Methods and systems for manufacturing DNA sequencing arrays

CN112204176BActive Publication Date: 2026-08-14CENTRILLION TECHNOLOGY HOLDINGS CORP
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2019-03-20
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

但是,以这种方式难以合成复杂度增加的阵列

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN112204176B_ABST
    Figure CN112204176B_ABST
Patent Text Reader

Abstract

This disclosure relates to methods for reversing oligonucleotide probes in in situ synthetic arrays. These methods can be used to reverse the orientation of the probe relative to the substrate from binding to the 3' of one substrate to binding to the 5' of another substrate. These methods can also be used to reduce or eliminate the presence of truncated probe sequences in the in situ synthetic array. These methods can preserve the original pattern of the synthetic oligonucleotide after reversal. These methods can be achieved by forming a hydrogel layer between the donor and acceptor substrates through a polymerization reaction that forms a hydrogel layer.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-referencing

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 646,279, filed March 21, 2018, which is incorporated herein by reference in its entirety. Background Technology

[0003] High-density DNA microarrays have been widely used in a range of genomic sequence analyses, including mutation and polymorphism (SNP genotyping), cytogenetics (copy number), nuclear proteomics, gene expression profiling and analysis, and transcriptome analysis. While many of these applications can be read using direct hybridization-based methods, the use of enzyme-catalyzed readouts may offer certain distinct advantages. For example, polymerase extension or ligation of array sequences may provide a higher level of discriminative power compared to detection by hybridization alone.

[0004] A method for fabricating ultra-high-density DNA microarrays combines in-situ synthesis with photolithography semiconductor fabrication to provide arrays with high-density DNA sequences on a substrate. Photolithography can produce populations of incomplete or truncated probe sequences, resulting in the synthesis of probe sequences of the desired or expected length (“full-length” probes). The presence of such truncated probe sequences can adversely affect array performance, for example, leading to poor signal-to-noise ratios in hybridization reactions. However, photolithography allows for efficient oligonucleotide synthesis in the 3' to 5' orientation, with the 3' ends of the synthesized probes bound to a solid support (5'-up microarrays). In certain enzymatic reactions requiring enzymatic addressing of free probe ends, such as polymerase extension or ligation reactions, free 3'-hydroxyl groups are needed for enzymatic reactions. Sequences synthesized by photolithography are typically oriented in the 3'→5' direction. This causes the 3' ends of the synthesized sequences to attach to the surface, preventing them from participating in enzymatic reactions requiring free 3'-hydroxyl ends.

[0005] Conversely, oligonucleotide probes immobilized on microbead arrays (e.g., Illumina) and other spotting arrays are typically attached to their substrate via amines or other functional groups that are synthetically attached to the 5' end of a previously synthesized and purified full-length probe. However, it is difficult to synthesize arrays with increased complexity in this manner. To date, 3'-up microarrays have been fabricated almost entirely in two steps using a "top-down" microfabrication strategy: first, the synthetic molecule is synthesized with its 5'-up orientation in a conventional manner, with a linker at the 5' end of the synthetic sequence. The synthetic sequence is then cleaved from its 3' end, followed by reacting the entire 5'-end with the substrate and spotting to produce the 3'-up sequence. Summary of the Invention

[0006] It is desirable to reverse the orientation of probes on an in-situ synthetic array (such as an array fabricated by photolithography) so that the probes have free 3'-hydroxyl ends in the 5'→3' direction and are in "full length". This disclosure provides a method for achieving molecular reversal of probe sequence orientation, such that probe sequences initially synthesized from the 3' end on a donor substrate are converted into probe sequences attached to a recipient substrate through their 5' ends to expose free 3'-hydroxyl groups, while maintaining the original pattern of the sequence on the donor substrate on the resulting recipient substrate. Additionally, this disclosure can reduce or eliminate truncated oligonucleotide probes in the recipient substrate.

[0007] Current techniques for fabricating high-resolution photolithographic DNA microarrays are limited by the fact that the 3' end of each sequence is anchored to a rigid substrate, thus preventing many potential enzymatic reactions. This disclosure provides a technique that can invert the entire microarray into a hydrogel. This method preserves the spatial fidelity of the original pattern of the microarray while removing erroneously synthesized oligomers inherent in all other microarray fabrication strategies. First, a standard 5'-up microarray can be synthesized on a donor wafer, wherein each oligonucleotide is anchored at the 3' end of the oligonucleotide attached to the microarray surface via a cleavable linker and has phosphorus acrylate (hereinafter referred to as "Acrydite") at the 5' end.

[0008] Acrydite, or phosphoramidite, is a phosphoramidite that can be used to synthesize oligonucleotides with a methacrylic acid group at the 5' end, namely 7-methacrylamidoheptyphosphonic acid, a monoester at the 5' end of the oligonucleotide:

[0009]

[0010] After array synthesis, an acrylamide monomer solution is applied to the donor wafer, and an acrylamide-silanized acceptor wafer is placed on top of the acrylamide monomer solution. As the polyacrylamide hydrogel forms between the two wafers, it covalently incorporates the Acrydite-terminated sequence into the hydrogel matrix. Finally, the oligonucleotides are released from the donor wafer by immersion in an ammonia solution, which cleaves the 3' cleavable linker inserted between the donor wafer and the oligonucleotide, thus releasing the 3'-terminated oligonucleotides. The array can now be presented 3'-up on the surface of the gel-coated acceptor wafer. Extension reactions, restriction enzyme digestion, and gel microsequencing using labeled reversible terminators demonstrate a versatile and powerful platform that can be easily constructed with much higher molecular complexity than conventional microarrays by endowing the system with a variety of enzymatic substrates. In this generation of microarrays, highly ordered purified oligonucleotides can be reversed to 3'-up in a biocompatible soft hydrogel and can be functionalized for a variety of programmable enzymatic reactions.

[0011] This disclosure presents a solution to the problem of synthesizing high-density, inverted, enzyme-compatible microarrays. First, a donor wafer is synthesized 3'→5' (a "bottom-up" approach); then, synthetic oligonucleotides are covalently anchored in a polyacrylamide hydrogel for uncapped sequences, which are thus receptive to Acrydite phosphorous acid (a "top-down" approach). After cleaving at the 3' end to separate the two wafers, the resulting purified oligonucleotide array can be inverted to 3'-up on the hydrogel surface, while preserving the spatial display of the sequences from the initial patterning in the "bottom-up" approach. In addition to its advantages of relative inexpensiveness, scalability, and compatibility with current machines and methods used for synthesizing microarrays, this capability enables a new generation of high-density lithographic arrays with unique applications utilizing a wide range of biochemistry, including nucleases.

[0012] In one aspect, this disclosure provides a method for reversing oligonucleotides on a surface, the method comprising: (a) providing a donor substrate coupled with a plurality of chains on a first surface of the donor substrate, the chains comprising oligonucleotides oriented from 3' to 5' and a first reactive group attached to the 5' end of the oligonucleotide; (b) providing a recipient substrate comprising a plurality of second reactive groups on a second surface of the recipient substrate; (c) arranging the donor substrate, the reaction mixture, and the recipient substrate in a sandwich configuration such that the first surface faces the second surface and the reaction mixture is located between the first surface and the second surface; (d) subjecting the sandwich configuration to immobilization conditions to form a first covalent bond between the first reactive group and the reaction mixture, and to form a second covalent bond between the second reactive groups of the plurality of second reactive groups and the reaction mixture, thereby producing a transformed sandwich configuration; and (e) releasing the donor substrate from the transformed sandwich configuration to provide 5' to 3' oriented oligonucleotides on the recipient substrate.

[0013] In another aspect, this disclosure provides a method for reversing oligonucleotides on a surface, the method comprising: (A) providing a donor substrate coupled with a plurality of molecules on a first surface of the donor substrate, the members of the plurality of molecules comprising (i) a first oligonucleotide oriented 3' to 5' fixed on the first surface of the donor substrate and (ii) a first reactive group attached to the 5' end of the first oligonucleotide; (b) providing a recipient substrate comprising a plurality of second reactive groups fixed on a surface of the recipient substrate; (c) arranging the donor substrate, the reaction mixture, and the recipient substrate in a sandwich configuration such that the first surface of the donor substrate faces the surface of the recipient substrate, and the reaction mixture is located between the first surface of the donor substrate and the surface of the recipient substrate; (d) subjecting the sandwich configuration to immobilization conditions to form a first covalent bond between the first reactive group and the reaction mixture or a derivative thereof, and to form a second covalent bond between members of the plurality of second reactive groups and the reaction mixture or a derivative thereof, thereby producing a transformed sandwich configuration; (e) releasing the donor substrate from the first oligonucleotide; and (f) providing a first oligonucleotide oriented 5' to 3' fixed on the recipient substrate by the reaction mixture or a derivative thereof.

[0014] In some embodiments of the aspects provided herein, the first oligonucleotide in (f) comprises a free 3' hydroxyl group. In some embodiments of the aspects provided herein, members of the plurality of molecules further comprise a universally cleavable linker between the first surface of the donor substrate and the 3' to 5'-oriented first oligonucleotide. In some embodiments of the aspects provided herein, the universally cleavable linker is provided by a reagent.

[0015]

[0016] Coupled with the first surface.

[0017] In some embodiments of the aspects provided herein, the release in (e) includes treatment with an alkali. In some embodiments of the aspects provided herein, the alkali comprises at least one selected from NH4OH, 1,2-diaminoethane, and methyl am. In some embodiments of the aspects provided herein, the fixation condition is a polymerization reaction. In some embodiments of the aspects provided herein, the reaction mixture comprises a variety of acrylamides for the polymerization reaction. In some embodiments of the aspects provided herein, the polymerization reaction forms a polymer gel comprising a first covalent bond and a second covalent bond. In some embodiments of the aspects provided herein, the first reactive group comprises a first polymerizable group. In some embodiments of the aspects provided herein, the second reactive group comprises a second polymerizable group. In some embodiments of the aspects provided herein, the first oligonucleotide oriented from 3' to 5' in (a) is full-length. In some embodiments of the aspects provided herein, the first oligonucleotide oriented from 5' to 3' in (f) is full-length. In some embodiments of the aspects provided herein, the release in (e) further includes performing a mechanical cutting process or a laser perforation process on a second surface of the donor substrate. In some embodiments of the aspects provided herein, the release in (e) after performing the mechanical cutting process or the laser perforation process further includes treatment with an alkali. In some embodiments of the aspects provided herein, a plurality of molecules are patterned on a first surface of a donor substrate. In some embodiments of the aspects provided herein, (f) includes converting a plurality of molecules into a plurality of inverted molecules on a surface of a recipient substrate, wherein the plurality of inverted molecules maintain a pattern on the surface of the recipient substrate.

[0018] In another aspect, this disclosure provides a method for preparing a 5' to 3' oriented oligonucleotide array immobilized on a receptor surface of a receptor substrate, the method comprising: (a) providing a sandwich structure comprising: (i) a donor substrate including a donor surface; (ii) a plurality of oligonucleotides, the 3' end of each member of the plurality of oligonucleotides being covalently bonded to the donor surface; (iii) an intermediate layer covalently bonded to the 5' end of a member of the plurality of oligonucleotides; and (iv) a receptor substrate including a receptor surface, the intermediate layer being covalently bonded to the receptor surface; (b) removing the donor substrate from the plurality of oligonucleotides; and (c) providing a 5' to 3' oriented oligonucleotide array on a receptor surface of a receptor substrate.

