficiency of viruses (including lentiviruses, retroviruses, or adenoviruses) into T cells, and the toxicity associated with prolonged CRISPR / Cas expression, electroporation has been used for efficient, low-toxicity gene manipulation in T cells.

[0146] Compared to DNA, which may be considered foreign genetic material or DNA damage (which would initiate the apoptosis pathway and lead to cell death), RNA and proteins are less toxic to electroporation and more tolerant to T cells.

[0147] The electroporation method used in this invention is briefly described below:

[0148] 1. Genetic material is prepared before mixing with target cells (e.g., T cells). The T cells can be naive T cells or activated T cells.

[0149] If DNA encoding the Cpf1 protein and a chimeric guide RNA are used, DNA electroporation can be performed via a single electroporation.

[0150] If using Cpf1 mRNA, use sequential or double electroporation. Perform electroporation on the Cpf1 mRNA first, followed by electroporation on the chimeric guide RNA. The interval between the two electroporations should be within 24 hours.

[0151] If using Cpf1 protein and chimeric guide RNA, pre-incubate the Cpf1 protein with the chimeric guide RNA before mixing with target cells.

[0152] 2. Mix the prepared genetic material with the target cells;

[0153] 3. Perform electroporation using an electroporation apparatus;

[0154] 4. Transfer the electroporated cells to a culture medium and incubate them under appropriate conditions for a sufficient time.

[0155] Engineered T cells

[0156] T cells can be engineered to express modified TCRs (so-called TCR therapy) or chimeric antigen receptors (CARs) derived from protein fusions with enhanced antigen specificity. These approaches can overcome fundamental limitations associated with central and peripheral tolerance and generate T cells that can more effectively target tumors without reactivating T cells in the patient.

[0157] Genetically modified TCR therapy is based on altering T cell specificity by mediating the expression of specific TCRα and β chains in the antigen recognition process. Tumor-specific TCRα and β chains are identified, isolated, and cloned into transduction vectors, and the transduction of T cells generates tumor antigen-specific T cells.

[0158] Chimeric antigen receptors (CARs) combine antibody-like recognition and T-cell activation functions. They consist of an antigen-binding domain typically derived from an antibody, a transmembrane domain that anchors the CAR to T cells, and one or more intracellular signaling domains that induce persistence, transport, and effector functions in transduced T cells. The sequences used to define CAR antigen-targeting motifs are typically derived from monoclonal antibodies, but ligands and other receptors can also be used.

[0159] When preparing gene-edited CAR T cells, T cell transduction and gene editing can be performed in any order. Specifically, T cell transduction can occur before gene editing via the CRISPR system. Figure 10 A) After that ( Figure 10 B) or simultaneously ( Figure 10 C) Proceed.

[0160] Currently, most CAR T cell clinical trials use autologous T cells, which may be limited by poor T cell quality and quantity, as well as the time and cost of preparing autologous T cell products. CAR T cell therapy can greatly benefit from universal donor T cells from allogeneic sources, as "off-the-shelf" cells can significantly increase the number of patients who can be treated with a single CAR T cell product. However, endogenous TCRs on allogeneic T cells can recognize allogeneic antigens in the recipient, leading to graft-versus-host disease (GVHD). Furthermore, HLA expressed on the surface of allogeneic T cells causes rapid rejection by the host immune system. In this context, ZFN and TALEN have been used to knock out endogenous T cell receptor genes in T cells, which can prevent undesirable graft-versus-host reactions. Genome editing strategies can also be used to prevent or delay rejection of CAR T cells by the recipient immune system by eliminating or reducing the expression of histocompatibility antigens on donor T cells. Future CAR T cell therapies could benefit from combined modifications of endogenous TCR genes, histocompatibility genes, and signal transduction pathway components.

[0161] In previous studies, the CRISPR / CAS9 system was used to simultaneously disrupt multiple genomic sites. This resulted in CAR T cells with insufficient expression of the endogenous T cell receptor (TCR) and HLA class I (HLA-I), which can serve as universal CAR T cells.

[0162] One potential problem with TCR / HLA is the activation of NK cells, which could lead to rapid rejection of these cells. Another approach is to also use TALEN to disrupt the CD52 gene, allowing for the administration of engineered T cells following alemtuzumab-based lymphocyte depletion therapy.

[0163] However, TALEN's TCR / CD52 gene disruption efficiency is very low (30%), thus limiting its use in large-scale manufacturing processes.

[0164] In this invention, we provide a more efficient method for preparing universal CAR T cells. Specifically, this invention provides a method for preparing engineered T cells, comprising the step of genetically modifying T cells by introducing and / or expressing a system in T cells, said system comprising at least:

[0165] -Cpf1 protein or a functional variant thereof, or one or more multinucleotide sequences encoding Cpf1 protein or a functional variant thereof;

[0166] - One or more engineered chimeric guide RNAs according to this application, or one or more polynucleotide sequences encoding engineered chimeric guide RNAs according to this application.

[0167] In one embodiment, the method for preparing engineered T cells further includes a step (b) of expanding the engineered T cells in vitro.

[0168] In one embodiment, the method for preparing engineered T cells further includes step (b) of transfecting the T cells with a chimeric antigen receptor (CAR). Specifically, step (b) is performed before, after, or simultaneously with step (a) of genetically modifying the T cells.

[0169] In one specific implementation, the T cells are derived from peripheral blood mononuclear cells (PBMCs) or umbilical cord blood. Preferably, the T cells are derived from inflammatory T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, or helper lymphocytes, especially CD4+ T lymphocytes and / or CD8+ T lymphocytes.

[0170] The inventors unexpectedly discovered that the above-described method according to the present invention achieved highly efficient gene disruption (~90%) at the TCR and CD52 sites using engineered chimeric guide RNA.

