Genetically engineered cyanobacteria grown under non-sterile conditions using antibiotic-free selection

Abstract

The present invention relates to methods of metabolically engineering cells to increase their ability to compete with contaminating microorganisms without the need for antibiotics. More particularly, the present invention provides methods of engineering cyanobacteria to utilize melamine as a nitrogen source, phosphite as a phosphorous source, optionally also utilizing NADP+ instead of NAD+, and also provides genetically engineered cyanobacteria made using such methods. In particular embodiments, the genetically engineered cells are cyanobacteria transformed with at least one polynucleotide molecule comprising heterologous melamine utilization pathway genes atzD, trzE, DUR1,2, trzC, guaD, and triA operably linked to at least one promoter and / or comprising a further phosphite dehydrogenase (ptxD) gene.

Description

[0001] Invention Field This invention relates to a method for increasing the ability of metabolically engineered cells to compete with contaminating microorganisms without the need for antibiotics. More specifically, the invention provides a method for engineering cyanobacteria to utilize melamine as a nitrogen source, phosphite as a phosphorus source, and optionally also NADP+ instead of NAD+, and also provides genetically engineered cells produced using this method. Background Technology

[0002] As part of efforts to advance a carbon-neutral economy, cyanobacteria are increasingly being used in metabolic engineering. They are photosynthetic autotrophs capable of growing with fairly simple requirements—minimal culture media with inorganic nitrogen and phosphorus sources, using light for energy generation, and employing CO2 as their sole carbon input. In recent years, cyanobacteria have been shown to produce a wide variety of molecules, from commercial chemicals such as lactates or ethanol [Angermayr et al., Applied and environmental microbiology . 78:7098-106.10.1128 / AEM.01587-12 (2012); Dexter et al., J Appl Microbiol 119:11-24.10.1111 / jam.12821 (2015); Gordon et al., Metab Eng . 38:170-179.10.1016 / j.ymben.2016.07.007 (2016), to biofuels (e.g., free fatty acids [Kato et al., Biotechnol Biofuels . 10: 141.10.1186 / s13068-017-0831-z (2017); Ruffing, Frontiers in bioengineering and biotechnology . 2: 17 (2014)] or butanol [Fathima et al., Biotechnol Biofuels 11: 188.10.1186 / s13068-018-1187-8 (2018); Shabestary et al., ACS Synth Biol . 7: 1669-1675 (2018)] to specific chemicals such as farnesene [Halfmann et al, Appl Microbiol Biotechnol . 98: 9869 (2014)], squalene [Choi et al., . 98: 9869 (2014)], ACS Synth Biol 6: 1289-1295 (2017); Englund et al., PLoS One . 9: e90270.10.1371 / journal.pone.0090270 (2014)] or limonene [Wang et al., Proceedings of the NationalAcademy of Sciences of the United States of America . 113: 14225-14230 (2016)]. Rapidly growing marine strains, such as Synechococcus ( Synechococcus sp.)PCC 7002 (hereinafter “Syn7002”) has attracted particular attention because it can grow in seawater (and therefore does not compete for freshwater resources), tolerates high light intensity and temperatures up to 40ºC (useful in large open-air facilities). Furthermore, it is naturally convertible, has an optimal division time of approximately 4 hours, and a usable genome sequence [Begemann et al., PLoS One 8:e76594.10.1371 / journal.pone.0076594 (2013); Clark et al., Metab Eng 47: 230-242 (2018); Frigaard et al., Methods Mol Biol 274: 325-40 (2004); Gordon et al., Metab Eng . 38:170-179.10.1016 / j.ymben.2016.07.007 (2016); Ludwig and Bryant, Frontiers in microbiology . 2: 41 (2011); Ludwig and Bryant, Frontiers in microbiology 3:354 (2012); Markley et al., ACS Synth Biol 4: 595 (2015); Perez et al., Journal of bacteriology .10: 1128 (2016); Xu et al., Methods Mol Biol . 684: 273-93 (2011)].

[0003] Large cyanobacterial cultures can be carried out in semi-closed systems such as hanging bags, or in open systems such as raceway tanks or airlift reservoirs [Schoepp et al., Bioresour Technol [166: 273-81 (2014)]. Closed systems offer advantages such as greater controllability, less chance of culture contamination, and generally higher growth yields. However, closed systems are generally more expensive to operate compared to open systems with airlift reservoirs or raceway tanks, which are the most economically viable alternatives discovered to date [Schoepp et al., 166: 273-81 (2014)]. Bioresour Technol[166: 273-81 (2014)]. On the other hand, open systems have the significant disadvantage of being exposed to the environment and are therefore more susceptible to contamination. The threat of contamination is usually minimized by using antibiotics and antibiotic-resistant cyanobacterial strains. Running large open systems with cyanobacterial strains carrying antibiotic resistance genes poses a serious biohazard once the culture escapes and may contribute to the spread of antibiotic resistance to environmentally pathogenic species through horizontal gene transfer.

[0004] Recently, the use of ecologically rare or xenobiotic macronutrients has been explored as a means to generate selective pressure on the growth of transgenic organisms without the use of antibiotics [Kanda et al., J Biotechnol . 182: 68-73(2014); Loera-Quezada et al., Plant Biotechnol J 14: 2066 (2016); Pandeya et al., Plant Mol Biol . 95: 567-577 (2017); Polyviou et al., Environmental microbiology reports 7: 824-30 (2015); Shaw et al., Science . 353: 583-6 (2016)] and allowing transgenic plants to compete with weeds while consuming significantly less phosphorus [Lopez-Arredondo and Herrera-Estrella, Nat Biotechnol . 30: 889 (2012)]. Phosphite dehydrogenase (PtxD) is an enzyme that converts phosphite (an ecologically rare form of phosphorus) to phosphate and has been introduced into a variety of organisms [Kanda et al., 30: 889 (2012)]. J Biotechnol . 182:68-73 (2014); Lopez-Arredondo and Herrera-Estrella, Nat Biotechnol . 30: 889(2012); Nahampun et al., Plant Cell Rep 35: 1121-1132 (2016); Pandeya et al., Plant Mol Biol [95: 567-577 (2017)]. A synthetic pathway utilizing the xenobiotic nitrogen-rich compound melamine has also been devised and introduced into various organisms [Shaw et al., 95: 567-577 (2017)]. Science . 353: 583-6 (2016)]. In Escherichia coli ( Escherichia coli The introduction of a complete pathway (consisting of 6 enzymes) allows the carrier strain to overcome intentional contamination [Shaw et al., Science. 353: 583-6 (2016)].

[0005] In many cases, antibiotic kits are used to introduce these pathways or genes into target organisms [Loera-Quezada et al., Plant Biotechnol J 14: 2066 (2016); Motomura et al., ACS Synth Biol .10:1021(2018); Shaw et al., Science [353: 583-6 (2016)]. Even if this demonstrates that these pathways provide an advantage to organisms carrying them, the risk of horizontal gene transfer of one or more antibiotic resistance cassettes remains.

[0006] In view of the above-mentioned shortcomings, it is desirable to provide a method for producing engineered microorganisms that can compete more effectively with pollutants without the risk of transferring antibiotic resistance genes into the environment. Summary of the Invention

[0007] This invention provides a method for engineering cyanobacterial strains capable of growing on melamine and / or phosphite as the sole N and Pi source, driving their genome integration through metabolic selection without antibiotic selection. Seven different *Synechococcus* PCC 7002 mutant strains capable of growing on melamine as the sole N source were obtained through laboratory evolution. Additionally, using… ptxD Genes or their mutants and phosphite have also been shown to be effective markers of metabolic selection in this cyanobacterial species. Cells transformed with melamine and phosphite metabolic pathways were able to grow using melamine and phosphite as N and Pi sources, respectively, and were tolerant of and easily competed for overcontamination, even in large amounts of excessive contamination.

[0008] Melamine mutant strains all have an impact. triA The gene mutations, denoted as Mel 1, include the Trp471stop mutation; Mel 4, the Leu88Phe mutation; Mel 5, the AGGAGA to AGAAGA mutation at the ribosome binding site (RBS); Mel 6, the Glu317Lys mutation; Mel 7, the His254Tyr mutation; Mel 8, the Ala355Val mutation; and Mel 5evo, which, in addition to having the same AGGAGA to AGAAGA mutation at the RBS as Mel 5, also exhibits mutations in... triA It contains Thr218Asn mutation and Val278Met mutation.

[0009] According to a first aspect, the present invention provides an isolated genetically engineered cyanobacterium, wherein the cyanobacterium has been transformed with at least one polynucleotide molecule, said at least one polynucleotide molecule comprising a heterologous melamine utilization pathway gene operably linked to at least one promoter. atzD, trzE, DUR1,2, trzC, guaD and triA ,in; i) The above triA The gene includes one or more mutations encoding amino acid substitutions, wherein the amino acid substitutions are located at positions selected from the group consisting of: Leu88Phe, His254Tyr, Glu317Lys, Ala355Val, Trp471Stop, and combinations of Thr218Asn and Val278Met. and / or ii) The triA Genes have AG G AGA to AG A AGA mutation ribosome binding site (RBS), The genetically engineered cyanobacteria do not possess heterologous antibiotic resistance genes.

[0010] According to another aspect, the present invention provides isolated genetically engineered cyanobacteria, wherein the cyanobacteria have been transformed with at least one polynucleotide molecule, said at least one polynucleotide molecule comprising a heterologous phosphite dehydrogenase operably linked to a promoter. ptxD ) gene, wherein, ptxD The gene includes the polynucleotide sequence shown in SEQ ID NO: 89 (natural), SEQ ID NO: 90 (MelPhi), or SEQ ID NO: 91 (NADP). The genetically engineered cyanobacteria do not possess heterologous antibiotic resistance genes.

[0011] According to another aspect, the present invention provides a recombinant vector comprising a melamine pathway gene operatively linked to at least one promoter. triA , DUR1,2 , atzD , trzC , trzE and guaD ,in i) The above triA The gene includes one or more mutations encoding amino acid substitutions, wherein the amino acid substitutions are located at positions selected from the group consisting of: Leu88Phe, His254Tyr, Glu317Lys, Ala355Val, Trp471Stop, and combinations of 254His and Val278Met. and / or ii) The triA Genes have AG G AGA to AG A AGA mutation ribosome binding site (RBS), The vector lacks the antibiotic resistance gene.

[0012] In some embodiments, the recombinant vector further comprises a polynucleotide including a heterologous phosphite dehydrogenase operably linked to a promoter. ptxD )Gene.

[0013] According to another aspect, the present invention provides a method for expressing a product in genetically engineered cyanobacterial cells, comprising the steps of: a) According to any aspect of the invention, a plurality of genetically engineered cyanobacterial cells are cultured in an antibiotic-free medium with melamine as the nitrogen source, said genetically engineered cyanobacterial cells comprising heterologous melamine utilization pathway genes and at least one exogenous polynucleotide comprising an expressible polynucleotide encoding RNA and / or protein products, wherein the culture promotes the growth of cyanobacterial cells that metabolize melamine. b) Culture the genetically engineered cyanobacterial cells under conditions suitable for expressing the product.

[0014] According to another aspect, the present invention provides a method for expressing a product in genetically engineered cyanobacterial cells, comprising the steps of: a) In an antibiotic-free culture medium using melamine as the nitrogen source and phosphite as the phosphorus source, multiple genetically engineered cyanobacterial cells are cultured, said genetically engineered cyanobacterial cells comprising heterologous melamine utilization pathway genes and phosphite metabolism genes, and at least one exogenous polynucleotide including an expressible polynucleotide encoding RNA and / or protein products, wherein the culture promotes the growth of cyanobacterial cells that metabolize melamine and phosphite; b) Culture the genetically engineered cyanobacterial cells under conditions suitable for expressing the product. Attached Figure Description

[0015] Figure 1 An overview of the melamine selection tool is shown. (A) Melamine utilization pathway reaction. One mol of melamine produces 6 mol of ammonia and 3 mol of carbon dioxide. (B) Schematic diagram of the melamine utilization operon. The primers shown are used to confirm whole-genome integration via this pathway. Different parts are not proportional. (C) 0.6% agarose gel PCR reaction was performed using the primers shown in A. (See sequences in Table 1) Figure 2The growth of melamine-utilizing strains in melamine-containing medium is shown. (A) Growth curves of wild-type (WT) Syn7002 and melamine-utilizing strains. (B) Culture samples 48 hours after inoculation. OD values ​​were calculated for all strains. 730 Converted to gram of stem cell weight (gDCW)·L -1 The factors are listed in Table 2.

[0016] Figure 3A-3B This shows the results, as discovered by Illumina sequencing, in different melamine-using strains. triA A schematic diagram of mutations at a gene locus. Mel1 has a 4-amino acid mutation before the original stop codon. Figure 3A Among different strains that utilize melamine, triA Multiple sequence alignment of loci ( Figure 3B ).

[0017] Figure 4 The LC-MS / MS quantification of melamine pathway intermediates in used culture medium at indicated time points is shown. (A) Melamine; (B) cyanuric acid diamide; (C) cyanuric acid monoamide; (D) cyanuric acid. Quantification of WT cultures inoculated in AD7-Mel medium is also included as a control. Note the difference in the proportions of melamine (in mM) and the remaining intermediates (in μM). Error bars may not be apparent due to proportions.

[0018] Figure 5 The growth curves of Mel5 strain grown in AD7-Mel medium containing 2 mM or 4 mM melamine are shown.

[0019] Figure 6 The growth of phosphite-utilizing strains in AD7 medium containing phosphate (Pho) and phosphite (Phi) is shown. (A) Growth curves of WT Syn7002 (left) and phosphite-utilizing strains (right) in AD7 medium containing Pho or different concentrations of Phi are shown. (B) Details of culture samples 48 hours after inoculation. The OD... 730 Converted to gram of stem cell weight (gDCW)·L -1 Factors.

[0020] Figure 7 shows an overview of the phosphite selection tool. (A) Top – Details of pSJ135, including primers for chromosome integration PCR. Bottom – Details of the construct pSJ141, which uses phosphite to drive heterologous genes (…). YFP (B) Chromosomal integration. PCR on 0.8% agarose gel, showing results against both WT and Mel5 backgrounds.ptxD Genome integration of genes and YFP Genes ptxD Driven integration. (C) YFP fluorescence of strains transformed with pSJ135 and pSJ141 relative to their respective background strains.

[0021] Figure 8A-8C This shows the knockout of the putative phosphonate transporter homolog in Syn7002. A0336 (top) and G0143 (bottom).( Figure 8A A schematic diagram of the knockout constructs pSJ156 (top) and pSJ157 (bottom). Elements are not to scale. Figure 8B ()Isolation gel for phosphonate transporter homolog knockout strains proposed by A0935-ptxD. Figure 8C Diluted platings of the A0935-ptxD parental strain and its derived knockout strain in AD7-Pho 1x (left) or AD7-Phi 20x (right). Note: ΔA – ΔA0336 :: SpR ΔG – ΔG0143 :: GmR Figure 9 Characterization of strains utilizing melamine and phosphite is shown. (A) Growth curves of WT and Mel5-A0935ptxD (“MelPhi”) strains in standard AD7 medium or AD7-MelPhi 20x. (B) Details of culture samples 48 hours after inoculation. For MelPhi strains in AD7-Mel Pho 1x or AD7-Mel Phi 20x, the OD200 was calculated. 730 Converted to gram of stem cell weight (gDCW)·L -1 The factors, and these factors can be found in Table 2. (C) The following growth curves were measured by flow cytometry: strains expressing YFP in a Syn7002 WT background (“pure YFP”, grown in conventional AD7); MelPhi strains (“pure MelPhi”, YFP-deficient, grown in AD7-MelPhi 20x); or mixed cultures of two strains in AD7-MelPhi 20x, with YFP (in WT background) and MelPhi (YFP-deficient) at a cell ratio of 6:1. “Mixed YFP” is the cell count of the YFP strain in the mixture, and “Mixed MelPhi” is the cell count of the MelPhi strain in the mixture.

[0022] Figure 10Growth curves of WT, Mel5, and Re-Mel5 strains in normal AD7-NO3 or AD7-Mel are shown.

[0023] Figure 11 The following growth curves, measured by flow cytometry, are shown: a strain expressing YFP in a Syn7002 WT background (“pure YFP”, grown in conventional AD7); a MelPhi strain (“pure MelPhi”, YFP-deficient, grown in AD7-MelPhi20x); or a mixed culture of two strains (“mixed YFP” and “mixed MelPhi”) in AD7-MelPhi 20x, with YFP (in a WT background) and MelPhi (YFP-deficient) combined at a cell ratio of 10:1.

[0024] Figure 12 The gating strategy used for cell counting in contamination experiments is illustrated. The data shown are for one of the 10:1 mixed culture experiments at T=100 h. Left gate (top to bottom) plotted on a dot plot of pure YFP and MelPhi cultures and mixed cultures; middle histogram plot of the same samples; right dot plot of the same samples using YFP with forward scattering for quantification. SSC – Side scattering; FSC – Forward scattering. Figure 13 Growth curves of Syn7002 WT and strains utilizing melamine and phosphite are shown in AD7 with nitrate (NO3) or melamine (Mel) and phosphate (Pho) or phosphite (Phi). All plates were grown at 30ºC and 80 μE·m. -2 ·s -1 Grow for 5 days under 1% CO2.

[0025] Figure 14 The growth curves of the MelPhi strain in AD7-Mel Phi 20x (2 L total culture volume) are shown over an 11-day period in two 1 L conical flasks with baffles.

[0026] Figure 15 Growth curves for the MelPhi strain (MelPhi WT) and its derivative (MelPhi AQ) are shown, in which the PtxD enzyme was mutated to use NADP+ instead of NAD+ (because cyanobacteria have more NADP+ than NAD+). The strain was grown using a fed-batch strategy, with melamine added daily (600 µL of 20 mM melamine stock solution added to 12 mL of culture) to continue growth to higher densities. The highest density achieved was approximately 70 OD. 730 .

[0027] Figure 16 Growth curves of strain Mel5 and an evolved strain of Mel5 (referred to as "Mel5evo") in 12 mM melamine are shown. Strain Mel5 could not grow in 12 mM melamine, but strain Mel5evo could and grew to approximately 50% OD. 730 . Definition For convenience, certain terms used in the specification, embodiments and appended claims are collected herein.

[0028] As used herein, the term “amino acid” or “amino acid sequence” refers to an oligopeptide, peptide, polypeptide, or protein sequence, or any fragment thereof, and refers to a naturally occurring or synthetic molecule. The “amino acid sequence” as used herein refers to the amino acid sequence of a naturally occurring protein molecule, and “amino acid sequence” and similar terms are not intended to limit the amino acid sequence to the complete natural amino acid sequence associated with said protein molecule.

[0029] As used herein, the term "comprising" or "including" should be interpreted as specifying the presence of the referred feature, integer, step, or component, but does not exclude the presence or addition of one or more features, integers, steps, or components or groups thereof. However, in the context of this disclosure, the term "comprising" or "including" also includes "consisting of". The word "comprising", such as "comprise" and "comprises", and "including", such as "include" and "includes", have variations with correspondingly changing meanings.

[0030] As used herein, the term "gene mutation" is defined as a gene mutation that has at least one nucleotide sequence that differs from the wild-type sequence by a substitution, deletion, or addition of at least one nucleotide that can enhance gene activity or result in a protein encoding an amino acid sequence that is relatively more active than the wild-type protein. For example, at least one natural or wild-type melamine deaminase (…) can be mutated. triA ) Genes and / or their ribosome binding sites (RBS) AGGAGA to increase melamine metabolism. The term "isolated" is defined herein as biological components (such as nucleic acids, peptides, or proteins) that are essentially separated, produced separately, or purified from other biological components (i.e., other chromosomes and extra chromosomal DNA and RNA) and proteins in the cells of an organism that contains naturally occurring components. Therefore, isolated nucleic acids, peptides, and proteins include nucleic acids and proteins purified using standard purification methods. The term also encompasses nucleic acids, peptides, and proteins prepared through recombinant expression in host cells, as well as chemically synthesized nucleic acids.

[0031] As used herein, the phrase “nucleic acid” or “nucleic acid sequence” means oligonucleotide, nucleotide, polynucleotide or any fragment thereof, refers to genomic or synthetic DNA or RNA that may be single-stranded or double-stranded and may represent a sense strand and an antisense strand, refers to peptide nucleic acid (PNA), or refers to any DNA- or RNA-like material.

[0032] As used herein, the term "operably linked" means that the components to which the term is applied are in a relationship that allows them to perform their inherent functions under appropriate conditions. For example, linking a control sequence to a protein-coding sequence that is "operably linked" to it enables the expression of the protein-coding sequence under conditions compatible with the transcriptional activity of the control sequence. By way of example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when they are in a functional relationship. For example, a promoter is operably linked to a coding sequence if it affects the transcription or expression of the coding sequence. Typically, operably linked DNA sequences are contiguous and, where binding to two protein-coding regions is required, they are in the same reading frame.

[0033] As used herein, the term "mutant" refers to a polynucleotide that can encode an exemplary catalytic enzyme that retains its activity, or that can have a mutation, for example, in its RBS, that enhances catalytic enzyme production. As used herein, a "mutant" of a catalytic enzyme refers to an amino acid sequence altered by one or more amino acids. Mutants can have "conserved" changes, where the substituted amino acids have similar structural or chemical properties (e.g., leucine replaced by isoleucine). Less commonly, mutants can have "non-conserved" changes (e.g., glycine replaced by tryptophan). Similar minor changes may also include amino acid deletions or insertions, or both. Using computer programs well known in the art, such as DNASTAR software, guidance can be found to determine which amino acid residues can be substituted, inserted, or deleted without loss of catalytic activity. In some embodiments, the mutant enzyme has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or higher, preferably at least 90%, homology or identity at the amino acid level, exemplifying the amino acid sequence described herein (e.g., melamine deaminase) or a functional fragment thereof—for example, at a length of about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100%, preferably at least 90% of the length of the mature reference sequence, while still maintaining catalytic activity. Preferably, the mutant enzyme has at least 90% identity at the amino acid level and maintains catalytic activity. An exemplary melamine deaminase mutant is represented as SEQ ID NO: 64 in Mel7 (SEQ ID NO: 87) with His254Tyr substitution for increased activity. 254Tyr may be substituted with other amino acids (conservative substitution) and retain activity.

[0034] The vector may comprise one or more catalytic enzyme nucleic acids in the form of one or more nucleic acids suitable for expression in a host cell. Preferably, the recombinant expression vector includes one or more regulatory sequences operatively linked to one or more pre-expressed nucleic acid sequences. The term "regulatory sequence" includes promoters, enhancers, ribosome binding sites and / or IRES elements and other expression control elements (e.g., polyadenylation signals). Regulatory sequences include those that direct constitutive expression of nucleotide sequences, such as P disclosed in the examples herein. c223 Promoter. The design of the expression vector can depend on factors such as the selection of the pre-transformed host cell and the desired protein expression level. The expression vectors of the present invention can be introduced into host cells to produce proteins or peptides (e.g., catalytic enzyme proteins) encoded by nucleic acids as described herein, including fusion proteins or peptides. The recombinant expression vectors of the present invention can be designed for the expression of catalytic enzyme proteins in prokaryotic or eukaryotic cells, more particularly in prokaryotic cells. For example, the peptides of the present invention can be expressed in bacterial (e.g., cyanobacteria) or yeast cells. Suitable host cells are further discussed in Goeddel, (1990) Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California.

[0035] The methods described above utilize a sequence of enzyme-catalyzed reactions. While these reactions can be carried out individually or, more particularly, in combination of two or more of them, it is especially preferred that all reactions be combined in a cascade reaction sequence that provides the product from the initial starting material in one pot, thereby eliminating the need for separating intermediates and potentially increasing the overall yield of the reaction sequence.

[0036] In this invention, the novel engineered bacteria do not contain antibiotic resistance genes and instead compete with contaminants using melamine and phosphite. Furthermore, the engineered cells of this invention... triA Mutations are included in genes and / or in their RBS that improve the growth of the organisms, some of which can grow robustly in 12 mM melamine. Additionally, phosphite metabolism genes... ptxD It can be mutated to utilize NADP+ instead of NAD+. Detailed Implementation

[0037] The references mentioned in this specification are listed in the form of a bibliography for convenience and are appended to the end of the embodiments. The full context of these references is incorporated herein by reference, but their inclusion in the specification does not imply that they constitute part of general common sense.

[0038] According to a first aspect, the present invention provides an isolated genetically engineered cyanobacterium, wherein the cyanobacterium has been transformed with at least one polynucleotide molecule, said at least one polynucleotide molecule comprising a heterologous melamine utilization pathway gene operably linked to at least one promoter. atzD, trzE, DUR1,2, trzC, guaD and triA ,in; i) The above triA The gene includes one or more mutations encoding amino acid substitutions, wherein the amino acid substitutions are located at positions selected from the group consisting of: Leu88Phe, His254Tyr, Glu317Lys, Ala355Val, Trp471Stop, and combinations of Thr218Asn and Val278Met. and / or ii) The triA Genes have AG G AGA to AG A AGA mutation ribosome binding site (RBS), The genetically engineered cyanobacteria do not possess heterologous antibiotic resistance genes.

[0039] In some implementations, the cyanobacterium is Syn7002.

[0040] In some implementations... triA The gene encodes an amino acid sequence selected from the following groups: SEQ ID NO:56 (natural, Mel5), SEQ ID NO:58 (Mel1), SEQ ID NO:60 (Mel4), SEQ ID NO:62 (Mel6), SEQ ID NO:64 (Mel7), SEQ ID NO:66 (Mel8), and SEQ ID NO:68 (Mel5evo). In some embodiments, triA The gene polynucleotide sequence has a similarity to that selected from the following groups. triA The gene has at least 80%, at least 85%, at least 90%, at least 95% sequence identity or 100% sequence identity: SEQ ID NO: 57, SEQ ID NO: 59 (Mel1), SEQ ID NO: 61 (Mel4), SEQ ID NO: 63 (Mel6), SEQ ID NO: 65 (Mel7), SEQ ID NO: 67 (Mel8), SEQ ID NO: 69 (Mel5evo) and SEQ ID NO: 70 (Mel5).

[0041] It should be understood that, due to redundancy in the genetic code, nucleic acid sequences can have less than 100% identity and still encode the same amino acid sequence.

[0042] In some implementations... triA The gene comprises a polynucleotide sequence selected from the group consisting of: SEQ ID NO: 57 (natural), SEQ ID NO: 59 (Mel1), SEQ ID NO: 61 (Mel4), SEQ ID NO: 63 (Mel6), SEQ ID NO: 65 (Mel7), SEQ ID NO: 67 (Mel8), SEQ ID NO: 69 (Mel5evo), and SEQ ID NO: 70 (Mel5 codon opt).

[0043] Preferably, triAThe gene includes the polynucleotide sequence shown in SEQ ID NO: 69 or SEQ ID NO: 70.

[0044] In some implementations, heterogeneous sources trzE The gene includes a polynucleotide sequence that has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with the polynucleotide sequence shown in SEQ ID NO: 71 or 72; trzC The gene comprises a polynucleotide sequence that has at least 80%, at least 85%, at least 90%, at least 95% sequence identity or 100% sequence identity with the polynucleotide sequence shown in SEQ ID NO: 73 or 74; DUR1,2 The gene includes a polynucleotide sequence that has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with the polynucleotide sequence shown in SEQ ID NO: 75 or 76; atzD The gene includes a polynucleotide sequence that has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with the polynucleotide sequence shown in SEQ ID NO: 77 or 78; and / or guaD The gene includes a polynucleotide sequence that has at least 80%, at least 85%, at least 90%, at least 95% sequence identity or 100% sequence identity with the polynucleotide sequence shown in SEQ ID NO: 79, 80 or 81 (Arg352Ser).

