Construction of gene editing system for high-fertility, blue-ear-disease-resistant and series of diarrhea disease high-quality pig nuclear transfer donor cells and application thereof

Abstract

The application discloses a high-fertility, blue-ear-disease and series of diarrhea disease high-quality pig nuclear transfer donor cell gene editing system and application. A CRISPR / Cas9 system for pig INHA-CD163-pAPN gene editing comprises a Cas9 expression vector, a gRNA expression vector for a pig INHA gene, a gRNA expression vector for a pig CD163 gene and a gRNA expression vector for a pig pAPN gene; the Cas9 expression vector is a plasmid full sequence as shown in SEQ ID NO. 2. The application designs corresponding gRNA expression vectors for different target points of INHA, CD163 and pAPN genes respectively, and obtains gRNA with higher editing efficiency and its expression vector through screening. The gene editing is carried out by using the Cas9 high-efficiency expression vector modified in the application, and the editing efficiency is significantly improved compared with the original vector.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the CRISPR / Cas9 system for editing the INHA, CD163, and pAPN genes, and its application in constructing high-fertility, resistant porcine reproductive and respiratory syndrome (PRRS) and a series of diarrheal diseases in high-quality porcine nuclear transfer donor cells. Background Technology

[0002] Pigs are among the earliest domesticated livestock in my country and have been an important meat-producing animal for humans throughout history. The Chinese people's love of pork is related to their centuries-old culinary culture. Since 2000, pork has accounted for over 70% of meat consumption in my country, making it the most consumed meat. Currently, my country has over 40 million breeding sows. If each sow could produce one more piglet per litter, assuming two litters per year, my country could reduce the number of sows by 3-4 million, lowering the cost of raising each pig and improving the economic efficiency of pig farming. Porcine reproductive and respiratory syndrome (PRRS), transmissible gastroenteritis (TGE), and porcine epidemic diarrhea (PED) are the most common infectious diseases in intensive pig farming, and these diseases have extremely high mortality rates, causing significant economic losses to pig production. Therefore, developing high-fertility pig breeds resistant to PRRS and PGE will bring greater economic benefits to the pig farming industry.

[0003] One of the key factors influencing piglet litter size is the number of ovulations, which is affected by follicle-stimulating hormone (FSH) levels. FSH secretion is regulated by a gonadal hormone called inhibin. Inhibin has a strong inhibitory effect on FSH secretion; it can feedback-inhibit the release of FSH from the anterior pituitary gland, thereby inhibiting follicle growth and development. Inhibin is a glycoprotein hormone secreted by the gonads, composed of an α subunit and a β subunit. The β subunit has two isoforms: β... A and β B ,αβ A Constitutes Inhibin A,αβ BThe INHA gene, which encodes the Inhibin α subunit, is essential for the physiological function of inhibin. Studies have shown that inhibiting INHA gene expression can promote follicle development and increase ovulation rate. CD163 has been confirmed as a receptor for porcine reproductive and respiratory syndrome virus (PRRSV). The primary interaction with PRRSV occurs through the lidand-binding pocket (LBP) in the SRCR5 domain of the CD163 receptor, located in exon 7 of porcine CD163. Since other parts of the SRCR5 domain still have important biological functions, editing only exon 7 of CD163 can preserve the biological function of CD163 to the maximum extent while disrupting the viral interaction region. Porcine aminopeptidase N (pAPN) has been confirmed as a specific receptor for porcine transmissible gastroenteritis virus (TGEV), and is also a receptor for porcine epidemic diarrhea virus (PEDV) and porcine deltacoronavirus (PDCoV). It is highly expressed on the brush border of the porcine small intestine. Disrupting the pAPN gene inactivates the receptor protein it encodes, rendering TGEV virus unable to infect live pigs, and significantly reducing the infectivity of PEDV and PDCoV in pigs. TGEV and PEDV belong to the genus alpha coronaviruses, while PDCoV belongs to the genus delta coronaviruses; pAPN is the common receptor for these three coronaviruses.

[0004] Gene editing is a biotechnology that has seen significant development in recent years, encompassing everything from homologous recombination-based gene editing to nuclease-based technologies such as ZFN, TALEN, and CRISPR / Cas9. CRISPR / Cas9 technology is currently the most advanced gene editing technology. Therefore, this invention utilizes CRISPR / Cas9 technology to mutate the INHA, CD163, and pAPN genes, obtaining single-cell clones with the combined knockout of these three genes. This lays the foundation for later breeding of high-fertility, resistant to porcine reproductive and respiratory syndrome (PRRS) and a series of diarrheal diseases using somatic cell nuclear transfer animal cloning technology. The loss of function of INHA, CD163, and pAPN can effectively increase the ovulation rate of female cloned pigs, thereby improving their fertility and increasing the economic benefits of pig farming. Furthermore, it can effectively enhance the cloned pigs' resistance to PRRS and a series of diarrheal diseases, reducing pig mortality and minimizing losses in the pig farming industry. Summary of the Invention

[0005] The purpose of this invention is to provide a CRISPR / Cas9 system for editing the INHA-CD163-pAPN gene in pigs.

[0006] Another object of the present invention is to provide applications of the CRISPR / Cas9 system.

[0007] Another object of the present invention is to provide a recombinant cell and its application.

[0008] The objective of this invention can be achieved through the following technical solutions:

[0009] A CRISPR / Cas9 system for editing the porcine INHA-CD163-pAPN gene comprises a Cas9 expression vector, a gRNA expression vector targeting the porcine INHA gene, a gRNA expression vector targeting the porcine CD163 gene, and a gRNA expression vector targeting the porcine pAPN gene. Preferably, the full-length plasmid sequence of the Cas9 expression vector (named pKG-GE3) is shown in SEQ ID NO. 2.

[0010] The Cas9 vector contains nucleotide sequences encoding Cas9 protein, EGFP, and Puro resistance protein. The Cas9 vector further contains an EF1a promoter, a WPRE element, and a 3'LTR sequence element. Preferably, the nucleotide sequence of the Cas9 vector from 5' to 3' is as follows: CMV enhancer, EF1a promoter, nuclear localization signal, nuclear localization signal, nucleotide sequence encoding Cas9 protein, nuclear localization signal, nuclear localization signal, nucleotide sequence encoding self-cleaving polypeptide P2A, nucleotide sequence encoding EGFP, nucleotide sequence encoding self-cleaving polypeptide T2A, nucleotide sequence encoding Puro resistance protein, WPRE sequence element, 3'LTR sequence element, and polyA signal sequence element.

[0011] To enhance the gene editing capability of the Cas9 vector, this invention modifies the pX330-U6-Chimeric_BB-CBh-hSpCas9 (PX330) vector (purchased from addgene (Plasmid #42230, from Zhang Feng lab)) to obtain pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO (i.e., the aforementioned pKG-GE3 vector). The PX330 vector map is shown below. Figure 1 The modification method is as follows:

[0012] 1) Remove redundant and invalid sequences from the original vector gRNA backbone;

[0013] 2) Modify the promoter: Modify the original promoter (chickenβ-actin promoter) to the EF1a promoter with higher expression activity to increase the protein expression capacity of the Cas9 gene;

[0014] 3) Adding a core positioning signal: A core positioning signal encoding sequence (NLS) is added to both the N and C ends of the Cas9 to enhance the core positioning capability of the Cas9;

[0015] 4) Add dual selection markers: The original vector has no selection markers, which is not conducive to the selection and enrichment of positive transformed cells. P2A-EGFP-T2A-PURO is inserted at the C-terminus of Cas9 to endow the vector with fluorescence and resistance selection ability.

[0016] 5) Inserting sequences that regulate gene expression, such as WPRE and 3'LTR: Inserting sequences such as WPRE and 3'LTR at the end of the gene reading frame can enhance the protein translation ability of the Cas9 gene.

[0017] The modified vector pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO (abbreviated as pKG-GE3) and the modification sites are as follows: Figure 2 The complete sequence of the plasmid is shown in SEQ ID NO: 2; the main elements of pKG-GE3 are:

[0018] 1) gRNA expression element: U6 gRNA scaffold;

[0019] 2) Promoters: EF1a promoter and CMV enhancer;

[0020] 3) Cas9 genes containing multiple NLS: Cas9 genes containing N-terminal and C-terminal multinucleus localization signals (NLS);

[0021] 4) Screening marker gene: Fluorescent and resistance dual-selection marker element P2A-EGFP-T2A-PURO;

[0022] 5) Elements that enhance translation: WPRE and 3'LTR enhance the translation efficiency of Cas9 and selection marker genes;

[0023] 6) Transcription termination signal: bGHpolyA signal;

[0024] 7) Vector backbone: including Amp resistance element and ori replicon, etc.

[0025] The plasmid pKG-GE3 contains a specific fusion gene; the specific fusion gene encodes a specific fusion protein;

[0026] The specific fusion protein comprises the following components from N-terminus to C-terminus: two nuclear localization signals (NLS), Cas9 protein, two nuclear localization signals, self-cleaving polypeptide P2A, fluorescent reporter protein, self-cleaving polypeptide T2A, and resistance selection marker protein.

[0027] In plasmid pKG-GE3, the expression of the specific fusion gene is initiated by the EF1a promoter;

[0028] In plasmid pKG-GE3, the downstream of the specific fusion gene has WPRE sequence elements, 3'LTR sequence elements, and bGHpoly(A)signal sequence elements.

[0029] The plasmid pKG-GE3 contains the following elements in sequence: CMV enhancer, EF1a promoter, the specific fusion gene, WPRE sequence element, 3'LTR sequence element, and bGH poly(A)signal sequence element.

[0030] In the specific fusion protein, the two nuclear localization signals upstream of the Cas9 protein are SV40 nuclear localization signals, and the two nuclear localization signals downstream of the Cas9 protein are nucleoplasmin nuclear localization signals.

[0031] In the specific fusion protein, the fluorescent reporter protein may specifically be the EGFP protein.

[0032] The specific fusion protein may include a Puromycin resistance protein as the resistance selection marker protein.

[0033] The amino acid sequence of the self-cleaving polypeptide P2A is “ATNFSLLKQAGDVEENPGP” (the self-cleaving occurs between the first and second amino acid residues starting from the C-terminus).

[0034] The amino acid sequence of the self-cleaving polypeptide T2A is “EGRGSLLTCGDVEENPGP” (the self-cleavage occurs between the first and second amino acid residues starting from the C-terminus).

[0035] The specific fusion gene is shown as nucleotides 911-6706 in SEQ ID NO: 2.

[0036] The CMV enhancer is shown as nucleotides 395-680 in SEQ ID NO: 2.

[0037] The EF1a promoter is shown as nucleotides 682-890 in SEQ ID NO: 2.

[0038] The WPRE sequence element is shown as nucleotides 6722-7310 of SEQ ID NO: 2.

[0039] The 3'LTR sequence element is shown as nucleotides 7382-7615 in SEQ ID NO: 2.

[0040] The bGH poly(A)signal sequence element is shown as nucleotides 7647-7871 in SEQ ID NO: 2.

[0041] Preferably, the pKG-GE3 plasmid is a circular plasmid.

[0042] As a preferred embodiment of the present invention, in the CRISPR / Cas9 system, the vector backbones of the gRNA expression vectors for the porcine INHA gene, the porcine CD163 gene, and the porcine pAPN gene are all pKG-U6gRNA, and their full plasmid sequences are shown in SEQ ID NO.3.

[0043] As a further preferred embodiment of the present invention, the gRNA expression vector targeting the porcine INHA gene expresses the gRNA shown in SEQ ID NO.18, the target of which is shown in SEQ ID NO.15; the gRNA expression vector targeting the porcine CD163 gene expresses the gRNA shown in SEQ ID NO.24, the target of which is shown in SEQ ID NO.21; and the gRNA expression vector targeting the porcine pAPN gene expresses the gRNA shown in SEQ ID NO.30, the target of which is shown in SEQ ID NO.27.

[0044] As a further preferred embodiment of the present invention, the gRNA expression vector targeting the porcine INHA gene is obtained from a double-stranded insert vector backbone pKG-U6gRNA formed by annealing single-stranded DNA as shown in SEQ ID NO. 16 and SEQ ID NO. 17; the gRNA expression vector targeting the porcine CD163 gene is obtained from a double-stranded insert vector backbone pKG-U6gRNA formed by annealing single-stranded DNA as shown in SEQ ID NO. 22 and SEQ ID NO. 23; and the gRNA expression vector targeting the porcine pAPN gene is obtained from a double-stranded insert vector backbone pKG-U6gRNA formed by annealing single-stranded DNA as shown in SEQ ID NO. 28 and SEQ ID NO. 29.

[0045] The application of the CRISPR / Cas9 system described in this invention in constructing recombinant porcine cells with mutations in the INHA, CD163, and pAPN genes.

[0046] A recombinant cell, obtained by co-transfection of porcine primary fibroblasts with the CRISPR / Cas9 system described in this invention and subsequently validated.

[0047] The application of the recombinant cells described in this invention in the construction of cloned pigs with INHA, CD163 and pAPN gene knockout.

[0048] A gRNA expression vector targeting the porcine INHA gene, which expresses the gRNA shown in SEQ ID NO.18, and whose vector backbone is pKG-U6gRNA, with the full sequence of the plasmid shown in SEQ ID NO.3.

[0049] A gRNA expression vector targeting the porcine CD163 gene, which expresses the gRNA shown in SEQ ID NO.24, and whose vector backbone is pKG-U6gRNA, with the full sequence of the plasmid shown in SEQ ID NO.3.

[0050] A gRNA expression vector targeting the porcine pAPN gene, which expresses the gRNA shown in SEQ ID NO.30, and whose vector backbone is pKG-U6gRNA, with the full sequence of the plasmid shown in SEQ ID NO.3.

[0051] Compared with the prior art, the present invention has at least the following beneficial effects:

[0052] (1) The research object of this invention (pig) has better applicability than other animals (mice, mice, primates).

[0053] Rodents such as mice and rats differ greatly from humans in body size, organ size, physiology, and pathology, making it impossible to realistically simulate normal human physiological and pathological states. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but they are small, reach sexual maturity late (mating begins at 6-7 years old), and are single-birth animals, resulting in extremely slow population expansion and high rearing costs. Furthermore, primate cloning is inefficient, difficult, and costly.

