Engineered probiotics with surface-displayed phenylalanine ammonia-lyase

By genetically engineering Escherichia coli Nissle 1917 to display phenylalanine ammonia-lyase on its surface, enhancing the internal and external transport and excretion of phenylalanine, an engineered probiotic was constructed. This solved the problems of low gene therapy transport efficiency and difficulties in low-phenylalanine diets, achieving highly effective treatment for phenylketonuria.

CN112662607BActive Publication Date: 2026-07-17SHANGHAI TAOYUSHENG BIOTECHNOLOGY CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI TAOYUSHENG BIOTECHNOLOGY CO LTD
Filing Date
2021-01-07
Publication Date
2026-07-17

AI Technical Summary

Technical Problem

Current technologies for treating phenylketonuria (PKU) suffer from low gene delivery efficiency, and low-phenylalanine diets are difficult to adhere to and have a heavy economic burden.

Method used

By genetically engineering Escherichia coli Nissle 1917 to display phenylalanine ammonia-lyase on its surface and enhance its ability to transport and excrete phenylalanine, an engineered probiotic was constructed to improve the degradation capacity of phenylalanine.

Benefits of technology

It significantly degrades phenylalanine to produce trans-cinnamic acid, providing a highly effective treatment for phenylketonuria. It has a good taste, high patient compliance, and can exert a sustained therapeutic effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0002887476820000071
    Figure BDA0002887476820000071
  • Figure BDA0002887476820000081
    Figure BDA0002887476820000081
  • Figure BDA0002887476820000091
    Figure BDA0002887476820000091
Patent Text Reader

Abstract

This invention discloses an engineered probiotic possessing surface-displayed phenylalanine ammonia-lyase, derived from *Escherichia coli* Nissle 1917. The argR gene has been knocked out and / or the argA gene (Y19C) has been mutated, integrating the L-phenylalanine ammonia-lyase gene stlA, the L-phenylalanine transport protein gene pheP, the L-amino acid deaminase gene pma, and the efflux pump gene acrA. This engineered probiotic can be used to treat phenylketonuria.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically, it relates to an engineered probiotic with phenylalanine ammonia-lyase on its surface, its construction method, and its application in the preparation of drugs for the treatment of phenylketonuria. Background Technology

[0002] Phenyleneketonuria (PKU) is a congenital disorder of phenylalanine metabolism and is an autosomal recessive genetic disorder. In China, the incidence of PKU in newborns is approximately 1 in 11,000, and it has been included in the mandatory screening program for newborns.

[0003] Phenylketonuria (PKU) is caused by a deficiency of phenylalanine hydroxylase (PAH) in the liver or mutations in tetrahydrobiopterin synthase or dihydrobiopterin reductase. Normally, phenylalanine is catalyzed by PAH to produce tyrosine, which is then used in the tyrosine metabolism pathway to synthesize thyroid hormones, adrenal glands, and melanin. PAH mutations lead to metabolic disorders of phenylalanine in the liver, preventing its conversion to tyrosine. Instead, phenylalanine and α-ketoglutarate accumulate in the blood and tissues and are excreted in the urine. Furthermore, the accumulation of its metabolites in the central nervous system can produce toxicity, inducing symptoms such as restlessness, hyperactivity, and mental abnormalities in affected children.

[0004] Currently, the main treatment for PKU is dietary therapy. Phenylalanine, as one of the essential amino acids for the human body, is mainly obtained from food. Children with PKU cannot follow a phenylalanine-free diet. Therefore, to ensure normal growth and development, a low-phenylalanine diet is necessary for children with PKU. However, dietary therapy faces challenges such as difficulty in long-term adherence and heavy economic burden. With the development of molecular biology techniques, gene therapy has entered the experimental stage. For example, recombinant adenovirus carrying cDNA expressing the PAH gene is placed in mice to restore liver PAH activity. However, the main problem currently is low transport efficiency. Summary of the Invention

[0005] Probiotics are a large class of drugs, generally administered orally as live bacteria preparations to achieve therapeutic and health-promoting effects. The advantages of probiotic preparations include convenient administration, pleasant taste, patient acceptance, high compliance, and the ability to continuously proliferate in the intestines, thus stably exerting their therapeutic effects.

[0006] Escherichia coli Nissle 1917 (abbreviated as EcN or Nissle 1917) is a non-pathogenic Escherichia coli and also a probiotic. The applicant reported in invention patent CN202011457369.7 an engineered probiotic of Nissle 1917 that can be used to treat phenylketonuria (PKU) by enhancing its ability to degrade phenylalanine and thus improving its therapeutic effect. The inventors further utilized genetic engineering technology to modify the Nissle 1917 engineered probiotic, enabling it to display phenylalanine ammonia-lyase on its surface, further improving its ability to degrade phenylalanine. Specifically, this invention includes the following technical solutions:

[0007] An engineered probiotic, derived from Escherichia coli Nissle 1917, possesses surface-displayed phenylalanine ammonia-lyase (PAL).

[0008] The aforementioned engineered probiotics are constructed by using Escherichia coli Nissle 1917 as the substrate bacteria, and constructing an Escherichia coli Nissle 1917 engineered probiotic that displays L-phenylalanine ammonia-lyase PAL on its surface through plasmid expression or genome integration; or they are obtained by genetically engineering Escherichia coli Nissle 1917 engineered bacteria that already possess intracellular phenylalanine ammonia-lyase PAL as a basis, and then further modifying it to display phenylalanine ammonia-lyase PAL on its surface.

[0009] For example, using *E. coli* Nissle 1917 as the substrate bacteria, engineered probiotics of *E. coli* Nissle 1917 displaying the L-phenylalanine ammonia-lyase gene stlA can be constructed through plasmid expression or genome integration. The plasmid can be, for example, the pINP-stlA plasmid, which, after transformation into Nissle 1917 (EcN), yields the recombinant engineered probiotic EcN / pINP-stlA.

[0010] The aforementioned engineered Escherichia coli Nissle 1917 strain, which already possesses the intracellular phenylalanine ammonia-lyase (PAL), can be constructed through the following steps: the exogenous L-phenylalanine ammonia-lyase gene stlA, the exogenous L-phenylalanine internal transport protein gene pheP, and the exogenous L-amino acid deaminase gene pma are integrated into the genome of Escherichia coli Nissle 1917.

[0011] Preferably, it also integrates the endogenous (i.e., derived from Nissle 1917) efflux pump gene acrA; and / or

[0012] The gene argR was knocked out and / or the gene argA (Y19C) mutation occurred; and / or

[0013] The RBS sequences of the stlA, pheP, and acrA genes were optimized.

[0014] Preferably, the nucleotide sequence of the L-phenylalanine ammonia-lyase (Genbank ID KGM29850.1) gene stlA is SEQ ID NO:1;

[0015] The nucleotide sequence of the L-phenylalanine transport protein (Genbank QPA14453.1) gene pheP is SEQ ID NO:2;

[0016] The nucleotide sequence of the L-amino acid deaminase (Genbank No. AAA86752.1) gene pma is SEQ ID NO:3.

[0017] The nucleotide sequence of the efflux pump protein (Genbank No. WP_001295833.1) gene acrA can be SEQ ID NO:4.

[0018] Furthermore, the aforementioned RBS sequence optimization can be as follows: the RBS (ribosome binding site) sequence of the stlA gene in the genome can be optimized from GCTAGGCAGGATACTTCCAATCCATGGCAACAAAACAAAAAGTAGAGGAGGTAAAT to CTCGCGAGAATTAAGAAGAAAGGAGGTTTTTTTT (SEQ ID NO:5); the RBS sequence of the pheP gene can be optimized from GCTAGGCAGGATACTTCCAATCCATGGCAACAAAACAAAAAGTAGAGGAGGTAAAT to GGAGTTATCTCTCCCGGGTCACAATATTAAGGAGGTTTTATTT (SEQ ID NO:6); and the RBS sequence of the acrA gene can be optimized from GCTAGGCAGGATACTTCCAATCCATGGCAACAAAACAAAAAGTAGAGGAGGTAAAT to GAGGCTAACAGGCACATTCAATAAGGAGGTTTTTT (SEQ ID NO:7).

[0019] The dapA gene, a dihydropyridine dicarboxylic acid synthase, can also be knocked out in the genome of the aforementioned Escherichia coli Nissle 1917 derivative.

[0020] Preferably, the genotype of the above-mentioned engineered probiotic is: EcN(malP::Pj23119H-stlA,yicS::Pj23119H-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,dapA::inaK-stlA,argA*,△argR,lacZ::Pj23119H-acrA).

[0021] A second aspect of the present invention provides a method for constructing the above-described engineered probiotics, which may include the following steps:

[0022] A. Using the engineered probiotic EcN / pINP-stlA containing the surface-displaying stlA plasmid pINP-stlA as the substrate bacteria, the L-phenylalanine ammonia-lyase gene stlA is knocked into one or more sites, preferably two or more sites, preferably three or more sites, preferably four or more sites, and preferably five sites at the malP site, yicS site, malE site, rhtC site, and exo site of the genome to obtain stlA gene-integrated strains;

[0023] B. For the stlA gene-integrated strain obtained in step A, knock in the L-phenylalanine transport protein gene pheP at one or more sites, preferably two sites, of the lacZ and agaI sites in its genome to obtain the stlA+pheP integrated strain.

[0024] C. For the stlA+pheP integrated strain obtained in step B, knock the L-amino acid deaminase gene pma into the araBD site of its genome to obtain the stlA+pheP+pma integrated strain.

[0025] D. For the stlA+pheP+pma integrated strain obtained in step C, knock out the dihydropyridine dicarboxylic acid synthase gene dapA in its genome to obtain the stlA+pheP+pma△dapA strain.