[0019] In some embodiments of the aspects provided herein, the method further includes: before (a), forming an intermediate layer from a reagent mixture between a donor surface and an acceptor surface bonded to a plurality of oligonucleotides. In some embodiments of the aspects provided herein, forming the intermediate layer includes performing a polymerization reaction. In some embodiments of the aspects provided herein, the polymerization reaction polymerizes an acrylamide reagent. In some embodiments of the aspects provided herein, the 3' ends of members of the plurality of oligonucleotides are covalently bonded at the 3' ends of the members to a universally cleavable linker, which is covalently bonded to the donor surface. In some embodiments of the aspects provided herein, removal in (b) includes breaking the bonds between the universally cleavable linker and the members of the plurality of oligonucleotides. In some embodiments of the aspects provided herein, removal in (b) further includes performing a mechanical cutting process or a laser perforation process on another surface of the donor substrate prior to breaking the bonds. In some embodiments of the aspects provided herein, breaking the bonds includes treating the universally cleavable linker with a basic reagent. In some embodiments of the aspects provided herein, the basic reagent comprises at least one selected from NH4OH, 1,2-diaminoethane, and methylamine. In some embodiments of the aspects provided herein, after (b), the intermediate layer remains covalently bonded to the acceptor surface. In some embodiments of the aspects provided herein, after (c), the oligonucleotide array remains 5' to 3' oriented and is covalently bonded to the intermediate layer via the 5' ends of the members of the plurality of oligonucleotides. In some embodiments of the aspects provided herein, after (c), each member of the oligonucleotide array contains a free 3' hydroxyl group. In some embodiments of the aspects provided herein, the plurality of oligonucleotides are synthesized from the donor surface with a 3' to 5' orientation prior to the formation of the intermediate layer. In some embodiments of the aspects provided herein, the thickness of the intermediate layer is about 10 μm, 15 μm, 20 μm, 25 μm, or 30 μm.

[0020] In another aspect, this disclosure provides a composition comprising: (a) a donor substrate including a donor surface; (b) a plurality of oligonucleotides, each member of the plurality of oligonucleotides being covalently bonded to the donor surface at the 3' end of the member of the plurality of oligonucleotides; (c) an intermediate layer covalently bonded to the 5' end of the member of the plurality of oligonucleotides; and (d) a receptor substrate including a receptor surface, the intermediate layer being covalently bonded to the receptor surface.

[0021] In some embodiments of the aspects provided herein, members of the plurality of oligonucleotides are covalently bonded to a universally cleavable linker via the 3' end of the members of the plurality of oligonucleotides. In some embodiments of the aspects provided herein, the universally cleavable linker is covalently bonded to a donor surface. In some embodiments of the aspects provided herein, the donor substrate is configured to be mechanically cut or laser-perforated into multiple pieces. In some embodiments of the aspects provided herein, the intermediate layer comprises polyacrylamide. In some embodiments of the aspects provided herein, the donor substrate is a silicon wafer. In some embodiments of the aspects provided herein, the acceptor substrate is a quartz wafer. In some embodiments of the aspects provided herein, each member of the plurality of oligonucleotides contains a free 3' hydroxyl group. In some embodiments of the aspects provided herein, the composition is characterized by a combination of any two or more of the following: (i) members of the plurality of oligonucleotides are covalently bonded to a universally cleavable linker via the 3' end of the members of the plurality of oligonucleotides; (ii) the donor substrate is configured to be mechanically cut or laser-perforated into multiple pieces; (iii) the intermediate layer comprises polyacrylamide; (iv) the donor substrate is a silicon wafer; (v) the acceptor substrate is a quartz wafer; and (vi) each member of the plurality of oligonucleotides comprises a free 3' hydroxyl group. In some embodiments of the aspects provided herein, the thickness of the intermediate layer is about 10 μm, 15 μm, 20 μm, 25 μm, or 30 μm.

[0022] In another aspect, this disclosure provides a composition comprising: (a) a substrate having a surface; (b) an intermediate layer having a first surface and a second surface, the first surface being adjacent to a surface of the substrate and the second surface being distant from a surface of the substrate, the first surface being covalently bonded to a surface of the substrate; and (c) a plurality of oligonucleotides covalently bonded to the second surface of the intermediate layer via the 5' ends of a plurality of oligonucleotides.

[0023] In some embodiments of the aspects provided herein, the 5' ends of the plurality of oligonucleotides are bonded to a second surface via carbon-carbon bonds. In some embodiments of the aspects provided herein, the substrate is quartz. In some embodiments of the aspects provided herein, the intermediate layer comprises polyacrylamide. In some embodiments of the aspects provided herein, the surface of the substrate is bonded to a first surface via carbon-carbon bonds. In some embodiments of the aspects provided herein, each member of the plurality of oligonucleotides comprises a free 3' hydroxyl group. In some embodiments of the aspects provided herein, the composition is characterized by a combination of any two or more of the following: (i) the 5' ends of the plurality of oligonucleotides are bonded to a second surface via carbon-carbon bonds; (ii) the substrate is quartz; (iii) the intermediate layer comprises polyacrylamide; (iv) the surface of the substrate is bonded to a first surface via carbon-carbon bonds; and (v) each member of the plurality of oligonucleotides comprises a free 3' hydroxyl group. In some embodiments of the aspects provided herein, the thickness of the intermediate layer is about 10 μm, 15 μm, 20 μm, 25 μm, or 30 μm.

[0024] Other aspects and advantages of the invention will become apparent to those skilled in the art from the following detailed description, in which only exemplary embodiments of the invention are shown and described. Those skilled in the art will recognize that other different embodiments are possible with respect to this disclosure, and that several details of the various apparent aspects can be modified, all without departing from the scope of the invention. Therefore, the drawings and descriptions should be considered exemplary and not restrictive.

[0025] Incorporation

[0026] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference to the extent that each individual publication, patent or patent application is specifically and individually cited and incorporated herein by reference. Attached Figure Description

[0027] The novel features of the invention are specifically set forth in the appended claims. A better understanding of the features and advantages of the invention will be obtained by referring to the following detailed description and accompanying drawings, which illustrate illustrative embodiments utilizing the principles of the invention, in which:

[0028] Figure 1A-1F A schematic process for inverting a probe into a hydrogel using a disclosed microarray inversion method is shown. Figure 1A The invention describes the preparation of 5'-up oligonucleotides on a donor substrate modified with an oligonucleotide sequence containing a universally cleavable linker (UCL) and 5'Acrydite. Figure 1B The preparation of an acrylamide-coated receptor substrate is shown. Figure 1CIt describes the ability to pour an acrylamide solution onto a donor substrate while simultaneously inverting the acceptor and placing it on top of the poured acrylamide solution. Figure 1D The diagram shows that the receptor wafer can be mechanically cut or laser-perforated. Figure 1E It is described that after exposure to concentrated ammonia (e.g., 28-33% ammonia in water, also known as ammonium hydroxide), for example, stirring for about 18 hours, the wafers can be separated. Figure 1F The array of transfers is shown to be 3'-up on the recipient wafer.

[0029] Figure 2A-2C Patterned AM1 DNA was displayed and transferred into a polyacrylamide hydrogel. Figure 2A The experiment demonstrates how fluorescently labeled probes hybridize with synthetic oligonucleotides on a gel on a receptor substrate after using a resolution test pattern on a 2in × 3in substrate and employing the DMT chemistry method.

[0030] Figure 2B It shows Figure 2A A magnified image (inset) of a portion of the fluorescence imaging of a fluorescently labeled probe hybridizing with a synthetic oligonucleotide on a gel. This is from... Figure 2A The enlarged illustrations demonstrate the transfer fidelity and high resolution of the pattern.

[0031] Figure 2C Fluorescence imaging of a fluorescently labeled probe hybridizing with a synthetic oligonucleotide on a gel substrate of a recipient substrate is shown. The oligonucleotides on a donor substrate on a 6-inch wafer were synthesized using the photoamidite method. Figure 2C The image shows 3μm (left) and 8μm (right) square features on a 6-inch receptor substrate (wafer), which demonstrate the scalability of the process.

[0032] Figure 3A Fluorescent images of Cy3-labeled extended nucleotides from an extension reaction catalyzed by Taq polymerase using only labeled T are shown in the presence of all four bases and 3 μm square features.

[0033] Figure 3B Fluorescent images of Cy3-labeled extended nucleotides extended by Hero polymerase from labeled A are shown in the presence of all four bases.

[0034] Figure 4 Fluorescent images of the transferred oligonucleotides are shown, with resolution determined by the photoresist process, displaying lines and spacing patterns of 1 μm, approximately the photolithographic limit of the imaging equipment used.

[0035] Figure 5AFluorescence microscopy is shown to sequence the first base on an inverted 3'-up oligonucleotide array prepared by using the disclosed method and a reversible terminator via synthesis. Figure 5B The sequence shown is such that the first base (cytosine at the 3' end of the fixed oligonucleotide) has a directly matching template and growth chain.

[0036] Figure 5C Another fluorescence microscopy technique is shown for sequencing the second base on an inverted 3'-up oligonucleotide array prepared by using the disclosed method and a reversible terminator via synthesis. Figure 5D The sequence shown is such that after the blocking group on the first added reversible terminator is cleaved and the second base (adenine at the 3' end of the fixed oligonucleotide) has a directly matching template and growth chain after the second round of extension.

[0037] Figure 6A An example phosphoramide reagent for preparing a universal cuttable connector is shown. Figure 6B Another example of a phosphoramidite reagent for preparing a universal cuttable connector is shown. Figure 6C Another example of a phosphoramidite reagent for preparing a universally cuttable connector is also shown.

[0038] Figures 7A-7D A schematic diagram is shown of the transferred oligonucleotides on the surface of the receptor hydrogel, 3' upward and with enzymatic function. Figure 7A Fluorescence imaging was shown after hybridization of the inverted 3'-up oligonucleotide array with the template oligonucleotide and extension by Klenow DNA polymerase and all four unlabeled bases. Figure 7B It shows in Figure 7A Fluorescence imaging following the extension reaction, when the template oligonucleotide was stripped with 0.2M NaOH and a Cy3-labeled probe targeting the newly synthesized mosaic terminal sequence was added. Figure 7C It shows that in the Figure 7B Fluorescence imaging following exposure of 3'-up oligonucleotides on the array to restriction endonuclease Ecor1 to digest partially extended oligonucleotides on the array. Figure 7D This illustrates the effect of adding a probe labeled with an AM1 complement. Figure 7C Fluorescence imaging of 3'-up oligonucleotides on the array indicates that in Figure 7C After treatment with restriction endonucleases, from Figure 7B The patterned DNA in the initial array is complete. Detailed Implementation

[0039] This disclosure provides a method for reversing the synthesis of oligonucleotide probes in situ. The method disclosed herein can also reduce or eliminate truncated oligonucleotide probes that do not contain the full-length synthetic oligonucleotide sequence, while retaining the full-length oligonucleotide probe. For example, full-length oligonucleotides can be immobilized onto the recipient substrate before the 3' end is released from the donor substrate, while non-full-length oligonucleotides cannot be immobilized onto the recipient substrate and can therefore be removed after the immobilization step when the 3' end is released.

