An aspergillus nidulans chitin deacetylase mutant

Abstract

This invention discloses a Aspergillus nidulans Chitin deacetylase mutant, characterized by: fungi Aspergillus nidulans The amino acid sequence of the chitin deacetylase underwent the following mutations: leucine (L) at position 139 was mutated to glycine (G), lysine (K) at position 164 was mutated to glutamic acid (E), tyrosine (Y) at position 166 was mutated to tryptophan (W), alanine (A) at position 171 was mutated to tryptophan (W), alanine (A) at position 195 was mutated to glutamic acid (E), and histidine (H) at position 199 was mutated to asparagine (D). The fungus... Aspergillus nidulans The amino acid sequence of chitin deacetylase is accessed in GenBank under the number XM_677557.1. This invention modifies the chitin deacetylase gene through site-directed mutagenesis, thereby increasing the catalytic activity of the encoded chitin deacetylase. The specific activity is 2.95 times that of the wild-type enzyme, which greatly improves the catalytic efficiency of chitin deacetylase. It is also suitable for industrial production needs and is worthy of promotion.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology and discloses mutants of chitin deacetylase from marine bacteria A. nidulans, particularly a mutant of chitin deacetylase from Aspergillus nidulans. Background Technology

[0002] Chitin, also known as chitosan or chitin, is widely found in the exoskeletons of crustaceans such as shrimp and crabs, as well as in the cell walls of algae and fungi. It is a common natural organic compound composed of N-acetyl-D-glucosamine linked by β-1,4 glycosidic bonds. It is poorly soluble in water and organic solvents, limiting its development and application. However, chitosan, obtained by removing more than 55% of the acetyl groups from chitin, is also called deacetylated chitin, chitosan amine, or soluble chitin. It is a derivative produced from chitin through a certain degree of deacetylation, is readily soluble in water, can undergo various chemical modifications, and has wide applications in medicine, food, and agriculture. Current methods for producing chitosan from chitin via deacetylation include the chemical thermal alkaline method and the bio-enzymatic method. The chemical method suffers from severe pollution, difficulty in controlling the reaction process, and unstable product molecular weight. Most seriously, the emissions cause significant environmental pollution and severe damage to the surrounding ecosystem. In contrast, the bio-enzymatic method is mild, environmentally friendly, and can produce high-quality chitosan; therefore, the bio-enzymatic method is more widely used. Chitin deacetylase (CDA, EC3.2.1.41) is a glycosyl hydrolase that removes the acetyl group from the chitin molecule through catalysis, thereby forming chitosan. Current research on chitin deacetylase mainly focuses on strain selection, enzyme purification, expression, enzymatic properties, and fermentation process improvement. While these methods can yield strains with high enzyme activity in a short time, they are limited by the enzyme production level of wild-type bacteria, making it difficult to screen for novel chitin deacetylase strains with high catalytic efficiency. With the rapid development of enzyme engineering, especially directed evolution technology, this invention discloses a chitin deacetylase mutant from the marine bacterium *Aspergillus nidulans* (*A. nidulans*) to improve enzyme catalytic efficiency. The aim is to improve the enzyme's catalytic properties by utilizing site-directed mutagenesis, site-directed saturation mutagenesis, and DNA-shuffling techniques, altering the optimal catalytic temperature and pH, thereby increasing the enzyme's catalytic efficiency. Summary of the Invention

[0003] This invention mutates the chitin deacetylase of the marine bacterium A. nidulans. Compared to the unmutated enzyme, the specific activity of the mutant enzyme is 2.95 times that of the wild-type enzyme, greatly improving the catalytic efficiency of chitin deacetylase and making it more suitable for industrial production. The specific scheme is as follows: A mutant of chitin deacetylase from *Aspergillus nidulans* is disclosed, wherein the amino acid sequence of the fungal chitin deacetylase has been mutated as follows: leucine (L) at position 139 is mutated to glycine (G), lysine (K) at position 164 is mutated to glutamic acid (E), tyrosine (Y) at position 166 is mutated to tryptophan (W), alanine (A) at position 171 is mutated to tryptophan (W), alanine (A) at position 195 is mutated to glutamic acid (E), and histidine (H) at position 199 is mutated to aspartic acid (D). The amino acid sequence of the fungal chitin deacetylase from *Aspergillus nidulans* is accessed in GenBank under the number XM_677557.1.