[0045] In some implementations, heterogeneous sources trzE The gene includes the polynucleotide sequence shown in SEQ ID NO: 71 or 72 (codon optimized); trzC The gene includes the polynucleotide sequence shown in SEQ ID NO: 73 or 74 (codon optimized); DUR1,2 The gene includes the polynucleotide sequence shown in SEQ ID NO: 75 or 76 (codon optimized); atzD The gene includes the polynucleotide sequence shown in SEQ ID NO: 77 or 78 (codon-optimized); and / or guaD The gene includes the polynucleotide sequence shown in SEQ ID NO: 79, 80 (codon-optimized) or 81 (Arg352Ser).

[0046] In some implementations... atzD The gene comes from Pseudomonas ( Pseudomonas sp.) strain ADP, trzE The gene comes from Rhodococcus ( Rhodococcus sp.)Mel、 DUR1,2 The gene comes from brewer's yeast. (S. cerevisiae ), trzC Genes come from Bacterial fruit spot disease of cucurbits ( A. citrulli )NRRL B-12227、 guaD The gene comes from E. coli K-12 and triA The gene comes from NRRL B-12227, a bacterial causal agent of fruit spot disease in cucurbits.

[0047] In some embodiments, each of the melamine utilization pathway genes has a ribosome binding site (RBS). Suitable examples of RBSs have the polynucleotide sequence AGGAGA. Advantageously, mutant RBSs comprising the polynucleotide sequence AGAAGA can be used. More particularly, this mutant RBS is associated with… triA Gene linkage. It should be understood that IRES may be suitable as a substitute for [the gene link]. atzD, trzE, DUR1,2, trzC and guaD One or more RBSs linked by genes.

[0048] In some embodiments, the at least one promoter is a constitutive promoter. It should be understood that there are known promoters suitable for driving gene expression via the melamine pathway, such as P... trc P psbA P cpcB and P c223 Preferably, the promoter is a strong promoter, such as P. c223 [Markley et al., ACS Synth Biol . 4: 595 (2015)].

[0049] In some embodiments, the constitutive promoter is P c223 (SEQ ID NO: 82).

[0050] In some embodiments, the heterologous melamine is expressed from a single promoter as part of a gene operon via a pathway gene.

[0051] In some embodiments, the gene operon polynucleotide sequence is selected from the group consisting of: SEQ ID NO: 83 (Mel1 strain), SEQ ID NO: 84 (Mel4 strain), SEQ ID NO: 85 (Mel5 strain), SEQ ID NO: 86 (Mel6 strain), SEQ ID NO: 87 (Mel7 strain) and SEQ ID NO: 88 (Mel8 strain). In some embodiments, at least one polynucleotide molecule further comprises a polynucleotide including a heterologous phosphite dehydrogenase operably linked to a promoter. ptxD ) gene. The results show that ptxDIt can be used alone for the selection of recombinant strains, without the need for antibiotic selection. It can also be used to... ptxD The gene was combined with the melamine pathway gene (MelPhi strain) to produce strains that fiercely compete with contaminating bacteria lacking these heterologous genes using a more stringent selection method. Furthermore, it generated strains that allow the engineered strains to utilize NADP+ instead of NAD+. ptxD The mutant form.

[0052] In some implementations... ptxD The gene includes the polynucleotide sequence shown in SEQ ID NO: 89 (natural), SEQ ID NO: 90 (MelPhi), or SEQ ID NO: 91 (NADP).

[0053] In some implementations, with ptxD Gene linker promoters can be selected from the following groups: P trc P psbA P cpcB and P c223 In some implementations, with ptxD The promoter for gene linking is a polynucleotide sequence including the one shown in SEQ ID NO: 92. psbA .

[0054] In some embodiments, the heterologous phosphite dehydrogenase ( ptxD The gene is expressed from a single promoter as part of a gene operon, wherein the polynucleotide sequence of the operon is shown in SEQ ID NO: 93.

[0055] In some embodiments, the isolated genetically engineered cyanobacteria of the present invention further comprise exogenous polynucleotides, which include expressible polynucleotides encoding RNA and / or protein products.

[0056] According to another aspect, the present invention provides isolated genetically engineered cyanobacteria, wherein the cyanobacteria have been transformed with at least one polynucleotide molecule, the at least one polynucleotide molecule comprising a heterologous phosphite dehydrogenase operably linked to a promoter. ptxD ) gene, wherein, ptxD The gene includes the polynucleotide sequence shown in SEQ ID NO: 89 (natural), SEQ ID NO: 90 (MelPhi) or SEQ ID NO: 91 (NADP), and wherein the genetically engineered cyanobacterium does not possess a heterologous antibiotic resistance gene.

[0057] Preferably, ptxDThe gene includes the polynucleotide sequence shown in SEQ ID NO: 90 or SEQ ID NO: 91.

[0058] According to another aspect, the present invention provides a recombinant vector comprising a melamine pathway gene operatively linked to at least one promoter. triA , DUR1,2 , atzD , trzC , trzE and guaD ,in i) triA The gene includes one or more mutations encoding an amino acid substitution, wherein the amino acid substitution is located at a position selected from the group consisting of: Leu88Phe, His254Tyr, Glu317Lys, Ala355Val, Trp471Stop, and combinations of Thr218Asn and Val278Met. and / or ii) The triA Genes have AG G AGA to AG A AGA mutation ribosome binding site (RBS), The vector lacks the antibiotic resistance gene.

[0059] In some implementations... triA The gene encodes an amino acid sequence selected from the following groups: SEQ ID NO:56 (natural, Mel5), SEQ ID NO:58 (Mel1), SEQ ID NO:60 (Mel4), SEQ ID NO:62 (Mel6), SEQ ID NO:64 (Mel7), SEQ ID NO:66 (Mel8), and SEQ ID NO:68 (Mel5evo).

[0060] In some implementations... triA The gene comprises a polynucleotide sequence selected from the group consisting of: SEQ ID NO: 57 (natural), SEQ ID NO: 59 (Mel1), SEQ ID NO: 61 (Mel4), SEQ ID NO: 63 (Mel6), SEQ ID NO: 65 (Mel7), SEQ ID NO: 67 (Mel8), SEQ ID NO: 69 (Mel5evo), and SEQ ID NO: 70 (Mel5).

[0061] In some implementations, heterologous genes trzEIncluding the polynucleotide sequence shown in SEQ ID NO: 71 or 72 (codon optimized); trzC Including the polynucleotide sequence shown in SEQ ID NO: 73 or 74 (codon optimized); DUR1,2 Including the polynucleotide sequence shown in SEQ ID NO: 75 or 76 (codon optimized); atzD Including the polynucleotide sequence shown in SEQ ID NO: 77 or 78 (codon optimized); guaD Including the polynucleotide sequences shown in SEQ ID NO: 79, 80 (codon-optimized) or 81 (Arg352Ser).

[0062] In some implementations... atzD The gene comes from the Pseudomonas strain ADP. trzE The gene comes from Rhodococcus Mel, DUR1,2 The genes come from brewer's yeast, trzC The gene originates from B-12227, a bacterial causal agent of fruit spot disease in cucurbits. guaD The gene comes from E. coli and triA The gene comes from B-12227, a bacterial causal agent of fruit spot disease in cucurbits.

[0063] In some embodiments, each of the melamine utilization pathway genes has a ribosome binding site (RBS). Suitable examples of RBSs have the polynucleotide sequence AGGAGA. Advantageously, mutant RBSs comprising the polynucleotide sequence AGAAGA can be used. More particularly, this mutant RBS is associated with… triA Gene linkage. It should be understood that IRES may be suitable as a substitute for [the gene link]. atzD, trzE, DUR1,2, trzC and guaD One or more RBSs linked by genes.

[0064] In some embodiments, the at least one promoter is a constitutive promoter. It should be understood that there are known promoters suitable for driving gene expression via the melamine pathway, such as P... trc P psbA P cpcB and P c223 Preferably, the promoter is a strong promoter, such as P. c223 [Markley et al., ACS Synth Biol . 4: 595 (2015)].

[0065] In some embodiments, the constitutive promoter is P c223 (SEQ ID NO: 82).

[0066] In some embodiments, the heterologous melamine is expressed from a single promoter as part of a gene operon via a pathway gene.

[0067] In some embodiments, the gene operon polynucleotide sequence is selected from the group consisting of: SEQ ID NO: 83 (Mel1), SEQ ID NO: 84 (Mel4), SEQ ID NO: 85 (Mel5), SEQ ID NO: 86 (Mel6), SEQ ID NO: 87 (Mel7) and SEQ ID NO: 88 (Mel8).

[0068] In some embodiments, at least one polynucleotide molecule further comprises a polynucleotide including a heterologous phosphite dehydrogenase operably linked to a promoter. ptxD )Gene.

[0069] In some implementations... ptxD The gene comprises a polynucleotide sequence selected from the group consisting of: SEQ ID NO: 89 (natural), SEQ ID NO: 90 (MelPhi) and SEQ ID NO: 91 (NADP).

[0070] In some implementations, with ptxD The promoters for gene linking are selected from the following groups: P trc P psbA P cpcB and P c223 In some implementations, with ptxD The promoter for gene linking is a polynucleotide sequence including the one shown in SEQ ID NO: 92. psbA .

[0071] In some embodiments, the recombinant vector further includes exogenous polynucleotides, which include expressible polynucleotides encoding RNA and / or protein products.

[0072] According to another aspect, the present invention provides a method for expressing a product in genetically engineered cyanobacterial cells, comprising the steps of: a) According to any aspect of the invention, a plurality of genetically engineered cyanobacterial cells are cultured in an antibiotic-free culture medium with melamine as the nitrogen source, the genetically engineered cyanobacterial cells comprising heterologous melamine utilization pathway genes and at least one exogenous polynucleotide comprising an expressible polynucleotide encoding RNA and / or protein products, wherein the growth of cells that metabolize melamine is favored. b) Culture the genetically engineered cyanobacterial cells under conditions suitable for expressing the product.

[0073] According to another aspect, the present invention provides a method for expressing a product in genetically engineered cyanobacterial cells, comprising the steps of: a) According to any aspect of the invention, a plurality of genetically engineered cyanobacterial cells are cultured in an antibiotic-free medium with melamine as the nitrogen source and phosphite as the phosphorus source. These genetically engineered cyanobacterial cells include heterologous melamine utilization pathway genes and phosphite metabolism genes, and at least one exogenous polynucleotide encoding an expressible polynucleotide encoding RNA and / or protein products. The culture promotes the growth of cyanobacterial cells that metabolize melamine and phosphite. b) Culture the genetically engineered cyanobacterial cells under conditions suitable for expressing the product.

[0074] In some embodiments, the expressed product is capable of converting the substrate into other products. The product may be, for example, an enzyme capable of catalyzing the conversion of the substrate in the culture into other products. For example, the expressed product may be an enzyme, such as farnesene synthase, which can convert CO2 and H2O into farnesene (C... 15 H 24 ).

[0075] In some embodiments, the culture medium includes melamine at concentrations of at least 1 mM, at least 2 mM, at least 4 mM, at least 6 mM, at least 8 mM, at least 10 mM, at least 12 mM, at least 14 mM, or at least 16 mM. In some embodiments, the concentration of melamine in the culture medium is selected from a concentration in the range of about 2 mM to about 12 mM.

[0076] In some embodiments, the method further includes isolating the product expressed in genetically engineered cyanobacterial cells.

[0077] The invention has now been generally described, and will be more readily understood by referring to the following embodiments provided by way of description, which are not intended to limit the invention.

[0078] Example Example 1: Method As described in Green and Sambrook and Russel, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2012), it is generally performed according to standard molecular biology techniques known in the art but not specifically described.

[0079] Cell growth conditions Synechococcus polyphylla PCC 7002 (a gift from Professor Donald Bryant of Pennsylvania State University) uses D7 micronutrients [Arnon et al., Biochim Biophys Acta [357:231-45 (1974)], supplemented as directed with 12 mM sodium nitrate (AD7-NO3), 4 mM cyanurate (AD7-Cya) or 2 mM melamine (AD7-Mel) and vitamin B. 12 (0.01 mg / L) of culture medium A [Stevens et al., J Phycol [9: 427-430 (1973)] The strains were photosynthetically autotrophic. For phosphite-utilizing strains, potassium dihydrogen phosphate (Pho) was replaced with potassium dihydrogen phosphate (Phi, Rudong Huayun Chemical Co., Ltd., Jiangsu, China) at 0.370 mM (Pho 1x or Phi 1x). Solid media were prepared by supplementing the above-described medium with 1.2% (w / v) Bacto agar (BD Diagnostics) and 1 g / L sodium thiosulfate.

[0080] For the growth experiment, at 50 µmol photons m -2 ·s -1 Liquid precultures of Syn7002 WT (grown on AD7-NO3) or melamine-growing strains (grown on AD7-Mel) were cultured at 38ºC, 1% CO2, and 160 rpm under low light intensity until OD... 730 Between 4 and 6 (late logarithmic growth under low light conditions). Cells were pelleted and washed twice with phosphate-free (AD7-MelP-) AD7-Mel medium, then inoculated into baffled flasks. Liquid cultures (25 mL total volume, three biological replicates per strain) were grown in the following conditions: in 100 mL baffled conical flasks, in a 740-FHC LED incubator (HiPoint Corporation), at 38ºC, in air supplemented with 1% (v / v) CO2, at 300 µmol photons. -2 ·s -1 Under constant illumination, using an LED Z4 panel, 215 µmol photons were set. -2 ·s -1 Red light (660 nm), 50 µmol photons -2 ·s -1 Green light (520 nm) and 35 µmol photons m-2 ·s -1 The blue light (450 nm) oscillated at 200 rpm. The light was measured at 730 nm (OD) in a 1-cm optical path using a Cary 300Bio (Varian) spectrophotometer. 730 Optical density measurements are used to monitor cell growth. For determining the weight of stem cells, the optical density will be measured at OD. 730 1 to 2 mL culture volumes measured at (between 8 and 10) were filtered into a pre-dried and pre-weighed glass microfiber filter (47 mm diameter, 1 µm pore size, GE Healthcare, Cat. No. 1822-047), washed twice with deionized water, and dried overnight at 65ºC (until the mass deviation between readings was no greater than 0.0001 g). All measurements were performed using the biological triplicate method for each strain.

[0081] All relevant plasmids were constructed using supercompetent *E. coli* cells (Stellar, TaKaRa) and incubated at 37ºC with 50 µg / mL of [amount missing]. -1 Kanamycin, 50 µg / mL -1 Spectinomycin, 50 µg·mL -1 Gentamicin or 100 µg / mL -1 Cultured in LB medium with carbenicillin, as needed. Unless otherwise specified, all chemicals used were purchased from Sigma-Aldrich.

[0082] strain construction Melamine-growing strains Unless otherwise specified, all PCR reactions were performed using Q5 DNA polymerase (New England Biolabs, NEB), and PCR products were typically digested overnight with DpnI and purified using the EZ-10 rotating column PCR product purification kit (BioBasic) before DNA assembly. Primers D08807 and D08808 (see Table 1) were used to PCR amplify the DNA from Syn7002 genomic DNA (gDNA), including... glpK DNA fragments at neutral genome integration sites [Begemann et al., PLoS One . 8:e76594.10.1371 / journal.pone.0076594 (2013)], with flanks of 500-bp upstream and downstream regions.

[0083] Table 1: List of primers used

[0084] Following the manufacturer's instructions, the purified PCR product was ligated into pCR-Blunt II TOPO (Invitrogen) and transformed into chemically competent Stellar E. coli cells to generate the plasmid pCRBlunt-glpK (correct assembly was confirmed by Sanger sequencing using universal M13 primers). The pCRBlunt-glpK backbone was amplified by reverse PCR using primers D98496993 and D77036, and the melamine operon was amplified into two fragments from the synthetic construct (GenScript, Ltd.) using primers D98847023 and D98847024 (upper half) and D98847025 and D98847026 (lower half). Following the manufacturer's instructions, the two fragments were assembled into pCRBlunt-glpK using NEBuilder HiFi DNA Assembly Master Mix (NEB). 1 µL of the assembly mixture was transformed into Stellar *E. coli* hypercompetent cells to obtain plasmid pSJ051. The correct assembly of the melamine operon was confirmed by Sanger sequencing using primers Mel_seq_1 to Mel_seq_14, D99280067, and D99280068 as shown in Table 1. (As previously described [Frigaard et al., ...) Methods Mol Biol [274: 325-40 (2004)] Syn7002 WT was modified by double homologous recombination. In short, as described above, at an OD of 0.5... 730 2 µg of pSJ051 was used to transform 2 mL of Syn7002 culture, and incubated overnight in a 12 mL round-bottom bayonet cap tube. The next day, the culture was centrifuged, and the precipitate was resuspended in 50 µL of supernatant and then spread on an AD7-Cya plate to facilitate the integration of the entire melamine operon into the culture. glpK Site. Incubate the plate under the conditions described above until colonies appear (after 2 weeks). Select eight colonies and streak them four times on an AD7-Cya plate, and then streak them on an AD7-Mel plate until chromosome separation is confirmed, using primers D99280067 and D99280068 (see [link to primers]). Figure 1 The test revealed that only six of the initial eight colonies survived and evolved into strains Mel1, Mel4, Mel5, Mel6, Mel7, and Mel8.

[0085] Strains utilizing phosphite and strains utilizing a combination of melamine and phosphite In ORF A0935 and A0936The region 500 bp upstream to 500 bp downstream of the neutral genome integration site [Davies et al., Frontiers in bioengineering and biotechnology [2: 21.10.3389 / fbioe.2014.00021 (2014)] PCR amplification was performed from Syn7002 gDNA using primers D100023580 and D100023581. pUC19 (Invitrogen) was digested with XbaI (NEB) and purified from agarose gel strips using the EZ-10 Spin Column DNA Gel Extraction Kit (BioBasic). Following the manufacturer's instructions, pEASY-Uni Seamless Cloning and Assembly Kit (TransGen Biotech Co., Ltd, China) was used to purify the DNA from the agarose gel strips. A0935-A0936 The site was assembled into the digested pUC19 backbone and transformed into Stellar E. coli cells to obtain plasmid pSZT001. Primer pairs A0935_UCO_F and A0936_UCO_R were used for reverse PCR amplification of the pSZT001 backbone, and primer pairs D98496996 and D100141467 were used for amplification of Pseudomonas stearothermiae (…). Pseudomonas stutzeri WM88 phosphite dehydrogenase ( ptxD ) gene [Loera-Quezada et al., Plant Biotechnol J Synthesized, codon-optimized (SEQ ID NO: 90) of [14: 2066 (2016)] (by GenScript, Ltd.), by Amaranthus lucida ( Amaranthus hybridus Constituent type psbA The promoter (SEQ ID NO:92) drives [Elhai and Wolk, Gene[68: 119-138 (1988)]. As described above, two fragments were assembled using the pEASY-Uni kit to obtain plasmid pSJ135. As described above, 2 µg of this plasmid was used to transform Syn7002 WT and Mel5 strains, except that before transformation, the cultures were centrifuged and washed twice with phosphate-deficient AD7 medium (AD7-NO3P for WT and AD7-Mel P for Mel5), and then plated on AD7-NO3Phi 1x (0.370 mM phosphite) or AD7-Mel Phi 1x, respectively. Both plates were incubated under the conditions described above until colonies appeared (10 days). Eight colonies were selected from each plate and repeatedly streaked on AD7-NO3Phi 1x or AD7-Mel Phi 1x until the complete chromosome separation was confirmed by colony PCR using primers D100043610 and D100043611 (see Figure 7), yielding strains A0935-ptxD and Mel5-ptxD, respectively.

[0086] To further test the use of phosphites as a selective marker, in strongly constitutive P cpt Promoters [Markley et al., ACS Synth Biol Under the control of [4: 595 (2015)], a DNA fragment containing the YFP gene was amplified from pAcsA-cpt-YFP (a gift from Professor Brian Pfleger of the University of Wisconsin-Madison) using primers D100263687 and D100263688. The pSJ135 backbone was amplified by reverse PCR using primers D100141467 and D100098818, and the two fragments were assembled using the pEASY-Uni kit to obtain pSJ141. As described above, Syn7002 WT or Mel5 was transformed with phosphite medium for transformant selection, and complete isolates were selected by colony PCR.

[0087] Knockout of the putative phosphonate transporter The putative phosphonate transporter gene was identified using the BlastP tool within CyanoBase (http: / / genomedotmicrobedbdotjp / blast / blast_search / cyanobase / genes), limiting the search to Syn7002 and including genes from Protochlorococcus (…). Prochlorococcus marinus sp.)MIT9301[Bisson et al., Nat Commun8: 1746.10.1038 / s41467-017-01226-8 (2017); Feingersch et al., ISME J The amino acid sequence of PhnD [6:827-34 (2012)] was used as a search template. In Syn7002: A0336 (E value = 1e... -96 ) and G0143 (E value = 2e) -08 Two homologs (labeled as putative phosphate / phosphonate-binding ABC transporters) were identified in the study. DNA sequences of these genes, 500 upstream and downstream, were amplified from Syn7002 cells using primers D15106 and D15107 (upstream region of A0336), D15108 and D15109 (downstream region of A0336), D15110 and D15111 (upstream region of G0143), and D15112 and D15113 (downstream region of G0143). The spectinomycin resistance cassette (for pBAD42) was used for amplification (using primers D98646038 and D98646039). A0336 ) or gentamicin resistance kits amplified from pVZ322 (using primers D99047654 and D99047655) (for G0143 Using NEBuilder HiFi DNAAssembly Master Mix, following the manufacturer's instructions, purified DNA fragments were assembled into XbaI-digested pUC19 fragments to obtain pSJ156 (pUC19-Δ). A0336 ::SpR) and pSJ157 (pUC19-Δ G0143 Both plasmids were used to transform Syn7002 WT and A0935-ptxD strains, and after complete isolation, pSJ157 was used to transform WT (WTΔ). A0336 strain) and A0935-ptxD (ptxDΔ A0336 Δ in the background of strain A0336 ::SpR deletion strain yielded double knockout strain WTΔ A0336 Δ G0143 and ptxDΔ A0336 ΔG 0143 . WT Syn7002, A0935-ptxD, ptxDΔ A0336 ,ptxDΔ D0143 (Δ in the background of A0935-ptxD) G0143 ::GmR) and ptxDΔA 0336 ΔG 0143 At an appropriate antibiotic concentration (50 µg·mL)-1 Spectinomycin and / or 50 µg·mL -1 Cultures of all strains were grown in standard AD7 (Pho 1x) medium under the conditions described above in the presence of gentamicin. All cultures were washed twice with AD7-NO3P- and resuspended in the same medium to OD200. 730 = 4, and use the same AD7-NO3P-medium medium to serially dilute at 1:10 (from 4 x 10). 0 Up to 4x10 -5 Spot 10 µL of each dilution onto AD7-NO3Pho 1x or AD7-NO3Phi 20x and incubate for 5 days under the conditions described above.

[0088] Yellow fluorescent protein (YFP) fluorescence measurement For the following whole-cell YFP fluorescence assay: Triple aliquots of culture (15 mL each) were grown in standard AD7 medium to OD0.05. 730 Fluorescence was measured in 150 µL aliquots using a 96-well black transparent substrate on a Hidex Sense (excitation: 485 / 10 nm; emission: 535 / 20 nm) between 0.5 and 1. Fluorescence was measured in triplicate for each culture and normalized to OD. 730 (As described above, measured simultaneously by a Hidex Sense plate reader), AD7 medium was used as a blank control.

[0089] Genome sequencing Genomic DNA was prepared from both WT strains and various melamine-utilized strains using the Quick-DNA Fungal / Bacterial Kit (Zymo Research). Library preparation was performed according to Illumina's TruSeq NanoDNA Sample Preparation Protocol. Samples were sheared onto a Covaris E220 as recommended by the manufacturer. 550 bp libraries were uniquely tagged with one of Illumina's TruSeq LT DNA barcodes for sample pooling for sequencing. Completed libraries were quantified using Promega's QuantiFluor dsDNA assay, and the average library size was determined on an Agilent Tapestation 4200. Library concentrations were then normalized to 4 nM using the Kapa Library Quantification Kit (KapaBiosystems) for the Illumina platform and validated by qPCR on the QuantStudio-3 real-time PCR system (AppliedBiosystems). Libraries were then pooled at equimolar concentrations and sequenced on the Illumina MiSeq platform with read lengths of 300 bp paired ends. Genomes were assembled and compared using Geneious 11.1.4 software (Biomatters Ltd.).

[0090] Ribosome binding site (RBS) point mutation test To assess the impact of RBS changes in Mel5, reverse PCR was performed [Liu and Naismith, BMC Biotechnol . 8: 91.10.1186 / 1472-6750-8-91 (2008)], using Q5 DNA polymerase (NEB), using primers D101108989 and D101108990, the original pSJ051 plasmid was... triA Mutation at the upstream RBS (from AG) G AGA changed to AG A AGA was used to obtain plasmid pSJ155. As described above, the plasmid was used to transform Syn7002 WT using AD7-Cya and AD7-Mel plates. As described above, the resulting strain Re-Mel5 was re-stripeted twice on AD7-Mel plates, and its growth in AD7-Mel was tested.

[0091] Co-culture competition experiments and flow cytometry Growth competition experiments were conducted by culturing Syn7002 strains transformed with pAcsA-cpt-YFP plasmid (constitutive expression of YFP, referred to as "cptYFP") and Mel5-ptxD in AD7-NO31xPho or AD7-Mel 20xPhi. The strains were diluted to an initial OD of 0.05. 730The culture was grown (in triplicate biological cultures) and then flow cytometry was performed using a 3-laser BD LSRFortessa X20 with FITC channels (ext: 488 nm; em: 525 / 50 nm) to detect YFP-positive cells and APC (ext: 633 nm; em: 670 / 30 nm)-positive chlorophyll a (Chl a) cells. For cell counting, the culture was first diluted to approximately 0.05 OD if necessary. 730 Acquisitions were performed at a constant rate of 3000 events / s on a Fortessa X20 flow cytometer. A logarithmic scale of forward scattering (on the x-axis) versus side scattering (on the y-axis) was used as the initial gating for selecting live cells, followed by analysis of Chl a positive cells. This was then used to plot gating for Chl a-only (Mel5-ptxD) or double-positive Chl a / YFP (cptYFP) cells. Cell counts were obtained by exhausting a set sample volume of 50 µL. Cell counts in triplicate samples were exported using BD FACS Diva software (v. 8.0) and inversely calculated based on the dilutions used.

[0092] Identification of melamine pathway intermediates using LC-MS / MS After 48 hours of growth, cultures of Syn7002 and the melamine-contaminated strain were collected and centrifuged (14000 g, 5 min, room temperature). The supernatant was filtered through a 0.2 µm syringe filter (Acrodisc filter with a Supor membrane, PALL) and frozen at -80ºC until further use. The previously described method [Braekevelt et al., NTU Phenomics Centre] was used. Food Addit Contam Part A Chem Anal Control Expo Risk Assess [28: 698-704 (2011)], melamine, ammeline, ammelide and cyanuric acid were quantified by LC-MS / MS.