[0040] As used herein, the term "oligonucleotide" generally refers to a nucleotide chain. In some cases, oligonucleotides are less than 200 residues in length, for example, between 15 and 100 nucleotides. Oligonucleotides can contain at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 bases. Oligonucleotides can be about 3 to about 5 bases, about 1 to about 50 bases, about 8 to about 12 bases, about 15 to about 25 bases, about 25 to about 35 bases, about 35 to about 45 bases, or about 45 to about 55 bases. Oligonucleotides (also referred to as "oligonucleotides") can be any type of oligonucleotide (e.g., primers). Oligonucleotides can contain natural nucleotides, non-natural nucleotides, or combinations thereof.

[0041] As used herein, the term “about” typically refers to a specified amount of + / - 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%.

[0042] As used herein, the terms “3’→5’ orientation” or “3’ to 5’ orientation” generally refer to the orientation of a nucleic acid sequence so that its 3’ end attaches / fixes to the surface of the substrate. As used herein, the alternative term “5’ up” also generally describes 3’–5’ orientation.

[0043] As used herein, the terms “5’→3’ orientation” or “5’ to 3’ orientation” generally refer to the orientation of a nucleic acid sequence so that the 5’ end of the nucleic acid sequence is attached / fixed to the surface of the substrate. As used herein, the other term “3’ up” also generally describes 5’–3’ orientation.

[0044] As used herein, the term "fixation" generally refers to the formation of a covalent bond between two reactive groups. For example, the polymerization of reactive groups is a form of fixation. The formation of carbon-carbon covalent bonds is an example of fixation.

[0045] With the advent of rapid genome sequencing and large genome databases, genetic information can be utilized in a variety of ways. One such application is oligonucleotide arrays. The general structure of an oligonucleotide array (or commonly referred to as a DNA microarray, DNA array, or DNA chip) is a well-defined array of spots or addressable sites on a surface. Each spot may contain a layer of relatively short strands of DNA called “probes” or “capture probes” (e.g., Schena, ed., “DNA Microarrays: A Practical Approach”, Oxford University Press; Marshall et al., (1998) Nat. Biotechnol. 16:27-31; each incorporated herein by reference). There are at least two techniques for generating arrays. One is based on photolithography (e.g., Affymetrix), and the other is based on robotically controlled inkjet (spotbot) technology (e.g., Arrayit.com). Other methods for generating microarrays are known, and any such known methods may be used herein.

[0046] Typically, oligonucleotides (probes or capture probes) can be selected and placed within a given spot in the array to bind at least a portion of the complementary nucleic acid to the nucleic acid or the target nucleic acid. An aqueous sample can be contacted with the array under appropriate hybridization conditions. The array can then be thoroughly washed to remove all non-specific adsorbed material. To determine if the target sequence has been captured, the array can be "developed" by adding, for example, a fluorescently labeled oligonucleotide sequence complementary to an unoccupied portion of the target sequence. The microarray can then be "read" using a microarray reader or scanner that outputs an image of the array. Spots exhibiting strong fluorescence may be positive for that specific target sequence.

[0047] Probes may contain deposited biomaterials to produce spot arrays. Probes may contain materials synthesized, deposited, or positioned according to other techniques to form an array. Therefore, for convenience, microarrays formed according to any of these techniques may be collectively referred to below as “probe arrays.” The term “probe” is not limited to probes fixed in an array. Rather, the functions and methods described herein can also be used for other parallel measurement devices. For example, these functions and methods can be applied when probes are fixed on or within beads, optical fibers, or other substrates or media.

[0048] In the methods and systems of this disclosure, probes can be attached to a solid substrate. The probes can bind to the substrate directly or through a linker. The linker may contain, for example, amino acids, peptides, nucleotides, oligonucleotides, or other organic molecules that do not interfere with the function of the probe.

[0049] Solid substrates can be biological, non-biological, organic, inorganic, or any combination thereof. Substrates can exist, for example, in the form of one or more particles, strands, precipitates, gels, sheets, tubes, spheres, containers, capillaries, pads, slices, membranes, plates, glass slides, or semiconductor integrated chips. Solid substrates can be planar or can have other surface structures. For example, a solid substrate can include raised or recessed regions on which synthesis or deposition occurs. In some instances, solid substrates are chosen to provide suitable light absorption properties. For example, the substrate may be any of the following: polymerized Langmuir Blodgett film, functionalized glass (e.g., controlled-hole glass), silica, titanium dioxide, alumina, indium tin oxide (ITO), Si, Ge, GaAs, GaP, SiO2, SiN4, modified silicon, top dielectric layer of a semiconductor integrated circuit (IC) chip, or any of various gels or polymers such as (poly)tetrafluoroethylene, (poly)vinylidene fluoride, polystyrene, polycarbonate, polydimethylsiloxane (PDMS), polymethyl methacrylate (PMMA), polycyclic olefins, or combinations thereof.

[0050] The solid substrate may contain a polymer coating or gel, such as a polyacrylamide gel or a PDMS gel. The gel and coating may additionally contain components to modify their physicochemical properties, such as hydrophobicity. For example, the polyacrylamide gel or coating may contain modified acrylamide monomers in its polymer structure, such as ethoxylated acrylamide monomers, phosphorylcholine acrylamide monomers, betaine acrylamide monomers, and any combination thereof.

[0051] As used herein, the term "intermediate layer" generally refers to a hydrogel or gel or polymeric layer bonded to a substrate (e.g., a recipient substrate) on one of its surfaces and to the 5' ends of multiple oligonucleotides on its other surface. The intermediate layer lies between the two substrates. The intermediate layer remains intact after removal of one of the substrates, such as the donor substrate. The 5' ends of the multiple oligonucleotides remain covalently bonded to the intermediate layer after removal of one of the substrates, such as the donor substrate.

[0052] As used herein, the term "hydrogel" generally refers to a gel in which water is the swelling agent. The term "gel" refers to a non-fluid colloidal or polymeric network that expands by a fluid through its volume. The term "swelling agent" is a fluid used to swell a gel or network. For example, water can be a swelling agent for a hydrogel. The hydrogels of this disclosure can be prepared by polymerization of one or more acrylamide-functionalized monomers. For example, an acrylamide tail can be bonded to the 5' end of a plurality of oligonucleotides. The acrylamide tail can also be bonded to the surface of a substrate, such as a receptor substrate. Then, when a solution containing acrylamide monomers is poured onto one surface of the substrate bonded to the acrylamide tail, another surface bonded to the acrylamide tail can be stacked on top of the poured solution. The poured solution can then be polymerized with the acrylamide monomers and the acrylamide tail to form an intermediate layer. In some cases, the hydrogels of this disclosure contain polyacrylamide. In some cases, the hydrogels of this disclosure contain cross-lined polyacrylamide. In some cases, the hydrogels of this disclosure contain about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% polyacrylamide by weight. In some cases, the hydrogel can be obtained by combining acrylamide and methylenebisacrylamide. The polymerization reaction can be initiated by an initiator free radical. The hydrogel can be obtained by combining acrylamide and methylenebisacrylamide in a molar ratio of 150:1 to 1000:1 in the presence of a free radical initiator. Methylenebisacrylamide can provide crosslinking between polymer chains, and the molar ratio can be varied to provide various crosslinking densities of the hydrogel. The conditions for obtaining the hydrogel can be modified. Ammonium persulfate (AMPS) can be used as an initiator for the polymerization reaction.

[0053] DNA microarrays can be fabricated using spatially oriented in-situ synthesis or immobilization of pre-synthesized oligonucleotides. In both cases, oligonucleotide synthesis can typically be performed by adding monomers along the 3' to 5' direction using standard 3'-phosphoramide reagents and solid-phase synthesis protocols (e.g., M. Egli et al., “Current Protocols in Nucleic Acid Chemistry”, John Wiley & Sons). Major impurities are truncated partial-length sequences resulting from incomplete monomer coupling and secondary depurination reactions.

[0054] On the one hand, the preparation of arrays of pre-synthesized oligonucleotide probes typically involves adding a reactive modifier to the ends of the oligonucleotides during synthesis on a high-throughput synthesizer, thereby covalently attaching the oligonucleotides to the substrate via the 5' end (see SJ Beaucage et al., Curr. Med. Chem. 2001, 8, 1213-44). This ensures that the probes attached to the support can be predominantly full-length sequences, as truncated sequences can be capped and rendered unreactive during synthesis (Brown T and Brown T, Jr. (2005–2015) Solid-phase oligonucleotide synthesis. [Online] Southampton, UK, ATDBio. http: / / www.atdbio.com / content / 17 / Solid-phase- oligonucleotide-synthesis [Accessed August 9, 2016]

[0055] The advantages of this disclosure include that the 3'-hydroxyl group of the oligonucleotide probe is "away" from the substrate and can be freely used for enzymatic reactions, such as template-guided polymerase-catalyzed chain elongation and ligation; and this feature can be used to perform highly sensitive and specific assays to detect and quantify genetic polymorphisms (K. Lindroos et al., Nucleic Acids Res. 2001, 29, e69; Gunderson KL et al., Nature Genetics 2005, 37, 549-54).

[0056] On the other hand, DNA microarrays can also be fabricated by directly synthesizing sequences in situ on the support. In this context, sequences can be “printed” in a highly parallel manner using spatially oriented synthesis via inkjet (TR Hughes et al., Nature Biotechnol 2001, 19, 342-7; C. Lausted et al., Genome Biol 2004, 5, R58), photolithography (AC Pease et al., Proc Natl Acad Sci USA 1994, 91, 5022-6; G. McGall et al., Proc Natl Acad Sci USA 1996; 93: 13555-60; S. Singh-Gasson et al., Nature Biotechnol 1999, 17, 974-8;) or electrochemical techniques (PLoS ONE 2006, 1, e34; BY Chow et al., Proc Natl Acad Sci USA 2009, 106, 15219-24). Similarly, synthesis was also performed in the 3' to 5' direction (although solid-phase oligonucleotide synthesis in the 5' to 3' direction is feasible, it is much less efficient and economical, thus reducing yield and product purity). However, the resulting probe can be attached to the substrate at the 3' end, and any truncated sequence impurities that occur during synthesis are retained on the support, which can be a particular problem in the case of photolithographic synthesis (J. Forman et al., Molecular Modeling of Nucleic Acids, Chapter 13, p. 221, American Chemical Society (1998) and G. McGall et al., J. Am. Chem. Soc. 119:5081-5090 (1997)). As a result, polymerase-based extension assays are generally not feasible when using arrays fabricated in this manner and in this direction (5' to 3').

[0057] Despite the aforementioned limitations, photolithography synthesis remains a highly attractive method for fabricating ultra-high-density DNA arrays because it can achieve density reductions per centimeter. 2 With over 10 million array sequences (ARPawloski et al., J Vac Sci Technol B2007, 25, 2537-46) and high scalability in manufacturing environments, there is a need to develop an efficient method for reversing sequences on such probe arrays.