[0054] Pigs, as model animals, do not have the aforementioned drawbacks. Pigs are the closest relatives to humans besides primates, and their body size, weight, and organ size are similar to humans. They are also remarkably similar to humans in anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis. Furthermore, pigs reach sexual maturity early (4-6 months), have high reproductive capacity, produce multiple offspring per litter, and can form a large herd within 2-3 years. In addition, pig cloning technology is very mature, and the costs of cloning and raising pigs are much lower than for primates. Therefore, pigs are very suitable animals to serve as human disease models.

[0055] (2) The pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector modified in this invention, compared to the original pX330 vector, has a stronger promoter and added elements to enhance protein translation, thus improving Cas9 expression and increasing the number of nuclear localization signals, thereby enhancing the nuclear localization ability of the Cas9 protein and achieving higher gene editing efficiency. This invention also incorporates fluorescent and antibiotic markers into the vector, making it easier to use for screening and enriching vector-positive transformed cells. Gene editing using the gRNA-modified Cas9 high-efficiency expression vector selected in this invention achieves an editing efficiency more than 100% higher than the original vector.

[0056] (3) This invention designs corresponding expression vectors for gRNAs targeting different sites of the INHA, CD163, and pAPN genes, and obtains gRNAs and their expression vectors with high editing efficiency through screening. When used in conjunction with the modified Cas9 high-efficiency expression vector of this invention for gene editing, the genotype of the obtained cells can be analyzed through sequencing of the target gene PCR products. The probability of obtaining a single target gene mutation is 21%-41%, which is significantly better than the probability of obtaining mutations using gene editing delivery methods using embryo injection technology (i.e., injecting gene editing materials into fertilized eggs).

[0057] (4) Using the mutant single-cell clone obtained by the present invention to perform somatic cell nuclear transfer animal cloning, cloned pigs containing target gene mutations can be directly obtained, and the mutation can be stably inherited.

[0058] This invention employs a technically challenging method of in vitro editing of primary cells and screening for positive edited single-cell clones. Subsequently, the corresponding gene-edited pigs are directly obtained through somatic cell nuclear transfer animal cloning technology, which can greatly shorten the production cycle of gene-edited pigs and save manpower, material resources, and financial resources. Attached Figure Description

[0059] Figure 1 This is a schematic diagram of the structure of plasmid pX330.

[0060] Figure 2 This is a schematic diagram of the structure of plasmid pU6gRNACas9.

[0061] Figure 3 The structural map of the pU6gRNA-eEF1a Cas9 vector.

[0062] Figure 4 Map of the pU6gRNA-eEF1a Cas9+nNLS vector.

[0063] Figure 5 This is a schematic diagram of the structure of plasmid pKG-GE3.

[0064] Figure 6 This is a schematic diagram of the structure of plasmid pKG-U6gRNA.

[0065] Figure 7 This is a schematic diagram of inserting a DNA molecule of about 20 bp (the target sequence binding region for transcription into gRNA) into the plasmid pKG-U6gRNA.

[0066] Figure 8 This is the sequencing peak diagram from step 2.3.3 in Example 2.

[0067] Figure 9 This is the sequencing peak diagram from step 2.4.3 in Example 2.

[0068] Figure 10 This is an electrophoresis image of the PCR amplification performed in step 3.1 of Example 3 using genomic DNA from 18 pigs as a template and primers consisting of INHA-E2-JDF178 / INHA-E2-JDR654.

[0069] Figure 11 This is the sequencing peak diagram from step 3.4 of Example 3.

[0070] Figure 12 This is an electrophoresis image of the PCR amplification performed in step 4.1 of Example 4 using genomic DNA from 18 pigs as a template and primers consisting of CD163-JDF121 / CD163-JDR518.

[0071] Figure 13 This is the sequencing peak diagram from step 4.4 of Example 4.

[0072] Figure 14 This is an electrophoresis image of the PCR amplification performed in step 5.1 of Example 5 using genomic DNA from 18 pigs as a template and primers consisting of APN-JDF94 / APN-JDR656.

[0073] Figure 15 This is the sequencing peak diagram from step 5.4 of Example 5.

[0074] Figure 16 This is an electrophoresis image of the PCR amplification performed in step 6.4.4 of Example 6 using genomic DNA as a template with primers consisting of INHA-E2-JDF178 / INHA-E2-JDR654.

[0075] Figure 17 This is an electrophoresis image of the PCR amplification performed in step 6.4.4 of Example 6 using genomic DNA as a template with primers consisting of CD163-JDF121 / CD163-JDR518.

[0076] Figure 18 This is an electrophoresis image of the PCR amplification performed in step 6.4.4 of Example 6 using genomic DNA as a template with primers consisting of APN-JDF94 / APN-JDR656.

[0077] Figure 19 This is an exemplary sequencing peak diagram for step 6.4.5.1 in Example 6, which determines that the target gene is wild-type.

[0078] Figure 20 This is an exemplary sequencing peak diagram from step 6.4.5.1 of Example 6, which determines that the target gene is a heterozygous mutant.

[0079] Figure 21 This is an exemplary sequencing peak diagram for step 6.4.5.1 in Example 6, which determines that the target gene is a homozygous mutant with identical biallelic variants.

[0080] Figure 22 This is an exemplary sequencing peak diagram for step 6.4.5.1 in Example 6, which determines that the target gene is a homozygous mutant with different biallelic variants.

[0081] Figure 23 This is an exemplary sequencing peak diagram for determining the target gene as wild-type in step 6.4.5.2 of Example 6.

[0082] Figure 24 This is an exemplary sequencing peak diagram from step 6.4.5.2 of Example 6, which determines that the target gene is a heterozygous mutant.

[0083] Figure 25 This is an exemplary sequencing peak diagram of step 6.4.5.2 in Example 6, which determines that the target gene is a homozygous mutant with identical biallelic variants.

[0084] Figure 26 This is an exemplary sequencing peak diagram for step 6.4.5.2 in Example 6, which determines that the target gene is a homozygous mutant with different biallelic variations.

[0085] Figure 27 This is an exemplary sequencing peak diagram from step 6.4.5.3 of Example 6, which shows the determination that the target gene is wild-type.

[0086] Figure 28 This is an exemplary sequencing peak diagram from step 6.4.5.3 of Example 6, which shows the determination that the target gene is a heterozygous mutant.

[0087] Figure 29 This is an exemplary sequencing peak diagram of step 6.4.5.3 in Example 6, which determines that the target gene is a homozygous mutant with identical biallelic variants.

[0088] Figure 30 This is an exemplary sequencing peak diagram for step 6.4.5.3 in Example 6, which determines that the target gene is a homozygous mutant with different biallelic variants. Detailed Implementation

[0089] Example 1: Construction of plasmids

[0090] 1.1 Construction of plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (pKG-GE3 for short)

[0091] The original plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (referred to as plasmid pX330) has the sequence shown in SEQ ID NO.1. A schematic diagram of the structure of plasmid pX330 is shown below. Figure 1 In SEQ ID NO.1, nucleotides 440-725 form the CMV enhancer, nucleotides 727-1208 form the chicken β-actin promoter, nucleotides 1304-1324 encode the SV40 nuclear localization signal (NLS), nucleotides 1325-5449 encode the Cas9 protein, and nucleotides 5450-5497 encode the nucleoplasmin nuclear localization signal (NLS).

[0092] plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO ( Figure 5 The plasmid pKG-GE3, abbreviated as pKG-GE3, has the nucleotides shown in SEQ ID NO.2. Compared with plasmid pX330, plasmid pKG-GE3 has undergone the following modifications: ① Removal of the residual gRNA backbone sequence (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTT) to reduce interference; ② Modification of the original chicken β-actin promoter to the EF1a promoter with higher expression activity to increase the protein expression capacity of the Cas9 gene; ③ Addition of nuclear localization signal encoding genes (NLS) upstream and downstream of the Cas9 gene to increase the nuclear localization capacity of the Cas9 protein; ④ The original plasmid lacked any eukaryotic cell selection markers, which was not conducive to the selection and enrichment of positive transformed cells. The P2A-EGFP-T2A-PURO encoding gene was inserted downstream of the Cas9 gene to endow the vector with fluorescence and eukaryotic cell resistance selection capabilities; ⑤ Insertion of WPRE elements and 3'LTR sequence elements to enhance the protein translation capacity of the Cas9 gene.

[0093] The pKG-GE3 plasmid construction method is as follows:

[0094] (1) Remove redundant and invalid sequences from the gRNA backbone.

[0095] Plasmid pX330 was digested with BbsI and XbaI enzymes, and the vector fragment (approximately 8313 bp) was recovered. An insert fragment of 175 bp (SEQ ID NO.4) was synthesized using a multi-fragment recombination method, and recombined with the recovered vector fragment to obtain the pU6gRNACas9 vector. Figure 2 ).

[0096] (2) Modification of promoter and enhancer

[0097] The constructed pU6gRNACas9 vector was subjected to XbaI and AgeI restriction enzymes to remove the promoter (chicken β-actin promoter) and enhancer sequence (CMV enhancer). Approximately 7650 bp of the linear vector sequence was recovered, and a 554 bp sequence containing the CMV enhancer and EF1a promoter (SEQ ID NO. 5) was synthesized using a multi-fragment recombination method. This sequence was then recombined with the enzyme-digested pU6gRNACas9 vector to obtain the pU6gRNA-eEF1aCas9 vector. Figure 3 ).

[0098] (3) Adding an NLS sequence to the N-terminus of the Cas9 gene

[0099] The constructed vector pU6gRNA-eEF1a Cas9 was digested with AgeI and BglII enzymes, and the 7786bp vector sequence was recovered. The NLS-added sequence was then added to the restriction sites, resulting in the synthesis of a 447bp Cas9 coding sequence (SEQ ID NO. 6) including two nuclear localization signals and a partially excised sequence, using a multi-fragment recombination method. This resulted in the pU6gRNA-eEF1a Cas9+nNLS vector. Figure 4 ).

[0100] (4) Add NLS, P2A-EGFP-T2A-PURO, and WPRE-3'LTR-bGH polyA signal to the C-terminus of the Cas9 gene.

[0101] The constructed vector was named pU6gRNA-eEF1aCas9+nNLS. After digestion with FseI and SbfI, the 7781bp vector sequence was recovered. A 2727bp fragment (SEQ ID NO. 7) including the NLS-P2A-EGFP-T2A-PURO-WPRE-3'LTR-bGH polyA signal was synthesized using a multi-fragment recombination method. This fragment was then recombinated with the original vector fragment to obtain the vector pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO, abbreviated as pKG-GE3. The plasmid map is shown below. Figure 5 , nucleotide sequence (SEQ ID NO.2).

[0102] In SEQ ID NO: 2, nucleotides 395-680 form the CMV enhancer, nucleotides 682-890 form the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), nucleotides 5276-5332 encode the self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the self-cleavage occurs between the first and second amino acid residues starting from the C-terminus), nucleotide 533... Nucleotides 3-6046 encode the EGFP protein; nucleotides 6056-6109 encode the self-cleaving polypeptide T2A (the amino acid sequence of self-cleaving polypeptide T2A is “EGRGSLLTCGDVEENPGP”, and the self-cleavage occurs between the first and second amino acid residues starting from the C-terminus); nucleotides 6110-6703 encode the Puromycin protein (abbreviated as Puro protein); nucleotides 6722-7310 form the WPRE sequence element; nucleotides 7382-7615 form the 3'LTR sequence element; and nucleotides 7647-7871 form the bGH poly(A)signal sequence element. In SEQ ID NO.2, nucleotides 911-6706 form the fusion gene, expressing the fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms three proteins: a protein containing Cas9 protein, a protein containing EGFP protein, and a protein containing Puro protein.

[0103] 1.2 Construction of pKG-U6gRNA vector

[0104] The pKG-U6 gRNA vector was derived from the pUC57 vector. A DNA fragment containing the U6 promoter, BbsI restriction site, and sgRNA backbone sequence (as shown in SEQ ID NO. 8) was ligated into the pUC57 vector via the EcoRV restriction site. This resulted in the full-length pKG-U6 gRNA vector sequence (SEQ ID NO. 3). In SEQ ID NO. 3, nucleotides 2280-2539 form the hU6 promoter, and nucleotides 2558-2637 are used for transcription to form the gRNA backbone. During use, approximately 20 bp of DNA (for transcription to form the target sequence binding region of the gRNA) is inserted... Figure 7 Insert plasmid pKG-U6gRNA ( Figure 6This process forms a recombinant plasmid, which is then transcribed into gRNA in the cell.

[0105] Example 2: Optimization of plasmid ratio and comparison of the effects of plasmid pX330 and plasmid pKG-GE3

[0106] 2.1 Design and Construction of Target gRNA

[0107] 2.1.1 Design of target gRNAs for the RAG1 gene using Benchling

[0108] RAG1-g4: AGTTATGGCAGAACTCAGTG (SEQ ID NO.9)

[0109] The following is a synthesized DNA oligo containing the insert sequence complementary to the above-mentioned RAG1 gene target:

[0110] RAG1-gRNA4S: caccgAGTTATGGCAGAACTCAGTG (SEQ ID NO.10)

[0111] RAG1-gRNA4A: aaacCACTGAGTTCTGCCATAACTc (SEQ ID NO.11)

[0112] Both RAG1-gRNA4S and RAG1-gRNA4A are single-stranded DNA molecules.

[0113] 2.1.2 Design primers for amplifying and detecting fragments containing the RAG1 gRNA target.

[0114] RAG1-nF126:CCCCATCCAAAGTTTTTAAAGGA

[0115] RAG1-nR525: TGTGGCAGATGTCACAGTTTAGG

[0116] 2.1.3 Construction and Cloning of GRNA Recombinant Vectors

[0117] 1) Digest 1 μg pKG-U6g RNA plasmid with restriction endonuclease BbsI;

[0118] 2) The pKG-U6gRNA plasmid digested by the enzyme was separated by running on an agarose gel (1% agarose gel concentration, i.e., 1g of agarose gel added to 100mL of electrophoresis buffer), and the digested products were purified and recovered using a gel recovery kit (Vazyme).

[0119] 3) The two complementary DNA oligos synthesized for the target site described in 2.1.1 are annealed using the following procedure to form a DNA double strand complementary to the sticky ends of the pKG-U6gRNA vector after BbsI restriction, as illustrated below. Figure 7 :

[0120] 95℃ for 5 min, then decrease to 25℃ at a rate of 5℃ / min;

[0121] 4) Initiate the connection reaction according to the following system: react at room temperature for 10 min.

[0122]

[0123] 5) Transformation

[0124] Follow the instructions for use of competent cells (Vazyme).