[0093] Example 2 The introduction of melamine degradation pathways requires evolutionary adaptation to effectively utilize it. The melamine degradation pathway used in this study is based on the optimal pathway (genetic pathway) reported by Shaw and colleagues. triA, guaD, trzC, atzD, trzE and DUR1,2 Including guaD The R352S mutation described in the gene product [Shaw et al., Science . 353: 583-6 (2016)]( Figure 1 In our case, we used codon-optimized genes (). triA, SEQ ID NO: 70; guaD,SEQ ID NO: 80; trzC SEQ ID NO:74; atzD, SEQ ID NO:78; trzE SEQ ID NO: 72; and DUR1,2, SEQ ID NO: 76), the synthesized strong cyanobacterial promoter P c223 (SEQ ID NO:82) [Markley et al., ACS Synth Biol [4: 595 (2015)] and the strongest RBS sequence tested in Syn7002 (AGGAGA) [Markley et al., . 4: 595 (2015)] and Markley et al. ACS Synth Biol [4: 595 (2015)] Upstream of all 6 genes. Intergenic regions (total 21 bp) were generated using a random DNA sequencer (http: / / worldwidewebdotfacultydotucrdotedu / ~mmaduro / randomdothtm), including 7 bp before and 8 bp after the RBS sequence, and the vector was constructed to target the entire pathway to WT Syn7002. glpK Neutral sites [Begemann et al., PLoS One [8:e76594.10.1371 / journal.pone.0076594 (2013)] (see details of Example 1). To avoid introducing antibiotic cartridges, transformants were selected on plates containing 2 mM melamine (AD7-Mel plates). However, despite several attempts, colonies could not be obtained when directly plated on AD7-Mel plates (data not shown). We hypothesize that positive transformants should be selected by plating cells onto AD7 plates containing 4 mM cyanuric acid instead of melamine, since cyanuric acid is an intermediate in the degradation of melamine formed in step 3 of this pathway ( Figure 1 A). This strategy resulted in the isolation of a small number of cyanuric acid-growing colonies. However, these colonies initially failed to grow on AD7-Mel plates and required four re-stretches on AD7-Cya plates before finally achieving growth on AD7-Mel plates. Further analysis of six isolated colonies grown on AD7-Mel plates (denoted as Mel1, Mel4, Mel5, Mel6, Mel7, and Mel8) revealed the presence of complete Mel operons (…). Figure 1 B), and PCR analysis determined that the separation was complete. Figure 1 C). The polynucleotide sequences of the Mel1, Mel4, Mel5, Mel6, Mel7 and Mel8 operons are shown in SEQ ID NO: 83, 84, 85, 86, 87 and 88, respectively.

[0094] The growth of different Mel strains and WT Syn 7002 was compared in AD7-Mel medium (containing 2 mM melamine) or conventional AD7 medium (containing nitrate). Figure 2 As seen in A and B, unlike the parental Syn7002 Wt strain, different individual strains were able to grow on melamine as the sole nitrogen source, albeit at different rates. In particular, two strains, Mel5 and Mel7, grew almost as well in AD7-Mel as Syn7002 WT did in AD7-NO3, while the remaining strains exhibited slower growth and different staining (…). Figure 2 B), this is a common indicator of stress [Collier and Grossman, Journal of Bacteriology . 174: 4718-26 (1992)].

[0095] To further understand the reasons behind these different phenotypes, we sequenced the genomes of all melamine-growing strains (Mel1, Mel4, Mel5, Mel6, Mel7, and Mel8) as well as the Syn7002 WT strain used in this experiment (obtained from Professor Donald Bryant's laboratory at Pennsylvania State University). Comparative sequencing identified several mutations in the melamine operon, all located in... triA (Encoding melamine deaminase) gene in or before RBS in triA The internal structure of the gene itself ( Figure 3A ). triA The mutations in the amino acid sequence are located at the following positions: Leu88Phe (Mel4), His254Tyr (Mel7), Glu317Lys (Mel6), Ala355Val (Mel8), and Trp471stop (Mel1). Mel5 has a mutation in RBS (from AG). G AGA to AG A AGA)( Figure 3B Since this is the first step in the melamine degradation pathway, it has an impact. triA Mutations in its RBS or other components will regulate the metabolic flux of the remainder of this pathway.

[0096] To further elucidate the changes in melamine pathway metabolic flux among different strains, LC-MS / MS was used to quantify pathway intermediates from melamine to cyanuric acid excretion into the growth medium. Figure 4During the first 24 hours of growth, melamine was consumed very rapidly in both Mel5 and Mel7. Simultaneously, it was found that cyanuric acid diamide (the first intermediate after melamine) accumulated significantly more in Mel5 and Mel7 (86.2 ± 1.6 µM in Mel5 and 57.2 ± 1.5 µM in Mel7) than in the other strains (≤25 µM) within the same timeframe. Cyanuric acid monoamide (the third intermediate) was quantified only at very low levels (<4 µM detected in Mel5 growth medium after 24 hours), while cyanuric acid accumulated rapidly in Mel5 at a concentration of 207.5 ± 16.3 µM and in Mel7 at a concentration of 134.5 ± 8.8 µM. Figure 4 AD). The initial article also reported significant cyanuric acid excretion into the culture medium, involving the introduction of the melamine degradation pathway into *E. coli* at an initial (molar) level of 13% melamine added [Shaw et al., Science [353:583-6 (2016)], strikingly similar to the 9.7% value observed in the Mel5 strain after 24 hours. The mutations present in the remaining strains likely did not confer the same strong advantage as those found in Mel5 and Mel7, resulting in lower intracellular nitrogen levels and slower growth rates observed under normal light conditions. Figure 2 It should be noted that precultures grown under low light conditions are much less affected, likely due to a decrease in overall metabolic rate under these conditions (data not shown).

[0097] Mel5 was grown in 2 mM and 4 mM melamine, and the growth rates were compared. Figure 5 It was shown that after about 72 hours, 4 mM melamine could maintain Mel5 with a higher OD than 2 mM melamine.

[0098] Finally, the RBS sequence in the original pSJ051 triA An upstream mutation was made to match the mutation found in Mel5. Colonies were obtained using this modified construct when directly plated on AD7-Mel plates (and by plated on AD7-Cya plates). The growth of the newly obtained strain (named "Re-Mel5") was compared with Mel5, and when grown in an environment with melamine as the sole nitrogen source, Re-Mel5 was found to reach a similar OD after 48 hours. 730 ( Figure 10 This indicates that the discovered mutation can indeed improve the utilization efficiency of melamine.

[0099] Example 3 Phosphite and PtxD can be used as an effective selection system in Synechococcus PCC7002. Although phosphite (Phi) has previously been shown to be able to maintain Synthocodile ( Synechocystis sp.)PCC 6803 [Polyviou et al., Environmental microbiology reports . 7: 824-30 (2015)] and Synechococcus PCC 7942 [Motomura et al., ACS Synth Biol [10:1021 (2018)] Growth of both modified strains, in which case genetic manipulation (including ptxD Both the integration of the operon of the specific Phi transporter and the antibiotic selection pressure were driven by antibiotic selection pressure. Meanwhile, neither strain (wild-type Synechococcus PCC 6803 or wild-type Synechococcus PCC 7942) appeared to be able to take up Phi without the specific transporter, thus making the construct too large to be practically useful as a selection marker. Since there was no data in the literature on the ability of Syn7002 to grow on Phi as the sole P source, the growth of the WT strain was tested using different concentrations of Phi. Figure 6 A, left image). Although there was some growth in the initial 24–36 hours, no observable growth occurred after this period, likely due to the complete depletion of internal phosphate reserves—cyanobacteria store phosphorus as polyphosphate granules in the cytoplasm and have a dynamic flow mechanism that allows them to access these reserves when needed [Gomez-Garcia et al., Journal of Bacteriology . 195,3309 (2013)].

[0100] At neutral sites A0935 In the absence of other alternative markers, Syn7002 WT cells transformed with a construct (pSJ135) containing the Pseudomonas schwanniferus WM88 phosphite dehydrogenase gene (codon-optimized; SEQ ID NO: 90) were found to contain no other biomarkers. Figure 7A The transformant (A0935-ptxD) was plated on an AD7 plate with Phi (0.37 mM, 1x) as the sole phosphorus source. This transformation produced hundreds of colonies, and although the transformant (A0935-ptxD) was pale yellow, characteristic of phosphate-deficient cells, this concentration of Phi was sufficient to induce whole-chromosome segregation in the transformed strain. Figure 7B Therefore, it was verified. ptxD Genes and phosphites are effective selection strategies in Syn7002.

[0101] Considering the individual ptxD The genes are sufficient to enable strain A0935-ptxD to grow on Phi, which appears to be different from the related (freshwater) strains Synychophora PCC6803 and Synychophora PCC7942. Syn7002 is able to be introduced into Phi from the growth medium via a transporter protein that has not yet been defined.

[0102] To test whether a higher concentration gradient was sufficient to enhance intracellular transport and allow for faster growth on Phi, the growth of A0935-ptxD was tested in AD7 cells with increased Phi concentrations (0.37 mM to 7.4 mM). Figure 6 As shown in Figure A (right side), the highest tested Phi concentration (Phi 20x, 7.4 mM) allowed this strain to achieve a growth rate close to that of Pho-grown cells. Simultaneously, the glycated stem cell weight (gDCW) and OD... 730 The relationship also increased with increasing Phi concentration, from 0.1633 ± 0.014 gDCW·L in cells grown in AD7-Phi 1x. -1 ·OD 730 -1 The concentration of 0.2038 ± 0.003 gDCW·L in cells grown in AD7-Phi 20x was [missing value]. -1 ·OD 730 -1 (Table 2), this value is similar to that of WT cells grown under standard conditions (0.2145 ± 0.007 gDCW·L). -1 ·OD 730 -1 This increase may be due to more efficient Phi absorption and conversion at higher Phi concentrations.

[0103] Table 2: OD of each test strain 730 The calculated ratio between the weight of stem cells (gDCW) / L.

[0104]

[0105] Note: The figure shows the mean and standard deviation of the dry weight determination using three biological samples.

[0106] Known to have the same expression ptxD Transgenic Arabidopsis thaliana (genes) Arabidopsis thaliana Plants (selected using phosphinothricin) were able to grow using Phi as the sole phosphorus source [Lopez-Arredondo and Herrera-Estrella, Nat Biotechnol. 30: 889 (2012)]. Although the specific transporter proteins for Phi uptake from plant roots are unclear, it appears that no additional Phi transporter genes are required, as is the case with Syn7002. However, unlike Arabidopsis, Phi uptake in Syn7002 is much less efficient. As previous studies have shown, several marine cyanobacteria are able to uptake and utilize Phi as a phosphorus source [Feingersch et al., 30: 889 (2012)]. ISME J 6: 827-34 (2012); Martinez et al., Environ Microbiol 14: 1363 (2012); Polyviou et al., Environmental microbiology reports [7: 824-30 (2015)] We searched the Syn7002 genome for putative transporter genes, such as ptxB and phnD Homologous compounds [Bisson et al., Nat Commun . 8: 1746.10.1038 / s41467-017-01226-8 (2017)]. Although not found ptxB Homologous, but ring chromosomes ( A0336 ) or pAQ7 plasmid ( G0143 There are two presumptions in ) phnD Gene A0336 and G0143 (Data not shown). We hypothesize that either of these two genes may be involved in the input of phosphite into the cell, because... phnD Homologous compounds also showed binding to phosphites [Bisson et al., Nat Commun . 8: 1746.10.1038 / s41467-017-01226-8 (2017)]. However, knocking out these putative phosphonate transporters alone or in combination does not prevent ptxD The parent strain grows on phosphate ( Figures 8A-8C ).

[0107] To investigate whether this selection method is sufficient to allow co-integration of other genes, a second construct was designed, in which... yfp Genes are integrated into chromosomes at the same locus, using ptxD As a selection marker, Phi was used as a positive selector. Figure 7B and 7C As can be seen from this, the method successfully co-integrated... yfp Genes can be synthesized, and YFP fluorescence can be measured in positive transformants. Therefore, this method can be used to select for the integration and expression of heterologous genes in Syn7002.

[0108] Example 4 Construct strains capable of growing on both melamine and phosphite. The examples above demonstrate two independent antibiotic-free selection methods in Syn7002. Strains produced through dual selection may be more robust to contaminating organisms. Therefore, Mel5, one of the best melamine-growing strains, was selected using pSJ135 (alone). ptxD Gene; SEQ ID NO: 93) or pSJ141 ( ptxD and yfp ) transformation, and positive transformants were selected on AD7-Mel 1xPhi plates. Similar to the Syn7002 WT background case, this selection method ( Figure 7B Positive transformants can be easily obtained, and YFP fluorescence can be measured in completely isolated YFP-expressing transformants. Figure 7C Compared to the parental strains MelPhi or Syn7002 WT grown in conventional AD7, strain Mel5-A0935ptxD (“MelPhi”) was able to grow in AD7-MelPhi 20x liquid medium, although at a slightly slower rate. Figure 9 A). As predicted, Syn7002 WT could not grow in AD7-MelPhi 20x medium ( Figure 9 A). This demonstrates that it is possible to use both melamine and Phi on the same substrate for dual selection. Figure 13 The growth of Syn7002, Mel5, A0935ptxD and MelPhi strains on plates containing various culture media is shown.

[0109] Example 5 The strain Mel5-A0935ptxD is resistant to intentional contamination. This invention relates to cyanobacterial strains suitable for outdoor cultivation in open systems. Under these conditions, the strain should be able to compete with other strains to become the dominant population in potentially contaminated systems. To determine the robustness of the obtained strain, an experiment was designed in which a large amount of the starting culture used for Mel5-A0935ptxD (in AD7-Mel Phi 20x) was intentionally overcontaminated, constitutively expressing YFP (from P... cpt The Syn7002 strain (promoter) was 6 times higher than that of the Syn7002 strain. Figure 9 C) or a 10-fold higher cell count ( Figure 11 ).like Figure 9 As seen in C, Mel5-A0935ptxD (“MelPhi”) was able to overcome this large amount of excessive contaminant and become the dominant population, thus demonstrating that this strain is indeed suitable for outdoor culture under unsterilized conditions. Although, as discussed above, leakage of melamine pathway intermediates occurred in the parental strain Mel5 cells during melamine culture (…). Figure 4 However, the low amounts of these xenobiotic compounds released by the cells (maximum 0.2 mM) are unlikely to support bacterial growth, thus eliminating any form of clearance of contaminant cells. As mentioned above, the slight growth observed in YFP contaminants (see Example 3) is most likely due to the flow and depletion of internal nutrient reserves, although this cannot sustain long-term growth. Previously, the expression... ptxD The transgenic Arabidopsis thaliana also showed the ability to resist and overcome deliberate contamination by common weeds [Lopez-Arredondo and Herrera-Estrella, Nat Biotechnol [30: 889 (2012)], which emphasizes the advantages of this approach, giving strains grown under unsterilized conditions a competitive edge.

[0110] Example 6 Growth scalability of strain Mel5-A0935ptxD The assay was tested by growing the sample in 2 x 1 L baffled Erlenmeyer flasks (total volume 2 L) in AD7-Mel Phi 20x medium in a growth chamber for 11 days. Mel5-A0935ptxD The ability to grow in larger-scale cultures. The bacteria grow very rapidly in the first 24 hours, gradually decreasing to approximately 10 OD ( ). Figure 14 The explanation for the slower growth rate is that the diluted culture allows more light in the first 24 hours, and then becomes largely light-limited after that stage as the culture becomes more turbid, thus growing more slowly.

[0111] Example 7 Construct a MelPhi strain capable of using NADP+ instead of NAD+ Because cyanobacteria have more NADP+ than NAD+, a novel derivative of the MelPhi strain was generated, in which the PtxD enzyme (codon-optimized; SEQ ID NO: 90) was mutated, using NADP+ instead of NAD+. The polynucleotide sequence of the mutated gene is shown in SEQ ID NO: 91. Using primers RF_ptxD_F (SEQ ID NO: 95) and RF_ptxD_R (SEQ ID NO: 96), using pSJ135 as a template, Phusion polymerase (NEB), and as van den Ent, et al., J Biochem Biophys Methods The RF cloning method described in , 67: 67-74 (2006) is for ptxD The gene sequence was mutated to obtain plasmid pSJ165. ptxD Mutations in the genes (Glu175Ala and Ala176Arg) mimic Woodyer, R. et al. FEBSJ The mutations described in ., 272: 3816-27 (2005) have previously been shown to increase the specificity of PtxD for NADP+. Mel5 was transformed with pSJ165 as described above. ptxD The mutant strain is designated MelPhiAQ, and its growth is compared to MelPhi using a fed-batch strategy, with melamine added daily to continue growing to a higher density. Figure 15 The two strains showed similar growth, with the highest density reached being approximately 70 OD. 730 .

[0112] Example 8 Evolution of Mel5 strains that can grow in high concentrations of melamine The Mel5 strain evolved in a medium containing 2 mM melamine and could grow in 4 mM melamine. Figure 5 Strains that can grow in higher concentrations of melamine may be even more resistant to contamination, so the Mel5 strain further evolved on 12 mM melamine. Mel5 cultures were spread onto AD7-Mel plates containing 12 mM melamine instead of the usual 2 mM and cultured as described above. After approximately 2 weeks, the resulting colonies were re-stretched 4 more times under the same conditions on AD7-Mel plates containing 12 mM melamine. Of the initial 12 colonies, 3 seemingly more robust growing strains (on the plate) were cultured in AD7 liquid medium with 12 mM melamine as the nitrogen source. The growth of the most robust strain, the newly evolved Mel5 strain (“Mel5evo”), was compared to Mel5. Figure 16 The study showed that the original strain could not grow in 12 mM melamine, but the evolved strain grew to a considerably high OD. 750 (Approximately 50% OD). Improved growth at high melamine concentrations appears to be due to... triA Further mutations in the genes. triA The polynucleotide sequence of the gene is shown in SEQ ID NO: 69, and the amino acid sequence is shown in SEQ ID NO: 68. (Compared to Mel5) triA Compared to the previous sequence, there are two further amino acid substitutions at Thr218Asn and Val278Met.

[0113] Summarize An important consideration in the engineered strains of this invention is that, at current prices and at the concentrations used in this study, melamine will be a more economical nitrogen source than nitrates, reducing costs by 24% when using melamine (see Table 3).

[0114] Table 3: Cost Estimates for Nitrates, Melamine, Phosphates, and Phosphites

[0115] Note: Based on data from the Alibaba.com website (accessed March 25, 2019), the values ​​represent the lowest prices.

[0116] Furthermore, since melamine is not used as an agricultural fertilizer, using it as a nitrogen source would eliminate competition from nitrogen-rich fertilizers used in agriculture. In addition, as melamine levels decrease below the levels detectable by LC-MS / MS within 24 hours of growth, residual melamine in the final culture supernatant will not be a barrier to adopting this technology.

[0117] The additional selection of phosphites gives the strains a double-edged sword, especially in the early stages of the culture when contaminant species are more difficult to overcome, thus allowing strains carrying both modifications to become the dominant population without the need for sterilization or the addition of antibiotics. Furthermore, this strategy eliminates the risk of horizontal gene transfer of antibiotic resistance cassettes [Ventola, PT . 40: 277-83(2015a); Ventola, PT 40: 344-52 (2015b); von Wintersdorff et al., Frontiers in microbiology . 7: 10.3389 / fmicb.2016.00173 (2016)]. The results of this study indicate that the TriA mutation regulates flux through the melamine pathway, enabling its more efficient utilization. The Mel5evo strain allows for high-density batch culture without the need for online feeding equipment (which is more expensive than batch culture). The MelPhiAQ strain grows well and can increase the yield of biomolecules requiring higher NADPH concentrations (because using the mutant PtxD enzyme to convert phosphite to phosphate converts NADP+ to NADPH, thus increasing its internal concentration).

[0118] The strains of this invention provide two different strategies for high-density culture. The first strategy is fed-batch culture using Mel5 and related engineered cyanobacterial strains. The second strategy is fed-batch culture using Mel5evo cyanobacterial strains with high concentrations of melamine (up to at least 12 mM). In summary, this work describes for the first time a marine cyanobacterial strain capable of growing on melamine at up to 12 mM as the sole nitrogen source, and the use of phosphite selection as an effective selection strategy among cyanobacteria that can utilize NADP+ instead of NAD+ and phosphite-metabolizing strains. Finally, we developed a unique strain capable of using both melamine and phosphite as the sole N and P sources, respectively. This strain is resistant to deliberate contamination by other cyanobacteria even when large amounts of contamination are present, and should prove to be a useful substrate strain for “green” biotechnology applications.