[0058] For example, modern high-density DNA microarrays can combine in-situ synthesis with photolithography semiconductor manufacturing methods to provide densities on the order of magnitude per centimeter. 2 10 7Arrays of one or more discrete sequence features (McGall, GH; Christians, FC High-Density Genechip Oligonucleotide Probe Arrays. Adv. Biochem. Eng. Biotechnol. 2002, 77, 21-42). This method can employ a "bottom-up" fabrication strategy, in which each base is added sequentially during exposure through a mask. Microarrays fabricated in this way have likely found wide applicability in a range of molecular biology applications, including large-scale parallel analysis in SNP genotyping, cytogenetics, nuclear proteomics, and transcriptomics. However, the versatility of microarrays may obscure the fact that almost all assays associated with them are limited to fluorescence detection of hybridization events. It is possible that various enzymes use DNA as a substrate, allowing for the potential to endow microarrays with novel properties and enzymatic functions if the orientation of nucleic acid probes fabricated using photolithography semiconductor methods in the gel can be reversed.

[0059] Previously reported microarrays may have inherent structural limitations that could significantly restrict their use with enzymes. First, the array substrate can be a rigid surface, such as quartz or silicon, which may negatively impact the activity of the enzyme with oligonucleotides near the surface, even if hydrophilic linker groups are included to elevate the oligonucleotides to a more enzymatically cooperative environment. See Shchepinov, MS et al., Steric Factors Influencing Hybridisation of Nucleic Acids to Oligonucleotide Arrays. Nucleic Acids Res. 1997, 25(6), 1155–1161. Second, the length of oligonucleotides on microarrays fabricated by sequential base addition may be limited due to the inefficiency of phosphoramidite chemical coupling yields. Even if longer pure sequence values ​​may have been determined, inefficient coupling during synthesis results in many truncated oligomer products being mixed with the full-length sequence, and there is currently no direct method to selectively remove them. See LeProust, EM et al.; Synthesis of High-Quality Libraries of Long (150mer) Oligonucleotides by a Novel Depurination Controlled Process. Nucleic Acids Res. 2010, 38(8), 2522-2540.

[0060] As mentioned above, a limitation of previously reported photolithographic microarrays is the directional orientation of the sequence, which can be synthesized in a 3'→5' orientation using phosphoramidite chemistry. This may cause the 3' end of the array sequence to attach to the surface (3' down) and prevent it from participating in enzymatic reactions requiring free 3'-hydroxyl groups. To date, 3'-up microarrays have been prepared using a "top-down" approach, where molecules can be synthesized with a 5'-up orientation and have linkers at the 5' end, then cleaved and the cleaved oligonucleotides reacted with a substrate to generate 3'-up oligomers by spotting or on beads. However, arrays fabricated in this way may lose the scale and precision achievable by photolithography—a "bottom-up" fabrication strategy. One could consider using the photoamidite method, a direct 5'→3' synthesis, to achieve 3'-up arrays. See Albert, TJ; Norton, J. et al.; Light-Directed 5'-->3' Synthesis of Complex Oligonucleotide Microarrays. Nucleic Acids Res. 2003, 31(7), e35. However, the lower yield of photoamidite compared to the DMT chemical method may make it impossible to synthesize long, pure oligonucleotide sequences with the correct sequence using this method.

[0061] Multiple probes may be located in one or more addressable regions (spots, locations, etc.) on a solid substrate, commonly referred to herein as “pixels”. In some cases, the solid substrate contains at least about 2, 3, 4, 5, 6 or 7-10, 10-50, 50-100, 100-500, 500-1,000, 1,000-5,000, 5,000-10,000, 10,000-50,000, 50,000-100,000, or more than 1,000,000 pixels with probes. In some cases, the solid substrate contains up to about 2, 3, 4, 5, 6 or 7-10, 10-50, 50-100, 100-500, 500-1,000, 1,000-5,000, 5,000-10,000, 10,000-50,000, 50,000-100,000, 100,000-500,000, 500,000-1,000,000 or more than 1,000,000 pixels with probes. In some cases, the solid substrate contains approximately 2, 3, 4, 5, 6 or 7-10, 10-50, 50-100, 100-500, 500-1,000, 1,000-5,000, 5,000-10,000, 10,000-50,000, 50,000-100,000, 100,000-500,000, 500,000-1,000,000 or more of 1,000,000 pixels with probes.

[0062] In some cases, having pixels that do not contain probes can be useful. Such pixels can act as control points to improve measurement quality, for example, by estimating and correcting nonspecific binding through the use of binding with the spots. In some cases, probe density can be controlled to facilitate probe attachment or enhance subsequent probe detection.

[0063] In some instances, having redundant pixels is useful; these redundant pixels have the same probe sequence as another pixel, but may not be physically adjacent or close to that other pixel. Data acquired from such a probe array may be less susceptible to manufacturing and measurement errors due to non-ideal conditions.

[0064] In some cases, in addition to the marker incorporated into the target, the marker is also attached to a probe within the pixel. In such a system, the captured target may result in two tags being in close proximity to each other within the pixel. As previously mentioned, the interaction between specific markers can produce unique detectable signals. For example, when the markers on the target and probe are respectively fluorescent donor and acceptor portions that can participate in the fluorescence resonance energy transfer (FRET) phenomenon, FRET signal enhancement or quenching can be detected.

[0065] Reverse oligonucleotide synthesis

[0066] In some cases, high-density oligonucleotide signatures and arrays can be fabricated using the methods disclosed herein. For example, oligonucleotide synthesis in a 3'→5' orientation scheme (e.g., phosphoramide chemistry) can be used to generate 3'→5' oriented sequences on a donor substrate, where the final 5' end unit of the "full-length" sequence may contain reactive groups for further chemical reactions. The "full-length" sequence from the donor substrate is then transferred monolithically to a recipient substrate coated with a polyacrylamide hydrogel, resulting in the "full-length" sequence immobilized on the polyacrylamide hydrogel, with the probe orientation reversed (5' attachment) and the spatial arrangement of the sequence from the initial array on the donor substrate fully preserved. Potential applications of such DNA sequencing arrays could include extended genotyping arrays and minimal sequencing via synthesis. The ability to generate such high-density DNA sequencing arrays will enable a new generation of high-density lithographic arrays with unique functionalities, allowing the development of new applications that leverage the highly specific biochemistry of DNases.

[0067] Figure 1A-1F An example scheme of this method is shown. First ( Figure 1A A cleavable silane, such as 2-hydroxyethyl 3-(methyl(3-(trimethoxysilyl)propyl)amino)propionate, can be applied to a silicon substrate (displayed as a Si wafer (donor)) and can be used with a connector incorporated into a universal cleavable assembly (e.g., Figure 6A , 6B Polythymidine (poly-(T)) sequences can be synthesized using DMT blocking chemistry of phosphoramidite (or phosphoramidite shown in 6C). This universal phosphoramidite reagent is available at AMC Chemicals, Oceanside, CA. Variable-region oligonucleotides can be applied to microarrays in a 3'→5' manner using photolysis blocking chemistry, and as described elsewhere, to create patterned structures with known DNA sequences at specific locations (Glenn McGall, "The Efficiency of Light-Directed Synthesis of DNA Arrays on Glass Substrates," JACS, 119(22): 5081-5090, (1997)) to generate probe sequences (denoted as AM1 in Figure 1). In some cases, the final synthesized amidite can be patterned using photoamidite followed by the addition of an Acrydite moiety. Figure 1AIn some cases, the last imide added to the imide pattern at the 5' end of the AM1 sequence during synthesis can be Acrydite. In some cases, to demonstrate the effect of high resolution, the DMT can be patterned with photoresist before adding the acrylamide group.

[0068] For receptor wafers ( Figure 1B The surface of the acceptor wafer can be modified to include acrylamide groups through silanization. In some cases, an acrylamide pregel polymerization solution can be prepared in water and rapidly applied to a first substrate (acceptor wafer or donor wafer), followed immediately by inverting a second substrate onto the solution on the first substrate. In other cases, an acrylamide monomer solution prepared in water can be applied to the donor wafer while the acceptor wafer is immediately inverted and placed on top to form a sandwich structure. Figure 1C Not limited to any of the working principles disclosed herein, capillary forces can cause the polymerization solution (i.e., the monomer solution) to be uniformly distributed to cover a single mold or wafer (e.g., a wafer with a diameter of 6 inches), thereby forming a structure such as... Figure 1C The "sandwich structure" shown. In some cases, polymerization can continue for more than 60 minutes, thereby covalently linking the two wafers through the hydrogel thus formed. In some cases, it may be possible to bond two substrates (e.g., Figure 1C The polymerization conditions (for donor and acceptor wafers) lasted for approximately 20 to approximately 60 minutes.

[0069] In the case of small blocks (approximately 1 cm in size), the substrate can be immersed in concentrated ammonia to cut the UCL, where two wafer blocks may take 10 to 18 hours to separate. For larger substrates (e.g., six-inch wafers), an additional step may be optional or required, such as mechanically cutting or laser perforating the sandwich structure substrate along the kerf. Figure 1D , Figure 1E Two substrates can be separated by treating them with an alkali (such as ammonia). For example, laser perforation methods can focus laser energy onto a tiny area of ​​the substrate in a very short time, thereby sublimating and evaporating the solid. Figure 1D The diagram shows that the acceptor wafer can be mechanically cut or laser-drilled. The length or diameter of the cut or drilled block can be approximately 5 mm, 6 mm, 7 mm, 8 mm, 9 mm, 10 mm, 11 mm, 12 mm, 13 mm, 14 mm, or 15 mm. Figure 1EIt is described that, for example, after exposure to concentrated ammonia (e.g., 28-33% ammonia in water, also known as ammonium hydroxide), for about 18 hours under stirring, a cut or perforated donor substrate (e.g., a quartz wafer) can be removed and released from the acceptor substrate (e.g., a silicon wafer). For smaller donor substrates that have not yet been cut or perforated, similar treatment with concentrated ammonia can also remove and release the acceptor substrate via alkaline hydrolysis of the UCL portion.

[0070] In some cases, when performing mechanical dicing, sandwich-structured wafers can be mounted on dicing tape (DU-300 from Nitto, Teaneck, NJ), and the top wafer (donor wafer) can be diced into 7.5mm x 7.5mm squares (chips). The tool used is a DISCO 2H6T dicing machine with a spindle speed of approximately 26,000 rpm, a feed rate of approximately 1mm / s, and resin-bonded diamond inserts (Thermocarbon, Casselberry, FL) with a width of approximately 0.3mm. The dicing depth is approximately 0.715mm, which cuts through the top wafer (donor wafer) and just touches the bottom wafer (recipient wafer).