[0171] The present invention also provides engineered T cells, particularly allogeneic T cells, prepared according to the method described above.

[0172] In a further embodiment, the engineered T cell gene further includes an exogenous recombinant polynucleotide encoding a CAR for specific cell recognition.

[0173] Specifically, the engineered T cells according to the invention have a wide range of uses, such as as active ingredients in pharmaceutical composition products for treating or preventing diseases such as cancer, infection or autoimmune diseases, and ideally as "off-the-shelf" products.

[0174] Conditions that can be treated with engineered T cells include, but are not limited to, cancer, infections, or autoimmune diseases. Cancers that can be treated with engineered T cells include, but are not limited to, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), breast cancer, lung cancer, colorectal cancer, gastric cancer, pancreatic cancer, ovarian cancer, metastatic adenocarcinoma, liver metastases, sarcoma, osteosarcoma, neuroblastoma, melanoma, mesothelioma, glioblastoma, glioma, malignant glioma, hepatocellular carcinoma, non-small cell lung cancer (NSCLC), gangliocytoma, brain cancer, kidney cancer, and prostate cancer. Infections that can be treated with engineered T cells include, but are not limited to, infections caused by viruses, bacteria, fungi, and parasites. Autoimmune diseases that can be treated with engineered T cells include, but are not limited to, type 1 diabetes, celiac disease, Graves' disease, inflammatory bowel disease, multiple sclerosis, psoriasis, rheumatoid arthritis, Addison's disease, Sjögren's syndrome, Hashimoto's thyroiditis, myasthenia gravis, vasculitis, pernicious anemia, and systemic lupus erythematosus.

[0175] Engineered T cells eliminate cancer by recognizing specific tumor antigens. In this study, the tumor antigens selected were: TSHR, CD19, CD123, CD22, CD30, CD171, CS-1, CLL-1, CD33, EGFRvIII, GD2, GD3, BCMA, TnAg, PSMA, ROR1, FLT3, FAP, TAG72, CD38, CD44v6, CEA, EPCAM, B7H3, KIT, IL-13Ra2, mesothelin, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, CD24, PDGFR-β, SSEA-4, CD20, folate receptor α, ERBB2 (Her2 / neu), MUC1, EGFR, NCAM, prostaglandins, PAP, ELF2M, and Ephrin. B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, fucose GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor β, TEM1 / CD248, TEM7R, CLDN6, GPRC5D, CXORF61, CD97, CD179a, ALK, polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-1a, MAGE-A1, pod protein, HPV E6, E7, MAGE A, ETV6-AML, spermin 17, XAGE1, Tie 2. MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, prostein, survivin and telomerase, PCTA-1 / galactagogue 8, MelanA / MART1, Ras mutant, hTERT, sarcoma translocation breakpoint, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, Cyclin B1, MYCN, RhoC, TRP-2, CYP1B 1, BORIS, SART3, PAX5, OY-TES 1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxylesterase, mut hsp70-2, CD79a, CD79b, CD72, LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, GPC3, FCRL5 and IGLL1, and any combination thereof. Detailed Implementation Plan

[0176] The following examples are provided for illustrative purposes only and do not limit the scope of the invention in any way.

[0177] Example 1: Effectively disrupting genes using various gRNAs

[0178] All crRNA, caRNA, csRNA, and catRNA used were derived from HiScribe. TM The T7 High Yield RNA was synthesized using the NEB kit and then cloned into pcDNA3.1 plasmids driven by the U6, T7, or EF1a promoters, respectively. To effectively initiate transcription under the U6 and T7 promoters, a "G" nucleotide was added before all crRNA, caRNA, csRNA, and catRNA sequences.

[0179] In all embodiments, the crRNA comprises a spacer sequence and a direct repeat sequence. Figure 1 A); the caRNA contains additional direct repeat sequences linked to the crRNA. Figure 1 B); csRNA contains a truncated pre-tRNA linked to the crRNA ( Figure 1 C); the catRNA contains a truncated pre-tRNA linked to the crRNA, followed by an additional direct repeat sequence ( Figure 1 D).

[0180] The sequences of various gRNAs used in the examples are shown in Table 1 below, where bold letters represent direct repeat sequences, italicized and underlined letters represent truncated pre-tRNA sequences, and underlined letters represent spacer sequences.

[0181] Table 1. Sequences of various gRNAs used in this embodiment

[0182]

[0183] The nucleotide sequence of LbCpf1 was amplified from the bacteria ND2006 of the family Spirulinaceae and cloned into the plasmid pcDNA3.1.

[0184] HEK293T cells (ATCC) were cultured in DMEM (Life Technologies, Carlsbad, CA, USA) supplemented with 10% FBS (Omega Scientific) and 25 mM Hepes. Cells were transfected at 70% confluence in 6-well plates with either a single 2 μg plasmid encoding LbCpf1 (control) or a combination of 2 μg plasmids encoding various gRNAs. These gRNA-encoding plasmids carried crRNAs targeting the DNMT1, VEGFa, and GRIN2b genes, driven by either the U6 polymerase III (Pol III) promoter or the EF1a polymerase II (Pol II) promoter. Cells were harvested 72 hours post-transfection for genomic DNA extraction. Specific knockout of the DNMT1, VEGFa, and GRIN2b genes was measured using TIDE online software.

[0185] The measured gene destruction efficiency results are as follows: Figure 3 As shown. It was found that when the tested crRNA, caRNA, csRNA, and catRNA were controlled by the pol III promoter, the gene disruption efficiency obtained from caRNA targeting the DNMT1, VEGFa, and GRIN2b genes (60.7%, 38.0%, and 47.0%, respectively) was significantly higher than that obtained from crRNA (42.1%, 23.2%, and 32.1%, respectively). Among all three genes, csRNA showed comparable disruption efficiency to caRNA. This significant increase was also observed when catRNA was used. Figure 3 As shown, catRNA effectively disrupted the DNMT1, VEGFa, and GRIN2b genes, with efficiencies of 68.3%, 51.6%, and 51.7%, respectively.