[0004] A method for preparing the Aspergillus nidulans chitin deacetylase mutant as described in claim 1, comprising the following steps: site-directed mutagenesis of the gene encoding chitin deacetylase using designed primers, followed by expression, and induction of expression in engineered bacteria containing the gene encoding the mutant chitin acetylase. (1) Codon optimization and biosynthesis were performed using the gene sequence of Aspergillus nidulans chitin deacetylase; (2) Construct the expression plasmid AnCDA-pPICZalphaA; (3) Using a plasmid containing chitin deacetylase as a template, primers were designed to induce mutations; (4) The mutated plasmid was transformed into E. coliDH5α for amplification; (5) After linearizing the extracted plasmid, it was transformed into Pichia pastoris X33. Single clones were selected for transformation and induced expression to obtain mutants with higher enzyme activity. (6) Recombinant Pichia pastoris X33 containing the gene encoding chitin deacetylases was methanol-induced to produce chitin deacetylases mutants.

[0005] Furthermore, the primers for the site-directed mutagenesis are as follows: 139primerF: 5' CATATATGCGTCCGCCGTATGGAGAAACCAATGAATTAGTTC 3' 139primerR:5'GAACTAATTCATTGGGTTTCTCCATACGGCGGACGCATATATG3' 164primerF: 5' GCCAGCGTGGATACCGAAGATTATGAAAATC 3' 164primerR:5' GATTTTCATAATCTTCGGTATCCACGCTGGC 3' 166primerF: 5' CGTGGATACCGAAGATTGGGAAAATCAGGATGCAG 3' 166primerR:5' CTGCATCCTGATTTTCCCAATCTTCGGTATCCACG 3' 171primerF:5' GATTGGGAAAATCAGGATTGGGATGCCATTATTAATACC 3' 171primerR:5' GGTATTAATAATGGCATCCCAATCCTGATTTTCCCAATC 3' 195primerF:5' CAGGTGGTAATATTGTGCTGGAGCATGATATTCATTATTGGACC 3' 195primerR:5' GGTCCAATAATGAATATCATGCTCCAGCACAATATTACCACCTG 3' 199primerF:5' CTGGAGCATGATATTGATTATTGGACCGTGG 3' 199primerR:5' CCACGGTCCAATAATCAATATCATGCTCCAG 3'.

[0006] Furthermore, step (6) specifically involves: administering the recombinant bacteria pPICZalphaA-An containing the gene encoding a mutant chitin deacetylase. CDA was plated on YPD plates containing 100 μg / mL bleomycin until single colonies were formed. Multiple single colonies were picked and validated using primers to induce expression. Heterologous recombinant bacteria were then inoculated into 20 mL of BMGY liquid medium and cultured at 28°C and 200 rpm until OD600 was reached. Once the expression level reaches 2.0-6.0, the cells are collected by centrifugation at 3000 rpm for 1 min, the supernatant is discarded, and the cells are resuspended in 50 mL of BMMY liquid medium. The cells are then cultured at 28°C and 200 rpm, with 0.5% methanol added every 24 hours. After induction for 7 days until the peak expression level is reached, the cells are centrifuged, and the supernatant is the An... CDA crude enzyme solution.

[0007] Furthermore, the BMGY liquid culture medium comprises: 10 g / L yeast extract, 20 g / L peptone, 10 ml / L glycerol, and 0.1 mol / L pH 7.0 potassium phosphate buffer. It is sterilized at 121 °C for 20 min, cooled, and then 100 mL of 10×YNB solution and 2 mL of 500×Biotin solution are added. It is then stored at 4 °C.

[0008] Furthermore, the BMMY liquid culture medium comprises: 10 g / L yeast extract, 20 g / L peptone, 0.1 mol / L potassium phosphate buffer at pH 7.0, sterilized at 121°C for 20 min, cooled, 100 mL of 10×YNB solution, 2 mL of 500×Biotin solution, and 1 mL of filtered sterilized methanol, and stored at 4°C.

[0009] Compared with the prior art, the present invention has the following beneficial effects: This invention modifies the chitin deacetylase gene through site-directed mutagenesis, increasing the catalytic activity of the encoded chitin deacetylase. The specific activity of the mutant enzyme is 2.95 times that of the wild-type enzyme, while other catalytic properties remain largely unchanged. The chitin deacetylase provided by this invention is more suitable for industrial production needs, meets the requirements of social production, and greatly improves the catalytic efficiency of chitin deacetylase. It is applicable to industrial production needs and is worthy of promotion. Detailed Implementation

[0010] This invention provides a chitin deacetylase mutant with enhanced catalytic activity. The mutant is based on GenBank accession number XM_677557.1 and has undergone the following mutations: leucine (L) at position 139 is mutated to glycine (G), lysine (K) at position 164 is mutated to glutamic acid (E), tyrosine (Y) at position 166 is mutated to tryptophan (W), alanine (A) at position 171 is mutated to tryptophan (W), alanine (A) at position 195 is mutated to glutamic acid (E), and histidine (H) at position 199 is mutated to aspartic acid (D).

