Artificial nucleic acids for RNA editing

Abstract

The present invention relates to artificial nucleic acids for the site-directed editing of a target RNA. In particular, the present invention provides artificial nucleic acids capable of site-directed editing of an endogenous transcript by making use of an endogenous deaminase. Further, the present invention provides artificial nucleic acids for the site-directed editing of a target RNA which are chemically modified, in particular according to the modification patterns described herein. The present invention also comprises vectors encoding said artificial nucleic acids and compositions comprising said artificial nucleic acids. Furthermore, the present invention provides the use of an artificial nucleic acid, a composition or a vector for the site-directed editing of a target RNA or in vitro diagnostics. In addition, the use of an artificial nucleic acid, a composition or a vector as described herein for the manufacture of a medicament or for the diagnosis of a disease or disorder is provided.

Description

Technical Field

[0001] This invention relates to artificial nucleic acids for site-specific editing of target RNA. Specifically, the invention provides artificial nucleic acids capable of site-specific editing of endogenous transcripts using endogenous deaminases. Further, the invention provides artificial nucleic acids for site-specific editing of target RNA that are chemically modified, specifically according to the modification pattern described herein. The invention also includes a vector encoding the artificial nucleic acid and a composition containing the artificial nucleic acid. Furthermore, the invention provides applications of the artificial nucleic acid, composition, or vector for site-specific editing of target RNA or for in vitro diagnostics. Additionally, the artificial nucleic acid, composition, or vector described herein is provided for use as a drug or for diagnosing diseases or disorders. Background Technology

[0002] In conventional gene therapy, genetic information is typically manipulated at the DNA level, resulting in permanent alterations to the genome. Depending on the application, persistent modification of the genome can be beneficial or may imply serious risks. In this regard, targeting RNA rather than DNA represents an attractive alternative. When treating subjects at the RNA level, changes in gene expression are often reversible, modifiable, and generally more effective. On the one hand, the limited duration of action also limits the risks associated with harmful side effects. On the other hand, the possibility of fine-tuning allows for continuous modulation of treatment and control of side effects in a time- and dose-dependent manner. Furthermore, manipulation of multiple gene expression levels is infeasible or ineffective at the genomic level, for example, when gene deletion is lethal or easily compensated for by redundant processes. For instance, targeting signaling networks at the RNA level appears particularly attractive. Multiple signaling cues are essential or highly redundant, making knockout sometimes fail to produce a clear phenotype, while knockdown does.

[0003] Therefore, there is growing interest in the engineering of RNA targeting strategies. One such strategy is RNA editing. (A)adenosine to (I)inosine RNA editing is a natural enzymatic mechanism that diversifies the transcriptome. Since inosine is biochemically interpreted as guanosine, A-to-I editing formally introduces A-to-G mutations, which can lead to recoding of amino acid codons, STAR and STOP codons, splicing alterations, and changes in miRNA activity, among other things. Targeting this enzymatic activity at specific sites on the transcript—a strategy known as site-directed RNA editing—shows great promise for disease treatment and general research into protein and RNA function. RNA editing strategies based on engineered deaminases have been developed (see, e.g., Vogel, P., Schneider, MF, Wettengel, J., Stafforst, T. Improving Site-Directed RNA Editing In Vitro and in Cell Culture by Chemical Modification of the Guide RNA. Angew. Chem. Int. Ed. 53, 6267-6271 (2014). However, in a therapeutic setting, the utilization of endogenous deaminases that act on the widespread expression of RNA would be most attractive. Administration of oligonucleotide drugs alone would allow the introduction of specific mutations into the transcriptome without ectopic expression of any (engineered) protein. For example, Wettengel et al. (Wettengel, J., Reautschnig, J., Geisler, S., Kahle, PJ, Stafforst, T. Harnessing human ADAR2 for RNA repair-Recoding a PINK1 mutation rescuesmitophagy. Nucl. Acids Res. 45, 2797-2808 (2017) reports a system that utilizes cellular ADAR2 without requiring artificial proteins. Furthermore, oligonucleotide constructs for site-directed RNA editing are described in International Patent Applications WO 2016 / 097212 and WO 2017 / 010556. Moreover, German Patent DE 10 2015 012 522 B3 describes a guide RNA molecule for site-directed RNA editing.

[0004] However, strategies known in the art suffer from similar problems: on the one hand, it has proven difficult to recruit deaminases, particularly endogenous deaminases, sufficiently to provide adequate RNA editing. On the other hand, efficient editing is often accompanied by low specificity, such as extensive off-target editing across the entire transcriptome. This is especially true when using known hyperactive mutants (Kuttan A, Bass BL: Mechanistic insights into editing-site specificity of ADARs. Proceedings of the National Academy of Sciences 2012, 109: E3295-E3304)—referred to here as E / Q—to improve efficiency and codon range.

[0005] Therefore, there is an urgent need for RNA editing strategies that allow for high editing yields and high specificity. Specifically, compounds are needed that are suitable for recruiting endogenous deaminases without causing off-target editing.

[0006] Therefore, an object of the present invention is to provide compounds capable of recruiting deaminases, preferably endogenous deaminases (e.g., adenosine deaminase), to the RNA target to be edited. A specific object of the present invention is to provide compounds suitable for editing RNA targets with high efficiency and specificity, specifically with a reduced rate of non-target editing. Therefore, improved RNA editing methods should be provided that allow for high-yield RNA editing at specific target sites in the target RNA, preferably with little or no non-specific editing at other genomic sites. Another specific object of the present invention is to provide an RNA editing system preferably characterized by the above-described advantages, which utilizes endogenous deaminases.

[0007] The solution to the stated objective is achieved through the embodiments described herein and defined by the claims. Summary of the Invention

[0008] Artificial nucleic acids for site-directed RNA editing

[0009] In a first aspect, the present invention relates to novel artificial nucleic acids for site-specific editing of target RNA. Specifically, this document provides artificial nucleic acids for site-specific editing of target RNA, the artificial nucleic acid comprising:

[0010] a) Target sequence, which contains a nucleic acid sequence complementary or partially complementary to the target sequence in the target RNA.

[0011] and

[0012] b) The recruitment fraction used to recruit deaminases.

[0013] The target sequence contains at least one nucleotide, wherein the nucleobase is chemically modified.

[0014] and / or

[0015] The target sequence contains at least one backbone modification.

[0016] The inventors have surprisingly discovered that the artificial nucleic acids described herein, specifically those containing chemically modified target sequences as defined herein, are capable of recruiting deaminases (specifically endogenous deaminases) to RNA targets and specifically editing nucleotides, preferably adenosine or cytidine nucleotides, at target sites in said RNA. Advantageously, the target RNA is efficiently edited by the artificial nucleic acids described herein, thus providing a high yield of edited target RNA. Surprisingly, increased RNA editing yield is achieved by using artificial nucleic acids, while undesirable off-target editing is still avoided. Therefore, the artificial nucleic acids described herein allow for efficient and highly specific site-directed RNA editing. The inventors have found that artificial nucleic acids are suitable for editing a variety of transcripts, such as endogenous mRNA of housekeeping genes and endogenous transcripts of disease-related genes (such as STAT1 or SERPINA1). Advantageously, the system according to the invention has proven applicable to a variety of cells, from immortalized cell lines and tumor cell lines to several primary human cell types. The inventors have further observed that the artificial nucleic acids according to the invention are also particularly resistant to degradation, for example, in serum. I do not wish to be bound by any assumptions and believe that the improved stability of the artificial nucleic acids described in this article contributes to the aforementioned beneficial effects.

[0017] As used herein, the phrase “artificial nucleic acid (molecule)” generally refers to a nucleic acid that is not naturally occurring. In other words, an artificial nucleic acid molecule can be a non-natural nucleic acid. Such an artificial nucleic acid molecule can be non-natural due to its individual sequence (which is not naturally occurring) and / or due to other modifications (e.g., structural modifications of nucleotides, which are not naturally occurring in this context). The artificial nucleic acid used herein is preferably distinguished from naturally occurring nucleic acids by at least one nucleotide or a modification of at least one nucleotide. An artificial nucleic acid molecule can be a DNA molecule, an RNA molecule, or a hybrid molecule comprising both DNA and RNA portions. In a preferred embodiment, the artificial nucleic acid is an RNA molecule that preferably contains one or more 2'-deoxynucleotides. Specifically, the artificial nucleic acid used herein can contain (unmodified or modified) ribonucleotides and / or (unmodified or modified) deoxynucleotides. Generally, artificial nucleic acids can be designed and / or generated by genetic engineering methods to correspond to a desired artificial nucleotide sequence (heterologous sequence) or a nucleic acid sequence having the desired artificial modification pattern described herein. Furthermore, the phrase “artificial nucleic acid (molecule)” is not limited to “a single molecule” but can also refer to a collection of the same molecules. Therefore, a phrase can refer to, for example, multiple identical molecules contained in a sample.

[0018] In the context of this invention, the phrase "RNA editing" refers to a reaction in which a nucleotide, preferably adenosine or cytidine nucleotide, in target RNA is converted to another nucleotide via a deamination reaction. This change typically results in a different gene product because the altered nucleotide preferably leads to a codon change, resulting in, for example, the incorporation of another amino acid into a polypeptide translated from RNA or the creation or deletion of a stop codon. Specifically, adenosine nucleotides in the target RNA are converted to inosine via deamination (e.g., by adenosine deaminase as described herein). In an alternative embodiment, cytidine nucleotides in the target RNA are converted to uridine nucleotides. As used herein, the term "target RNA" generally refers to RNA that has undergone an editing reaction, supported by artificial nucleic acids as described herein.

[0019] RNA editing achieved through the artificial nucleic acids described herein is further “site-specific,” meaning that a specific nucleotide at a target site in the target RNA is edited, preferably without editing or substantially without editing other nucleotides. Typically, the nucleotide at the target site is targeted by a target sequence of the artificial nucleic acid described herein, wherein the target sequence is preferably capable of specific base pairing with the target sequence under physiological conditions. Therefore, in the context of this invention, the phrase “target sequence” is generally used with respect to nucleic acid sequences that are (at least partially) complementary to the target sequence of the artificial nucleic acid. The target sequence contains a target site, wherein the target site is typically the nucleotide to be edited, preferably adenosine or cytidine nucleotide. In some embodiments, the target site may contain two or more nucleotides to be edited, wherein these nucleotides are preferably separated from each other by at least one, preferably two, other nucleotides. As used herein, the terms “complementary” or “partially complementary” preferably refer to nucleic acid sequences whose complementary nucleotides are preferably capable of specific intermolecular base pairing under physiological conditions, preferably Watson-Crick base pairing. The term “complementary” as used herein may also refer to an inverse complementary sequence. The artificial nucleic acids described herein may also be referred to herein as “antisense oligonucleotides” or “ASOs”, because artificial nucleic acids typically contain a nucleic acid sequence in the target sequence that represents the antisense of the nucleic acid sequence in the target RNA. Therefore, the target sequence preferably guides the recruitment portion and deaminase to the target site in the target RNA in a sequence-specific manner. In the context of this invention, the term “guide RNA” may also be used to refer to artificial nucleic acids that preferably guide deaminase function to the target site.

[0020] In the context of this invention, the term "recruiting portion" refers to a portion of the artificial nucleic acid described herein that recruits deaminases and is typically covalently linked to a target sequence. Thus, the "recruiting portion" recruits the deaminase to a target site in the target RNA, wherein the target RNA (and the target site) is preferably recognized and bound by the target sequence in a sequence-specific manner. In some embodiments, the recruiting portion comprises or is composed of at least one coupling agent capable of recruiting the deaminase, wherein the deaminase comprises a portion that binds to said coupling agent. The coupling agent recruiting the deaminase is typically covalently linked to the target sequence. Preferably, the coupling agent is linked to the 5'-end or 3'-end of the target sequence. The coupling agent may also optionally be linked to an internal nucleotide of the target sequence (i.e., not a 5'- or 3'-terminal nucleotide), for example, by linking to a nucleotide variant or preferably a modified nucleotide as described herein (such as thymidine). In a further embodiment, the recruiting portion comprises a nucleic acid sequence capable of specifically binding to the deaminase, preferably to the double-stranded (ds) RNA-binding domain of the deaminase. The nucleic acid sequence of the recruitment portion is typically covalently linked to the 5' or 3' end of the target sequence, preferably to the 5' end of the target sequence. In some embodiments, the artificial nucleic acid described herein comprises the target sequence described herein and at least two recruitment portions described herein.

[0021] In some embodiments, the artificial nucleic acid includes a portion that enhances cellular uptake of the artificial nucleic acid. Preferably, the portion that enhances cellular uptake is triantane N-acetylgalactosamine (GalNAc3), which is preferably conjugated to the 3' or 5' end of the artificial nucleic acid.

[0022] The length of the artificial nucleic acid according to the invention is not limited and can be, for example, an oligonucleotide. As used herein, the term "oligonucleotide" can refer to short nucleic acid molecules (e.g., 6-mer or 10-mer) and longer oligonucleotides (e.g., nucleic acid molecules containing 100 or even 200 nucleotides), wherein the oligonucleotide can contain (unmodified or modified) ribonucleotides and / or (unmodified or modified) deoxynucleotides. According to a preferred embodiment, the artificial nucleic acid contains at least about 15, preferably at least about 20, more preferably at least about 25, even more preferably at least about 30, even more preferably at least about 35, and most preferably at least about 40 nucleotides. Optionally, the length of the artificial nucleic acid is in the range of about 10 to about 200 nucleotides, preferably about 15 to about 100 nucleotides, more preferably about 15 to about 70 nucleotides, and most preferably about 20 to about 70 nucleotides.

[0023] The artificial nucleic acid described herein is preferably a single-stranded (ss) nucleic acid molecule. In a preferred embodiment, the artificial nucleic acid is a single-stranded nucleic acid that contains a double-stranded (ds) region under physiological conditions. Preferably, the artificial nucleic acid is a single-stranded nucleic acid containing a double-stranded region within its recruitment portion.

[0024] The target sequence of an artificial nucleic acid typically comprises a nucleic acid sequence complementary to, or at least partially complementary to, the nucleic acid sequence immediately adjacent to the 5' and 3' of the nucleotide at the target site in the target RNA. Preferably, the target sequence comprises a nucleic acid sequence complementary to, or at least 60%, 70%, 80%, 90%, 95%, or 99% complementary to, the nucleic acid sequence in the target RNA, wherein the complementary nucleic acid sequence in the target RNA contains the target site, and preferably comprises at least 10, at least 12, at least 15, at least 18, at least 20, at least 22, at least 25, or at least 30 nucleotides. Preferably, specifically under physiological conditions, the target sequence of the artificial nucleic acid exists as a substantially single-stranded nucleic acid.

[0025] The artificial nucleic acids described herein can be synthesized by methods known in the art. Preferably, as described herein, they are chemically synthesized or transcribed in vitro using a suitable vector. Unless otherwise stated, the nucleic acid sequences provided herein are printed from 5' to 3'. In other words, the first nucleotide residue in the printed nucleic acid sequence—unless otherwise stated—is the 5'-terminus of the nucleic acid sequence. The amino acid sequence—unless otherwise stated—is printed from the N-terminus to the C-terminus.

[0026] Chemical modification

[0027] The artificial nucleic acids according to the present invention are typically chemically modified. As used herein, the term "chemically modified" preferably refers to a chemical modification selected from backbone modification, sugar modification, or base modification (including base-free sites). In the context of the present invention, "chemically modified nucleic acid" may refer to a nucleic acid containing at least one chemically modified nucleotide.

[0028] The artificial nucleic acid preferably comprises a targeting sequence containing at least one chemically modified nucleotide. More preferably, the targeting sequence comprises multiple chemically modified nucleotides, preferably producing the modification pattern of the targeting sequence described herein. In an optional embodiment, the artificial nucleic acid comprises a recruitment portion containing a nucleic acid sequence capable of specifically binding to a deaminase, wherein the recruitment portion comprises at least one chemically modified nucleotide. In a preferred embodiment, the nucleic acid sequence in the recruitment portion comprises multiple chemically modified nucleotides, preferably producing the modification pattern of the nucleic acid sequence of the recruitment portion described herein. According to a particularly preferred embodiment, the artificial nucleic acid comprises the chemically modified targeting sequence and the recruitment portion, the recruitment portion comprising the chemically modified nucleic acid sequence described herein.

[0029] In general, the artificial nucleic acid molecules of the present invention can comprise natural (i.e., naturally occurring) nucleotides as well as chemically modified nucleotides. As used herein, the term "nucleotide" generally includes (unmodified and modified) ribonucleotides and (unmodified and modified) deoxynucleotides. Therefore, the term "nucleotide" preferably refers to adenosine, deoxyadenosine, guanosine, deoxyguanosine, 5-methoxyuridine, thymidine, uridine, deoxyuridine, cytidine, deoxycytidine, or variants thereof. Furthermore, in the cases where "nucleotide" is mentioned herein, the corresponding nucleoside is also preferably included.

[0030] In this regard, a “variant” of a nucleotide is generally a naturally occurring or artificial variant of the nucleotide. Therefore, a variant is preferably a chemically derived nucleotide having a non-naturally occurring functional group, which is preferably added to a naturally occurring nucleotide or from a naturally occurring nucleotide where the naturally occurring functional group is missing or substituted. Thus, in such a nucleotide variant, each component of the naturally occurring nucleotide can be modified, preferably a ribonucleotide or deoxynucleotide, i.e., the base component, sugar (ribose) component, and / or phosphate component that preferably form the backbone of an artificial nucleic acid through the modifications described herein. Therefore, the term “(variant of nucleotide, ribonucleotide, deoxynucleotide, etc.)” also includes nucleotides preferably chemically modified as described herein.

[0031] The chemically modified nucleotides used herein are preferably variants of guanosine, uridine, adenosine, thymidine, and cytosine, including but not limited to any naturally occurring or non-natural guanosine, uridine, adenosine, thymidine, or cytosine that has been chemically modified, for example, by acetylation, methylation, hydroxylation, etc., including 1-methyl-adenosine, 1-methyl-guanosine, 1-methyl-inosine, 2,2-dimethyl-guanosine, 2,6-diaminopurine, 2′-amino-2′-deoxyadenosine, 2′-amino-2′-deoxycytidine, 2′-amino-2′-deoxyguanosine, 2′-amino-2′-deoxyuridine, 2-amino-6-chloropurine nucleoside, 2-aminopurine nucleoside, 2′-arabinoside, 2′-arabinoside, 2′-arabinoside, 2′-arabinoside, 2′-azido-2′-deoxyadenosine, 2′-azido-2′-deoxycytidine, 2′-azido-2′-deoxyuridine ... Oxyguanosine, 2′-azido-2′-deoxyuridine, 2-chloroadenosine, 2′-fluoro-2′-deoxyadenosine, 2′-fluoro-2′-deoxycytidine, 2′-fluoro-2′-deoxyguanosine, 2′-fluoro-2′-deoxyuridine, 2′-fluorothymidine, 2-methyl-adenosine, 2-methyl-guanosine, 2-methyl-thio-N6-isopentenyl-adenosine, 2′-O-methyl-2-aminoadenosine, 2′-O-methyl-2 2′-deoxyadenosine, 2′-O-methyl-2′-deoxycytidine, 2′-O-methyl-2′-deoxyguanosine, 2′-O-methyl-2′-deoxyuridine, 2′-O-methyl-5-methyluridine, 2′-O-methylinosine, 2′-O-methylpseuuridine, 2-thiocytidine, 2-thiocytidine, 3-methylcytidine, 4-acetylcytidine, 4-thiouridine, 5-(carboxyhydroxymethyl)uridine, 5,6-Dihydrouridine, 5-Aminoallylcytidine, 5-Aminoallyl-Deoxyuridine, 5-Bromouridine, 5-Carboxymethylaminomethyl-2-thiouracil, 5-Carboxymethylmonomethyluracil, 5-Chloro-arasaccharide-cytosine, 5-Fluorouridine, 5-Iodouridine, 5-Methoxycarbonylmethyluridine, 5-Methoxyuridine, 5-Methyl-2-thiouridine, 6-Azoxycytidine, 6-Azoxyuridine, 6-Chloro-7-Deazoguanosine, 6-Chloropurinononucleotide, 6-Mercapto-Guanosine, 6-Methyl-Mercaptopurinononucleotide, 7-Deazo-2′-Deoxy-Guanosine, 7-Deazoadenosine, 7-Methyl-Guanosine, 8-Azoxyadenosine, 8-Bromo- Adenosine, 8-bromo-guanosine, 8-mercapto-guanosine, 8-oxo-guanosine, benzimidazole-nucleoside, β-D-mannosyl-queosine, dihydro-uridine, inosine, N1-methyladenosine, N6-([6-aminohexyl]carbamoylmethyl)-adenosine, N6-isopentenyl-adenosine, N6-methyl-adenosine, N7-methyl-xanthine nucleoside, N-uracil-5-oxyacetic acid methyl ester, puromycin, queosine, uracil-5-oxyacetic acid, uracil-5-oxyacetic acid methyl ester, wybutoxosine, xanthine nucleoside, and xyloo-adenosine. Preparation of such variants is known to those skilled in the art, for example, in U.S. patents US 4,373,071, US 4,401,796, US 4,415,732, US 4,458,066, US 4,500,707, US 4,668,777, US 4,973,679, US 5,047,524, US 5,132,418, US 5,153,319, US 5,262,530, or 5,700,642.