[0119] literature Angermayr, SA, Paszota, M., Hellingwerf, KJ, 2012. Engineeringa cyanobacterial cell factory for production of lactic acid. Applied andenvironmental microbiology. 78,7098-106.10.1128 / AEM.01587-12. Arnon, DI, McSwain, BD, Tsujimoto, HY, Wada, K., 1974.Photochemical activity and components of membrane preparations from blue-green algae. I. Coexistence of two photosystems in relation to chlorophyll aand removal of phycocyanin. Biochim Biophys Acta. 357,231-45. Begemann, MB, Zess, EK, Walters, EM, Schmitt, EF, Markley, AL, Pfleger, BF, 2013. An organic acid based counter selectionsystem for cyanobacteria. PLoS One. 8,e76594.10.1371 / journal.pone.0076594. Bisson, C., Adams, N. B. P., Stevenson, B., Brindley, A. A.,Polyviou, D., Bibby, T. S., Baker, P. J., Hunter, C. N., Hitchcock, A., 2017.The molecular basis of phosphite and hypophosphite recognition by ABC-transporters. Nat Commun. 8,1746.10.1038 / s41467-017-01226-8. Braekevelt, E., Lau, B. P., Feng, S., Menard, C., Tittlemier, S. A.,2011. Determination of melamine, ammeline, ammelide and cyanuric acid ininfant formula purchased in Canada by liquid chromatography-tandem massspectrometry. Food Addit Contam Part A Chem Anal Control Expo Risk Assess.28,698-704.10.1080 / 19440049.2010.545442. Choi, S. Y., Wang, J. Y., Kwak, H. S., Lee, S. M., Um, Y., Kim, Y.,Sim, S. J., Choi, J. I., Woo, H. M., 2017. Improvement of squalene productionfrom CO2in Synechococcus elongatus PCC 7942 by metabolic engineering andscalable production in a photobioreactor. ACS Synth Biol. 6,1289-1295.10.1021 / acssynbio.7b00083. Clark, R. L., McGinley, L. L., Purdy, H. M., Korosh, T. C., Reed, J.L., Root, T. W., Pfleger, B. F., 2018. Light-optimized growth ofcyanobacterial cultures: Growth phases and productivity of biomass andsecreted molecules in light-limited batch growth. Metab Eng. 47,230-242.10.1016 / j.ymben.2018.03.017. Collier, J. L., Grossman, A. R., 1992. Chlorosis induced by nutrientdeprivation in Synechococcus sp. strain PCC 7942: not all bleaching is thesame. Journal of bacteriology. 174,4718-26. Davies, F. K., Work, V. H., Beliaev, A. S., Posewitz, M. C., 2014.Engineering limonene and bisabolene production in wild type and a glycogen-deficient mutant of Synechococcus sp. PCC 7002. Frontiers in bioengineering andbiotechnology. 2,21.10.3389 / fbioe.2014.00021. Dexter, J., Armshaw, P., Sheahan, C., Pembroke, J. T., 2015. Thestate of autotrophic ethanol production in Cyanobacteria. J Appl Microbiol.119,11-24.10.1111 / jam.12821. Elhai, J., Wolk, C. P., 1988. A versatile class of positive-selectionvectors based on the nonviability of palindrome-containing plasmids thatallows cloning into long polylinkers. Gene. 68,119-138.Doi 10.1016 / 0378-1119(88)90605-1. Englund, E., Pattanaik, B., Ubhayasekera, S. J., Stensjo, K.,Bergquist, J., Lindberg, P., 2014. Production of squalene in Synechocystis sp.PCC 6803. PLoS One.9,e90270.10.1371 / journal.pone.0090270. Fathima, A. M., Chuang, D., Lavina, W. A., Liao, J., Putri, S. P.,Fukusaki, E., 2018. Iterative cycle of widely targeted metabolic profilingfor the improvement of 1-butanol titer and productivity in Synechococcus elongatus . Biotechnol Biofuels. 11,188.10.1186 / s13068-018-1187-8. Feingersch, R., Philosof, A., Mejuch, T., Glaser, F., Alalouf, O.,Shoham, Y., Beja, O., 2012. Potential for phosphite and phosphonateutilization by Prochlorococcus . ISME J. 6,827-34.10.1038 / ismej.2011.149. Frigaard, N. U., Sakuragi, Y., Bryant, D. A., 2004. Gene inactivationin the cyanobacterium Synechococcus sp. PCC 7002 and the green sulfurbacterium Chlorobium tepidum using in vitro-made DNA constructs and naturaltransformation. Methods Mol Biol. 274,325-40.10.1385 / 1-59259-799-8:325. Gomez-Garcia, M. R., Fazeli, F., Grote, A., Grossman, A. R., Bhaya,D., 2013. Role of polyphosphate in thermophilic Synechococcus sp. frommicrobial mats. Journal of bacteriology.195,3309-19.10.1128 / JB.00207-13. Gordon, G. C., Korosh, T. C., Cameron, J. C., Markley, A. L.,Begemann, M. B., Pfleger, B. F., 2016. CRISPR interference as a titratable,trans-acting regulatory tool for metabolic engineering in thecyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 38,170-179.10.1016 / j.ymben.2016.07.007. Halfmann, C., Gu, L., Gibbons, W., Zhou, R., 2014. Geneticallyengineering cyanobacteria to convert CO2, water, and light into the long-chain hydrocarbon farnesene. Appl Microbiol Biotechnol. 98,9869-77.10.1007 / s00253-014-6118-4. Hirota, R., Abe, K., Katsuura, Z. I., Noguchi, R., Moribe, S.,Motomura, K., Ishida, T., Alexandrov, M., Funabashi, H., Ikeda, T., Kuroda,A., 2017. A novel biocontainment strategy makes bacterial growth and survivaldependent on phosphite. Sci Rep. 7,44748.10.1038 / srep44748. Kanda, K., Ishida, T., Hirota, R., Ono, S., Motomura, K., Ikeda, T.,Kitamura, K., Kuroda, A., 2014. Application of a phosphite dehydrogenase geneas a novel dominant selection marker for yeasts. J Biotechnol. 182,68-73.10.1016 / j.jbiotec.2014.04.012. Kato, A., Takatani, N., Ikeda, K., Maeda, S. I., Omata, T., 2017.Removal of the product from the culture medium strongly enhances free fattyacid production by genetically engineered Synechococcus elongatus. BiotechnolBiofuels. 10,141.10.1186 / s13068-017-0831-z. Liu, H., Naismith, J. H., 2008. An efficient one-step site-directeddeletion, insertion, single and multiple-site plasmid mutagenesis protocol.BMC Biotechnol. 8,91.10.1186 / 1472-6750-8-91. Loera-Quezada, M. M., Leyva-Gonzalez, M. A., Velazquez-Juarez, G.,Sanchez-Calderon, L., Do Nascimento, M., Lopez-Arredondo, D., Herrera-Estrella, L., 2016. A novel genetic engineering platform for the effectivemanagement of biological contaminants for the production of microalgae. PlantBiotechnol J. 14,2066-76.10.1111 / pbi.12564. Lopez-Arredondo, D. L., Herrera-Estrella, L., 2012. Engineeringphosphorus metabolism in plants to produce a dual fertilization and weedcontrol system. Nat Biotechnol. 30,889-93.10.1038 / nbt.2346. Ludwig, M., Bryant, D. A., 2011. Transcription profiling of the modelcyanobacterium Synechococcussp. strain PCC 7002 by next-gen (SOLiD) sequencingof cDNA. Frontiers in microbiology. 2,41. Ludwig, M., Bryant, D. A., 2012. Synechococcus sp. strain PCC 7002transcriptome: acclimation to temperature, salinity, oxidative stress, andmixotrophic growth conditions. Frontiers in microbiology.3,354. Markley, A. L., Begemann, M. B., Clarke, R. E., Gordon, G. C.,Pfleger, B. F., 2015. Synthetic biology toolbox for controlling geneexpression in the cyanobacterium Synechococcus sp. strain PCC 7002. ACS SynthBiol.4,595-603.10.1021 / sb500260k. Martinez, A., Osburne, M. S., Sharma, A. K., DeLong, E. F., Chisholm,S. W., 2012. Phosphite utilization by the marine picocyanobacterium Prochloro coccus MIT9301. Environ Microbiol. 14,1363-77.10.1111 / j.1462-2920.2011.02612.x. Motomura , K. , Sano , K. , Watanabe , S. , Kanbara , A. , Gamal Nasser , AH , Ikeda , T. , Ishida , T. , Funabashi , H. , Kuroda , A. , Hirota , R. , 2018 . ACS Synth Biol.10.1021 / acssynbio.8b00199. Nahampun , HN , Lopez-Arredondo , D. , Xu , X. , Blacksmith-Star , L. ,Wang , K. , 2016 ptxD gene as an alternative selectable markerfor Agrobacterium -mediated maize transformation. Plant Cell Rep. 35.1121-1132.10.1007 / s00299-016-1942-x. Pandeya , D , Campbell , LM , Nunes , E , Lopez-Arredondo , DL,Janga , MR , Blacksmith-Star , L , Rathore , KS , 2017 . ptxD gene incombination with phosphite serves as a highly effective selection system togenerate transgenic cotton ( Gossypium hirsutum L.). Plant Mol Biol. 95.567-577.10.1007 / s11103-017-0670-0. Perez, A. A., Liu, Z., Rodionov, D. A., Li, Z., Bryant, D. A., 2016.Complementation of cobalamin auxotrophy in Synechococcus sp. strain PCC 7002and validation of a putative cobalamin riboswitch in vivo. Journal ofbacteriology.10.1128 / JB.00475-16. Polyviou, D., Hitchcock, A., Baylay, A. J., Moore, C. M., Bibby, T.S., 2015. Phosphite utilization by the globally important marinediazotroph Trichodesmium . Environmental microbiology reports. 7,824-30.10.1111 / 1758-2229.12308. Ruffing, A. M., 2014. Improved free fatty acid production incyanobacteria with Synechococcus sp. PCC 7002 as host. Frontiers inbioengineering and biotechnology.2,17.10.3389 / fbioe.2014.00017. Schoepp, N. G., Stewart, R. L., Sun, V., Quigley, A. J., Mendola, D.,Mayfield, S. P., Burkart, M. D., 2014. System and method for research-scaleoutdoor production of microalgae and cyanobacteria. Bioresour Technol. 166,273-81.10.1016 / j.biortech.2014.05.046. Shabestary, K., Anfelt, J., Ljungqvist, E., Jahn, M., Yao, L.,Hudson, E. P., 2018. Targeted repression of essential genes to arrest growthand increase carbon partitioning and biofuel titers in cyanobacteria. ACSSynth Biol.7,1669-1675.10.1021 / acssynbio.8b00056. Shaw, A. J., Lam, F. H., Hamilton, M., Consiglio, A., MacEwen, K.,Brevnova, E. E., Greenhagen, E., LaTouf, W. G., South, C. R., van Dijken, H.,Stephanopoulos, G., 2016. Metabolic engineering of microbial competitiveadvantage for industrial fermentation processes. Science. 353,583-6.10.1126 / science.aaf6159. Stevens, S. E., Patterson, C. O., Myers, J., 1973. Production ofhydrogen peroxide by blue-green algae - a survey. J Phycol. 9,427-430 van den Ent, F., and Löwe J., 2006. RF cloning: A restriction-freemethod for inserting target genes into plasmids. J Biochem Biophys Methods .Apr30; 67(1): 67-74. Ventola, C. L., 2015a. The antibiotic resistance crisis: part 1:causes and threats. P T. 40,277-83. Ventola, C. L., 2015b. The antibiotic resistance crisis: part 2:management strategies and new agents. P T. 40,344-52. von Wintersdorff, C. J. H., Penders, J., van Niekerk, J. M., Mills,N. D., Majumder, S., van Alphen, L. B., Savelkoul, P. H. M., Wolffs, P. F.G., 2016. Dissemination of antimicrobial resistance in microbial ecosystemsthrough horizontal gene transfer. Frontiers in microbiology. 7.10.3389 / fmicb.2016.00173. Wang, X., Liu, W., Xin, C., Zheng, Y., Cheng, Y., Sun, S., Li, R.,Zhu, X. G., Dai, S. Y., Rentzepis, P. M., Yuan, J. S., 2016. Enhancedlimonene production in cyanobacteria reveals photosynthesis limitations.Proceedings of the National Academy of Sciences of the United States ofAmerica. 113,14225-14230.10.1073 / pnas.1613340113. Woodyer R., Zhao H., van der Donk WA., 2005. Mechanisticinvestigation of a highly active phosphite dehydrogenase mutant and itsapplication for NADPH regeneration. FEBS J .Aug; 272(15): 3816-27. Xu, Y., Alvey, RM, Byrne, PO, Graham, JE, Shen, G., Bryant, DA, 2011. Expression of genes in cyanobacteria: adaptation of endogenousplasmids as platforms for high-level gene expression in Synechococcus sp. PCC7002. Methods Mol Biol. 684, 273-93. sequence list <110> Nanyang Technological University <120> Genetically engineered cyanobacteria grown under unsterilized conditions were selected using antibiotic-free methods. <130> PPI21171099SG <150> 10201810863R <151> 2018-12-04 <160> 96 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <220> <223> D08807 <400> 1 gcactgtggc aaggaaatcg 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <220> <223> D08808 <400> 2 tcgcctttat ggaggatggc 20 <210> 3 <211> 28 <212> DNA <213> Artificial sequence <220> <223> D98496993 <400> 3 taaaaaagac tttatgactg ctttactg 28 <210> 4 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> D77036 <400> 4 ggctcaaaag acatcattta gg 22 <210> 5 <211> 70 <212> DNA <213> Artificial sequence <220> <223> D98847023 <400> 5 gaaggttttc tgttatctga aattcctccc taaatgatgt cttttgagcc aaaggtgctt 60 gtgtctcaac 70 <210> 6 <211> 46 <212> DNA <213> Artificial sequence <220> <223> D98847024 <400> 6 tcatggtgta tatctcctaa tcaatttaga gcatttcaaa gtaggc 46 <210> 7 <211> 49 <212> DNA <213> Artificial sequence <220> <223> D98847025 <400> 7 tcgggcctac tttgaaatgc tctaaattga ttaggagata tacaccatg 49 <210> 8 <211> 69 <212> DNA <213> Artificial sequence <220> <223> D98847026 <400> 8 gggaataatg ttggtcatgg agcagtaaag cagtcataaa gtctttttta tcgctcgtca 60 tttgctttc 69 <210> 9 <211> 29 <212> DNA <213> Artificial sequence <220> <223> D99280067 <400> 9 tgaagatcaa caccatctat gacttagcc 29 <210> 10 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> D99280068 <400> 10 taaccccatg caaacgccat c 21 <210> 11 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Mel_seq_1 <400> 11 tgccattggt atgagtgaac aagc 24 <210> 12 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Mel_seq_2 <400> 12 tctctccgat tgtaccggtg c 21 <210> 13 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Mel_seq_3 <400> 13 aatggatcaa atcttttatt tgtgaagaaa gtgg 34 <210> 14 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Mel_seq_4 <400> 14 atgatgtggc ccgctcc 17 <210> 15 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Mel_seq_5 <400> 15 tcgtggataa actctttgtg atgatgacc 29 <210> 16 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Mel_seq_6 <400> 16 catgcccaaa ttaccgaaac c 21 <210> 17 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Mel_seq_7 <400> 17 tgctctctga tagtgatatt aattccacc 29 <210> 18 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Mel_seq_8 <400> 18 gaaggtgaac ccattattga taaacc 26 <210> 19 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Mel_seq_9 <400> 19 tccatcaatt tcaaattctc aagtctcg 28 <210> 20 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Mel_seq_10 <400> 20 agcaatcccc tcaaaaaatt tagttcc 27 <210> 21 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Mel_seq_11 <400> 21 tcattggcaa aaaatttacc gattatgc 28 <210> 22 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Mel_seq_12 <400> 22 tgcccaatgt gaccgtgg 18 <210> twenty three <211> 25 <212> DNA <213> Artificial sequence <220> <223> Mel_seq_13 <400> twenty three tcaaagaaga ataccccgat acctg 25 <210> twenty four <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Mel_seq_14 <400> twenty four tcgatgaacg cctccaagtg g 21 <210> 25 <211> 36 <212> DNA <213> Artificial sequence <220> <223> D100023580 <400> 25 acccggggat cctctagagc cagatccttt tgcatc 36 <210> 26 <211> 39 <212> DNA <213> Artificial sequence <220> <223> D100023581 <400> 26 ctgcaggtcg actcttgaag ggagccagaa cataaaaag 39 <210> 27 <211> 33 <212> DNA <213> Artificial sequence <220> <223> A0935_UCO_F <400> 27 tgacttggtt cacgtagaaa aaccagaagg gac 33 <210> 28 <211> 51 <212> DNA <213> Artificial sequence <220> <223> A0936_UCO_R <400> 28 tgtccactcc ttaatcacta ttcaaaatat tatatttact cagtttttaa g 51 <210> 29 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> D98496996 <400> 29 attaaggagt ggacagccta c 21 <210> 30 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> D100141467 <400> 30 acgtgaacca agtcagacaa tc 22 <210> 31 <211> 32 <212> DNA <213> Artificial sequence <220> <223> D100043610 <400> 31 tagatgatga tgtagaattg tctgctaatt ac 32 <210> 32 <211> 27 <212> DNA <213> Artificial sequence <220> <223> D100043611 <400> 32 taatgatttc agtacaaatt gctctgc <210> 33 <211> 52 <212> DNA <213> The snowstorm <220> <223> D100263687 <400> 33 tttgattgtc tgacttggtt cacgtttgag gccgttgatc tagacaaaaa ac <210> 34 <211> 24 <212> DNA <213> The snowstorm <220> <223> D100263688 <400> 34 aggravation ttccatgggc catc <210> 35 <211> 19 <212> DNA <213> The snowstorm <220> <223> D100098818 <400> 35 agaaaaacca gaaggacg <210> 36 <211> 53 <212> DNA <213> The snowstorm <220> <223> D101108991 <400> 36 call us attccatggg ccatcatcat catcatcatc atc <210> 37 <211> 50 <212> DNA <213> Artificial sequence <220> <223> D101108992 <400> 37 ggaattaatc ttctacttga ctttatgagt tgggagctcc ttttgcaatc 50 <210> 38 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> D74727 <400> 38 ttcacagagg aaggggaaat tgtc 24 <210> 39 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> D74729 <400> 39 tcatatccgg ggcatacatt cg 22 <210> 40 <211> 50 <212> DNA <213> Artificial sequence <220> <223> D101108989 <400> 40 ttaagctagt tagaagattc agaccatgca aaccctcagc attcaacatg 50 <210> 41 <211> 47 <212> DNA <213> Artificial sequence <220> <223> D101108990 <400> 41 ggtctgaatc ttctaactag cttaattccg ttcgtacacg aggcgac 47 <210> 42 <211> 46 <212> DNA <213> Artificial sequence <220> <223> D15106 <400> 42 gttgtaaaac gacggccagt gaattttaag cctggggtga gttgac 46 <210> 43 <211> 58 <212> DNA <213> Artificial sequence <220> <223> D15107 <400> 43 cgtttccagt tgtccactcc ttaattaatt tctcaaggga aagaaaaaga tttattcc 58 <210> 44 <211> 52 <212> DNA <213> Artificial sequence <220> <223> D15108 <400> 44 ttaaaaagca tgacttggtt cacgtacgaa ggttgttttt aaagctaaga ag 52 <210> 45 <211> 52 <212> DNA <213> Artificial sequence <220> <223> D15109 <400> 45 caggaaacag ctatgaccat gattatatga aaatgcttca caccatgatt cg 52 <210> 46 <211> 52 <212> DNA <213> Artificial sequence <220> <223> D15110 <400> 46 gttgtaaaac gacggccagt gaattacaat tgacacaaaa aagagagcaa ag 52 <210> 47 <211> 45 <212> DNA <213> Artificial sequence <220> <223> D15111 <400> 47 gctccggctt tgacttggtt cacgtgtgac cctcttgcag caacc 45 <210> 48 <211> 54 <212> DNA <213> Artificial sequence <220> <223> D15112 <400> 48 ttccacggtg tgtccactcc ttaatttgcc tgattatgct tccatcaaaa tttg 54 <210> 49 <211> 43 <212> DNA <213> Artificial sequence <220> <223> D15113 <400> 49 caggaaacag ctatgaccat gattatatcc gtcacggtgg ctc 43 <210> 50 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> D39394 <400> 50 taggtagtat tggggcatca gg 22 <210> 51 <211> 27 <212> DNA <213> Artificial sequence <220> <223> D39395 <400> 51 taatctcgat gtgatgattg ctgaagg 27 <210> 52 <211> 35 <212> DNA <213> Artificial sequence <220> <223> D99047654 <400> 52 attaaggagt ggacacaccg tggaaacgga tgaag 35 <210> 53 <211> 32 <212> DNA <213> Artificial sequence <220> <223> D99047655 <400> 53 acgtgaacca agtcaaagcc ggagcgcttt tg 32 <210> 54 <211> 33 <212> DNA <213> Artificial sequence <220> <223> D98646038 <400> 54 attaaggagt ggacaactgg aaacggatga agg 33 <210> 55 <211> 36 <212> DNA <213> Artificial sequence <220> <223> D98646039 <400> 55 acgtgaacca agtcatgctttttaagggaa ttgtgc 36 <210> 56 <211> 474 <212> PRT <213> Artificial sequence <220> <223> Original TriA <400> 56 Met Gln Thr Leu Ser Ile Gln His Gly Thr Leu Val Thr Met Asp Gln 1 5 10 15 Tyr Arg Arg Val Leu Gly Asp Ser Trp Val His Val Gln Asp Gly Arg 20 25 30 Ile Val Ala Leu Gly Val His Ala Glu Ser Val Pro Pro Pro Ala Asp 35 40 45 Arg Val Ile Asp Ala Arg Gly Lys Val Val Leu Pro Gly Phe Ile Asn 50 55 60 Ala His Thr His Val Asn Gln Ile Leu Leu Arg Gly Gly Pro Ser His 65 70 75 80 Gly Arg Gln Leu Tyr Asp Trp Leu Phe Asn Val Leu Tyr Pro Gly Gln 85 90 95 Lys Ala Met Arg Pro Glu Asp Val Ala Val Ala Val Arg Leu Tyr Cys 100 105 110 Ala Glu Ala Val Arg Ser Gly Ile Thr Thr Ile Asn Asp Asn Ala Asp 115 120 125 Ser Ala Ile Tyr Pro Gly Asn Ile Glu Ala Ala Met Ala Val Tyr Gly 130 135 140 Glu Val Gly Val Arg Val Val Tyr Ala Arg Met Phe Phe Asp Arg Met 145 150 155 160 Asp Gly Arg Ile Gln Gly Tyr Val Asp Ala Leu Lys Ala Arg Ser Pro 165 170 175 Gln Val Glu Leu Cys Ser Ile Met Glu Glu Thr Ala Val Ala Lys Asp 180 185 190 Arg Ile Thr Ala Leu Ser Asp Gln Tyr His Gly Thr Ala Gly Gly Arg 195 200 205 Ile Ser Val Trp Pro Ala Pro Ala Ile Thr Pro Ala Val Thr Val Glu 210 215 220 Gly Met Arg Trp Ala Gln Ala Phe Ala Arg Asp Arg Ala Val Met Trp 225 230 235 240 Thr Leu His Met Ala Glu Ser Asp His Asp Glu Arg Leu His Trp Met 245 250 255 Ser Pro Ala Glu Tyr Met Glu Cys Tyr Gly Leu Leu Asp Glu Arg Leu 260 265 270 Gln Val Ala His Cys Val Tyr Phe Asp Arg Lys Asp Val Arg Leu Leu 275 280 285 His Arg His Asn Val Lys Val Ala Ser Gln Val Val Ser Asn Ala Tyr 290 295 300 Leu Gly Ser Gly Val Ala Pro Val Pro Glu Met Val Glu Arg Gly Met 305 310 315 320 Ala Val Gly Ile Gly Thr Asp Asp Gly Asn Cys Asn Asp Ser Val Asn 325 330 335 Met Ile Gly Asp Met Lys Phe Met Ala His Ile His Arg Ala Val His 340 345 350 Arg Asp Ala Asp Val Leu Thr Pro Glu Lys Ile