[0011] This invention provides a method for identifying mutant amino acids. By comparing the sequence of A. nidulans chitin deacetylase with chitin deacetylase sequences with a sequence similarity higher than 80% using BLAST, different amino acid sites are identified. Furthermore, by simulating the tertiary structure of A. nidulans chitin deacetylase using SWISS-MODEL, it was found that leucine (L) at position 139, lysine (K) at position 164, alanine (A) at position 171, and histidine (H) at position 199 are located in a random coil structure near the catalytic center; tyrosine (Y) at position 166 is located in an α-helix structure near the catalytic center; and alanine (A) at position 195 is located in a β-sheet structure near the catalytic center. Mutations in these structures are expected to alter the catalytic domain and change substrate binding capacity and catalytic efficiency.

[0012] This invention provides a method for constructing the chitin deacetylase mutant, which involves designing primers to perform site-directed mutagenesis on the gene encoding chitin deacetylase and then expressing it. Specifically, the construction method involves codon optimization of the *A. nidulans* chitin deacetylase gene sequence followed by biosynthesis to construct the expression plasmid An. CDA-pPICZalphaA was used as a template with a plasmid containing chitin deacetylases. Primers were designed for mutation, and the mutated plasmid was transformed into E. coli DH5α for amplification. The plasmid was then extracted, linearized, and transformed into Pichia pastoris X33. Single clones were selected for transformation and induced expression to obtain mutants with higher enzyme activity. The primers used for site-directed mutagenesis are shown below: 139primerF: 5' CATATATGCGTCCGCCGTATGGAGAAACCAATGAATTAGTTC 3' 139primerR: 5' GAACTAATTCATTGGGTTTCTCCATACGGCGGACGCATATATG 3' 164primerF: 5' GCCAGCGTGGATACCGAAGATTATGAAAATC 3' 164primerR:5' GATTTTCATAATCTTCGGTATCCACGCTGGC 3' 166primerF: 5' CGTGGATACCGAAGATTGGGAAAATCAGGATGCAG 3' 166primerR:5' CTGCATCCTGATTTTCCCAATCTTCGGTATCCACG 3' 171primerF:5' GATTGGGAAAATCAGGATTGGGATGCCATTATTAATACC 3' 171primerR:5' GGTATTAATAATGGCATCCCAATCCTGATTTTCCCAATC 3' 195primerF:5' CAGGTGGTAATATTGTGCTGGAGCATGATATTCATTATTGGACC 3' 195primerR:5' GGTCCAATAATGAATATCATGCTCCAGCACAATATTACCACCTG 3' 199primerF:5' CTGGAGCATGATATTGATTATTGGACCGTGG 3' 199primerR:5' CCACGGTCCAATAATCAATATCATGCTCCAG 3'.

[0013] This invention provides a method for producing a chitin deacetylase mutant using genetically engineered bacteria through fermentation. Recombinant Pichia pastoris X33 (pPICZalphaA-AnCDA) containing the gene encoding the mutant chitin deacetylase is induced to express the enzyme with methanol. Specifically, the recombinant bacteria are inoculated into 2 mL of YPD medium and cultured until single colonies are produced. After verification, heterologous recombinant bacteria are transferred and inoculated at 1% in a 250 mL Erlenmeyer flask containing 20 mL of BMGY medium. The culture is maintained at 28°C and 200 rpm until the OD600 reaches 2.0-6.0. The cells are collected by centrifugation in sterile centrifuge tubes and resuspended in 50 mL of BMMY medium. Expression is induced at 28°C, with methanol added every 24 hours to a final concentration of 0.5% or 1%. After 7 days of induction, the supernatant is collected by centrifugation to obtain the Aspergillus nidulans chitin deacetylase solution. Example