[0026] E. For the stlA+pheP+pma△dapA strain obtained in step D, a (Y19C) mutation is performed on the argA site of its genome to obtain the stlA+pheP+pma△dapA argA* strain;

[0027] F. For the stlA+pheP+pma△dapA argA* strain obtained in step E, knock out argR in its genome to obtain the stlA+pheP+pma△dapA argA*△argR strain.

[0028] Preferably, the above method may further include the following steps:

[0029] G. For the stlA+pheP+pma△dapA argA*△argR strain obtained in step F, knock in the efflux pump gene acrA at the lacZ site in its genome to obtain the stlA+pheP+pma+acrA△dapA argA*△argR strain.

[0030] The above method may also include the following steps:

[0031] H. For the stlA+pheP+pma+acrA△dapA argA*△argR strain obtained in step G, optimize the RBS sequence of the stlA gene in its genome to SEQ ID NO:5, the RBS sequence of the pheP gene to SEQ ID NO:6, and the RBS sequence of the acrA gene to SEQ ID NO:7 to obtain the RBS-optimized strain.

[0032] I. For the RBS optimized strain obtained in step H, knock in the surface-displaying stlA gene at the dapA site in its genome to obtain an engineered probiotic with surface-displaying phenylalanine ammonia-lyase.

[0033] The knock-in and knock-out of the above genes can be carried out using gene editing technology, which employs the CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas related transposon system INTEGRATE system, or CAST system.

[0034] A third aspect of the invention provides the use of the above-described engineered probiotics in the preparation of medicaments for the treatment of phenylketonuria.

[0035] The aforementioned drugs are preferably oral dosage forms, which can be administered orally. Accordingly, the drug dosage form is an oral dosage form suitable for oral administration while maintaining the activity of probiotics, including solid granules, tablets, and liquid live bacteria preparations.

[0036] Optionally, the drug, in addition to the engineered probiotics as the active pharmaceutical ingredient, also contains at least one adjuvant therapeutic agent, thereby forming a compound drug. Preferably, the adjuvant therapeutic agent is another pharmaceutical ingredient used to treat phenylketonuria without impairing the activity of the probiotics.

[0037] In vitro experiments have shown that the engineered probiotics constructed in this invention can significantly degrade phenylalanine to produce trans-cinnamic acid, which shows promise for development into an effective drug for treating phenylketonuria. Attached Figure Description

[0038] Figure 1 A bar chart comparing the ability of the original strain E. coli Nissle 1917 and various engineered strains to degrade phenylalanine to produce trans-cinnamic acid. Detailed Implementation

[0039] The inventors, based on the original *E. coli* Nissle 1917, which lacked the ability to degrade phenylalanine, modified its genome to enable the recombinant Nissle 1917(EcN) engineered bacteria to express the phenylalanine ammonia-lyase gene, thus acquiring the ability to degrade phenylalanine. The recombinant Nissle 1917(EcN) engineered bacteria can express the phenylalanine ammonia-lyase gene intracellularly or display L-phenylalanine ammonia-lyase (PAL) on its surface. The recombinant Nissle 1917(EcN) engineered bacteria displaying L-phenylalanine ammonia-lyase (PAL) on its surface possesses a stronger ability to degrade phenylalanine, thus making it suitable for use as an engineered probiotic. Furthermore, the argine synthesis pathway was enhanced by inactivating the argR gene and performing an anti-feedback inhibition mutation (Y19C) on argA. Subsequently, through genetic engineering, the strain was made to express the L-phenylalanine transport protein gene and / or the L-amino acid deaminase gene, resulting in engineered probiotics TYS009 and TYS010 with significantly improved phenylalanine degradation capabilities. This has been described in patent CN202011457369.7, the entire contents of which are incorporated herein by reference.

[0040] Based on the engineered probiotic TYS010, this invention further strengthens the phenylalanine efflux pump gene, such as acrA, and optimizes the RBS sequences of the stlA, pheP, and acrA genes to obtain the engineered probiotic TYS013, which has the ability to display phenylalanine ammonia-lyase PAL on its surface, thereby further improving its ability to degrade phenylalanine.

[0041] For the sake of brevity, the term "engineered probiotics" will sometimes be abbreviated as "(genetically) engineered bacteria" or "probiotics" in this article. They have the same meaning and can be used interchangeably.

[0042] The argR gene is a gene that regulates the arginine operon, which is ubiquitous in bacteria and has different functions in different bacteria. The inventors found that by knocking out this negative regulatory gene in the genome of Escherichia coli Nissle 1917, its inhibition on arginine synthesis can be relieved to some extent.

[0043] The Y19C mutation in the argA gene encoding N-acetylglutamate synthase (NAGS) has the effect of relieving arginine feedback inhibition.

[0044] In one specific embodiment, the present invention introduces a constitutive promoter Pj23119 to regulate the phenylalanine ammonia-lyase gene (stlA) from *Photorhabdus luminescens* and enhances the phenylalanine-specific transporter gene (pheP) from *E. coli* MG1655 into the genome of the probiotic *E. coli* Nissle 1917. This effectively improves the intracellular transport of phenylalanine and converts it into trans-cinnamic acid. Simultaneously, an L-amino acid deaminase gene (pma) from *Proteus mirabilis* HI4320 is introduced, which can degrade phenylalanine into phenylpyruvic acid. Knocking out argR and mutating argA (Y19C) strengthens the argine synthesis pathway, effectively utilizing the ammonia released when phenylalanine is converted into trans-cinnamic acid and phenylpyruvic acid, thereby promoting the conversion of phenylalanine to trans-cinnamic acid and phenylalanine, achieving the goal of effectively degrading phenylalanine. By enhancing the trans-cinnamic acid efflux pump gene arcA, the intracellular trans-cinnamic acid content was effectively reduced, further promoting the conversion of phenylalanine to trans-cinnamic acid. Furthermore, the expression of these genes was improved by optimizing the ribosome binding sites (RBS) of stlA, pheP, and acrA. Further, stlA was displayed on the cell surface, enabling the engineered probiotics to act as "immobilized cell factories" to catalyze the reaction, further enhancing the probiotics' ability to degrade phenylalanine.

[0045] It should be understood that in the specific operation of constructing the genetically engineered bacteria of the present invention, the order of steps A, B, C, up to step I is not fixed from front to back according to the English alphabetical order. They can be operated in a cross or reversed manner, as long as each step can achieve its own function and complete the directional change of the host cell genotype.

[0046] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0047] This article involves the addition amount, content and concentration of various substances. Unless otherwise specified, the percentage content mentioned refers to the mass percentage.

[0048] Example

[0049] Materials and methods

[0050] The whole genome synthesis, primer synthesis, and sequencing in this article were all completed by Nanjing Jinruis Biotechnology Co., Ltd.

[0051] The molecular biology experiments in this embodiment, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were both performed according to Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments if necessary.

[0052] Main culture medium:

[0053] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride. (For solid medium, add 20 g / L agar powder.)

[0054] The original Escherichia coli Nissle 1917, plasmids pTargetF (Addgene:62226), pCas (Addgene:62225), and pSU2718 were kindly provided by Professor Yang Sheng's research group at the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences.

[0055] The pTargetF plasmid (Addgene:62226), pCas plasmid (Addgene:62225), and pSU2718 plasmids are stored by Shanghai Taoyusheng Biotechnology Co., Ltd. Any unit or individual may obtain these plasmids and related plasmids and bacteria for the purpose of verifying the present invention, but they may not be used for other purposes, including development and utilization, scientific research and teaching, without the permission of Shanghai Taoyusheng Biotechnology Co., Ltd.

[0056] The construction of the PAL-engineered probiotics was based on the work of Isabella, V. et al. (Development of asynthetic live bacterial therapeutic for the human metabolic disease phenylketonuria. Nat Biotechnol 36, 857–864, 2018.) and Kurtz, C. et al. (An engineered E. coli Nissle improves hyperammonemia and survival in mice and shows dose-dependent exposure in healthy humans. Sci. Transl. Med. 11, eaau 7975, 2019.). The probiotic genome was modified using the CRISPR-Cas9 method described by Jiang Y et al. (Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System, Appl Environ Microbiol, 2015).

[0057] The primer sequence information used in the following examples is shown in Table 1.

[0058] Table 1. List of primers used in the examples

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065] In Table 1, "-F" in the name represents positive; "-R" represents negative.

[0066] Example 1: Construction of PAL-engineered probiotic EcN / pINP-stlA for surface display

[0067] 1.1 Construction of pINP-stlA plasmid

[0068] (1) Using pSU2718 plasmid as template and 15A-F / Psu-RG as primers, the 15A fragment was amplified by PCR, about 1kb; using pPIC9k plasmid as template and Kan-FG / Kan-R(15A) as primers, the Kan fragment was amplified by PCR, about 1kb; using pUC-inak plasmid as template (synthesized by GenScript) and inak-F / inaK-R as primers, the inak-N fragment was amplified by PCR, about 600bp; using pUC-sltA plasmid (synthesized by GenScript) as template and stlA(inaK)-F / stlA-R as primers, the stlA(inaK) fragment was amplified by PCR, about 1.6kb; using pTrc99a plasmid as template and rrnB-F / rrnB-R as primers, the rrnB fragment was amplified by PCR, about 400bp.

[0069] (2) The 15A, Kan, inak-N, stlA (inaK) and rrnB fragments were ligated using DNA assembly (DNA assembly kit purchased from TransGold). The ligation products were transformed into DH5α chemocompetent cells, and the recovery solution was plated on LB solid plates containing kanamycin (final concentration 50 μg / mL) to obtain transformants containing pINP-stlA plasmid.

[0070] 1.2 Construction of recombinant engineered probiotic EcN / pINP-stlA

[0071] (1) Prepare Escherichia coli Nissle 1917 (EcN) chemically transformed competent cells. The method for preparing chemically transformed competent cells is referred to "Molecular Cloning: A Laboratory Manual" (3rd edition).