Leu Glu Met Ala Thr 355 360 365 Ile Asp Gly Ala Arg Ser Leu Gly Met Asp His Glu Ile Gly Ser Ile 370 375 380 Glu Thr Gly Lys Arg Ala Asp Leu Ile Leu Leu Asp Leu Arg His Pro 385 390 395 400 Gln Thr Thr Pro His His His Leu Ala Ala Thr Ile Val Phe Gln Ala 405 410 415 Tyr Gly Asn Glu Val Asp Thr Val Leu Ile Asp Gly Asn Val Val Met 420 425 430 Glu Asn Arg Arg Leu Ser Phe Leu Pro Pro Glu Arg Glu Leu Ala Phe 435 440 445 Leu Glu Glu Ala Gln Ser Arg Ala Thr Ala Ile Leu Gln Arg Ala Asn 450 455 460 Met Val Ala Asn Pro Ala Trp Arg Ser Leu 465 470 <210> 57 <211> 1425 <212> DNA <213> Artificial sequence <220> <223> Acidovorax avenae subsp. citrulli NRRL B-12227 <400> 57 atgcaaacgc tcagcatcca gcacggtacc ctcgtcacga tggatcagta ccgcagagtc 60 cttggggata gctgggttca cgtgcaggat ggacggatcg tcgcgctcgg agtgcacgcc 120 gagtcggtgc ctccgccagc ggatcgggtg atcgatgcac gcggcaaggt cgtgttaccc 180 ggtttcatca atgcccacac ccatgtgaac cagatcctcc tgcgcggagg gccctcgcac 240 gggcgtcaac tctatgactg gctgttcaac gttttgtatc cgggacaaaa ggcgatgaga 300 ccggaggacg tagcggtggc ggtgaggttg tattgtgcgg aagctgtgcg cagcgggatt 360 acgacgatca acgacaacgc cgattcggcc atctacccag gcaacatcga ggccgcgatg 420 gcggtctatg gtgaggtggg tgtgagggtc gtctacgcccc gcatgttctt tgatcggatg 480 gacgggcgca ttcaagggta tgtggacgcc ttgaaggctc gctctcccca agtcgaactg 540 tgctcgatca tgggagaac ggctctggcc aaagatcgga tcacagccct gtcagatcag 600 tatcatggca cggcaggagg tcgtatatca gtttggcccg ctcctgccat taccccggcg 660 gtgacagttg aaaggaatgcg atgggcacaa gccttcgccc gtgatcgggc ggtaatgtgg 720 acgcttcaca tggcggagag cgatcatgat gagcggcttc attggatgag tcccgccgag 780 tacatggagt gttacggact cttggatgag cgtctgcagg tcgcgcattg cgtgtacttt 840 gaccgggaagg atgttcggct gctgcaccgc caaatgtga aggtcgcgtc gcaggttgtg 900 agcaatgcct acctcggctc aggggtggcc cccgtgccag agatggtgga gcgcggcatg 960 gccgtgggca ttggaacaga tgacgggaat tgtaatgact ccgtaaacat gatcggagac 1020 atgaagttta tggcccatat tcaccgcgcg gtgcatcggg atgcggacgt gctgacccca 1080 gagaattc ttgaaatggc gacgatcgat ggggcgcgtt cgttgggaat ggaccacgag 1140 attggttcca tcgaaaccgg caagcgcgcg gaccttatcc tgcttgacct gcgtcaccct 1200 cagacgactc ctcaccatca tttggcggcc acgatcgtgt ttcaggctta cggcaatgag 1260 gtggacactg tcctgattga cggaaacgtt gtgatggaga accgccgctt gagctttctt 1320 ccccctgaac gtgagttggc gttccttgag gaagcgcaga gccgcgccac agctattttg 1380 cagcgggcga acatggtggc taacccagct tggcgcagcc tctag 1425 <210> 58 <211> 470 <212> PRT <213> Artificial sequence <220> <223> Mel1 TriA <400> 58 Met Gln Thr Leu Ser Ile Gln His Gly Thr Leu Val Thr Met Asp Gln 1 5 10 15 Tyr Arg Arg Val Leu Gly Asp Ser Trp Val His Val Gln Asp Gly Arg 20 25 30 Ile Val Ala Leu Gly Val His Ala Glu Ser Val Pro Pro Pro Ala Asp 35 40 45 Arg Val Ile Asp Ala Arg Gly Lys Val Val Leu Pro Gly Phe Ile Asn 50 55 60 Ala His Thr His Val Asn Gln Ile Leu Leu Arg Gly Gly Pro Ser His 65 70 75 80 Gly Arg Gln Leu Tyr Asp Trp Leu Phe Asn Val Leu Tyr Pro Gly Gln 85 90 95 Lys Ala Met Arg Pro Glu Asp Val Ala Val Ala Val Arg Leu Tyr Cys 100 105 110 Ala Glu Ala Val Arg Ser Gly Ile Thr Thr Ile Asn Asp Asn Ala Asp 115 120 125 Ser Ala Ile Tyr Pro Gly Asn Ile Glu Ala Ala Met Ala Val Tyr Gly 130 135 140 Glu Val Gly Val Arg Val Val Tyr Ala Arg Met Phe Phe Asp Arg Met 145 150 155 160 Asp Gly Arg Ile Gln Gly Tyr Val Asp Ala Leu Lys Ala Arg Ser Pro 165 170 175 Gln Val Glu Leu Cys Ser Ile Met Glu Glu Thr Ala Val Ala Lys Asp 180 185 190 Arg Ile Thr Ala Leu Ser Asp Gln Tyr His Gly Thr Ala Gly Gly Arg 195 200 205 Ile Ser Val Trp Pro Ala Pro Ala Ile Thr Pro Ala Val Thr Val Glu 210 215 220 Gly Met Arg Trp Ala Gln Ala Phe Ala Arg Asp Arg Ala Val Met Trp 225 230 235 240 Thr Leu His Met Ala Glu Ser Asp His Asp Glu Arg Leu His Trp Met 245 250 255 Ser Pro Ala Glu Tyr Met Glu Cys Tyr Gly Leu Leu Asp Glu Arg Leu 260 265 270 Gln Val Ala His Cys Val Tyr Phe Asp Arg Lys Asp Val Arg Leu Leu 275 280 285 His Arg His Asn Val Lys Val Ala Ser Gln Val Val Ser Asn Ala Tyr 290 295 300 Leu Gly Ser Gly Val Ala Pro Val Pro Glu Met Val Glu Arg Gly Met 305 310 315 320 Ala Val Gly Ile Gly Thr Asp Asp Gly Asn Cys Asn Asp Ser Val Asn 325 330 335 Met Ile Gly Asp Met Lys Phe Met Ala His Ile His Arg Ala Val His 340 345 350 Arg Asp Ala Asp Val Leu Thr Pro Glu Lys Ile Leu Glu Met Ala Thr 355 360 365 Ile Asp Gly Ala Arg Ser Leu Gly Met Asp His Glu Ile Gly Ser Ile 370 375 380 Glu Thr Gly Lys Arg Ala Asp Leu Ile Leu Leu Asp Leu Arg His Pro 385 390 395 400 Gln Thr Thr Pro His His Leu Ala Ala Thr Ile Val Phe Gln Ala 405 410 415 Tyr Gly Asn Glu Val Asp Thr Val Leu Ile Asp Gly Asn Val Val Met 420 425 430 Glu Asn Arg Arg Leu Ser Phe Leu Pro Pro Glu Arg Glu Leu Ala Phe 435 440 445 Leu Glu Glu Ala Gln Ser Arg Ala Thr Ala Ile Leu Gln Arg Ala Asn 450 455 460 Met Val Ala Asn Pro Ala 465 470 <210> 59 <211> 1443 <212> DNA <213> Artificial sequence <220> <223> Mel1 gene sequence <220> <221> RBS <222> (5)..(10) <220> <221> Gene <222> (19)..(1443) <400> 59 agttaggaga ttcagaccat gcaaaccctc agcattcaac atggcaccct cgtgacgatg 60 gatcaatatc gccgggtgct cggcgatagc tgggtgcatg tgcaagatgg ccgcattgtg 120 gccctcggtg tgcatgccga atctgtgccc ccccccgccg atcgtgtgat tgatgcccgc 180 ggtaaagtgg tgctccccgg ttttattaat gcccataccc acgtgaatca aattctcctc 240 cgtggtggtc cctctcacgg tcgccaactc tatgattggc tctttaatgt gctctacccc 300 ggccaaaaag ccatgcgccc cgaagatgtg gccgtggccg tgcggctcta ttgtgccgaa 360 gccgtgcgca gtggtattac caccattaat gataatgccg attccgccat ttaccccggc 420 aatattgaag ccgcgatggc cgtgtatggc gaagtgggtg tgcgggtggt gtacgcccgc 480 atgtttttcg atcgcatgga tggccggatt caaggttatg tggatgccct caaagcccgg 540 agcccccaag tggaactctg ttctattatg gaagaaaccg ccgtggccaa agatcggatt 600 accgccctca gcgatcaata tcacggcacc gccggtggcc gcattagtgt gtggcccgcc 660 cccgccatta cccccgccgt gaccgtggag ggtatgcgtt gggcccaagc ctttgcccgc 720 gatcgggccg tgatgtggac cctccacatg gccgaaagcg atcatgatga acggctccac 780 tggatgtctc ccgccgaata tatggaatgt tacggcctcc tcgatgaacg cctccaagtg 840 gcccactgtg tgtattttga tcgcaaagat gtgcggctcc tccatcgcca caatgtgaaaa 900 gtggccagtc aagtggtgtc caatgcctac ctcggcagtg gtgtggcccc cgtgcccgaa 960 atggtggaac gtggcatggc cgtgggcatt ggcaccgatg atggtaattg taatgattcc 1020 gtgaatatga ttggcgatat gaaatttatg gcccatattc accgggccgt gcatcgcgat 1080 gccgatgtgc tcaccccga aaaaattctc gaaatggcca ccattgatgg cgcccgcagt 1140 ctcggtatgg atcatgaaat tggctccatt gaaaccggta aacgggccga tctcattctc 1200 ctcgatctcc gccaccccca aaccaccccc caccatcacc tcgccgccac cattgtgttt 1260 caagcctacg gtaatgaagt ggataccgtg ctcattgatg gcaatgtggt gatggaaaat 1320 cgccggctca gttttctccc ccccgaacgg gaactcgcct ttctcgaaga agcccaaagt 1380 cgcgccaccg ccattctcca acgcgccaat atggtggcca atcccgcctg acgcagcctc 1440 city ​​1443 <210> 60 <211> 474 <212> PRT <213> Artificial sequence <220> <223> Mel4 TriA. <400> 60 Met Gln Thr Leu Ser Ile Gln His Gly Thr Leu Val Thr Met Asp Gln 1 5 10 15 Tyr Arg Arg Val Leu Gly Asp Ser Trp Val His Val Gln Asp Gly Arg 20 25 30 Ile Val Ala Leu Gly Val His Ala Glu Ser Val Pro Pro Pro Ala Asp 35 40 45 Arg Val Ile Asp Ala Arg Gly Lys Val Val Leu Pro Gly Phe Ile Asn 50 55 60 Ala His Thr His Val Asn Gln Ile Leu Leu Arg Gly Gly Pro Ser His 65 70 75 80 Gly Arg Gln Leu Tyr Asp Trp Phe Phe Asn Val Leu Tyr Pro Gly Gln 85 90 95 Lys Ala Met Arg Pro Glu Asp Val Ala Val Ala Val Arg Leu Tyr Cys 100 105 110 Ala Glu Ala Val Arg Ser Gly Ile Thr Thr Ile Asn Asp Asn Ala Asp 115 120 125 Ser Ala Ile Tyr Pro Gly Asn Ile Glu Ala Ala Met Ala Val Tyr Gly 130 135 140 Glu Val Gly Val Arg Val Val Tyr Ala Arg Met Phe Phe Asp Arg Met 145 150 155 160 Asp Gly Arg Ile Gln Gly Tyr Val Asp Ala Leu Lys Ala Arg Ser Pro 165 170 175 Gln Val Glu Leu Cys Ser Ile Met Glu Glu Thr Ala Val Ala Lys Asp 180 185 190 Arg Ile Thr Ala Leu Ser Asp Gln Tyr His Gly Thr Ala Gly Gly Arg 195 200 205 Ile Ser Val Trp Pro Ala Pro Ala Ile Thr Pro Ala Val Thr Val Glu 210 215 220 Gly Met Arg Trp Ala Gln Ala Phe Ala Arg Asp Arg Ala Val Met Trp 225 230 235 240 Thr Leu His Met Ala Glu Ser Asp His Asp Glu Arg Leu His Trp Met 245 250 255 Ser Pro Ala Glu Tyr Met Glu Cys Tyr Gly Leu Leu Asp Glu Arg Leu 260 265 270 Gln Val Ala His Cys Val Tyr Phe Asp Arg Lys Asp Val Arg Leu Leu 275 280 285 His Arg His Asn Val Lys Val Ala Ser Gln Val Val Ser Asn Ala Tyr 290 295 300 Leu Gly Ser Gly Val Ala Pro Val Pro Glu Met Val Glu Arg Gly Met 305 310 315 320 Ala Val Gly Ile Gly Thr Asp Asp Gly Asn Cys Asn Asp Ser Val Asn 325 330 335 Met Ile Gly Asp Met Lys Phe Met Ala His Ile His Arg Ala Val His 340 345 350 Arg Asp Ala Asp Val Leu Thr Pro Glu Lys Ile Leu Glu Met Ala Thr 355 360 365 Ile Asp Gly Ala Arg Ser Leu Gly Met Asp His Glu Ile Gly Ser Ile 370 375 380 Glu Thr Gly Lys Arg Ala Asp Leu Ile Leu Leu Asp Leu Arg His Pro 385 390 395 400 Gln Thr Thr Pro His His His Leu Ala Ala Thr Ile Val Phe Gln Ala 405 410 415 Tyr Gly Asn Glu Val Asp Thr Val Leu Ile Asp Gly Asn Val Val Met 420 425 430 Glu Asn Arg Arg Leu Ser Phe Leu Pro Pro Glu Arg Glu Leu Ala Phe 435 440 445 Leu Glu Glu Ala Gln Ser Arg Ala Thr Ala Ile Leu Gln Arg Ala Asn 450 455 460 Met Val Ala Asn Pro Ala Trp Arg Ser Leu 465 470 <210> 61 <211> 1443 <212> DNA <213> Artificial sequence <220> <223> Mel4 gene sequence <220> <221> RBS <222> (5)..(10) <220> <221> gene <222> (19)..(1443) <223> triA gene sequence <400> 61 agttaggaga ttcagaccat gcaaaccctc agcattcaac atggcaccct cgtgacgatg 60 gatcaatatc gccgggtgct cggcgatagc tgggtgcatg tgcaagatgg ccgcattgtg 120 gccctcggtg tgcatgccga atctgtgccc ccccccgccg atcgtgtgat tgatgcccgc 180 ggtaaagtgg tgctccccgg ttttattaat gcccataccc acgtgaatca aattctcctc 240 cgtggtggtc cctctcacgg tcgccaactc tatgattggt tctttaatgt gctctacccc 300 ggccaaaaag ccatgcgccc cgaagatgtg gccgtggccg tgcggctcta ttgtgccgaa 360 gccgtgcgca gtggtattac caccattaat gataatgccg attccgccat ttaccccggc 420 aatattgaag ccgcgatggc cgtgtatggc gaagtgggtg tgcgggtggt gtacgcccgc 480 atgtttttcg atcgcatgga tggccggatt caaggttatg tggatgccct caaagcccgg 540 agcccccaag tggaactctg ttctattatg gaagaaaccg ccgtggccaa agatcggatt 600 accgccctca gcgatcaata tcacggcacc gccggtggcc gcattagtgt gtggcccgcc 660 cccgccatta cccccgccgt gaccgtggag ggtatgcgtt gggcccaagc ctttgcccgc 720 gatcgggccg tgatgtggac cctccacatg gccgaaagcg atcatgatga acggctccac 780 tggatgtctc ccgccgaata tatggaatgt tacggcctcc tcgatgaacg cctccaagtg 840 gccactgtg tgtattttga tcgcaaagat gtgcggctcc tccatcgcca caatgtgaaa 900 gtggccagtc aagtggtgtc caatgcctac ctcggcagtg gtgtggcccc cgtgcccgaa 960 atggtggaac gtggcatggc cgtgggcatt ggcaccgatg atggtaattg taatgattcc 1020 gtgaatatga ttggcgatat gaaatttatg gcccatattc accgggccgt gcatcgcgat 1080 gccgatgtgc tcaccccga aaaaattctc gaaatggcca ccattgatgg cgcccgcagt 1140 ctcggtatgg atcatgaaat tggctccatt gaaaccggta aacgggccga tctcattctc 1200 ctcgatctcc gccaccccca aaccaccccc caccatcacc tcgccgccac cattgtgttt 1260 caagcctacg gtaatgaagt ggataccgtg ctcattgatg gcaatgtggt gatggaaaat 1320 cgccggctca gttttctccc ccccgaacgg gaactcgcct ttctcgaaga agcccaaagt 1380 cgcgccaccg ccattctcca acgcgccaat atggtggcca atcccgcctg gcgcagcctc 1440 taa 1443 <210> 62 <211> 474 <212> PRT <213> Artificial sequence <220> <223> Mel6 TriA <400> 62 Met Gln Thr Leu Ser Ile Gln His Gly Thr Leu Val Thr Met Asp Gln 1 5 10 15 Tyr Arg Arg Val Leu Gly Asp Ser Trp Val His Val Gln Asp Gly Arg 20 25 30 Ile Val Ala Leu Gly Val His Ala Glu Ser Val Pro Pro Pro Ala Asp 35 40 45 Arg Val Ile Asp Ala Arg Gly Lys Val Val Leu Pro Gly Phe Ile Asn 50 55 60 Ala His Thr His Val Asn Gln Ile Leu Leu Arg Gly Gly Pro Ser His 65 70 75 80 Gly Arg Gln Leu Tyr Asp Trp Leu Phe Asn Val Leu Tyr Pro Gly Gln 85 90 95 Lys Ala Met Arg Pro Glu Asp Val Ala Val Ala Val Arg Leu Tyr Cys 100 105 110 Ala Glu Ala Val Arg Ser Gly Ile Thr Thr Ile Asn Asp Asn Ala Asp 115 120 125 Ser Ala Ile Tyr Pro Gly Asn Ile Glu Ala Ala Met Ala Val Tyr Gly 130 135 140 Glu Val Gly Val Arg Val Val Tyr Ala Arg Met Phe Phe Asp Arg Met 145 150 155 160 Asp Gly Arg Ile Gln Gly Tyr Val Asp Ala Leu Lys Ala Arg Ser Pro 165 170 175 Gln Val Glu Leu Cys Ser Ile Met Glu Glu Thr Ala Val Ala Lys Asp 180 185 190 Arg Ile Thr Ala Leu Ser Asp Gln Tyr His Gly Thr Ala Gly Gly Arg 195 200 205 Ile Ser Val Trp Pro Ala Pro Ala Ile Thr Pro Ala Val Thr Val Glu 210 215 220 Gly Met Arg Trp Ala Gln Ala Phe Ala Arg Asp Arg Ala Val Met Trp 225 230 235 240 Thr Leu His Met Ala Glu Ser Asp His Asp Glu Arg Leu His Trp Met 245 250 255 Ser Pro Ala Glu Tyr Met Glu Cys Tyr Gly Leu Leu Asp Glu Arg Leu 260 265 270 Gln Val Ala His Cys Val Tyr Phe Asp Arg Lys Asp Val Arg Leu Leu 275 280 285 His Arg His Asn Val Lys Val Ala Ser Gln Val Val Ser Asn Ala Tyr 290 295 300 Leu Gly Ser Gly Val Ala Pro Val Pro Glu Met Val Lys Arg Gly Met 305 310 315 320 Ala Val Gly Ile Gly Thr Asp Asp Gly Asn Cys Asn Asp Ser Val Asn 325 330 335 Met Ile Gly Asp Met Lys Phe Met Ala His Ile His Arg Ala Val His 340 345 350 Arg Asp Ala Asp Val Leu Thr Pro Glu Lys Ile Leu Glu Met Ala Thr 355 360 365 Ile Asp Gly Ala Arg Ser Leu Gly Met Asp His Glu Ile Gly Ser Ile 370 375 380 Glu Thr Gly Lys Arg Ala Asp Leu Ile Leu Leu Asp Leu Arg His Pro 385 390 395 400 Gln Thr Thr Pro His His Leu Ala Ala Thr Ile Val Phe Gln Ala 405 410 415 Tyr Gly Asn Glu Val Asp Thr Val Leu Ile Asp Gly Asn Val Val Met 420 425 430 Glu Asn Arg Arg Leu Ser Phe Leu Pro Pro Glu Arg Glu Leu Ala Phe 435 440 445 Leu Glu Glu Ala Gln Ser Arg Ala Thr Ala Ile Leu Gln Arg Ala Asn 450 455 460 Met Val Ala Asn Pro Ala Trp Arg Ser Leu 465 470 <210> 63 <211> 1443 <212> DNA <213> Artificial sequence <220> <223> Mel6 gene sequence <220> <221> RBS <222> (5)..(10) <220> <221> Gene <222> (19)..(1443) <223> triA gene sequence <400> 63 agttaggaga ttcagaccat gcaaaccctc agcattcaac atggcaccct cgtgacgatg 60 gatcaatatc gccgggtgct cggcgatagc tgggtgcatg tgcaagatgg ccgcattgtg 120 gccctcggtg tgcatgccga atctgtgccc ccccccgccg atcgtgtgat tgatgcccgc 180 ggtaaagtgg tgctccccgg ttttattaat gcccataccc acgtgaatca aattctcctc 240 cgtggtggtc cctctcacgg tcgccaactc tatgattggc tctttaatgt gctctacccc 300 ggccaaaaag ccatgcgccc cgaagatgtg gccgtggccg tgcggctcta ttgtgccgaa 360 gccgtgcgca gtggtattac caccattaat gataatgccg attccgccat ttaccccggc 420 aatattgaag ccgcgatggc cgtgtatggc gaagtgggtg tgcgggtggt gtacgcccgc 480 atgtttttcg atcgcatgga tggccggatt caaggttatg tggatgccct caaagcccgg 540 agcccccaag tggaactctg ttctattatg gaagaaaccg ccgtggccaa agatcggatt 600 accgccctca gcgatcaata tcacggcacc gccggtggcc gcattagtgt gtggcccgcc 660 cccgccatta cccccgccgt gaccgtggag ggtatgcgtt gggcccaagc ctttgcccgc 720 gatcgggccg tgatgtggac cctccacatg gccgaaagcg atcatgatga acggctccac 780 tggatgtctc ccgccgaata tatggaatgt tacggcctcc tcgatgaacg cctccaagtg 840 gcccactgtg tgtattttga tcgcaaagat gtgcggctcc tccatcgcca caatgtgaaaa 900 gtggccagtc aagtggtgtc caatgcctac ctcggcagtg gtgtggcccc cgtgcccgaa 960 atggtgaaac gtggcatggc cgtgggcatt ggcaccgatg atggtaattg taatgattcc 1020 gtgaatatga ttggcgatat gaaatttatg gcccatattc accgggccgt gcatcgcgat 1080 gccgatgtgc tcaccccga aaaaattctc gaaatggcca ccattgatgg cgcccgcagt 1140 ctcggtatgg atcatgaaat tggctccatt gaaaccggta aacgggccga tctcattctc 1200 ctcgatctcc gccaccccca aaccaccccc caccatcacc tcgccgccac cattgtgttt 1260 caagcctacg gtaatgaagt ggataccgtg ctcattgatg gcaatgtggt gatggaaaat 1320 cgccggctca gttttctccc ccccgaacgg gaactcgcct ttctcgaaga agcccaaagt 1380 cgcgccaccg ccattctcca acgcgccaat atggtggcca atcccgcctg gcgcagcctc 1440 city ​​1443 <210> 64 <211> 474 <212> PRT <213> Artificial sequence <220> <223> Mel7 TriA <400> 64 Met Gln Thr Leu Ser Ile Gln His Gly Thr Leu Val Thr Met Asp Gln 1 5 10 15 Tyr Arg Arg Val Leu Gly Asp Ser Trp Val His Val Gln Asp Gly Arg 20 25 30 Ile Val Ala Leu Gly Val His Ala Glu Ser Val Pro Pro Pro Ala Asp 35 40 45 Arg Val Ile Asp Ala Arg Gly Lys Val Val Leu Pro Gly Phe Ile Asn 50 55 60 Ala His Thr His Val Asn Gln Ile Leu Leu Arg Gly Gly Pro Ser His 65 70 75 80 Gly Arg Gln Leu Tyr Asp Trp Leu Phe Asn Val Leu Tyr Pro Gly Gln 85 90 95 Lys Ala Met Arg Pro Glu Asp Val Ala Val Ala Val Arg Leu Tyr Cys 100 105 110 Ala Glu Ala Val Arg Ser Gly Ile Thr Thr Ile Asn Asp Asn Ala Asp 115 120 125 Ser Ala Ile Tyr Pro Gly Asn Ile Glu Ala Ala Met Ala Val Tyr Gly 130 135 140 Glu Val Gly Val Arg Val Val Tyr Ala Arg Met Phe Phe Asp Arg Met 145 150 155 160 Asp Gly Arg Ile Gln Gly Tyr Val Asp Ala Leu Lys Ala Arg Ser Pro 165 170 175 Gln Val Glu Leu Cys Ser Ile Met Glu Glu Thr Ala Val Ala Lys Asp 180 185 190 Arg Ile Thr Ala Leu Ser Asp Gln Tyr His Gly Thr Ala Gly Gly Arg 195 200 205 Ile Ser Val Trp Pro Ala Pro Ala Ile Thr Pro Ala Val Thr Val Glu 210 215 220 Gly Met Arg Trp Ala Gln Ala Phe Ala Arg Asp Arg Ala Val Met Trp 225 230 235 240 Thr Leu His Met Ala Glu Ser Asp His Asp Glu Arg Leu Tyr Trp Met 245 250 255 Ser Pro Ala Glu Tyr Met Glu Cys Tyr Gly Leu Leu Asp Glu Arg Leu 260 265 270 Gln Val Ala His Cys Val Tyr Phe Asp Arg Lys Asp Val Arg Leu Leu 275 280 285 His Arg His Asn Val Lys Val Ala Ser Gln Val Val Ser Asn Ala Tyr 290 295 300 Leu Gly Ser Gly Val Ala Pro Val Pro Glu Met Val Glu Arg Gly Met 305 310 315 320 Ala Val Gly Ile Gly Thr Asp Asp Gly Asn Cys Asn Asp Ser Val Asn 325 330 335 Met Ile Gly Asp Met Lys Phe Met Ala His Ile His Arg Ala Val His 340 345 350 Arg Asp Ala Asp Val Leu Thr Pro Glu Lys Ile Leu Glu Met Ala Thr 355 360 365 Ile Asp Gly Ala Arg Ser Leu Gly Met Asp His Glu Ile Gly Ser Ile 370 375 380 Glu Thr Gly Lys Arg Ala Asp Leu Ile Leu Leu Asp Leu Arg His Pro 385 390 395 400 Gln Thr Thr Pro His His His Leu Ala Ala Thr Ile Val Phe Gln Ala 405 410 415 Tyr Gly Asn Glu Val Asp Thr Val Leu Ile Asp Gly Asn Val Val Met 420 425 430 Glu Asn Arg Arg Leu Ser Phe Leu Pro Pro Glu Arg Glu Leu Ala Phe 435 440 445 Leu Glu Glu Ala Gln Ser Arg Ala Thr Ala Ile Leu Gln Arg Ala Asn 450 455 460 Met Val Ala Asn Pro Ala Trp Arg Ser Leu 465 470 <210> 65 <211> 1443 <212> DNA <213> Artificial sequence <220> <223> Mel7 gene sequence <220> <221> RBS <222> (5)..(10) <220> <221> gene <222> (19)..(1443) <223> triA gene sequence <400> 65 agttaggaga ttcagaccat gcaaaccctc agcattcaac atggcaccct cgtgacgatg 60 gatcaatatc gccgggtgct cggcgatagc tgggtgcatg tgcaagatgg ccgcattgtg 120 gccctcggtg tgcatgccga atctgtgccc ccccccgccg atcgtgtgat tgatgcccgc 180 ggtaaagtgg tgctccccgg ttttattaat gcccataccc acgtgaatca aattctcctc 240 cgtggtggtc cctctcacgg tcgccaactc tatgattggc tctttaatgt gctctacccc 300 ggccaaaaag ccatgcgccc cgaagatgtg gccgtggccg tgcggctcta ttgtgccgaa 360 gccgtgcgca gtggtattac caccattaat gataatgccg attccgccat ttaccccggc 420 aatattgaag ccgcgatggc cgtgtatggc gaagtgggtg tgcgggtggt gtacgcccgc 480 atgtttttcg atcgcatgga tggccggatt caaggttatg tggatgccct caaagcccgg 540 agcccccaag tggaactctg ttctattatg gaagaaaccg ccgtggccaa agatcggatt 600 accgccctca gcgatcaata tcacggcacc gccggtggcc gcattagtgt gtggcccgcc 660 cccgccatta cccccgccgt gaccgtggag ggtatgcgtt gggcccaagc ctttgcccgc 720 gatcgggccg tgatgtggac cctccacatg gccgaaagcg atcatgatga acggctctac 780 tggatgtctc ccgccgaata tatggaatgt tacggcctcc tcgatgaacg cctccaagtg 840 gccactgtg tgtattttga tcgcaaagat gtgcggctcc tccatcgcca caatgtgaaa 900 gtggccagtc aagtggtgtc caatgcctac ctcggcagtg gtgtggcccc cgtgcccgaa 960 atggtggaac gtggcatggc cgtgggcatt ggcaccgatg atggtaattg taatgattcc 1020 gtgaatatga ttggcgatat gaaatttatg gcccatattc accgggccgt gcatcgcgat 1080 gccgatgtgc tcaccccga aaaaattctc gaaatggcca ccattgatgg cgcccgcagt 1140 ctcggtatgg atcatgaaat tggctccatt gaaaccggta aacgggccga tctcattctc 1200 ctcgatctcc gccaccccca aaccaccccc caccatcacc tcgccgccac cattgtgttt 1260 caagcctacg gtaatgaagt ggataccgtg ctcattgatg gcaatgtggt gatggaaaat 1320 cgccggctca gttttctccc ccccgaacgg gaactcgcct ttctcgaaga agcccaaagt 1380 cgcgccaccg ccattctcca acgcgccaat atggtggcca atcccgcctg gcgcagcctc 1440 taa 1443 <210> 66 <211> 474 <212> PRT <213> Artificial sequence <220> <223> Mel8 TriA <400> 66 Met Gln Thr Leu Ser Ile Gln His Gly Thr Leu Val Thr Met Asp Gln 1 5 10 15 Tyr Arg Arg Val Leu Gly Asp Ser Trp Val His Val Gln Asp Gly Arg 20 25 30 Ile Val Ala Leu Gly Val His Ala Glu Ser Val Pro Pro Pro Ala Asp 35 40 45 Arg Val Ile Asp Ala Arg Gly Lys Val Val Leu Pro Gly Phe Ile Asn 50 55 60 Ala His Thr His Val Asn Gln Ile Leu Leu Arg Gly Gly Pro Ser His 65 70 75 80 Gly Arg Gln Leu Tyr Asp Trp Leu Phe Asn Val Leu Tyr Pro Gly Gln 85 90 95 Lys Ala Met Arg Pro Glu Asp Val Ala Val Ala Val Arg Leu Tyr Cys 100 105 110 Ala Glu Ala Val Arg Ser Gly Ile Thr Thr Ile Asn Asp Asn Ala Asp 115 120 125 Ser Ala Ile Tyr Pro Gly Asn Ile Glu Ala Ala Met Ala Val Tyr Gly 130 135 140 Glu Val Gly Val Arg Val Val Tyr Ala Arg Met Phe Phe Asp Arg Met 145 150 155 160 Asp Gly Arg Ile Gln Gly Tyr Val Asp Ala Leu Lys Ala Arg Ser Pro 165 170 175 Gln Val Glu Leu Cys Ser Ile Met Glu Glu Thr Ala Val Ala Lys Asp 180 185 190 Arg Ile Thr Ala Leu Ser Asp Gln Tyr His Gly Thr Ala Gly Gly Arg 195 200 205 Ile Ser Val Trp Pro Ala Pro Ala Ile Thr Pro Ala Val Thr Val Glu 210 215 220 Gly Met Arg Trp Ala Gln Ala Phe Ala Arg Asp Arg Ala Val Met Trp 225 230 235 240 Thr Leu His Met Ala Glu Ser Asp His Asp Glu Arg Leu His Trp Met 245 250 255 Ser Pro Ala Glu Tyr Met Glu Cys Tyr Gly Leu Leu Asp Glu Arg Leu 260 265 270 Gln Val Ala His Cys Val Tyr Phe Asp Arg Lys Asp Val Arg Leu Leu 275 280 285 His Arg His Asn Val Lys Val Ala Ser Gln Val Val Ser Asn Ala Tyr 290 295 300 Leu Gly Ser Gly Val Ala Pro Val Pro Glu Met Val Glu Arg Gly Met 305 310 315 320 Ala Val Gly Ile Gly Thr Asp Asp Gly Asn Cys Asn Asp Ser Val Asn 325 330 335 Met Ile Gly Asp Met Lys Phe Met Ala His Ile His Arg Ala Val His 340 345 350 Arg Asp Val Asp Val Leu Thr Pro Glu Lys Ile Leu Glu Met Ala Thr 355 360 365 Ile Asp Gly Ala Arg Ser Leu Gly Met Asp His Glu Ile Gly Ser Ile 370 375 380 Glu Thr Gly Lys Arg Ala Asp Leu Ile Leu Leu Asp Leu Arg His Pro 385 390 395 400 Gln Thr Thr Pro His His Leu Ala Ala Thr Ile Val Phe Gln Ala 405 410 415 Tyr Gly Asn Glu Val Asp Thr Val Leu Ile Asp Gly Asn Val Val Met 420 425 430 Glu Asn Arg Arg Leu Ser Phe Leu Pro Pro Glu Arg Glu Leu Ala Phe 435 440 445 Leu Glu Glu Ala Gln Ser Arg Ala Thr Ala Ile Leu Gln Arg Ala Asn 450 455 460 Met Val Ala Asn Pro Ala Trp Arg Ser Leu 465 470 <210> 67 <211> 1443 <212> DNA <213> Artificial sequence <220> <223> Mel8 gene sequence <220> <221> RBS <222> (5)..