[0125] 2.1.4 Construction of gRNA vector

[0126] 1) The synthesized RAG1-gRNA4S and RAG1-gRNA4A were mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. This double-stranded DNA molecule with sticky ends was ligated to a vector backbone to obtain the plasmid pKG-U6gRNA (RAG1-gRNA4). The plasmid pKG-U6gRNA (RAG1-gRNA4) will express RAG1-gRNA4 as shown in SEQ ID NO. 12.

[0127] 2.1.5 Identification of gRNA vectors

[0128] Single clones were picked from LB plates and placed into LB culture medium containing the corresponding antibiotics. After culturing in a shaker at 37°C for 12-16 hours, plasmids were extracted and sent to General Electric for sequencing. Sequence alignment confirmed that the RAG1-gRNA4 vector was successfully constructed.

[0129] 2.2 Preparation of primary porcine fibroblasts

[0130] 2.2.1 Take 0.5g of newly hatched Congjiang Xiang pig ear tissue, remove hair and bone tissue, and soak in 75% alcohol for 30-40 seconds;

[0131] 2.2.2 Wash 5 times with PBS containing 5% P / S (Gibco Penicillin-Streptomycin), and wash once with PBS without P / S;

[0132] The 5% P / S PBS formulation is: 5% P / S (Gibco Penicillin-Streptomycin) + 95% PBS, where 5% and 95% are volume percentages.

[0133] 2.2.3 Cut the tissue into small pieces with scissors, add 5 mL of 0.1% collagenase (Sigma) solution, and digest in a shaker at 37°C for 1 hour;

[0134] 2.2.4 Centrifuge at 500g for 5 min, remove the supernatant, resuspend the precipitate in 1 mL of complete culture medium, and transfer it into a 10 cm cell culture dish containing 10 mL of complete culture medium and sealed with 0.2% gelatin (VWR).

[0135] The complete cell culture medium was formulated as follows: 15% fetal bovine serum (Gibco) + 83% DMEM medium.

[0136] (Gibco) + 1% P / S (Gibco Penicillin-Streptomycin) + 1% HEPES (Solarbio), where 15%, 83%, 1%, and 1% are volume percentages.

[0137] 2.2.5 Incubate at 37℃ in a constant temperature incubator containing 5% CO2 (volume percentage) and 5% O2 (volume percentage);

[0138] 2.2.6 When the cells reach approximately 60% confluency in the dish, digest them with 0.25% (Gibco) trypsin. Then, add complete culture medium to stop the digestion. Transfer the cell suspension to a 15mL centrifuge tube, centrifuge at 400g for 4 minutes, discard the supernatant, and obtain the cell pellet for the next cell transfection experiment.

[0139] 2.3 Plasmid ratio optimization

[0140] 2.3.1 Co-transfection grouping

[0141] Group 1: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.44 μg plasmid pKG-U6gRNA (RAG1-gRNA4) : 1.56 μg plasmid pKG-GE3. That is, the molar ratio of plasmid pKG-U6gRNA (RAG1-gRNA4) to plasmid pKG-GE3 was 1:1.

[0142] Group 2: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.72 μg plasmid pKG-U6gRNA (RAG1-gRNA4) : 1.28 μg plasmid pKG-GE3. That is, the molar ratio of plasmid pKG-U6gRNA (RAG1-gRNA4) to plasmid pKG-GE3 was 2:1.

[0143] Group 3: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (RAG1-gRNA4) : 1.08 μg plasmid pKG-GE3. That is, the molar ratio of plasmid pKG-U6gRNA (RAG1-gRNA4) to plasmid pKG-GE3 was 3:1.

[0144] Group 4: Transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (RAG1-gRNA4). Quantity: Approximately 200,000 porcine primary fibroblasts: 1 μg plasmid pKG-U6gRNA (RAG1-gRNA4).

[0145] 2.3.2 Co-transfection procedure

[0146] Transfection experiments were performed using the Neomyoblast nuclear transfection kit and the Neom™ transfection system.

[0147] 1) Prepare the electroporation DNA solution according to the above grouping, and be careful not to generate air bubbles during the mixing process;

[0148] 2) Wash the cell pellet prepared in 2.2.6 above with 1 ml PBS phosphate buffer (Solarbio) and transfer it to a 1.5 ml centrifuge tube. Centrifuge at 600 g for 6 min, discard the supernatant, and resuspend the cells in 11 μL of Opti-MEM electroporation basic solution. Avoid the generation of air bubbles during the resuspending process.

[0149] 3) Take 10 μL of cell suspension and add it to the electroporation DNA solution in step 1) and mix well. Be careful not to generate air bubbles during the mixing process.

[0150] 4) Place the electroporation cup provided with the kit into the cup holder of the Neon™ transfection system, and add 3 mL of Buffer E;

[0151] 5) Use an electroporator to draw 10 μL of the mixture obtained in step 3), insert it into the electroporation cup, select the electroporation program (1450V 10ms 3pulse), and immediately after electroporation, transfer the mixture from the electroporator into a 6-well plate in a clean bench. Each well contains 3 mL of complete culture medium (15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% P / S (Gibco Penicillin-Streptomycin) + 1% HEPES (Solarbio)).

[0152] 6) After mixing, place in a constant temperature incubator at 37℃ with 5% CO2 and 5% O2 for incubation;

[0153] 7) Change the medium 12-18 h after electroporation, and digest the cells with 0.25% (Gibco) trypsin 36-48 h and collect the cells in a 1.5 mL centrifuge tube.

[0154] 2.3.3 Gene Editing Efficiency Analysis

[0155] Genomic DNA was extracted from the cells collected in section 2.3.2 and amplified by PCR using primers consisting of RAG1-nF126 and RAG1-nR525. The products were then sequenced. Analysis of the sequencing peaks using the web-based Synthego ICE tool revealed editing efficiencies of 9%, 53%, and 66% for the first, second, and third groups, respectively. An example peak diagram of the sequencing results is shown below. Figure 8 Analysis determined that the third group had the highest gene editing efficiency, meaning the optimal molar ratio of gRNA plasmid to Cas9 plasmid was 3:1, with an actual plasmid dosage of 0.92 μg: 1.08 μg.

[0156] 2.4 Comparison of the effects of plasmid pX330 and plasmid pKG-GE3

[0157] 2.4.1 Co-transfection grouping

[0158] RAG1-330 group: porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pX330. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (RAG1-gRNA4): 1.08 μg plasmid pX330, with a molar ratio of pKG-U6gRNA (RAG1-gRNA4) to pX330 of 3:1.

[0159] RAG1-KG group: porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (RAG1-gRNA4): 1.08 μg plasmid pKG-GE3, with a molar ratio of pKG-U6gRNA (RAG1-gRNA4) to pKG-GE3 of 3:1.

[0160] Group RAG1-B: Porcine primary fibroblasts were transfected with plasmid pKG-U6gRNA (RAG1-gRNA4). The ratio was approximately 200,000 porcine primary fibroblasts to 0.92 μg of plasmid pKG-U6gRNA (RAG1-gRNA4).

[0161] 2.4.2 Co-transfection procedure

[0162] Same as 2.3.2 in this embodiment.

[0163] 2.4.3 Gene Editing Efficiency Analysis

[0164] Genomic DNA was extracted from the cells collected in section 2.4.2 and amplified by PCR using primers consisting of RAG1-nF126 and RAG1-nR525. The products were then sequenced. Analysis of the sequencing peaks using the web-based Synthego ICE tool revealed editing efficiencies of 28% and 68% for the RAG1-330 and RAG1-KG groups, respectively. An example peak diagram of the sequencing results is shown below. Figure 9 The results showed that using plasmid pKG-GE3 significantly improved gene editing efficiency compared to using plasmid pX330.

[0165] Example 3: Screening for highly efficient INHA gene gRNA targets

[0166] Information on the porcine INHA gene: Encoding the inhibitor subunit alpha protein; located on porcine chromosome 5; GeneID 397386, Sus scrofa. The protein encoded by the porcine INHA gene is shown in GENBANK ACCESSION NO.XP_020930352.1 (linear CON 12-JAN-2018), and its amino acid sequence is shown in SEQ ID NO.13. In the genomic DNA, the porcine INHA gene has two exons, and the sequence of the second exon and its upstream and downstream 100 bp sequences are shown in SEQ ID NO.14.

[0167] 3.1 Conservation analysis of INHA gene knockout target sites and adjacent genomic sequences

[0168] Eighteen newborn Congjiang Xiang pigs were selected, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10) and 8 males (named A, B, C, D, E, F, G, and H).

[0169] Using genomic DNA from 18 pigs as templates, PCR amplification was performed using primer pairs (the target sequences of the primer pairs included exon 2 of the porcine INHA gene), followed by electrophoresis. The PCR amplification products were recovered and sequenced, and the sequencing results were compared with INHA gene sequences in public databases. Based on the alignment results, primers for detecting mutations were designed (the primers themselves avoided potential mutation sites). The designed primers for mutation detection were: INHA-E2-JDF178 / INHA-E2-JDR654. The electrophoresis images of the PCR amplification of genomic DNA from 18 pigs using the primer pairs INHA-E2-JDF178 / INHA-E2-JDR654 are shown below. Figure 10 .

[0170] INHA-E2-JDF178: 5'-CTGCGCTGTCCTCTCTGTTC-3';

[0171] INHA-E2-JDR654: 5'-AGTGCTGGGTGAGAAGGTTG-3'.

[0172] 3.2 Design and Construction of Target gRNA

[0173] Several targets were initially screened by NGG (avoiding possible mutation sites), and four targets were further screened out after preliminary experiments.

[0174] The four target points are as follows:

[0175] sgRNA INHA-E2-g1 Target: 5'-CCTCTGCAGCAGGCGCAGCG-3' (SEQ ID NO.15);

[0176] sgRNA INHA-E2-g2 Target: 5'-CCTGCTGCAGAGGCCCCCGG-3';

[0177] sgRNA INHA-E2-g3 Target: 5'-GTGGCAGTCGGCGTGCACAG-3';

[0178] sgRNA INHA-E2-g4 Target: 5'-AGATGTTGAGGGAAGCTCTG-3'.

[0179] The complementary DNA oligos for the insertion sequences at four target sites of the synthesized INHA gene are as follows:

[0180] INHA-E2-gRNA1-S: 5'-caccgCCTCTGCAGCAGGCGCAGCG-3' (SEQ ID NO. 16);

[0181] INHA-E2-gRNA1-A: 5'-aaacCGCTGCGCCTGCTGCAGAGGc-3' (SEQ ID NO. 17);

[0182] INHA-E2-gRNA2-S: 5'-caccgCCTGCTGCAGAGGCCCCCGG-3';

[0183] INHA-E2-gRNA2-A: 5'-aaacCCGGGGGCCTCTGCAGCAGGc-3';

[0184] INHA-E2-gRNA3-S: 5'-caccGTGGCAGTCGGCGTGCACAG-3';

[0185] INHA-E2-gRNA3-A: 5'-aaacCTGTGCACGCCGACTGCCAC-3';

[0186] INHA-E2-gRNA4-S: 5'-caccgAGATGTTGAGGGAAGCTCTG-3';

[0187] INHA-E2-gRNA4-A: 5'-aaacCAGAGCTTCCCTCAACATCTc-3'.

[0188] INHA-E2-gRNA1-S, INHA-E2-gRNA1-A, INHA-E2-gRNA2-S, INHA-E2-gRNA2-A, INHA-E2-gRNA3-S, INHA-E2-gRNA3-A, INHA-E2-gRNA4-S, and INHA-E2-gRNA4-A are all single-stranded DNA molecules.

[0189] 3.3 Preparation of gRNA recombinant plasmids

[0190] The pKG-U6gRNA plasmid was digested with the restriction endonuclease BbsI, and the vector backbone (a large linear fragment of about 3kb) was recovered.

[0191] INHA-E2-gRNA1-S and INHA-E2-gRNA1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(INHA-E2-g1). Plasmid pKG-U6gRNA(INHA-E2-g1) expresses the sgRNA shown in SEQ ID NO.18.INHA-E2-g1 ,

[0192] CCUCUGCAGCAGGCGCAGCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu(SEQ ID NO.18). INHA-E2-gRNA2-S and INHA-E2-gRNA2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(INHA-E2-g2). Plasmid pKG-U6gRNA(INHA-E2-g2) expresses sgRNA. INHA-E2-g2 sgRNA INHA-E2-g2 The sequence is as follows:

[0193] CCUGCUGCAGAGGCCCCCGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu.

[0194] INHA-E2-gRNA3-S and INHA-E2-gRNA3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. This sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain the plasmid pKG-U6gRNA(INHA-E2-g3). The plasmid pKG-U6gRNA(INHA-E2-g3) expressed sgRNA. INHA-E2-g3 sgRNA INHA-E2-g3 The sequence is as follows:

[0195] GUGGCAGUCGGCGUGCACAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu.

[0196] INHA-E2-gRNA4-S and INHA-E2-gRNA4-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. This sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain the plasmid pKG-U6gRNA(INHA-E2-g4). The plasmid pKG-U6gRNA(INHA-E2-g4) expresses sgRNA. INHA-E2-g4 sgRNAINHA-E2-g4 The sequence is as follows:

[0197] AGAUGUUGAGGGAAGCUCUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggc accgagucggugcuuuu.

[0198] 3.4 Comparison of editing efficiency of gRNA targeting different sites in the INHA gene

[0199] Primary porcine fibroblasts were prepared from ear tissue of newborn Congjiang Xiang pigs (female, blood type AO).

[0200] 1. Co-transfection

[0201] Group 1: Porcine primary fibroblasts were co-transfected with plasmids pKG-U6gRNA (INHA-E2-g1) and pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg pKG-U6gRNA (INHA-E2-g1) : 1.08 μg pKG-GE3. The molar ratio of pKG-U6gRNA (INHA-E2-g1) to pKG-GE3 was 3:1.

[0202] Group 2: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (INHA-E2-g2) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg pKG-U6gRNA (INHA-E2-g2) : 1.08 μg pKG-GE3. The molar ratio of pKG-U6gRNA (INHA-E2-g2) to pKG-GE3 was 3:1.

[0203] Group 3: Porcine primary fibroblasts were co-transfected with plasmids pKG-U6gRNA (INHA-E2-g3) and pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg pKG-U6gRNA (INHA-E2-g3) : 1.08 μg pKG-GE3. The molar ratio of pKG-U6gRNA (INHA-E2-g3) to pKG-GE3 was 3:1.