[0032] In some embodiments, the artificial nucleic acid described herein comprises at least one chemically modified nucleotide selected from 2-amino-6-chloropurine nucleoside-5′-triphosphate, 2-aminopurine-nucleoside-5′-triphosphate, 2-aminoadenosine-5′-triphosphate, 2′-amino-2′-deoxycytidine-triphosphate, 2-thiocytidine-5′-triphosphate, 2-thiouridine-5′-triphosphate, 2′-fluorothymidine-5′-triphosphate, 2′-O-methyl-inosine-5′-triphosphate. 5'-triphosphate, 4-thiouridine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodocytidine-2'-deoxycytidine-5'-triphosphate, 5-iodocytidine-5'-triphosphate Glycoside-5′-triphosphate, 5-iodo-2′-deoxyuridine-5′-triphosphate, 5-methylcytidine-5′-triphosphate, 5-methyluridine-5′-triphosphate, 5-propynyl-2′-deoxycytidine-5′-triphosphate, 5-propynyl-2′-deoxyuridine-5′-triphosphate, 6-azytidine-5′-triphosphate, 6-azyuridine-5′-triphosphate, 6-chloropurine nucleoside-5′-triphosphate, 7-deazoadenosine-5′-triphosphate 7-Denitroguanosine-5′-triphosphate, 8-Azoadenosine-5′-triphosphate, 8-azidoadenosine-5′-triphosphate, benzimidazole-nucleoside-5′-triphosphate, N1-methyladenosine-5′-triphosphate, N1-methylguanosine-5′-triphosphate, N6-methyladenosine-5′-triphosphate, O6-methylguanosine-5′-triphosphate, pseudouridine-5′-triphosphate, puromycin-5′-triphosphate, or xanthine nucleoside-5′-triphosphate.

[0033] In some embodiments, the artificial nucleic acid described herein comprises at least one chemically modified nucleotide selected from pyridine-4-ketoribonucleoside, 5-azuridine, 2-thio-5-azuridine, 2-thiouridine, 4-thio-pseuuridine, 2-thio-pseuuridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyluridine, 1-carboxymethyl-pseuuridine, 5-propynyluridine, 1-propynyl-pseuuridine, 5-taurate methyluridine, 1-taurate methyl-2- Thio-uridine, 1-taurate methyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-denitro-pseudouridine, 2-thio-1-methyl-1-denitro-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseudouridine.

[0034] In some embodiments, the artificial nucleic acid described herein comprises at least one chemically modified nucleotide selected from 5-az-cytidine, pseudocytidine, 3-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudocytidine, pyrrolo-cytidine, pyrrolo-pseudocytidine, 2-thiocytidine, 2-thio-5-methylcytidine, 4-thio-pseudocytidine, 4-thio-1-methylcytidine 4-Thio-1-methyl-1-denitro-pseudo-cytidine, 1-methyl-1-denitro-pseudo-cytidine, zebularine, 5-nitro-zebularine, 5-methyl-zebularine, 5-nitro-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudo-cytidine, and 4-methoxy-1-methyl-pseudo-cytidine.

[0035] In other embodiments, the artificial nucleic acid described herein comprises at least one chemically modified nucleotide selected from 2-aminopurine, 2,6-diaminopurine, 7-deazo-adenine, 7-deazo-8-azo-adenine, 7-deazo-2-aminopurine, 7-deazo-8-azo-2-aminopurine, 7-deazo-2,6-diaminopurine, 7-deazo-8-azo-2,6-diaminopurine, 1-methyladenosine, N6 -Methyl adenosine, N6-isopentenyl adenosine, N6-(cis-hydroxyisopentenyl) adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6-glycylcarbamoyl adenosine, N6-threonylcarbamoyl adenosine, 2-methylthio-N6-threonylcarbamoyl adenosine, N6,N6-dimethyl adenosine, 7-methyl adenosine, 2-methylthio-adenosine, and 2-methoxy-adenosine.

[0036] In other embodiments, the artificial nucleic acid described herein comprises at least one chemically modified nucleotide selected from inosine, 1-methyl-inosine, γ-nucleotide, wybutosine, 7-denitroguanosine, 7-denitro-8-nitroguanosine, 6-thioguanosine, 6-thio-7-denitroguanosine, 6-thio-7-denitro-8-nitroguanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.

[0037] In some embodiments, the artificial nucleic acid described herein comprises at least one chemically modified nucleotide selected from 6-azocytidine, 2-thiocytidine, α-thiocytidine, pseudo-isocytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, α-thiouridine, 4-thiouridine, 6-azocytidine, 5-hydroxyuridine, deoxy-thymidine, 5-methyluridine, pyrrolo-cytidine, inosine, α-thioguanosine, 6-methylguanosine, 5-methylcytosine, 8-oxo-guanosine, 7-deazo-guanosine, N1-methyl-adenosine, 2-amino-6-chloropurine, N6-methyl-2-aminopurine, pseudo-isocytidine, 6-chloropurine, N6-methyl-adenosine, α-thio-adenosine, 8-azido-adenosine, and 7-deazo-adenosine.

[0038] According to a preferred embodiment, the artificial nucleic acid comprises at least one chemically modified nucleotide, which is chemically modified at the 2' position. Preferably, the chemically modified nucleotide contains a substituent at the 2' carbon atom, wherein the substituent is selected from halogens, alkoxy groups, hydrogen, aryloxy groups, amino groups, and aminoalkoxy groups, and is preferably selected from 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl, and 2'-fluorine. In the case of artificial nucleic acids, specifically if the artificial nucleic acid is RNA or a molecule containing ribonucleotides, a 2'-deoxynucleotide (containing hydrogen as a substituent at the 2' carbon atom), such as deoxycytidine or a variant thereof, can also be referred to as a "chemically modified nucleotide".

[0039] Another chemical modification at the 2' position of the nucleotides described herein is the locking nucleic acid (LNA) nucleotide, the vinyl-bridged nucleic acid (ENA) nucleotide, and the (S)-restricted ethyl cEt nucleotide. These backbone modifications lock the sugar of the modified nucleotide into a preferred northern conformation. It is believed that the types of modifications present in the target sequences of artificial nucleic acids allow the target sequences to bind to the target RNA quickly and firmly.

[0040] According to some embodiments, the artificial nucleic acid comprises at least one chemically modified nucleotide, wherein the phosphate backbone of the incorporated artificial nucleic acid molecule is modified. The phosphate groups of the backbone can be modified, for example, by replacing one or more oxygen atoms with different substituents. Further, the modified nucleotide may comprise complete replacement of the unmodified phosphate moiety with the modified phosphate ester described herein. Examples of modified phosphate groups include, but are not limited to, thiophosphates, selenophosphates, borano phosphates, borano phosphate esters, hydrogen phosphonates, aminophosphates, alkyl phosphonates, aryl phosphonates, and phosphate triesters. The phosphate linker can also be modified by replacing the linked oxygen with nitrogen (bridged aminophosphate), sulfur (bridged thiophosphate), and carbon (bridged methylene-phosphonate).

[0041] According to a further preferred embodiment, the artificial nucleic acid comprises a base-free site. As used herein, a "base-free site" is a nucleotide lacking an organic base. In a preferred embodiment, the base-free nucleotide further comprises the chemical modification described herein at the 2' position of the ribose. Preferably, the 2' C atom of the ribose is substituted with a substituent selected from: halogen, alkoxy, hydrogen, aryloxy, amino, and aminoalkoxy, preferably selected from 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl, and 2'-fluorine. Preferred base-free nucleotides are characterized by the following structure 1A or 1B:

[0042]

[0043] Therefore, in the context of this invention, a "chemically modified nucleotide" may also be a baseless site.

[0044] According to another embodiment, artificial nucleic acid molecules can be modified by adding a so-called "5′ cap" structure. The 5′ cap is an entity, typically a modified nucleotide entity, that "caps" the 5' end of mature mRNA. The 5′ cap can usually be formed from a modified nucleotide, specifically a derivative of guanine nucleotides. Preferably, the 5′ cap is linked to the 5' end of the artificial nucleic acid via a 5′-5′-triphosphate bond. The 5′ cap can be methylated, for example, m7GpppN, where N is the terminal 5' nucleotide of the nucleic acid carrying the 5′ cap, typically the 5' end of RNA. Further examples of 5' cap structures include glycerol groups, inverse deoxygenated abase residues (partially), 4',5' methylene nucleotides, 1-(beta-D-erythrofuranosyl)nucleotides, 4'-thionucleotides, carbocyclic nucleotides, 1,5-anhydrous hexitol nucleotides, L-nucleotides, α-nucleotides, modified base nucleotides, and threo-pentofuranosyl nucleotides. (e.g., cleotide), acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-reverse nucleotide moiety, 3'-3'-reverse abase-free moiety, 3'-2'-reverse nucleotide moiety, 3'-2'-reverse abase-free moiety, 1,4-butanediol phosphate, 3'-aminophosphate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3'-thiophosphate, dithiophosphate, or bridged or unbridged methyl phosphonate moiety. Particularly preferred modified 5' cap structures are CAP1 (methylation of the ribose of the adjacent nucleotide of m7G), CAP2 (methylation of the ribose of the second nucleotide downstream of m7G), CAP3 (methylation of the ribose of the third nucleotide downstream of m7G), CAP4 (methylation of the ribose of the fourth nucleotide downstream of m7G), ARCA (anti-reverse CAP analogs, modified ARCA (e.g., phosphate thioester modified ARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-denitro-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0045] Target sequence

[0046] The artificial nucleic acid according to the invention comprises a target sequence containing a nucleic acid sequence complementary to a target sequence in a target RNA, and wherein the target sequence comprises at least one nucleotide, wherein the nucleobases are chemically modified, and / or wherein the target sequence comprises at least one backbone modification. The target sequence is described in more detail in this section. However, the descriptions provided in other sections of this document, particularly those relating to artificial nucleic acids and recruitment portions, also apply to the target sequence. Specifically, the descriptions of chemical modifications provided herein also relate to the target sequence.

[0047] According to a preferred embodiment, the targeting sequence comprises at least one chemically modified nucleotide, which is chemically modified at the 2' position. Preferably, the chemically modified nucleotide contains a substituent at the 2' carbon atom, wherein the substituent is selected from halogens, alkoxy groups, hydrogen, aryloxy groups, amino groups, and aminoalkoxy groups, and is preferably selected from 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl, and 2'-fluorine; and / or wherein the chemically modified nucleotide is selected from locked nucleic acid (LNA) nucleotides, vinyl-bridged nucleic acid (ENA) nucleotides, and (S)-restricted ethyl cEt nucleotides.

[0048] Preferably, the targeting sequence of the artificial nucleic acid includes at least one backbone modification, wherein the nucleotide contains a modified phosphate ester group. The modified phosphate ester group is preferably selected from thiophosphates, selenophosphates, boron phosphates, boron phosphates, hydrophosphonates, aminophosphates, alkylphosphonates, arylphosphonates, and triphosphates, most preferably thiophosphates.

[0049] According to some embodiments, at least about 20%, preferably at least about 40%, more preferably at least about 60%, even more preferably at least about 80%, and most preferably at least about 95% of the nucleotides in the target sequence are chemically modified at the 2' position, preferably by the modifications described herein.

[0050] At the location corresponding to the target site (the nucleotide to be edited) in the target RNA, the target sequence contains a cytidine nucleotide or a variant of a cytidine nucleotide, preferably a cytidine ribonucleotide, deoxycytidine nucleotide, modified cytidine ribonucleotide, modified deoxycytidine nucleotide, or a base-free site. In this context, when the target sequence is preferably aligned with the target RNA via specific base pairings as described herein, "the location corresponding to the target site" or "the location corresponding to the nucleotide to be edited" refers to the nucleotide position in the target sequence opposite the target site. In a preferred embodiment, the target sequence contains, at the location corresponding to the target site, preferably cytidine or a variant thereof, deoxycytidine or a variant thereof, or a base-free site as described herein.

[0051] In some embodiments, the target site in the target RNA comprises two or more nucleotides to be edited, wherein these nucleotides are preferably separated from each other by at least one, preferably two, other nucleotides. In these embodiments, the target sequence may contain, at each position corresponding to the nucleotide to be edited, preferably the nucleotides described herein, preferably cytidine or variants thereof, deoxycytidine or variants thereof, or a base-free site (as exemplified, for example, according to the nucleotide sequence of SEQ ID NO: 16).

[0052] In a preferred embodiment, the 5' or 3' position corresponding to the target site is preferably at least one of two nucleotides, namely cytidine nucleotide or variant thereof, deoxycytidine nucleotide or variant thereof, or 5' or 3' without a base site, preferably both of which are chemically modified at the 2' carbon atom, wherein the 2' carbon atom is attached to a substituent selected from the following: halogen, alkoxy, hydrogen, aryloxy, amino and aminoalkoxy, preferably selected from 2'-O-methyl, 2'-O-methoxyethyl, 2'-hydrogen (2'-deoxy) and 2'-fluorine;

[0053] and / or

[0054] The nucleotide at least one of the following, located at the position corresponding to the target site, is a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or two nucleotides at the 5' or 3' position without a base site, preferably two nucleotides containing modified phosphate groups, preferably thiophosphate groups.

[0055] Surprisingly, it was found that reducing at least one, preferably both, of the two nucleotides surrounding the nucleotide corresponding to the target site (which is preferably a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or a base-free site) significantly increases the specificity of the RNA editing response by reducing off-target editing, and also preferably improves the serum stability of the artificial nucleic acid. Prior to this invention, it was generally believed in the art that the nucleotide corresponding to the position of the nucleotide to be edited, as well as the two nucleotides flanking the nucleotide in the target sequence, should not be modified. Therefore, the excellent results obtained by the inventors when using artificial nucleic acids, wherein the nucleotide triplet opposite the target site contains at least one of the modified nucleotides described herein, are even more surprising.

[0056] In this context, it is particularly preferred that the target sequence contains a nucleic acid sequence:

[0057] 3'As*c C*5',

[0058] in

[0059] As is an adenosine nucleotide or a variant thereof, preferably an adenosine ribonucleotide or deoxyadenosine nucleotide, which further comprises a thiophosphate group;

[0060] c is the nucleotide to be edited in the target sequence, preferably adenosine or cytidine, more preferably a cytidine nucleotide or a variant thereof, deoxycytidine nucleotide or a variant thereof, or a base-free site at the position of adenosine;

[0061] C is a cytidine nucleotide or a variant thereof;

[0062] An asterisk (*) indicates that the aforementioned nucleotide at the 2' carbon atom is chemically modified by 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl, or 2'-fluorine.

[0063] In some implementations, it is preferred that the target sequence comprises a nucleic acid sequence:

[0064] 3'A c C 5',

[0065] A is an adenosine nucleotide or a variant thereof, preferably an adenosine ribonucleotide or deoxyadenosine nucleotide;

[0066] c is the nucleotide to be edited in the target sequence, preferably adenosine or cytidine, more preferably a deoxycytidine nucleotide or modified deoxycytidine nucleotide at the position of adenosine; and

[0067] C is a cytidine nucleotide or a variant thereof, preferably a cytidine ribonucleotide, a modified cytidine ribonucleotide, a deoxycytidine nucleotide or a modified deoxycytidine nucleotide, more preferably a deoxycytidine nucleotide or a modified deoxycytidine nucleotide.

[0068] According to another embodiment, the target sequence comprises a nucleic acid sequence:

[0069] 3'Us*c C*5',

[0070] in

[0071] Us is a uridine nucleotide or a variant thereof, preferably a uridine ribonucleotide or a deoxyuridine nucleotide, and further comprises a thiophosphate group;

[0072] c is the nucleotide to be edited in the target sequence, preferably adenosine or cytidine, more preferably a cytidine nucleotide or a variant thereof, deoxycytidine nucleotide or a variant thereof, or a base-free site at the position of adenosine;

[0073] C is a cytidine nucleotide or a variant thereof;

[0074] An asterisk (*) indicates that the aforementioned nucleotide on the 2' carbon atom is chemically modified by 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl, or 2'-fluorine.

[0075] Further preferably, at least two of the five nucleotides at the 3' end of the target sequence of the artificial nucleic acid described herein contain modified phosphate groups, preferably modified phosphate groups as defined herein, and more preferably thiophosphate groups.

[0076] In some embodiments, the nucleotide to be edited in the target sequence is preferably adenosine or cytidine, more preferably the nucleotide at the position of adenosine is a base-free site, preferably the base-free site described herein. This embodiment is particularly preferred if the deaminase contains a mutation that reduces the activity of the deaminase relative to the natural (physiological) target (such as the adenosine or cytidine nucleotide at the target site). Examples of such mutated deaminases include ADAR2 mutants E488Y, E488F, or E488W.

[0077] Optionally or in addition to the above modifications, at least two of the five nucleotides at the 3' end of the target sequence are preferably LNA nucleotides, ENA nucleotides, or (S)-restricted ethyl cEt nucleotides, more preferably LNA nucleotides.

[0078] In a preferred embodiment, the target sequence of the artificial nucleic acid includes:

[0079] At least one nucleotide comprising a modified phosphate group, preferably a modified phosphate group as defined herein, more preferably a thiophosphate nucleotide;

[0080] At least one LNA nucleotide; and

[0081] At least one nucleotide containing a substituent at the 2' carbon atom, wherein the substituent is selected from halogens, alkoxy groups, hydrogen (2'-deoxy), aryloxy groups, amino groups, and aminoalkoxy groups, preferably selected from 2'-O-methyl, 2'-O-methoxyethyl, 2'-hydrogen (2'-deoxy), and 2'-fluorine.