[0072] (2) pINP-stlA plasmid was transformed into EcN-competent cells, and the bacterial culture was spread on LB solid plates containing kanamycin (final concentration 50 μg / mL) to obtain EcN / pINP-stlA recombinant engineered probiotics.

[0073] Example 2: Construction of engineered probiotic TYS009 and TYS009 / pINP-stlA for degrading phenylalanine

[0074] 2.1 Construction of pTargetF-malP plasmid

[0075] Using pTargetF plasmid (Addgene:62226) as a template and malP-N20-F / pTargetF-R as primers, the malP-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-malP plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0076] 2.2 Knock-in of Pj23119-stlA at the malP site

[0077] (1) Electroporation fragment preparation: using E. coli Nissle Using the 1917 genome as a template, PCR amplification was performed using malP-F1 / malP-R1 and malP-F2 / malP-R2 primers to obtain malP-UP and malP-DN fragments, approximately 600 bp each. Using pUC-sltA plasmid (synthesized by GenScript) as a template, PCR amplification was performed using stlA(malP)-F / stlA(malP)-R primers to obtain the stlA(malP) fragment, approximately 1.6 kb. Using pTargetF plasmid as a template, PCR amplification was performed using Pj23119(malP)-F / Pj23119(malP)-R primers to amplify the Pj23119(malP) fragment, approximately 100 bp. Using the Pj23119(malP) / stlA(malP) fragment as a template, PCR amplification was performed using Pj23119(malP)-F / stlA(malP)-R primers. PCR amplification yielded the stlA(malP)-2 fragment, approximately 1.7 kb; using the malP-UP / stlA(malP)-2 / malP-DN fragment as a template and malP-F1 / malP-R2 as primers, overlap PCR amplification yielded the malP::Pj23119-stlA fragment, approximately 3 kb.

[0078] (2) Preparation of competent cells: The pCas plasmid was transformed into E. coli Nissle 1917 chemically competent cells. Transformants were obtained by screening on LB agar plates containing kanamycin (50 μg / mL) to obtain EcN / pCas transformants (the method for preparing chemically competent cells is described in *Molecular Cloning: A Laboratory Manual* (3rd edition)). Single colonies of EcN / pCas were picked and cultured in 4 mL LB tubes containing kanamycin (50 μg / mL) at 30°C and 220 rpm. 600When the concentration was 0.4, arabinose with a final concentration of 10 mM was added for induction, and the cells were cultured for another hour to prepare electrocompetent cells (see reference for the preparation method of electrocompetent cells (Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System, Jiang Y, Chen B, et al., Appl Environ Microbiol, 2015)).

[0079] (3) Electroporation: The malP::Pj23119-stlA fragment and pTargetF-malP plasmid were electroporated into EcN / pCas competent cells (electroporation conditions: 2.5kV, 200Ω, 25μF), plated on LB plates containing spectinomycin (50μg / ml) and kanamycin (50μg / ml), and incubated overnight at 30℃; single colonies were grown and colony PCR was performed using malP-VF / stlA-VR primers to verify the colony, and the positive fragment was about 600bp;

[0080] (4) Loss of pTargetF-malP plasmid: Select a single colony that has been verified as positive by PCR and inoculate it into an LB tube containing kanamycin (final concentration of 50 μg / ml). At the same time, add IPTG to a final concentration of 1 mM and incubate overnight at 30°C. The next day, the bacterial solution in the test tube is directly streaked onto an LB plate containing kanamycin (final concentration of 50 μg / ml) and incubated overnight at 30°C. The next day, select a single colony and transfer it to an LB plate containing spectinomycin (final concentration of 50 μg / ml). If it cannot grow, it indicates that the pTargetF-malP plasmid has been lost, and the EcN(malP::Pj23119-stlA) / pCas strain is obtained.

[0081] 2.3 Construction of pTargetF-yicS plasmid

[0082] Using pTargetF plasmid as a template and yicS-N20-F / pTargetF-R as primers, the yicS-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-yicS plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0083] 2.4 Knock-in of Pj23119-stlA at the yicS site

[0084] (1) Electroporation fragment preparation: Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using yicS-F1 / yicS-R1 and yicS-F2 / yicS-R2 primers to obtain yicS-UP and yicS-DN fragments, each approximately 600 bp. Using stlA(malP)-2 fragment as a template, PCR amplification was performed using Pj23119(yicS)-F / stlA(malP)-R primers to obtain stlA(yicS) fragment, approximately 1.7 kb. Using yicS-UP / stlA(yicS) / yicS-DN fragment as a template, PCR amplification was performed using yicS-F1 / yicS-R2 primers to obtain yicS::Pj23119-stlA fragment, approximately 3 kb.

[0085] (2) Electroporation: The method is the same as in 2.2. The yicS::Pj23119-stlA fragment and pTargetF-yicS plasmid were electroporated into EcN(malP::Pj23119-stlA) / pCas competent cells and plated on LB plates containing spectinomycin (50 μg / ml) and kanamycin (50 μg / ml). The cells were incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using yicS-VF / stlA-VR primers. The positive fragment was about 500 bp.

[0086] (3) Loss of pTargetF-yicS plasmid: The method is the same as 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119stlA) / pCas is obtained.

[0087] 2.5 Knock-in the apramycin resistance gene at the malE site

[0088] (1) Amplification of fragments containing homologous arms: Using pIJ773 plasmid (Gust B, et al., PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. USA 2003, 100: 1541-1546.) as a template, and Apr(malE)-F / Apr(malE)-R as primers, the Apr(malE) fragment, approximately 1.4 kb, was amplified by PCR. The PCR fragment was digested with DpnI.

[0089] (2) Electroporation: The method is the same as in 2.2. The Apr(malE) fragment was electroporated into EcN(malP::stlA,yicS::stlA) / pCas competent cells and plated on LB plates containing apramycin (50 μg / ml) and kanamycin (50 μg / ml). The cells were incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using malE-VF / Apr-VR primers. The positive fragment was about 800 bp, and the EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Apr) / pCas strain was obtained.

[0090] 2.6 Construction of pTargetF-Apr plasmid

[0091] Using pTargetF plasmid as a template and Apr-N20-F / pTargetF-R as primers, the Apr-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-Apr plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0092] 2.7 Knock-in Pj23119-stlA at the malE site

[0093] (1) Electroporation fragment preparation: Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using malE-F1 / malE-R1 and malE-F2 / malE-R2 primers to obtain malE-UP and malE-DN fragments, each approximately 600 bp; using stlA(malP)-2 fragment as a template, PCR amplification was performed using Pj23119(malE)-F / stlA(malP)-R primers to obtain stlA(malE) fragment, approximately 1.7 kb; using malE-UP / stlA(malE) / malE-DN fragment as a template, PCR amplification was performed using malE-F1 / malE-R2 primers to obtain malE::Pj23119-stlA fragment, approximately 3 kb.

[0094] (2) Electroporation: The method is the same as in 2.2. The malE::Pj23119-stlA fragment and pTargetF-Apr plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Apr) / pCas competent cells, plated on LB plates containing spectinomycin (50 μg / ml) and kanamycin (50 μg / ml), and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using malE-VF / stlA-VR primers. The positive fragment was about 500 bp.

[0095] (3) loss of pTargetF-Apr plasmid: the method is the same as 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA) / pCas is obtained.

[0096] 2.8 Construction of pTargetF-rhtC plasmid

[0097] Using pTargetF plasmid as a template and rhtC-N20-F / pTargetF-R as primers, the rhtC-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-rhtC plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0098] 2.9 Construction of pTargetT-Ptac-stlA(rhtC) plasmid

[0099] Using the E. coli Nissle 1917 genome as a template, rhtC-UP and rhtC-DN fragments, approximately 600 bp each, were amplified by PCR using primers rhtC-F1 / rhtC-R1 and rhtC-F2 / rhtC-R2, respectively. The tac fragment, approximately 1.5 kb, was amplified by PCR using p57-tac plasmid as a template and primers tac-F / tac-R. The stlA(malP)-2 fragment, approximately 1.6 kb, was amplified by PCR using stlA(rhtC)-F / stlA(rhtC)-R. The rhtC-UP, tac, stlA(rhtC), and rhtC-DN fragments were then assembled using DNA assembly methods. Kit was purchased from TransGen and cloned into the EcoRI / HindIII site of pTargetF-rhtC to obtain the pTargetT-Ptac-stlA(rhtC) plasmid.

[0100] 2.10 Knock-in Ptac-stlA at rhtC site

[0101] (1) Electroporation: The method is the same as in 2.2. The pTargetT-Ptac-stlA(rhtC) plasmid was electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA) / pCas competent cells, plated on LB plates containing spectinomycin (50 μg / ml) and kanamycin (50 μg / ml), and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using rhtC-VF / stlA-VR primers. The positive fragment was about 2.5 kb.

[0102] (2) Loss of pTargetT-Ptac-stlA(rhtC) plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA) / pCas is obtained.

[0103] 2.11 Construction of pTargetF-exo plasmid

[0104] Using pTargetF plasmid as a template and exo-N20-F / pTargetF-R as primers, the exo-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-exo plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0105] 2.12 Construction of pTargetT-Ptac-stlA(exo) plasmid

[0106] Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using primers exo-F1 / exo-R1 and exo-F2 / exo-R2 to obtain exo-UP and exo-DN fragments, each approximately 600 bp. Using p57-tac plasmid as a template and primers tac(exo)-F / tac-R, PCR amplification was performed on the tac(exo) fragment, approximately 2.1 kb. Using pTargetT-Ptac-stlA(rhtC) plasmid as a template and primers stlA(rhtC)-F / stlA(exo)-R, PCR amplification was performed on the stlA(exo) fragment, approximately 1.6 kb. The exo-UP, tac(exo), stlA(exo), and exo-DN fragments were then assembled using DNA assembly methods. Kit was purchased from TransGen and cloned into the EcoRI / HindIII site of pTargetF-exo to obtain the pTargetT-Ptac-stlA(exo) plasmid.