[0204] Group 4: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (INHA-E2-g4) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (INHA-E2-g4) : 1.08 μg of plasmid pKG-GE3. The molar ratio of pKG-U6gRNA (INHA-E2-g4) to pKG-GE3 was 3:1.

[0205] Group 5: Porcine primary fibroblasts, electroporated without plasmids using the same electroporation parameters.

[0206] Co-transfection was performed using electroporation. The transfection was carried out using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3pulse).

[0207] 2. After completing step 1, incubate in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total incubation time is 48 hours.

[0208] 3. After completing step 2, cells were digested and collected using trypsin. Cells were then lysed and genomic DNA extracted. PCR amplification was performed using primers consisting of INHA-E2-JDF178 and INHA-E2-JDR654, followed by 1% agarose gel electrophoresis. The target fragment was recovered and sequenced. The sequencing peak diagram is shown below. Figure 11 The gene editing efficiency of different targets was determined by analyzing the sequencing peaks using the Synthego ICE tool. The gene editing efficiencies of groups one through four were 62%, 5%, 8%, and 1%, respectively. No gene editing occurred in group five. The results indicate that group one had the highest editing efficiency, with sgRNA... INHA-E2-g1 The target point is the optimal target point.

[0209] Example 4: Screening for highly efficient CD163 gene gRNA targets

[0210] Porcine CD163 gene information: Encodes the CD163 molecule protein; located on porcine chromosome 5; GeneID is 397031, Sus scrofa. The protein encoded by the porcine CD163 gene is shown in GENBANK ACCESSION NO.XP_020946779.1(linear CON 12-JAN-2018), and its amino acid sequence is shown in SEQ ID NO.19. In the genomic DNA, the porcine CD163 gene has 18 exons, of which exon 7 and its upstream and downstream 400 bp sequences are shown in SEQ ID NO.20.

[0211] 4.1 Conservation analysis of CD163 gene knockout target sites and adjacent genomic sequences

[0212] Eighteen newborn Congjiang Xiang pigs were selected, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10) and 8 males (named A, B, C, D, E, F, G, and H).

[0213] Using genomic DNA from 18 pigs as templates, PCR amplification was performed using primer pairs (the target sequences of the primer pairs included exon 7 of the porcine CD163 gene), followed by electrophoresis. The PCR amplification products were recovered and sequenced, and the sequencing results were compared with CD163 gene sequences in public databases. Based on the alignment results, primers for detecting mutations were designed (the primers themselves avoided potential mutation sites). The designed primers for detecting mutations were CD163-JDF121 / CD163-JDR518. The electrophoresis images of the PCR amplification of genomic DNA from 18 pigs using the CD163-JDF121 / CD163-JDR518 primer pairs are shown below. Figure 12 .

[0214] CD163-JDF121: 5'-GAATCGGCTAAGCCCACTGTA-3';

[0215] CD163-JDR518: 5'-ACTGGGCAGAGTGAAAGGTG-3'.

[0216] 4.2 Design and Construction of Target gRNA

[0217] Several targets were initially screened by NGG (avoiding possible mutation sites), and four targets were further screened out after preliminary experiments.

[0218] The four target points are as follows:

[0219] sgRNA CD163-E7-g1 Target: 5'-GGAACTACAGTGCGGCACTG-3';

[0220] sgRNA CD163-E7-g2 Target: 5'-GGTCGTGTTGAAGTACAACA-3' (SEQ ID NO.21);

[0221] sgRNA CD163-E7-g3 Target: 5'-GTACAACATGGAGACACGTG-3';

[0222] sgRNA CD163-E7-g4Target: 5'-ACTGTGGTTTCCCTCCTGGG-3'.

[0223] The complementary DNA oligos for the insertion sequences at four target sites of the synthesized CD163 gene are as follows:

[0224] CD163-E7-gRNA1-S: 5'-caccGGAACTACAGTGCGGCACTG-3';

[0225] CD163-E7-gRNA1-A: 5'-aaacCAGTGCCGCACTGTAGTTCC-3';

[0226] CD163-E7-gRNA2-S: 5'-caccGGTCGTGTTGAAGTACAACA-3' (SEQ ID NO. 22);

[0227] CD163-E7-gRNA2-A: 5'-aaacTGTTGTACTTCAACACGACC-3' (SEQ ID NO. 23);

[0228] CD163-E7-gRNA3-S: 5'-caccGTACAACATGGAGACACGTG-3';

[0229] CD163-E7-gRNA3-A: 5'-aaacCACGTGTCTCCATGTTGTAC-3';

[0230] CD163-E7-gRNA4-S: 5'-caccgACTGTGGTTTCCCTCCTGGG-3';

[0231] CD163-E7-gRNA4-A: 5'-aaacCCCAGGAGGGAAACCACAGTc-3'.

[0232] CD163-E7-gRNA1-S, CD163-E7-gRNA1-A, CD163-E7-gRNA2-S, CD163-E7-gRNA2-A, CD163-E7-gRNA3-S, CD163-E7-gRNA3-A, CD163-E7-gRNA4-S, and CD163-E7-gRNA4-A are all single-stranded DNA molecules.

[0233] 4.3 Preparation of gRNA recombinant plasmids

[0234] The pKG-U6gRNA plasmid was digested with the restriction endonuclease BbsI, and the vector backbone (a large linear fragment of about 3kb) was recovered.

[0235] CD163-E7-gRNA1-S and CD163-E7-gRNA1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. This sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain the plasmid pKG-U6gRNA(CD163-E7-g1). The plasmid pKG-U6gRNA(CD163-E7-g1) expressed sgRNA. CD163-E7-g1 sgRNA CD163-E7-g1 The sequence is as follows:

[0236] GGAACUACAGUGCGGCACUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu.

[0237] CD163-E7-gRNA2-S and CD163-E7-gRNA2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(CD163-E7-g2). Plasmid pKG-U6gRNA(CD163-E7-g2) expresses the sgRNA shown in SEQ ID NO.24. CD163-E7-g2 :

[0238] GGUCGUGUUGAAGUACAACAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggc accgagucggugcuuuu (SEQ ID NO. 24).

[0239] CD163-E7-gRNA3-S and CD163-E7-gRNA3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. This sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain the plasmid pKG-U6gRNA(CD163-E7-g3). The plasmid pKG-U6gRNA(CD163-E7-g3) expressed sgRNA. CD163-E7-g3 sgRNA CD163-E7-g3 The sequence is as follows:

[0240] GUACAACAUGGAGACACGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu.

[0241] CD163-E7-gRNA4-S and CD163-E7-gRNA4-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. This sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain the plasmid pKG-U6gRNA(CD163-E7-g4). The plasmid pKG-U6gRNA(CD163-E7-g4) expressed sgRNA. CD163-E7-g4 sgRNA CD163-E7-g4 The sequence is as follows:

[0242] ACUGUGGUUUCCCUCGGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu.

[0243] 4.4 Comparison of editing efficiency of gRNA targeting different sites in the CD163 gene

[0244] Primary porcine fibroblasts were prepared from ear tissue of newborn Congjiang Xiang pigs (female, blood type AO).

[0245] 1. Co-transfection

[0246] Group 1: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (CD163-E7-g1) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg pKG-U6gRNA (CD163-E7-g1) : 1.08 μg pKG-GE3. The molar ratio of pKG-U6gRNA (CD163-E7-g1) to pKG-GE3 was 3:1.

[0247] Group 2: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (CD163-E7-g2) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg pKG-U6gRNA (CD163-E7-g2) : 1.08 μg pKG-GE3. The molar ratio of pKG-U6gRNA (CD163-E7-g2) to pKG-GE3 was 3:1.

[0248] Group 3: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (CD163-E7-g3) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (CD163-E7-g3) : 1.08 μg of plasmid pKG-GE3. The molar ratio of pKG-U6gRNA (CD163-E7-g3) to pKG-GE3 was 3:1.

[0249] Group 4: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (CD163-E7-g4) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg pKG-U6gRNA (CD163-E7-g4) : 1.08 μg pKG-GE3. The molar ratio of pKG-U6gRNA (CD163-E7-g4) to pKG-GE3 was 3:1.

[0250] Group 5: Porcine primary fibroblasts, electroporated without plasmids using the same electroporation parameters.

[0251] Co-transfection was performed using electroporation. The transfection was carried out using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3pulse).

[0252] 2. After completing step 1, incubate in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total incubation time is 48 hours.

[0253] 3. After completing step 2, cells were digested and collected using trypsin, then lysed and genomic DNA was extracted. PCR amplification was performed using primer pairs consisting of CD163-JDF121 and CD163-JDR518, followed by 1% agarose gel electrophoresis. The target fragment was recovered and sequenced; the sequencing peak diagram is shown below. Figure 13 The gene editing efficiency of different targets was determined by analyzing the sequencing peaks using the Synthego ICE tool. The gene editing efficiencies of groups one through four were 16%, 34%, 10%, and 10%, respectively. No gene editing occurred in group five. The results indicate that group two had the highest editing efficiency, specifically sgRNA. CD163-E7-g2 The target point is the optimal target point.

[0254] Example 5: Screening for highly efficient pAPN gene gRNA targets

[0255] Porcine APN (pAPN) gene information: Encoding alanyl aminopeptidase, membrane protein; located on porcine chromosome 7; GeneID 397520, Sus scrofa. The protein encoded by the porcine APN gene is shown in GENBANK ACCESSION NO. NP_999442.1 (linear CON 12-JAN-2018), and the amino acid sequence is shown in SEQ ID NO. 25. In the genomic DNA, the porcine APN gene has two exons, and the second exon and its upstream and downstream 100 bp sequences are shown in SEQ ID NO. 26.

[0256] 5.1 Conservation analysis of pAPN gene knockout target sites and adjacent genomic sequences

[0257] Eighteen newborn Congjiang Xiang pigs were selected, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10) and 8 males (named A, B, C, D, E, F, G, and H).

[0258] Using genomic DNA from 18 pigs as templates, PCR amplification was performed using primer pairs (the target sequences of the primer pairs included exon 2 of the porcine APN gene), followed by electrophoresis. The PCR amplification products were recovered and sequenced, and the sequencing results were compared with pAPN gene sequences in public databases. Based on the alignment results, primers for detecting mutations were designed (the primers themselves avoided potential mutation sites). The designed primers for detecting mutations were APN-JDF94 / APN-JDR656. The electrophoresis images of PCR amplification of genomic DNA from 18 pigs using the APN-JDF94 / APN-JDR656 primer pair are shown below. Figure 14 .

[0259] APN-JDF94: 5'-GAACCGGAGCAGTGTCTCTA-3';

[0260] APN-JDR656: 5'-CCCCTGGGTGGTGTAGTTGA-3'.

[0261] 5.2 Design and Construction of Target gRNA

[0262] Several targets were initially screened by NGG (avoiding possible mutation sites), and four targets were further screened out after preliminary experiments.

[0263] The four target points are as follows:

[0264] sgRNA APN-E2-g1Target: 5'-GAGGATGCCCAGGATGCCCA-3' (SEQ ID NO. 27);

[0265] sgRNA APN-E2-g2 Target: 5'-CCTGGGCATCCTCCTCGGCG-3';

[0266] sgRNA APN-E2-g3 Target: 5'-CACAGACAGAGCGATGATGG-3';

[0267] sgRNA APN-E2-g4 Target: 5'-GCTCTGGTCCAAGGTGATGG-3'.

[0268] The complementary DNA oligos for the insertion sequences at four target sites of the synthesized pAPN gene are as follows:

[0269] APN-E2-gRNA1-S: 5'-caccGAGGATGCCCAGGATGCCCA-3' (SEQ ID NO. 28);

[0270] APN-E2-gRNA1-A: 5'-aaacTGGGCATCCTGGGCATCCTC-3' (SEQ ID NO. 29);

[0271] APN-E2-gRNA2-S: 5'-caccgCCTGGGCATCCTCCTCGGCG-3';

[0272] APN-E2-gRNA2-A: 5'-aaacCGCCGAGGAGGATGCCCAGGc-3';

[0273] APN-E2-gRNA3-S: 5'-caccgCACAGACAGAGCGATGATGG-3';

[0274] APN-E2-gRNA3-A: 5'-aaacCCATCATCGCTCTTGTCTGTGc-3';

[0275] APN-E2-gRNA4-S: 5'-caccGCTCTGGTCCAAGGTGATGG-3';

[0276] APN-E2-gRNA4-A: 5'-aaacCCATCACCTTGGACCAGAGC-3'.

[0277] APN-E2-gRNA1-S, APN-E2-gRNA1-A, APN-E2-gRNA2-S, APN-E2-gRNA2-A, APN-E2-gRNA3-S, APN-E2-gRNA3-A, APN-E2-gRNA4-S, and APN-E2-gRNA4-A are all single-stranded DNA molecules.

[0278] 5.3 Preparation of gRNA recombinant plasmids

[0279] The pKG-U6gRNA plasmid was digested with the restriction endonuclease BbsI, and the vector backbone (a large linear fragment of about 3kb) was recovered.

[0280] APN-E2-gRNA1-S and APN-E2-gRNA1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(APN-E2-g1). Plasmid pKG-U6gRNA(APN-E2-g1) expresses the sgRNA shown in SEQ ID NO.30. APN-E2-g1 :

[0281] GAGGAUGCCCAGGAUGCCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu (SEQ ID NO. 30).

[0282] APN-E2-gRNA2-S and APN-E2-gRNA2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. This sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain the plasmid pKG-U6gRNA(APN-E2-g2). The plasmid pKG-U6gRNA(APN-E2-g2) expresses sgRNA. APN-E2-g2 sgRNA APN-E2-g2 The sequence is as follows:

[0283] CCUGGGCAUCCUCCUCGGCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu.

[0284] APN-E2-gRNA3-S and APN-E2-gRNA3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. This sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(APN-E2-g3). Plasmid pKG-U6gRNA(APN-E2-g3) expresses sgRNA. APN-E2-g3 sgRNA APN-E2-g3 The sequence is as follows:

[0285] CACAGACAGAGCGAUGAUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu.

[0286] APN-E2-gRNA4-S and APN-E2-gRNA4-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. This sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain the plasmid pKG-U6gRNA(APN-E2-g4). The plasmid pKG-U6gRNA(APN-E2-g4) expresses sgRNA. APN-E2-g4 sgRNA APN-E2-g4 The sequence is as follows:

[0287] GCUCUGGUCCAAGGUGAUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu.