[0082] In some implementations, the target sequence of the artificial nucleic acid is characterized by a modification pattern according to any one of formulas (Ia), (Ib), or (Ic):

[0083] (Ia)3'N a CN b 5'

[0084] in

[0085] N is a nucleotide or a variant thereof, preferably a ribonucleotide or a variant thereof, a deoxynucleotide or a variant thereof, more preferably a modified ribonucleotide or a modified deoxynucleotide as described herein;

[0086] C is the nucleotide at the position corresponding to the nucleotide to be edited in the target sequence, and C is a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or a baseless site;

[0087] a is an integer ranging from 1 to 40, preferably from 6 to 10;

[0088] b is an integer in the range of 4 to 40; and

[0089] Where a+b is in the range of 15 to 80;

[0090] (Ib)3'N c Ns d N a CN b Ns e N f 5'

[0091] in

[0092] N is a nucleotide or a variant thereof, preferably a ribonucleotide or a variant thereof, a deoxynucleotide or a variant thereof, more preferably a modified ribonucleotide or a modified deoxynucleotide as described herein;

[0093] C is the nucleotide at the position corresponding to the nucleotide to be edited in the target sequence, and C is a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or a baseless site;

[0094] Ns is a nucleotide containing a modified phosphate group, preferably a thiophosphate group;

[0095] c is an integer in the range of 0 to 4;

[0096] d is an integer in the range of 1 to 10;

[0097] a is an integer in the range of 1 to 26;

[0098] b is an integer in the range of 4 to 40;

[0099] e is an integer in the range of 0 to 4;

[0100] f is an integer in the range of 0 to 4;

[0101] Where a+d+c is in the range of 1 to 40;

[0102] Where b+e+f is in the range of 4 to 40; and

[0103] Where a+d+c+b+e+f is in the range of 15 to 80;

[0104] (Ic)3'N c Nl g N h Nl i N a CN bNl j N k Nl l N m 5'

[0105] in

[0106] N is a nucleotide or a variant thereof, preferably a ribonucleotide or a variant thereof, a deoxynucleotide or a variant thereof, more preferably a modified ribonucleotide or a modified deoxynucleotide as described herein;

[0107] C is the nucleotide at the position corresponding to the nucleotide to be edited in the target sequence, and C is a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or a baseless site;

[0108] Nl is an LNA nucleotide or a modified LNA nucleotide;

[0109] c is an integer ranging from 0 to 4, preferably from 1 to 3;

[0110] g and i are integers in the range of 1 to 5;

[0111] h is an integer ranging from 1 to 30, preferably from 1 to 5;

[0112] a is an integer in the range of 1 to 15;

[0113] b is an integer in the range of 4 to 30;

[0114] j is an integer in the range of 0 to 5, preferably 1 to 3;

[0115] k is an integer in the range of 4 to 30;

[0116] l is an integer in the range of 0 to 5, preferably 1 to 3;

[0117] m is an integer in the range of 0 to 3;

[0118] Where c+g+h+i+a is in the range of 1 to 40;

[0119] Where b+j+k+l+m is in the range of 4 to 40; and

[0120] The values ​​of c+g+h+i+a+b+j+k+l+m are in the range of 15 to 80.

[0121] According to a further preferred embodiment, the target sequence is characterized by a chemical modification selected from any one of formulas II(a) to II(1):

[0122] (a)3'Ns4 N6 CN 7-29 5';

[0123] (b)3'Ns4 N 6-10 CN 9-12 Ns2 5';

[0124] (c)3'Ns2 N 11-15 CN 9-12 Ns2 5';

[0125] (d)3'Nls2 Ns2 NI N 6-10 CN 5-9 Nl2 N Ns2 5';

[0126] (e)3'Nls Ns Nls Ns N 6-10 CN 4-8 Nl N Nl N Ns2 5';

[0127] (f)3'Ns Nls Ns Nls N 6-10 CN 3-7 Nl N Nl N2 Ns2 5';

[0128] (g)3'Ns2 N Nl N Nl N 6-10 CN 4-8 Nl N Nl N Ns2 5',

[0129] (h)3'Ns Nls Ns2 Nl N5 C N5 Nl N 1-23 5';

[0130] (i)3'Nls Ns Nls Ns N8 C N6 Nl N 1-23 5'

[0131] (j)3'Ns Nls Ns2 Nl N5 C N5 Nl N 20 Nl2 5';

[0132] (k)3'Nls Ns Nls Ns N8 C N6 Nl N 20 Nl2 5'; and

[0133] (l)3'Ns4 N6 C N9 Ns2 5',

[0134] in

[0135] N is a nucleotide or a variant thereof, preferably a ribonucleotide or a variant thereof, a deoxynucleotide or a variant thereof, more preferably a modified ribonucleotide or a modified deoxynucleotide as described herein;

[0136] Ns is a nucleotide containing a modified phosphate group, preferably a thiophosphate group;

[0137] Nl is an LNA nucleotide or a modified LNA nucleotide;

[0138] Nls is an LNA nucleotide or a modified LNA nucleotide, which further comprises a modified phosphate group, preferably a thiophosphate group.

[0139] C is the nucleotide at the position corresponding to the nucleotide to be edited in the target sequence, and C is a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or a baseless site.

[0140] Formulas (Ia), (Ib), (Ic), and II(a)-(l) describe the modification patterns of the target sequences of the artificial nucleic acids described herein. The modification patterns used herein refer to the presence (or, respectively, absence) of certain modifications shown in the formula at certain positions in the target sequence. The corresponding positions can be obtained from the formula, specifically the relative positions of the modifications with respect to the nucleotides to be edited in the target RNA, preferably cytidine or its variants, deoxycytidine or its variants, or nucleotides at a base-free site. The above formulas define modification patterns applicable to various nucleic acid sequences containing the nucleotides defined in the formula. The individual nucleic acid sequence used as the target sequence for editing a given target RNA is always dependent on the specific target RNA and target site. However, the modification patterns identified herein are applicable independently of specific nucleic acid sequences and define the number and type of modifications and their relative positions.

[0141] In this context, it should be noted that the subscripts (and variables) used in the formulas represent the number of a specific type of nucleotide present in the target sequence. For example, "N 11-13 "The target sequence (at this position) contains nucleotides from 11 to 13 (i.e., 11, 12, or 13) as defined by the formula. Therefore, this exemplary modification pattern is applicable to nucleic acid sequences that contain nucleotides of type 11, 12, or 13 at this position."

[0142] According to some implementation methods, the target sequence of the artificial nucleic acid described herein is characterized by a modification pattern, wherein,

[0143] Except for cytidine nucleotides or variants thereof, deoxycytidine nucleotides or variants thereof, preferably deoxycytidine nucleotides, or no base sites at the positions corresponding to the nucleotides to be edited in the target sequence.

[0144] In addition to LNA nucleotides, and

[0145] Optionally, except for at least one of the two nucleotides at the 5' or 3' of the nucleotide located at the position corresponding to the nucleotide to be edited in the target sequence,

[0146] All nucleotides are chemically modified at the 2' carbon atom, which is attached to a substituent selected from the following: halogen, alkoxy, hydrogen, aryloxy, amino and aminoalkoxy, preferably selected from 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl and 2'-fluorine.

[0147] In some embodiments, the target sequence of the artificial nucleic acid comprises or consists of nucleic acid sequences selected from the following:

[0148] 5'U*U*C*A*C*U*UcA G*U*G*U*As*Us*Gs*Cs*C*3' (SEQ ID NO: 1);

[0149] 5'U*U*C*A*C*U*UcA G*U*G*U*As*Us*Gs*Cs*C*3' (SEQ ID NO: 2);

[0150] 5'A*C*C*U*C*C*AcU C*A*G*U*Gs*Us*Gs*As*U*3' (SEQ ID NO: 3);

[0151] 5'U*U*U*C*C*U*CcA C*U*G*U*Us*Gs*Cs*As*A*3' (SEQ ID NO: 4);

[0152] 5'U*G*U*G*U*A*UcU U*G*C*U*Gs*Us*Gs*As*G*3' (SEQ ID NO: 5);

[0153] 5'G*A*G*G*U*C*CcU G*G*G*G*Gs*Cs*Gs*Cs*U*3' (SEQ ID NO: 6);

[0154] 5'G*A*U*C*U*U*CcU G*A*U*G*Gs*Cs*Cs*As*C*3' (SEQ ID NO: 7);

[0155] 5'A*G*C*C*A*C*AcA C*U*C*C*Gs*Us*Cs*As*G*3' (SEQ ID NO: 8);

[0156] 5'G*A*U*U*U*U*CcU G*A*U*A*Gs*Cs*Us*As*C*3' (SEQ ID NO: 9);

[0157] 5’G*G*C*C*A*C*AcA U*U*C*U*Gs*Us*Cs*As*G*3’ (SEQ ID NO:10);

[0158] 5’G*A*U*C*U*U*CcU G*A*U*G*Gs*Cs*Cs*As*C*3’ (SEQ ID NO:11);

[0159] 5’G*G*C*C*A*C*AcA C*U*C*C*Gs*Us*Cs*As*G*3’ (SEQ ID NO:12);

[0160] 5’G*A*U*U*U*U*CcU G*A*U*A*Gs*Cs*As*As*C*3’ (SEQ ID NO:13);

[0161] 5’G*G*C*U*A*C*GcA C*U*C*U*Gs*Us*Cs*As*A*3’ (SEQ ID NO:14);

[0162] 5’A*G*G*C*C*G*CcG U*C*G*U*Gs*Gs*Cs*Gs*G*3’ (SEQ ID NO:15);

[0163] 5’C*C*G*C*U*C*CcU CcU C*A*G*C*Cs*Cs*Gs*Us*C*3’ (SEQ ID NO:16);

[0164] 5’A*C*G*C*C*A*CcA G*C*U*C*Cs*As*As*Cs*U*3’ (SEQ ID NO:17);

[0165] 5’G*U*C*U*C*A*CcAA*U*U*G*Cs*Us*Cs*Us*C*3’ (SEQ ID NO:18);

[0166] 5’G*A*A*A*U*A*CcA U*C*A*G*As*Us*Us*Us*G*3 (SEQ ID NO:19);

[0167] 5’A*A*U*U*A*G*CcU U*C*U*G*Gs*Cs*Cs*As*U*3’ (SEQ ID NO:20);

[0168] 5’G*A*U*C*A*G*CcU C*C*U*G*Gs*Cs*Cs*As*U*3’ (SEQ ID NO:21);

[0169] 5’G*A*U*C*A*G*CcU U*C*U*G*Gs*Cs*Cs*As*U*3’ (SEQ ID NO:22);

[0170] 5’G*A*U*C*A*G*CcU U*C*U*G*Gs*Cs*Cs*As*U*3’ (SEQ ID NO:23);

[0171] 5’C*A*C*U*G*C*CcA G*G*C*A*Us*Cs*As*Gs*C*3’ (SEQ ID NO:24);

[0172] 5’C*A*C*U*G*C*CcG G*G*C*A*Us*Cs*As*Gs*C*3’ (SEQ ID NO:25);

[0173] 5’U*C*C*G*C*C*CcG A*U*C*C*As*Cs*Gs*As*U*3’ (SEQ ID NO:26);

[0174] 5’C*C*U*U*U*C* UcG U*C*G*A*Us*Gs*Gs*Us*C*3’ (SEQ ID NO:27);

[0175] 5’C*C*U*U*U*C*U*cG U*C*G*A*Us*Gs*Gs*Us*C*3’ (SEQ ID NO:28);

[0176] 5’C*U*U*G*A*U*AcA U*C*C*A*Gs*Us*Us*Cs*C*3’ (SEQ ID NO:29);

[0177] 5’U*U*U*C*A*G*GcA U*U*U*C*Cs*Us*Cs*Cs*G*3’ (SEQ ID NO:30);

[0178] 5’C*U*U*C*A*G*GcA U*G*G*G*Gs*Cs*As*Gs*C*3’ (SEQ ID NO:31);

[0179] 5’A*G*G*A*A*C*AcAA*C*C*U*Us*Us*Gs*Us*C*3’ (SEQ ID NO:32);

[0180] 5’U*U*U*C*A*C*AcA U*C*C*A*Us*Cs*As*As*C*3’ (SEQ ID NO:33);

[0181] 5'C*U*U*C*A*C*GcA U*C*C*A*Us*Cs*As*As*C*3' (SEQ ID NO: 34);

[0182] 5'U*G*G*G*A*C*AcAA*C*C*C*Cs*Us*Gs*Cs*C*3' (SEQ ID NO: 35);

[0183] 5'C*G*A*C*U*C*CcU C*U*G*G*As*Us*Gs*Us*U*3' (SEQ ID NO: 36);

[0184] 5'C*G*A*C*U*C*UcU C*U*G*G*As*Us*Gs*Us*U*3' (SEQ ID NO: 37);

[0185] Or a fragment or variant of any of these nucleic acid sequences;

[0186] in

[0187] A is an adenosine nucleotide or a variant thereof, preferably an adenosine ribonucleotide, an adenosine deoxynucleotide, a modified adenosine ribonucleotide, or a modified adenosine deoxynucleotide;

[0188] C is a cytidine nucleotide or a variant thereof, preferably a cytidine ribonucleotide, a cytidine deoxynucleotide, a modified cytidine ribonucleotide, or a modified cytidine deoxynucleotide;

[0189] G is a guanosine nucleotide or a variant thereof, preferably a guanosine ribonucleotide, a guanosine deoxynucleotide, a modified guanosine ribonucleotide, or a modified guanosine deoxynucleotide.

[0190] U is a uridine nucleotide or a variant thereof, preferably a uridine ribonucleotide, a uridine deoxynucleotide, a modified uridine ribonucleotide, or a modified uridine deoxynucleotide;

[0191] As, Cs, Gs and Us are nucleotides, preferably the ribonucleotides or deoxynucleotides defined above, which further contain phosphate thioester groups;

[0192] Where an asterisk (*) indicates that the aforementioned nucleotide at the 2' carbon atom is preferably chemically modified with 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl, or 2'-fluorine; and

[0193] The lowercase letter 'c' represents the nucleotide to be edited in the target sequence, preferably adenosine or cytidine, more preferably adenosine, and 'c' represents a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or a baseless site.

[0194] In the context of this invention, a “variant” of a nucleic acid sequence or amino acid sequence is at least 40%, preferably at least 50%, more preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% identical to a sequence or variant derived therefrom. Preferably, the variant is a functional variant.

[0195] As used herein, a “fragment” of a nucleic acid sequence or amino acid sequence consists of consecutive extensions of nucleotide or amino acid residues corresponding to the full-length sequence, representing at least 5%, 10%, 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, and most preferably at least 90% of the full-length sequence. For the purposes of this invention, such a fragment is preferably a functional fragment.

[0196] According to some implementations, the target sequence of the artificial nucleic acid contains a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or a base-free site at the position corresponding to the nucleotide to be edited in the target sequence.

[0197] The nucleotide or a variant thereof located at the 5' position corresponding to the nucleotide to be edited is a pyrimidine nucleotide, preferably a pyrimidine ribonucleotide or a pyrimidine deoxynucleotide, and wherein the pyrimidine nucleotide contains a nucleobase that is preferably chemically modified at the 2' position by 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl or 2'-fluorine.

[0198] In an optional embodiment, the target sequence of the artificial nucleic acid contains cytidine nucleotides or variants thereof, deoxycytidine or variants thereof, preferably deoxycytidine nucleotides, or no base site at the position corresponding to the nucleotide to be edited in the target sequence.

[0199] At least one of the two nucleotides or variants thereof located at the 5' or 3' position corresponding to the nucleotide to be edited, preferably both, is chemically modified at the 2' carbon atom, which is attached to a substituent selected from the following: halogen, alkoxy, hydrogen, aryloxy, amino and aminoalkoxy, preferably selected from 2'-O-methyl, 2'-O-methoxyethyl, 2'-hydrogen and 2'-fluorine;

[0200] and / or

[0201] At least one of the two nucleotides or variants thereof located at the 5' or 3' position corresponding to the nucleotide to be edited, preferably both containing modified phosphate groups, more preferably the modified phosphate groups described herein, and more preferably thiophosphate groups.

[0202] Recruiting portion with coupling agent

[0203] According to some embodiments of the invention, the artificial nucleic acid comprises the target sequence described herein and further comprises a recruitment portion comprising at least one coupling agent. The coupling agent is capable of recruiting a deaminase comprising a portion binding the coupling agent. As described above, the recruitment portion comprises or consists of a coupling agent that recruits the deaminase and is generally covalently linked to the target sequence. More specifically, the recruitment portion consists of the coupling agent described herein, which links, preferably covalently, to the 5'-terminus or 3'-terminus of the target sequence. Optionally, the coupling agent may also link, preferably covalently, to an internal nucleotide of the target sequence (i.e., not a 5'- or 3'-terminal nucleotide), for example, by linking to a preferred nucleotide variant or modified nucleotide (such as amino-thymidine) described herein.

[0204] The coupling agent recruiting deaminases is typically covalently linked to the target sequence. Preferably, the coupling agent is linked to the 5'-terminus or 3'-terminus of the target sequence. Alternatively, the coupling agent may also be linked to an internal nucleotide of the target sequence (i.e., not a 5'- or 3'-terminal nucleotide), for example, by linking to a preferred nucleotide variant or modified nucleotide (such as amino-thymidine) described herein.

[0205] In a preferred embodiment, the coupling agent is selected from O6-benzyladenine, O2-benzyladenine, chloroalkyl, 1xBG, 2xBG, 4xBG, and variants thereof. According to a particularly preferred embodiment, the coupling agent is a branched molecule, such as 2xBG or 4xBG, each preferably capable of recruiting deaminase molecules, and thus preferably amplifying the editing reaction. An exemplary structure of a suitable branched coupling agent is shown below:

[0206] The coupling agent preferably has the ability to specifically bind a portion of the deaminase. The portion of the deaminase is preferably a tag linked to the deaminase described herein, preferably adenosine deaminase or cytidine deaminase. More preferably, the tag is selected from SNAP-tags, CLIP-tags, HaloTags, and fragments or variants of any of these. Therefore, the deaminase defined by the coupling agent in these embodiments is preferably an artificial version of an endogenous deaminase (preferably the deaminase described herein). Preferably, the deaminase is selected from fragments or variants of SNAP-ADAR1, SNAP-ADAR2, Apobec1-SNAP, SNAPf-ADAR1, SNAPf-ADAR2, Apobec1-SNAPf, Halo-ADAR1, Halo-ADAR2, Apobec1-Halo, Clip-ADAR1, Clip-ADAR2, Clipf-ADAR1, Clipf-ADAR2, Apobec1-Clip, and Apobec1-Clipf, or any of these, wherein the deaminase is preferably derived from human or mouse. More preferably, the deaminase is selected from fragments or variants of SNAP-ADAR1, SNAP-ADAR2, SNAPf-ADAR1, SNAPf-ADAR2, Halo-ADAR1, Halo-ADAR2, Clip-ADAR1, Clip-ADAR2, Clipf-ADAR1, and Clipf-ADAR2, or any one thereof, wherein the deaminase is derived from human. According to another embodiment, the deaminase is selected from fragments or variants of mApobec1-SNAP, mApobec1-SNAPf, mApobec1-Halo, mApobec1-Clip, and mApobec1-Clipf, or any one thereof, wherein the deaminase is derived from mouse. In a particularly preferred embodiment, the deaminase is a highly active mutant of any of the deaminases described herein, preferably a highly active Q mutant, more preferably a highly active Q mutant of ADAR1 deaminase or ADAR2 deaminase (e.g., human ADAR1p150, E1008Q; human ADAR1p110, E713Q; human ADAR2, E488Q) or a labeled version thereof, more preferably as described herein, or a fragment or variant of any of these.

[0207] The labeled deaminase, preferably as described herein (e.g., SNAP-, SNAPf-, Clip-, Clipf-, Halo- labeled deaminases or fragments or variants thereof), is preferably overexpressed for RNA editing, for example by transiently transfecting cells with a vector encoding the labeled deaminase or by stable expression in transgenic cells, tissues or organisms.