[0107] 2.13 Knock-in Ptac-stlA at exo site

[0108] (1) Electroporation: The method is the same as in 2.2. The pTargetT-Ptac-stlA(exo) plasmid was electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA) / pCas competent cells, plated on LB plates containing spectinomycin (50 μg / ml) and kanamycin (50 μg / ml), and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using exo-VF / stlA-VR primers to verify the colony. The positive fragment was about 3kb.

[0109] (2) Loss of pTargetT-Ptac-stlA(exo) plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA) / pCas is obtained.

[0110] 2.14 Construction of pTargetF-lacZ plasmid

[0111] Using pTargetF plasmid as a template and lacZ-N20-F / pTargetF-R as primers, the lacZ-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-lacZ plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0112] 2.15 Knock-in Pj23119-pheP at the lacZ site

[0113] (1) Electroporation fragment preparation: Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using lacZ-F1 / lacZ-R1 and lacZ-F2 / lacZ-R2 primers to obtain lacZ-UP and lacZ-DN fragments, approximately 600bp and 700bp respectively; using pTargetF plasmid as a template, PCR amplification was performed using Pj23119(lacZ)-F / Pj23119(lacZ)-R primers to amplify the Pj23119(lacZ) fragment, approximately 100bp; using E. coli MG... Using the 1655 genome as a template and pheP(lacZ)-F / pheP(lacZ)-R as primers, PCR amplification yielded the pheP(lacZ)-1 fragment, approximately 1.4 kb. Using the Pj23119(lacZ) / pheP(lacZ)-1 fragment as a template and Pj23119(lacZ)-F / pheP(lacZ)-R as primers, PCR amplification yielded the pheP(lacZ)-2 fragment, approximately 1.5 kb. Using the lacZ-UP / pheP(lacZ)-2 / lacZ-DN fragment as a template and lacZ-F1 / lacZ-R2 as primers, overlap PCR amplification yielded the lacZ::Pj23119-pheP fragment, approximately 2.8 kb.

[0114] (2) Electroporation: The method is the same as in 2.2. The lacZ::Pj23119-pheP fragment and pTargetF-lacZ plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA) / pCas competent cells, plated on LB plates containing spectinomycin (50 μg / ml) and kanamycin (50 μg / ml), and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using lacZ-VF / pheP-VR primers to verify the colony. The positive fragment was about 500 bp.

[0115] (3) Loss of pTargetF-lacZ plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP) / pCas is obtained.

[0116] 2.16 Construction of pTargetF-agaI plasmid

[0117] Using pTargetF plasmid as a template and agaI-N20-F / pTargetF-R as primers, the agaI-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-agaI plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0118] 2.17 Knock-in Pj23119-pheP at the agaI site

[0119] (1) Electroporation fragment preparation: Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using agaI-F1 / agaI-R1 and agaI-F2 / agaI-R2 as primers to obtain agaI-UP and agaI-DN fragments, each approximately 600 bp; using the pheP(lacZ)-2 fragment as a template, PCR amplification was performed using pheP(agaI)-F / pheP(agaI)-R as primers to obtain the pheP(agaI) fragment, approximately 1.4 kb; using the agaI-UP / pheP(agaI)-2 / agaI-DN fragment as a template, PCR amplification was performed using agaI-F1 / agaI-R2 as primers to obtain the agaI::Pj23119-pheP fragment, approximately 2.7 kb.

[0120] (2) Electroporation: The method is the same as in 2.2. The agaI::Pj23119-pheP fragment and pTargetF-agaI plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP) / pCas competent cells, plated on LB plates containing spectinomycin (50 μg / ml) and kanamycin (50 μg / ml), and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using agaI-VF / pheP-VR primers. The positive fragment was about 500 bp.

[0121] (3) Loss of pTargetF-agaI plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP) / pCas is obtained.

[0122] 2.18 Construction of pTargetF-araBD plasmid

[0123] Using pTargetF plasmid as a template and araBD-N20-F / pTargetF-R as primers, the araBD-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-araBD plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0124] 2.19 Construction of pTargetT-Para-pma (araBD) plasmid

[0125] Using the E. coli Nissle 1917 genome as a template, araBD-UP and araBD-DN fragments, approximately 600 bp each, were obtained by PCR amplification using primers araBD-F1 / araBD-R1 and araBD-F2 / araBD-R2, respectively. Using pUC-pma plasmid (synthesized by GenScript) as a template, pma(araBD)-F / pma(araBD)-R was amplified by PCR to obtain the pma(araBD) fragment, approximately 1.6 kb. The araBD-UP, araBD-DN, and stlA(araBD) fragments were cloned into the EcoRI / HindIII site of pTargetF-araBD using DNA assembly (DNA assembly kit purchased from TransGen). This yielded the pTargetT-Para-pma(araBD) plasmid.

[0126] 2.20 Para-pma knocked into the araBD site

[0127] (1) Electroporation: The method is the same as in 2.2. The pTargetT-Para-pma (araBD) plasmid was electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP) / pCas competent cells, plated on LB plates containing spectinomycin (50 μg / ml) and kanamycin (50 μg / ml), and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using araBD-VF / pma-VR primers. The positive fragment was about 1.6 kb.

[0128] (2) Loss of pTargetT-Para-pma(araBD) plasmid: The method is the same as in 2.2, and the strain EcN(malP::stlA,yicS::stlA,malE::stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::pheP,agaI::pheP,araBD::Para-pma) / pCas is obtained.

[0129] 2.21 Construction of pTargetF-dapA plasmid

[0130] Using pTargetF plasmid as a template and dapA-N20-F / pTargetF-R as primers, the dapA-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-dapA plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0131] 2.22 Construction of pTargetT-dapA plasmid

[0132] Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using dapA-F1 / dapA-R1 and dapA-F2 / dapA-R2 primers to obtain dapA-UP and dapA-DN fragments, each approximately 600 bp in length. The dapA-UP and dapA-DN fragments were then cloned into the EcoRI / HindIII site of pTargetF-dapA using a DNA assembly method (DNA assembly kit purchased from TransGen), resulting in the pTargetT-dapA plasmid.

[0133] 2.23 dapA gene knockout

[0134] (1) Electroporation: The method is the same as in 2.2. The pTargetT-dapA plasmid was electroporated into EcN(malP::stlA,yicS::stlA,malE::stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::pheP,agaI::pheP,araBD::Para-pma) / pCas competent cells and plated on LB plates containing spectinomycin (50 μg / ml), kanamycin (50 μg / ml) and diaminopimelic acid (100 μg / mL). The cells were incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using dapA-VF / dapA-VR primers. The positive fragment was about 1 kb.

[0135] (2) Loss of pTargetT-dapA plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP,araBD::Para-pma,△dapA) / pCas is obtained.

[0136] (3) pCas plasmid loss: Select positive colonies of pTargetT-dapA plasmid loss, inoculate them into LB test tubes, and incubate overnight at 37°C; the next day, streak the bacterial solution onto LB plates and incubate overnight at 37°C; the next day, select a single colony and transfer it to an LB plate containing kanamycin (final concentration of 50 μg / mL) and diaminopimelic acid (100 μg / mL). If it cannot grow, it indicates that the pCas plasmid is lost. The strain EcN (malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP,araBD::Para-pma,△dapA) was named TYS009.

[0137] 2.24 Construction of recombinant engineered probiotic TYS009 / pINP-stlA

[0138] (1) Prepared TYS009 engineered probiotic cells. The preparation method of chemically transformed competent cells is referred to "Molecular Cloning: A Laboratory Manual" (3rd edition).

[0139] (2) pINP-stlA plasmid was transformed into TYS009 competent cells, and the bacterial culture was spread on LB solid plates containing kanamycin (final concentration 50 μg / mL) to obtain TYS009 / pINP-stlA recombinant engineered probiotics.

[0140] Example 3: Construction of TYS010, an engineered probiotic with enhanced arginine pathway

[0141] 3.1 Knock-in the apramycin resistance gene at the argA site

[0142] (1) Amplification of fragments containing homologous arms: Using pIJ773 plasmid (Gust B, et al., PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. USA 2003, 100: 1541-1546.) as a template, and Apr(argA)-F / Apr(argA)-R as primers, the Apr(argA) fragment, approximately 1.4 kb, was amplified by PCR. The PCR fragment was digested with DpnI.

[0143] (2) Electroporation: The method is the same as in 2.2. The Apr(argA) fragment was electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP,araBD::Para-pma,△dapA) / pCas competent cells obtained in Example 2, and then coated onto cells containing apramycin (50 μg / ml), kanamycin (50 μg / ml) and diaminopimelic acid (10 μg / ml). Incubate overnight at 30°C on LB agar plates (0 μg / mL). Once a single colony grows, verify the colony growth using argA-VF / argA-VR primers. The positive fragment is approximately 2.6 kb, yielding the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP,araBD::Para-pma,△dapA,argA::Apr) / pCas.

[0144] 3.2 Construction of argA site-directed mutagenesis (Y19C)

[0145] (1) Electroporation fragment preparation: Using the E. coli Nissle 1917 genome as a template, argAmu-1 and argAmu-2 fragments, approximately 500 bp each, were obtained by PCR amplification using argAmu-F1 / argAmu-R1 and argAmu-F2 / argAmu-R2 primers, respectively. Using argAmu-1 and argAmu-2 fragments as templates, and argAmu-F1 / argAmu-R2 primers, the argA* (i.e. argAmut(Y19C)) fragment, approximately 1 kb, was obtained by overlap PCR amplification.

[0146] (2) Electroporation: The method is the same as in 2.2. The argA* fragment and pTargetF-Apr plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23 119-pheP,araBD::Para-pma,△dapA,argA::Apr) / pCas competent cells were plated on LB agar plates containing spectinomycin (50 μg / ml), kanamycin (50 μg / ml), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using argA-VF / argA-VR primers to verify the colony; the positive fragment was approximately 1.1 kb.