[0186] It was also noted that catRNAs driven by the pol II promoter showed significantly improved efficiency for the three genes tested compared to those driven by the pol III promoter. The inventors also observed a trend towards higher efficiency using pol-II caRNAs, although it was not comparable to the catRNAs used in this experiment. This difference between caRNAs or catRNAs transcribed from pol II and pol III promoters is due to the presence of the 5' cap and 3' poly-A tail structures, which are present only in the pol II promoter. The 5' cap and 3' poly-A tail structures provide protection against external RNases until Cpf1 cleaves the additional direct repeat sequence, conferring relatively higher stability and a longer half-life, thereby improving gene editing efficiency.

[0187] However, compared to the control, the crRNA and csRNA driven by the pol II promoter did not appear to cause any gene damage, suggesting that the crRNA and csRNA may be nonfunctional. This is because without additional direct repeat sequences, the Cpf1 protein cannot process the transcribed crRNA and csRNA, leaving the 3' poly-A tail still attached to the crRNA, thus preventing the transcribed crRNA and csRNA from functioning.

[0188] Furthermore, it was noted that catRNA exhibited significantly higher gene disruption efficiency in all three genes tested, both with the pol II promoter and with the pol III promoter. This is attributed to the truncated pre-tRNA structure, which significantly increases the stability of the entire catRNA molecule.

[0189] Example 2: The combination of gRNA and dCpf1 effectively activates genes.

[0190] Although Cpf1 has been used for gene disruption, the gene regulation of the non-catalytically active LbCpf1 (dCpf1) has not been well studied. Compared to wild-type LbCpf1, dCpf1 contains the D832A mutation.

[0191] To utilize dCpf1 for gene activation, we linked dCpf1 to four copies of the herpes simplex virus-derived VP16 (VP64) activator domain to prepare the dCpf1-VP64 fusion protein. To test whether this construct could activate endogenous genes, we co-transfected 293T cells with plasmids containing this sequence, either alone (control) or in combination with plasmids encoding crRNA, caRNA, or catRNA (targeting different locations in the DNMT1 and VEGFa promoter regions, respectively). Figure 5 The arrows in A and 5B indicate specific target sites in the promoter regions of each gene. Gene expression was measured by quantitative real-time PCR 48 hours post-transfection. Slight gene upregulation was detected with caRNA compared to crRNA targeting the DNMT1 or VEGFa promoters. However, significant gene upregulation was observed with catRNA targeting the DNMT1 or VEGFa promoters. Figure 5 C and 5D).

[0192] The crRNA, caRNA, and catRNA used in the following examples have the same structures as those used in Example 1, with the only difference being the spacer region sequence. Therefore, only the spacer region sequence is provided in the following examples. The spacer region sequences used in this example are shown in Table 2 below.

[0193] Table 2. Spacer sequences of promoter regions targeting DNMT1 and VEGFa genes

[0194] name Interval sequence DNMT1-1 TCAGCACCATTTGTTAAAGACAC(SEQ ID NO:13) DNMT1-2 CGCGCGAAAAGCCGGGGCGCCTG(SEQ ID NO:14) DNMT1-3 TGAGAGCCCTTGAGTAAAGTCCT(SEQ ID NO:15) VEGFa-1 TGACCTCCCAAACAGCTACATAT(SEQ ID NO:16) VEGFa-2 CTGCCTCCCTCCTCGCCAATGCCC(SEQ ID NO:17) VEGFa-3 TCCCCAAATCACTGTGGATTTTG(SEQ ID NO:18)

[0195] Figure 5 The results in C and 5D indicate that dCpf1, along with crRNA, caRNA, or catRNA, can effectively activate genes, with caRNA and catRNA showing relatively higher efficiency compared to crRNA. In the DNM1 and VEGF genes, catRNA targeting the second position of the promoter region achieved the highest activation.

[0196] Example 3: Co-activation of gRNA pools or arrays

[0197] To test whether there is a synergistic effect of gene activation when using different gRNAs that simultaneously target the promoter, we co-transfected crRNA, caRNA, catRNA pools or arrays (each targeting the same site in Example 2) with the dCpf1-VP64 fusion protein into 293T cells. Figure 4 This is a schematic diagram of the catRNA pool and catRNA array used in this embodiment. The spacer sequence is the same as that used in Example 2.

[0198] Figure 5 C shows the results of targeting the DNMT1 promoter. No significant gene activation was observed with either the crRNA pool or the crRNA array compared to a single crRNA. However, significant gene activation was detected with either the caRNA pool or the caRNA array, reaching levels similar to those achieved with a single catRNA. This gene activation was further enhanced by both the catRNA pool and the catRNA array, with the catRNA pool achieving a 5.3-fold increase in gene activation. Notably, catRNA consistently exhibited better performance than caRNA, regardless of whether it was in pool or array form. A similar trend was observed in the case of the VEGFa promoter, such as... Figure 5 As shown in D.

[0199] The results above indicate that although individual caRNAs and catRNAs can effectively induce gene activation, caRNA or catRNA pools and arrays exhibit a synergistic effect in gene activation.

[0200] Example 4: Multiple strong activators enhance gene activation

[0201] Since Pol-II crRNA is nonfunctional, and Pol-II caRNA and Pol-II catRNA are always more effective than pol-III caRNA and Pol-III catRNA, we use Pol-III crRNA, Pol-II caRNA, and Pol-II catRNA in further embodiments.