[0208] According to a preferred embodiment, the recruitment portion comprises or consists of a coupling agent selected from or composed of a coupling agent selected from the following: O6-benzylguanine, 1xBG, 2xBG, 4xBG, and variants of any of these. In this embodiment, the artificial nucleic acid is recruited in the presence of a deaminase, preferably more preferably an adenosine or cytidine deaminase as described herein, wherein the deaminase comprises a SNAP-tag or a variant thereof. In an alternative embodiment, the recruitment portion comprises or consists of a chloroalkane, and more preferably a deaminase as described herein, preferably an adenosine or cytidine deaminase comprising a HaloTag or a variant thereof. According to a further embodiment, the recruitment portion comprises O2-benzylcytosine or a variant thereof, and more preferably a deaminase as described herein, preferably an adenosine or cytidine deaminase comprising a Clip-tag or a variant thereof.

[0209] In some embodiments, the artificial nucleic acid described herein comprises the target sequence described herein and at least two or more recruitment moieties, wherein each recruitment moieties comprises or consists of the coupling agents described herein, and wherein each recruitment moieties preferably recruits deaminase molecules, thus preferably scaling up the editing reaction. Each of these recruitment moieties preferably comprises—independent of the other recruitment moieties—a coupling agent selected from: O6-benzylguanine, O2-benzylcytosine, chloroalkyl, 1xBG, 2xBG, 4xBG, and any variants thereof. Preferably, the artificial nucleic acid comprises at least two recruitment moieties, wherein each recruitment moieties comprises the same or different coupling agents. Figure 11 An illustrative structure is provided illustrating an implementation that includes more than one recruitment portion and / or includes a branched coupling agent.

[0210] Recruitment portion with nucleic acid recruitment motif

[0211] In a preferred embodiment of the invention, the artificial nucleic acid comprises the targeting sequence described herein and a recruitment moiety comprising or composed of a nucleic acid sequence capable of specifically binding to a deaminase, preferably adenosine or cytidine deaminase. Preferably, the nucleic acid sequence capable of specifically binding to a deaminase specifically binds to a double-stranded (ds) RNA-binding domain, preferably the deaminase described herein. Advantageously, the recruitment moiety comprising or composed of a nucleic acid sequence capable of specifically binding to a deaminase also binds to an endogenous deaminase. Thus, the artificial nucleic acid according to the invention utilizes an endogenous (or heterologously expressed) deaminase to promote site-directed RNA editing.

[0212] Preferably, the recruitment portion comprises or consists of a nucleic acid sequence capable of specifically binding to a deaminase, wherein the nucleic acid sequence is preferably covalently linked to the 5' or 3' end of the target sequence, more preferably the 5' end of the target sequence. In some embodiments, the artificial nucleic acid comprises the target sequence described herein and at least two recruitment portions described herein.

[0213] In some embodiments, the recruitment portion comprises or is composed of a nucleic acid sequence capable of intramolecular base pairing. The recruitment portion preferably comprises or is composed of a nucleic acid sequence capable of forming a stem-loop structure. In some embodiments, the stem-loop structure comprises or is composed of a double helix stem containing at least two mismatched nucleotides. In a preferred embodiment, the stem-loop structure comprises a loop consisting of 3 to 8, preferably 4 to 6, more preferably 5 nucleotides. The loop preferably comprises or is composed of the nucleic acid sequence GCUAA or GCUCA.

[0214] According to a preferred embodiment, the recruitment portion of the artificial nucleic acid comprises or is composed of a nucleic acid sequence containing at least one chemical modification as described herein. Specifically, the recruitment portion of the artificial nucleic acid preferably comprises or is composed of a nucleic acid sequence containing at least one nucleotide, wherein the nucleobases are chemically diluted, and / or wherein the nucleic acid sequence contains at least one backbone modification. The chemical modifications described herein in the relevant sections and generally further regarding artificial nucleic acids and target sequences also apply to the recruitment portion.

[0215] In some embodiments, at least one chemically modified nucleotide is chemically modified at the 2' position. Preferably, the chemically modified base contains a substituent at the 2' carbon atom, wherein the substituent is selected from halogens, alkoxy groups, hydrogen, aryloxy groups, amino groups, and aminoalkoxy groups, and is preferably selected from 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl, and 2'-fluorine. According to alternative embodiments, the chemically modified nucleotide is a locked nucleic acid (LNA) nucleotide, an ethylene-bridged nucleic acid (ENA) nucleotide, or a (S)-restricted ethyl cEt nucleotide.

[0216] In a preferred embodiment, the artificial nucleic acid includes a recruitment portion comprising the nucleic acid sequence described herein, wherein the recruitment portion comprises at least one chemically modified nucleotide, wherein the chemically modified nucleotide contains a substituent at the 2' carbon atom, wherein the substituent is selected from halogens, alkoxy groups, hydrogen, aryloxy groups, amino groups, and aminoalkoxy groups, preferably selected from 2'-hydrogen, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-fluorine; and / or

[0217] The chemically modified nucleotides are locked nucleic acid (LNA) nucleotides, ethylene-bridged nucleic acid (ENA) nucleotides, or (S)-restricted ethyl cEt nucleotides.

[0218] Preferably, the recruitment portion of the artificial nucleic acid includes at least one backbone modification, wherein the nucleotide contains a modified phosphate ester group. The modified phosphate ester group is preferably selected from thiophosphates, selenophosphates, boron phosphates, boron phosphates, hydrophosphonates, aminophosphates, alkylphosphonates, arylphosphonates, and triphosphates, with thiophosphates being the most preferred.

[0219] In some embodiments, at least about 20%, preferably at least about 40%, more preferably at least about 60%, even more preferably at least about 80%, and most preferably at least about 95% of the nucleotides in the recruited portion of the nucleic acid sequence are preferably chemically modified at the 2' position by the modifications described herein.

[0220] Preferably, the recruitment portion comprises a nucleic acid sequence, wherein at least two of the five nucleotides at the 5' end of the nucleic acid sequence contain thiophosphate groups.

[0221] According to some implementations, the recruitment portion includes a nucleic acid sequence, wherein at least two of the five nucleotides at the 5' end of the nucleic acid sequence are LNA nucleotides, ENA nucleotides, or (S)-restricted ethyl cEt nucleotides.

[0222] In a preferred embodiment of the present invention, the recruitment portion comprises a nucleic acid sequence, wherein

[0223] At least one nucleotide contains a modified phosphate group, preferably a thiophosphate group;

[0224] At least one LNA nucleotide, ENA nucleotide, or (S)-restricted ethyl cEt nucleotide; and

[0225] At least one nucleotide containing a substituent at the 2' carbon atom, wherein the substituent is selected from halogen, alkoxy, hydrogen, aryloxy, amino and aminoalkoxy, preferably selected from 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl or 2'-fluorine.

[0226] According to a particularly preferred embodiment, the recruitment portion comprises or consists of nucleic acid sequences selected from or composed of the following:

[0227] (a)5'GGUGUCGAG-N a -AGA-N c -GAGAACAAUAU-GCU A / C A-AUGUUGUUCUC-N d -UCU-N b -CUCGACACC 3' (SEQ ID NO: 38);

[0228] (b)5'GsGsUGUCGAG-N a -AGA-N c -GAGAACAAUAU-GCU A / C A-AUGUUGUUCUC-N d -UCU-N b -CUCGACACC 3'(SEQ ID NO: 39); and

[0229] (c)5'GslGslUGUCGAG-Na -AGA-N c -GAGAACAAUAU-GCU A / C A-AUGUUGUUCUC-N d -UCU-N b -CUCGACACC 3' (SEQ ID NO: 40);

[0230] Or a fragment or variant of any of these;

[0231] in

[0232] N a and N b A mismatch is formed, and N is preferred. a It is adenosine and N b It is cytidine;

[0233] N c and N d A mismatch is formed, and N is preferred. c and N d It is guanosine;

[0234] Gs is a guanosine containing a thiophosphate group; and

[0235] Gsl is an LNA guanosine containing a thiophosphate group.

[0236] According to optional embodiments, the recruitment portion comprises or consists of a nucleic acid sequence derived from or consisting of a fragment or variant of VA (virus-associated) RNA I. VA RNA I is an RNA derived from adenovirus and is known to those skilled in the art. In a preferred embodiment, the recruitment portion of the artificial nucleic acid comprises a nucleic acid sequence

[0237] GCACACCTGGGTTCGACACGCGGGCGGTAACCGCATGGATCACGGCGGACGGCCGGATTCGGGGTTCGAACCCCGGTCGTCCGCCATGATACCCTTGC (SEQ ID NO: 41), or a fragment or variant thereof.

[0238] In a preferred embodiment, the recruitment portion comprises a nucleic acid sequence according to any one of SEQ ID NO: 38 to 41, or a fragment or variant of any of these sequences, wherein at least one nucleotide, preferably at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the nucleotide, contains a substituent at the 2' carbon atom, wherein the substituent is selected from halogens, alkoxy groups, hydrogen, aryloxy groups, amino groups, and aminoalkoxy groups, and is preferably selected from 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl, and 2'-fluorine.

[0239] According to a particularly preferred embodiment, the recruitment portion comprises nucleic acid sequences selected from the following:

[0240] (a)5'G*G*U*GU*C*GAG-N a -AGA-N c -GAGAAC*AAU*AU*-GC*U*A / C A-AU*GU*U*GU*U*C*U*C*-N d -U*C*U*-N b *-C*U*C*GAC*AC*C*3'(SEQ ID NO: 42);

[0241] (b)5'Gs*Gs*U*GU*C*GAG-N a -AGA-N c -GAGAAC*AAU*AU*-GC*U*A / C A-AU*GU*U*GU*U*C*U*C*-N d -U*C*U*-N b *-C*U*C*GAC*AC*C*3' (SEQ ID NO: 43); and

[0242] (c)5'Gsl*Gsl*U*GU*C*GAG-N a -AGA-N c -GAGAAC*AAU*AU*-GC*U*A / C A-AU*GU*U*GU*U*C*U*C*-N d -U*C*U*-N b *-C*U*C*GAC*AC*C*3'(SEQ ID NO: 44);

[0243] Or fragments or variants of any of these sequences;

[0244] in

[0245] N a and N b A mismatch is formed, and N is preferred. a It is adenosine and N b It is cytidine;

[0246] N c and N d A mismatch is formed, and N is preferred. c and N d It is guanosine;

[0247] Gs is guanosine containing a thiophosphate group;

[0248] Gsl is an LNA guanosine containing a thiophosphate group; and

[0249] An asterisk (*) indicates that the nucleotide on the 2' carbon atom is preferably modified with 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl or 2'-fluorine.

[0250] In some embodiments, the artificial nucleic acid described herein preferably includes the recruitment portion and the target sequence described herein in the 5' to 3' direction.

[0251] A further aspect of the invention relates to an artificial nucleic acid for site-specific editing of target RNA, the artificial nucleic acid comprising:

[0252] a) A target sequence, which contains or is composed of a nucleic acid sequence that is complementary to or partially complementary to the target sequence in the target RNA.

[0253] and

[0254] b) A recruitment portion for recruiting deaminases, wherein the recruitment portion contains or consists of a nucleic acid sequence capable of specifically binding to deaminases, preferably adenosine or cytidine deaminases.

[0255] Accordingly, the recruitment portion is preferably as defined in the section “Recruitment portion having nucleic acid recruitment motif” herein. In a preferred embodiment of this aspect of the invention, the target sequence is preferably chemically modified as described herein. In some embodiments of this aspect, the target sequence is not chemically modified. In a particularly preferred embodiment, the artificial nucleic acid is synthesized in cells, preferably cells as described herein, more preferably by transcription from a vector, preferably a vector as described herein. According to a particularly preferred embodiment of this aspect of the invention, the artificial nucleic acid comprises a recruitment portion comprising or consisting of a nucleic acid sequence according to any one of SEQ ID NO: 38 to 41, or a fragment or variant thereof.

[0256] Deaminase

[0257] Artificial nucleic acids are suitable for site-directed RNA editing via deaminases, wherein the deaminase is preferably adenosine deaminase or a fragment or variant thereof, preferably ADAR (adenosine deaminase acting on dsRNA) enzyme or a fragment or variant thereof, more preferably selected from ADAR1, ADAR2 and fragments or variants thereof, and even more preferably a peptide or protein containing an adenosine deaminase domain; or

[0258] Cytidine deaminase or a fragment or variant thereof, preferably Apobec1 or a fragment or variant thereof, more preferably a peptide or protein containing a cytidine deaminase domain.

[0259] As used herein, the term "deaminase" refers to any peptide, protein, or protein domain capable of catalyzing the deamination of nucleotides or variants thereof in target RNA, specifically adenosine or cytidine. Therefore, the term refers not only to full-length and wild-type deaminases such as ADAR1, ADAR2, or Apobec1, but also to fragments or variants of deaminases, preferably functional fragments or variants. Specifically, the term also refers to mutants and variants of deaminases, such as preferably mutants of ADAR1, ADAR2, or Apobec1 as described herein. Furthermore, the term "deaminase" as used herein also includes any deaminase fusion protein (e.g., based on Cas9 and Cas13). In the context of this invention, the term "deaminase" also refers to a deaminase such as a labeled variant of the deaminases preferably described herein, SNAP-ADAR1, SNAP-ADAR2, Apobec1-SNAP, SNAPf-ADAR1, SNAPf-ADAR2, Apobec1-SNAPf, Halo-ADAR1, Halo-ADAR2, Apobec1-Halo, Clip-ADAR1, Clip-ADAR2, Clipf-ADAR1, Clipf-ADAR2, Apobec1-Clip, and Apobec1-Clipf, or a fragment or variant of any of these, wherein the deaminase is preferably derived from human or mouse.

[0260] In a preferred embodiment, the deaminase is an adenosine deaminase (such as ADAR1, preferably ADAR1p150, ADAR1p110, or ADAR2), preferably a eukaryotic adenosine deaminase, more preferably a vertebrate adenosine deaminase, even more preferably a mammalian adenosine deaminase, and most preferably a human adenosine deaminase, such as hADAR1 or hADAR2, or fragments or variants thereof. In a particularly preferred embodiment, the deaminase is preferably a labeled adenosine deaminase as described herein, or fragments or variants thereof. More preferably, the deaminase used herein is selected from SNAP-ADAR1, SNAP-ADAR2, SNAPf-ADAR1, SNAPf-ADAR2, Halo-ADAR1, Halo-ADAR2, Clip-ADAR1, Clip-ADAR2, Clipf-ADAR1, and Clipf-ADAR2, or fragments or variants thereof, wherein the deaminase is derived from human.

[0261] According to optional embodiments, the deaminase is a cytidine deaminase (such as Apobec1, preferably human Apobec1 or mouse Apobec1 (mApobec1)), preferably a eukaryotic cytidine deaminase, more preferably a vertebrate cytidine deaminase, even more preferably a mammalian cytidine deaminase, and most preferably a mouse or human cytidine deaminase or a fragment or variant thereof. In a particularly preferred embodiment, the deaminase is preferably a cytidine deaminase labeled as described herein or a fragment or variant thereof. According to a preferred embodiment, the deaminase is selected from mApobec1-SNAP, mApobec1-SNAPf, mApobec1-Halo, mApobec1-Clip, and mApobec1-Clipf or a fragment or variant thereof, wherein the deaminase is derived from a mouse.

[0262] In a preferred embodiment, the deaminase is preferably an endogenous deaminase or a fragment or variant thereof as described herein. Artificial nucleic acids comprising a recruitment motif having a nucleic acid recruitment motif (see the corresponding section herein) are preferably used in combination with an endogenous deaminase or a fragment or variant thereof.

[0263] In a particularly preferred embodiment, the deaminase is a highly active mutant of any of the deaminases mentioned herein, preferably a highly active Q mutant, more preferably a highly active Q mutant of ADAR1 deaminase or ADAR2 deaminase (e.g., human ADAR1p150, E1008Q; human ADAR1p110, E713Q; human ADAR2, E488Q) or a labeled version thereof, most preferably as described herein, or a fragment or variant of any of these.

[0264] The labeled deaminase as described herein is preferably used in combination with the artificial nucleic acid according to the invention, wherein the recruitment portion comprises at least one coupling agent capable of recruiting the deaminase, the deaminase comprising a portion that binds the coupling agent (see also the section "Recruitment portion having coupling agent").

[0265] The following text describes, as examples, the particularly preferred deaminases used in this paper:

[0266] hADAR1p150:

[0267] Nucleic acid sequence:

[0268]

[0269]

[0270] amino acid sequence:

[0271]

[0272] According to a preferred embodiment, amino acid residue E1008 is mutated in hADAR1p150. Particularly preferred is mutant E1008Q, a highly active mutant. Further preferred mutants include E1008Y, E1008F, E1008W, E1008H, E1008L, E1008M, E1008I, and E1008V, which have reduced activity and are preferably used in combination with artificial nucleic acids having a base-free site in the target sequence corresponding to the position of the nucleotide to be edited.

[0273] hADAR1p110:

[0274] Nucleic acid sequence:

[0275]

[0276]

[0277] amino acid sequence:

[0278]

[0279]

[0280] According to a preferred embodiment, amino acid residue E713 is mutated in hADAR1p110. Particularly preferred is mutant E713Q, a highly active mutant. Further preferred mutants include E713Y, E713F, E713W, E713H, E713L, E713M, E713I, and E713V, which have reduced activity and are preferably used in combination with artificial nucleic acids having a base-free site in the target sequence corresponding to the position of the nucleotide to be edited.

[0281] hADAR2:

[0282] Nucleic acid sequence:

[0283]

[0284] amino acid sequence:

[0285]

[0286] According to a preferred embodiment, amino acid residue E488 is mutated in hADAR2. Particularly preferred is the mutant E488Q, a highly active mutant. Further preferred mutants include E488Y, E488F, E488W, E488H, E488L, E488M, E488I, and E488V, which have reduced activity and are preferably used in conjunction with artificial nucleic acids having a base-free site in the target sequence corresponding to the position of the nucleotide to be edited. Further preferred sites that can be mutated in hADAR2 include I456 or T490, and also further include R348, R470, H471, R474, S495, R510, K594, R477, or R481.

[0287] SNAPf-ADAR1:

[0288] Nucleic acid sequence:

[0289]

[0290]

[0291] amino acid sequence:

[0292]

[0293] According to a preferred embodiment, amino acid residue E406 is mutated in SNAPf-ADAR1. Particularly preferred is mutant E406Q, a highly active mutant. Further preferred mutants include E406Y, E406F, E406W, E406H, E406L, E406M, E406I, and E406V, which have reduced activity and are preferably used in combination with artificial nucleic acids having a base-free site in the target sequence corresponding to the position to be edited.

[0294] SNAPf-ADAR2:

[0295] Nucleic acid sequence:

[0296]

[0297]

[0298] amino acid sequence:

[0299]

[0300] According to a preferred embodiment, amino acid residue E403 is mutated in hADAR2. Particularly preferred is mutant E403Q, a highly active mutant. Further preferred mutants include E403Y, E403F, E403W, E403H, E403L, E403M, E403I, and E403V, ​​which have reduced activity and are preferably used in conjunction with artificial nucleic acids having a base-free site in the target sequence corresponding to the position of the nucleotide to be edited. Further preferred sites that can be mutated in hADAR2 include I371 or T405, and further include R263, R385, H386, R389, S410, R425, K509, R392, or R484.