[0288] 5.4 Comparison of editing efficiency of gRNA targeting different sites in the pAPN gene

[0289] Primary porcine fibroblasts were prepared from ear tissue of newborn Congjiang Xiang pigs (female, blood type AO).

[0290] 1. Co-transfection

[0291] Group 1: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (APN-E2-g1) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg pKG-U6gRNA (APN-E2-g1) : 1.08 μg pKG-GE3. The molar ratio of pKG-U6gRNA (APN-E2-g1) to pKG-GE3 was 3:1.

[0292] Group 2: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (APN-E2-g2) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg pKG-U6gRNA (APN-E2-g2) : 1.08 μg pKG-GE3. The molar ratio of pKG-U6gRNA (APN-E2-g2) to pKG-GE3 was 3:1.

[0293] Group 3: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (APN-E2-g3) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg pKG-U6gRNA (APN-E2-g3) : 1.08 μg pKG-GE3. The molar ratio of pKG-U6gRNA (APN-E2-g3) to pKG-GE3 was 3:1.

[0294] Group 4: Primary porcine fibroblasts were co-transfected with plasmids pKG-U6gRNA (APN-E2-g4) and pKG-GE3. The ratio was approximately 200,000 primary porcine fibroblasts: 0.92 μg pKG-U6gRNA (APN-E2-g4) : 1.08 μg pKG-GE3. The molar ratio of pKG-U6gRNA (APN-E2-g4) to pKG-GE3 was 3:1.

[0295] Group 5: Porcine primary fibroblasts, electroporated without plasmids using the same electroporation parameters.

[0296] Co-transfection was performed using electroporation. The transfection was carried out using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3pulse).

[0297] 2. After completing step 1, incubate in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total incubation time is 48 hours.

[0298] 3. After completing step 2, cells were digested and collected using trypsin. Cells were then lysed and genomic DNA extracted. PCR amplification was performed using primers consisting of APN-JDF94 and APN-JDR656, followed by 1% agarose gel electrophoresis. The target fragment was recovered and sequenced. The sequencing peak diagram is shown below. Figure 15The gene editing efficiency of different targets was determined by analyzing the sequencing peaks using the Synthego ICE tool. The gene editing efficiencies of groups one through four were 52%, 15%, 16%, and 5%, respectively. No gene editing occurred in group five. The results indicate that group one had the highest editing efficiency, specifically sgRNA. APN-E2-g1 The target point is the optimal target point.

[0299] Example 6: Construction of a single-cell clone of Congjiang Xiang pig with combined knockout of INHA, CD163, and pAPN genes.

[0300] 6.1 Preparation of primary porcine fibroblasts

[0301] Same as 2.2 in Example 2.

[0302] 6.2 Porcine primary fibroblasts were co-transfected with the constructed pKG-U6gRNA(INHA-E2-g1) plasmid, pKG-U6gRNA(CD163-E7-g2), pKG-U6gRNA(APN-E2-g1), and pKG-GE3 plasmid.

[0303] 6.2.1 Transfect porcine primary fibroblasts with plasmids pKG-U6gRNA(INHA-E2-g1), pKG-U6gRNA(CD163-E7-g2), pKG-U6gRNA(APN-E2-g1), and pKG-GE3. The ratio of plasmids was approximately 200,000 porcine primary fibroblasts: 0.47 μg pKG-U6gRNA(INHA-E2-g1): 0.47 μg pKG-U6gRNA(CD163-E7-g2): 0.47 μg pKG-U6gRNA(APN-E2-g1): 1.59 μg pKG-GE3. The molar ratio of each plasmid was 1:1:1:1, i.e., total gRNA:pKG-GE3 was 3:1.

[0304] 6.2.2 Co-transfection procedure

[0305] Same as in Example 2, 2.3.2, but without using 0.25% (Gibco) trypsin to digest and collect cells in 1.5 mL centrifuge tubes.

[0306] 6.3 Screening of single-cell clones with combined knockout of INHA, CD163, and pAPN genes

[0307] 6.3.1 The cell population obtained from step 6.2.2 after electroporation for 48 hours was digested with trypsin, neutralized with complete culture medium, centrifuged at 500g for 5 min, the supernatant was removed, the pellet was resuspended in 200 μL of complete culture medium and diluted appropriately, and single cells were picked up with a pipette and transferred to a 96-well plate containing 100 μL of complete culture medium in each well, with one cell per well.

[0308] 6.3.2 Cultured in a constant temperature incubator at 37℃ with 5% CO2 and 5% O2, changing the cell culture medium every 2 to 3 days. During this period, the cell growth in each well was observed under a microscope, and wells without cells or non-single-cell clones were excluded.

[0309] 6.3.3 Once the cells in the wells of the 96-well plate have reached the bottom of the wells, digest them with trypsin and collect the cells. Two-thirds of the cells are seeded into 6-well plates containing complete culture medium, and the remaining one-third of the cells are collected in 1.5 mL centrifuge tubes for subsequent genotyping.

[0310] 6.3.4 When the 6-well plate reaches 80% confluence, digest the cells with 0.25% (Gibco) trypsin and collect the cells. Freeze the cells using cell cryopreservation solution (90% complete culture medium + 10% DMSO, volume ratio).

[0311] 6.4 Identification of single-cell clones with combined knockout of INHA, CD163, and pAPN genes

[0312] 6.4.1 Add 10 μL of KAPA2G lysis buffer to the cells collected in the 1.5 mL centrifuge tube in step 6.3.3 to lyse the cells and obtain cell lysate that releases genomic DNA.

[0313] The KAPA2G lysis buffer preparation system is as follows:

[0314] 10X extract buffer 1μL

[0315] Enzyme 0.2μL

[0316] ddH2O 8.8μL

[0317] 75℃ for 15 min — 95℃ for 5 min — 4℃, after the reaction, the cell lysis buffer was stored at -20℃;

[0318] 6.4.2 Using the aforementioned primer pairs for INHA gene E2 (INHA-E2-JDF178 / INHA-E2-JDR654), primer pairs for CD163 gene E7 (CD163-JDF121 / CD163-JDR518), and primer pairs for pAPN gene E2 (APN-JDF94 / APN-JDR656), and using the aforementioned cell lysate as DNA template, PCR amplification of the target regions of INHA, CD163, and pAPN genes was performed, and the target gene mutation status of single-cell clones was detected. The length of the target PCR product of INHA gene was 477 bp, the length of the target PCR product of CD163 gene was 398 bp, and the length of the target PCR product of pAPN gene was 563 bp.

[0319] 6.4.3 Amplify the target regions of INHA, CD163 and pAPN genes using standard PCR reactions;

[0320] 6.4.4 Perform electrophoresis on the PCR reaction products. The electrophoresis results are as follows: Figure 16 (INHA) Figure 17 (CD163) Figure 18 (pAPN), lane numbering is consistent with single-cell clone numbering. PCR amplification products are recovered and sequenced.

[0321] 6.4.5 The sequencing results were compared with the target information of INHA, CD163 and pAPN to determine whether the single-cell clone was a joint knockout of the three genes INHA, CD163 and pAPN.

[0322] 6.4.5.1 For the INHA gene, the genotypes of single-cell clones numbered 3, 8, 10, 20, 22, 25, 27, 33, 34, 38, 48, 51, and 59 are homozygous mutants with identical biallelic variations; the genotypes of single-cell clones numbered 7, 18, 29, 42, 44, and 53 are homozygous mutants with different biallelic variations; the genotypes of single-cell clones numbered 4, 11, 14, 24, 32, and 55 are heterozygous mutants; the genotypes of other single-cell clones are wild-type; the rate of obtaining INHA gene-edited single-cell clones is 41%.

[0323] Example sequencing alignment results are as follows Figures 19 to 22 ,in Figure 19 The sequencing results of clone number 2 are compared with the wild-type reference sequence, and it is determined to be wild-type. Figure 20 The sequencing results of clone number 4 were compared with the wild-type reference sequence, and it was determined to be a heterozygous mutant. Figure 21The sequencing results of clone number 8 were compared with the wild-type reference sequence, and it was determined to be a homozygous mutant with identical biallelic variants. Figure 22 The sequencing results of clone number 53 were compared with the wild-type reference sequence, and it was determined to be a homozygous mutant with different biallelic variations.

[0324] Based on the analysis of specific sequences, the genotypes of each single-cell clone are shown in Table 1:

[0325] Table 1 Genotyping of INHA gene knockout single-cell clones

[0326]

[0327]

[0328]

[0329] 6.4.5.2 For the CD163 gene, the genotypes of single-cell clones numbered 3, 7, 8, 18, 20, 42, and 44 are homozygous mutants with identical biallelic variations; the genotypes of single-cell clones numbered 21 and 27 are homozygous mutants with different biallelic variations; the genotypes of single-cell clones numbered 11, 12, 22, and 36 are heterozygous mutants; the genotypes of other single-cell clones are wild-type; the rate of obtaining CD163 gene-edited single-cell clones is 21%.

[0330] Example sequencing alignment results are as follows Figures 23 to 26 ,in Figure 23 The sequencing result of clone number 1 is compared with the wild-type reference sequence, and it is determined to be wild-type; Figure 24 The sequencing results of clone number 12 were compared with the wild-type reference sequence, and it was determined to be a heterozygous mutant. Figure 25 The sequencing results of clone number 3 were compared with the wild-type reference sequence, and it was determined to be a homozygous mutant with identical biallelic variants. Figure 26 The sequencing results of clone number 27 were compared with the wild-type reference sequence, and it was determined to be a homozygous mutant with different biallelic variations.

[0331] Based on the analysis of specific sequences, the genotypes of each single-cell clone are shown in Table 2:

[0332] Table 2 Genotyping of CD163 gene knockout single-cell clones

[0333]

[0334]

[0335] 6.4.5.3 For the pAPN gene, the genotypes of single-cell clones numbered 3, 7, 8, 18, 23, 27, 32, 41, 44, 50, and 56 are homozygous mutants with identical biallelic variations; the genotypes of single-cell clones numbered 9, 14, 42, and 55 are homozygous mutants with different biallelic variations; the genotypes of single-cell clones numbered 2, 29, 36, 38, 46, 51, and 58 are heterozygous mutants; the genotypes of other single-cell clones are wild-type; the rate of obtaining pAPN gene-edited single-cell clones is 36%.

[0336] Example sequencing alignment results are as follows Figures 27 to 30 ,in Figure 27 The sequencing result of clone number 1 is compared with the wild-type reference sequence, and it is determined to be wild-type; Figure 28 The sequencing results of clone number 2 were compared with the wild-type reference sequence, and it was determined to be a heterozygous mutant. Figure 29 The sequencing results of clone number 7 were compared with the wild-type reference sequence, and it was determined to be a homozygous mutant with identical biallelic variants. Figure 30 The sequencing results of clone number 9 were compared with the wild-type reference sequence, and it was determined to be a homozygous mutant with different biallelic variations.

[0337] Based on the analysis of specific sequences, the genotypes of each single-cell clone are shown in Table 3:

[0338] Table 3 Genotyping of pAPN gene knockout single-cell clones

[0339]

[0340]

[0341]

[0342] 6.4.6 Through analysis, single-cell clones numbered 3, 7, 8, 18, 27, 42, and 44 were single-cell clones with homozygous knockout of the INHA, CD163, and pAPN genes, with a combined knockout homozygosity rate of approximately 11%.

[0343] Both the heterozygous and homozygous mutant single-cell clones mentioned above can be used for the cloning of gene-edited pigs.