[0147] (3) Loss of pTargetF-Apr plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP,araBD::Para-pma,△dapA,argA*) / pCas is obtained.

[0148] 3.3 Construction of pTargetF-argR plasmid

[0149] Using pTargetF plasmid as a template and argR-N20-F / pTargetF-R as primers, the argR-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-argR plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0150] 3.4 argR gene knockout

[0151] (1) Electroporation fragment preparation: Using the E. coli Nissle 1917 genome as a template, argR-KO1 and argR-KO2 fragments, approximately 500 bp each, were obtained by PCR amplification using argR-aL-F / argR-aL-R and argR-aR-F / argR-aR-R primers, respectively. Using argR-KO1 and argR-KO2 fragments as templates, and argR-aL-F / argR-aR-R primers, the argR-KO fragment, approximately 1 kb, was obtained by overlap PCR amplification.

[0152] (2) Electroporation: The method is the same as in 2.2. The argR-KO fragment and pTargetF-argR plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::P j23119-pheP,araBD::Para-pma,△dapA,argA*) / pCas competent cells were plated on LB agar plates containing spectinomycin (50 μg / mL), kanamycin (50 μg / mL), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using argR-aL-F / argR-aR-R primers to verify the colony growth. The positive fragment was approximately 1 kb.

[0153] (3) Loss of pTargetF-argR plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP,araBD::Para-pma,△dapA,argA*,△argR) / pCas is obtained.

[0154] (4) pCas plasmid loss: The method is the same as in 2.23, and strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP,araBD::Para-pma,△dapA,argA*,△argR) is obtained and named TYS010.

[0155] Example 4: Construction of probiotic TYS011 for external drainage pump enhancement

[0156] 4.1 Construction of pTargetF-lacZ2 plasmid

[0157] Using pTargetF plasmid as a template and lacZ2-N20-F / pTargetF-R as primers, the lacZ2-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-lacZ2 plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0158] 4.2 Knock-in Pj23119-acrA at the lacZ site

[0159] (1) Electroporation fragment preparation: Using the E. coli Nissle1917 genome as a template, PCR amplification was performed using lacZ2-LF / lacZ2-LR and lacZ2-RF / lacZ2-RR primers to obtain lacZ2-UP and lacZ2-DN fragments, approximately 600bp and 700bp respectively. Using the E. coli Nissle1917 genome as a template, PCR amplification was performed using acrA-F / acrA-R primers to obtain the acrA-1 fragment, approximately 1.2kb. Using the acrA-1 fragment as a template, PCR amplification was performed using acrA-F2 / acrA-R primers to obtain the Pj23119-acrA fragment, approximately 1.3kb. Using the lacZ2-UP / Pj23119-acrA / lacZ2-DN fragment as a template, PCR amplification was performed using lacZ2-LF / lacZ2-RR primers. PCR amplification yielded a lacZ2::Pj23119-acrA fragment, approximately 2.6 kb.

[0160] (2) Electroporation: The method is the same as in 2.2. The lacZ2::Pj23119-acrA fragment and pTargetF-lacZ2 plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,aga I::Pj23119-pheP,araBD::Para-pma,△dapA,argA*,△argR) / pCas competent cells were plated on LB agar plates containing spectinomycin (50 μg / ml), kanamycin (50 μg / ml), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using lacZ2-VF / acrA-VR primers to verify the colony PCR. The positive fragment was approximately 800 bp.

[0161] (3) Loss of pTargetF-lacZ2 plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas is obtained.

[0162] (4) pCas plasmid loss: The method is the same as in 2.23, and strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) is obtained and named TYS011.

[0163] Example 5: Construction of RBS-optimized engineered probiotics TYS012 and TYS012 / pINP-stlA

[0164] 5.1 Construction of pTargetF-agaI2 plasmid

[0165] Using pTargetF plasmid as a template and agaI2-N20-F / pTargetF-R as primers, the agaI2-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-agaI2 plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0166] 5.2 agaI gene knockout

[0167] (1) Electroporation fragment preparation: Using the TYS010 genome as a template, agaIKO-UP and agaIKO-DN fragments were obtained by PCR amplification using agaIH-F / agaIH-R and phePH-F / pheP-seq-R primers, respectively, with a length of approximately 500bp and 200bp. Using agaIKO-UP and agaIKO-DN fragments as templates, and agaIH-F / pheP-seq-R primers, the agaI-KO fragment was obtained by overlap PCR amplification with a length of approximately 700bp.

[0168] (2) Electroporation: The method is the same as in 2.2. The agaI-KO fragment and pTargetF-agaI2 plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119-pheP,a In competent cells, raBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas were plated on LB agar plates containing spectinomycin (50 μg / mL), kanamycin (50 μg / mL), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were observed and verified by colony PCR using agaIH-F / pheP-seq-R primers. The positive fragment was approximately 700 bp.

[0169] (3) Loss of pTargetF-agaI2 plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA,△agaI) / pCas is obtained.

[0170] 5.3 Pj23119H-pheP with RBS enhancement after insertion at the agaI site

[0171] (1) Electroporation fragment preparation: Using the TYS010 genome as a template, PCR amplification was performed using agaIH-F / 23119H(agaI)-R and pheP(23119H)-F / pheP-seq-R as primers to obtain agaIH-UP and phePH-DN fragments, approximately 800bp and 300bp respectively; using agaIH-UP and phePH-DN fragments as templates, and using agaIH-F / pheP-seq-R as primers, overlap PCR amplification was performed to obtain agaI::Pj23119H-pheP fragment, approximately 1.1kb.

[0172] (2) Electroporation: The method is the same as in 2.2. The agaI::Pj23119H-pheP fragment and pTargetF-Apr plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,araBD::P In ara-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA,△agaI) / pCas competent cells, the cells were plated on LB agar plates containing spectinomycin (50 μg / mL), kanamycin (50 μg / mL), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using agaIH-F / pheP-seq-R primers to verify the colony PCR. The positive fragment was approximately 900 bp.

[0173] (3) Loss of pTargetF-Apr plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas is obtained.

[0174] 5.4 Construction of pTargetF-lacZ3 plasmid

[0175] Using pTargetF plasmid as a template and lacZ3-N20-F / pTargetF-R as primers, the lacZ3-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-lacZ3 plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0176] 5.5 Pj23119H-pheP enhanced by RBS knock-in at the lacZ site

[0177] (1) Electroporation fragment preparation: Using the TYS010 genome as a template and lacZH-F / 23119H(agaI)-R as primers, PCR amplification was performed to obtain lacZH-UP, approximately 700bp; using lacZH-UP and phePH-DN fragments as templates and lacZH-F / pheP-seq-R as primers, overlap PCR amplification was performed to obtain lacZ::Pj23119H-pheP fragment, approximately 1kb.

[0178] (2) Electroporation: The method is the same as in 2.2. The lacZ::Pj23119H-pheP fragment and pTargetF-lacZ3 plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119-pheP,agaI::Pj23119 H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas competent cells were plated on LB agar plates containing spectinomycin (50 μg / mL), kanamycin (50 μg / mL), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using lacZH-F / pheP-seq-R primers to verify the colony PCR. The positive fragment was approximately 1 kb.

[0179] (3) Loss of pTargetF-lacZ3 plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas is obtained.

[0180] 5.6 Construction of pTargetF-malE plasmid

[0181] Using pTargetF plasmid as a template and malE-N20-F / pTargetF-R as primers, the malE-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-malE plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0182] 5.7 malE gene knockout

[0183] (1) Electroporation fragment preparation: Using the TYS010 genome as a template, malEKO-UP and malEKO-DN fragments were obtained by PCR amplification using malE-LH-F / malE-LH-R and stlAH-F / stlA-seq-R primers, respectively, with a length of approximately 300bp and 100bp. Using malEKO-UP and malEKO-DN fragments as templates, malE-LH-F / stlA-seq-R primers were used for overlap PCR amplification to obtain the malE-KO fragment, with a length of approximately 400bp.

[0184] (2) Electroporation: The method is the same as in 2.2. The malE-KO fragment and pTargetF-malE plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,a In competent cells, raBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas were plated on LB agar plates containing spectinomycin (50 μg / mL), kanamycin (50 μg / mL), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using malE-LH-F / stlA-seq-R primers to verify the colony PCR. The positive fragment was approximately 400 bp.

[0185] (3) Loss of pTargetF-malE plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,△malE,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas is obtained.

[0186] 5.8 Pj23119H-stlA with RBS enhancement after malE site knockout

[0187] (1) Electroporation fragment preparation: Using the TYS010 genome as a template, PCR amplification was performed using malE-LH-F / 23119H(malE)-R and stlA(23119H)-F / stlA-seq-R as primers to obtain malEH-UP and stlAH-DN, respectively, with a length of approximately 900bp and 100bp. Using malEH-UP and stlAH-DN fragments as templates, and malE-LH-F / stlA-seq-R as primers, overlap PCR amplification was performed to obtain the malE::Pj23119H-stlA fragment, with a length of approximately 1kb.

[0188] (2) Electroporation: The method is the same as in 2.2. The malE::Pj23119H-stlA fragment and pTargetF-Apr plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,ΔmalE,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,a In competent cells, raBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas were plated on LB agar plates containing spectinomycin (50 μg / mL), kanamycin (50 μg / mL), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were observed and verified by colony PCR using malE-LH-F / stlA-seq-R primers. The positive fragment was approximately 1 kb.

[0189] (3) Loss of pTargetF-Apr plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ:Pj23119-:acrA) / pCas is obtained.