[0014] Implementation Example 1: Construction of Mutant Expression Plasmids and Obtaining Recombinant Pichia pastoris Yeast expression codons were optimized based on the AnCDA gene sequence XM_677557.1 from GenBank. The optimized enzyme gene was synthesized by GenScript Biotech Co., Ltd. An EcoRI restriction site was added to the 5' end of the target gene, and a histidine tag and a NotI restriction site were added to the 3' end. Primers were designed using Primer Premier 5.0. AnCDA-EcoRI-F: GGAATTCATGTTCGCAACCCTGGCCCTGGTGT AnCDA-NotI-R: ATAAGAATGCGGCCGCTTAATGATGGTGATGATGATGATGATACCAGGCAATTT The synthesized AnCDA gene was used as a template and the above primers were used for PCR amplification. The PCR amplification conditions were: 94 ℃ for 5 min, 32 cycles (94 ℃ for 30 s, 55 ℃ for 30 s, 68 ℃ for 30 s), and terminated at 4 ℃.

[0015] The PCR product was recovered by gel electrophoresis, yielding a band of approximately 700 bp. The purified DNA and pPICZalphaA plasmid were double-digested with EcoRI and NotI, respectively. The plasmid and AnCDA were then ligated using T4 ligase to construct the recombinant vector pPICZalphaA-AnCDA. CDA. The Hanahan method, a molecular cloning experimental guide, was used to transform E. coli DH5α. The recombinant E. coli DH5α was plated on low-salt LB medium containing Zecoin (100 μg / mL) and cultured overnight at 37 °C. Positive clones were screened, and plasmids were extracted using a plasmid extraction kit and sequenced.

[0016] By comparing the sequence of A. nidulans chitin deacetylase with chitin deacetylases with a sequence similarity of more than 80% using BLAST, different amino acid sites were identified. Further simulation of the tertiary structure of A. nidulans chitin deacetylase using SWISS-MODEL revealed that leucine (L) at position 139, lysine (K) at position 164, alanine (A) at position 171, and histidine (H) at position 199 are located in a random coil structure near the catalytic center; tyrosine (Y) at position 166 is located in an α-helix structure near the catalytic center; and alanine (A) at position 195 is located in a β-sheet structure near the catalytic center. Mutations in these structures are expected to alter the catalytic domain and change substrate binding ability and catalytic efficiency.

[0017] Primers were designed to mutate the Pichia pastoris recombinant vector pPICZalphaA-AnCDA as a template. The mutated plasmid was linearized and transformed into Pichia pastoris X33 for amplification. Positive clones were screened and induced to express the mutants with enhanced activity.

[0018] The primers used for site-directed mutagenesis are: 139primerF: 5' CATATATGCGTCCGCCGTATGGAGAAACCAATGAATTAGTTC 3' 139primerR: 5' GAACTAATTCATTGGGTTTCTCCATACGGCGGACGCATATATG 3' 164primerF: 5' GCCAGCGTGGATACCGAAGATTATGAAAATC 3' 164primerR:5' GATTTTCATAATCTTCGGTATCCACGCTGGC 3' 166primerF: 5' CGTGGATACCGAAGATTGGGAAAATCAGGATGCAG 3' 166primerR:5' CTGCATCCTGATTTTCCCAATCTTCGGTATCCACG 3' 171primerF:5' GATTGGGAAAATCAGGATTGGGATGCCATTATTAATACC 3' 171primerR:5' GGTATTAATAATGGCATCCCAATCCTGATTTTCCCAATC 3' 195primerF:5' CAGGTGGTAATATTGTGCTGGAGCATGATATTCATTATTGGACC 3' 195primerR:5' GGTCCAATAATGAATATCATGCTCCAGCACAATATTACCACCTG 3' 199primerF:5' CTGGAGCATGATATTGATTATTGGACCGTGG 3' 199primerR:5' CCACGGTCCAATAATCAATATCATGCTCCAG 3' Add 22 μL of ddH2O, 1 μL each of upstream and downstream primers, 1 μL of template DNA, and 25 μL of premix taq to the PCR tube.

[0019] After mixing, PCR amplification was performed under the following conditions: 94 ℃ for 5 min, 32 cycles (94 ℃ for 30 s, annealing for 30 s, 72 ℃ for 60 s), terminated at 10 ℃. The annealing temperature was related to the primer Tm value.

[0020] The amplified products were detected by 1.0% agarose gel electrophoresis and then sequenced. The PCR amplified products were purified by 1.0% agarose gel electrophoresis, and then double-digested with the expression vector pPICZalphaA. The digested fragments were recovered by 1% agarose gel electrophoresis and electroporated into competent Pichia pastoris X33. The recombinant bacteria were plated on YPD plates containing 100 μg / mL bleomycin until single colonies were generated. Multiple single colonies were picked and verified with primers to induce expression.