[0344] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Nanjing Qizhen Gene Engineering Co., Ltd. <120> Constructing a gene-editing system for high-fertility, resistant porcine reproductive and respiratory syndrome (PRRS) and a series of diarrheal diseases, and its application. <160> 30 <170> SIPOSequenceListing 1.0 <210> 1 <211> 8484 <212> DNA <213> Artificial Sequence <400> 1 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300 gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360 agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420 aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480 ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540 aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600 caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660 acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720 ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780 ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840 ggggggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc 900 agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata 960 aaaagcgaag cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct 1020 ccgccgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 1080 gcgggcggga cggccctctct cctccgggct gtattagct gagcaagagg taagggtttta 1140 agggatggtt ggttggtggg gtattaatgt tattacct ggagcacctg cctgaatca 1200 ctttttttca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactaca 1260 ggatcatgat attgattaca aagacgatga cgatagatg gcccaaaga agaagcggaa 1320 ggtcggtatc cacggagtcc cagcagccga cagaagtac agcatcggcc tggacatcgg 1380 caccaactct gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaatt 1440 caagtgctg ggcaaccg accggcacag catcaagaag aacctgatcg gagccctgct 1500 gttcgacagc ggcgaacag ccgaggccac ccggctgaag agaccgcca gagaagata 1560 caccagacgg aagaccgga tctgctatct gcaagagatc ttcagcacg agatggccaa 1620 ggtggacgac agctctctcc acagactgga agagtccttc ctggtggaag aggataagaa 1680 gcacgagcgg cacccatct tcggcacat cgtggacgag gtggcctacc acgagaagta 1740 ccccaccatc taccacctga gaagaaact ggtggacagc ccgacagg ccgacctgcg 1800 gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1860 cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1920 caaccagctg ttcgaggaaa accccacatcaa cgccagcggc gtggacgcca aggccatcct 1980 2040 gaagagaat ggcctgttcg gaacctgat tgccctgagc ctgggcctga cccccaactt 2100 caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 2160 cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 2220 cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 2280 caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2340 gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtcaaag agattttctt 2400 cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2460 ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2520 gctgaacaga gaggacctgc tgcggaagca gcggaccttc vakaacggca gcatccccca 2580 ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggagat tttacccatt 2640 cctgaaggac aaccgggaaa agatcgagaa gatcctgacc ttccgcatcc cctactacgt 2700 gggccctctg gccagggaa acagcagatt cgcctggattg accagaaga gcgaggaaac 2760 catcaccccc tggaacttcg aggagtggt ggacaagggc gctccccc agagcttcat 2820 cgagcggatg accaacttcg atagaacct gcccaacgag aaggtgctgc ccaagcacag 2880 cctgctgtac gagtacttca ccgtgtataa cgagctgacc aaagtgaaat acgtgaccga 2940 gggaatgaga aagcccgcct tcctgagcgg cgagcagaa aaggccatcg tggacctgct 3000 gttcaagacc aaccggaaag tgaccgtgaa gcagctgaaa gaggactact tcaagaaat 3060 cgagtgctc gactccgtgg aaatctccgg cgtggagat cggttcacg cctccctggg 3120 cacataccac gatctgctga aaattatcaa ggacaggac ttcctggaca atgaggaaaa 3180 cgaggacatt ctggaagata tcgtgctgac cctgacactg tttgaggaca gagagatgat 3240 cgaggaacgg ctgaaaacct atgcccacct gttcgacgac aaagtgatga agcagctgaa 3300 gcggcggaga tacaccggct ggggcaggct gagccggaag ctgatcaacg gcatccggga 3360 caagcagtcc ggcaagacaa tcctggattt cctgaagtcc gacggcttcg ccaagaaaa 3420 cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3480 ggtgtccggc cagggcgata gcctgcacga gcacattgcc aatctggccg gcagccccgc 3540 cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3600 ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3660 gggacagaag aacagccgcg agaatgaa gcggatcgaa gagggcatca aagagctggg 3720 cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3780 cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3840 gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3900 cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3960 cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 4020 tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 4080 taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 4140 acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 4200 agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 4260 ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4320 cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4380 ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4440 taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4500 ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4560 cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4620 gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4680 caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4740 cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4800 caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4860 cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4920 ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4980 aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 5040 tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 5100 tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 5160 gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 5220 cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 5280 gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5340 ccggagagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5400 caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5460 ggccacgaaa aaggccggcc aggcaaaaaa gaaaaagtaa gaattcctag agctcgctga 5520 tcagcctcga ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct 5580 tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca 5640 tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag 5700 ggggaggatt gggaagagaa tagcaggcat gctggggagc ggccgcagga acccctagtg 5760 atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 5820 gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 5880 ctgcaggggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 5940 atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 6000 tggttacgcg cagcgtgacc gctacacttg ccagcgcctt agcgcccgct cctttcgctt 6060 tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 6120 tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 6180 gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 6240 agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct 6300 cgggctattc ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg 6360 agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 6420 ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 6480 caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6540 ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6600 cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6660 tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 6720 ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 6780 aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 6840 tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 6900 atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 6960 agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 7020 tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 7080 tacactattc tcagaatgac ttggttgagt actcaccagt cacaagaaag catcttacgg 7140 atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 7200 ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 7260 tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 7320 acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 7380 7440 aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttat gctgataaat 7500 ctggagccgg tgagcgtgga agccgcggta tcattgcagc actggggcca gatggtaagc 7560 cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7620 gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 7680 actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 7740 agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 7800 cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 7860 tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 7920 agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 7980 ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 8040 acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 8100 ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 8160 gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 8220 gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 8280 gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 8340 tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 8400 caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 8460 tttgctggcc ttttgctcac atgt 8484 <210> 2 <211> 10476 <212> DNA <213]] Artificial Sequence <400> 2 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300 gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360 gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420 cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480 ctttccattg acgtcaatgg gtggagtatt tacggtaac tgcccacttg gcagtacatc 540 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600 ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660 tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720 ggggaggggt cggcaattga tccggtgcct agaaaggtg gcgcggggta aactgggaaa 780 gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840 footgtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900 cggtgccacc atggactata aggaccacga cggagactac aggatcatg atattgatta 960 caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020 gaaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080 cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140 cagcagaaa ttcaggtgc tgggcacac cgaccggcac agcatcaga agaacctgat 1200 cggagccctg ctgttcgaca gcggcgaac agccgaggcc acccggctga agagaaccgc 1260 cagagaga tacaccagac ggagaccg gatctgctat ctgcagaga tctcaga 1320 cgagatggcc aaggtggacg acagctctt ccacagactg gaagagtcct tcctggtgga 1380 agaggataag aagcacgagc ggcacccat cttcggcac atcgtggacg aggtggccta 1440 ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500 ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560 cctgatcgag ggcgacctga accccgacaa cagcgacgtg ggalagctgt tcatccagct 1620 ggtgcagacc tacaccacc tgttcgagga aaacccatc aacgccagcg gcgtggacgc 1680 CAggccatc ctgtctgcca gactgagca gagcagacgg ctggaaaatc tgatcgccca 1740 gctgcccggc gagagaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800 gaccccac ttcagagca actcgacct ggccgaggat gccaactgc agctgagca 1860 ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920 cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980 gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040 ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100 agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160 ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220 actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280 cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340 tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400 cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460 gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520 ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580 gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640 atacgtgacc gaggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700 cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760 cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820 cgcctccctg ggcacatacc acgatctgct gaaaattatc areacaagg acttcctgga 2880 2940 cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000 gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060 cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120 cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180 ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240 cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300 gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360 gaccacccag aagggacaga agacagccg cgagagaatg aagcggatcg aagaggggcat 3420 haaagagctg ggcagccaga tcctgaaaga acacccgtg gaaaacacccc agctgcagaa 3480 cgagaagctg tacctgtact acctgcagaa tggcgggat atgtacgtgg accaggaact 3540 ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600 ggacgactcc atcgacaca aggtgctgac cagaagcgac aagaccggg gcaagagcga 3660 caacgtgccc tccgaagagg tcgtgagaa catgagaac tactggcggc agctgctgaa 3720 cgccaagctg attacccaga gaagttcga caatctgacc aaggccgaga gaggcggcct 3780 gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaccc ggcagatcac 3840 aaagcacgtg gcacagatcc tggactcccg gatgacact aagtacgacg agaatgacaa 3900 gctgatccgg gaagtgaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960 ggatttccag ttttacaag tgcgcgagat storm caccacgccc acgacgccta 4020 cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080 cgtgtacggc gactacaagg tgtacgacgt gcggagaatg atcgccaaga gcgagcagga 4140 aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200 cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260 aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320 catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380 gtctatcctg cccaagagga acagcgataa gctgatcgcc agaagaagg actgggaccc 4440 tagaaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500 agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gaggctgctgg ggatcaccat 4560 catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620 agaagtgaaa agaagcctga tcatcaagct gcctaagtac tccctgttcg agctgggaaaa 4680 cggccggaag agaatgctgg cctctgccgg cgaactgcag aaggggaaacg aactggccct 4740 gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800 ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860 gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920 caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980 tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040 caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100 ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160 caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220 gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280 aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340 gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400 cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460 cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520 cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580 cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640 cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700 cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760 caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820 gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880 gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940 ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000 cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060 caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120 gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180 cgcgttcgcc gactacccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240 ggtcaccgag ctgcaagaac tcttctccac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300 ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360 ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420 gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480 ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540 ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600 ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660 cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720 caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780 tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840 tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900 gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960 tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020 tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080 gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140 cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200 caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260 tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320 agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380 ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620 cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680 cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740 aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800 ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860 gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920 atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980 cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040 ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100 taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160 aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220 ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280 tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340 ggttaaaaaaa tgagctgatt taacaaaat ttaacgcgaa ttttaacaa attackacgt 8400 ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460 cccgacaccc gccacaccc gctgacgcgc cctgacggggc tgtctgctc cggcatccg 8520 cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580 caccgaaacg cgcgagacga aagggccctcg tgatacgcct atttttag gttaatgtca 8640 tgatataat gtttcttag acgtcaggtg gcactttcg gggaaatgtg cgcggaaccc 8700 ctatttgtttt atttttctaa atacattca atatgtatcc gctcatgaga caataaccct 8760 gataaatgct tcaatatat tgaaaaagga agagtatgag tattcacat ttccgtgtcg 8820 cccttattcc ctttttgcg gcattttgcc tcctgtttt tgctcacca gaaacgctgg 8880 tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940 tcacagcgg tagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000 cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg CAGAGCAAC 9060 tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120 agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180 ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240 ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300 aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360 gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420 tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480 ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540 cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600 atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660 cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780 cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840 ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900 tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960 taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020 caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080 agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140 gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200 gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260 ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320 acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380 tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440 ggttcctggc cttttgctgg ccttttgctc acatgt 10476 <210> 3 <211> 3120 <212> DNA <213> Artificial Sequence <400> 3 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780 gcgaactact tactctagct tcccggcaac attaataga ctggatggag gcggataaag 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tccttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc ttttttctg cgcgtaatct 1260 gctgcttgca aaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160 cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220 accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280 ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340 tgttagagag ataattggaa ttaatttgac tgtaaacaca aagattag tacaaaatac 2400 gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460 ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520 gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580 ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640 tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700 ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760 accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820 atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880 ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940 gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000 cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060 tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120 <210> 4 <211> 175 <212> DNA <213> Artificial Sequence <400> 4 tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 60 gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 120 ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccgtta cataa 175 <210> 5 <211> 554 <212> DNA <213> Artificial Sequence <400> 5 tctgcagaca aatggctcta gaggtacccg ttacataact tacggtaaat ggcccgcctg 60 gctgaccgcc caacgacccc cgcccattga cgtcaatagt aacgccaata gggactttcc 120 attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 180 atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 240 gtgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 300 tcgctattac catgggggca gagcgcacat cgcccacagt ccccgagaag ttggggggag 360 gggtcggcaa ttgatccggt gcctagagaa ggtggcgcgg ggtaaactgg gaaagtgatg 420 tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata agtgcagtag 480 tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggtt ggaccggtgc 540 caccatggac tata 554 <210> 6 <211> 447 <212> DNA <213> Artificial Sequence <400> 6 ccagaacaca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 