[0190] 5.9 Construction of pTargetF-malP2 plasmid

[0191] Using pTargetF plasmid as a template and malP2-N20-F / pTargetF-R as primers, the malP2-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-malP2 plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0192] 5.10 malP gene knockout

[0193] (1) Electroporation fragment preparation: Using the TYS010 genome as a template and malP-LH-F / malP-LH-R as primers, the malPKO-UP fragment (approximately 400 bp) was amplified by PCR; using malPKO-UP and malEKO-DN fragments as templates and malP-LH-F / stlA-seq-R as primers, the malP-KO fragment (approximately 500 bp) was amplified by overlap PCR.

[0194] (2) Electroporation: The method is the same as in 2.2. The malP-KO fragment and pTargetF-malP2 plasmid were electroporated into EcN(malP::Pj23119-stlA,yicS::Pj23119-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP, In competent cells, araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas were plated on LB agar plates containing spectinomycin (50 μg / mL), kanamycin (50 μg / mL), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were observed and verified by colony PCR using malP-LH-F / stlA-seq-R primers. The positive fragment was approximately 500 bp.

[0195] (3) Loss of pTargetF-malP plasmid: The method is the same as in 2.2, and the strain EcN(△malP,yicS::Pj23119-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas is obtained.

[0196] 5.11 Knock-in of RBS-enhanced Pj23119H-stlA at the malP site

[0197] (1) Electroporation fragment preparation: Using the TYS010 genome as a template, malPH-UP was obtained by PCR amplification using malP-LH-F / 23119H(malE)-R as primers. The malPH-UP fragment, approximately 700bp, was obtained by PCR amplification using malPH-UP and stlAH-DN fragments as templates and malP-LH-F / stlA-seq-R as primers. The malP::Pj23119H-stlA fragment, approximately 800bp, was obtained by overlap PCR amplification.

[0198] (2) Electroporation: The method is the same as in 2.2. The malP::Pj23119H-stlA fragment and pTargetF-Apr plasmid were electroporated into EcN(ΔmalP,yicS::Pj23119-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,ar The cells were prepared as follows: aBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas competent cells were plated on LB agar plates containing spectinomycin (50 μg / ml), kanamycin (50 μg / ml), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using malP-LH-F / stlA-seq-R primers to verify the colony PCR. The positive fragment was approximately 800 bp.

[0199] (3) Loss of pTargetF-Apr plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119H-stlA,yicS::Pj23119-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas is obtained.

[0200] 5.12 Construction of pTargetF-yicS2 plasmid

[0201] Using pTargetF plasmid as a template and yicS2-N20-F / pTargetF-R as primers, the yicS2-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-yicS2 plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0202] 5.13 yicS gene knockout

[0203] (1) Electroporation fragment preparation: Using the TYS010 genome as a template and yicS-LH-F / yicS-LH-R as primers, the yicSKO-UP fragment of about 400bp was obtained by PCR amplification; using yicSKO-UP and malEKO-DN fragments as templates and yicS-LH-F / stlA-seq-R as primers, the yicS-KO fragment of about 500bp was obtained by overlap PCR amplification.

[0204] (2) Electroporation: The method is the same as in 2.2. The yicS-KO fragment and pTargetF-yicS2 plasmid were electroporated into EcN(malP::Pj23119H-stlA,yicS::Pj23119-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP, In competent cells, araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas were plated on LB agar plates containing spectinomycin (50 μg / mL), kanamycin (50 μg / mL), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using yicS-LH-F / stlA-seq-R primers to verify the colony PCR. The positive fragment was approximately 500 bp.

[0205] (3) Loss of pTargetF-yicS2 plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119H-stlA,△yicS,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas is obtained.

[0206] 5.14 Knock-in of yicS site to enhance RBS Pj23119H-stlA

[0207] (1) Electroporation fragment preparation: Using the TYS010 genome as a template and yicS-LH-F / 23119H(malE)-R as primers, PCR amplification was performed to obtain yicSH-UP, approximately 800bp; using yicSH-UP and stlAH-DN fragments as templates and yicS-LH-F / stlA-seq-R as primers, overlap PCR amplification was performed to obtain yicS::Pj23119H-stlA fragment, approximately 900bp.

[0208] (2) Electroporation: The method is the same as in 2.2. The yicS::Pj23119H-stlA fragment and pTargetF-Apr plasmid were electroporated into EcN(malP::Pj23119H-stlA,△yicS,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,a In competent cells, raBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas were plated on LB agar plates containing spectinomycin (50 μg / ml), kanamycin (50 μg / ml), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using yicS-LH-F / stlA-seq-R primers to verify the colony PCR. The positive fragment was approximately 900 bp.

[0209] (3) Loss of pTargetF-Apr plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119H-stlA,yicS::Pj23119H-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas is obtained.

[0210] 5.15 Construction of pTargetF-lacZ4 plasmid

[0211] Using pTargetF plasmid as a template and lacZ4-N20-F / pTargetF-R as primers, the lacZ4-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into E. coli DH5α chemically competent cells. The cells were screened at 37°C on LB agar plates containing spectinomycin (50 μg / mL) to obtain the pTargetF-lacZ4 plasmid. The preparation method of chemically transformed competent cells was based on the method described in Molecular Cloning: A Laboratory Manual (3rd Edition).

[0212] 5.16 Knock-in RBS-enhanced Pj23119H-acrA at the lacZ site

[0213] (1) Electroporation fragment preparation: Using the TYS010 genome as a template, PCR amplification was performed using lacZ4-LH-F / lacZ4-LH-R and acrA(23119H)-F / acrA-VR as primers to obtain lacZ4H-UP-1 and arcAH-DN fragments, approximately 330bp and 500bp, respectively. Using lacZ4H-UP-1 fragment as a template and lacZ4-LH-F / 23119H(acrA)-R as primers, overlap PCR amplification was performed to obtain lacZ4H-UP fragment, approximately 360bp. Using lacZ4H-UP and arcAH-DN fragments as templates and lacZ4-LH-F / acrA-VR as primers, overlap PCR amplification was performed to obtain lacZ::Pj23119H-acrA fragment, approximately 900bp.

[0214] (2) Electroporation: The method is the same as in 2.2. The lacZ::Pj23119H-acrA fragment and pTargetF-lacZ4 plasmid were electroporated into EcN(malP::Pj23119H-stlA,yicS::Pj23119H-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj2311 9H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119-acrA) / pCas competent cells were plated on LB agar plates containing spectinomycin (50 μg / ml), kanamycin (50 μg / ml), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using primers lacZ4-LH-F / acrA-VR to verify the colony PCR. The positive fragment was approximately 900 bp.

[0215] (3) Loss of pTargetF-lacZ4 plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119H-stlA,yicS::Pj23119H-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119H-acrA) / pCas is obtained.

[0216] (4) pCas plasmid loss: The method is the same as in 2.23, and the strain EcN(malP::Pj23119H-stlA,yicS::Pj23119H-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119H-acrA) was obtained and named TYS012.

[0217] 5.17 Construction of recombinant engineered probiotic TYS012 / pINP-stlA

[0218] (1) Prepared TYS012 engineered probiotic chemically transformed competent cells. The method for preparing chemically transformed competent cells is referred to "Molecular Cloning: A Laboratory Manual" (3rd edition).

[0219] (2) pINP-stlA plasmid was transformed into TYS012 competent cells, and the bacterial culture was spread on LB solid plates containing kanamycin (final concentration 50 μg / mL) to obtain TYS012 / pINP-stlA recombinant engineered probiotics.

[0220] Example 6: Surface display of PAL module integrated into TYS012 genome

[0221] 6.1 dapA site knock-in surface visualization of PAL expression module

[0222] (1) Construction of pTargetF-dapA2 plasmid: Using pTargetF plasmid as template and dapA2-N20-F / pTargetF-R as primers, the dapA2-N20 fragment (approximately 2.2 kb) was amplified by PCR. After digestion of the PCR fragment with DpnI, the fragment was self-ligated and transformed into Escherichia coli DH5α chemically competent cells. The cells were screened at 37°C on LB solid plates containing spectinomycin (50 μg / mL) to obtain pTargetF-dapA2 plasmid. The preparation method of chemically transformed competent cells was referred to "Molecular Cloning: A Laboratory Manual" (3rd edition).

[0223] (2) Electroporation fragment preparation: Using the EcN genome as a template, PCR amplification was performed using dapA2-LF / 23119-R and dapA2-R-F2 / dapA2-RR primers to obtain dapA2(inaK)-UP and dapA2(inaK)-DN fragments, approximately 600bp and 500bp, respectively; using pINP-stlA plasmid as a template and Pj23119-F / INP-R primers, PCR amplification was performed to obtain the INP-stlA fragment, approximately 2.6kb; using dapA2(inaK)-UP / INP-stlA / dapA2(inaK)-DN fragment as a template and dapA2-LF / dapA2-RR primers, Overlap PCR amplification was performed to obtain the dapA::inaK-stlA fragment, approximately 3.6kb.

[0224] (3) Electroporation: The method is the same as in 2.2. The dapA::inaK-stlA fragment and pTargetF-dapA2 plasmid were electroporated into EcN(malP::Pj23119H-stlA,yicS::Pj23119H-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H- PheP,araBD::Para-pma,△dapA,argA*,△argR,lacZ::Pj23119H-acrA) / pCas competent cells were plated on LB agar plates containing spectinomycin (50 μg / mL), kanamycin (50 μg / mL), and diaminopimelic acid (100 μg / mL) and incubated overnight at 30°C. Single colonies were grown and colony PCR was performed using dapA2-LF / stlA-seq-R primers to verify the colony PCR. The positive fragment was approximately 1.2 kb.

[0225] (4) Loss of pTargetF-dapA2 plasmid: The method is the same as in 2.2, and the strain EcN(malP::Pj23119H-stlA,yicS::Pj23119H-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,dapA::inaK-stlA,argA*,△argR,lacZ::Pj23119H-acrA) / pCas is obtained.