[0202] To extend the utility of the dCpf1 activator, we ligated dCpf1 to the VP64 activator or a strongly synthetic VPR activator containing the following: VP64 activator, human NF-KB p65 activation domain, and Epstein-Barr virus-derived R-trans activator (Rta) (Chavez A et al., 2015), and co-transfected it into 293T cells, either alone (control) or in combination with a single crRNA, caRNA, or catRNA (targeting the same site in the promoter region of the DNMT1 or VEGFa gene). Gene expression was calculated by quantitative real-time PCR 48 hours post-transfection.

[0203] The same gRNA targeting the second position of the DNMT1 promoter and the first position of VEGFa as in Example 3 was used.

[0204] like Figure 6 As shown, dCpf1-VPR resulted in strong upregulation of transcription in the promoters of both target genes. Consistent with previous observations of the dCas9 activator, gene activation via the dCpf1 activator was more efficient when multiple strong activator domains were recruited to the target promoters. The dCpf1-VPR fusion exhibited higher activity compared to dCpf1-VP64. In the strong VPR-mediated activation, caRNA showed a slightly increased gene activation in the promoters of DNMT1 and VEGFa genes compared to crRNA, while catRNA-induced DNMT1 and VEGFa activation was approximately 5.3-fold and 4.4-fold higher than crRNA-induced activation, further demonstrating the advantages of using caRNA and catRNA, especially catRNA, for gene interference.

[0205] This result indicates that including multiple activators can improve gene activation efficiency compared to using only one activator.

[0206] Example 5: Simultaneous activation of gRNA pools or arrays

[0207] The ability of Cpf1 to process multiple crRNAs within a single transcript makes it an excellent platform for multi-gene regulation. To test whether simultaneous gene activation could be achieved using different caRNAs and catRNAs, we co-transfected the dCpf1-VPR fusion protein with a pool or array of gRNAs targeting both the DNMT1 and VEGFa promoters into 293T cells. Gene expression was measured by quantitative real-time PCR 48 hours post-transfection. Figure 7 This is a schematic diagram of the catRNA pool and catRNA array used in this embodiment.

[0208] The spacer sequences used in the gRNA of this embodiment are DNMT1-1 and VEGFa-2, which are the same as those used in Example 3.

[0209] The results are as follows Figure 8 As shown, simultaneous activation in both GNMT1 and VEGFa was clearly achieved using either caRNA or catRNA pools or arrays. Specifically, caRNA pools and arrays resulted in a significant increase in gene activation compared to crRNA, while catRNA further enhanced this increase.

[0210] The above results indicate that caRNA and catRNA can be used to effectively activate multiple target genes simultaneously.

[0211] Example 6: Disrupting genes using catRNAs with spacer regions of different lengths

[0212] It has been reported that truncated guide RNAs can increase gene targeting specificity. To test whether gene disruption can be achieved using catRNAs with truncated spacer regions, we prepared catRNAs targeting the DNMT1 or VEGRa genes with spacer regions of different lengths and co-transfected them with LbCpf1 into 293T cells. Cells were harvested 72 hours after DNA transfection for genomic DNA extraction. Specific knockout in the DNMT1 and VEGRa genes was measured using the TIDE online software.

[0213] The spacer region sequences of the catRNA used in this embodiment are shown in Table 3 below.

[0214] Table 3. Sequences of intervals with different lengths

[0215] name Interval sequence DNMT1-24bp CTGATGGTCCATGTCTGTTACTCG(SEQ ID NO:19) DNMT1-20bp CTGATGGTCCATGTCTGTTA(SEQ ID NO:20) DNMT1-18bp CTGATGGTCCATGTCTGT(SEQ ID NO:21) DNMT1-17bp CTGATGGTCCATGTCTG(SEQ ID NO:22) DNMT1-16bp CTGATGGTCCATGTCT(SEQ ID NO:23) DNMT1-15bp CTGATGGTCCATGTC(SEQ ID NO:24) DNMT1-14bp CTGATGGTCCATGT(SEQ ID NO:25) VEGFa-24bp CTAGGAATATTGAAGGGGGCAGGG(SEQ ID NO:26) VEGFa-20bp CTAGGAATATTGAAGGGGGGC(SEQ ID NO:27) VEGFa-18bp CTAGGAATATTGAAGGGG(SEQ ID NO:28) VEGFa-17bp CTAGGAATATTGAAGGG(SEQ ID NO:29) VEGFa-16bp CTAGGAATATTGAAGG(SEQ ID NO:30) VEGFa-15bp CTAGGAATATTGAAG(SEQ ID NO:31) VEGFa-14bp CTAGGAATATTGAA(SEQ ID NO:32)

[0216] Figure 9 The results show that gene disruption was detected when the spacer sequence length was at least 16 bp, while effective gene disruption required at least 17 bp.

[0217] Example 7: Preparation of gene-edited CAR-T cells

[0218] To illustrate the use of catRNA in immunotherapy, particularly chimeric antigen T-cell therapy, we prepared genetically modified CAR-T cells by targeting TRAC, TRBC, B2m, CD52 GR, dCK, and PD-1. In this example, CD4 and CD8 T cells mixed in equal proportions were used as the raw material.