[0301] mAPOBEC1-SNAP (mA1-SNAP), C-to-U deaminase:

[0302] Nucleic acid sequence:

[0303]

[0304] amino acid sequence:

[0305]

[0306]

[0307] Halo-ADAR1Q:

[0308] Nucleic acid sequence:

[0309]

[0310] amino acid sequence:

[0311]

[0312]

[0313] According to a preferred embodiment, the wild-type amino acid residue E521 is mutated to Q, resulting in a highly active deaminase mutant. Further preferred mutants include E521Y, E521F, E521W, E521H, E521L, E521M, and E521V, which have reduced activity and are preferably used in combination with an artificial nucleic acid having a base-free site in the target sequence corresponding to the position of the nucleotide to be edited.

[0314] Clipf-ADAR1Q:

[0315] Nucleic acid sequence:

[0316]

[0317] amino acid sequence:

[0318]

[0319]

[0320] According to a preferred embodiment, the wild-type amino acid residue E406 is mutated to Q in Clipf-ADAR1, resulting in a highly active deaminase mutant. Further preferred mutants include E406Y, E406F, E406W, E406H, E406L, E406M, and E406V, which have reduced activity and are preferably used in combination with an artificial nucleic acid having a base-free site in the target sequence corresponding to the position of the nucleotide to be edited.

[0321] According to a preferred embodiment, the artificial nucleic acid described herein, comprising a recruitment portion having a nucleic acid recruitment motif (see the corresponding section herein), is preferably used for site-directed RNA editing in the presence of an endogenous deaminase, preferably selected from hADAR1p110, hADAR1p150, hADAR2, and Apobec1, preferably defined by the sequence defined above, or fragments or variants of any of these deaminases.

[0322] According to optional embodiments, the artificial nucleic acid described herein, comprising a recruitment portion having a coupling agent (see the corresponding section herein), is preferably used for site-directed RNA editing in the presence of a labeled deaminase, preferably selected from SNAPf-ADAR1, SNAPf-ADAR2, mAPOBEC-SNAP, Halo-ADAR, and Clipf-ADAR, preferably a sequence defined above, or a fragment or variant of any of these deaminases.

[0323] Vectors containing artificial nucleic acids

[0324] On the one hand, the present invention provides a vector comprising the artificial nucleic acid described herein.

[0325] As used herein, the term "vector" generally refers to a nucleic acid molecule, preferably an artificial nucleic acid molecule. In the context of this invention, a vector is suitable for incorporating or containing a desired nucleic acid sequence, such as a nucleic acid sequence of an artificial nucleic acid or a fragment thereof. Such a vector can be a storage vector, expression vector, cloning vector, transfer vector, etc. Cloning vectors can be, for example, plasmid vectors or phage vectors. Transfer vectors can be vectors suitable for transferring nucleic acid molecules into cells or organisms, such as viral vectors. Preferably, in the sense of this application, a vector includes a cloning site, selection markers such as antibiotic resistance factors, and sequences suitable for vector replication, such as an origin of replication.

[0326] The vector can be an RNA vector or a DNA vector. Preferably, the vector is a DNA vector. The vector can be any vector known to those skilled in the art, such as a viral vector or a plasmid vector. Preferably, the vector is a plasmid vector, more preferably a DNA plasmid vector. In some embodiments, the vector is a viral vector, preferably selected from lentiviral vectors, retroviral vectors, adenovirus vectors, adenovirus-associated virus (AAV) vectors, and hybrid vectors.

[0327] Preferably, the vector according to the invention is suitable for producing artificial nucleic acid molecules according to the invention, preferably RNA. Therefore, preferably, the vector contains elements required for transcription, such as promoters, for example, RNA polymerase promoters. Preferably, the vector is suitable for transcription using eukaryotic, prokaryotic, viral, or bacteriophage transcription systems, such as eukaryotic, prokaryotic, or eukaryotic, prokaryotic, viral, or bacteriophage in vitro transcription systems. Therefore, for example, the vector may contain a promoter sequence that is recognized by a polymerase, such as RNA polymerase, for example, eukaryotic, prokaryotic, viral, or bacteriophage RNA polymerase. In a preferred embodiment, the vector contains a bacteriophage RNA polymerase promoter, such as SP6, T3, or T7, preferably the T7 promoter. Preferably, the vector is suitable for in vitro transcription using a bacteriophage-based in vitro transcription system, such as an in vitro transcription system based on T7 RNA polymerase.

[0328] In some embodiments, the vector is designed to transcribe artificial nucleic acids upon transfection into eukaryotic cells, preferably into mammalian cells, or upon administration of a preferred subject described herein. In a preferred embodiment, the vector is designed to transcribe artificial nucleic acids via a eukaryotic RNA polymerase, preferably RNA polymerase II or III, more preferably RNA polymerase III. In some embodiments, the vector may contain a U6 snRNA promoter or an H1 promoter, and optionally a selection marker, such as a reporter gene (e.g., GFP) or a resistance gene (e.g., puromycin or hygromycin resistance gene).

[0329] Cells containing artificial nucleic acids or vectors

[0330] According to one aspect of the invention, a cell comprising the artificial nucleic acid or vector described herein is provided. The cell can be any cell, such as a bacterial cell or a eukaryotic cell, preferably an insect cell, plant cell, or vertebrate cell, such as a mammalian cell (e.g., human or mouse cell). The cell can be used, for example, to replicate the vector of the invention in a bacterial cell. Furthermore, the cell, preferably a eukaryotic cell, can be used to synthesize the artificial nucleic acid molecule according to the invention.

[0331] Cells according to the invention can be obtained, for example, by standard nucleic acid transfer methods, such as standard transfection, transduction, or transformation methods. As used herein, the term "transfection" generally refers to the introduction of nucleic acid molecules, such as DNA or RNA (e.g., mRNA), into cells, preferably eukaryotic cells. In the context of this invention, the term "transfection" encompasses any method known to those skilled in the art for introducing nucleic acids into cells, preferably eukaryotic cells (e.g., mammalian cells). Such methods include, for example, electroporation, lipid transfection based on cationic lipids and / or liposomes, calcium carbonate precipitation, nanoparticle-based transfection, virus-based transfection, or transfection based on cationic polymers (such as DEAE-glucan or polyethyleneimine), etc. In this document, the artificial nucleic acids or vectors described herein can be introduced into cells transiently or stably maintained in cells (e.g., in stable cell lines).

[0332] Preferably, the cell is a mammalian cell, such as a human, livestock, or laboratory animal cell, such as a mouse or rat cell. Preferably, the cell is a human cell. The cell can be an established cell line, such as CHO, BHK, 293T, COS-7, HELA, HEK, Jurkat cell lines, etc., or the cell can be a primary cell, such as human skin fibroblast (HDF) cells, etc., preferably cells isolated from an organism. In a preferred embodiment, the cell is a mammalian object, preferably a cell isolated from a human object.

[0333] Compositions containing artificial nucleic acids

[0334] In a further aspect, the present invention relates to compositions comprising the artificial nucleic acids, vectors, or cells described herein, and optionally additional excipients, preferably pharmaceutically acceptable excipients. The compositions described herein are preferably pharmaceutical compositions. The compositions described herein can be used for the treatment or prevention of a subject, such as in gene therapy methods. Optionally, the compositions can also be used for diagnostic purposes or laboratory uses, such as in vitro experiments.

[0335] Preferably, the composition further comprises one or more preferably pharmaceutically acceptable mediators, diluents, and / or excipients. In the context of this invention, a pharmaceutically acceptable mediator generally includes a liquid or non-liquid basis of the composition described herein. In one embodiment, the composition is provided in liquid form. In this context, preferably, the mediator is water-based, such as pyrogen-free water, isotonic saline, or buffered (aqueous) solutions, such as phosphate, citrate, etc. The buffer may be hypertonic, isotonic, or hypotonic relative to a particular reference medium; that is, the buffer may have a higher, the same, or lower salt content relative to a particular reference medium, wherein such concentrations of the aforementioned salts are preferably used without causing damage to mammalian cells due to osmosis or other concentration effects. The reference medium is, for example, a liquid produced by in vivo methods, such as blood, lymph, cytosol fluid, or other body fluids, or a liquid that can be used as a reference medium in in vitro methods, such as commonly used buffers or liquids. Such commonly used buffers or liquids are known to those skilled in the art. Ringer's lactate solution is particularly preferred as a liquid basis.

[0336] One or more compatible solid or liquid fillers, diluents, or encapsulating compounds suitable for administration to the recipient may also be used in the pharmaceutical compositions of the present invention. The term “compatibility” as used herein preferably means that these components of the (pharmaceutical) composition can be mixed with artificial nucleic acids, carriers, or cells as defined herein in a manner that does not interact with, and such interaction would substantially reduce the efficacy of the composition under typical use conditions.

[0337] The compositions according to the invention may optionally further comprise one or more additional pharmaceutically active ingredients. In this context, a pharmaceutically active ingredient is a compound that exhibits a therapeutic effect of curing, improving, or preventing a specific indication or disease. Such compounds include, but are not limited to, peptides or proteins, nucleic acids, (therapeutic) low molecular weight organic or inorganic compounds (molecular weight less than 5000, preferably less than 1000), sugars, antigens or antibodies, or other therapeutic agents known in the art.

[0338] Furthermore, the composition may contain a carrier for artificial nucleic acids or vectors. Such a carrier may be suitable for mediating dissolution in physiologically acceptable liquids, transport of pharmaceutically active artificial nucleic acid molecules or vectors, or cellular uptake. Therefore, such a carrier may be a component suitable for storing and delivering the artificial nucleic acid molecules or vectors described herein. This component may be, for example, a cationic or polycationic carrier or compound that can be used as a transfection or complexing agent. In this document, particularly preferred transfection or complexing agents are cationic or polycationic compounds.

[0339] The term "cationic compound" generally refers to a charged molecule that carries a positive charge (cation) at a pH typically between 1 and 9, preferably at pH 9 or below (e.g., 5 to 9), or below 8 (e.g., 5 to 8) or below 7 (e.g., 5 to 7), and most preferably at physiological pH (e.g., 7.3 to 7.4). Therefore, a cationic compound can be any positively charged compound or polymer, preferably selected from cationic peptides or proteins or cationic lipids, which carry a positive charge under physiological conditions, particularly in vivo. A "cationic peptide or protein" may contain at least one positively charged amino acid, or more than one positively charged amino acid, such as those selected from Arg, His, Lys, or Orn. ​​Therefore, a "polycationic compound" also exists within a range exhibiting more than one positive charge under given conditions.

[0340] The compositions described herein preferably comprise artificial nucleic acids or carriers in naked or composite form. In a preferred embodiment, the composition comprises nanoparticles, preferably lipid nanoparticles or liposomes, of artificial nucleic acids or carriers.

[0341] Reagent test kit

[0342] According to a further aspect, the present invention relates to a kit or kit of parts comprising artificial nucleic acid molecules, vectors, cells and / or (pharmaceutical) compositions according to the present invention.

[0343] Preferably, the kit further includes instructions for use, cells for transfection, means for administering the composition, a pharmaceutically acceptable carrier or medium for dissolving or diluting the artificial nucleic acid molecule, vector, cells, or composition, and / or a pharmaceutically acceptable solution. In a preferred embodiment, the kit comprises the artificial nucleic acid or vector described herein in liquid or solid (e.g., lyophilized) form, and a pharmaceutically acceptable medium for administration. For example, the kit may contain an artificial nucleic acid or vector and a medium (e.g., water, PBS, Ringer's lactate, or another suitable buffer) mixed prior to administration to the recipient.

[0344] Applications of artificial nucleic acids, vectors, compositions or cells

[0345] In a further aspect, the present invention relates to the application of the artificial nucleic acids, vectors, compositions or cells described herein.

[0346] Specifically, this invention includes the use of artificial nucleic acids, vectors, compositions, or cells for site-specific editing of target RNA. The artificial nucleic acids, vectors, compositions, or cells described herein are preferably used to facilitate site-specific editing of target RNA, preferably by specifically binding to the target RNA via a target sequence and by recruiting the deaminases described herein to the target site. The reaction can occur in vitro or in vivo.

[0347] In a preferred embodiment, an artificial nucleic acid, vector, or composition is given or introduced into a cell containing the target RNA to be edited. The cell containing the target RNA preferably further contains a deaminase, preferably as described herein. The deaminase is preferably an endogenous deaminase, more preferably an adenosine or cytidine deaminase, or a recombinant deaminase (such as a labeled deaminase or a mutant deaminase, preferably as described herein), which is preferably stably expressed or introduced into the cell before or simultaneously with the artificial nucleic acid, vector, or composition. Optionally, the cell containing the artificial nucleic acid or vector described herein is used for site-specific editing of the target RNA by contacting the cell and the target RNA or by introducing the target RNA into the cell (e.g., by transfection, preferably as described herein).

[0348] In a further preferred embodiment, the present invention provides a method for site-directed editing of target RNA, comprising contacting the target RNA with an artificial nucleic acid, and substantially comprising the steps described herein regarding the application of artificial nucleic acids, vectors, compositions, or cells for site-directed RNA editing.

[0349] The editing reaction is preferably monitored or controlled by sequence analysis of the target RNA.

[0350] The applications and methods described herein can be further used for the in vitro diagnosis of diseases or disorders. Preferably, the diseases or disorders are selected from infectious diseases, oncological diseases, cardiovascular diseases, autoimmune diseases, allergies, and neurological diseases or disorders.

[0351] Medical applications of artificial nucleic acids, vectors, compositions or cells

[0352] In a further aspect, the artificial nucleic acids, vectors, compositions, cells, or kits described herein are provided for use as pharmaceuticals, such as gene therapy. Preferably, the artificial nucleic acids, vectors, compositions, cells, or kits described herein are provided for the treatment or prevention of diseases or disorders selected from infectious diseases, oncological diseases, cardiovascular diseases, autoimmune diseases, allergies, and neurological diseases or disorders. According to a preferred embodiment, the artificial nucleic acids, vectors, compositions, cells, or kits described herein are provided for use as pharmaceuticals or for the treatment or prevention of diseases or disorders preferably as described herein, wherein use as a pharmaceutical or treatment or prevention includes the step of site-specific editing of target RNA.

[0353] On one hand, the present invention further provides a method for treating a subject suffering from a disease or disorder, the method comprising administering an effective amount of the artificial nucleic acid, vector, composition or cell described herein to the subject, wherein the disease or disorder is preferably selected from infectious diseases, tumor diseases, cardiovascular diseases, autoimmune diseases, allergies and neurological diseases or disorders.

[0354] The artificial nucleic acids, carriers, cells, or (pharmaceutical) compositions described herein can be administered orally, parenterally, via inhalation spray, locally, rectally, nasally, buccally, vaginally, through an implanted reservoir, or via jet injection. The term parenterally as used herein includes subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrasheath, intrahepatic, intralesional, intracranial, percutaneous, intradermal, intrapulmonary, intraperitoneal, intracardiac, intra-arterial, and sublingual injection or infusion techniques. In a preferred embodiment, the artificial nucleic acid molecules, carriers, cells, or (pharmaceutical) compositions described herein are administered via needle-free injection (e.g., jet injection).

[0355] Preferably, the artificial nucleic acids, carriers, cells, or (pharmaceutical) compositions described herein are administered parenterally, for example by parenteral injection, more preferably by subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrasheath, intrahepatic, intralesional, intracranial, percutaneous, intradermal, intrapulmonary, intraperitoneal, intracardiac, intraarterial, sublingual injection, or by infusion techniques. Intradermal and intramuscular injections are particularly preferred. The aseptic injectable form of the pharmaceutical compositions of the present invention can be an aqueous or oily suspension. These suspensions can be formulated using suitable dispersants or wetting agents and suspending agents according to techniques known in the art.

[0356] The artificial nucleic acids, vectors, cells, or (pharmaceutical) compositions described herein may also be administered orally in any orally acceptable dosage form (including, but not limited to, capsules, tablets, aqueous suspensions, or solutions).

[0357] The artificial nucleic acids, carriers, cells, or (pharmaceutical) compositions described herein can also be administered topically, particularly when the target of treatment includes areas or organs easily accessible by topical application (e.g., including skin or any other accessible epithelial tissue disease). Suitable topical formulations can be readily prepared for each of these areas or organs. For topical application, the artificial nucleic acids, carriers, cells, or (pharmaceutical) compositions described herein can be formulated into suitable ointments that are suspended or dissolved in one or more carriers.

[0358] In one embodiment, the use of a drug includes the step of transfecting mammalian cells, preferably in vitro or ex vivo, and more preferably in vitro transfecting isolated cells of a subject being treated with the drug. If the application includes in vitro transfection of isolated cells, the use of a drug may further include re-administering the transfected cells to the patient. The use of an artificial nucleic acid or vector as a drug may further include the step of selecting successfully transfected isolated cells. Therefore, it may be advantageous if the vector further includes a selection marker.

[0359] According to another aspect of the invention, artificial nucleic acids, vectors, cells or (pharmaceutical) compositions described herein are provided for the diagnosis of diseases or disorders, preferably selected from infectious diseases, tumor diseases, cardiovascular diseases, autoimmune diseases, allergies and neurological diseases or disorders. Attached Figure Description

[0360] The accompanying drawings shown below are merely exemplary and should be used to further describe the invention. These drawings should not be construed as limiting the invention thereto.

[0361] Figure 1 Editing was performed in an engineered cell line expressing ADAR (293Flp-In T-Rex).

[0362] A) Sequences and chemical modification patterns of several ASO designs. B) Initial sequence screening using plasmid-encoded guide RNA by editing luciferase reporter molecules. C) Comparative editing of two endogenous transcripts (ACTB, GAPDH) by transfecting the corresponding chemically modified ASOs into ADAR-expressing cell lines. A single ASO (for GAPDH or ACTB) or two ASOs (for both GAPDH and ACTB) were transfected. Data in B) are shown as mean ± SD, N = 2 independent experiments. Data in C) are shown as mean ± SD, N = 3 independent experiments. A1p110 = ADAR1p110; A1p150 = ADAR1p150.

[0363] Figure 2 Endogenous transcripts (GAPDH, ACTB, and each of the 5'-UAG triplet in the 3'-UTR) were edited by recruiting endogenous ADARs in various cells and cell lines through transfection with various ASOs. Experiments were performed with and without IFN-α, as shown.

[0364] A) Compare the recruitment of endogenous ADAR by three different ASOs in HeLa cells. Transfect with a single guide RNA (targeting GAPDH or ACTB) or two guide RNAs (targeting both GAPDH and ACTB). “R / G-free” means an ASO lacking the ADAR recruitment domain. B) Comparative editing of guide RNAs v9.4 and v9.5 on GAPDH. C) Effect of isotype-specific ADAR knockout on GADPH editing yield in HeLa cells. D) Validate knockout efficiency by Western blotting. E) Determine the effective dose (ED50) of ASO v9.5 for GAPDH editing in HeLa cells in a 96-well format. ED50 = 0.2 pmol / well (with IFN-α) and 0.4 pmol / well (without IFN-α). F) Time course of GAPDH editing yield in HeLa cells with and without IFN-α. G) GAPDH editing yield was 5 pmol / 96 wells (25 pmol / 24 wells for SH-SY5Y) ASO v9.5 in various standard (cancer) cell lines. H) GAPDH editing yield with ASO v9.5 (25 pmol / 24 wells, unless otherwise specified) in various primary human cell lines. HUVEC = Human umbilical vein endothelial cells; HAEC = Human aortic endothelial cells; NHA = Normal human astrocytes; RPE = Human retinal pigment epithelium; NHBE = Normal human bronchial epithelium. AH) Data are presented as mean ± SD, N = 3 independent experiments. Experiments in hepatocytes are single assays per donor or mean values ​​of indicator donors (mean ± SD). A1p150 = ADAR1p150.

[0365] Figure 3 ORF editing is performed in primary cells and applications.