[0226] (5) pCas plasmid loss: The method is the same as in 2.23, and strain EcN(malP::Pj23119H-stlA,yicS::Pj23119H-stlA,malE::Pj23119H-stlA,rthC::Ptac-stlA,exo::Ptac-stlA,lacZ::Pj23119H-pheP,agaI::Pj23119H-pheP,araBD::Para-pma,dapA::inaK-stlA,argA*,△argR,lacZ::Pj23119H-acrA) was obtained and named TYS013.

[0227] Example 7: In vitro comparison of the degradation effect of engineered probiotics on phenylalanine

[0228] 7.1 In vitro activity testing of engineered probiotics

[0229] (1) The original strain E. coli Nissle1917 (EcN), the engineered strains EcN / pINP-stlA, TYS009, TYS009 / pINP-stlA, TYS010, TYS011, TYS012, TYS012 / pINP-stlA and TYS013 were inoculated into LB medium (except for EcN and EcN / pINP-stlA, the other strains were cultured with a final concentration of 100 μg / mL diaminopimelic acid) and cultured overnight at 37℃ and 250 rpm. The inoculum was transferred to 30 mL of LB medium at a 1% inoculum level (except for EcN and EcN / pINP-stlA, other strains need to be cultured with a final concentration of 100 μg / mL diaminopimelic acid), and cultured at 37℃ and 250 rpm for 1.5 hours. After 1.5 hours, 10 mM arabinose and 1 mM IPTG were added and cultured for another 3 hours.

[0230] (2) Collect bacterial cells by centrifugation at 4000 rpm, resuspend the bacterial cells in M9 medium (containing 0.5% glucose), and concentrate the bacterial cells at OD500.600 Adjust to 1.0. Take 0.4 mL of bacterial culture into a 2 mL centrifuge tube, centrifuge at 4500 rpm for 10 min, discard the supernatant, and resuspend the bacterial cells in 5 mL of analytical buffer (M9 medium, 5 g / L glucose, 50 mM MOPS, 4 mM L-phenylalanine) in a regular test tube. Set the culture temperature to T=0 h, incubate at 37℃ and 250 rpm for 3 hours, then take a 1 mL sample. Centrifuge at 13000 rpm for 10 min, collect the supernatant sample, and perform HPLC analysis.

[0231] 7.2 HPLC Detection Method for Phenylalanine, Phenylacetic Acid and Trans-Cinnamic Acid

[0232] The chromatographic column was a ZORBAX SB-C18 column (150 mm × 4.6 mm, 5 μm); the column temperature was 40 ℃; gradient elution was performed using 1.5% acetic acid and acetonitrile as the mobile phase; a UV detector was used with a detection wavelength of 260 nm and an injection volume of 5 μL.

[0233] The in vitro detection results of phenylalanine degradation by various strains were shown in Figure 1 middle.

[0234] from Figure 1 It was found that engineered probiotics have a significant ability to degrade phenylalanine to produce trans-cinnamic acid. Compared to TYS010, strain TYS011, which enhanced the efflux pump acrA, showed a 3.1% increase in trans-cinnamic acid production; strain TYS012, with RBS optimization of the stlA, pheP, and acrA genes, showed a 16.8% increase in trans-cinnamic acid production compared to TYS011; strain TYS012, with its surface-displaying stlA plasmid, showed a 16.5% increase in trans-cinnamic acid production compared to TYS012; and strain TYS013, with its surface-displaying stlA integrated strain, showed a 15.7% increase in trans-cinnamic acid production compared to TYS012.

[0235] In summary, the engineered probiotic TYS013 with enhanced efflux pump gene acrA and surface PAL display constructed in this invention has a significant ability to degrade phenylalanine in vitro, and is expected to be applied in vivo for the treatment of phenylketonuria. sequence list <110> Shanghai Tao Yusheng Biotechnology Co., Ltd. <120> Engineered probiotics with surface-displayed phenylalanine ammonia-lyase <130> SHPI2010685 <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1599 <212> DNA <213> Photorhabdus luminescens <400> 1 atgaaagcta aagatgttca gccaaccatt attattaata aaaatggcct tatctctttg 60 gaagatatct atgacattgc gataaaacaa aaaaagtag aaattcaac ggagatcact 120 gaacttttga cgcatggtcg tgaaaaatta gaggaaaaat taaattcagg agaggttata 180 tatggaatca atacaggatt tggagggaat gccaatttag ttgtgccatt tgagaaaatc 240 gcagagcatc agcaaaatct gttaactttt cttctgctg gtactgggga ctatatgtcc 300 aaaccttgta ttaaagcgtc acaatttact atgttacttt ctgtttgcaa aggttggtct 360 gcaaccagac caattgtcgc tcaagcaatt gttgatcata ttaatcatga cattgttcct 420 ctggttcctc gctatggctc agtgggtgca agcggtgatt taattccttt atcttatatt 480 gcacgagcat tatgtggtat cggcaaagtt tattatatgg gcgcagaaat tgacgctgct 540 gaagcaatta aacgtgcagg gttgacacca ttatcgttaa aagccaaaga aggtcttgct 600 ctgattaacg gcacccgggt aatgtcagga atcagtgcaa tcaccgtcat taaactggaa 660 aaactattta aagcctcaat ttctgcgatt gcccttgctg ttgaagcatt acttgcatct 720 catgaacatt atgatgcccg gattcaacaa gtaaaaaatc atcctggtca aaacgcggtg 780 gcaagtgcat tgcgtaattt attggcaggt tcaacgcagg ttaatctatt atctggggtt 840 aaagaacaag ccaataaagc ttgtcgtcat caagaaatta cccaactaaa tgatacctta 900 caggaagttt attcaattcg ctgtgcacca caagtattag gtatagtgcc agaatcttta 960 gctaccgctc ggaaaatatt ggaacgggaa gttatctcag ctaatgataa tccattgata 1020 gatccagaaa atggcgatgt tctacacggt ggaaatttta tggggcaata tgtcgcccga 1080 acaatggatg cattaaaact ggatattgct ttaattgcca atcatcttca cgccattgtg 1140 gctcttatga tggataaccg tttctctcgt ggattaccta attcactgag tccgacaccc 1200 ggcatgtatc aaggttttaa aggcgtccaa ctttctcaaa ccgctttagt tgctgcaatt 1260 cgccatgatt gtgctgcatc aggtattcat accctcgcca cagaacaata caatcaagat 1320 attgtcagtt taggtctgca tgccgctcaa gatgttttag agatggagca gaaattacgc 1380 aatattgttt caatgacaat tctggtagtt tgtcaggcca ttcatcttcg cggcaatatt 1440 agtgaaattg cgcctgaaac tgctaaattt taccatgcag tacgcgaaat cagttctcct 1500 ttgatcactg atcgtgcgtt ggatgaagat ataatccgca ttgcggatgc aattattaat 1560 gatcaacttc ctctgccaga aatcatgctg gaagaataa 1599 <210> 2 <211> 1377 <212> DNA <213> Escherichia coli MG1655 <400> 2 atgaaaaacg cgtcaaccgt atcggaagat actgcgtcga atcaagagcc gacgcttcat 60 cgcggattac ataaccgtca tattcaactg attgcgttgg gtggcgcaat tggtactggt 120 ctgtttcttg gcattggccc ggcgattcag atggcgggtc cggctgtatt gctgggctac 180 ggcgtcgccg ggatcatcgc tttcctgatt atgcgccagc ttggcgaaat ggtggttgag 240 gagccggtat ccggttcatt tgcccacttt gcctataaat actggggacc gtttgcgggc 300 ttcctctctg gctggaacta ctgggtaatg ttcgtgctgg tgggaatggc agagctgacc 360 gctgcgggca tctatatgca gtactggttc ccggatgttc caacgtggat ttgggctgcc 420 gccttcttta ttatcatcaa cgccgttaac ctggtgaacg tgcgcttata tggcgaaacc 480 gagttctggt ttgcgttgat taaagtgctg gcaatcatcg gtatgatcgg ctttggcctg 540 tggctgctgt tttctggtca cggcggcgag aaagccagta tcgacaacct ctggcgctac 600 ggtggtttct tcgccaccgg ctggaatggg ctgattttgt cgctggcggt aattatgttc 660 tccttcggcg gtctggagct gattgggatt actgccgctg aagcgcgcga tccggaaaaa 720 agcattccaa aagcggtaaa tcaggtggtg tatcgcatcc tgctgtttta catcggttca 780 ctggtggttt tactggcgct ctatccgtgg gtggaagtga aatccaacag tagcccgttt 840 gtgatgattt tccataatct cgacagcaac gtggtagctt ctgcgctgaa cttcgtcatt 900 ctggtagcat cgctgtcagt gtataacagc ggggtttact ctaacagccg catgctgttt 960 ggcctttctg tgcagggtaa tgcgccgaag tttttgactc gcgtcagccg tcgcggtgtg 1020 ccgattaact cgctgatgct ttccggagcg atcacttcgc tggtggtgtt aatcaactat 1080 ctgctgccgc aaaaagcgtt tggtctgctg atggcgctgg tggtagcaac gctgctgttg 1140 aactggatta tgatctgtct ggcgcatctg cgttttcgtg cagcgatgcg acgtcagggg 1200 cgtgaaacac agttaaggc gctgctctat ccgttcggca actatctctg cattgccttc 1260 ctcggcatga tttgctgct gatgtgcacg atggatgata tgcgcttgtc agcgatcctg 1320 ctgccggtgt ggattgtatt cctgtttatg gcatttaaaa cgctgcgtcg gaaataa 1377 <210> 3 <211> 1422 <212> DNA <213> Proteus mirabilis HI4320 <400> 3 atgaacattt caaggagaaa gctactttta ggtgttggtg ctgcgggcgt tttagcaggt 60 ggtgcggctt tagttccaat ggttcgccgt gacggcaaat ttgtggaagc taaatcaaga 120 gcatcatttg ttgaaggtac gcaaggggct cttcctaaag aagcagatgt agtgattatt 180 ggtgccggta ttcaagggat catgaccgct attaaccttg ctgaacgtgg tatgagtgtc 240 actatcttag aaaagggtca gattgccggt gagcaatcag gccgtgcata cagccaaatt 300 attagttacc aaacatcgcc agaaatcttc ccattacacc attatgggaa aatattatgg 360 cgtggcatga atgagaaaat tggtgcggat accagttatc gtactcaagg tcgtgtagaa 420 gcgctggcag atgaaaaagc attagataaa gctcaagcgt ggatcaaaac agctaaagaa 480 gcggcaggtt ttgatacacc attaaatact cgcatcatta aaggtgaga gctatcaaat 540 cgcttagtcg gtgctcaaac gccatggact gttgctgcat ttgaaga ttcaggctct 600 gttgatcctg aaacaggcac acctgcactc gctcgttatg ccaaacaaat cggtgtgaaa 660 atttatacca actgtgcagt aagaggtatt gaaactgcgg gtggtaaaat ctctgatgtg 720 gtgagtgaga aaggggcgat taaaacgtct caagttgtac tcgctgggg tatctggtcg 780 cgtttattta tgggcaatat gggtattgat atcccaacgc tcaatgtata tctatcacaa 840 caacgtgtct caggggttcc tggtgcacca cgtggtaatg tgcatttacc taatggtatt 900 catttccgcg aaaagcgga tggtacttat gccgttgcac cacgtatctt tacgagttca 960 atagtcaaag atagcttcct gctagggcct aaatttatgc acttattagg tggcggagag 1020 ttaccgttgg aattctctat tggtgaagat ctatttaatt catttaaaat gccgacctct 1080 tggaatttag atgaaaaaac accattcgaa caattccgag ttgccacggc aacacaaaat 1140 acgcaacact tagatgctgt tttccaaaga atgaaaacag aattcccagt atttgaaaaa 1200 tcagaagttg ttgaacgttg gggtgccgtt gtgagtccaa catttgatga attacctatc 1260 atttctgagg tcaaagaata cccaggctta gtgattaaca cggcaacagt gtggggtatg 1320 acagaaggcc cggcagcggg tgaagtgacc gctgatattg tcatgggcaa gaaacctgtt 1380 attgatccaa cgccgtttag tttggatcgt tttaagaagt aa 1422 <210> 4 <211> 1194 <212> DNA <213> Escherichia coli Nissle 1917 <400> 4 atgaacaaaa acagagggtt tacgcctctg gcggtcgttc tgatgctctc aggcagctta 60 gcctaacag gatgtgacga caaacaggcc caacaaggtg gccagcagat gccgccgtt 120 ggcgtagtaa cagtcaaaac tgaacctctg cagatcacaa ccgagcttcc gggtcgcacc 180 agtgcctacc ggatcgcaga agttcgtcct caagttagcg ggattatcct gaagcgtaat 240 ttcaaagaag gtagcgacat cgaagcaggt gtctctctct atcagattga tcctgcgacc 300 tatcaggcgg catacgacag tgcgaaaggt gatctggcga aagcccaggc tgcagccaat 360 atcgcgcaat tgacggtgaa tcgttatcag aaattgctcg gtactcagta catcagtaag 420 caagatcag atcaggctct ggctgatgcg caacaggcga atgctgcggt aactgcggcg 480 aaagctgccg ttgaaactgc gcgaatcaat ctggcttaca ccaaagttac ctctccgatt 540 agtggtcgca ttggtaagtc aaacgtgacg gaaggcgcat tggtacagaa cggtcaggcg 600 actgcgctgg caaccgtgca gcaacttgat ccgatctacg ttgatgtgac ccagtccagc 660 aacgacttcc tgcgcctgaa acaggaactg gcgaatggca cgctgaaaca agaaccgg 720 aaagccaaag tgtcgctgat caccagtgac ggcattaagt tcccgcagga cggtacgctg 780 gaattctctg acgttaccgt tgatcagacc actgggtcta tcaccctacg cgctatcttc 840 ccgaacccgg atcacactct gctgccgggt atgttcgtgc gtgcacgtct ggaagaaggg 900 cttaatccaa acgctatttt agtcccgcaa cagggcgtaa cccgtacgcc gcgtggcgat 960 gccaccgtac tggtggttgg cgcggatgac aaagtggaaa cccgtccgat cgttgcaagc 1020 caggctatcg gcgataagtg gctggtgaca gaaggtctga aagcaggcga tcgcgtagta 1080 ataagtgggc tgcagaaagt gcgtcctggt gtccaggtaa aagcacaaga agttaccgct 1140 gataataacc agcaagccgc aagcggtgct cagcctgaac agtccaagtc ttaa 1194 <210> 5 <211> 34 <212> DNA <213> Artificial sequence () <400> 5 ctcgcgagaa ttaagaagaa aggaggtttt tttt 34 <210> 6 <211> 43 <212> DNA <213> Artificial sequence () <400> 6 ggagttatct ctcccgggtc acaatattaa ggaggtttta ttt 43 <210> 7 <211> 35 <212> DNA <213> Artificial sequence () <400> 7 gaggctaaca ggcacattca ataaggaggt ttttt 35