[0219] Transcribed Cpf1 mRNA and chimeric guide RNA were electroporated into T cells in vitro according to the following protocol. In short, T cells were first stimulated with anti-CD3 / CD28 beads at a 3:1 bead-to-cell ratio, and one day later, the CAR transgene was introduced via lentiviral transduction. Then, 2 to 4 days post-stimulation, T cells were washed twice with Opti-MEM and resuspended in Opti-MEM to a final concentration of 1 × 10⁻⁶. 7 Cells / ml. Subsequently, using a BTX830 electroporator (Harvard Apparatus BTX), 20 μg LbCpf1 mRNA and 20 μg chimeric guide RNA were electroporated together in a single electroporation in a 2 mm cuvette, or electroporated separately before the latter, at 400 V for 700 μs. Immediately after electroporation, cells were placed in 2 ml of preheated antibiotic-free medium and incubated at 37 °C and 5% CO2. Cells were harvested 72 hours after electroporation for genomic DNA extraction, and gene destruction efficiency was calculated using TIDE online software.

[0220] The spacer sequence used in the catRNA of this embodiment is shown in Table 4 below.

[0221] Table 4. Spacer sequences used to prepare CART cells

[0222] name Interval sequence TCRα-1 ATTCTCAAACAAATGTGTCACAA(SEQ ID NO:33) TCRα-2 CATGTGCAAACGCCTTCAACAAC(SEQ ID NO:34) TCRα-3 CACATGCAAAGTCAGATTTGTTG(SEQ ID NO:35) TCRα-4 TTGCTCCAGGCCACAGCACTGTT(SEQ ID NO:36) TCRα-5 TCTGTGATATACACATCAGAATC(SEQ ID NO:37) TCRα-6 TGACACATTTGTTTGAGAATCAA(SEQ ID NO:38) TCRα-7 TTTGAGAATCAAAATCGGTGAAT(SEQ ID NO:39) TCRα-8 AGAATCAAAATCGGTGAATAGGC(SEQ ID NO:40) TCRα-9 GAGTCTCTCAGCTGGTACACGGC(SEQ ID NO:41) TCRβ-1 AGCCATCAGAAGCAGAGATCTCC (SEQ ID NO:42) TCRβ-2 CCTCGGTGTCCTACCAGCAAGGGG(SEQ ID NO:43) TCRβ-3 GCCCTATCCTGGGTCCACTCGTCA(SEQ ID NO:44) TCRβ-4 GGTGTGGGAGATCTCTGCTTCTGA(SEQ ID NO:45) CD52-1 TATCTGTACCATAACCAGGAGGC(SEQ ID NO:46) CD52-2 TCCTGAGAGTCCAGTTTGTATCT(SEQ ID NO:47) CD52-3 GCTGGTGTCGTTTTGTCCTGAGA(SEQ ID NO:48) CD52-4 CTTTTCTTCGTGGCCAATGCCAT(SEQ ID NO:49) CD52-5 TTCGTGGCCAATGCCATAATCCA(SEQ ID NO:50) B2m-1 ATCCATCCGACATTGAAGTTGAC(SEQ ID NO:51) B2m-2 GCTGTGCTCGCGCTACTCTCTCT(SEQ ID NO:52) PD-1 ACCTTCCGCTCACCTCCGCCTGAG(SEQ ID NO:53) PD-2 TGCCCTTCCAGAGAGAAGGGCAG(SEQ ID NO:54) PD-3 TCTGCAGGGACAATAGGAGCCAG(SEQ ID NO:55) PD-4 TCCTCAAAGAAGGAGGACCCCTC(SEQ ID NO:56) PD-5 CAGTGGCGAGAGAAGACCCGGA(SEQ ID NO:57) PD-6 CTAGCGGAATGGGCACCTCATCC(SEQ ID NO:58) PD-7 CTCAGGAGAAGCAGGCAGGGTGC (SEQ ID NO:59) PD-8 CAACACATCGGAGAGCTTCGTGC(SEQ ID NO:60) PD-9 ATCTGCGCCTTGGGGGCCAGGGA(SEQ ID NO:61)

[0223] Figure 11 B shows that, in sequential electroporation mode, catRNA produced gene destruction efficiency three times that of crRNA and 1.5 times that of caRNA. When using Cpf1 mRNA and catRNA in a single electroporation, approximately 20% gene destruction could be achieved; however, neither crRNA nor caRNA yielded detectable gene destruction. Figure 11 A).

[0224] Flow cytometry confirmed high levels of surface CAR transgene expression and elimination of endogenous genes. 5 x 10⁵ cells were transfected with 20 μg of in vitro transcribed LbCpf1 mRNA alone or with 10 μg of chimeric catRNA targeting different genes or combinations thereof. 6 10 CD4+CD8 T cells were transfected. Three days post-transfection, the corresponding antibody or combination thereof specific to the target gene was used for flow cytometry analysis. In this example, the same CD4+CD8 T cells transfected only with LbCpf1 mRNA (i.e., without catRNA) were used as a control. Results are as follows: Figure 12-17 As shown.

[0225] Figure 12Flow cytometry results of catRNAs targeting TRAC or TRBC are shown, with a CD3 antibody used to detect the TCR / CD3 complex expressed on CART cells. The number of positive cells detected with the TCR / CD3 marker was approximately 96.5% without catRNA, which significantly decreased to 9.57% with TRAC-catRNA and to 26.8% with TRBC-catRNA. These results confirm the successful disruption of TRAC or TRBC using catRNA in CD4+CD8 cells. Negative cells that do not express TRAC or TRBC are useful CART cells.

[0226] Figure 13 The flow cytometry results for catRNA targeting CD52 are shown. When catRNA was not used, the number of positive cells detected with the CD52 marker was approximately 97.7%, which significantly decreased to 41.7% in the case of CD52-catRNA. This result confirms that the use of catRNA successfully disrupts CD52 in CD4+CD8 cells. Negative cells that do not express CD52 are useful CAR-T cells.