[0021] Implementation Example 2: Induced Expression of Recombinant Bacteria (1) BMGY liquid culture medium: Prepared with 10 g / L yeast extract, 20 g / L peptone, 10 ml / L glycerol, and 0.1 mol / L pH7.0 potassium phosphate buffer. Sterilize at 121 °C for 20 min. After cooling, add 100 mL of 10×YNB solution and 2 mL of 500×Biotin solution. Store at 4 °C for later use.

[0022] (2) BMMY liquid culture medium: Prepared with 10 g / L yeast extract, 20 g / L peptone, 0.1 mol / L, pH 7.0 potassium phosphate buffer, sterilized at 121 ℃ for 20 min, cooled, 100 mL of 10×YNB solution, 2 mL of 500×Biotin solution, 1 mL of sterilized methanol filtered, and stored at 4 ℃ for later use.

[0023] (3) Induction of recombinant bacterial expression: Recombinant bacteria were picked and inoculated into 20 mL of BMGY liquid medium. They were cultured at 28℃ and 200 r / min until the OD600 reached 2.0-6.0. The cells were collected by centrifugation at 3000 r / min for 1 min. The supernatant was discarded and the cells were resuspended in 50 mL of BMMY liquid medium. The cells were cultured at 28℃ and 200 r / min. 0.5% of the total volume of methanol was added every 24 h. After induction for 7 days until the highest expression level was reached, the cells were centrifuged. The supernatant was the crude AnCDA enzyme solution.

[0024] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims. sequence list <110> Jiangsu Ocean University <120> A chitin deacetylase mutant of Aspergillus nidulans <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 243 <212> PRT <213> Aspergillus nidulans <400> 1 Met Phe Ala Thr Leu Ala Leu Val Phe Thr Ala Leu Ala Ser Asn Ala 1 5 10 15 Leu Thr Thr Pro Leu Pro Leu Val Arg Arg Val Pro Thr Gly Gln Val 20 25 30 Ile Thr Gln Cys Thr Thr Pro Asn Thr Ile Ala Leu Thr Phe Asp Asp 35 40 45 Gly Pro Ser Glu Tyr Thr Pro Gln Leu Leu Asp Leu Leu Ser Arg Tyr 50 55 60 Ser Ala Arg Ala Thr Phe Phe Val Leu Gly Asp Ala Ala Ala Gln Asn 65 70 75 80 Pro Gly Leu Leu Gln Arg Met Arg Asp Glu Gly His Gln Val Gly Ala 85 90 95 His Thr Tyr Asp His Val Ser Leu Pro Ser Leu Gly Tyr Asp Gly Ile 100 105 110 Ala Ser Gln Met Thr Arg Leu Glu Glu Val Ile Arg Pro Ala Leu Gly 115 120 125 Val Ala Pro Ala Tyr Met Arg Pro Pro Tyr Gly Glu Thr Asn Glu Leu 130 135 140 Val Leu Gln Val Met Arg Asp Leu Asp Tyr Arg Val Ile Ser Ala Ser 145 150 155 160 Val Asp Thr Glu Asp Trp Glu Asn Gln Asp Trp Asp Ala Ile Ile Asn 165 170 175 Thr Ser Phe Gln Leu Phe Leu Asp Gln Leu Asp Ala Gly Gly Asn Ile 180 185 190 Val Leu Glu His Asp Ile Asp Tyr Trp Thr Val Ala Ser Leu Ala Glu 195 200 205 Arg Met Leu Gln Glu Val Asn Ala Arg Gly Leu Ile Ala Thr Thr Val 210 215 220 Gly Asp Cys Leu Gly Asp Gly Glu Ile Ala Trp Tyr His His His His 225 230 235 240 His His His

Claims

1. A kind Aspergillus nidulans Chitin deacetylase mutant, characterized by: fungi Aspergillus nidulans The amino acid sequence of chitin deacetylase underwent the following mutations: leucine (L) at position 139 was mutated to glycine (G), lysine (K) at position 164 was mutated to glutamic acid (E), tyrosine (Y) at position 166 was mutated to tryptophan (W), alanine (A) at position 171 was mutated to tryptophan (W), alanine (A) at position 195 was mutated to glutamic acid (E), and histidine (H) at position 199 was mutated to aspartic acid (D). (Fungi) Aspergillus nidulans The amino acid sequence of chitin deacetylase is accessed in GenBank under the number XM_677557.