60 ggatcatgat attgattaca aagacgatga cgataagatg gcccccaaaa agaaacgaaa 120 ggtgggtggg tccccaaaga agaagcggaa ggtcggtatc cacggagtcc cagcagccga 180 aagagtac agcatcggcc tggacatcgg caccaactct gtgggctgggg ccgtgatcac 240 cgacgagtac aaggtgccca gcaagaaatt caaggtgctg ggcaacaccg accggcacag 300 catcaagaag aacctgatcg gagccctgct gttcgacagc ggcgaaacag ccgaggccac 360 ccggctgaag agaaccgcca gaagagata caccagacgg aagaaccgga tctgctatct 420 447 <210> 7 <211> 2727 <212> DNA <213> Artificial Sequence <400> 7 cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa gggcggctcc aagcggcctg 60 ccgcgacgaa gaagcggga caggccaaga aaaagaaagg atccggcgca acaaacttct 120 ctctgctgaa acaagccgga gatgtcgaag agaatcctgg accggtgagc aagggcgagg 180 agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca 240 agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt 300 tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct 360 acggcgtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt 420 ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact 480 acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga 540 agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca 600 acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca 660 agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca 720 cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg 780 ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg 840 ccgccgggat cactctcggc atggacgagc tgtacaaggg ctccggcgag ggcaggggaa 900 gtcttctaac atgcggggac gtggaggaaa atcccggccc aaccgagtac aagcccacgg 960 tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg caccctcgcc gccgcgttcg 1020 ccgactaccc cgccacgcgc cacaccgtcg atccggaccg ccacatcgag cgggtcaccg 1080 agctgcaaga actcttcctc acgcgcgtcg ggctcgacat cggcaaggtg tgggtcgcgg 1140 acgacggcgc cgcggtggcg gtctggacca cgccggagag cgtcgaagcg ggggcggtgt 1200 tcgccgagat cggcccgcgc atggccgagt tgagcggttc ccggctggcc gcgcagcaac 1260 agatggaagg cctcctggcg ccgcaccggc ccaaggagcc cgcgtggttc ctggccaccg 1320 tcggagtctc gcccgaccac cagggcaagg gtctgggcag cgccgtcgtg ctccccggag 1380 tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga gacctccgcg ccccgcaacc 1440 tccccttcta cgagcggctc ggcttcaccg tcaccgccga cgtcgaggtg cccgaaggac 1500 cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaac gcgttaagtc gacaatcaac 1560 ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt gctcctttta 1620 cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc tattgcttcc cgtatggctt 1680 tcattttctc ctccttgtat aaatcctggt tgctgtctct ttatgaggag ttgtggcccg 1740 ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc actggttggg 1800 gcattgccac cacctgtcag ctcctttccg ggactttcgc tttccccctc cctattgcca 1860 cggcggaact catcgccgcc tgccttgccc gctgctggac aggggctcgg ctgttgggca 1920 ctgacaattc cgtggtgttg tcggggaaat catcgtcctt tccttggctg ctcgcctgtg 1980 ttgccacctg gattctgcgc gggacgtcct tctgctacgt cccttcggcc ctcaatccag 2040 cggaccttcc ttcccgcggc ctgctgccgg ctctgcggcc tcttccgcgt cttcgccttc 2100 gccctcagac gagtcggatc tccctttggg ccgcctcccc gcgtcgactt taagaccaat 2160 gacttacaag gcagctgtag atcttagcca ctttttaaaa gaaaaggggg gactggaagg 2220 gctaattcac tcccaacgaa gacaagatct gctttttgct tgtactgggt ctctctggtt 2280 agaccagatc tgagcctggg agctctctgg ctaactaggg aacccactgc ttaagcctca 2340 ataaagcttg ccttgagtgc ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa 2400 ctagagatcc ctcagaccct tttagtcagt gtggaaaatc tctagcaggg cccgtttaaa 2460 cccgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 2520 ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 2580 aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 2640 acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 2700 tggcctgcag gggcgcctga tgcggta 2727 <210> 8 <211> 410 <212> DNA <213> Artificial Sequence <400> 8 gataaacatg tgagggccta tttcccatga ttccttcata tttgcatata cgatacaagg 60 ctgttagaga gataattgga attaatttga ctgtaaacac aaagatatta gtacaaaata 120 cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta tgttttaaaa 180 tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct ttatatatct 240 tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 300 gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 360 ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccatag 410 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 agttatggca gaactcagtg 20 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <400> 10 caccgagtta tggcagaact cagtg 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <400> 11 aaaccactga gttctgccat aactc 25 <210> 12 <211> 100 <212> RNA <213> Artificial Sequence <400> 12 aguuauggca gaacucagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 13 <211> 339 <212> PRT <213> Pig (Sus scrofa) <400> 13 Met Gly Arg Gly Asp Trp Gly Gly Pro Gly Gln Thr Leu Thr Glu Gly 1 5 10 15 Ala Gln Gly Trp Val Trp Val His Arg Trp Gln Gly Gln Val Ser Tyr 20 25 30 Val Ala Ser Ala Ala Pro Leu Ala Val Gly Pro Thr Glu Trp Ala Trp 35 40 45 Leu Pro Gly Pro Gly Ala Gly Pro Gly Ala Cys Pro Gly Gln Gly Ala 50 55 60 Arg Cys Gly Asp Glu Pro Ala Ala Gly Glu Leu Ala Arg Glu Ala Glu 65 70 75 80 Glu Gly Leu Phe Thr Tyr Val Phe Arg Pro Ser Gln His Thr Arg Ser 85 90 95 Arg Gln Val Thr Ser Ala Gln Leu Trp Phe His Thr Gly Leu Asp Arg 100 105 110 Gln Gly Met Ala Ala Ala Asn Ser Ser Gly Pro Leu Leu Asp Leu Leu 115 120 125 Ala Leu Ser Ser Arg Gly Pro Val Ala Val Pro Met Ser Leu Gly Gln 130 135 140 Ala Pro Pro Arg Trp Ala Val Leu His Leu Ala Ala Ser Ala Leu Pro 145 150 155 160 Leu Leu Thr His Pro Val Leu Val Leu Leu Leu Arg Cys Pro Leu Cys 165 170 175 Ser Cys Ser Ala Arg Pro Glu Ala Thr Pro Phe Leu Val Ala His Thr 180 185 190 Arg Ala Arg Pro Pro Ser Gly Gly Glu Arg Ala Arg Arg Ser Thr Ala 195 200 205 Pro Leu Pro Trp Pro Trp Ser Pro Ala Ala Leu Arg Leu Leu Gln Arg 210 215 220 Pro Pro Glu Glu Pro Ala Val His Ala Asp Cys His Arg Ala Ser Leu 225 230 235 240 Asn Ile Ser Phe Gln Glu Leu Gly Trp Asp Arg Trp Ile Val His Pro 245 250 255 Pro Ser Phe Ile Phe His Tyr Cys His Gly Gly Cys Gly Leu Pro Thr 260 265 270 Leu Pro Asn Leu Pro Leu Ser Val Pro Gly Ala Pro Pro Thr Pro Val 275 280 285 Gln Pro Leu Leu Leu Val Pro Gly Ala Gln Pro Cys Cys Ala Ala Leu 290 295 300 Pro Gly Thr Met Arg Ser Leu Arg Val Arg Thr Thr Ser Asp Gly Gly 305 310 315 320 Tyr Ser Phe Lys Tyr Glu Thr Val Pro Asn Leu Leu Thr Gln His Cys 325 330 335 Ala Cys Ile <210> 14 <211> 1034 DNA <213> Sus scrofa (pig) <400> 14 gcaggctcct gagtggcagc cagatcctgc ctgttgagga ggaggggtcc caggttctgc 60 cagtcagggc tgccctctcc cttccttctg cctcctgcag gtgcccgctg tggggacgag 120 ccagctgctg gagagctggc ccgggaggct gaggagggcc tcttcacata tgtattccgg 180 ccgtcccagc acacacgcag ccgccaggtg acttcagctc agctgtggtt ccacacggga 240 ctggacagac aggggatggc agccgccaat agctctgggc ccctgctgga cctgctggca 300 ctatcatcca ggggtcctgt ggctgtgccc atgtcactgg gccaggcgcc ccctcgctgg 360 gctgtgctgc acctggccgc ctctgccctc cctttgttga cccacccagt cctggtgctg 420 ctgctgcgct gtcctctctg ttcctgctca gcccggcccg aggccacccc cttcctggtg 480 gcccacactc gggccaggcc acccagcgga gggggagagg gcccgacgct ccaccgcccc 540 tctgccctgg ccttggtccc ccgccgcgct gcgcctgctg cagaggcccc cggaggaacc 600 cgctgtgcac gccgactgcc acagagcttc cctcaacatc tccttccagg agctgggctg 660 ggaccggtgg atcgtgcacc ctcccagttt catcttccac tactgtcacg ggggctgcgg 720 gctgccgacc ctgcccaacc tgcccctgtc tgtccctggg gcccccccta cccctgtcca 780 gcccctgttg ttggtgccag gggctcagcc ctgctgcgct gctctcccgg ggaccatgag 840 gtccctacgc gttcgcacca cctcggatgg aggttactct ttcaagtacg agacagtgcc 900 caaccttctc acccagcact gtgcctgcat ctaagggtgt cccgctggtg gccaagctcc 960 cacaggcacc agcctggagg aaggcagagt tcccacctcc cctttccttc cgcctctccg 1020 cctggaggct cccc 1034 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 cctctgcagc aggcgcagcg 20 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <400> 16 caccgcctct gcagcaggcg cagcg 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <400> 17 aaaccgctgc gcctgctgca gaggc 25 <210> 18 <211> 100 <212> RNA <213> Artificial Sequence <400> 18 ccucugcagc aggcgcagcg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 19 <211> 1113 <212> PRT <213> Sus scrofa <400> 19 Met Asp Lys Leu Arg Met Val Leu His Glu Asn Ser Gly Ser Ala Asp 1 5 10 15 Phe Arg Arg Cys Ser Ala His Leu Ser Ser Phe Thr Phe Ala Val Val 20 25 30 Ala Val Leu Ser Ala Cys Leu Val Thr Ser Ser Leu Gly Gly Lys Asp 35 40 45 Lys Glu Leu Arg Leu Thr Gly Gly Glu Asn Lys Cys Ser Gly Arg Val 50 55 60 Glu Val Lys Val Gln Glu Glu Trp Gly Thr Val Cys Asn Asn Gly Trp 65 70 75 80 Asp Met Asp Val Val Ser Val Val Cys Arg Gln Leu Gly Cys Pro Thr 85 90 95 Ala Ile Lys Ala Thr Gly Trp Ala Asn Phe Ser Ala Gly Ser Gly Arg 100 105 110 Ile Trp Met Asp His Val Ser Cys Arg Gly Asn Glu Ser Ala Leu Trp 115 120 125 Asp Cys Lys His Asp Gly Trp Gly Lys His Asn Cys Thr His Gln Gln 130 135 140 Asp Ala Gly Val Thr Cys Ser Asp Gly Ser Asp Leu Glu Met Arg Leu 145 150 155 160 Val Asn Gly Gly Asn Arg Cys Leu Gly Arg Ile Glu Val Lys Phe Gln 165 170 175 Gly Arg Trp Gly Thr Val Cys Asp Asp Asn Phe Asn Ile Asn His Ala 180 185 190 Ser Val Val Cys Lys Gln Leu Glu Cys Gly Ser Ala Val Ser Phe Ser 195 200 205 Gly Ser Ala Asn Phe Gly Glu Gly Ser Gly Pro Ile Trp Phe Asp Asp 210 215 220 Leu Val Cys Asn Gly Asn Glu Ser Ala Leu Trp Asn Cys Lys His Glu 225 230 235 240 Gly Trp Gly Lys His Asn Cys Asp His Ala Glu Asp Ala Gly Val Ile 245 250 255 Cys Leu Asn Gly Ala Asp Leu Lys Leu Arg Val Val Asp Gly Val Thr 260 265 270 Glu Cys Ser Gly Arg Leu Glu Val Lys Phe Gln Gly Glu Trp Gly Thr 275 280 285 Ile Cys Asp Asp Gly Trp Asp Ser Asp Asp Ala Ala Val Ala Cys Lys 290 295 300 Gln Leu Gly Cys Pro Thr Ala Val Thr Ala Ile Gly Arg Val Asn Ala 305 310 315 320 Ser Glu Gly Thr Gly His Ile Trp Leu Asp Ser Val Ser Cys His Gly 325 330 335 His Glu Ser Ala Leu Trp Gln Cys Arg His His Glu Trp Gly Lys His 340 345 350 Tyr Cys Asn His Asn Glu Asp Ala Gly Val Thr Cys Ser Asp Gly Ser 355 360 365 Asp Leu Glu Leu Arg Leu Lys Gly Gly Gly Ser His Cys Ala Gly Thr 370 375 380 Val Glu Val Glu Ile Gln Lys Leu Val Gly Lys Val Cys Asp Arg Ser 385 390 395 400 Trp Gly Leu Lys Glu Ala Asp Val Val Cys Arg Gln Leu Gly Cys Gly 405 410 415 Ser Ala Leu Lys Thr Ser Tyr Gln Val Tyr Ser Lys Thr Lys Ala Thr 420 425 430 Asn Thr Trp Leu Phe Val Ser Ser Cys Asn Gly Asn Glu Thr Ser Leu 435 440 445 Trp Asp Cys Lys Asn Trp Gln Trp Gly Gly Leu Ser Cys Asp His Tyr 450 455 460 Asp Glu Ala Lys Ile Thr Cys Ser Ala His Arg Lys Pro Arg Leu Val 465 470 475 480 Gly Gly Asp Ile Pro Cys Ser Gly Arg Val Glu Val Gln His Gly Asp 485 490 495 Thr Trp Gly Thr Val Cys Asp Ser Asp Phe Ser Leu Glu Ala Ala Ser 500 505 510 Val Leu Cys Arg Glu Leu Gln Cys Gly Thr Val Val Ser Leu Leu Gly 515 520 525 Gly Ala His Phe Gly Glu Gly Ser Gly Gln Ile Trp Ala Glu Glu Phe 530 535 540 Gln Cys Glu Gly His Glu Ser His Leu Ser Leu Cys Pro Val Ala Pro 545 550 555 560 Arg Pro Asp Gly Thr Cys Ser His Ser Arg Asp Val Gly Val Val Cys 565 570 575 Ser Arg Tyr Thr Gln Ile Arg Leu Val Asn Gly Lys Thr Pro Cys Glu 580 585 590 Gly Arg Val Glu Leu Asn Ile Leu Gly Ser Trp Gly Ser Leu Cys Asn 595 600 605 Ser His Trp Asp Met Glu Asp Ala His Val Leu Cys Gln Gln Leu Lys 610 615 620 Cys Gly Val Ala Leu Ser Ile Pro Gly Gly Ala Pro Phe Gly Lys Gly 625 630 635 640 Ser Glu Gln Val Trp Arg His Met Phe His Cys Thr Gly Thr Glu Lys 645 650 655 His Met Gly Asp Cys Ser Val Thr Ala Leu Gly Ala Ser Leu Cys Ser 660 665 670 Ser Gly Gln Val Ala Ser Val Ile Cys Ser Gly Asn Gln Ser Gln Thr 675 680 685 Leu Ser Pro Cys Asn Ser Ser Ser Ser Asp Pro Ser Ser Ser Ile Ile 690 695 700 Ser Glu Glu Asn Gly Val Ala Cys Ile Gly Ser Gly Gln Leu Arg Leu 705 710 715 720 Val Asp Gly Gly Gly Arg Cys Ala Gly Arg Val Glu Val Tyr His Glu 725 730 735 Gly Ser Trp Gly Thr Ile Cys Asp Asp Ser Trp Asp Leu Asn Asp Ala 740 745 750 His Val Val Cys Lys Gln Leu Ser Cys Gly Trp Ala Ile Asn Ala Thr 755 760 765 Gly Ser Ala His Phe Gly Glu Gly Thr Gly Pro Ile Trp Leu Asp Glu 770 775 780 Ile Asn Cys Asn Gly Lys Glu Ser His Ile Trp Gln Cys His Ser His 785 790 795 800 Gly Trp Gly Arg His Asn Cys Arg His Lys Glu Asp Ala Gly Val Ile 805 810 815 Cys Ser Glu Phe Met Ser Leu Arg Leu Ile Ser Glu Asn Ser Arg Glu 820 825 830 Thr Cys Ala Gly Arg Leu Glu Val Phe Tyr Asn Gly Ala Trp Gly Ser 835 840 845 Val Gly Lys Asn Ser Met Ser Pro Ala Thr Val Gly Val Val Cys Arg 850 855 860 Gln Leu Gly Cys Ala Asp Arg Gly Asp Ile Ser Pro Ala Ser Ser Asp 865 870 875 880 Lys Thr Val Ser Arg His Met Trp Val Asp Asn Val Gln Cys Pro Lys 885 890 895 Gly Pro Asp Thr Leu Trp Gln Cys Pro Ser Ser Pro Trp Lys Lys Arg 900 905 910 Leu Ala Ser Pro Ser Glu Glu Thr Trp Ile Thr Cys Ala Asn Lys Ile 915 920 925 Arg Leu Gln Glu Gly Asn Thr Asn Cys Ser Gly Arg Val Glu Ile Trp 930 935 940 Tyr Gly Gly Ser Trp Gly Thr Val Cys Asp Asp Ser Trp Asp Leu Glu 945 950 955 960 Asp Ala Gln Val Val Cys Arg Gln Leu Gly Cys Gly Ser Ala Leu Glu 965 970 975 Ala Gly Lys Glu Ala Ala Phe Gly Gln Gly Thr Gly Pro Ile Trp Leu 980 985 990 Asn Glu Val Lys Cys Lys Gly Asn Glu Thr Ser Leu Trp Asp Cys Pro 995 1000 1005 Ala Arg Ser Trp Gly His Ser Asp Cys Gly His Lys Glu Asp Ala Ala 1010 1015 1020 Val Thr Cys Ser Glu Ile Ala Lys Ser Arg Glu Ser Leu His Ala Thr 1025 1030 1035 1040 Gly Arg Ser Ser Phe Val Ala Leu Ala Ile Phe Gly Val Ile Leu Leu 1045 1050 1055 Ala Cys Leu Ile Ala Phe Leu Ile Trp Thr Gln Lys Arg Arg Gln Arg 1060 1065 1070 Gln Arg Leu Ser Val Phe Ser Gly Gly Glu Asn Ser Val His Gln Ile 1075 1080 1085 Gln Tyr Arg Glu Met Asn Ser Cys Leu Lys Ala Asp Glu Thr Asp Met 1090 1095 1100 Leu Asn Pro Ser Glu Asn Ser Asn Glu 1105 1110 <210> 20 <211> 1115 <212> DNA <213> Sus scrofa <400> 20 tggcaaagat tgtctttaaa atctgagctc catgtcttct gctttatttc tggtgtgcct 60 ttgactccag attacagtaa atggaggact gagtataggg ctaaaaagta gagagaatgg 120 atgcatatta tctgtggtct ccaatgtgat gatgaagta ggcaatact caaggaaag 180 agaaagcatg ctccaagaat tatggttcc agaaggcaaa gtcccagaat tgtctccagg 240 gaaggacagg gaggtctaga atcggctaag cccactgtag gcagaaaaac gaaggcaat 300 gatggcttc cctttctcac tttcactct ctggctct cttatcatga aggaaatat 360 tggaatcata ttctccctca ccgaatgct attttcag cccacaggaa acccaggctg 420 gttggagggg acatccctg ctctggtcgt gttgaagtac acatggaga cacgtggggc 480 accgtctgtg attctgactt ctctctggag gcggccagcg tgctgtgcag ggaactacag 540 tgcggcactg tggtttccct cctgggggga gctcacttg gagaggaag tggacagatc 600 tgggctgaag aattccagtg tgaggggcac gagtcccacc ttcactg cccagtagca 660 ccccgccctg acgggacatg tagccacagc agggacgtcg gcgtagtctg ctcaagtgag 720 acccagggaa tgtgttcact ttgttcccat gccatgaaga gggtagggtt aggtagtcac 780 agacatcttt ttaaagccct gtctccttcc agatacaca caatccgct tggtgaatgg 840 caagacccca tgtgaaggaa gagtggagct caacattctt gggtcctggg ggtccctctg 900 caactctcac tgggacatgg aagatgccca tgttttatgc cagcagctta aatgtggagt 960 tgccctttct atcccgggag gagcaccttt tgggaaagga agtgagcagg tctggaggca 1020 catgtttcac tgcactggga ctgagaagca catgggagat tgttccgtca ctgctctggg 1080 cgcatcactc tgttcttcag ggcaagtggc ctctg 1115 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <400> 21 ggtcgtgttg aagtacaaca 20 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <400> 22 caccggtcgt gttgaagtac aaca 24 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <400> 23 aaactgttgt acttcaacac gacc 24 <210> 24 <211> 100 <212> RNA <213> Artificial Sequence <400> 24 ggucguguug aaguacaaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 25 <211> 963 <212> PRT <213> Sus scrofa (pig) <400> 25 Met Ala Lys Gly Phe Tyr Ile Ser Lys Ala Leu Gly Ile Leu Gly Ile 1 5 10 15 Leu Leu Gly Val Ala Ala Val Ala Thr Ile Ile Ala Leu Ser Val Val 20 25 30 Tyr Ala Gln Glu Lys Asn Lys Asn Ala Glu His Val Pro Gln Ala Pro 35 40 45 Thr Ser Pro Thr Ile Thr Thr Thr Ala Ala Ile Thr Leu Asp Gln Ser 50 55 60 Lys Pro Trp Asn Arg Tyr Arg Leu Pro Thr Thr Leu Leu Pro Asp Ser 65 70 75 80 Tyr Phe Val Thr Leu Arg Pro Tyr Leu Thr Pro Asn Ala Asp Gly Leu 85 90 95 Tyr Ile Phe Lys Gly Lys Ser Ile Val Arg Leu Leu Cys Gln Glu Pro 100 105 110 Thr Asp Val Ile Ile Ile His Ser Lys Lys Leu Asn Tyr Thr Thr Gln 115 120 125 Gly His Met Val Val Leu Arg Gly Val Gly Asp Ser Gln Val Pro Glu 130 135 140 Ile Asp Arg Thr Glu Leu Val Glu Leu Thr Glu Tyr Leu Val Val His 145 150 155 160 Leu Lys Gly Ser Leu Gln Pro Gly His Met Tyr Glu Met Glu Ser Glu 165 170 175 Phe Gln Gly Glu Leu Ala Asp Asp Leu Ala Gly Phe Tyr Arg Ser Glu 180 185 190 Tyr Met Glu Gly Asn Val Lys Lys Val Leu Ala Thr Thr Gln Met Gln 195 200 205 Ser Thr Asp Ala Arg Lys Ser Phe Pro Cys Phe Asp Glu Pro Ala Met 210 215 220 Lys Ala Thr Phe Asn Ile Thr Leu Ile His Pro Asn Asn Leu Thr Ala 225 230 235 240 Leu Ser Asn Met Pro Pro Lys Gly Ser Ser Thr Pro Leu Ala Glu Asp 245 250 255 Pro Asn Trp Ser Val Thr Glu Phe Glu Thr Thr Pro Val Met Ser Thr 260 265 270 Tyr Leu Leu Ala Tyr Ile Val Ser Glu Phe Gln Ser Val Asn Glu Thr 275 280 285 Ala Gln Asn Gly Val Leu Ile Arg Ile Trp Ala Arg Pro Asn Ala Ile 290 295 300 Ala Glu Gly His Gly Met Tyr Ala Leu Asn Val Thr Gly Pro Ile Leu 305 310 315 320 Asn Phe Phe Ala Asn His Tyr Asn Thr Ser Tyr Pro Leu Pro Lys Ser 325 330 335 Asp Gln Ile Ala Leu Pro Asp Phe Asn Ala Gly Ala Met Glu Asn Trp 340 345 350 Gly Leu Val Thr Tyr Arg Glu Asn Ala Leu Leu Phe Asp Pro Gln Ser 355 360 365 Ser Ser Ile Ser Asn Lys Glu Arg Val Val Thr Val Ile Ala His Glu 370 375 380 Leu Ala His Gln Trp Phe Gly Asn Leu Val Thr Leu Ala Trp Trp Asn 385 390 395 400 Asp Leu Trp Leu Asn Glu Gly Phe Ala Ser Tyr Val Glu Tyr Leu Gly 405 410 415 Ala Asp His Ala Glu Pro Thr Trp Asn Leu Lys Asp Leu Ile Val Pro 420 425 430 Gly Asp Val Tyr Arg Val Met Ala Val Asp Ala Leu Ala Ser Ser His 435 440 445 Pro Leu Thr Thr Pro Ala Glu Glu Val Asn Thr Pro Ala Gln Ile Ser 450 455 460 Glu Met Phe Asp Ser Ile Ser Tyr Ser Lys Gly Ala Ser Val Ile Arg 465 470 475 480 Met Leu Ser Asn Phe Leu Thr Glu Asp Leu Phe Lys Glu Gly Leu Ala 485 490 495 Ser Tyr Leu His Ala Phe Ala Tyr Gln Asn Thr Thr Tyr Leu Asp Leu 500 505 510 Trp Glu His Leu Gln Lys Ala Val Asp Ala Gln Thr Ser Ile Arg Leu 515 520 525 Pro Asp Thr Val Arg Ala Ile Met Asp Arg Trp Thr Leu Gln Met Gly 530 535 540 Phe Pro Val Ile Thr Val Asp Thr Lys Thr Gly Asn Ile Ser Gln Lys 545 550 555 560 His Phe Leu Leu Asp Ser Glu Ser Asn Val Thr Arg Ser Ser Ala Phe 565 570 575 Asp Tyr Leu Trp Ile Val Pro Ile Ser Ser Ile Lys Asn Gly Val Met 580 585 590 Gln Asp His Tyr Trp Leu Arg Asp Val Ser Gln Ala Gln Asn Asp Leu 595 600 605 Phe Lys Thr Ala Ser Asp Asp Trp Val Leu Leu Asn Val Asn Val Thr 610 615 620 Gly Tyr Phe Gln Val Asn Tyr Asp Glu Asp Asn Trp Arg Met Ile Gln 625 630 635 640 His Gln Leu Gln Thr Asn Leu Ser Val Ile Pro Val Ile Asn Arg Ala 645 650 655 Gln Val Ile Tyr Asp Ser Phe Asn Leu Ala Thr Ala His Met Val Pro 660 665 670 Val Thr Leu Ala Leu Asp Asn Thr Leu Phe Leu Asn Gly Glu Lys Glu 675 680 685 Tyr Met Pro Trp Gln Ala Ala Leu Ser Ser Leu Ser Tyr Phe Ser Leu 690 695 700 Met Phe Asp Arg Ser Glu Val Tyr Gly Pro Met Lys Lys Tyr Leu Arg 705 710 715 720 Lys Gln Val Glu Pro Leu Phe Gln His Phe Glu Thr Leu Thr Lys Asn 725 730 735 Trp Thr Glu Arg Pro Glu Asn Leu Met Asp Gln Tyr Ser Glu Ile Asn 740 745 750 Ala Ile Ser Thr Ala Cys Ser Asn Gly Leu Pro Gln Cys Glu Asn Leu 755 760 765 Ala Lys Thr Leu Phe Asp Gln Trp Met Ser Asp Pro Glu Asn Asn Pro 770 775 780 Ile His Pro Asn Leu Arg Ser Thr Ile Tyr Cys Asn Ala Ile Ala Gln 785 790 795 800 Gly Gly Gln Asp Gln Trp Asp Phe Ala Trp Gly Gln Leu Gln Gln Ala 805 810 815 Gln Leu Val Asn Glu Ala Asp Lys Leu Arg Ser Ala Leu Ala Cys Ser 820 825 830 Asn Glu Val Trp Leu Leu Asn Arg Tyr Leu Gly Tyr Thr Leu Asn Pro 835 840 845 Asp Leu Ile Arg Lys Gln Asp Ala Thr Ser Thr Ile Asn Ser Ile Ala 850 855 860 Ser Asn Val Ile Gly Gln Pro Leu Ala Trp Asp Phe Val Gln Ser Asn 865 870 875 880 Trp Lys Lys Leu Phe Gln Asp Tyr Gly Gly Gly Ser Phe Ser Phe Ser 885 890 895 Asn Leu Ile Gln Gly Val Thr Arg Arg Phe Ser Ser Glu Phe Glu Leu 900 905 910 Gln Gln Leu Glu Gln Phe Lys Lys Asn Asn Met Asp Val Gly Phe Gly 915 920 925 Ser Gly Thr Arg Ala Leu Glu Gln Ala Leu Glu Lys Thr Lys Ala Asn 930 935 940 Ile Lys Trp Val Lys Glu Asn Lys Glu Val Val Leu Asn Trp Phe Ile 945 950 955 960 Glu His Ser <210> 26 <211> 1203 <212> DNA <213> Sus scrofa <400> 26 ctgccacctg cccttcagcc cttggtgggc tcccaggctc ctgcagcctg taaccagacc 60 ctgtttgctc ccagcaggca cccctgagcc gcactccgca cgctgttcct gaatctcccc 120 tccagaaccg gagcagtgtc tctacccagt tcagtgacct tcgtctgtct gagccctggt 180 taatttttgc ccagtctgca ggctgtgggg ctcctcccct tcagggatat aagcctggtc 240 cgaagctgcc ctgtcccctg cccgtcctga gcctccccga gctcccttct caccctcacc 300 atggccaagg gattctacat ttccaaggcc ctgggcatcc tgggcatcct cctcggcgtg 360 gcggccgtgg ccaccatcat cgctctgtct gtggtgtacg cccaggagaa gaacaagaat 420 gccgagcatg tcccccaggc ccccacgtcg cccaccatca ccaccacagc cgccatcacc 480 ttggaccaga gcaagccgtg gaaccggtac cgcctaccca caacgctgtt gcctgattcc 540 tacaacgtga cgctgagacc ctacctcact cccaacgcgg atggcctgta catcttcaag 600 ggcaaaagca tcgtccgctt catctgccag gagcccaccg atgtcatcat catccatagc 660 aagaagctca actacaccac ccaggggcac atggtggtcc tgcggggcgt gggggactcc 720 caggtcccag agatcgacag gactgagctg gtagagctca ctgagtacct ggtggtccac 780 ctcaagggct cgctgcagcc cggccacatg tacgagatgg agagtgaatt ccagggggaa 840 cttgccgacg acctggcagg cttctaccgc agcgagtaca tggagggcaa cgtcaaaaag 900 taagtcaggt gggggcacac cctagatgct gaggcagagc tggatcctgg gggccaagga 960 agggcttgga ttcgggacct tggaaccttc tggagacttt ggctggcccg tcgctccatc 1020 cgcagctctg gtagagaagc tatctagaca atcagccctt tcccggagag cccccctaac 1080 cttagggagt caggggtgag tgatccaagt gcccccttgg gtagaaagga aaacaggctc tgaggacaga aatttgccca aggtctccca gctaattcag gggtggagcc tgcccggact ttg 1203 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <400> 27 gaggatgccc aggatgccca <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <400> 28 caccgaggat gcccaggatg ccca <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <400> 29 24. aaactgggca tcctgggcat cctc <210> 30 <211> 100 <212> RNA <213> Artificial Sequence <400> 30 gaggaugccc aggaugccca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