[0071] In some cases, laser perforation can be performed using the method described by Potomac Photonics, Inc. (Baltimore MD). A 6-inch sandwich wafer with the top wafer (donor wafer, silicon wafer) facing the laser can be perforated at 1.75mm intervals, defining a 7.5mm × 7.5mm chip. The estimated hole diameter can be approximately 0.2mm. In this method, the bottom wafer (recipient wafer) can be a quartz material transparent to the laser (Nd:YAG, wavelength 1064nm), allowing the perforation process to stop at the quartz wafer interface (after drilling through the donor silicon wafer). The process may take approximately 45 minutes to create approximately 6000 holes covering the entire wafer surface.

[0072] After releasing the donor substrate, the donor wafer can be immersed in ammonia for at least 3 hours and / or in a 1:1 ethylenediamine (EDA):water mixture for approximately 1 to 3 hours to complete deprotection and ensure that the universally cleavable adapter (UCL) is cut to expose the 3' hydroxyl group (i.e., to cut the UCL to expose the 3' hydroxyl group on the DNA sequence). The wafer can then be rinsed with water followed by 4× saline-sodium citrate (SSC) buffer for further analysis and / or reactions. Figure 1F ).

[0073] The following tests demonstrate that the synthesized oligonucleotides are transferred to a gel-coated acceptor wafer with high fidelity. When an example shows that the above method can transfer oligonucleotides or DNA sequences from a donor substrate to a gel on a acceptor substrate with good fidelity, a 20-mer (5'TACGATTCAGCCGATACAGC3', AM1) can be synthesized on a 2-inch × 3-inch donor substrate using DMT chemistry. Next, four DMT-thymine residues can be added to the 5' end of the 20-mer, followed by the addition of thymine phosphoramide with a photoactivation blocking group (photo-T). Finally, the photo-T reaction can be selectively induced by UV exposure using a resolution test pattern mask (e.g., Centrillion resolution test pattern or RTP), and then acrylamide phosphoramide (ACRYDITE) can be transferred through the exposed hydroxyl groups. TM (Glen Research, Sterling, VA) can be added to oligonucleotides. In some cases, only acrylamide phosphoramide (ACRYDITE) can be added. TM Add to the exposed deblocking area. In other cases, acrylamide phosphoramidite can be added to the entire surface of the treated donor substrate. Even when ACRYDITE TM It may come into contact with the entire wafer surface; the area exposed through the mask (de-blocking area) can also be used with ACRYDITE. TM The phosphoramidite reaction is then performed. The sandwich structure assembly can then be shaken in ammonia water for 24 hours to cut the universally cuttable connector (UCL), thereby releasing the oligonucleotide from the donor wafer into the hydrogel.

[0074] As used herein, photoamidite, including photo-T, can be a nucleoside analog / reagent comprising (i) a photoprotective group, for example, on the 5' hydroxyl group of the nucleoside, and (ii) a phosphoramidite moiety on the 3' hydroxyl group, as follows:

[0075]

[0076] in:

[0077] R1, R2, and R3 are each independently H, alkyl, alkoxy, or aryl, or any two of R1, R2, and R3 together with their bonded atoms form a fused ring with a benzene ring containing a nitro group.

[0078] R4 is H, alkyl, or aryl;

[0079] m is 0 or 1;

[0080] n is 0 or 1;

[0081] B is a protected heterocyclic base in nucleic acids: A pg C pg G pg 、T、U;

[0082] A is adenine;

[0083] C stands for cytosine;

[0084] G stands for guanine;

[0085] T stands for thymine;

[0086] U is uracil; and

[0087] pg is independently one or more protecting groups on the nitrogen atom outside the ring of a heterocyclic base A, C, G, T or U.

[0088] UCLs can be molecules that are non-reactive during oligonucleotide synthesis but can become reactive after oligonucleotide synthesis to release the free 3'-OH terminus. The choice of universally cleavable linkers (UCLs) can include, but is not limited to, those that are not. Figure 6A , Figure 6B and Figure 6C The molecule shown. Multiple UCLs can be inserted between the polythymidine sequence and the synthesized 3' to 5' oriented oligonucleotide.

[0089] To verify whether the oligonucleotides were successfully transferred to the gel, fluorescently labeled AM1 sequence complements were hybridized and imaged at 10× magnification. Figure 2A The resolution test pattern mask has a field of view of 5.5 mm and a spacing of 500 μm between fields of view. As shown in the figure, feature fidelity and hybridization signal intensity were maintained on a 7.5 mm block. Figure 2B It shows Figure 2A The illustrations show that the spatial resolution achieved after the transfer is very high, with 3-4 μm lines and spacing patterns as shown in the figure. Finally, to demonstrate that the process is compatible with all microarray fabrication requirements, a complete 6-inch wafer was synthesized using cleavable silane, two UCL and AM1 sequences via the photoamidite method. Figure 2C Laser perforation along the cleavage paths of the donor wafer facilitates the mass transfer of ammonia to wafer regions modified with cleavable silane. Following gel transfer, features at 3 μm and 8 μm were readily identifiable, indicating that the entire process can be scaled up. These results demonstrate that highly ordered oligonucleotide arrays can be transferred into hydrogel-coated acceptor wafers with associated mold geometries while maintaining high spatial pattern fidelity. The diffusion of ammonia through the polymerized hydrogel is clearly sufficient to chemically cleave portions synthesized below the light-defined sequence, and the chemical approach employed is compatible with commercial microarray fabrication techniques.

[0090] The probes on the gel can hybridize with the complementary variant of synthesized AM1 labeled with Cy3 (QCAM1, IDT, Coralville, IA) at the 5' end, and are imaged at 10× magnification, such as... Figure 2A As shown. The Centrillion RTP has a field of view of 5.5mm and a spacing of 0.5mm between fields of view. Figure 2A As shown, feature fidelity and signal can be maintained on the approximately 7.5 mm block.

[0091] In some cases, DMT chemistry may be incompatible with photolithography-based microarray probe synthesis because, without a special photoresist process or other space-constrained deblocking process, it may be impossible to photolyze and define each base. In another example, donor substrates / wafers can be prepared using the AM1 synthesis and RTP described above, but this time on a quartz substrate with cleavable silane, and all active bases can be added to the grown DNA sequence via photoamidite. After gel transfer and hybridization with fluorescently labeled complements, the results of this experiment can be similar to or essentially identical to those obtained using DMT chemistry. Spatial resolution can be high, approximately 3–4 μm line and spacing (L / S) patterns.

[0092] In some cases, to fully ensure compatibility of the process with all microarray fabrication requirements, the photoamidite method can be used to synthesize complete 6-inch wafers from the Centrillion pilot product line (Palo Alto, CA) using cleavable silane, UCL, and AM1 sequences. Hybridization results can be similar to or substantially identical to those obtained using the AMT chemistry method. Feasibility studies for wafer-scale transfer demonstrate that wafer-scale transfer is feasible. Results demonstrate that oligonucleotides can be transferred from solid donor wafers to acceptor wafers and placed onto acrylamide gels on wafer blocks of various sizes with relevant mold geometries using the process described above. It can be demonstrated that diffusion of ammonia through the polymerized sandwich structure is sufficient to support the chemical cleavage of the synthesized portions below the photodefined sequence, and that the chemistry used is compatible with the phosphoramidite chemistry required for microarray fabrication, as detected by complementary sequence hybridization.

[0093] Because the transferred oligonucleotides are 3'-up and have available hydroxyl groups, they can respond to various polymerase elongation reactions. For example, they can be used on portions of a 6-inch wafer synthesized using the method described above. Extension determination. In this case, the quartz sacrificial wafer can have a single UCL and no cleavable silane to maintain compatibility with the control components of the product wafer. A complete 50-polymer (5'ACGTTGGCTGACAGAGTGATCAGTGTCATAGTTGCGTTGGCAGGAATGTG3', AM5) can be synthesized via the photoamidite method, cleaved into individual smaller chips, and extended after gel transfer. All four bases can be present, but only the base T can be labeled with Cy3. Figure 3A The results of the alignment markers after the DNA synthesis, inversion onto the gel, and extension reaction are shown. The squares in the image are 3 μm in size and contain unextended second sequences. These results indicate that the conversion of the synthetic DNA can be detected in the 3' upward orientation. Figure 3A Fluorescent images of Cy3-labeled extended nucleotides from an extension reaction catalyzed by Taq polymerase using only labeled T are shown in the presence of all four bases and 3 μm square features.

[0094] To further confirm the presence of the reverse oligonucleotide and demonstrate that the 3' upward probe would be successful for multiple polymerases, a Centrillion Hero2 extension assay was performed. Figure 3B In this case, all four bases can be labeled, and the labeling can be based on the template oligonucleotide of the hybridization. Figure 3B The sequence shown is used for the enzyme-catalyzed extension reaction, and the presence of dideoxynucleotides ensures that only a single base is added in this experiment. Figure 3B Fluorescent images of Cy3-labeled extended nucleotides extended by Hero polymerase from labeled A are shown in the presence of all four bases. The high “A” intensity and clear negative control (without insertion of other bases except for a small amount of C leakage due to the filter assembly) demonstrate that the method works as expected and provide evidence of the availability of the 3' hydroxyl group on gel-reversed oligonucleotides, as no extension was observed in the presence of mismatched bases. Figure 3A and 3B These results demonstrate that oligonucleotides initially synthesized with the 5' up orientation can be reversed on an acrylamide gel with the 3' up orientation and can be used for a variety of enzymatic reactions.

[0095] Recently, arrays combining array fabrication with commercial sequencing readouts have been proposed. High-resolution printing may be required in these cases and other potential applications. For example, arrays can be used to elucidate the positional information of biomolecules by in situ attaching unique oligonucleotides patterned on the array to the sample of interest; the results can then be analyzed using commercial sequencing readouts. In these cases, the spatial resolution of biomolecules is naturally limited by the number of unique features that can be patterned into a given region. Therefore, submicron resolution of photolithographically patterned features can be important for array fabrication. However, DMT chemistry is not directly compatible with photolithography-based microarray probe synthesis because there is no special photoresist process or other spatially confined deblocking process to photolyze and define each base.

[0096] To test the resolution of the gel reversal process described above, Centrillion photoresist was coated onto a second wafer with AM1 probes, as before, but this time on a quartz substrate with cleavable silane to exhibit high spatial resolution. All active bases were exposed using the photoamidite method. In this experiment, DMT chemistry was used to synthesize the 20-mer sequence, which could be added with fluorescein labeling (6-FAM, Glen Research). The final T at the 5' end of the synthesized sequence retained the DMT group and could be imaged using Centrillion photoresist, which spatially deblocks the protecting group on the polymer substrate using photoacid-generating chemistry. Gel transfer was performed as previously described, with the donor substrate block floating and separating from the acceptor substrate in an alkaline solution over approximately 18 hours. Figure 4 Fluorescent images of the experimental results are shown. The 1.0 μm line and spacing pattern can be resolved to the limits of the imaging tool (Keyence microscope, 40x, NA 0.6), suggesting that the lateral “blurring” from the gel inversion process may be, or primarily, related to the molecular length of the synthesized oligonucleotides.