[0366] A) Editing of the 5'-UAG codon in the ORF (site #2) and 3'-UTR of endogenous GAPDH in 293-Flp-In cells expressing the corresponding ADAR isotype using ASO v9.4. B) ASO design v25 for ORF editing. C) Editing of the 5'-UAG site (#1) in the GAPDH ORF using ASO v25 in HeLa and primary cells. D) Editing of the Tyr701 site (5'-UAU codon) of STAT1 in HeLa and primary cells. E) Editing of the PiZZ mutation (E342K, 5'-CAA codon in SERPINA1) in 293 cells and HeLa cells expressing ADAR1p150. SERPINA1 E342K cDNA was co-transfected or genetically integrated into HeLa cells. When transfected with wild-type SERPINA1, A1AT secretion was normalized to secretion. A, CD: Data are presented as mean ± SD, N = 3 independent experiments; hepatocyte experiments were single assays per donor; nd = no edits detected.

[0367] Figure 4 In HeLa cells with ASO v25, the editing yield of 5'-UAG in the ORF of GAPDH, which contains both chemically unmodified and modified ADAR recruitment domains, was improved.

[0368] ASO v25 with the chemically unmodified ADAR recruitment domain (unmodified R / G) was compared with ASO of the same sequence with additional chemical modifications (all pyrimidine nucleotides in the ADAR recruitment domain were 2'-O-methylated in the backbone). ASO was transfected into HeLa cells. Data are presented as mean ± SD, N = 3 independent experiments.

[0369] Figure 5 According to a preferred embodiment of the ASO of the present invention.

[0370] A) General structures in the target sequence and recruitment portion. Different sequence variations of the recruitment portion and different structures of the target sequence are shown. B) Exemplary modification patterns for the target sequence and recruitment portion, respectively.

[0371] Figure 6 Serum stability of unmodified and modified ASO.

[0372] A) Serum stability of guide RNA targeting codon 5'-AAA. Guide RNAs with modified (2'-O-methyl or 2'-fluorine) nucleotides at the 5' position of the anticodon were compared with their corresponding unmodified guide RNAs. Figure 2A shows urea PAGE gels after guide RNA incubation for 5 minutes to 12 hours (see Example 5). B) Effect of targeting codons on serum stability. C) Effect of modification patterns targeting the anticodon (3'-ACC) on serum stability.

[0373] Figure 7 Site-directed RNA editing via ADAR with SNAP-tagged markers driven by short, chemically modified guide RNA.

[0374] a) The double-stranded RNA-binding domain (dsRBD) of hADAR has been replaced by a SNAP-tag. This tag is capable of forming a covalent bond with guide RNA modified with benzylguanine (BG). When bound to SNAP-ADAR, the guide RNA targets the attached SNAP-ADAR protein to the target RNA, forming the necessary secondary structure for A-to-I editing catalyzed by the deaminase domain. b) Typical BG-guide RNA targeting a UAG site with a 5'-CCA anticodon. This guide RNA is 22 nt long and is tightly chemically stable via 2'-methoxylation and a terminal thiophosphate bond. The first three 5'-terminal nucleotides do not pair with the target RNA bases but serve as a linker. This sequence preferably contains an unmodified or partially modified ribonucleotide gap (5'-CCA) facing the target site and containing a central mismatched cytosine opposite the target adenosine for efficient deamination. A C6-amino linker is located at the 5' end of the guide RNA to introduce the BG modification into the full-length oligonucleotide. c) Experimental setup. Cells with stably integrated SNAP-ADAR (SA) were seeded into 24-well plates containing doxycycline (dox) medium to induce SA expression. After 24 h, cells were reverse stained with guide RNA. After 24 h, cells were lysed for RNA isolation to analyze RNA editing.

[0375] Figure 8 Editing performance of four SNAP-ADARs. a) Transfection of engineered 293 cell lines expressing the corresponding SA enzyme with a single gRNA or four gRNAs targeting the indicated 5'-UAG triplet in the endogenous transcript. b) and c) Time- and dose-dependent editing in GAPDH transcripts. d) Editing of the 5'-UAG site in the 5'-UTR, ORF, and 3'-UTR of various transcripts. e) Comparative editing of all 16 triplets (5'-NAN) in the ORF of the endogenous GAPDH transcript. a)-e) Data are presented as mean ± SD, N = 3 independent experiments, black dots indicate individual data points.

[0376] Figure 9 : Controls off-target editing in SAQ cells.

[0377] a) To avoid unintended editing of adjacent adenosines at the target site, the relative bases in the guide RNA can be modified by 2'-methoxylation (M) or 2'-fluorination (F). This is an exemplary demonstration for the triple CAA. b) Off-target editing of adjacent adenosines was detected in the triples CAA, AAA, AAC, and UAA when SA2Q cells were specifically used. However, off-target editing was significantly reduced when the strategy was applied. Data are presented as mean ± SD, N = 3 independent experiments, with black dots representing individual data points.

[0378] Figure 10 The effects of chemical modification on editing yield and serum stability.

[0379] Examples of chemical modifications that stabilize the 3'-ACC anticodon (A) and 3'-UCC anticodon (B) in the target sequence, respectively, include 2'-F, 2'-O-methyl, 2'-deoxy, and thiophosphate modifications.

[0380] Figure 11 Branching and multi-copy conjugates are used to conjugate guide RNA. Schemes for conjugating 1xBG, 2xBG, or 4xBG to one or both ends of the ASO site are shown. These structures allow for the recruitment of multiple deaminases to the target, thus significantly improving their editing performance, for example, regarding potency (see [link to documentation]). Figure 12 ).

[0381] Figure 12 Results of the application of branched / multiple coupling agents.

[0382] It has been tested with Figure 11 Various guide RNAs with the structures shown were used to edit the Tyr701 codon in the endogenous STAT1 transcript in 293-Flp-In cells expressing SNAP-ADAR1Q. Specifically, guide RNAs containing either a 5'-amino linker or both 5'- and 3'-amino linkers and ligated to one (single) or two (double) coupling agents (1xBG, 2xBG, or 4xBG) were applied. Detailed Implementation

[0383] Example

[0384] The embodiments shown below are merely exemplary and should be used to further describe the invention. These embodiments should not be construed as limiting the invention thereto.

[0385] Example 1:

[0386] Unmodified RNA oligonucleotides were generated by in vitro transcription from linearly synthesized DNA templates (purchased from Sigma-Aldrich, Germany) using T7 RNA polymerase (Thermo Scientific, USA) overnight at 37°C. The resulting RNA was precipitated in ethanol and purified by urea (7M) polyacrylamide (15%) gel electrophoresis (PAGE), extracted into water, precipitated with ethanol, resuspended, and stored in nuclease-free water. All chemically modified RNA oligonucleotides were purchased from Biospring (Germany), Eurogentec (Belgium), or Dharmacon (USA). Long sequences were assembled from two parts by ligation.

[0387] As a first step, plasmid passage is used to screen for suitable guide RNA sequences. (Reporter editing assay) Figure 1 B) leads to the identification of sequence variant 9.4, which has an additional 5 bp at the 5' site of the RNA helix in the ADAR recruitment domain.

[0388] In the report-edit assay, firefly luciferase was expressed under the control of the CMV promoter from the pShuttle-CMV plasmid. The W417X amber mutation was introduced via overlap PCR. The sequence of the cloned product was determined by Sanger sequencing. The R / G-guide RNA was expressed under the control of the U6 promoter by a pSilencer backbone modified similar to that described by Wettengel et al. (Wettengel, J., Reautschnig, J., Geisler, S., Kahle, PJ, Stafforst, T. Harnessing human ADAR2 for RNA repair-Recoding a PINK1 mutation rescuesmitophagy. Nucl. Acids Res. 45, 2797-2808 (2017)). The sequence of the cloned product was determined by Sanger sequencing. Table 1 provides the sequences of the R / G-guide RNA used.

[0389] Table 1: R / G Guide RNA

[0390]

[0391]

[0392]

[0393] Legend of Table 1:(N) = RNA base, [N] = 2'-OMe RNA base, * = phosphate thioester bond, {N} = LNA base

[0394] As described by Wettengel et al. and Heep et al., Flp-In 293 T-Rex cells containing the corresponding integrated ADAR version of the genome were generated (R78007, Thermo Fisher Scientific) (Heep, M., Mach, P., Reautschnig, P., Wettengel, J., Stafforst, T. Applying Human ADAR1p110 and ADAR1p150 for Site-Directed RNA Editing-G / C Substitution Stabilizes GuideRNAs Against Editing. Genes 8, 34 (2017)). Cells were cultured in DMEM + 10% FBS + 100 μg / ml hygromycin B + 15 μg / ml cyprodinil S. During editing, 2.5 × 10⁻⁶ cells were used. 5 Cells / well (ADAR1p110, ADAR1p150) or 3x10 5 Cells / wells (ADAR2) were seeded in 500 μl of poly-D-lysine-coated 24-well plates containing DMEM, 10% FBS, and 10 ng / ml doxycycline. After 24 hours, transfection was performed using a 3:1 ratio of Lipofectamine-2000 with the plasmid, along with a luciferase reporter plasmid (300 ng) and R / G-guide RNA (1300 ng). The medium was changed every 24 hours until harvest. RNA was isolated and sequenced 72 hours post-transfection, as described above.

[0395] Even though it was not effective in recruiting ADAR2 (reducing editing yield by 35%), sequence variant 9.4 still nearly doubled the editing yield of ADAR1p110.

[0396] In the next step, plasmid delivery was performed by replacing the guide RNA with chemically stable antisense oligonucleotides (ASOs). In the first round, three chemically stable ASO designs (v1, v9, v9.4) were tested to edit the corresponding 5'-UAG sites of the 3'-UTR in GAPDH and ACTB. Although the ADAR recruitment domains consist of native oligonucleotides, the 17nt antisense portion of the ASO was designed as an Antagomir-like modified gapmer10 (overall 2'-O methylation, 3'-terminal phosphate thioester bond) with three native ribonucleoside gaps opposite the editing site. Figure 1A), similar to that described in Vogel et al. (Vogel, P., Schneider, MF, Wettengel, J., Stafforst, T. Improving Site-Directed RNA Editing In Vitro and in Cell Culture by Chemical Modification of the Guide RNA. Angew. Chem. Int. Ed. 53, 6267-6271 (2014)), was used for the SNAP-ADAR method. We constructed an ASO targeting a specific 5'-UAG site in the 3'-UTR of the housekeeping genes ACTB or GAPDH.

[0397] To assess the individual ADAR preference of this type of ASO, we lipid-transfected it into engineered 293Flp-In T-Rex cells that expressed specific ADAR isoforms (ADAR2, ADAR1p110, or ADAR1p150) under the control of the CMV tet-on promoter. 48 hours before ASO transfection, 2 × 10⁻⁶ cells were lipid-transfected. 5 100 cells / well of the corresponding ADAR-Flp-In 293 T-Rex cells were seeded in 24-well plates containing 10 ng / mL doxycycline in DMEM + 10% FBS to induce ADAR gene expression. After 48 hours, the cells were isolated and reverse-stained in 96-well plates. For this purpose, the corresponding ASO (5 pmol / well, unless otherwise specified) and Lipofectamine 2000 (0.75 μL / well) were diluted to 10 μL in separate tubes with OptiMEM. After 5 minutes, the two solutions were mixed, and 100 μL of cell suspension (5 × 10⁻⁶ cells / well) in DMEM + 10% FBS + 10 ng / mL doxycycline was added. 4 (Number of cells) were added to the transfection mixture in 96 wells. After 24 hours, the cells were harvested as described above for RNA isolation and sequencing.

[0398] Notably, in cells expressing ADAR1p150, extremely high editing yields (75-85%) were detected for both targets. Figure 1C). Editing yields of ADAR1-isotype p110 were low, ranging from 12-50%; however, the data clearly showed a strong (2-3 fold) advantage in editing yield with the new guide RNA sequence 9.4 compared to the initial form 1. Editing with ADAR2 remained within the range comparable to ADAR1 p110 (15-50%), and the effectiveness of the new design 9.4 decreased again compared to the old form 1. Finally, we tested concurrent editing of the two transcripts by co-transfection with two ASOs. Figure 1 (C, right figure). The editing yield remained almost constant, indicating that site-directed RNA editing can potentially occur simultaneously at several sites or on the transcript.

[0399] Example 2:

[0400] In another series of experiments, the 5'-UAG codon in the 3'-UTR of two housekeeping genes, GAPDH and ACTB, in HeLa cells was edited using endogenously expressed ADAR through simple lipid transfection of the corresponding ASO.

[0401] Therefore, HeLa cells (catalog number: ATCC CCL-2) were cultured in DMEM + 10% FBS + P / S (100 U / mL penicillin and 100 μg / mL streptomycin). 5 × 10⁶ cells were cultured in 100 μL of DMEM + 10% FBS (+600 units IFN-α, Merck, catalog number IF007, batch number 2937858). 4 Cells were added to a 96-well transfection mixture of 0.5 μL Lipofectamine 2000 and 5 pmol guide RNA / well. For concurrent editing of two different ASOs, 2.5 pmol of each corresponding ASO was co-transfected. Cells were harvested 24 hours later for RNA isolation and sequencing.

[0402] The control ASO, which contains only the specific domain but lacks the ADAR recruitment domain, did not trigger any edits. Figure 1 A, 2A). Some edits were observed using the initial sequence v1 and design v4 (A, 2A). Figure 2A). However, the novel sequence v9.4 provided significantly higher editing yields in both transcripts, approximately 40%. Given the particularly good performance of the ASO design v9.4 on ADARp150, experiments were repeated using HeLa cells pretreated with IFN-α (known to induce ADAR1p150 expression). Indeed, for all ASO designs (v1, v4, v9.4), IFN-α treatment nearly doubled the editing yield, and the editing yields on both transcripts reached up to 70%. These results confirm the advantage of sequence v9.4 in utilizing endogenously expressed ADAR.

[0403] Similarly, in this series of experiments, after co-transfection with two guide RNAs, the editing of the two transcripts was further analyzed. Under this same setting, the editing yield remained constant at high levels. Figure 2 (A, right figure). To assess the effects of chemical modification, the recruitment of ADAR overexpressed in Flp-In cells was also tested using unmodified in vitro transcribed guide RNA of the same sequence, and it was found to be significantly worse than that of chemically stable ASO.

[0404] The next step was to extend the chemical modifications to the ADAR recruitment domain. Specifically, the 5'-terminus was stabilized via 2′-O-methylation and a thiophosphate bond, and all pyrimidines were replaced with their 2′-O-methylated analogs. Even with these significant modifications, this ASO design v9.5 performed comparable to or even better than others in recruiting endogenous ADAR in HeLa cells. Figure 2 B) indicates that the ADARs'dsRNA-binding domain has undergone extensive chemical modifications.

[0405] To assess which ADAR isoforms were recruited by ASO v9.5 in HeLa cells, ADAR expression was determined in Western blot experiments.

[0406] For Western blotting, cells were collected 72 h after reverse staining with siRNA and lysed in urea lysis buffer (8 M urea, 100 mM NaH2PO4, 10 mM Tris, pH 8.0). Shear force was applied using a 23-gauge syringe, and cell debris was removed by centrifugation at 30,000 g for 15 min at 4 °C. Total protein mass was then normalized using Bradford assay, and a suitable amount of protein lysate in 1x Laemmli buffer was loaded onto an SDS-PAGE gel (4% stack, 12% separation gel). Proteins were then transferred to a PVDF membrane overnight at 30 V using a tank-blotting system. At room temperature, the membrane was blocked for 2 h in 5% skim milk powder TBST + 50 μg / ml antibiotic protein, and then incubated overnight at 4°C with primary antibody (5% skim milk powder TBST + 1:1000 α-ADAR1, Santa Cruz, sc-73408 or α-ADAR2, Santa Cruz, sc-73409 + 1:40.000 α-β-actin, Sigma Aldrich, A5441). Secondary antibody (5% skim milk powder TBST + 1:10.000 α-mouse-HRP + 1:50.000 Precision Protein) was then added. TM StrepTactin-HRP conjugate (Bio-Rad, #1610381) was incubated at room temperature for 1.5 h. After each antibody incubation, the membrane was washed with TBST 3 x 5 min. Detection was performed using 1 ml of Clarity Western ECL substrate (Biorad) and Fusion SL Vilber Lourmat (Vilber).

[0407] In Western blot analysis, only ADAR1p110 was found to be well expressed, while ADAR1p150 was only weakly expressed, but could be clearly induced by IFN-α. Figure 2D). ADAR2 could not be detected (data not shown). RNA interference was applied to knock down specific ADAR isotypes. Therefore, HeLa cells were reverse stained with 2.5 pmol of siRNA in a 12-well format to target ADAR1 (two isotypes, Dharmacon and SMARTpool: ON-TARGETplus ADAR(103) siRNA, L-008630-00-0005), ADAR1p150 (Ambion (Life Technologies), sense strand 5'-GCCUCGCGGGCGCAAUGAAtt (SEQ ID NO: 90); antisense strand: 5'-UUCAUUGCGCCCGCGAGGCat (SEQ ID NO: 91)), ADAR2 (Dharmacon, SMARTpool: ON-TARGETplus ADARB1(104) siRNA, L-009263-01-0005) or a mock (Dharmacon, siGENOME Non-Targeting siRNA Pool#2, D-001206-14-05). Add 800μl DMEM+ containing 1.2×10 5 Before applying 10% FBS to each HeLa cell, evenly distribute 200 μl of a transfection mixture containing 2.5 μl of the corresponding siRNA (1 nM) and 3 μl of HiPerFect (Qiagen, Germany) and OptiMEM into each well. Change the medium every 24 h. For RNA editing experiments, isolate cells 48 h after siRNA transfection and reverse stain with the corresponding ASO as described above.

[0408] When transfected with siRNA to resist ADAR2 or mimicry, the editing yield remained unchanged at 35% and 70% respectively, based on IFN-α. Figure 2 C). However, specific knockdown of the long isoform ADAR1 p150 resulted in reduced editing yields of 10% and 20%. Concurrent knockdown of two ADAR1 isoforms eliminated editing below detection. This suggests that two ADAR1 isoforms contribute to editing, however, the p150 isoform of the weaker-expressed ADAR1 contributes the most to the obtained editing yield. This is highly consistent with the observed positive effects of IFN-α therapy. Figure 2 Moreover, this is consistent with the better performance of ASO in 293Flp-In cells expressing ADAR1p150. Figure 1 C).

[0409] When the amount of ASO v9.5 was varied between 20 pmol and 40 fmol / 96 wells ( Figure 2E) An sigmoidal dependency was observed in the editing yield, with half-maximum yields achieved at doses of 0.2 pmol ASO / 96 wells (with IFN-α) and 0.4 pmol / well (without IFN). Maximum editing yields were obtained at ≥2 pmol / 96 wells. The efficacy in HeLa cells appears to be within a range similar to that of transfecting siRNA duplexes to interfere with RNA.

[0410] The time profile of editing yield was further analyzed within 5 days after transfection of 5 pmol / well into rapidly dividing HeLa cells (10% FBS). For this purpose, HeLa cells were transfected as described above. Cells were treated with IFN-α for 24 hours prior to transfection (as indicated). Cells were harvested at the corresponding time points shown for RNA isolation. For the 24-hour post-transfection time point, cells were isolated and transferred to 24-well plates after 24 hours to avoid cell overgrowth. The culture medium (containing IFN-α at the indicated time) was changed every 24 hours. Maximum editing yield was typically observed within a time window of 12–48 hours post-transfection, followed by a slow decline. Figure 2 F).