[0227] Figure 14 Flow cytometry results targeting both TCR and CD52 catRNAs are shown, with a CD3 antibody used to detect the TCR / CD3 complex expressed in CAR-T cells. Without catRNAs, the number of positive cells detected using CD3 / CD52 markers was approximately 98.2%. With TRBC and CD52 catRNAs, the TCR / CD52 double-deficient cell population reached 68.7%, and with TRBC and CD52 catRNAs, the TCR / CD52 double-deficient cell population increased to 57.2%. These results confirm the successful disruption of both TCR and CD52 using catRNAs in CD4+CD8 cells. Negative cells that do not express TCR and CD52 are useful CAR-T cells.

[0228] Figure 15 Flow cytometry results for catRNA targeting B2M are shown. The number of positive cells detected with the B2M marker was approximately 96.5% without catRNA, which significantly decreased to 22.1% with B2M-catRNA. This result confirms the successful disruption of B2M in CD4+CD8 cells using catRNA. Negative cells that do not express B2M are useful CAR-T cells.

[0229] Figure 16Flow cytometry results targeting both TCR and B2M catRNAs are shown, with a CD3 antibody used to detect the TCR / CD3 complex expressed in CART cells. Without catRNA, the number of positive cells detected using the CD3 / B2M marker was approximately 98.5%. With TRBC and B2M catRNA, the TCR / B2M double-deficient cell population reached 55.8%, and with TRBC and B2M catRNA, this increased to 60.4%. These results confirm the successful disruption of both TCR and B2M in CD4+CD8 cells using catRNA. Negative cells that do not express TCR and B2M are useful CART cells.

[0230] Figure 17 The flow cytometry results for catRNA targeting PD1 are shown. When catRNA was not used, the number of positive cells detected with the PD1 marker was approximately 96.8%, which significantly decreased to 26.1% in the case of PD1-catRNA. These results confirm that catRNA successfully disrupts PD1 in CD4+CD8 cells. PD1-negative cells are useful CAR-T cells.

[0231] Example 9: Preparation of gene-edited CAR-T cells

[0232] We also prepared gene-edited CAR-T cells using the method according to the present invention. In this embodiment, CD4+CD8 T cells from three healthy human donors were used as raw materials.

[0233] Transcribed Cpf1 mRNA and chimeric guide crRNA were electroporated into T cells in vitro according to the following protocol. In short, T cells were first stimulated with anti-CD3 / CD28 beads at a bead:cell ratio of 3:1, and one day later, the CAR transgene was introduced via lentiviral transduction. Then, 2 to 4 days post-stimulation, T cells were washed twice with Opti-MEM and resuspended in Opti-MEM to a final concentration of 1 × 10⁻⁶. 7 Cells / ml. Cells (0.1 ml) were then mixed with the prepared Cpf1-catRNA complex (obtained by pre-incubating 5 μg LbCpf1 protein with 20 μg catRNA at room temperature for 10 min) and electroporated in 2 mm cuvettes using a BTX830 electroporator (Harvard Apparatus BTX) at 400 V for 700 μs. Immediately after electroporation, cells were placed in 2 ml of preheated antibiotic-free medium and incubated at 37 °C and 5% CO2. Cells were harvested 72 h after electroporation for genomic DNA extraction, and gene destruction efficiency was determined by flow cytometry.