Claims

1. An engineered probiotic, which is a derivative of Escherichia coli Nissle 1917, characterized in that, Based on the engineered Escherichia coli Nissle 1917 strain, which already possesses intracellular phenylalanine ammonia-lyase, this strain was obtained through further genetic engineering to display phenylalanine ammonia-lyase on its surface. The engineered Escherichia coli Nissle 1917 strain, which already possesses intracellular phenylalanine ammonia-lyase, was constructed through the following steps: the exogenous L-phenylalanine ammonia-lyase gene stlA, the exogenous L-phenylalanine internal transport protein gene pheP, and the exogenous L-amino acid deaminase gene pma were integrated into the genome of Escherichia coli Nissle 1917. The engineered probiotics also integrate the endogenous efflux pump gene acrA; The genes argR and dihydropyridine dicarboxylic acid synthase gene dapA were knocked out, and gene argA was generated. Y19C mutation; The RBS sequences of the stlA, pheP, and acrA genes were optimized. The nucleotide sequence of the L-phenylalanine ammonia-lyase gene stlA is SEQ ID NO: 1; the nucleotide sequence of the L-phenylalanine transport protein gene pheP is SEQ ID NO: 2; the nucleotide sequence of the L-amino acid deaminase gene pma is SEQ ID NO: 3; and the nucleotide sequence of the efflux pump gene acrA is SEQ ID NO:

4. The RBS sequence change of the stlA gene is SEQ ID NO: 5; the RBS sequence change of the pheP gene is SEQ ID NO: 6; the RBS sequence change of the acrA gene is SEQ ID NO:

7. The genotype of the strain is: EcN(malP::Pj23119H-stlA, yicS::Pj23119H-stlA, malE::Pj23119H-stlA, rthC::Ptac-stlA, exo::Ptac-stlA, lacZ::Pj23119H-pheP, agaI::Pj23119H-pheP, araBD::Para-pma, dapA::inaK-stlA, argA*, △argR, lacZ::Pj23119H-acrA).

2. A method for constructing the engineered probiotics as described in claim 1, characterized in that, Includes the following steps: A. Using the engineered probiotic EcN / pINP-stlA containing the surface-displaying stlA plasmid pINP-stlA as the substrate bacteria, the L-phenylalanine ammonia-lyase gene stlA was knocked into one or more sites in the genome, namely the malP site, yicS site, malE site, rhtC site and exo site, to obtain stlA gene-integrated strains. B. For the stlA gene-integrated strain obtained in step A, knock in the L-phenylalanine transport protein gene pheP at one or more sites at the lacZ site and agaI site in its genome to obtain the stlA+pheP integrated strain. C. For the stlA+pheP integrated strain obtained in step B, knock in the L-amino acid deaminase gene pma into the araBD site of its genome to obtain the stlA+pheP+pma integrated strain. D. For the stlA+pheP+pma integrated strain obtained in step C, knock out the dihydropyridine dicarboxylic acid synthase gene dapA in its genome to obtain the stlA+pheP+pma △dapA strain; E. For the stlA+pheP+pma △dapA strain obtained in step D, a (Y19C) mutation is performed on the argA site of its genome to obtain the stlA+pheP+pma △dapA argA* strain; F. For the stlA+pheP+pma △dapA argA* strain obtained in step E, knock out argR in its genome to obtain the stlA+pheP+pma △dapA argA* △argR strain; G. For the stlA+pheP+pma △dapA argA* △argR strain obtained in step F, knock in the efflux pump gene acrA at the lacZ site of its genome to obtain the stlA+pheP+pma+acrA △dapA argA* △argR strain; H. For the stlA+pheP+pma+acrA △dapA argA* △argR strain obtained in step G, change the RBS sequence of the stlA gene in its genome to SEQ ID NO: 5, the RBS sequence of the pheP gene to SEQ ID NO: 6, and the RBS sequence of the acrA gene to SEQ ID NO: 7 to obtain the RBS optimized strain; I. For the RBS optimized strain obtained in step H, knock in the surface-displaying stlA gene at the dapA site in its genome to obtain an engineered probiotic with surface-displaying phenylalanine ammonia-lyase.

3. The use of the engineered probiotics as described in claim 1 in the preparation of a drug for the treatment of phenylketonuria.

4. The application as described in claim 3, characterized in that, The drug is an oral dosage form.

5. The application as described in claim 4, characterized in that, The oral dosage form is selected from solid granules, tablets, and liquid live bacteria preparations.

6. The application as described in claim 3, characterized in that, In addition to the engineered probiotics, the active pharmaceutical ingredient, the drug also contains at least one adjuvant therapeutic agent, which is a pharmaceutical ingredient used to treat phenylketonuria without impairing the activity of the probiotics.