[0411] To evaluate the range of cell lines effective in recruiting endogenous ADAR, ASO v9.5 was applied to a cohort of 10 immortalized human standard (cancer) cell lines. Figure 2 G). All cells were cultured in DMEM + 10% FBS + P / S. 5 × 10⁶ cells / day. 4Cell lines per 96 wells: HeLa cells (catalog number: ATCC CCL-2), U2OS-Flp-In T-Rex (donated by Professor Elmar Schiebel), SK-N-BE(2) (catalog number: ATCC CRL-2271), SK-N-BE(2) (catalog number: ATCC CRL-2271), U87MG (catalog number: ATCC HTB-14), Huh7 (CLS GmbH, Heidelberg, catalog number: 300156), HepG2 (DSMZ, Braunschweig, Germany, catalog number: ACC180), AKN-1 (donated by Nüssler Laboratory), empty HEK-Flp-In T-Rex (R78007, Thermo Fisher Scientific, stably transfected with empty pcDNA5 vector), and A549 (European Certified Cell Culture Collection ECACC). [86012804] As described above for HeLa cells, reverse staining was performed using the appropriate ASO without further optimization. Only SH-SY5Y (catalog number: ATCC CRL-2266) cells were subjected to different reverse staining in a 24-well format: 5 × 10⁻⁶ ASO was added to a 100 μL transfection mixture consisting of 2.5 μL Lipofectamine 2000 and 25 pmol ASO in OptiMEM. 5 500 μL of medium (+3000 U IFN-α) per cell. In some cell lines, such as A549 and Huh7, editing yields were comparable to HeLa cells, while others showed lower yields. Under all conditions, the lowest editing levels were achieved using the "empty" 293Flp-In cell line (integrated with empty pcDNA5), with yields <11%. Editing yields of 4%–34% (mean 18.5%) were achieved before IFN-α treatment. As previously mentioned, yields increased 2–3 times after IFN-α treatment, ranging from 11%–73% (mean 46.8%).

[0412] To better evaluate the potential therapeutic scope of ASOs recruited by ADAR, a group of seven primary cell lines from different tissues were tested, including fibroblasts (from Parkinson's patients) and commercially available astrocytes, hepatocytes (from several donors), epithelial cells from the retina and bronchi, and endothelial cells from arteries and veins. Figure 2H). Except for primary fibroblasts, all primary cells were purchased from Lonza, a kind gift from the Valente laboratory. Primary fibroblasts were cultured in DMEM + 20% FBS. As shown, other cell lines were cultured in their respective commercial media: human umbilical vein endothelial cells (HUVEC, Lonza catalog number: CC-2517) and human aortic endothelial cells (HAEC, Lonza catalog number: CC-2535) were cultured in 200 PRF medium (Thermo Fisher Scientific catalog number: M200PRF500) with low serum growth supplement (LSGS Thermo Fisher Scientific catalog number: S00310); normal human astrocytes (NHA, Lonza catalog number: CC-2565) were cultured in ABM basal medium (Lonza catalog number: CC-3187) with AGM SingleQuot kit supplemented with growth factors (Lonza catalog number: CC-4123); and human retinal pigment epithelial cells (H-RPE, Lonza catalog number: 194987) were cultured in EpiLife medium (Thermo Fisher Scientific catalog number: S0095) with human corneal growth supplement (Thermo Fisher Scientific catalog number: S0095). Normal human bronchial epithelial cells (NHBE, Lonza catalog number: CC-2540) were cultured in airway epithelial cell basal medium (LGC standard catalog number: ATCC-PCS-300-030) with a bronchial epithelial cell growth kit (LGC standard catalog number: ATCC-PCS-300-040), and primary human hepatocytes (PHH, Lonza catalog number: HUCPI) were frozen in Cryo HH thawing medium (Lonza catalog number: MCHT50) and seeded in hepatocyte plating medium (Lonza catalog number: MP100) supplemented with hepatocytes. Six hours post-seeding, they were cultured in hepatocyte maintenance medium (Lonza catalog number: MM250) supplemented with hepatocytes. Twenty-four hours before transfection with ASO in a 24-well format, 3.5 × 10⁶ cells were seeded. 4 HUVEC and HAEC, 1×10 5 NHA, H-RPE and NHBE and 4.5×10 5PHH. For PHH, 24-well plates coated with mouse collagen I- (GreinerBioOne) were used. Shortly before transfection, the medium was changed (adding 3000 UIFN-α to 500 μL of medium / well, if indicated). For each well, 1.5 μL of Lipofectamine RNAiMAX (Thermo Fisher Scientific) and 25 pmol ASO were separately diluted with 50 μL of OptiMEM. Five minutes after incubation, the two solutions were combined, and after an additional 20 minutes of incubation, 100 μL of the transfection mixture was evenly distributed into one well. After 24 hours, cells were harvested for RNA isolation and sequencing. Surprisingly, higher levels of editing were detected in primary cells compared to immortalized cells, achieving editing levels of 10%–63% (mean 31.5%). Notably, editing levels were higher in primary hepatocyte samples and patient fibroblasts than in HeLa cells. Furthermore, IFN-α treatment increased editing yields in all cells, ranging from 35% to 77% (mean 62.6%). Transfection of a series of ASO dilutions (25–0.2 pmol ASO v9.5 / 24 wells, without IFN treatment) into donor #1 and #2 hepatocytes showed a clear dose-dependent effect. Figure 2 H).

[0413] Example 3:

[0414] After characterizing the ASO design 9.4 to edit the 5'-UAG triplet in the 3'-UTR, editing of the 5'-UAG triplet in the ORF of GAPDH in the ADAR-expressing 293 cell line was tested using ASO-based v9.4 (see also Example 1). Comparison of editing yields obtained using the three ADARs showed that the editing yield in the ORF followed the same trend as with the previous 3'-UTR (ADAR1p150 > ADAR1p110 ≈ ADAR2), although the editing yield was generally lower (11%–55%, see Example 1). Figure 3 A).

[0415] The ASO structure was further optimized by increasing the length of the specific domain and including LNA modifications to improve target binding kinetics. We identified ASO design v25, which consists of an unchanged ADAR recruitment domain but contains a 40 nt specific domain that is 2′-O-methylated, partially methylated by a thiophosphate bond, and contains three LNA modifications (…). Figure 3B). After transfection into HeLa cells, ASO v25 achieved an editing yield of 26 ± 3% in the absence of IFN-α and 42.7 ± 1.5% in the presence of IFN-α. Notably, chemical modification of the ADAR recruitment domain is important. Without chemical modification, v25 did not perform editing in the absence of IFN-α, but only underwent moderate editing (13.7 ± 3.5%) in the presence of IFN-α. Figure 4 The newly designed v25 was also tested in several primary cells to edit the 5'-UAG site in the GAPDH ORF. Prior to IFN-α treatment, editing levels were obtained at 12.7 ± 2.1% (fibroblasts), 9.3 ± 0.6% (RPE), and 38% (hepatocytes, one donor). As previously described, IFN-α treatment increased the editing levels to 22.7 ± 0.6% (fibroblasts), 32.3 ± 4.5% (RPE), and 45% (hepatocytes, one donor).

[0416] Example 4:

[0417] To evaluate the therapeutic potential of this ASO, editing of two therapeutically relevant deamination sites was tested. First, a phosphorylation site in endogenous STAT1 (Tyr701) was targeted, which deamination switched the protein to a transcription factor. After editing, the corresponding 5′-UIU codon encodes Cys, an amino acid that cannot mimic phosphorylated Tyr. The aforementioned ASO-based v25 design was used in these experiments. An editing yield of 21.0 ± 6.2% was achieved in primary fibroblasts prior to IFN-α treatment, and up to 7% was achieved in RPE. Figure 3 D). In the presence of IFN-α, the yield increased to 32 ± 7% (fibroblasts) and 19.7 ± 2.5% (RPE). Similar values ​​were obtained in HeLa cells. Overall, editing endogenous STAT1 transcripts by recruiting endogenous ADAR in primary cell lines likely yields moderate yields.

[0418] As a second site, editing of the PiZZ mutation (E342K) in the SERPINA1 transcript was tested, the most common cause of α1-antitrypsin deficiency (A1AD). The loss of antitrypsin, which regulates neutrophil elastase activity, leads to severe lung damage. Furthermore, the mutant antitrypsin accumulates in the liver and causes severe liver injury. First, editing of the E342K mutation (5'-CAA triplet) was tested after overexpression of the mutant SERPINA1 cDNA in 293 cells treated with an ASO designed based on v9.4. To obtain SERPINA1 cDNA for cloning, total RNA was isolated from HepG2 cells and reverse transcribed. The E342K mutation was inserted into the cDNA by PCR, and restriction was performed using HindIII and ApaI. Under CMV promoter control, both wild-type SERPINA1 and the E342K mutant were cloned into the pcDNA3.1 vector. To integrate the SERPINA1 genome using the piggyBac transposon system, wild-type and mutant cDNAs were cloned into the PB-CA vector using the same restriction sites as described above. 24 hours before transfection, 1x102 6 HeLa cells were seeded into 6-well plates. Following the manufacturer's protocol, 1 μg of piggyBae transposase vector (Transposagen Biopharmaceuticals) and 2.5 μg of SERPINA1 PB-CA vector were co-transfected with 10.5 μL FuGENE6 (Promega). After 24 hours, cells were selected for 2 weeks in DMEM + 10% FBS medium containing 10 μg / mL puromycin. For editing, stably transfected or plasmid-transfected cells (300 ng plasmid / 0.9 μL FuGENE6 for HeLa, and 100 ng plasmid / 0.3 μL Lipofectamine 2000 for Flp-ADAR1p150 cells) were reverse-stained with the corresponding ASO. After 24 hours, cell supernatant was collected for A1AT-ELISA, and cells were harvested for RNA isolation and sequencing. A1AT-ELISA was performed using a commercial kit (catalog number: ab108799, Abcam) according to the manufacturer's protocol. Samples from three biological replicates were measured using technical replicates. A1AT protein levels were calculated from a standard curve using linear regression.

[0419] Only in the presence of ASO, an editing yield of 29 ± 2% was determined at the target site. Figure 3E). α1-Antitrypsin (A1AT) secretion was measured by ELISA, and the secretion was normalized in cells transfected with wild-type SERPINA cDNA. Secretion levels increased from 14 ± 1.8% before repair to 27 ± 4.3% after repair. In addition to the 5'-UAG triplet, the 5'-CAA triplet contained editable adenosine closest to target A. Indeed, some small edits were detected at the proximal site; this issue could be addressed by further chemical modification of the ASO around the target nucleotide. To test the repair of endogenous ADAR leading to the A1AD mutation, HeLa cell lines stably expressing mutant SERPINA1 were created using the piggyBac system or by overexpression of SERPINA1 cDNA via plasmid passage. Editing levels of 19 ± 2% (integrated cDNA with IFN-α) and 21 ± 4% (transient expression of cDNA with IFN-α) were achieved by recruiting endogenous ADAR through the application of v25-based designed ASOs.

[0420] Example 5:

[0421] To test the stability of guide RNA, it was incubated in PBS buffer containing 10% FBS for specified times (0 min, 5 min, 10 min, 1 h, 3 h, 6 h, 12 h, or 24 h). After incubation, the guide RNA was separated on 15% urea (7 M)-PAGE, stained with SYBR Gold, and photographed and quantified using a Typhoon FLA biomolecular imaging system. Guide RNA with unmodified 3nt anticodons typically has a short half-life (minutes) in serum. Guide RNA with 3'-UCU anticodons targeting the 5'-AAA codon (e.g.) Figure 6 A) Due to degradation, it was essentially undetectable at the first incubation time point (5 min). However, single skeletal modifications with 2'-F or 2'-O-methyl groups improved stability. Figure 6 (A and B). For example, for the anticodon 3'-ACC, the half-life was significantly improved by several modification modifiers, increasing from less than 5 min to approximately 24 h (an improvement of about 300-fold), with each modifier modifying all nucleotides in the anticodon. Furthermore, these modifications also improved editing yield compared to the unmodified guide RNA (BG-85) in the 3nt anticodon (see, for example, BG-150 / BG-151). Figure 6 C).

[0422] Example 6:

[0423] In the parallel approach, a guide RNA conjugated with a coupling agent is used to edit an endogenous transcript labeled with ADAR. For example, a BG-conjugated guide RNA is used in conjunction with a SNAP-labeled ADAR (see [link to article]). Figure 7 As described by Hanswillemenke et al., BG-conjugated gRNAs were synthesized and PAGE purified from commercially available oligonucleotides containing a 5'-amino-C6 linker (BioSpring, Germany) (J. Am. Chem. Soc. 2015, 137, 15875-15881). The sequences and chemical modifications of all guide RNAs are provided in Table 2.

[0424] Table 2: Guide RNA used with labeled ADAR

[0425]

[0426]

[0427] Legend of Table 2: Nucleotides highlighted in bold are unmodified and are opposite the triplet, with the target adenosine in the middle. Nucleotides highlighted in italics are modified with 2'-O-methylation, and 2'-fluorinated nucleotides are grayed out. The backbone contains terminal phosphate-thioester bonds as indicated by "s". The first three nucleotides at the 5' end are not complementary to the mRNA substrate but act as a linker sequence between the gRNA and the SNAP-tag.

[0428] For this study, all NH2-guide RNAs were purchased from Biospring (Germany) as HPLC-purified ssRNAs with a 5'-C6 amino linker. Our protocol can be used to introduce the BG moiety as an alternative to commercial BG derivatives. Benzylguanine linked to the carboxylic acid linker 2,3 (12 μl, 60 mM DMSO) was in situ activated to an OSu-ester by incubation at 30 °C for 1 h with EDCI·HCl (12 μl, 17.4 mg / mL DMSO). Then, NH2-guide RNA (25 μl, 6 μg / μl) and DIPEA (12 μl, 1:20 DMSO) were added to the pre-activated mixture and incubated (90 min, 30 °C). 20.19 Crude BG-guide RNA was purified by 20% urea PAGE of unreacted NH2-guide RNA, followed by extraction with H2O (700 μl, overnight at 4 °C). RNA precipitation was completed with sodium acetate (0.1 v, 3.0 M) and ethanol (3 v, 100%, overnight at -80 °C). BG-guide RNA was washed with ethanol (75%) and dissolved in water (60 μl).

[0429] Cell lines that stably express SNAP-ADAR1 (SA1), SNAP-ADAR2 (SA2), and 2, as well as their highly active EQ variants 10SA1Q and SA2Q, were generated. Each corresponding enzyme (SA1 (wt & Q) and SA2 (wt and Q)) was integrated into a single copy at the FRT site in the genome of the aforementioned 293 Flip-In cells (R78007, Thermo Fisher Scientific) under the control of the dox-inducible CMV promoter (see Wettengel, J., Reautschnig, J., Geisler, S., Kahle, PJ, Stafforst, T. Harnessing human ADAR2 for RNA repair - Recoding a PINK1 mutation rescues mitophagy. Nucl. Acids Res. 45, 2797-2808 (2017); or Cox, DBT, Gootenberg, JS, Abudayyeh, OO, Franklin, B., Kellner, MJ, Joung, J., Zhang, F. RNA editing with CRISPR-Cas13, Science, 10.1126 / science.aaq0180 (2017). Doxycycline (10 ng / ml) induced enzyme expression of all four enzymes to substantially equivalent levels, as confirmed by Western blotting and fluorescence microscopy (data not shown). Similarly, at the RNA level, the expression levels of SA1 (wt&Q) and SA2 (wt and Q) were substantially equivalent to the mean FPKM values, with 679 and 814 for SA1(Q) and SA2(Q), respectively. EQ mutations did not alter protein localization. SA1(Q) was localized in both the cytoplasm and nucleoplasm; SA2(Q) was primarily localized in the cytoplasm. To determine the location of different SNAP-ADAR proteins, 1×10⁻⁶ cells were printed on poly-D-lysine-coated coverslips in a 24-well format. 3 Cells were seeded in 500 μl of selective medium with or without doxycycline (10 ng / ml). One day later, BG-FITC labeling and nuclear staining of the SNAP tag were performed. Western blot analysis was used to verify the amount of SNAP-ADAR protein. For this purpose, 3 × 10⁶ cells were seeded. 5Cells were seeded in 24-well format in 500 μl of selective medium with or without doxycycline (10 ng / ml) for one day. Cells were then lysed with urea-buffered saline (10 mM Tris in 8 M urea, 100 mM NaH2PO4, pH 8.0). Protein lysates (5 μg) were separated by SDS-PAGE and transferred to a PVDF membrane (Bio-Rad Laboratories, USA) for immunoblotting with primary antibodies against SNAP tag (1:1000, P9310S, New England Biolabs, USA) and β-actin (1:40000, A5441, Sigma Aldrich, USA). The blots were then cultured with HRP-conjugated secondary antibodies against rabbits (1:10000, 111-035-003, Jackson Immuno Research Laboratory, USA) and mice (1:10000, 115-035-003, Jackson Immuno Research Laboratory, USA) and visualized by enhanced chemiluminescence.

[0430] Editing was initiated via transfection with short, chemically stable BG-guided RNA, and formal A-to-G conversion in cDNA of specific 5′-UAG triplets in the 3′-UTR of four targeted endogenous mRNAs: ACTB, GAPDH, GUSB, and SA1 / 2 was analyzed. For both wild-type enzymes (SA1 / 2), editing yields of 40-80% were achieved depending on the target. Figure 8 a). The application of highly active mutants (SA1Q / SA2Q) increased the yield to 65-90%. Maximum editing yield (80-90%) was obtained approximately 3 hours post-transfection. Figure 1 b) The activity was kept constant for 3 days, then slowly decreased, possibly due to cell division diluting the guide RNase conjugate. The activated enzymes (SA1Q & SA2Q) showed up to 12-fold increased potency compared to the wild-type enzymes (SA1 & SA2), achieving a half-maximum editing yield of 0.15 pmol / well compared to 1–2 pmol / well. Figure 1 c). Concurrent editing of all four transcripts was tested by co-transfection with four guide RNAs. Notably, the yield remained constant. Figure 1 a). Compared to ORF and 5′-UTR, 3′-UTR has higher editing productivity ( Figure 1 d) This may be due to translational interference. Faster enzymes (SA1Q & SA2Q) increased the yield of 5′-UTR from 25-50% to 60-75% and the yield of ORF from 15-60% to 50-85%. Figure 1d). Furthermore, translational repression by puromycin increased ORF editing in SA1 / 2 cells to the level of 3′-UTR editing (data not shown). To assess codon range, all 16 possible 5′-NAN triplets SA1Q and SA2Q in the ORF of endogenous GAPDH were tested. Yields ranging from minimal to almost quantitative were obtained, reflecting the known bias of ADAR ( Figure 1 e). Although editing of 5′-GAN triads is generally difficult (<30%), significant yields (>50%) were achieved for 10 / 16 triads. For 7 / 16 triads, at least one enzyme yielded excellent editing yields (>70%).

[0431] Example 7:

[0432] The primary goal of RNA editing is to inhibit ectopic editing (see...). Figure 9 a). Therefore, it was tested whether ectopic editing could be avoided by using the chemically modified form of the guide RNA described herein. Some off-target editing was detected only for adenosine-rich triples (AAC, AAA, UAA, CAA), primarily SA2Q (5-75%), and primarily CAA triples ( Figure 9 b, right figure, "r"). If three natural nucleotides are present in the guide RNA opposite the target adenosine, the detargeting editing rate is higher ( Figure 9 b, specifically the right figure, “r”). Careful inclusion of further chemical modifications (2′-methoxy, 2′-fluorine) limits detargeting editing at the CAA triplet to 20% and detargeting editing at all other sites to <10%, without reducing target editing ( Figure 9 (b, “M”, “F”). It is worth noting that, at least for AAA, the additional modifications even increase the target yield from 40% to 50%.