[0097] 3'-up microarrays can serve as a versatile tool for enzyme-catalyzed assays. Accordingly, the two polymerase-catalyzed reactions shown above ( Figure 3A and 3B This demonstrates that the 3' hydroxyl group can be used for labeled base extension assays. Other enzymatic reactions can be sequenced using reversible terminators on the chip, further demonstrating the utility of the 3' up hydroxyl form and showcasing the chip's versatility in terms of enzyme activity, selectivity, and future potential assay development. Figures 5A-5DResults of two-base extension using Centrillion's reversible terminator chemistry method are shown in U.S. Patent Application No. 2016 / 0355541A1 and International Patent Application No. WO 2016 / 182984, all of which are incorporated herein by reference for all purposes. Figure 5A and Figure 5B In this process, the correct base (cytosine) can be added in the presence of other labeled bases. After cleavage by labeling and terminator (blocking group) at the 3' hydroxyl group, a second base (such as...) can be added in the second round of extension using a labeled reversible terminator. Figure 5C and Figure 5D (As shown). In the second round of extension, the correct incorporation of the second base (adenosine) can... Figure 5C and Figure 5D As shown in the image. This chip can be used for on-chip sequencing of nucleic acids.

[0098] Successful fabrication and transfer of the resulting 3'-up oligonucleotides can produce oligonucleotides suitable for polymerase-catalyzed extension reactions, and the above results demonstrate good extension efficiency and probe fidelity. Within the limits of the detection method used, it appears that no lateral displacement blurring from the gel inversion process can be detected as long as the sacrificial wafer (donor substrate) can be chemically cleaved from the product wafer (recipient substrate).

[0099] The ability to control the release of bound oligonucleotides from the donor substrate after radical polymerization using a gel on the recipient substrate can be advantageous. Release prior to gel formation may result in loss of probe and / or positional fidelity. In some cases, if physical removal of the donor wafer is attempted before complete chemical release from the recipient substrate, high feature fidelity may be found at the edges, but poor fidelity and signal may be found at the center, indicating that physical breakage may have occurred in the gel or possibly midway through DNA synthesis. Conversely, complete release of the cleavable portion after gel formation can provide good signal and feature fidelity across the entire chip / wafer. Post-polymerization chemical release can present substantial mass transfer problems, namely, how to get the chemical reagents to the interface for release.

[0100] Recognizing the issues related to the time of release of the donor substrate from the recipient substrate, in some cases, laser perforation along the kerf can be introduced before immersing the "sandwich structure" in ammonia or other cutting reagents. Unbound from any theory disclosed herein, the presence of hydrogel between the substrates can induce Fick diffusion, one of the main mechanisms enabling concentrated bases for cutting to travel from the edge of the chip / wafer / mold to the internal portions (e.g., the center) of the chip / wafer / mold. In water, D = 1.64 x 10⁻⁶. -5 cm 2At a rate of / s, the characteristic time for ammonia to reach the center of the approximately 1 cm die may be about 13 minutes. This could result in the ammonia solution reaching the interior or center of the substrate (i.e., chip / wafer) at that point. Deprotection in concentrated ammonia solution can take several hours, for example, approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 hours. In some cases, the dicing reaction can be completed in a short time, for example, using dilute ammonia or caustic alkali solutions within approximately 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 minutes, while maintaining high fidelity throughout the oligonucleotide synthesis cycle, for example, by using a more active releasing agent, such as AMA (a 1:1 mixture (v / v) of aqueous ammonium hydroxide and aqueous methylamine). Changing the temperature is also an option, as the dicing rate will increase to shorten the dicing wait time.

[0101] By comparing the fluorescent hybridization signals of the inverted 3'-up oligonucleotides (on the acceptor wafer) with those of the synthesized 5'-up oligonucleotides (on the donor wafer), it can be estimated that more than 50% of the full-length synthetic oligonucleotides can be transferred. This can be consistent with the polymerization conditions chosen to allow some, most, or all of the monomers to react during polymerization. Although the exact number of transferred oligonucleotides may not be known when using hybridization methods to confirm the presence of 5'-up transferred oligonucleotides, the detected hybridization signal on the gel may range from 60% to 100% compared to 5'-up oligonucleotides on similarly treated wafers. Hybridization methods may not be precise because many short capped sequences from the non-integral synthetic layer yield do not transfer to the gel because they do not acquire the acrylamide monomer moiety, thus reducing the total charge field of the transferred oligonucleotides. Similarly, within this range, hybridization yield may be inversely proportional to the surface oligonucleotide concentration. Even with 50% oligonucleotide transfer, similar hybridization metric signals may be detected due to the increased hybridization efficiency. However, since hybridization can be the starting step in many downstream assays, the fact that the signal is as high or higher than that of a similarly synthesized 5' upward is advantageous for the present invention.

[0102] In summary, the methods described herein can be used to obtain the inversion of transferred oligonucleotides, and excellent results can be obtained from the extension assays of inverted oligonucleotides catalyzed by three different polymerases. This inversion can be achieved while retaining the high spatial resolution required for microarray operation (approximately 3 μm is required for photoamidite synthesis), and even demonstrating the 1 μm lateral resolution required for potential readouts using commercial sequencers. This inversion method for fabricating DNA sequencing arrays is a powerful tool for expanding the applicability of DNA arrays and providing them with new applications, and has the potential to realize future applications such as DNA storage.

[0103] This novel photolithographic DNA microarray, patterned onto a hydrogel with oligonucleotides in a 3' up configuration, offers numerous advantages. For example, the array can exhibit fewer sequencing errors, and more oligonucleotides can be added via polymerase, effectively allowing for the programming of a wide variety of substrate sequences into the system for future application development. The fabrication strategy is compatible with existing machines and tools used for synthesizing microarrays, is relatively inexpensive, and scalable to six-inch wafer fabrication. Positional fidelity of the array within the gel can be high, and synthesis can be integrated with photoacid-generating chemistry to produce submicron-scale features. Polymerase and restriction endonuclease assays demonstrate that the patterned oligonucleotides can serve as substrates for different enzymes, and synthetic sequencing demonstrates the array's applicability to a wider range of heterologous substrates, such as fluorescent reversible terminators. This fabrication process could become a powerful tool for expanding the applicability of DNA microarrays, potentially enabling applications such as constructing genome sequencing libraries via chip-based barcodes and storing indexed DNA data.

[0104] In some embodiments, the surface treatment of the substrate may include covalently binding an oligothymidine group to the substrate. In some embodiments, the oligothymidine group thereby attached to the surface may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more thymidine nucleotides. In some embodiments, the oligothymidine group may comprise 5 thymidine nucleotides. In some embodiments, the free 5' hydroxyl group of the oligothymidine group may react with and covalently attach to the branched-link head phosphorous amide.

[0105] Following surface cleaning and treatment, the reagent can react with surface hydroxyl or amino groups. For example, the surface can react with cleavable linker (CL) phosphorus amides via reactive groups such as hydroxyl groups. Cleavable linker (CL) phosphorus amides include, for example, universal cleavable linker (UCL) phosphorus amides. The selection of cleavable linker phosphorus amides may include, but is not limited to, the molecules shown in Figure 6. As used herein, the term cleavable linker or CL (including UCL) generally refers to any of the following: cleavable linker phosphorus amide reagents, cleavable linkers that bind to the surface before the addition of nucleotides, and branch linkers that bind to the surface after the addition of nucleotides. Cleavable linker phosphorus amides can be reacted with a substrate using standard DNA synthesis protocols with some modifications, including, for example, adding a cleavable linker reagent to the DNA synthesis substrate, increasing the coupling time (e.g., 3 minutes), etc. In some embodiments, the cleavable linker phosphorus amide can react with free hydroxyl groups. In some embodiments, the cleavable linker may contain hydroxyl groups protected by DMT. In some embodiments, the cleavable linker may contain primary hydroxyl groups protected by DMT.

[0106] Then, DNA sequences can be synthesized on the substrate according to a standard DNA synthesizer protocol. A capping step is performed after each step of nucleic acid addition to block unreacted free 3' hydroxyl groups, preventing the truncated sequence from continuing to elongate the DNA chain. Capping can be achieved by treating with an acetylation reagent.

[0107] Following the final capping step, the reactive group with phosphoramide can react with the full-length DNA sequence but not with DNA sequences truncated at the 5' end. The reactive group can be immobilized with the gel in a sandwich structure of donor and acceptor substrates as described above.

[0108] In some embodiments, the cleavable linker (or UCL) can be cleaved, for example, by reacting with NH4OH, potassium carbonate, methylamine, 1,2-diaminoethane (also known as ethylenediamine EDA), potassium hydroxide in methanol, or AMA (a mixture of NH4OH and methylamine). Cleavage of the cleavable linker releases the 3'-OH ends of the entire probe sequence, thereby releasing the truncated probe sequence that is not immobilized on the gel.

[0109] In some embodiments, the cleavable connector can be cleaved under alkaline conditions to cut both full-length and truncated probe sequences from their 3' ends. Since a covalent bond is provided between the 5' ends of the full-length probe sequences, pre-fixed (or gel-polymerized) on the 5' ends, and the gel on the recipient substrate, these probes can be reversed to a 5'-to-3' orientation on the surface of the recipient substrate. Simultaneously, the truncated probe sequences can be removed from the recipient surface, and their sole attachment to the donor substrate can be severed, thereby removing the truncated probe sequences from both substrates after washing. Therefore, in some embodiments, the probe sequences remaining on the recipient substrate can comprise a majority of full-length probe sequences with a 5'-to-3' orientation. In some embodiments, the probe reversal step can increase the percentage of full-length probe sequences among all probe sequences compared to the probes before the probe reversal step (i.e., on the donor substrate).

[0110] The in-situ probe reversal disclosed in this disclosure can have several advantages. In certain chemical reactions, the use of toxic reagents can be avoided. Additionally, avoiding a separate cleavage step after DNA array synthesis can save time and reduce costs for large-scale applications. Eliminating the synthesis step can reduce operational errors that may occur during DNA array preparation.

[0111] When synthetic probes (full-length and truncated probes) are treated with alkaline reagents such as NH4OH, ethylenediamine / water (EDA: water), or AMA (a mixture of NH4OH and methylamine), UCL cleavage occurs. Since the full-length probe can be immobilized on the acceptor substrate, free 3'-OH groups at the 3' ends of the full-length probe sequence oriented from 5' to 3' on the acceptor substrate can be obtained.

[0112] In one example, controlled-pore glass (CPG) beads can be used as a synthetic substrate, which reacts with branched and cleavable adapters. Oligonucleotide probes can then be synthesized on the cleavable adapters attached to the substrate, which include a reactive group at the 5' end of the full-length probe sequence.

[0113] The probe reversal technique discussed in this article can be performed in an aqueous medium. Avoiding the use of organic solvents makes this technique more environmentally friendly and increases the ease of chemical treatment and waste disposal.

[0114] The probe reversal technique discussed in this article can be performed at pH values ​​of at least approximately 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, or 13.5. The probe reversal technique discussed in this article can be performed at pH values ​​of up to approximately 14.0, 13.5, 13.0, 12.5, 12.0, 11.5, 11.0, 10.5, 10.0, 9.5, 9.0, 8.5, 8.0, 7.5, 7.0, 6.5, 6.0, 5.5, 5.0, 4.5, 4.0, 3.5, 3.0, 2.5, 2.0, 1.5, 1.0, or 0.5. The probe reversal technique discussed in this paper can be performed at pH values ​​of approximately 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, or 13.5. In some cases, the probe reversal technique discussed in this paper can be performed at or near physiological pH, such as approximately 7.365 or approximately 7.5. Performing the reaction at physiological pH can reduce or eliminate the need for handling harsh substances or reaction conditions, and allows the use of aqueous media.