(10) <220> <221> Gene <222> (19)..(1443) <223> triA gene sequence <400> 67 agttaggaga ttcagaccat gcaaaccctc agcattcaac atggcaccct cgtgacgatg 60 gatcaatatc gccgggtgct cggcgatagc tgggtgcatg tgcaagatgg ccgcattgtg 120 gccctcggtg tgcatgccga atctgtgccc ccccccgccg atcgtgtgat tgatgcccgc 180 ggtaaagtgg tgctccccgg ttttattaat gcccataccc acgtgaatca aattctcctc 240 cgtggtggtc cctctcacgg tcgccaactc tatgattggc tctttaatgt gctctacccc 300 ggccaaaaag ccatgcgccc cgaagatgtg gccgtggccg tgcggctcta ttgtgccgaa 360 gccgtgcgca gtggtattac caccattaat gataatgccg attccgccat ttaccccggc 420 aatattgaag ccgcgatggc cgtgtatggc gaagtgggtg tgcgggtggt gtacgcccgc 480 atgtttttcg atcgcatgga tggccggatt caaggttatg tggatgccct caaagcccgg 540 agcccccaag tggaactctg ttctattatg gaagaaaccg ccgtggccaa agatcggatt 600 accgccctca gcgatcaata tcacggcacc gccggtggcc gcattagtgt gtggcccgcc 660 cccgccatta cccccgccgt gaccgtggag ggtatgcgtt gggcccaagc ctttgcccgc 720 gatcgggccg tgatgtggac cctccacatg gccgaaagcg atcatgatga acggctccac 780 tggatgtctc ccgccgaata tatggaatgt tacggcctcc tcgatgaacg cctccaagtg 840 gcccactgtg tgtattttga tcgcaaagat gtgcggctcc tccatcgcca caatgtgaaaa 900 gtggccagtc aagtggtgtc caatgcctac ctcggcagtg gtgtggcccc cgtgcccgaa 960 atggtggaac gtggcatggc cgtgggcatt ggcaccgatg atggtaattg taatgattcc 1020 gtgaatatga ttggcgatat gaaatttatg gcccatattc accgggccgt gcatcgcgat 1080 gtcgatgtgc tcacccccga aaaattctc gaaatggcca ccattgatgg cgcccgcagt 1140 ctcggtatgg atcatgaaat tggctccatt gaaaccggta aacgggccga tctcattctc 1200 ctcgatctcc gccaccccca aaccaccccc caccatcacc tcgccgccac cattgtgttt 1260 caagcctacg gtaatgaagt ggataccgtg ctcattgatg gcaatgtggt gatggaaaat 1320 cgccggctca gttttctccc ccccgaacgg gaactcgcct ttctcgaaga agcccaaagt 1380 cgcgccaccg ccattctcca acgcgccaat atggtggcca atcccgcctg gcgcagcctc 1440 city ​​1443 <210> 68 <211> 474 <212> PRT <213> Artificial sequence <220> <223> Mel5Evo TriA <400> 68 Met Gln Thr Leu Ser Ile Gln His Gly Thr Leu Val Thr Met Asp Gln 1 5 10 15 Tyr Arg Arg Val Leu Gly Asp Ser Trp Val His Val Gln Asp Gly Arg 20 25 30 Ile Val Ala Leu Gly Val His Ala Glu Ser Val Pro Pro Pro Ala Asp 35 40 45 Arg Val Ile Asp Ala Arg Gly Lys Val Val Leu Pro Gly Phe Ile Asn 50 55 60 Ala His Thr His Val Asn Gln Ile Leu Leu Arg Gly Gly Pro Ser His 65 70 75 80 Gly Arg Gln Leu Tyr Asp Trp Leu Phe Asn Val Leu Tyr Pro Gly Gln 85 90 95 Lys Ala Met Arg Pro Glu Asp Val Ala Val Ala Val Arg Leu Tyr Cys 100 105 110 Ala Glu Ala Val Arg Ser Gly Ile Thr Thr Ile Asn Asp Asn Ala Asp 115 120 125 Ser Ala Ile Tyr Pro Gly Asn Ile Glu Ala Ala Met Ala Val Tyr Gly 130 135 140 Glu Val Gly Val Arg Val Val Tyr Ala Arg Met Phe Phe Asp Arg Met 145 150 155 160 Asp Gly Arg Ile Gln Gly Tyr Val Asp Ala Leu Lys Ala Arg Ser Pro 165 170 175 Gln Val Glu Leu Cys Ser Ile Met Glu Glu Thr Ala Val Ala Lys Asp 180 185 190 Arg Ile Thr Ala Leu Ser Asp Gln Tyr His Gly Thr Ala Gly Gly Arg 195 200 205 Ile Ser Val Trp Pro Ala Pro Ala Ile Asn Pro Ala Val Thr Val Glu 210 215 220 Gly Met Arg Trp Ala Gln Ala Phe Ala Arg Asp Arg Ala Val Met Trp 225 230 235 240 Thr Leu His Met Ala Glu Ser Asp His Asp Glu Arg Leu His Trp Met 245 250 255 Ser Pro Ala Glu Tyr Met Glu Cys Tyr Gly Leu Leu Asp Glu Arg Leu 260 265 270 Gln Val Ala His Cys Met Tyr Phe Asp Arg Lys Asp Val Arg Leu Leu 275 280 285 His Arg His Asn Val Lys Val Ala Ser Gln Val Val Ser Asn Ala Tyr 290 295 300 Leu Gly Ser Gly Val Ala Pro Val Pro Glu Met Val Glu Arg Gly Met 305 310 315 320 Ala Val Gly Ile Gly Thr Asp Asp Gly Asn Cys Asn Asp Ser Val Asn 325 330 335 Met Ile Gly Asp Met Lys Phe Met Ala His Ile His Arg Ala Val His 340 345 350 Arg Asp Ala Asp Val Leu Thr Pro Glu Lys Ile Leu Glu Met Ala Thr 355 360 365 Ile Asp Gly Ala Arg Ser Leu Gly Met Asp His Glu Ile Gly Ser Ile 370 375 380 Glu Thr Gly Lys Arg Ala Asp Leu Ile Leu Leu Asp Leu Arg His Pro 385 390 395 400 Gln Thr Thr Pro His His His Leu Ala Ala Thr Ile Val Phe Gln Ala 405 410 415 Tyr Gly Asn Glu Val Asp Thr Val Leu Ile Asp Gly Asn Val Val Met 420 425 430 Glu Asn Arg Arg Leu Ser Phe Leu Pro Pro Glu Arg Glu Leu Ala Phe 435 440 445 Leu Glu Glu Ala Gln Ser Arg Ala Thr Ala Ile Leu Gln Arg Ala Asn 450 455 460 Met Val Ala Asn Pro Ala Trp Arg Ser Leu 465 470 <210> 69 <211> 1446 <212> DNA <213> Artificial sequence <220> <223> Mel5Evo <220> <221> RBS <222> (1)..(21) <220> <221> Gene <222> (22)..(1446) <223> triA gene sequence <400> 69 gctagttaga agattcagac catgcaaacc ctcagcattc aacatggcac cctcgtgacg 60 atggatcaat atcgccgggt gctcggcgat agctgggtgc atgtgcaaga tggccgcatt 120 gtggccctcg gtgtgcatgc cgaatctgtg cccccccccg ccgatcgtgt gattgatgcc 180 cgcggtaaag tggtgctccc cggttttatt aatgcccata cccacgtgaa tcaaattctc 240 ctccgtggtg gtccctctca cggtcgccaa ctctatgatt ggctctttaa tgtgctctac 300 cccggccaaa aagccatgcg ccccgaagat gtggccgtgg ccgtgcggct ctattgtgcc 360 gaagccgtgc gcagtggtat taccaccatt aatgataatg ccgattccgc catttacccc 420 ggcaatattg aagccgcgat ggccgtgtat ggcgaagtgg gtgtgcgggt ggtgtacgcc 480 cgcatgtttt tcgatcgcat ggatggccgg attcaaggtt atgtggatgc cctcaaagcc 540 cggagccccc aagtggaact ctgttctatt atggaagaaa ccgccgtggc caaagatcgg 600 attaccgccc tcagcgatca atatcacggc accgccggtg gccgcattag tgtgtggccc 660 gcccccgcca ttaaccccgc cgtgaccgtg gagggtatgc gttgggccca agcctttgcc 720 cgcgatcggg ccgtgatgtg gaccctccac atggccgaaa gcgatcatga tgaacggctc 780 cactggatgt ctcccgccga atatatggaa tgttacggcc tcctcgatga acgcctccaa 840 gtggcccact gtatgtattt tgatcgcaaa gatgtgcggc tcctccatcg ccacaatgtg 900 aaagtggcca gtcaagtggt gtccaatgcc tacctcggca gtggtgtggc ccccgtgccc 960 gaaatggtgg aacgtggcat ggccgtgggc attggcaccg atgatggtaa ttgtaatgat 1020 tccgtgaata tgattggcga tatgaaattt atggcccata ttcaccgggc cgtgcatcgc 1080 gatgccgatg tgctcacccc cgaaaaaatt ctcgaaatgg ccaccattga tggcgcccgc 1140 agtctcggta tggatcatga aattggctcc attgaaaccg gtaaacgggc cgatctcatt 1200 ctcctcgatc tccgccaccc ccaaaccacc ccccaccatc acctcgccgc caccattgtg 1260 tttcaagcct acggtaatga agtggatacc gtgctcattg atggcaatgt ggtgatggaa 1320 aatcgccggc tcagttttct cccccccgaa cgggaactcg cctttctcga agaagcccaa 1380 agtcgcgcca ccgccattct ccaacgcgcc aatatggtgg ccaatcccgc ctggcgcagc 1440 ctctaa 1446 <210> 70 <211> 1443 <212> DNA <213> Artificial sequence <220> <223> Mel5 triA includes RBS <220> <221> RBS <222> (5)..(10) <220> <221> gene <222> (19)..(1443) <223> triA gene sequence <400> 70 agttagaaga ttcagaccat gcaaaccctc agcattcaac atggcaccct cgtgacgatg 60 gatcaatatc gccgggtgct cggcgatagc tgggtgcatg tgcaagatgg ccgcattgtg 120 gccctcggtg tgcatgccga atctgtgccc ccccccgccg atcgtgtgat tgatgcccgc 180 ggtaaagtgg tgctccccgg ttttattaat gcccataccc acgtgaatca aattctcctc 240 cgtggtggtc cctctcacgg tcgccaactc tatgattggc tctttaatgt gctctacccc 300 ggccaaaaag ccatgcgccc cgaagatgtg gccgtggccg tgcggctcta ttgtgccgaa 360 gccgtgcgca gtggtattac caccattaat gataatgccg attccgccat ttaccccggc 420 aatattgaag ccgcgatggc cgtgtatggc gaagtgggtg tgcgggtggt gtacgcccgc 480 atgtttttcg atcgcatgga tggccggatt caaggttatg tggatgccct caaagcccgg 540 agcccccaag tggaactctg ttctattatg gaagaaaccg ccgtggccaa agatcggatt 600 accgccctca gcgatcaata tcacggcacc gccggtggcc gcattagtgt gtggcccgcc 660 cccgccatta cccccgccgt gaccgtggag ggtatgcgtt gggcccaagc ctttgcccgc 720 gatcgggccg tgatgtggac cctccacatg gccgaaagcg atcatgatga acggctccac 780 tggatgtctc ccgccgaata tatggaatgt tacggcctcc tcgatgaacg cctccaagtg 840 gccactgtg tgtattttga tcgcaaagat gtgcggctcc tccatcgcca caatgtgaaa 900 gtggccagtc aagtggtgtc caatgcctac ctcggcagtg gtgtggcccc cgtgcccgaa 960 atggtggaac gtggcatggc cgtgggcatt ggcaccgatg atggtaattg taatgattcc 1020 gtgaatatga ttggcgatat gaaatttatg gcccatattc accgggccgt gcatcgcgat 1080 gccgatgtgc tcacccccga aaaaattctc gaaatggcca ccattgatgg cgcccgcagt 1140 ctcggtatgg atcatgaaat tggctccatt gaaaccggta aacgggccga tctcattctc 1200 ctcgatctcc gccaccccca aaccaccccc caccatcacc tcgccgccac cattgtgttt 1260 caagcctacg gtaatgaagt ggataccgtg ctcattgatg gcaatgtggt gatggaaaat 1320 cgccggctca gttttctccc ccccgaacgg gaactcgcct ttctcgaaga agcccaaagt 1380 cgcgccaccg ccattctcca acgcgccaat atggtggcca atcccgcctg gcgcagcctc 1440 taa 1443 <210> 71 <211> 726 <212> DNA <213> Artificial sequence <220> <223> trzE Rhodococcus sp. Mel <400> 71 atgatatact caacagtcaa cgctaatcct tacgcttggc cttacgatgg ttcaatagac 60 cctgctcaca ccgctttaat cttaatcgat tggcaaatag acttttgtgg tccaggtggt 120 tatgcgatt ccatgggtta cgacttatcc ttgactagaa gtggtttaga acctacagca 180 agagtattgg ctgcagccag agatactggt atgacagtta tccatactag agaaggtcac 240 agaccagatt tggctgactt gccacctaat aagagatgga gatctgcatc agccggtgct 300 gaaatcggtt cagttggtcc atgtggtaga attttagtca gaggtgaacc tggttgggaa 360 atagtaccag aagttgcacc tagagaaggt gaaccaatta tagataaacc tggtaaaggt 420 gctttctacg caacagattt ggacttgttg ttgagaacaa gaggtatcac ccatttgatt 480 ttgaccggta taactacaga tgtttgcgtc cacaccacta tgagagaagc caacgataga 540 ggttacgaat gttaattttt gtctgattgc accggtgcta ctgacagaaa gcatcacgaa 600 gctgcattat ctatggtcac catgcaaggt ggtgtattcg gtgcaactgc ccattcagat 660 gacttattgg ccgctttggg tacaaccgtt ccagcagccg ctggtcctag agctagaaca 720 street 726 <210> 72 <211> 726 <212> DNA <213> Artificial sequence <220> <223> trzE Rhodococcus sp. Mel <400> 72 atgatttata gtaccgtgaa tgccaatccc tatgcctggc cctacgatgg ctccattgat 60 cccgcccaca ccgccctcat cctcatcgat tggcaaatcg atttttgtgg tcccggcggt 120 tatgtggata gtatgggcta cgatctcagc ctcacccgct ctggcctcga acccaccgcc 180 cgcgtgctcg ccgccgcccg cgataccggc atgaccgtga ttcacacccg cgaaggtcat 240 cgtcccgatc tcgccgatct cccccccaat aaacgttggc ggagtgcctc cgccggcgcc 300 gaaattggca gtgtgggtcc ctgtggccgc attctcgtgc gtggtgaacc cggttgggaa 360 attgtgcccg aagtggcccc ccgcgaaggt gaacccatta ttgataaacc cggtaaaggt 420 gccttttatg ccaccgatct cgatctcctc ctccgcaccc gcggcattac ccacctcatt 480 ctcaccggca ttaccaccga tgtgtgtgtg cataccacca tgcgcgaagc caatgatcgg 540 ggctacgaat gtctcattct ctccgattgt accggtgcca ccgatcggaa acaccatgaa 600 gccgccctca gcatggtgac catgcaaggc ggtgtgtttg gtgccaccgc ccattctgat 660 gatctcctcg ccgccctcgg caccaccgtg cccgccgccg ccggcccccg tgcccgcacc 720 gaataa 726 <210> 73 <211> 1239 <212> DNA <213> Artificial sequence <220> <223> trzC Acidovorax avenae subsp. citrulli NRRL B-12227 <400> 73 atgtcaatgg aaacccatag ttatgtagac gtcgcaattc gtaacgcgcg tcttgccgat 60 acggagggaa ttgtcgatat tcttattcac gatgggcgca ttgcgtccat cgtgaagtcg 120 acaaaaacaa aaggatcggt ggagatcgat gctcatgagg gtctggtcac ttccggcctg 180 gtagagcctc acatccatct cgataaggcc ctgacggcag atcgggttcc cgcaggaagc 240 attggcgacc ttcgaacgcg acgaggcctt gagatggcaa ttcgggccac ccgtgatatc 300 aagcgtacgt tcacggttga agatgttcga gaacgggcca tacgtgcggc cctgatggca 360 tcccgtgcgg gaaccaccgc attgcggaca cacgtcgatg tcgacccgat tgtcggcctc 420 gcaggtatcc gtggtgtcct tgaggcgcgt gaagtctgcg cgggattgat cgatatccag 480 atcgtcgcct tccctcagga gggactcttc tgctctgcgg gggccgtgga cctcatgcgg 540 gaggcgatca aactgggcgc ggatgccgtc ggcggcgcac ccgcgctgga tgatcgcccg 600 caggaccatg tccgagccgt ttttgacctt gctgctgagt tcggcctgcc cgtagacatg 660 cacgtcgatg agtccgaccg gcgggaagac tttacgcttc cctttgtgat tgaagctgcc 720 cgtgaacggc gtgtgcccaa tgtgaccgtc gcgcacatca gctcgctgtc cgtacagacg 780 gatgacgtag cacggtcgac cattgccgcc cttgcggacg ccgatgttaa tgtcgtggtt 840 aatccgatca ttgtcaaaat tacgcggctg agtgaattac tcgatgccgg agtctccgta 900 atgtttggct cggacaacct gcgggatccg ttctatccgc tcggagcggc gaatcccctt 960 ggatcagcca tttttgcctg tcaaattgcc gcgctgggaa caccgcaaga tctcagacgg 1020 gtattcgatg cggtcaccat caacgctgcc cgcatgctgg gattcccctc acttttaggc 1080 gtcgtggaag gggcagtcgc ggatctcgca gtattcccat cggcgacgcc cgaggaggtt 1140 gttctggatc aacagtctcc gctcttcgta ctcaagggcg gacgtgtcgt tgccatgcga 1200 ttggccgctg gatcaacgtc gttccgcgac tactcatga 1239 <210> 74 <211> 1239 <212> DNA <213> Artificial sequence <220> <223> trzC Acidovorax avenae subsp. citrulli NRRL B-12227 <400> 74 atgagcatgg aaacccactc ctatgttgat gttgcgatcc gtaacgcccg tctcgccgat 60 accgaaggca ttgttgatat tctgattcat gatggtcgga ttgccagcat tgtgaaatcc 120 accaaaacca aaggttccgt ggaaattgat gcccatgaag gtctcgtgac cagtggcctc 180 gtggaacccc acattcatct cgataaagcc ctcaccgccg atcgcgtgcc cgccggtagt 240 attggcgatc tccggacccg ccggggtctc gaaatggcca ttcgcgccac ccgcgatatt 300 aaacgcacct ttaccgtgga agatgtgcgg gaacgcgcca ttcgggccgc cctcatggcc 360 agtcgcgccg gcaccaccgc cctccgcacc catgtggatg tggaccccat tgtgggtctc 420 gccggtattc ggggcgtgct cgaagcccgc gaagtgtgtg ccggtctcat tgatattcaa 480 attgtggcct ttccccaaga aggcctcttt tgtagtgccg gtgccgtgga tctcatgcgg 540 gaagccatta aactcggtgc cgatgccgtg ggcggtgccc ccgccctcga tgatcgcccc 600 caagatcatg tgcgcgccgt gtttgatctc gccgccgaat ttggtctccc cgtggatatg 660. cacgtggatg aaagtgatcg ccggggagat tttaccctcc cctttgtgat tgaagccgcc 720 cgcgaacggc gcgtgcccaa tgtgaccgtg gcccacattt cctctctcag tgtgcaaacc 780 gatgatgtgg cccgctccac cattgccgcc ctcgccgatg ccgatgtgaa tgtggtggtg 840 aatcccatta ttgtgaaaat tacccgcctc tctgaactcc tcgatgccgg tgtgtctgtg atgtttggct ccgataatct ccgcgatccc ttttatcccc tcggtgccgc caatcccctc 960. ggtagtgcca tttttgcctg tcaaattgcc gccctcggca ccccccaaga cctccgccgg 1020 gtgtttgatg ccgtgaccat taatgccgcc cgcatgctcg gttttcccag tctcctcggt 1080 gtggtggaag gtgccgtggc cgatctcgcc gtgtttccca gtgccacccc cgaagaagtg gtgctcgatc aacaaagtcc cctctttgtg ctcaaaggtg gtcgggtcgt tgcgatgcgg ttagcggcgg gtagcacctc ctttcgtgat tattcgtaa 1239 <210> 75 <211> 1866 <212> DNA <213> Artificial sequence <220> <223> DUR 1,2 Saccharomyces cerevisiae, truncated amino acids 1-622 <400> 75 atgacagtta gttccgatac aactgctgaa atatcgttag gttggtcaat ccaagactgg 60 attgatttcc acaagtcatc aagctcccag gcttcactaa ggcttcttga atcactacta 120 gactctcaaa atgttgcgcc agtcgataat gcgtggatat cgctaatttc aaaggaaaat 180 ttactgcacc aattccaaat tttaaagagc agagaaaata aagaaactct acctctctac 240 ggtgtcccta ttgctgttaa ggacaacatc gacgttagag gtctacccac caccgctgca 300 tgtccatcct ttgcatatga gccttccaaa gactctaaag tagtagaact actaagaaat 360 gcaggtgcga taatcgtggg taagacaaac ttggaccaat ttgccacagg attagtcggc 420 acacggtctc catatgggaa aacaccttgc gcttttagca aagagcatgt atctggtggt 480 tcctccgctg ggtcagcatc ggtggtcgcc agaggtatcg taccaattgc attgggtact 540 gatacagcag gttctggtag agtcccagcc gccttgaaca acctgattgg cctaaagcca 600 acaaagggcg tcttttcctg tcaaggtgta gttcccgctt gtaaatcttt agactgcgtc 660 tccatctttg cattaaacct aagtgatgct gaacgctgct tccgcatcat gtgccagcca 720 gatcctgata atgatgaata ttctagaccc tatgtttcca accctttgaa aaaattttca 780 agcaatgtaa cgattgctat tcctaaaaat atcccatggt atggtgaaac caagaatcct 840 gtactgtttt ccaatgctgt cgaaaatcta tcaagaacgg gcgctaacgt catagaaatt 900 gattttgagc ctcttttaga gttagctcgc tgtttatacg aaggtacttg ggtggccgag 960 cgttatcaag ctattcaatc gtttttggac agtaaaccac caaaggaatc tttggaccct 1020 actgttattt caattataga aggggccaag aaatacagtg cagtagactg cttcagtttt 1080 gaatacaaaa gacaaggcat cttgcaaaaa gtgagacgac ttctcgaatc agtcgatgta 1140 ttgtgtgtgc ccacatgtcc tttaaatcct actatgcaac aagttgcgga tgaaccagtc 1200 ctagtcaatt caagacaagg cacatggact aattttgtca acttggcaga tttggcagcc 1260 cttgctgttc ccgcagggtt ccgagacgat ggtttgccaa atggtattac tttaatcggt 1320 aaaaaattca cagattacgc actattagag ttggctaacc gctatttcca aaatatattc 1380 cccaacggtt ccagaacata cggtactttt acctcttctt cagtaaagcc agcaaacgat 1440 caattagtgg gaccagacta tgacccatct acgtccataa aattggctgt tgtcggtgca 1500 catcttaagg gtctgcctct acattggcaa ttggaaaagg tcaatgcaac atatttatgt 1560 acaacaaaaa catcaaaagc ttaccagctt tttgctttgc ccaaaaatgg accagtttta 1620 aaacctggtt tgagaagagt tcaagatagc aatggctctc aaatcgaatt agaagtgtac 1680 agtgttccaa aagaactgtt cggtgctttt atttccatgg ttcctgaacc attaggaata 1740 ggttcagtgg agttagaatc tggtgaatgg atcaaatcct ttatttgtga agaatctggt 1800 tacaaagcca aaggtacagt tgatatcaca aagtatggtg gatttagagc atattttgaa 1860 atgttg 1866 <210> 76 <211> 1869 <212> DNA <213> Artificial sequence <220> <223> DUR 1,2 Saccharomyces cerevisiae, truncated amino acids 1-622 <400> 76 atgaccgtga gttccgatac caccgccgaa atttctctcg gctggagtat ccaagattgg 60 atcgattttc acaaaagctc tagttcccaa gcctccctcc gcctcctcga atccctcctc 120 gatagccaaa atgtggcccc cgtggataat gcctggattt ccctcattag caaggaaaac 180 ctcctccatc aatttcaaat tctcaagtct cgcgaaaaca aggaaaccct ccccctctat 240 ggtgtgccca ttgccgtgaa agataatatt gatgtgcgtg gcctccccac caccgccgcc 300 tgtcccagtt ttgcctacga accctctaaa gatagtaaag tggtggaact cctccgcaat 360 gccggcgcca ttattgtggg taaaaccaat ctcgatcaat ttgccaccgg cctcgtgggc 420 acccgcagtc cctatggcaa aaccccctgt gccttttcca aagaacacgt gagcggcggt 480 agctctgccg gctccgccag cgtggtggcc cgcggtattg tgcccattgc cctcggcacc 540 gataccgccg gctctggtcg ggtgcccgcc gccctcaata atctcattgg cctcaaaccc 600 accaagggtg tgtttagttg tcaaggcgtg gtgcccgcct gtaaatctct cgattgtgtg 660 agtatttttg ccctcaatct cagcgatgcc gaacgctgtt ttcggattat gtgtcaaccc 720 gatcccgata atgatgaata ttcccgcccc tacgtgagca atcccctcaa aaaatttagt 780 tccaatgtga ccattgccat tcccaaaat attccctggt atggtgaaac caaaaatccc 840 gtgctctttt ccaatgccgt ggaaaatctc agccggaccg gcgccaatgt gattgaaatt 900 gattttgaac ccctcctcga actcgcccgc tgtctctatg aaggcacctg ggtggccgaa 960 cgctatcaag ccattcaatc ttttctcgat agtaaacccc ccaaagaatc tctcgatccc 1020 accgtgatta gtatcatcga aggtgccaaa aaatactccg ccgtggattg ttttagcttt 1080 gaatacaaac gccaaggcat tctccaaaaa gtgcgccggc tcctcgaatc cgtggatgtg 1140 ctctgtgtgc ccacctgtcc cctcaatccc accatgcaac aagtggccga tgaacccgtg 1200 ctcgtgaata gccgccaagg cacctggacc aattttgtga atctcgccga tctcgccgcc 1260 ctcgccgtgc ccgccggttt tcgggatgat ggcctcccca atggtattac cctcattggc 1320 aaaaaattta ccgattatgc cctcctcgaa ctcgccaacc gctactttca aaacatcttt 1380 cccaacggct cccggaccta tggcaccttt accagctcta gtgtgaaacc cgccaatgat 1440 caactcgtgg gccccgatta cgatccctct accagtatta aactcgccgt ggtgggcgcc 1500 cacctcaaag gcctccccct ccattggcaa ctcgaaaaag tgaatgccac ctatctctgt 1560 accaccaaaa ccagcaaagc ctaccaactc tttgccctcc ccaaaaatgg tcccgtgctc 1620 aaacccggcc tccgtcgtgt gcaagattcc aatggtagcc aaattgaact cgaagtgtat 1680 tccgtgccca aagaactctt tggcgccttt attagcatgg tgcccgaacc cctcggcatt 1740 ggttctgtgg aactcgaaag tggcgaatgg atcaaatctt ttatttgtga agaaagtggc 1800 tacaaagcca aaggcaccgt ggatattacc