[0234] Figure 18 This indicates that electroporation of Cpf1 protein and catRNA targeting TRAC and CD52 significantly disrupted TCR / CD52 expression in T cells from three donors. sequence list <110> Nanjing Beiheng Biotechnology Co., Ltd. <120> Engineered chimeric guide RNA and its applications <160> 61 <170> SIPOSequenceListing 1.0 <210> 1 <211> 50 <212> DNA <213> Artificial Sequence <400> 1 gaatttctac taagtgtaga tctgatggtc catgtctgtt actctttttt 50 <210> 2 <211> 50 <212> DNA <213> Artificial Sequence <400> 2 gaatttctac taagtgtaga tctaggaata ttgaaggggg caggtttttt 50 <210> 3 <211> 50 <212> DNA <213> Artificial Sequence <400> 3 gaatttctac taagtgtaga tgtgctcaat gaaaggagat aaggtttttt 50 <210> 4 <211> 76 <212> DNA <213> Artificial Sequence <400> 4 gaatttctac taagtgtaga tctgatggtc catgtctgtt actcaatttc tactaagtgt 60 agattttttt aaaaaa 76 <210> 5 <211> 76 <212> DNA <213> Artificial Sequence <400> 5 gaatttctac taagtgtaga tctaggaata ttgaaggggg caggaatttc tactaagtgt 60 agattttttt aaaaaa 76 <210> 6 <211> 76 <212> DNA <213> Artificial Sequence <400> 6 gaatttctac taagtgtaga tgtgctcaat gaaaggagat aaggaatttc tactaagtgt 60 agattttttt aaaaaa 76 <210> 7 <211> 118 <212> DNA <213> Artificial Sequence <400> 7 gccagtggtc tagtggtaga atagtaccct gccacggtac agacccgggt tcgattcccg 60 gctggaaata atttctacta agtgtagatc tgatggtcca tgtctgttac tctttttt 118 <210> 8 <211> 118 <212> DNA <213> Artificial Sequence <400> 8 gccagtggtc tagtggtaga atagtaccct gccacggtac agacccgggt tcgattcccg 60 gctggaaata atttctacta agtgtagatc taggaatatt gaagggggca ggtttttt 118 <210> 9 <211> 124 <212> DNA <213> Artificial Sequence <400> 9 gccagtggtc tagtggtaga atagtaccct gccacggtac agacccgggt tcgattcccg 60 gctggaaata atttctacta agtgtagatg tgctcaatga aaggagataa ggttttttaa 120 aaaa 124 <210> 10 <211> 144 <212> DNA <213> Artificial Sequence <400> 10 gccagtggtc tagtggtaga atagtaccct gccacggtac agacccgggt tcgattcccg 60 gctggaaata atttctacta agtgtagatc tgatggtcca tgtctgttac tcaatttcta 120 ctaagtgtag atttttttaa aaaa 144 <210> 11 <211> 144 <212> DNA <213> Artificial Sequence <400> 11 gccagtggtc tagtggtaga atagtaccct gccacggtac agacccgggt tcgattcccg 60 gctggaaata atttctacta agtgtagatc taggaatatt gaagggggca ggaatttcta 120 ctaagtgtag atttttttaa aaaa 144 <210> 12 <211> 144 <212> DNA[[ID=ll]] <213> Artificial Sequence <400> 12 gccagtggtc tagtggtaga atagtaccct gccacggtac agacccgggt tcgattcccg 60 gctggaaata atttctacta agtgtagatg tgctcaatga aaggagataa ggaatttcta 120 ctaagtgtag atttttttaa aaaa 144 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <400> 13 tcagcaccat ttgttaaaga cac 23 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <400> 14 cgcgcgaaaa gccggggcgc ctg 23 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <400> 15 tgagagccct tgagtaaagt cct 23 <210> 16 <211> twenty three <212> DNA <213> Artificial Sequence <400> 16 tgacctccca aacagctaca tat 23 <210> 17 <211> twenty three <212> DNA <213> Artificial Sequence <400> 17 ctgctccctc ctcgccaatg ccc 23 <210> 18 <211> twenty three <212> DNA <213> Artificial Sequence <400> 18 tccccaaatc actgtggatt ttg 23 <210> 19 <211> twenty four <212> DNA <213> Artificial Sequence <400> 19 ctgatggtcc atgtctgtta ctcg 24 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <400> 20 ctgatggtcc atgtctgtta 20 <210> twenty one <211> 18 <212> DNA <213> Artificial Sequence <400> twenty one ctgatggtcc atgtctgt 18 <210> twenty two <211> 17 <212> DNA <213> Artificial Sequence <400> twenty two ctgatggtcc atgtctg 17 <210> twenty three <211> 16 <212> DNA <213> Artificial Sequence <400> twenty three ctgatggtcc atgtct 16 <210> twenty four <211> 15 <212> DNA <213> Artificial Sequence <400> twenty four ctgatggtcc atgtc 15 <210> 25 <211> 14 <212> DNA <213> Artificial Sequence <400> 25 ctgatggtcc atgt 14 <210> 26 <211> twenty four <212> DNA <213> Artificial Sequence <400> 26 ctaggaatat tgaagggggc aggg 24 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <400> 27 ctaggaatat tgaagggggc 20 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <400> 28 ctaggaatat tgaagggg 18 <210> 29 <211> 17 <212> DNA <213> Artificial Sequence <400> 29 ctaggaatat tgaaggg 17 <210> 30 <211> 16 <212> DNA <213> Artificial Sequence <400> 30 ctaggaatat tgaagg 16 <210> 31 <211> 15 <212> DNA <213> Artificial Sequence <400> 31 ctaggaatat tgaag 15 <210> 32 <211> 14 <212> DNA <213> Artificial Sequence <400> 32 ctaggaatat tgaa 14 <210> 33 <211> twenty three <212> DNA <213> Artificial Sequence <400> 33 attctcaaac aaatgtgtca caa 23 <210> 34 <211> twenty three <212> DNA <213> Artificial Sequence <400> 34 catgtgcaaa cgccttcaac aac 23 <210> 35 <211> twenty three <212> DNA <213> Artificial Sequence <400> 35 cacatgcaaa gtcagatttg ttg 23 <210> 36 <211> twenty three <212> DNA <213> Artificial Sequence <400> 36 ttgctccagg ccacagcact gtt 23 <210> 37 <211> twenty three <212> DNA <213> Artificial Sequence <400> 37 tctgtgatat acacatcaga atc ​​23 <210> 38 <211> twenty three <212> DNA <213> Artificial Sequence <400> 38 tgacacattt gtttgagaat caa 23 <210> 39 <211> twenty three <212> DNA <213> Artificial Sequence <400> 39 tttgagaatc aaaatcggtg aat 23 <210> 40 <211> twenty three <212> DNA <213> Artificial Sequence <400> 40 agaatcaaaa tcggtgaata ggc 23 <210> 41 <211> twenty three <212> DNA <213> Artificial Sequence <400> 41 gagtctctca gctggtacac ggc 23 <210> 42 <211> twenty three <212> DNA <213> Artificial Sequence <400> 42 agccatcaga agcagagatc tcc 23 <210> 43 <211> twenty four <212> DNA <213> Artificial Sequence <400> 43 cctcggtgtc ctaccagcaa gggg 24 <210> 44 <211> twenty four <212> DNA <213> Artificial Sequence <400> 44 gccctatcct gggtccactc gtca 24 <210> 45 <211> twenty four <212> DNA <213> Artificial Sequence <400> 45 ggtgtgggag atctctgctt ctga 24 <210> 46 <211> twenty three <212> DNA <213> Artificial Sequence <400> 46 tatctgtacc ataaccagga ggc 23 <210> 47 <211> twenty three <212> DNA <213> Artificial Sequence <400> 47 tcctgagagt ccagtttgta tct 23 <210> 48 <211> twenty three <212> DNA <213> Artificial Sequence <400> 48 gctggtgtcg ttttgtcctg aga 23 <210> 49 <211> twenty three <212> DNA <213> Artificial Sequence <400> 49 cttttcttcg tggccaatgc cat 23 <210> 50 <211> twenty three <212> DNA <213> Artificial Sequence <400> 50 ttcgtggcca atgccataat cca 23 <210> 51 <211> twenty three <212> DNA <213> Artificial Sequence <400> 51 atccatccga cattgaagtt gac 23 <210> 52 <211> twenty three <212> DNA <213> Artificial Sequence <400> 52 gctgtgctcg cgctactctc tct 23 <210> 53 <211> twenty four <212> DNA <213> Artificial Sequence <400> 53 accttccgct cacctccgcc tgag 24 <210> 54 <211> twenty three <212> DNA <213> Artificial Sequence <400> 54 tgcccttcca gagagaaggg cag 23 <210> 55 <211> twenty three <212> DNA <213> Artificial Sequence <400> 55 tctgcaggga caataggagc cag 23 <210> 56 <211> twenty three <212> DNA <213> Artificial Sequence <400> 56 tcctcaaaga aggaggaccc ctc 23 <210> 57 <211> twenty three <212> DNA <213> Artificial Sequence <400> 57 cagtggcgag agaagacccc gga 23 <210> 58 <211> twenty three <212> DNA <213> Artificial Sequence <400> 58 ctagcggaat gggcacctca tcc 23 <210> 59 <211> twenty three <212> DNA <213> Artificial Sequence <400> 59 ctcaggagaa gcaggcaggg tgc 23 <210> 60 <211> twenty three <212> DNA <213> Artificial Sequence <400> 60 caacacatcg gagagcttcg tgc 23 <210> 61 <211> twenty three <212> DNA <213> Artificial Sequence <400> 61 atctgcgcct tgggggccag gga 23