[0115] The probe reversal technique discussed in this paper can be performed at temperatures of approximately 15°C, 20°C, 25°C, 30°C, or 35°C. The probe reversal technique discussed in this paper can be performed at temperatures of up to approximately 15°C, 20°C, 25°C, 30°C, or 35°C. The probe reversal technique discussed in this paper can be performed at temperatures of at least approximately 15°C, 20°C, 25°C, 30°C, or 35°C. In some cases, the probe reversal technique discussed in this paper can be performed at or near room temperature, such as approximately 20°C, approximately 21°C, approximately 22°C, approximately 23°C, approximately 24°C, approximately 25°C, approximately 26°C, approximately 20°C to approximately 26°C, or approximately 20°C to approximately 22°C. Performing the reaction at room temperature reduces or eliminates the need for handling harsh substances or reaction conditions.

[0116] Releasing truncated probe sequences can increase the percentage of full-length sequences present in the array. In some cases, at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, or 99.999% of the probes still bound to the array substrate after the probe inversion process are full-length sequences. In some cases, the probe inversion process can release at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, or 99.999% of the truncated probes bound to the array substrate before the probe inversion process.

[0117] The synthetic substrate can include various forms or shapes, such as beads or planar arrays. The synthetic substrate can include any suitable material, including but not limited to glass (e.g., controlled-pore glass), silicon, or plastic. The substrate may contain a polymer coating or gel, such as a polyacrylamide gel or PDMS gel. The gel and coating may additionally contain components to modify their physicochemical properties, such as hydrophobicity. For example, a polyacrylamide gel or coating may contain modified acrylamide monomers in its polymer structure, such as ethoxylated acrylamide monomers, phosphorylcholine acrylamide monomers, betaine acrylamide monomers, and any combinations thereof.

[0118] For a variety of applications, reverse probes offer numerous advantages over standard non-reverse probes. For example, as mentioned above, probe reversal can remove most or all of the unwanted truncated probe sequence, thus providing a population of reverse probes containing up to 100% full-length probe sequences. Additionally, reverse probes can have free 3'OH groups, which is advantageous for enzymatic reactions (e.g., single or multiple base extensions, ligase reactions, etc.). Reverse probes can also be used in sequencing-by-synthesis (SBS) processes and other applications.

[0119] Example

[0120] Cleavable silane synthesis

[0121] The synthesis of 2-hydroxyethyl 3-(methyl(3-(trimethoxysilyl)propyl)amino)propionic acid is as follows: N-methyl-3-(trimethoxysilyl)prop-1-amine was cooled under nitrogen atmosphere with stirring in an ice bath. 2-hydroxyethyl acrylate (HEA) was added dropwise over 30 minutes with stirring, and the reaction was maintained at room temperature (RT) under nitrogen atmosphere for 24 hours with stirring, and stored undiluted.

[0122] Chip and gel preparation

[0123] use (KMG) The substrate was cleaned, rinsed, and exposed to a 3% by weight silanizing agent in 5% water in ethanol solution for 4 hours. It was then washed, dried, and kept in a desiccator for at least 24 hours before RT atmospheric storage and use. Unless otherwise specified, the silanizing agent for donor wafers is the aforementioned cleavable silane; for acceptor wafers, the silanizing agent is 3-acrylamidopropyltrimethoxysilane (Gelest). A 2-inch × 3-inch silane-coated slide was placed in an ABI (Applied Biosystems) 394 synthesizer, and a custom-made flow cell was inserted into the flow path instead of a column. The flow cell consisted of a substrate vacuum-fixed to an O-ring end-sealed position. The reagent flowed into the cell as per normal DNA / RNA synthesis procedures. Exposure on the ABI instrument was performed on a 2-inch × 3-inch substrate using a custom-made exposure tool with a 365nm lamp and exposure through a proximity mask (Compugraphics, Fremont, CA). When specified, complete 6-inch wafers are fabricated in a similar manner using a similarly modified flow cell connected to a Dr. Oligo (Biolytic, Fremont, CA) synthesizer. The 6-inch wafers are then exposed in a cleanroom in Palo Alto, CA, using a Neutronix Quintel 8008AL (NxQ, Morgan Hill, CA) exposure tool with hard contact (vacuum between mask and substrate), or as instructed using a similar hard-contact close-range exposure tool in Taiwan, ensuring tight contact between the mask and wafer.

[0124] Photoamidite (i.e., light-T) was used and exposed as described in the literature. See McGall GH, Christians F.C. (2002) High-Density Gene Chip Oligonucleotide Probe Arrays. In: Hoheisel J. et al. (eds.) Chip Technology. Advances in Biochemical Engineering / Biotechnology, Vol. 77, 21-42. Springer, Berlin, Heidelberg. The wafer contained five dimethoxytriphenylmethyl-blocked thymines (DMT-Ts), which were placed at the bottom or near or on the surface of the substrate and uniformly transverse across the wafer before the addition of the cleavable portion of one or two universally cleavable adapters (UCL, AM Chemicals, P / N 02120, Oceanside, CA). The sequence of interest was then synthesized in a 3'->5' orientation. After completing the sequence of interest, place four more DMT-Ts, then pattern the last T of interest (either a light-T, or, in the case of high-resolution display, a DMT-T with photoresist), and then add ACRYDITE. TM (Glen Research, Sterling, VA). Then the 2-inch x 3-inch substrate was cut into... A square. Unless otherwise specified, prepare 5% tetramethylenediamine (TEMED, Aldrich, Milwaukee, WI), a weighed 4.8% potassium persulfate (Aldrich) solution, and a saturated 5% acrylamide solution with 5% bifunctional groups (Bio-Rad, Hercules, CA, 161-0144) and degas under nitrogen for at least 10 minutes and no more than 1 hour. Add about 200 μl of TEMED to 10 ml of acrylamide solution. Then add 250 μl of potassium persulfate (KPS) and quickly stir until completely free from exposure to atmosphere. Remove about 20 μl of the reaction mixture and add it to an air-coated acrylamide-silane substrate, and invert a patterned sacrificial wafer block of about 7.5 mm × about 7.5 mm (cut from a 6-inch wafer) or about 1 cm critical-size rectangle cut from a synthetic wafer on top. No attempt was made to remove oxygen at this point, and it is presumed that polymerization proceeded after the free radicals exceeded the dissolved oxygen between the sandwich-structured wafers. As a result, the oxygen-affected polymerization reaction altered the gel properties, and the edges of the polymerized gel became rough.

[0125] Unless otherwise specified, place the wafer “sandwich structure” with crosslinked blocks in concentrated ammonia solution for 18 hours. For complete 6-inch wafer gel transfer, apply approximately 300 μl of the polymer mixture to the synthesized 5'-up sacrificial wafer with the quartz substrate on top, allowing wicking of the polymer mixture to be observed. In some cases, the sacrificial wafer may float off the gel due to solution movement from the orbital oscillator when the 2' × 3' substrate is cut into 8-10 mm blocks and inverted. If the complete release chemistry is not used, either due to wafer compatibility issues or early experiments where the required level of cuttable portion is unclear, gentle pushing may be necessary. Place the wafer sandwich structure in ammonia solution until release, then apply an ethylenediamine:water (50:50, Aldrich Milwaukee, WI) solution for 1-3 hours to complete deprotection and ensure complete reduction of UCL to 3'OH.

[0126] The gel wafers were then washed with water, followed by 4×SSC buffer (Aldrich), and prepared for hybridization. Hybridization was performed using a 25 nM complementary sequence labeled with Cy3 (IDT, Coralville, IA) at the 5' end, incubated overnight at 45°C, and then cooled for at least 1 hour. The gel wafers were washed three times with 4×SSC, with the last wash lasting at least 5 minutes, and then imaged on a fluorescence microscope (Keyence BZ-X710 Itasca, IL).

[0127] Probe extension measurement

[0128] An 84-base template oligonucleotide, 5'CTGTCTCTTATACACATCTGAGCTGAATTCATAACTTCGTATAGCATACATTATACGAAGTTATGCTGTATCGGCTGAATCGTA, was ordered from IDT and hybridized with the reverse array for 2 hours at 45°C in 2×SSC buffer. The array was then washed twice at 15 minutes on RT in 1×SSC buffer, followed by two 15-minute washes each in 0.5×SSC buffer at RT. Extension was performed for 1 hour at 37°C under standard conditions using DNA polymerase Klenow Large Fragment (New England Biolabs, Ipswitch, MA). The array was then washed in 1×SSC and immersed in 0.2N NaOH solution with shaking for 10 minutes to remove the template oligonucleotide, and finally equilibrated with 5 ml of 1×SSC. Cy3-labeled probes targeting the mosaic end sequences were then hybridized with the array, washed as before, and imaged on a Keyence BZ-X710.

[0129] Patterning and transfer using Centrillion photoresist

[0130] To demonstrate high resolution, AM1 oligonucleotides (5'TACGATTCAGCCGATACAGC3') were fabricated on a 2-inch × 3-inch substrate, differing in that 6-fluorescein phosphoramide (6-FAM, Glen Research) was added on the inductance, and the light-T group was replaced by DMT-T, while the DMT group set remained intact. The wafer was spin-coated with Centrillion photoresist (Centrillion Technologies, Inc., Palo Alto, CA) at 2500 rpm for 1 minute, and then baked in a convection oven at 50°C for 5 minutes at 36 mJ / cm². 2 Expose at a certain speed and let stand at RT for 4 minutes. Strip the resist in propylene glycol monomethyl ether acetate (PGMEA) and isopropanol. Dry the substrate with nitrogen, then place it back into the synthesizer for Acrydite, invert it onto the gel, and image it on a Keyence microscope using the FITC channel.

[0131] On-chip stepwise sequencing

[0132] The AM1 sequence (5'TACGATTCAGCCGATACAGC3') was synthesized on a chip using an ABI 394 DNA synthesizer with the 5' end up using patterned Acrydite, then inverted onto the gel as before, and finally washed on RT for 30 minutes in 8×SSC. The sequence GAAGAGAGGTAGTAATCATGGCTCTATCGGCTGAATCGTA / 3ddC / 1μm was hybridized in 8×SSC at 35°C, transferred to RT and washed over 30 minutes. Extension occurred with all four bases present, three fluorescent labels, and reversible terminators. The first base was added to a fluorescent premix (FLMM) and imaged in three channels to indicate correct base addition. Extension was completed with an unlabeled reversible terminator, cut, and imaged to verify fluorescence loss. The process was then repeated with the second base using FLMM and imaged.