[0433] Example 8:

[0434] Regarding its role in RNA editing, multiple copies of the branched adapter and the BG-derived recruitment moiety were tested. To this end, various guide RNAs were tested side-by-side against the Tyr701 codon in the endogenous STAT1 transcript in SNAP-ADAR1Q-expressing 293-Flp-In cells (induction with 10 ng / ml doxycycline for 24 h prior to guide RNA transfection, followed by editing analysis 24 h post-transfection). Specifically, guide RNAs containing a 5'-amino linker or 5'- and 3'-amino linkers, coupled to one or two recruitment moieties, were applied. The resulting guide RNAs may potentially recruit 1 to 8 SNAP-ADAR1Q deaminases, such as... Figure 11As exemplified, with saturated amounts of guide RNA (1 pmol / well or more), almost all guide RNAs achieved the same editing yield (70-80%). Only a single 1xBG guide RNA did not reach maximum yield, but stopped at approximately 60%. Guide RNAs that allowed recruitment of more than one SNAP-ADAR1Q showed increased potency, indicating that they maintained high editing yields when the amount of guide RNA was reduced. For example, with a single 1xBG, the editing yield dropped to 22% and below detection when the amount of guide RNA was reduced to 0.1 pmol / well and 0.01 pmol / well. In contrast, for dual 2xBG and dual 4xBG guide RNAs, the editing yield remained at 58% and 65% respectively at 0.1 pmol / well, while it dropped to only 17% and 10% at 0.01 pmol / well, thus significantly improving the potency of the guide RNA.

Claims

1. An artificial nucleic acid for site-specific editing of target RNA, said artificial nucleic acid comprising: a) A target sequence comprising a nucleic acid sequence complementary to a target sequence in the target RNA, and b) The recruitment fraction used to recruit deaminases. The target sequence comprises at least one nucleotide, which is chemically modified at the 2' position, and wherein at least one of the two nucleotides located at the 5' or 3' position corresponding to the nucleotide to be edited in the target sequence is chemically modified at the 2' carbon atom to include a substituent, wherein the substituent is selected from: halogens, alkoxy groups, and hydrogen; and The targeted sequence comprises at least one backbone modification, wherein the nucleotide contains a modified phosphate ester group, wherein the modified phosphate ester group is selected from thiophosphates, selenophosphates, borane phosphates, borane phosphates, hydrophosphonates, aminophosphates, alkylphosphonates, arylphosphonates, and phosphate triesters. The target sequence contains cytidine nucleotides or deoxycytidine nucleotides at the positions corresponding to the nucleotides to be edited in the target sequence, and The recruitment portion comprises at least one coupling agent capable of recruiting a deaminase, the deaminase comprising a portion that binds to the coupling agent, or the recruitment portion comprises a nucleic acid sequence capable of specifically binding the deaminase, and the nucleic acid sequence is covalently linked to the 5' end of the target sequence.

2. The artificial nucleic acid according to claim 1, wherein... The substituent is selected from 2'-hydrogen, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-fluoro; and / or The chemically modified nucleotides are selected from locked nucleic acid (LNA) nucleotides, ethylene-bridged nucleic acid (ENA) nucleotides, and (S)-restricted ethyl cEt nucleotides.

3. The artificial nucleic acid according to claim 1 or 2, wherein at least 40% of the nucleotides of the target sequence are chemically modified at the 2' position.

4. The artificial nucleic acid according to claim 1 or 2, At least one of the two nucleotides located at the 5' or 3' position corresponding to the nucleotide to be edited in the target sequence contains a modified phosphate group.

5. The artificial nucleic acid according to claim 4, wherein the modified phosphate group is a thiophosphate group.

6. The artificial nucleic acid according to claim 1 or 2, wherein the nucleotide at the 5' position corresponding to the nucleotide to be edited is a pyrimidine nucleotide.

7. The artificial nucleic acid according to claim 6, wherein the pyrimidine nucleotide is chemically modified at the 2' position by 2'-hydrogen, 2'-O-methyl, 2'-O-methoxyethyl or 2'-O-fluorine.

8. The artificial nucleic acid according to claim 1 or 2, The target sequence described herein comprises a nucleic acid sequence: 3' As* c C* 5', in As is an adenosine nucleotide, which contains a thiophosphate group; c is a cytidine nucleotide, deoxycytidine nucleotide, or no-base site at the position corresponding to the nucleotide to be edited in the target sequence; and C is a cytidine nucleotide; The asterisk (*) indicates that the aforementioned nucleotide on the 2' carbon atom is chemically modified by 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl, or 2'-fluorine.

9. The artificial nucleic acid according to claim 8, wherein the adenosine nucleotide is adenosine ribonucleotide or deoxyadenosine nucleotide.

10. The artificial nucleic acid according to claim 1 or 2, The target sequence described herein comprises a nucleic acid sequence: 3' Us* c C* 5', in Us is uridine nucleotide, which contains a thiophosphate group; c is a cytidine nucleotide, deoxycytidine nucleotide, or no-base site at the position corresponding to the nucleotide to be edited in the target sequence; and C is a cytidine nucleotide; The asterisk (*) indicates that the aforementioned nucleotide on the 2' carbon atom is chemically modified by 2'-hydrogen (2'-deoxy), 2'-O-methyl, 2'-O-methoxyethyl, or 2'-fluorine.

11. The artificial nucleic acid according to claim 10, wherein the uridine nucleotide is uridine ribonucleotide or deoxyuridine nucleotide.

12. The artificial nucleic acid according to claim 1 or 2, wherein at least two of the five nucleotides at the 3' end of the target sequence comprise a modified phosphate ester group.

13. The artificial nucleic acid according to claim 12, wherein the modified phosphate group is a thiophosphate group.

14. The artificial nucleic acid according to claim 1 or 2, wherein at least two of the five nucleotides at the 3' end of the target sequence are LNA nucleotides, ENA nucleotides, or (S)-restricted ethyl cEt nucleotides.

15. The artificial nucleic acid according to claim 1 or 2, wherein the targeting sequence comprises: At least one nucleotide containing a modified phosphate ester group; At least one nucleotide selected from the following: LNA nucleotide, ENA nucleotide, and (S)-restricted ethyl cEt nucleotide; and At least one nucleotide containing a substituent on the 2' carbon atom, wherein the substituent is selected from halogens, alkoxy groups, hydrogen, aryloxy groups, amino groups, and aminoalkoxy groups.

16. The artificial nucleic acid according to claim 15, wherein the modified phosphate group is a thiophosphate nucleotide, the at least one nucleotide is an LNA nucleotide, and the substituent is selected from 2'-hydrogen, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-fluoro.

17. The artificial nucleic acid according to claim 1 or 2, wherein the targeting sequence comprises a nucleic acid sequence, wherein, In addition to the cytidine nucleotides and deoxycytidine nucleotides at the positions corresponding to the nucleotides to be edited in the target sequence. Except for LNA nucleotides, all nucleotides are chemically modified at the 2' carbon atom, which is attached to a substituent selected from the following: halogen, alkoxy, hydrogen, aryloxy, amino, and aminoalkoxy.

18. The artificial nucleic acid according to claim 1 or 2, wherein the target sequence comprises cytidine nucleotide, deoxycytidine nucleotide, and at the position corresponding to the nucleotide to be edited in the target sequence. At least one of the two nucleotides located at the 5' or 3' position corresponding to the nucleotide to be edited in the target sequence is chemically modified at the 2' carbon atom, wherein the 2' carbon atom is attached to a substituent selected from: halogen, alkoxy, hydrogen, aryloxy, amino, and aminoalkoxy; and At least one of the two nucleotides located at the 5' or 3' position corresponding to the nucleotide to be edited in the target sequence contains a modified phosphate group.

19. The artificial nucleic acid according to claim 18, wherein the substituent is selected from 2'-O-methyl, 2'-O-methoxyethyl, 2'-hydrogen and 2'-fluorine, and the modified phosphate group is a thiophosphate group.

20. The artificial nucleic acid according to claim 1 or 2, wherein the target sequence comprises cytidine nucleotide, deoxycytidine nucleotide, and at the position corresponding to the nucleotide to be edited in the target sequence. The nucleotide at the 5' position corresponding to the nucleotide to be edited is a pyrimidine nucleotide, and the pyrimidine nucleotide contains a nucleobase that is chemically modified at the 2' position.

21. The artificial nucleic acid according to claim 1 or 2, wherein the targeting sequence comprises the nucleic acid sequence defined in any one of claims 8 to 13.

22. The artificial nucleic acid according to claim 1 or 2, wherein the coupling agent is selected from O6-benzylguanine, O2-benzylcytosine, chloroalkyl, 1xBG, 2xBG, 4xBG.

23. The artificial nucleic acid according to claim 1 or 2, wherein the portion bound to the coupling agent is selected from SNAP-tag, CLIP-tag, and Halo-tag.

24. The artificial nucleic acid according to claim 1 or 2, wherein The recruitment component contains O6-benzylguanine, 1xBG, 2xBG, and 4xBG, and the deaminase contains a SNAP-tag; The recruitment portion contains chloroalkane, and the deaminase contains a Halo tag; or The recruitment portion contains O2-benzylcytosine, and the deaminase contains a Clip-tag.

25. The artificial nucleic acid according to claim 24, wherein the deaminase is adenosine deaminase.

26. The artificial nucleic acid according to claim 1 or 2, wherein The recruitment portion includes a coupling agent capable of recruiting more than one deaminase molecule; and / or The recruitment portion comprises at least two parts of the coupling agent, wherein the at least two parts represent the same coupling agent or different coupling agents.

27. The artificial nucleic acid according to claim 26, wherein the coupling agent is selected from 2xBG and 4xBG.

28. The artificial nucleic acid according to claim 1 or 2, wherein the recruitment portion comprises a nucleic acid sequence capable of specifically binding to the dsRNA binding domain of the deaminase.

29. The artificial nucleic acid according to claim 1 or 2, wherein the deaminase is adenosine or cytidine deaminase.

30. The artificial nucleic acid according to claim 1 or 2, wherein the recruitment portion comprises a nucleic acid sequence capable of intramolecular base pairing.

31. The artificial nucleic acid according to claim 30, wherein the nucleic acid sequence capable of intramolecular base pairing is capable of forming a stem-loop structure.

32. The artificial nucleic acid of claim 31, wherein the stem-loop structure comprises at least two mismatched double helix stems.

33. The artificial nucleic acid of claim 31, wherein the stem-loop structure comprises a loop consisting of 3 to 8 nucleotides.

34. The artificial nucleic acid of claim 33, wherein the loop comprises the nucleic acid sequence GCUAA or GCUCA.

35. The artificial nucleic acid according to claim 1 or 2, wherein the recruitment portion comprises a nucleic acid sequence containing at least one nucleotide, wherein the nucleotide contains chemically modified nucleobases, and / or wherein the nucleic acid sequence contains at least one backbone modification.

36. The artificial nucleic acid of claim 35, wherein the recruitment portion comprises a nucleic acid sequence comprising at least one chemically modified nucleotide at the 2' position.

37. The artificial nucleic acid according to claim 36, wherein... The chemically modified nucleotide contains a substituent at the 2' carbon atom, wherein the substituent is selected from halogens, alkoxy groups, hydrogen, aryloxy groups, amino groups, and aminoalkoxy groups; and / or The chemically modified nucleotides are locked nucleic acid (LNA) nucleotides, ethylene-bridged nucleic acid (ENA) nucleotides, or (S)-restricted ethyl cEt nucleotides.

38. The artificial nucleic acid of claim 35, wherein the recruitment comprises a nucleic acid sequence containing at least one backbone modification, and wherein the phosphate group of the sugar linking two adjacent nucleotides is a modified phosphate group.

39. The artificial nucleic acid according to claim 38, wherein the modified phosphate group is selected from thiophosphate, selenophosphate, boron phosphate, boron phosphates, hydrophosphonates, aminophosphates, alkylphosphonates, arylphosphonates and triphosphates.

40. The artificial nucleic acid of claim 35, wherein the recruitment portion comprises a nucleic acid sequence, wherein at least 40% of the nucleotides are chemically modified at the 2' position.

41. The artificial nucleic acid of claim 35, wherein the recruitment portion comprises a nucleic acid sequence, wherein at least two of the five nucleotides at the 5' end of the nucleic acid sequence comprise phosphate thioester groups.

42. The artificial nucleic acid of claim 35, wherein the recruitment portion comprises a nucleic acid sequence, wherein at least two of the five nucleotides at the 5' end of the nucleic acid sequence are LNA nucleotides, ENA nucleotides, or (S)-restricted ethyl cEt nucleotides.

43. The artificial nucleic acid of claim 35, wherein the recruitment portion comprises a nucleic acid sequence, the nucleic acid sequence comprising: At least one nucleotide containing a modified phosphate ester group; At least one LNA nucleotide, ENA nucleotide, or (S)-restricted ethyl cEt nucleotide; and At least one nucleotide containing a substituent at the 2' carbon atom, wherein the substituent is selected from halogens, alkoxy groups, hydrogen, aryloxy groups, amino groups, and aminoalkoxy groups.

44. The artificial nucleic acid according to claim 43, wherein the modified phosphate group is a thiophosphate group and wherein the substituent is selected from 2'-hydrogen, 2'-O-methyl, 2'-O-methoxyethyl and 2'-fluoro.

45. The artificial nucleic acid according to claim 1 or 2, wherein the recruitment portion comprises a nucleic acid sequence selected from: (a)5' GGUGUCGAG – N a – AGA – N c – GAGAACAAUAU - GCU A / CA – AUGUOCAAUAU –N d – UCU – N b - CUCGACACC 3' (SEQ ID NO: 38)? (b) 5' GsGsUGUCGAG – N a – AGA – N c – GAGAACAAUAU - GCU A / C A – AUGUUGUUCUC– N d – UCU – N b - CUCGACACC 3' (SEQ ID NO: 39); and (c)5′ GslGslUGUCGAG – N a – AGA – N c – GAGAACAAUAU - GCU A / CA –AUGUUGUUCUCUC – N d – UCU – N b - CUCGACACC 3' (SEQ ID NO: 40)? in N a and N b This results in a mismatch; N c and N d This results in a mismatch; Gs is a guanosine containing a thiophosphate group; and Gsl is an LNA guanosine containing a thiophosphate group.

46. ​​The artificial nucleic acid according to claim 1 or 2, wherein the recruitment portion comprises a nucleic acid sequence derived from VA RNA I.

47. The artificial nucleic acid according to claim 1 or 2, wherein the recruitment portion comprises the nucleic acid sequence GCACACCTGGGTTCGACACGCGGGCGGTAACCGCATGGATCACGGCGGACGGCCGGATTCGGGGTTCGAACCCCGGTCGTCCGCCATGATACCCTTGC (SEQ ID NO: 41).

48. The artificial nucleic acid according to claim 45, wherein at least one nucleotide contains a substituent at the 2' carbon atom, wherein the substituent is selected from halogens, alkoxy groups, hydrogen, aryloxy groups, amino groups, and aminoalkoxy groups.

49. The artificial nucleic acid according to claim 1 or 2, wherein the recruitment portion comprises a nucleic acid sequence selected from: (a)5' G*G*U*GU*C*GAG – N a – AGA – N c – GAGAAC*AAU*AU* - GC*U* A / CA – AU*GU*U*GU*U*C*U*C* – N d – U*C*U* – N b * - C*U*C*GAC*AC*C* 3' (SEQ ID NO: 42); (b) 5' Gs*Gs*U*GU*C*GAG – N a – AGA – N c – GAGAAC*AAU*AU* - GC*U* A / C A –AU*GU*U*GU*U*C*U*C* – N d – U*C*U* – N b * - C*U*C*GAC*AC*C* 3' (SEQ ID NO: 43); and (c)5’ Gsl*Gsl*U*GU*C*GAG – N a – AGA – N c – GAGAAC*AAU*AU* - GC*U* A / C A –AU*GU*U*GU*U*C*U*C* – N d – U*C*U* – N b * - C*U*C*GAC*AC*C* 3’ (SEQ ID NO: 44); in N a and N b This results in a mismatch; N c and N d This results in a mismatch; Gs is guanosine containing a thiophosphate group; Gsl is an LNA guanosine containing a thiophosphate group; and An asterisk (*) indicates that the nucleotide on the 2' carbon atom is modified.

50. The artificial nucleic acid of claim 1, wherein the artificial nucleic acid comprises a portion that enhances cellular uptake of the artificial nucleic acid.

51. The artificial nucleic acid of claim 50, wherein the portion that enhances cellular uptake is triantane N-acetylgalactosamine (GalNAc3).

52. The artificial nucleic acid according to claim 51, wherein the GalNAc3 is conjugated to the 3' end or the 5' end of the artificial nucleic acid.

53. The artificial nucleic acid according to claim 1, wherein the recruitment portion and the target sequence are included in the direction from 5' to 3'.

54. The artificial nucleic acid according to claim 1, wherein it is RNA.

55. The artificial nucleic acid according to claim 1, wherein the deaminase is adenosine deaminase or Cytidine deaminase.

56. The artificial nucleic acid according to claim 55, wherein: (1) Adenosine deaminase is selected from ADAR1 and ADAR2; or (2) The cytidine deaminase is Apobec1.

57. The artificial nucleic acid according to claim 1, wherein the deaminase is adenosine deaminase or cytidine deaminase.

58. The artificial nucleic acid according to claim 1, wherein the site-directed editing comprises the deamination of adenosine or cytidine in the target sequence.

59. A vector encoding an artificial nucleic acid according to any one of claims 1 to 58.

60. A cell comprising an artificial nucleic acid according to any one of claims 1 to 58 or a vector according to claim 59.

61. A composition comprising an artificial nucleic acid according to any one of claims 1 to 58, a carrier according to claim 59 or a cell according to claim 60, and a pharmaceutically acceptable excipient.

62. The composition of claim 61, comprising the artificial nucleic acid in nanoparticle form or the carrier.

63. The composition of claim 62, wherein the nanoparticles are lipid nanoparticles or liposomes.

64. The composition according to any one of claims 61 to 63, wherein the artificial nucleic acid or the carrier is complexed with a cationic compound.

65. The composition of claim 64, wherein the cationic compound is a cationic lipid.

66. A kit comprising an artificial nucleic acid according to any one of claims 1 to 58, a vector according to claim 59, a cell according to claim 60, or a composition according to any one of claims 61 to 65.

67. An in vitro method for site-specific editing of target RNA, the method comprising contacting the target RNA with an artificial nucleic acid according to any one of claims 1 to 58.

68. The artificial nucleic acid according to claim 1, the vector according to claim 59, the cell according to claim 60, the composition according to claim 61, or the kit according to claim 66, used as a drug.

69. The artificial nucleic acid of claim 1, the vector of claim 59, the cell of claim 60, the composition of claim 61, or the kit of claim 66, for the treatment or prevention of a disease or disorder selected from infectious diseases, tumors, cardiovascular diseases, autoimmune diseases, allergies, and neurological diseases or disorders.

70. The artificial nucleic acid of claim 1, the vector of claim 59, the cell of claim 60, the composition of claim 61, or the kit of claim 66, for the treatment or prevention of a disease or disorder, wherein the treatment or prevention comprises the step of site-specific editing of target RNA.

71. The artificial nucleic acid according to claim 1, the vector according to claim 59, the cell according to claim 60, the composition according to claim 61, or the kit according to claim 66, for the diagnosis of diseases or disorders.

72. The artificial nucleic acid according to claim 71, wherein the disease or disorder is selected from infectious diseases, tumor diseases, cardiovascular diseases, autoimmune diseases, allergies, and neurological diseases or disorders.

Images