1.

2. The polynucleotide of claim 1, wherein the polynucleotide encodes a chitin deacetylase mutant. Aspergillus nidulans The gene of a chitin deacetylase mutant.

3. A vector carrying the gene of claim 2, wherein the vector is pPICZalphaA.

4. A host cell carrying the gene of claim 2, said host cell being E. coli DH5α.

5. A method as claimed in claim 1 Aspergillus nidulans A method for producing a chitin deacetylase mutant, characterized by: (1) The codons of the chitin deacetylase gene sequence with GenBank accession number XM_677557.1 were optimized and the optimized gene was synthesized; (2) The optimized gene was cloned into the expression vector pPICZalphaA to construct the recombinant expression plasmid AnCDA-pPICZalphaA; (3) Using the recombinant expression plasmid from step (2) as a template, PCR amplification was performed using site-directed mutagenesis primers to introduce mutations. (4) The mutated plasmid was transformed into E. coli DH5α for amplification; (5) Extract plasmids and linearize them, transform them into Pichia pastoris X33, and screen for positive clones; (6) Methanol-induced expression was performed to obtain chitin deacetylases mutants.

6. A method according to claim 5 Aspergillus nidulans The method for preparing chitin deacetylase mutants is characterized by: The primers for the site-directed mutagenesis are as follows: 139primerF:5'CATATATGCGTCCGCCGTATGGAGAAACCAATGAATTAGTTC3' 139primerR:5'GAACTAATTCATTGGGTTTCTCCATACGGCGGACGCATATATG3' 164primerF:5'GCCAGCGTGGATACCGAAGATTATGAAAATC3' 164primerR:5'GATTTTCATAATCTTCGGTATCCACGCTGGC3' 166primerF:5'CGTGGATACCGAAGATTGGGAAAATCAGGATGCAG3' 166primerR:5'CTGCATCCTGATTTTCCCAATCTTCGGTATCCACG3' 171primerF:5'GATTGGGAAAATCAGGATTGGGATGCCATTATTAATACC 3' 171primerR:5'GGTATTAATAATGGCATCCCAATCCTGATTTTCCCAATC 3' 195primerF:5'CAGGTGGTAATATTGTGCTGGAGCATGATATTCATTATTGGACC3' 195primerR:5'GGTCCAATAATGAATATCATGCTCCAGCACAATATTACCACCTG3' 199primerF:5'CTGGAGCATGATATTGATTATTGGACCGTGG3' 199primerR:5'CCACGGTCCAATAATCAATATCATGCTCCAG3'.

7. A method according to claim 5 Aspergillus nidulans The method for preparing chitin deacetylase mutants is characterized by: The specific operation of step (6) is as follows: Recombinant Pichia pastoris containing the gene encoding mutant chitin deacetylase is spread on a YPD plate containing 100 μg / mL bleomycin until single colonies are produced. Multiple single colonies are picked and verified using primers to induce expression. Recombinant Pichia pastoris is then inoculated into 20 mL of BMGY liquid medium and cultured at 28℃ and 200 r / min until OD... 600 Once the expression level reaches 2.0-6.0, the cells are collected by centrifugation at 3000 rpm for 1 min. The supernatant is discarded, and the cells are resuspended in 50 mL of BMMY liquid medium. The cells are then cultured at 28°C and 200 rpm, with 0.5% methanol added every 24 hours. After induction for 7 days until the peak expression level is reached, the cells are centrifuged again, and the supernatant is used as the culture medium. An CDA crude enzyme solution.

8. A method according to claim 7 Aspergillus nidulans A method for preparing a chitin deacetylase mutant, characterized by: The BMGY liquid culture medium consists of: 10 g / L yeast extract, 20 g / L peptone, 10 ml / L glycerol, and 0.1 mol / L pH 7.0 potassium phosphate buffer. It is sterilized at 121 °C for 20 min, cooled, and then 100 mL of 10×YNB solution and 2 mL of 500×Biotin solution are added. It is then stored at 4 °C.

9. A method according to claim 8 Aspergillus nidulans A method for preparing a chitin deacetylase mutant, characterized by: The BMMY liquid culture medium consists of: 10 g / L yeast extract, 20 g / L peptone, 0.1 mol / L pH 7.0 potassium phosphate buffer, sterilized at 121°C for 20 min, cooled, 100 mL of 10×YNB solution, 2 mL of 500×Biotin solution, and 1 mL of filtered sterilized methanol, and stored at 4°C.