Claims

1. A CRISPR / Cas9 system for editing the INHA-CD163-pAPN gene in pigs, characterized in that, The invention comprises a Cas9 expression vector, a gRNA expression vector targeting the porcine INHA gene, a gRNA expression vector targeting the porcine CD163 gene, and a gRNA expression vector targeting the porcine pAPN gene. The full-length plasmid sequence of the Cas9 expression vector is shown in SEQ ID NO.

2. The gRNA expression vector targeting the porcine INHA gene expresses the gRNA shown in SEQ ID NO. 18, with its target shown in SEQ ID NO.

15. The gRNA expression vector targeting the porcine CD163 gene expresses the gRNA shown in SEQ ID NO. 24, with its target shown in SEQ ID NO.

21. The gRNA expression vector targeting the porcine pAPN gene expresses the gRNA shown in SEQ ID NO. 30, with its target shown in SEQ ID NO.

27. The gRNA expression vector targeting the porcine INHA gene is obtained by annealing the single-stranded DNA shown in SEQ ID NO. 16 and SEQ ID NO. 17 to form a double-stranded insert vector backbone pKG-U6gRNA. The gRNA expression vector targeting the porcine CD163 gene is obtained by annealing the single-stranded DNA shown in SEQ ID NO. 22 and SEQ ID NO.

17. The double-stranded insert vector backbone pKG-U6gRNA, derived from the annealed single-stranded DNA shown in NO.23, is obtained; the gRNA expression vector targeting the porcine pAPN gene is derived from the double-stranded insert vector backbone pKG-U6gRNA, derived from the annealed single-stranded DNA shown in SEQ ID NO.28 and SEQ ID NO.29; the vector backbones of the gRNA expression vectors targeting the porcine INHA gene, the porcine CD163 gene, and the porcine pAPN gene are all pKG-U6gRNA, and their full plasmid sequences are shown in SEQ ID NO.3; the molar ratio of the gRNA expression vector targeting the porcine INHA gene: the gRNA expression vector targeting the porcine CD163 gene: the gRNA expression vector targeting the porcine pAPN gene: the Cas9 expression vector is 1:1:1:

1.

2. The application of the CRISPR / Cas9 system according to claim 1 in constructing recombinant porcine cells with mutations in the INHA, CD163, and pAPN genes.

3. A recombinant cell with INHA, CD163, and pAPN genes knocked out, characterized in that... The results were obtained by co-transfection of porcine primary fibroblasts with the CRISPR / Cas9 system as described in claim 1, and subsequently verified.

4. The application of the recombinant cells described in claim 3 in the construction of cloned pigs with the INHA, CD163 and pAPN triple gene knockout.

Images