aaatatggcg gttttcgggc ctactttgaa 1860 atgctctaa 1869 <210> 77 <211> 1092 <212> DNA <213> Artificial sequence <220> <223> atzD Pseudomonas sp. ADP <400> 77 atgtatcaca tcgacgtttt ccgaatccct tgccacagcc ctggtgatac atcgggtctc 60 gaggatttga ttgaaacagg ccgcgttgcc cccgccgaca tcgtcgcggt aatgggcaag 120 accgagggca atggctgcgt caacgattac acgcgtgaat acgccaccgc catgcttgct 180 gcgtgccttg ggcgtcattt gcaactccca ccccatgagg tggaaaagcg ggtcgcgttt 240 gtgatgtcag gtgggacgga aggcgtgctg tccccccacc acacggtatt cgcaagacgt 300 ccggcaatcg acgcgcatcg tcccgctggc aaacgtctca cgcttggaat cgccttcacg 360 cgtgattttc tgccggagga aattggccgc cacgctcaga taacggagac agccggcgcc 420 gtcaaacgcg caatgcgaga tgccgggatc gcttcgattg acgatctgca ttttgtgcag 480 gtgaagtgtc cgctgctgac accagcaaag atcgcctcgg cgcgatcacg cggatgcgct 540 ccagtcacga cggatacgta tgaatcgatg ggctattcgc gcggcgcttc ggccctgggc 600 atcgctctcg ctacagaaga ggtgccctcc tcgatgctcg tagacgaatc agtgctgaat 660 gactggagtc tctcatcgtc actggcgtcg gcgtctgcag gcatcgaact ggagcacaac 720 gtggtgatcg ctattggcat gagcgagcag gccaccagtg aactggtcat tgcccacggc 780 gtgatgagcg acgcgatcga cgcggcctcg gtgcggcgaa cgattgaatc gctgggcata 840 cgtagcgatg acgagatgga tcgcatcgtc aacgtattcg ccaaagcgga ggcgagcccg 900 gacggggttg tacgaggtat gcggcacacg atgctaagtg actccgacat taattcgacc 960 cgccatgcgc gggcggtcac cggcgcggcc attgcctcgg tagttgggca tggcatggtg 1020 tatgtgtccg gtggcgccga gcatcaggga cctgccggcg gcggcccttt tgcagtcatt 1080 gcccgcgctt aa 1092 <210> 78 <211> 1092 <212> DNA <213> Artificial sequence <220> <223> atzD Pseudomonas sp. ADP <400> 78 atgtatcaca ttgatgtgtt tcgcattccc tgtcatagcc ccggtgatac ctctggcctc 60 gaagatttga ttgaaaccgg tcgtgtggcc cccgccgata ttgtggccgt gatgggtaaa 120 accgagggta atggctgtgt gaatgattat acccgcgaat acgccaccgc catgctcgcc 180 gcctgtctcg gccgccacct ccaactcccc ccccatgaag tggaaaaacg ggtggccttt 240 gtgatgagtg gtggcaccga aggtgtgctc tccccccacc ataccgtgtt tgcccgtcgc 300 cccgccattg atgcccaccg tcccgccggt aaacgtctca ccctcggcat tgcctttacc 360 cgcgattttc tccccgaaga aattggtcgg catgcccaaa ttaccgaaac cgccggcgcc 420 gtgaaacgtg ccatgcgtga tgccggtatt gccagtattg atgatctcca ctttgtgcaa 480 gtgaaatgtc ccctcctcac ccccgccaaa attgcctccg cccgcagccg gggctgtgcc 540 cccgtgacca ccgataccta tgaatctatg ggttacagtc ggggcgcctc cgccctcggt 600 attgccctcg ccaccgaaga agtgcccagt tccatgctcg tggatgaaag tgtgctcaat 660 gattggtccc tcagctctag tctcgcctcc gccagcgccg gcattgaact cgaacacaat 720 gtggtgattg ccattggtat gagtgaacaa gccacctccg aactcgtgat tgcccacggc 780 gtgatgagcg atgccattga tgccgcctct gtgcgccgga ccattgaaag cctcggtatt 840 cgctctgatg atgaaatgga tcggattgtg aatgtgtttg ccaaagccga agccagtccc 900 gatggtgtgg tgcgtggtat gcgtcacacc atgctctctg atagtgatat taattccacc 960 cgtcatgccc gtgccgtgac cggtgccgcc attgccagcg tggtgggtca cggcatggtg 1020 tacgtgtctg gcggtgccga acatcaaggt cccgccggtg gtggtccctt tgccgtgatt 1080 gcccgtgcct aa 1092 <210> 79 <211> 1320 <212> DNA <213> Artificial sequence <220> <223> guaD Escherichia coli K-12 <400> 79 atgatgtcag gagaacacac gttaaaagcg gtacgaggca gttttattga tgtcacccgt 60 acgatcgata acccggaaga gattgcctct gcgctgcggt ttattgagga tggtttatta 120 ctcattaaac agggaaaagt ggaatggttt ggcgaatggg aaaacggaaa gcatcaaatt 180 cctgacacca ttcgcgtgcg cgactatcgc ggcaaactga tagtaccggg ctttgtcgat 240 acacatatcc attatccgca aagtgaaatg gtgggggcct atggtgagca attgctggag 300 tggttgaata aacacacctt ccctactgaa cgtcgttatg aggatttaga gtacgcccgc 360 gaaatgtcgg cgttcttcat caagcagctt ttacgtaacg gaaccaccac ggcgctggtg 420 tttggcactg ttcatccgca atctgttgat gcgctgtttg aagccgccag tcatatcaat 480 atgcgtatga ttgccggtaa ggtgatgatg gaccgcaacg caccggatta tctgctcgac 540 actgccgaaa gcaagctatca ccaaagcaaa gaactgatcg aacgctggca caaaaatggt 600 cgtctgctat atgcgattac gccacgcttc gccccgacct catctcctga acagatggcg 660 atggcgcaac gcctgaaaga agaatatccg gatacgtggg tacataccca tctctgtgaa 720 aaaagatg aaattgcctg ggtgaaatcg ctttatcctg accatgatgg ttatctggat 780 gtttaccatc agtacggcct gaccggtaaa aactgtgtct ttgctcactg cgtccatctc 840 gaaaaaag agtgggatcg tctcagcgaa accaaatcca gcattgcttt ctgtccgacc 900 tccaaccttt acctcggcag cggcttattc aacttgaaaa aagcatggca gaagaagtt 960 aaagtgggca tgggaacgga tatcggtgcc ggaaccactt tcaacatgct gcaaacgctg 1020 aacgaagcct acaaagtatt gcaattacaa ggctatcgcc tctcggcata tgaagcgttt 1080 tacctggcca cgctcggcgg agcgaaatct ctgggccttg acgatttgat tggcaacttt 1140 ttacctggca aagaggctga tttcgtggtg atggaaccca ccgccactcc gctacagcag 1200 ctgcgctatg acaactctgt ttctttagtc gacaaattgt tcgtgatgat gacgttgggc 1260 gatgaccgtt cgatctaccg cacctacgtt gatggtcgtc tggtgtacga acgcaactaa 1320 <210> 80 <211> 1343 <212> DNA <213> Artificial sequence <220> <223> guaD Escherichia coli K-12 <400> 80 atgatgagcg gcgaacacac cctcaaagcc gtgcgcggtt cttttattga tgtgacccgg 60 accattgata atcccgaaga aattgccagc gccctccgct ttattgaaga tggcctcctc 120 ctcattaaac agggtaaagt ggaatggttt ggcgaatggg aaaatggtaa acaccaaatt 180 cccgatacca ttcgcgtgcg ggattatcgg ggcaaactca ttgtgcccgg ttttgtggat 240 acccacattc attatcccca aagtgaaatg gtgggcgcct acggtgaaca actcctcgaa 300 tggctcaata aacatacctt tcccaccgaa cgccggtatg aagatttgga atacgcccgc 360 gaaatgtccg cctttttcat taaacaactc ctccggaatg gcaccaccac cgccctcgtg 420 tttggcaccg tgcatcccca aagtgtggat gccctctttg aagccgcctc ccatattaat 480 atgcgcatga ttgccggcaa agtgatgatg gatcggaatg cccccgatta tctcctcgat 540 accgccgaaa gttcctacca ccaatctaaa gaactcattg aacgctggca taaaaatggt 600 cggctcctct atgccattac cccccgtttt gcccccacca gctctcccga acaaatggcg 660 atggcccaac ggctcaaaga agaatacccc gatacctggg tgcataccca tctctgtgaa 720 aataaaagatg aaattgcctg ggtgaaaagc ctctatcccg atcacgatgg ctacctcgat 780 gtgtatcatc aatacggcct caccggtaaa aattgtgtgt ttgcccactg tgtgcatctc 840 gaagaaaaag aatgggatcg cctctctgaa accaaaagtt ccattgcctt ttgtcccacc 900 agcaatctct atctcggctc tggcctcttt aatctcaaaa aagcctggca gaaaaaagtg 960 aaagtgggca tgggcaccga tattggcgcc ggcaccacct ttaatatgct ccaaaccctc 1020 aatgaagcct ataaagtgct ccaactccaa ggctacagcc tctctgccta tgaagccttt 1080 tacctcgcca ccctcggcgg tgccaaaagt ctcggcctcg atgatctcat tggcaatttt 1140 ctccccggta aagaagccga ttttgtggtg atggaaccca ccgccacccc cctccaacaa 1200 ctccgttatg ataatagtgt gtccctcgtg gagggtttgc atggtctgaa tctgataaac 1260 tctttgtgat gatgaccctc ggcgatgatc gctccattta tcggacctac gtggatggtc 1320 gcctcgtgta cgaacggaat taa 1343 <210> 81 <211> 1320 <212> DNA <213> Artificial sequence <220> <223> guaD R352S Escherichia coli K-12 <400> 81 atgatgtcag gagaacacac gttaaaagcg gtacgaggca gttttattga tgtcacccgt 60 acgatcgata acccggaaga gattgcctct gcgctgcggt ttattgagga tggtttatta 120 ctcattaaac agggaaaagt ggaatggttt ggcgaatggg aaaacggaaa gcatcaaatt 180 cctgacacca ttcgcgtgcg cgactatcgc ggcaaactga tagtaccggg ctttgtcgat 240 acacatatcc attatccgca aagtgaaatg gtgggggcct atggtgagca attgctggag 300 tggttgaata aacacacctt ccctactgaa cgtcgttatg aggatttaga gtacgcccgc 360 gaaatgtcgg cgttcttcat caagcagctt ttacgtaacg gaaccaccac ggcgctggtg 420 tttggcactg ttcatccgca atctgttgat gcgctgtttg aagccgccag tcatatcaat 480 atgcgtatga ttgccggtaa ggtgatgatg gaccgcaacg caccggatta tctgctcgac 540 actgccgaaa gcaagctatca ccaaagcaaa gaactgatcg aacgctggca caaaaatggt 600 cgtctgctat atgcgattac gccacgcttc gccccgacct catctcctga acagatggcg 660 atggcgcaac gcctgaaaga agaatatccg gatacgtggg tacataccca tctctgtgaa 720 aaaagatg aaattgcctg ggtgaaatcg ctttatcctg accatgatgg ttatctggat 780 gtttaccatc agtacggcct gaccggtaaa aactgtgtct ttgctcactg cgtccatctc 840 gaaaaaag agtgggatcg tctcagcgaa accaaatcca gcattgcttt ctgtccgacc 900 tccaaccttt acctcggcag cggcttattc aacttgaaaa aagcatggca gaagaagtt 960 aaagtgggca tgggaacgga tatcggtgcc ggaaccactt tcaacatgct gcaaacgctg 1020 aacgaagcct acaaagtatt gcaattacaa ggctatagcc tctcggcata tgaagcgttt 1080 tacctggcca cgctcggcgg agcgaaatct ctgggccttg acgatttgat tggcaacttt 1140 ttacctggca aagaggctga tttcgtggtg atggaaccca ccgccactcc gctacagcag 1200 ctgcgctatg acaactctgt ttctttagtc gacaaattgt tcgtgatgat gacgttgggc 1260 gatgaccgtt cgatctaccg cacctacgtt gatggtcgtc tggtgtacga acgcaactaa 1320 <210> 82 <211> 89 <212> DNA <213> Artificial sequence <220> <223> Pc223 promoter <400> 82 ttaacaaaaa agcaggaata aaattaacat gatgtaacag acataagtcc catcaccgtt 60 gtataatgtt aactgtggga ttgcaaaag 89 <210> 83 <211> 7983 <212> DNA <213> Artificial sequence <220> <223> Mel1 <220> <221> promoter <222> (1)..(89) <223> Pc223 promoter <220> <221> Gene <222> (104) (1195) <223> atzd <220> <221> Gene <222> (1217) (1942) <223> trzE <220> <221> Gene <222> (1963)..(3831) <223> DUR1,2 <220> <221> Gene <222> (3853)..(5091) <223> trzC <220> <221> Gene <222> (5113)..(6432) <223> guaD <220> <221> Gene <222> (6454)..(7878) <223> triA <220> <221> Terminator <222> (7929)..(7957) <223> RRNB terminator <400> 83 ttaacaaaaa agcaggaata aaattaacat gatgtaacag acataagtcc catcaccgtt 60 gtataatgtt aactgtggga ttgcaaaaga ggagattaat tcaatgtatc acattgatgt 120 gtttcgcatt ccctgtcata gccccggtga tacctctggc ctcgaagatt tgattgaaac 180 cggtcgtgtg gcccccgccg atattgtggc cgtgatgggt aaaaccgagg gtaatggctg 240 tgtgaatgat tatacccgcg aatacgccac cgccatgctc gccgcctgtc tcggccgcca 300 cctccaactc cccccccatg aagtggaaaa acgggtggcc tttgtgatga gtggtggcac 360 cgaaggtgtg ctctcccccc accataccgt gtttgcccgt cgccccgcca ttgatgccca 420 ccgtcccgcc ggtaaacgtc tcaccctcgg cattgccttt acccgcgatt ttctccccga 480 agaaattggt cggcatgccc aaattaccga aaccgccggc gccgtgaaac gtgccatgcg 540 tgatgccggt attgccagta ttgatgatct ccactttgtg caagtgaaat gtcccctcct 600 cacccccgcc aaaattgcct ccgcccgcag ccggggctgt gcccccgtga ccaccgatac 660 ctatgaatct atgggttaca gtcggggcgc ctccgccctc ggtattgccc tcgccaccga 720 agaagtgccc agttccatgc tcgtggatga aagtgtgctc aatgattggt ccctcagctc 780 tagtctcgcc tccgccagcg ccggcattga actcgaacac aatgtggtga ttgccattgg 840 tatgagtgaa caagccacct ccgaactcgt gattgcccac ggcgtgatga gcgatgccat 900 tgatgccgcc tctgtgcgcc ggaccattga aagcctcggt attcgctctg atgatgaaat 960 ggatcggatt gtgaatgtgt ttgccaaagc cgaagccagt cccgatggtg tggtgcgtgg 1020 tatgcgtcac accatgctct ctgatagtga tattaattcc acccgtcatg cccgtgccgt 1080 gaccggtgcc gccattgcca gcgtggtggg tcacggcatg gtgtacgtgt ctggcggtgc 1140 cgaacatcaa ggtcccgccg gtggtggtcc ctttgccgtg attgcccgtg cctaagtcaa 1200 gtaggagatt aattccatga tttatagtac cgtgaatgcc aatccctatg cctggcccta 1260 cgatggctcc attgatcccg cccacaccgc cctcatcctc atcgattggc aaatcgattt 1320 ttgtggtccc ggcggttatg tggatagtat gggctacgat ctcagcctca cccgctctgg 1380 cctcgaaccc accgcccgcg tgctcgccgc cgcccgcgat accggcatga ccgtgattca 1440 cacccgcgaa ggtcatcgtc ccgatctcgc cgatctcccc cccaataaac gttggcggag 1500 tgcctccgcc ggcgccgaaa ttggcagtgt gggtccctgt ggccgcattc tcgtgcgtgg 1560 tgaacccggt tgggaaattg tgcccgaagt ggccccccgc gaaggtgaac ccattattga 1620 taaacccggt aaaggtgcct tttatgccac cgatctcgat ctcctcctcc gcacccgcgg 1680 cattacccac ctcattctca ccggcattac caccgatgtg tgtgtgcata ccaccatgcg 1740 cgaagccaat gatcggggct acgaatgtct cattctctcc gattgtaccg gtgccaccga 1800 tcggaaacac catgaagccg ccctcagcat ggtgaccatg caaggcggtg tgtttggtgc 1860 caccgcccat tctgatgatc tcctcgccgc cctcggcacc accgtgcccg ccgccgccgg 1920 cccccgtgcc cgcaccgaat aatctaatag gagacaaata ctatgaccgt gagttccgat 1980 accaccgccg aaatttctct cggctggagt atccaagatt ggatcgattt tcacaaaagc 2040 tctagttccc aagcctccct ccgcctcctc gaatccctcc tcgatagcca aaatgtggcc 2100 cccgtggata atgcctggat ttccctcatt agcaaggaaa acctcctcca tcaatttcaa 2160 attctcaagt ctcgcgaaaa caaggaaacc ctccccctct atggtgtgcc cattgccgtg 2220 aaagataata ttgatgtgcg tggcctcccc accaccgccg cctgtcccag ttttgcctac 2280 gaaccctcta aagatagtaa agtggtggaa ctcctccgca atgccggcgc cattattgtg 2340 ggtaaacca atctcgatca atttgccacc ggcctcgtgg gcacccgcag tccctatggc 2400 aaaaccccct gtgccttttc caaagaacac gtgagcggcg gtagctctgc cggctccgcc 2460 agcgtggtgg cccgcggtat tgtgcccatt gccctcggca ccgataccgc cggctctggt 2520 cgggtgcccg ccgccctcaa taatctcatt ggcctcaaac ccaccaaggg tgtgtttagt 2580 tgtcaaggcg tggtgcccgc ctgtaaatct ctcgattgtg tgagtatttt tgccctcaat 2640 ctcagcgatg ccgaacgctg ttttcggatt atgtgtcaac ccgatcccga taatgatgaa 2700 tattcccgcc cctacgtgag caatcccctc aaaaaattta gttccaatgt gaccattgcc 2760 attcccaaaa atattccctg gtatggtgaa accaaaaatc ccgtgctctt ttccaatgcc 2820 gtggaaaatc tcagccggac cggcgccaat gtgattgaaa ttgattttga acccctcctc 2880 gaactcgccc gctgtctcta tgaaggcacc tgggtggccg aacgctatca agccattcaa 2940 tcttttctcg atagtaaacc ccccaaagaa tctctcgatc ccaccgtgat tagtatcatc 3000 gaaggtgcca aaaaatactc cgccgtggat tgttttagct ttgaatacaa acgccaaggc 3060 attctccaaa aagtgcgccg gctcctcgaa tccgtggatg tgctctgtgt gcccacctgt 3120 cccctcaatc ccaccatgca acaagtggcc gatgaacccg tgctcgtgaa tagccgccaa 3180 ggcacctgga ccaattttgt gaatctcgcc gatctcgccg ccctcgccgt gcccgccggt 3240 tttcgggatg atggcctccc caatggtatt accctcattg gcaaaaaatt taccgattat 3300 gccctcctcg aactcgccaa ccgctacttt caaaacatct ttcccaacgg ctcccggacc 3360 tatggcacct ttaccagctc tagtgtgaaa cccgccaatg atcaactcgt gggccccgat 3420 tacgatccct ctaccagtat taaactcgcc gtggtgggcg cccacctcaa aggcctcccc 3480 ctccattggc aactcgaaaa agtgaatgcc acctatctct gtaccaccaa aaccagcaaa 3540 gcctaccaac tctttgccct ccccaaaaat ggtcccgtgc tcaaacccgg cctccgtcgt 3600 gtgcaagatt ccaatggtag ccaaattgaa ctcgaagtgt attccgtgcc caaagaactc 3660 tttggcgcct ttattagcat ggtgcccgaa cccctcggca ttggttctgt ggaactcgaa 3720 agtggcgaat ggatcaaatc ttttatttgt gaagaaagtg gctacaaagc caaaggcacc 3780 gtggatatta ccaaatatgg cggttttcgg gcctactttg aaatgctcta aattgattag 3840 gagatataca ccatgagcat ggaaacccac tcctatgttg atgttgcgat ccgtaacgcc 3900 cgtctcgccg ataccgaagg cattgttgat attctgattc atgatggtcg gattgccagc attgtgaat ccaccaaaac caaaggttcc gtggaaattg atgcccatga aggtctcgtg accagtggcc tcgtggaacc ccacattcat ctcgataaag ccctcaccgc cgatcgcgtg cccgccggta gtattggcga tctccggacc cgccggggtc tcgaaatggc cattcgcgcc 4140 acccgcgata ttaaacgcac ctttaccgtg gaagatgtgc gggaacgcgc cattcgggcc gccctcatgg ccagtcgcgc cggcaccacc gccctccgca cccatgtgga tgtggacccc 4260 attgtgggtc tcgccggtat tcggggcgtg ctcgaagccc gcgaagtgtg tgccggtctc 4320. attgatattc aaattgtggc ctttccccaa gaaggcctct tttgtagtgc cggtgccgtg gatctcatgc gggaagccat taaactcggt gccgatgccg tgggcggtgc ccccgccctc 4440 gatgatcgcc cccaagatca tgtgcgcgcc gtgtttgatc tcgccgccga atttggtctc cccgtggata tgcacgtgga tgaaagtgat cgccgggaag attttaccct cccctttgtg 4560 attgaagccg cccgcgaacg gcgcgtgccc aatgtgaccg tggcccacat ttcctctctc 4620. agtgtgcaaa ccgatgatgt ggcccgctcc accattgccg ccctcgccga tgccgatgtg 4680 aatgtggtgg tgaatcccat tattgtgaaa attacccgcc tctctgaact cctcgatgcc 4740 ggtgtgtctg tgatgtttgg ctccgataat ctccgcgatc ccttttatcc cctcggtgcc 4800 gccaatcccc tcggtagtgc catttttgcc tgtcaaattg ccgccctcgg caccccccaa 4860 gacctccgcc gggtgtttga tgccgtgacc attaatgccg cccgcatgct cggttttccc 4920 agtctcctcg gtgtggtgga aggtgccgtg gccgatctcg ccgtgtttcc cagtgccacc 4980 cccgaagaag tggtgctcga tcaacaaagt cccctctttg tgctcaaagg tggtcgggtc 5040 gttgcgatgc ggttagcggc gggtagcacc tcctttcgtg attattcgta atatacttag 5100 gagattcata cgatgatgag cggcgaacac accctcaaag ccgtgcgcgg ttcttttatt 5160 gatgtgaccc ggaccattga taatcccgaa gaaattgcca gcgccctccg ctttattgaa 5220 gatggcctcc tcctcattaa acagggtaaa gtggaatggt ttggcgaatg ggaaaatggt 5280 aaacaccaaa ttcccgatac cattcgcgtg cgggattatc ggggcaaact cattgtgccc 5340 ggttttgtgg atacccacat tcattatccc caaagtgaaa tggtgggcgc ctacggtgaa 5400 caactcctcg aatggctcaa taaacatacc tttcccaccg aacgccggta tgaagaatttg 5460 gaatacgcccc gcgaaatgtc cgcctttttc attaaaac tcctccggaa tggcaccacc 5520 accgccctcg tgtttggcac cgtgcatccc caaagtgtgg atgccctctt tgaagccgcc 5580 tcccatatta atatgcgcat gattgccggc aaagtgatga tggatcggaa tgccccccgat 5640 tatctcctcg ataccgccga aagttcctac caccaatcta aagaactcat tgaacgctgg 5700 cataaaaaatg gtcggctcct ctatgccatt accccccgtt ttgcccccac cagctctccc 5760 gaacaaatgg cgatggccca acggctcaaa gaagaatacc ccgatacctg ggtgcatacc 5820 catctctgtg aaaataaga tgaaattgcc tgggtgaaaa gcctctatcc cgatcacgat 5880 ggctacctcg atgtgtatca tcaatacggc ctcaccggta aaaattgtgt gtttgcccac 5940 tgtgtgcatc tcgaagaaaa agaatgggat cgcctctctg aaaccaaaag ttccattgcc 6000 ttttgtccca ccagcaatct ctatctcggc tctggcctct ttaatctcaa aaaagcctgg 6060 cagaaaaaag tgaaagtggg catgggcacc gatattggcg ccggcaccac ctttaatatg 6120 ctccaaaccc tcaatgaagc ctataaagtg ctccaactcc aaggctacag cctctctgcc 6180 tatgaagcct tttacctcgc caccctcggc ggtgccaaaa gtctcggcct cgatgatctc 6240 attggcaatt ttctccccgg taaagaagcc gattttgtgg tgatggaacc caccgccacc 6300 cccctccaac aactccgtta tgataatagt gtgtccctcg tggataaact ctttgtgatg 6360 atgaccctcg gcgatgatcg ctccatttat cggacctacg tggatggtcg cctcgtgtac 6420 gaacggaatt aagctagtta ggagattcag accatgcaaa ccctcagcat tcaacatggc 6480 accctcgtga cgatggatca atatcgccgg gtgctcggcg atagctgggt gcatgtgcaa 6540 gatggccgca ttgtggccct cggtgtgcat gccgaatctg tgcccccccc cgccgatcgt 6600 gtgattgatg cccgcggtaa agtggtgctc cccggtttta ttaatgccca tacccacgtg 6660 aatcaaattc tcctccgtgg tggtccctct cacggtcgcc aactctatga ttggctcttt 6720 aatgtgctct accccggcca aaaagccatg cgccccgaag atgtggccgt ggccgtgcgg 6780 ctctattgtg ccgaagccgt gcgcagtggt attaccacca ttaatgataa tgccgattcc 6840 gccatttacc ccggcaatat tgaagccgcg atggccgtgt atggcgaagt gggtgtgcgg 6900 gtggtgtacg cccgcatgtt tttcgatcgc atggatggcc ggattcaagg ttatgtggat 6960 gccctcaaag cccggagccc ccaagtggaa ctctgttcta ttatggaaga aaccgccgtg 7020 gccaaagatc ggattaccgc cctcagcgat caatatcacg gcaccgccgg tggccgcatt 7080 agtgtgtggc ccgcccccgc cattaccccc gccgtgaccg tggagggtat gcgttgggcc 7140 caagcctttg cccgcgatcg ggccgtgatg tggaccctcc acatggccga aagcgatcat 7200 gatgaacggc tccactggat gtctcccgcc gaatatatgg aatgttacgg cctcctcgat 7260 gaacgcctcc aagtggccca ctgtgtgtat tttgatcgca aagatgtgcg gctcctccat 7320 cgccacaatg tgaaagtggc cagtcaagtg gtgtccaatg cctacctcgg cagtggtgtg 7380 gcccccgtgc ccgaaatggt ggaacgtggc atggccgtgg gcattggcac cgatgatggt 7440 aattgtaatg attccgtgaa tatgattggc gatatgaaat ttatggccca tattcaccgg 7500 gccgtgcatc gcgatgccga tgtgctcacc cccgaaaaaa ttctcgaaat ggccaccatt 7560 gatggcgccc gcagtctcgg tatggatcat gaaattggct ccattgaaac cggtaaacgg 7620 gccgatctca ttctcctcga tctccgccac ccccaaacca ccccccacca tcacctcgcc 7680 gccaccattg tgtttcaagc ctacggtaat gaagtggata ccgtgctcat tgatggcaat 7740 gtggtgatgg aaaatcgccg gctcagtttt ctcccccccg aacgggaact cgcctttctc 7800 gaagaagccc aaagtcgcgc caccgccatt ctccaacgcg ccaatatggt ggccaatccc 7860 gcctgacgca gcctctaaaa gggtgggcgc gccgacccag ctttcttgta caaactcggc 7920 cctgcaggag aaggccatcc tgacggatgg cctttttgaa gcttgaaagc aaatgacgag 7980 cga 7983 <210> 84 <211> 7968 <212> DNA <213> Artificial sequence <220> <223> Mel4 <220> <221> Promoter <222> (1)..(89) <223> Pc223 promoter <220> <221> Gene <222> (104)..(1195) <223> atzD <220> <221> Gene <222> (1217) (1942) <223> trzE <220> <221> Gene <222> (1963) (3831) <223> DUR1,2 <220> <221> Gene <222> (3853)..(5091) <223> trzC <220> <221> Gene <222> (5113)...(6432) <223> guaD <220> <221> Gene <222> (6454)..(7878) <223> triA <220> <221> Termination <222> (7929)...