Claims

1. An engineered chimeric guide RNA comprising: (1) At least one crRNA sequence suitable for the CRISPR / Cpf1 system; and (2) At least one additional direct repeat sequence and small RNA species, The crRNA sequence is capable of hybridizing with the target site, and the additional direct repeat sequence and / or small RNA species confer increased stability to the chimeric guide RNA; the small RNA species is a truncated form of pre-tRNA, which is a pre-tRNA with the recipient stem region truncated. The truncated pre-tRNA is attached to the 5' end of the crRNA sequence; the additional direct repeat sequence is attached to the 3' end of the crRNA sequence.

2. The engineered chimeric guide RNA of claim 1, wherein the engineered chimeric guide RNA comprises a crRNA sequence, an additional direct repeat sequence, and a truncated form of pre-tRNA.

3. The engineered chimeric guide RNA of claim 1 or 2, further comprising one or more elements selected from the untranslated region (UTR), polyA, and 5'-methylguanosine cap.

4. The engineered chimeric guide RNA of claim 1, wherein the crRNA comprises a spacer sequence of 10-30 bp in length.

5. The engineered chimeric guide RNA of claim 1, wherein the engineered chimeric guide RNA targets one or more target sites.

6. The engineered chimeric guide RNA of claim 5, wherein the target site is located in the same or different DNA sequences.

7. The engineered chimeric guide RNA of claim 1, wherein the engineered chimeric guide RNA is in the form of a pool or an array.

8. A CRISPR / Cpf1 system comprising: (a) one or more engineered chimeric guide RNAs according to any one of claims 1-7, or one or more polynucleotide sequences encoding an engineered chimeric guide RNA according to any one of claims 1-7; and (b) Cpf1 protein, or one or more polynucleotide sequences encoding Cpf1 protein.

9. The CRISPR / Cpf1 system of claim 8, wherein components (a) and (b) are polynucleotide sequences located on the same or different vectors.

10. The CRISPR / Cpf1 system of claim 8, wherein the system further comprises Mg 2+ .

11. The CRISPR / Cpf1 system of claim 8, wherein the Cpf1 protein contains one or more nuclear localization signals.

12. A cell or its descendants comprising the system of any one of claims 8-11.

13. A method for in vitro modification of a target site, comprising delivering a CRISPR / Cpf1 system comprising the following to the site: (a) one or more engineered chimeric guide RNAs according to any one of claims 1-7, or one or more polynucleotide sequences encoding an engineered chimeric guide RNA according to any one of claims 1-7; and (b) Cpf1 protein, or one or more polynucleotide sequences encoding Cpf1 protein.

14. A method for in vitro altering the expression of at least one target gene, comprising delivering a CRISPR / Cpf1 system comprising the following to said target gene: (a) one or more engineered chimeric guide RNAs according to any one of claims 1-7, or one or more polynucleotide sequences encoding an engineered chimeric guide RNA according to any one of claims 1-7; and (b) Cpf1 protein, or one or more polynucleotide sequences encoding Cpf1 protein.

15. The method of claim 13 or 14, wherein the components (a) and (b) of the CRISPR / Cpf1 system are delivered together or separately.

16. The method of claim 13, wherein the target site is intracellular.

17. The method of claim 14, wherein the target gene is intracellular.

18. The method of claim 16 or 17, wherein the cell is a eukaryotic cell.

19. The method of claim 13, wherein the target site is contained in an in vitro DNA molecule.

20. A method for preparing engineered T cells, comprising the following steps: (a) Genetically modifying T cells by introducing and / or expressing a composition in cells, said composition comprising at least: a Cpf1 protein and one or more engineered chimeric guide RNAs according to any one of claims 1-7; and (b) Cells obtained by in vitro expansion.

21. The method of claim 20, further comprising the step (a') of transfecting chimeric antigen receptors into T cells.

22. The method of claim 21, wherein step (a') is performed before, after, or simultaneously with step (a) of genetically modifying T cells.

23. The method of any one of claims 20-22, wherein the T cells are derived from donor peripheral blood mononuclear cells (PBMCs) or umbilical cord blood.

24. The method of any one of claims 20-22, wherein the T cells are derived from inflammatory T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, or helper lymphocytes.

25. The method of any one of claims 20-22, wherein the T cells are CD4+ T lymphocytes and / or CD8+ T lymphocytes.

Images