[0133] Enzymatic reaction of 3'-upward transfer oligonucleotides

[0134] Because transfer oligonucleotides are 3' up and have reactive hydroxyl groups, they can respond to polymerase extension reactions. To demonstrate this, an 84-base template oligonucleotide containing the AM1 inverse complement, 5'CTGTCTCTTATACACATCTGAGCTGAATTCATAACTTCGTATAGCATACATTATACGAAGTTATGCTGTATCGGCTGAATCGT, was hybridized to an array and extended using Klenow DNA polymerase. Figure 7A After extension, the template oligonucleotide was stripped with NaOH, the array was washed in SSC buffer, and finally the array was hybridized with a probe complementary to the last 20 bases at the 3' end of the newly extended molecule. Figure 7B The results of hybridization of the fluorescent probe with the newly synthesized region of the array are shown. The resolution test pattern can be readily observed, demonstrating that 64 bases can be efficiently added to the 3' end of the oligonucleotide on the array via an enzyme-catalyzed extension reaction.

[0135] The ability to copy long template DNA sequences to the 3' ends of densely patterned arrays is another advantage and unexpected result of the disclosed platform. This capability allows for the simultaneous addition of significant molecular complexity to all features on the array. As an example, in Figures 7A-7D The template oligonucleotides used are designed to encode: 1) a classic LoxP sequence for Cre-mediated recombination between the array and any flopped DNA target; 2) an EcoI restriction sequence; 3) an AluI restriction sequence; and 4) a 19-base mosaic end sequence recognized by the Tn5 transposase. Since the polymerase reaction plays a role in this system, the array can be constructed in single-stranded or double-stranded configurations. Both EcoI and AluI have been shown to cleave both single-stranded and double-stranded DNA, and in this example, researchers can choose to generate sticky or flat array ends as needed. Meanwhile, the Tn5 transposase has been used to construct genomic DNA sequencing libraries on hydrogel surfaces, where the mosaic end oligonucleotides are randomly distributed within the gel. Given the length of the final molecule, it may be impossible to synthesize arrays with so many sequence motifs using standard phosphoramide chemistry with photolithography. Instead, error-free or substantially error-free microarrays of said oligonucleotides can be produced by using only the 3'-up oligonucleotides from the transfer of this disclosure, followed by extension of the 3' oligonucleotides by polymerase.

[0136] To demonstrate that inverted and extended arrays can be used as substrates for enzymes other than polymerases, from Figure 7B The resulting array ( Figure 7BThe fluorescent probe used (still hybridizing with the 3'-up oligonucleotide) was exposed to the restriction enzyme EcorI at 37°C for 1 hour. Upon imaging, the template pattern was barely detectable (as shown in Figure 3C), indicating that the added enzyme performed an internal cleavage at the recognition sequence, releasing the 3'Alu1 and the mosaic end sequence along with the hybridized fluorescent probe. Figure 7C ).

[0137] To ensure that the cleavage was selective and not a result of non-specific degradation of the array in the gel, a second Cy3-labeled probe was added, which was found to hybridize with the original AM1 sequence. Figure 7D ). Due to Figure 7D The resolution test pattern was easily observed again, leading to the conclusion that digestion with EcoI is specific to the internal restriction sequence and preserves the 5' cleaved Acrydite registration sequence intact.

[0138] While preferred embodiments of the invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided merely as examples. Numerous variations, modifications, and substitutions will occur to those skilled in the art without departing from the scope of the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be used in the practice of the invention. The following claims are intended to define the scope of the invention, thereby covering the methods and structures and their equivalents within the scope of these claims.

Claims

1. A method for reversing oligonucleotides on a surface, the method comprising: (a) A donor substrate coupled to a plurality of molecules on a first surface of the donor substrate, wherein members of the plurality of molecules comprise (i) a first oligonucleotide oriented 3' to 5' on the first surface of the donor substrate, wherein the members of the plurality of molecules further comprise a universally cleavable linker between the first surface of the donor substrate and the first oligonucleotide oriented 3' to 5', and wherein the 3' end of the first oligonucleotide is fixed on the first surface of the donor substrate, and (ii) a first reactive group attached to the 5' end of the first oligonucleotide, wherein the first reactive group comprises phosphorous acrylate; (b) Providing the receptor substrate comprising a plurality of second reactive groups fixed on the surface of the receptor substrate, wherein the second reactive groups comprise acrylamide; (c) Provide an intermediate layer containing polyacrylamide; (d) The donor substrate, the intermediate layer and the recipient substrate are arranged in a sandwich structure such that the first surface of the donor substrate faces the surface of the recipient substrate, and the intermediate layer is located between the first surface of the donor substrate and the surface of the recipient substrate. (e) subjecting the sandwich structure to fixed conditions to form a first covalent bond between the first reactive group and the intermediate layer, and to form a second covalent bond between members of the plurality of second reactive groups and the intermediate layer, thereby producing a transformed sandwich structure; (f) Releasing the donor substrate from the first oligonucleotide, wherein the release comprises treating with a base and breaking the bond between the universally cleavable linker and the first oligonucleotide, wherein the universally cleavable linker is cleaved to expose a free 3' hydroxyl group. and (g) Providing a first oligonucleotide oriented 5' to 3' through the intermediate layer fixed to the receptor substrate, wherein the 5' end of the first oligonucleotide is fixed to the receptor substrate.

2. The method according to claim 1, wherein the first oligonucleotide in (g) comprises the free 3' hydroxyl group.

3. The method of claim 1, wherein the universal cutable connector is obtained through a reagent Coupled with the first surface.

4. The method according to claim 1, wherein the base comprises at least one selected from NH4OH, 1,2-diaminoethane and methylamine.

5. The method according to claim 1, wherein the fixed condition is a polymerization reaction.

6. The method of claim 5, wherein the polymerization reaction forms a polymer gel, and wherein the polymer gel comprises the first covalent bond and the second covalent bond.

7. The method of claim 1, wherein the first oligonucleotide oriented from 3' to 5' in (a) is full-length, and wherein the first oligonucleotide oriented from 3' to 5' is untrunculated.

8. The method of claim 7, wherein the first oligonucleotide oriented from 5' to 3' in (g) is full-length, and wherein the first oligonucleotide oriented from 5' to 3' is untrunculated.

9. The method of claim 1, wherein the release in (f) further comprises performing a mechanical cutting process or a laser perforation process on the second surface of the donor substrate.

10. The method of claim 9, wherein in (f) after performing the mechanical cutting process or the laser perforation process, the release further comprises treatment with an alkali.

11. The method of claim 1, wherein the plurality of molecules are patterned on the first surface of the donor substrate.

12. The method of claim 11, wherein the provision in (g) comprises converting the plurality of molecules into a plurality of inverted molecules on the surface of the receptor substrate, and wherein the plurality of inverted molecules maintain the pattern on the surface of the receptor substrate.

13. A method for preparing a 5' to 3' oriented oligonucleotide array immobilized on the receptor surface of a receptor substrate, the method comprising: (a) Providing a sandwich structure construction, the sandwich structure construction comprising: (i) A donor substrate including the donor surface; (ii) A plurality of oligonucleotides, wherein the 3' end of each member of the plurality of oligonucleotides is covalently bonded to the donor surface, wherein the 3' end of each member of the plurality of oligonucleotides is covalently bonded to a universally cleavable adapter, the universally cleavable adapter being covalently bonded to the donor surface; (iii) An intermediate layer comprising polyacrylamide, said intermediate layer being covalently bonded to a first reactive group attached to the 5' end of each member of the plurality of oligonucleotides, said first reactive group comprising phosphorous acrylate; and (iv) A receptor base comprising a receptor surface, wherein the intermediate layer is covalently bonded to a plurality of second reactive groups fixed on the receptor surface, wherein the second reactive groups comprise acrylamide; (b) Releasing the donor substrate from the plurality of oligonucleotides, wherein the release comprises treating with a base and breaking the bond between the universally cleavable linker and each member of the plurality of oligonucleotides, wherein the universally cleavable linker is cleaved to expose a free 3' hydroxyl group; and (c) Providing an array of oligonucleotides 5' to 3' oriented on the receptor surface of the receptor substrate, wherein the 5' ends of the oligonucleotides are anchored to the receptor substrate.

14. The method of claim 13, further comprising: Prior to (a), the intermediate layer is formed by acrylamide used for the polymerization reaction between the donor surface and the acceptor surface, which are bonded to the plurality of oligonucleotides.

15. The method of claim 14, wherein forming the intermediate layer comprises performing a polymerization reaction.

16. The method of claim 15, wherein the polymerization reaction polymerizes the acrylamide reagent.

17. The method of claim 13, wherein the release in (b) further comprises performing a mechanical cutting process or a laser perforation process on another surface of the donor substrate prior to the treatment with the alkali and the breaking of the bond.

18. The method of claim 13, wherein the base comprises at least one selected from NH4OH, 1,2-diaminoethane, and methylamine.

19. The method of claim 13, wherein after (b), the intermediate layer remains covalently bonded to the receptor surface.

20. The method of claim 19, wherein after (c), the oligonucleotide array is maintained with a 5' to 3' orientation and covalently bonded to the intermediate layer via the 5' ends of the members of the plurality of oligonucleotides.

21. The method of claim 19, wherein after (c), each member of the oligonucleotide array contains the free 3' hydroxyl group.

22. The method of claim 14, wherein the plurality of oligonucleotides are synthesized from the donor surface at a 3' to 5' orientation prior to the formation of the intermediate layer.

23. A composition for preparing an oligonucleotide array, the composition comprising: (a) A donor substrate including the donor surface; (b) A plurality of oligonucleotides, wherein the 3' end of each member of the plurality of oligonucleotides is covalently bonded to the donor surface, wherein the members of the plurality of oligonucleotides are covalently bonded to a universally cleavable linker via the 3' end; (c) An intermediate layer comprising polyacrylamide, said intermediate layer being covalently bonded to a first reactive group attached to the 5' end of said member of the plurality of oligonucleotides, said first reactive group comprising phosphorous acrylate; and (d) A receptor substrate comprising a receptor surface, wherein the intermediate layer is covalently bonded to a plurality of second reactive groups immobilized on the receptor surface, wherein the second reactive groups comprise acrylamide. Each member of the plurality of oligonucleotides contains a free 3' hydroxyl group.

24. The composition of claim 23, wherein the universally cuttable connector is covalently bonded to the donor surface.

25. The composition of claim 23, wherein the donor substrate is configured to be mechanically cut or laser-perforated into multiple pieces.

26. The composition of claim 23, wherein the donor substrate is a silicon wafer.

27. The composition of claim 23, wherein the receptor substrate is a quartz wafer.

28. The composition of claim 23, wherein the composition is characterized by a combination of any two or more of the following: (i) The members of the plurality of oligonucleotides are covalently bonded to a universally cleavable linker via the 3' end of the members of the plurality of oligonucleotides; (ii) The donor substrate is configured to be mechanically cut or laser-perforated into multiple pieces; (iii) The intermediate layer comprises polyacrylamide; (iv) The donor substrate is a silicon wafer; (v) The receptor substrate is a quartz wafer; and (vi) Each member of the plurality of oligonucleotides contains the free 3' hydroxyl group.

Citation Information

Patent Citations

  • Disulfide-linked reversible terminators

    US20160355541A1

  • Disulfide-linked reversible terminators

    WO2016182984A1

  • Fabrication of patterned arrays

    CN106460032A