(7957) <223> RRNB Terminator <400> 84 ttaacaaaaa agcaggaata aaattaacat gatgtaacag acataagtcc catcaccgtt 60 gtataatgtt aactgtggga ttgcaaaaga ggagattaat tcaatgtatc acattgatgt 120 gtttcgcatt ccctgtcata gccccggtga tacctctggc ctcgaagatt tgattgaaac 180 cggtcgtgtg gcccccgccg atattgtggc cgtgatgggt aaaaccgagg gtaatggctg 240 tgtgaatgat tatacccgg aatacgccac cgccatgctc gccgcctgtc tcggccgcca 300 cctccaactc cccccccatg aagtggaaaa acgggtggcc tttgtgatga gtggtggcac 360 cgaaggtgtg ctctcccccc accataccgt gtttgcccgt cgccccgcca ttgatgccca 420 ccgtcccgcc ggtaaacgtc tcaccctcgg cattgccttt acccgcgatt ttctccccga 480 agaaattggt cggcatgccc aaattaccga aaccgccggc gccgtgaaac gtgccatgcg 540 tgatgccggt attgccagta ttgatgatct ccactttgtg caagtgaaat gtcccctcct 600 caccccgcc aaaattgcct ccgcccgcag ccggggctgt gcccccgtga ccaccgatac 660 ctatgaatct atgggttaca gtcggggcgc ctccgccctc ggtattgccc tcgccaccga 720 agaagtgcc agttccatgc tcgtggatga aagtgtgctc aatgattggt ccctcagctc 780 tagtctcgcc tccgccagcg ccggcattga actcgaacac aatgtggtga ttgccattgg 840 tatgagtgaa caagccacct ccgaactcgt gattgcccac ggcgtgatga gcgatgccat 900 tgatgccgcc tctgtgcgcc ggaccattga aagcctcggt attcgctctg atgatgaaat 960 ggatcggatt gtgaatgtgt ttgccaaagc cgaagccagt cccgatggtg tggtgcgtgg 1020 tatgcgtcac accatgctct ctgatagtga tattaattcc acccgtcatg cccgtgccgt 1080 gaccggtgcc gccattgcca gcgtggtggg tcacggcatg gtgtacgtgt ctggcggtgc 1140 cgaacatcaa ggtcccgccg gtggtggtcc ctttgccgtg attgcccgtg cctaagtcaa 1200 gtaggagatt aattccatga tttatagtac cgtgaatgcc aatccctatg cctggcccta 1260 cgatggctcc attgatcccg cccacaccgc cctcatcctc atcgattggc aaatcgattt 1320 ttgtggtccc ggcggttatg tggatagtat gggctacgat ctcagcctca cccgctctgg 1380 cctcgaaccc accgcccgcg tgctcgccgc cgcccgcgat accggcatga ccgtgattca 1440 cacccgcgaa ggtcatcgtc ccgatctcgc cgatctcccc cccaataaac gttggcggag 1500 tgcctccgcc ggcgccgaaa ttggcagtgt gggtccctgt ggccgcattc tcgtgcgtgg 1560 tgaacccggt tgggaaattg tgcccgaagt ggccccccgc gaaggtgaac ccattattga 1620 taaacccggt aaaggtgcct tttatgccac cgatctcgat ctcctcctcc gcacccgcgg 1680 cattacccac ctcattctca ccggcattac caccgatgtg tgtgtgcata ccaccatgcg 1740 cgaagccaat gatcggggct acgaatgtct cattctctcc gattgtaccg gtgccaccga 1800 tcggaaacac catgaagccg ccctcagcat ggtgaccatg caaggcggtg tgtttggtgc 1860 caccgcccat tctgatgatc tcctcgccgc cctcggcacc accgtgcccg ccgccgccgg 1920 cccccgtgcc cgcaccgaat aatctaatag gagacaaata ctatgaccgt gagttccgat 1980 accaccgccg aaatttctct cggctggagt atccaagatt ggatcgattt tcacaaaagc 2040 tctagttccc aagcctccct ccgcctcctc gaatccctcc tcgatagcca aaatgtggcc 2100 cccgtggata atgcctggat ttccctcatt agcaaggaaa acctcctcca tcaatttcaa 2160 attctcaagt ctcgcgaaaa caaggaaacc ctccccctct atggtgtgcc cattgccgtg 2220 aaagataata ttgatgtgcg tggcctcccc accaccgccg cctgtcccag ttttgcctac 2280 gaaccctcta aagatagtaa agtggtggaa ctcctccgca atgccggcgc cattattgtg 2340 ggtaaacca atctcgatca atttgccacc ggcctcgtgg gcacccgcag tccctatggc 2400 aaaaccccct gtgccttttc caaagaacac gtgagcggcg gtagctctgc cggctccgcc 2460 agcgtggtgg cccgcggtat tgtgcccatt gccctcggca ccgataccgc cggctctggt 2520 cgggtgcccg ccgccctcaa taatctcatt ggcctcaaac ccaccaaggg tgtgtttagt 2580 tgtcaaggcg tggtgcccgc ctgtaaatct ctcgattgtg tgagtatttt tgccctcaat 2640 ctcagcgatg ccgaacgctg ttttcggatt atgtgtcaac ccgatcccga taatgatgaa 2700 tattcccgcc cctacgtgag caatcccctc aaaaaattta gttccaatgt gaccattgcc 2760 attcccaaaa atattccctg gtatggtgaa accaaaaatc ccgtgctctt ttccaatgcc 2820 gtggaaaatc tcagccggac cggcgccaat gtgattgaaa ttgattttga acccctcctc 2880 gaactcgccc gctgtctcta tgaaggcacc tgggtggccg aacgctatca agccattcaa 2940 tcttttctcg atagtaaacc ccccaaagaa tctctcgatc ccaccgtgat tagtatcatc 3000 gaaggtgcca aaaaatactc cgccgtggat tgttttagct ttgaatacaa acgccaaggc 3060 attctccaaa aagtgcgccg gctcctcgaa tccgtggatg tgctctgtgt gcccacctgt 3120 cccctcaatc ccaccatgca acaagtggcc gatgaacccg tgctcgtgaa tagccgccaa 3180 ggcacctgga ccaattttgt gaatctcgcc gatctcgccg ccctcgccgt gcccgccggt 3240 tttcgggatg atggcctccc caatggtatt accctcattg gcaaaaaatt taccgattat 3300 gccctcctcg aactcgccaa ccgctacttt caaaacatct ttcccaacgg ctcccggacc 3360 tatggcacct ttaccagctc tagtgtgaaa cccgccaatg atcaactcgt gggccccgat 3420 tacgatccct ctaccagtat taaactcgcc gtggtgggcg cccacctcaa aggcctcccc 3480 ctccattggc aactcgaaaa agtgaatgcc acctatctct gtaccaccaa aaccagcaaa 3540 gcctaccaac tctttgccct ccccaaaat ggtcccgtgc tcaaacccgg cctccgtcgt 3600 gtgcaagatt ccaatggtag ccaaattgaa ctcgaagtgt attccgtgcc caaagaactc 3660 tttggcgcct ttattagcat ggtgcccgaa cccctcggca ttggttctgt ggaactcgaa 3720 agtggcgaat ggatcaaatc ttttatttgt gaaaagtg gctacaaagc caaaggcacc 3780 gtggatatta ccaaatatgg cggtttttcgg gcctactttg aaatgctcta aattgattag 3840 gagatataca ccatgagcat ggaaacccac tcctatgttg atgttgcgat ccgtaacgcc cgtctcgccg ataccgaagg cattgttgat attctgattc atgatggtcg gattgccagc attgtgaat ccaccaaaac caaaggttcc gtggaaattg atgcccatga aggtctcgtg accagtggcc tcgtggaacc ccacattcat ctcgataaag ccctcaccgc cgatcgcgtg cccgccggta gtattggcga tctccggacc cgccggggtc tcgaaatggc cattcgcgcc 4140 acccgcgata ttaaacgcac ctttaccgtg gaagatgtgc gggaacgcgc cattcgggcc gccctcatgg ccagtcgcgc cggcaccacc gccctccgca cccatgtgga tgtggacccc 4260 attgtgggtc tcgccggtat tcggggcgtg ctcgaagccc gcgaagtgtg tgccggtctc 4320. attgatattc aaattgtggc ctttccccaa gaaggcctct tttgtagtgc cggtgccgtg gatctcatgc gggaagccat taaactcggt gccgatgccg tgggcggtgc ccccgccctc 4440 gatgatcgcc cccaagatca tgtgcgcgcc gtgtttgatc tcgccgccga atttggtctc cccgtggata tgcacgtgga tgaaagtgat cgccgggaag attttaccct cccctttgtg 4560 attgaagccg cccgcgaacg gcgcgtgccc aatgtgaccg tggcccacat ttcctctctc 4620 agtgtgcaaa ccgatgatgt ggcccgctcc accattgccg ccctcgccga tgccgatgtg 4680 aatgtggtgg tgaatcccat tattgtgaaa attacccgcc tctctgaact cctcgatgcc 4740 ggtgtgtctg tgatgtttgg ctccgataat ctccgcgatc ccttttatcc cctcggtgcc 4800 gccaatcccc tcggtagtgc catttttgcc tgtcaaattg ccgccctcgg caccccccaa 4860 gacctccgcc gggtgtttga tgccgtgacc attaatgccg cccgcatgct cggttttccc 4920 agtctcctcg gtgtggtgga aggtgccgtg gccgatctcg ccgtgtttcc cagtgccacc 4980 cccgaagaag tggtgctcga tcaacaaagt cccctctttg tgctcaaagg tggtcgggtc 5040 gttgcgatgc ggttagcggc gggtagcacc tcctttcgtg attattcgta atatacttag 5100 gagattcata cgatgatgag cggcgaacac accctcaaag ccgtgcgcgg ttcttttatt 5160 gatgtgaccc ggaccattga taatcccgaa gaaattgcca gcgccctccg ctttattgaa 5220 gatggcctcc tcctcattaa acagggtaaa gtggaatggt ttggcgaatg ggaaaatggt 5280 aaacaccaaa ttcccgatac cattcgcgtg cgggattatc ggggcaaact cattgtgccc 5340 ggttttgtgg atacccacat tcattatccc caaagtgaaa tggtgggcgc ctacggtgaa 5400 caactcctcg aatggctcaa taaacatacc tttcccaccg aacgccggta tgaagaatttg 5460 gaatacgcccc gcgaaatgtc cgcctttttc attaaaac tcctccggaa tggcaccacc 5520 accgccctcg tgtttggcac cgtgcatccc caaagtgtgg atgccctctt tgaagccgcc 5580 tcccatatta atatgcgcat gattgccggc aaagtgatga tggatcggaa tgccccccgat 5640 tatctcctcg ataccgccga aagttcctac caccaatcta aagaactcat tgaacgctgg 5700 cataaaaaatg gtcggctcct ctatgccatt accccccgtt ttgcccccac cagctctccc 5760 gaacaaatgg cgatggccca acggctcaaa gaagaatacc ccgatacctg ggtgcatacc 5820 catctctgtg aaaataaga tgaaattgcc tgggtgaaaa gcctctatcc cgatcacgat 5880 ggctacctcg atgtgtatca tcaatacggc ctcaccggta aaaattgtgt gtttgcccac 5940 tgtgtgcatc tcgaagaaaa agaatgggat cgcctctctg aaaccaaaag ttccattgcc 6000 ttttgtccca ccagcaatct ctatctcggc tctggcctct ttaatctcaa aaaagcctgg 6060 cagaaaaaag tgaaagtggg catgggcacc gatattggcg ccggcaccac ctttaatatg 6120 ctccaaaccc tcaatgaagc ctataaagtg ctccaactcc aaggctacag cctctctgcc 6180 tatgaagcct tttacctcgc caccctcggc ggtgccaaaa gtctcggcct cgatgatctc 6240 attggcaatt ttctccccgg taaagaagcc gattttgtgg tgatggaacc caccgccacc 6300 cccctccaac aactccgtta tgataatagt gtgtccctcg tggataaact ctttgtgatg 6360 atgaccctcg gcgatgatcg ctccatttat cggacctacg tggatggtcg cctcgtgtac 6420 gaacggaatt aagctagtta ggagattcag accatgcaaa ccctcagcat tcaacatggc 6480 accctcgtga cgatggatca atatcgccgg gtgctcggcg atagctgggt gcatgtgcaa 6540 gatggccgca ttgtggccct cggtgtgcat gccgaatctg tgcccccccc cgccgatcgt 6600 gtgattgatg cccgcggtaa agtggtgctc cccggtttta ttaatgccca tacccacgtg 6660 aatcaaattc tcctccgtgg tggtccctct cacggtcgcc aactctatga ttggttcttt 6720 aatgtgctct accccggcca aaaagccatg cgccccgaag atgtggccgt ggccgtgcgg 6780 ctctattgtg ccgaagccgt gcgcagtggt attaccacca ttaatgataa tgccgattcc 6840 gccatttacc ccggcaatat tgaagccgcg atggccgtgt atggcgaagt gggtgtgcgg 6900 gtggtgtacg cccgcatgtt tttcgatcgc atggatggcc ggattcaagg ttatgtggat 6960 gccctcaaag cccggagccc ccaagtggaa ctctgttcta ttatggaaga aaccgccgtg 7020 gccaaagatc ggattaccgc cctcagcgat caatatcacg gcaccgccgg tggccgcatt 7080 agtgtgtggc ccgcccccgc cattaccccc gccgtgaccg tggagggtat gcgttgggcc 7140 caagcctttg cccgcgatcg ggccgtgatg tggaccctcc acatggccga aagcgatcat 7200 gatgaacggc tccactggat gtctcccgcc gaatatatgg aatgttacgg cctcctcgat 7260 gaacgcctcc aagtggccca ctgtgtgtat tttgatcgca aagatgtgcg gctcctccat 7320 cgccacaatg tgaaagtggc cagtcaagtg gtgtccaatg cctacctcgg cagtggtgtg 7380 gcccccgtgc ccgaaatggt ggaacgtggc atggccgtgg gcattggcac cgatgatggt 7440 aattgtaatg attccgtgaa tatgattggc gatatgaaat ttatggccca tattcaccgg 7500 gccgtgcatc gcgatgccga tgtgctcacc cccgaaaaaa ttctcgaaat ggccaccatt 7560 gatggcgccc gcagtctcgg tatggatcat gaaattggct ccattgaaac cggtaaacgg 7620 gccgatctca ttctcctcga tctccgccac ccccaaacca ccccccacca tcacctcgcc 7680 gccaccattg tgtttcaagc ctacggtaat gaagtggata ccgtgctcat tgatggcaat 7740 gtggtgatgg aaaatcgccg gctcagtttt ctcccccccg aacgggaact cgcctttctc 7800 gaagaagccc aaagtcgcgc caccgccatt ctccaacgcg ccaatatggt ggccaatccc 7860 gcctggcgca gcctctaaaa gggtgggcgc gccgacccag ctttcttgta caaactcggc 7920 cctgcaggag aaggccatcc tgacggatgg cctttttgaa gcttgaaa 7968 <210> 85 <211> 7968 <212> DNA <213> Artificial sequence <220> <223> Mel5 <220> <221> Promoter <222> (1)..(89) <223> Pc223 promoter <220> <221> Gene <222> (104) (1195) <223> atzD <220> <221> Gene <222> (1217) (1942) <223> trzE <220> <221> Gene <222> (1963) (3831) <223> DUR1,2 <220> <221> Gene <222> (3853)..(5091) <223> trzC <220> <221> Gene <222> (5113)...(6432) <223> guaD <220> <221> Gene <222> (6454)..(7878) <223> triA <220> <221> Termination <222> (7929)...(7957) <223> RRNB Terminator <400> 85 ttaacaaaaa agcaggaata aaattaacat gatgtaacag acataagtcc catcaccgtt 60 gtataatgtt aactgtggga ttgcaaaaga ggagattaat tcaatgtatc acattgatgt 120 gtttcgcatt ccctgtcata gccccggtga tacctctggc ctcgaagatt tgattgaaac 180 cggtcgtgtg gcccccgccg atattgtggc cgtgatgggt aaaaccgagg gtaatggctg 240 tgtgaatgat tatacccgg aatacgccac cgccatgctc gccgcctgtc tcggccgcca 300 cctccaactc cccccccatg aagtggaaaa acgggtggcc tttgtgatga gtggtggcac 360 cgaaggtgtg ctctcccccc accataccgt gtttgcccgt cgccccgcca ttgatgccca 420 ccgtcccgcc ggtaaacgtc tcaccctcgg cattgccttt acccgcgatt ttctccccga 480 agaaattggt cggcatgccc aaattaccga aaccgccggc gccgtgaaac gtgccatgcg 540 tgatgccggt attgccagta ttgatgatct ccactttgtg caagtgaaat gtcccctcct 600 cacccccgcc aaaattgcct ccgcccgcag ccggggctgt gcccccgtga ccaccgatac 660 ctatgaatct atgggttaca gtcggggcgc ctccgccctc ggtattgccc tcgccaccga 720 agaagtgcc agttccatgc tcgtggatga aagtgtgctc aatgattggt ccctcagctc 780 tagtctcgcc tccgccagcg ccggcattga actcgaacac aatgtggtga ttgccattgg 840 tatgagtgaa caagccacct ccgaactcgt gattgcccac ggcgtgatga gcgatgccat 900 tgatgccgcc tctgtgcgcc ggaccattga aagcctcggt attcgctctg atgatgaaat 960 ggatcggatt gtgaatgtgt ttgccaaagc cgaagccagt cccgatggtg tggtgcgtgg 1020 tatgcgtcac accatgctct ctgatagtga tattaattcc acccgtcatg cccgtgccgt 1080 gaccggtgcc gccattgcca gcgtggtggg tcacggcatg gtgtacgtgt ctggcggtgc 1140 cgaacatcaa ggtcccgccg gtggtggtcc ctttgccgtg attgcccgtg cctaagtcaa 1200 gtaggagatt aattccatga tttatagtac cgtgaatgcc aatccctatg cctggcccta 1260 cgatggctcc attgatcccg cccacaccgc cctcatcctc atcgattggc aaatcgattt 1320 ttgtggtccc ggcggttatg tggatagtat gggctacgat ctcagcctca cccgctctgg 1380 cctcgaaccc accgcccgcg tgctcgccgc cgcccgcgat accggcatga ccgtgattca 1440 cacccgcgaa ggtcatcgtc ccgatctcgc cgatctcccc cccaataaac gttggcggag 1500 tgcctccgcc ggcgccgaaa ttggcagtgt gggtccctgt ggccgcattc tcgtgcgtgg 1560 tgaacccggt tgggaaattg tgcccgaagt ggccccccgc gaaggtgaac ccattattga 1620 taaacccggt aaaggtgcct tttatgccac cgatctcgat ctcctcctcc gcacccgcgg 1680 cattacccac ctcattctca ccggcattac caccgatgtg tgtgtgcata ccaccatgcg 1740 cgaagccaat gatcggggct acgaatgtct cattctctcc gattgtaccg gtgccaccga 1800 tcggaaacac catgaagccg ccctcagcat ggtgaccatg caaggcggtg tgtttggtgc 1860 caccgcccat tctgatgatc tcctcgccgc cctcggcacc accgtgcccg ccgccgccgg 1920 cccccgtgcc cgcaccgaat aatctaatag gagacaaata ctatgaccgt gagttccgat 1980 accaccgccg aaatttctct cggctggagt atccaagatt ggatcgattt tcacaaaagc 2040 tctagttccc aagcctccct ccgcctcctc gaatccctcc tcgatagcca aaatgtggcc 2100 cccgtggata atgcctggat ttccctcatt agcaaggaaa acctcctcca tcaatttcaa 2160 attctcaagt ctcgcgaaaa caaggaaacc ctccccctct atggtgtgcc cattgccgtg 2220 aaagataata ttgatgtgcg tggcctcccc accaccgccg cctgtcccag ttttgcctac 2280 gaaccctcta aagatagtaa agtggtggaa ctcctccgca atgccggcgc cattattgtg 2340 ggtaaacca atctcgatca atttgccacc ggcctcgtgg gcacccgcag tccctatggc 2400 aaaaccccct gtgccttttc caaagaacac gtgagcggcg gtagctctgc cggctccgcc 2460 agcgtggtgg cccgcggtat tgtgcccatt gccctcggca ccgataccgc cggctctggt 2520 cgggtgcccg ccgccctcaa taatctcatt ggcctcaaac ccaccaaggg tgtgtttagt 2580 tgtcaaggcg tggtgcccgc ctgtaaatct ctcgattgtg tgagtatttt tgccctcaat 2640 ctcagcgatg ccgaacgctg ttttcggatt atgtgtcaac ccgatcccga taatgatgaa 2700 tattcccgcc cctacgtgag caatcccctc aaaaaattta gttccaatgt gaccattgcc 2760 attcccaaaa atattccctg gtatggtgaa accaaaaatc ccgtgctctt ttccaatgcc 2820 gtggaaaatc tcagccggac cggcgccaat gtgattgaaa ttgattttga acccctcctc 2880 gaactcgccc gctgtctcta tgaaggcacc tgggtggccg aacgctatca agccattcaa 2940 tcttttctcg atagtaaacc ccccaaagaa tctctcgatc ccaccgtgat tagtatcatc 3000 gaaggtgcca aaaaatactc cgccgtggat tgttttagct ttgaatacaa acgccaaggc 3060 attctccaaa aagtgcgccg gctcctcgaa tccgtggatg tgctctgtgt gcccacctgt 3120 cccctcaatc ccaccatgca acaagtggcc gatgaacccg tgctcgtgaa tagccgccaa 3180 ggcacctgga ccaattttgt gaatctcgcc gatctcgccg ccctcgccgt gcccgccggt 3240 tttcgggatg atggcctccc caatggtatt accctcattg gcaaaaaatt taccgattat 3300 gccctcctcg aactcgccaa ccgctacttt caaaacatct ttcccaacgg ctcccggacc 3360 tatggcacct ttaccagctc tagtgtgaaa cccgccaatg atcaactcgt gggccccgat 3420 tacgatccct ctaccagtat taaactcgcc gtggtgggcg cccacctcaa aggcctcccc 3480 ctccattggc aactcgaaaa agtgaatgcc acctatctct gtaccaccaa aaccagcaaa 3540 gcctaccaac tctttgccct ccccaaaat ggtcccgtgc tcaaacccgg cctccgtcgt 3600 gtgcaagatt ccaatggtag ccaaattgaa ctcgaagtgt attccgtgcc caaagaactc 3660 tttggcgcct ttattagcat ggtgcccgaa cccctcggca ttggttctgt ggaactcgaa 3720 agtggcgaat ggatcaaatc ttttatttgt gaaaagtg gctacaaagc caaaggcacc 3780 gtggatatta ccaaatatgg cggtttttcgg gcctactttg aaatgctcta aattgattag 3840 gagatataca ccatgagcat ggaaacccac tcctatgttg atgttgcgat ccgtaacgcc cgtctcgccg ataccgaagg cattgttgat attctgattc atgatggtcg gattgccagc attgtgaat ccaccaaaac caaaggttcc gtggaaattg atgcccatga aggtctcgtg accagtggcc tcgtggaacc ccacattcat ctcgataaag ccctcaccgc cgatcgcgtg cccgccggta gtattggcga tctccggacc cgccggggtc tcgaaatggc cattcgcgcc 4140 acccgcgata ttaaacgcac ctttaccgtg gaagatgtgc gggaacgcgc cattcgggcc gccctcatgg ccagtcgcgc cggcaccacc gccctccgca cccatgtgga tgtggacccc 4260 attgtgggtc tcgccggtat tcggggcgtg ctcgaagccc gcgaagtgtg tgccggtctc 4320. attgatattc aaattgtggc ctttccccaa gaaggcctct tttgtagtgc cggtgccgtg gatctcatgc gggaagccat taaactcggt gccgatgccg tgggcggtgc ccccgccctc 4440 gatgatcgcc cccaagatca tgtgcgcgcc gtgtttgatc tcgccgccga atttggtctc cccgtggata tgcacgtgga tgaaagtgat cgccgggaag attttaccct cccctttgtg 4560 attgaagccg cccgcgaacg gcgcgtgccc aatgtgaccg tggcccacat ttcctctctc 4620 agtgtgcaaa ccgatgatgt ggcccgctcc accattgccg ccctcgccga tgccgatgtg 4680 aatgtggtgg tgaatcccat tattgtgaaa attacccgcc tctctgaact cctcgatgcc 4740 ggtgtgtctg tgatgtttgg ctccgataat ctccgcgatc ccttttatcc cctcggtgcc 4800 gccaatcccc tcggtagtgc catttttgcc tgtcaaattg ccgccctcgg caccccccaa 4860 gacctccgcc gggtgtttga tgccgtgacc attaatgccg cccgcatgct cggttttccc 4920 agtctcctcg gtgtggtgga aggtgccgtg gccgatctcg ccgtgtttcc cagtgccacc 4980 cccgaagaag tggtgctcga tcaacaaagt cccctctttg tgctcaaagg tggtcgggtc 5040 gttgcgatgc ggttagcggc gggtagcacc tcctttcgtg attattcgta atatacttag 5100 gagattcata cgatgatgag cggcgaacac accctcaaag ccgtgcgcgg ttcttttatt 5160 gatgtgaccc ggaccattga taatcccgaa gaaattgcca gcgccctccg ctttattgaa 5220 gatggcctcc tcctcattaa acagggtaaa gtggaatggt ttggcgaatg ggaaaatggt 5280 aaacaccaaa ttcccgatac cattcgcgtg cgggattatc ggggcaaact cattgtgccc 5340 ggttttgtgg atacccacat tcattatccc caaagtgaaa tggtgggcgc ctacggtgaa 5400 caactcctcg aatggctcaa taaacatacc tttcccaccg aacgccggta tgaagaatttg 5460 gaatacgcccc gcgaaatgtc cgcctttttc attaaaac tcctccggaa tggcaccacc 5520 accgccctcg tgtttggcac cgtgcatccc caaagtgtgg atgccctctt tgaagccgcc 5580 tcccatatta atatgcgcat gattgccggc aaagtgatga tggatcggaa tgccccccgat 5640 tatctcctcg ataccgccga aagttcctac caccaatcta aagaactcat tgaacgctgg 5700 cataaaaaatg gtcggctcct ctatgccatt accccccgtt ttgcccccac cagctctccc 5760 gaacaaatgg cgatggccca acggctcaaa gaagaatacc ccgatacctg ggtgcatacc 5820 catctctgtg aaaataaga tgaaattgcc tgggtgaaaa gcctctatcc cgatcacgat 5880 ggctacctcg atgtgtatca tcaatacggc ctcaccggta aaaattgtgt gtttgcccac 5940 tgtgtgcatc tcgaagaaaa agaatgggat cgcctctctg aaaccaaaag ttccattgcc 6000 ttttgtccca ccagcaatct ctatctcggc tctggcctct ttaatctcaa aaaagcctgg 6060 cagaaaaaag tgaaagtggg catgggcacc gatattggcg ccggcaccac ctttaatatg 6120 ctccaaaccc tcaatgaagc ctataaagtg ctccaactcc aaggctacag cctctctgcc 6180 tatgaagcct tttacctcgc caccctcggc ggtgccaaaa gtctcggcct cgatgatctc 6240 attggcaatt ttctccccgg taaagaagcc gattttgtgg tgatggaacc caccgccacc 6300 cccctccaac aactccgtta tgataatagt gtgtccctcg tggataaact ctttgtgatg 6360 atgaccctcg gcgatgatcg ctccatttat cggacctacg tggatggtcg cctcgtgtac 6420 gaacggaatt aagctagtta gaagattcag accatgcaaa ccctcagcat tcaacatggc 6480 accctcgtga cgatggatca atatcgccgg gtgctcggcg atagctgggt gcatgtgcaa 6540 gatggccgca ttgtggccct cggtgtgcat gccgaatctg tgcccccccc cgccgatcgt 6600 gtgattgatg cccgcggtaa agtggtgctc cccggtttta ttaatgccca tacccacgtg 6660 aatcaaattc tcctccgtgg tggtccctct cacggtcgcc aactctatga ttggctcttt 6720 aatgtgctct accccggcca aaaagccatg cgccccgaag atgtggccgt ggccgtgcgg 6780 ctctattgtg ccgaagccgt gcgcagtggt attaccacca ttaatgataa tgccgattcc 6840 gccatttacc ccggcaatat tgaagccgcg atggccgtgt atggcgaagt gggtgtgcgg 6900 gtggtgtacg cccgcatgtt tttcgatcgc atggatggcc ggattcaagg ttatgtggat 6960 gccctcaaag cccggagccc ccaagtggaa ctctgttcta ttatggaaga aaccgccgtg 7020 gccaaagatc ggattaccgc cctcagcgat caatatcacg gcaccgccgg tggccgcatt 7080 agtgtgtggc ccgcccccgc cattaccccc gccgtgaccg tggagggtat gcgttgggcc 7140 caagcctttg cccgcgatcg ggccgtgatg tggaccctcc acatggccga aagcgatcat 7200 gatgaacggc tccactggat gtctcccgcc gaatatatgg aatgttacgg cctcctcgat 7260 gaacgcctcc aagtggccca ctgtgtgtat tttgatcgca aagatgtgcg gctcctccat 7320 cgccacaatg tgaaagtggc cagtcaagtg gtgtccaatg cctacctcgg cagtggtgtg 7380 gcccccgtgc ccgaaatggt ggaacgtggc atggccgtgg gcattggcac cgatgatggt 7440 aattgtaatg attccgtgaa tatgattggc gatatgaaat ttatggccca tattcaccgg 7500 gccgtgcatc gcgatgccga tgtgctcacc cccgaaaaaa ttctcgaaat ggccaccatt 7560 gatggcgccc gcagtctcgg tatggatcat gaaattggct ccattgaaac cggtaaacgg 7620 gccgatctca ttctcctcga tctccgccac ccccaaacca ccccccacca tcacctcgcc 7680 gccaccattg tgtttcaagc ctacggtaat gaagtggata ccgtgctcat tgatggcaat 7740 gtggtgatgg aaaatcgccg gctcagtttt ctcccccccg aacgggaact cgcctttctc 7800 gaagaagccc aaagtcgcgc caccgccatt ctccaacgcg ccaatatggt ggccaatccc 7860 gcctggcgca gcctctaaaa gggtgggcgc gccgacccag ctttcttgta caaactcggc 7920 cctgcaggag aaggccatcc tgacggatgg cctttttgaa gcttgaaa 7968 <210> 86 <211> 7968 <212> DNA <213> Artificial sequence <220> <223> Mel6 <220> <221> Promoter <222> (1)..(89) <223> Pc223 promoter <220> <221> Gene <222> (104) (1195) <223> atzD <220> <221> Gene <222> (1217) (1942) <223> trzE <220> <221> Gene <222> (1963) (3831) <223> DUR1,2 <220> <221> Gene <222> (3853)..(5091) <223> trzC <220> <221> Gene <222> (5113)...(6432) <223> guaD <220> <221> Gene <222> (6454)..(7878) <223> triA <220> <221> Termination <222> (7929)...(7957) <223> RRNB Terminator <400> 86 ttaacaaaaa agcaggaata aaattaacat gatgtaacag acataagtcc catcaccgtt 60 gtataatgtt aactgtggga ttgcaaaaga ggagattaat tcaatgtatc acattgatgt 120 gtttcgcatt ccctgtcata gccccggtga tacctctggc ctcgaagatt tgattgaaac 180 cggtcgtgtg gcccccgccg atattgtggc cgtgatgggt aaaaccgagg gtaatggctg 240 tgtgaatgat tatacccgg aatacgccac cgccatgctc gccgcctgtc tcggccgcca 300 cctccaactc cccccccatg aagtggaaaa acgggtggcc tttgtgatga gtggtggcac 360 cgaaggtgtg ctctcccccc accataccgt gtttgcccgt cgccccgcca ttgatgccca 420 ccgtcccgcc ggtaaacgtc tcaccctcgg cattgccttt acccgcgatt ttctccccga 480 agaaattggt cggcatgccc aaattaccga aaccgccggc gccgtgaaac gtgccatgcg 540 tgatgccggt attgccagta ttgatgatct ccactttgtg caagtgaaat gtcccctcct 600 caccccgcc aaaattgcct ccgcccgcag ccggggctgt gcccccgtga ccaccgatac 660 ctatgaatct atgggttaca gtcggggcgc ctccgccctc ggtattgccc tcgccaccga 720 agaagtgcc agttccatgc tcgtggatga aagtgtgctc aatgattggt ccctcagctc 780 tagtctcgcc tccgccagcg ccggcattga actcgaacac aatgtggtga ttgccattgg 840 tatgagtgaa caagccacct ccgaactcgt gattgcccac ggcgtgatga gcgatgccat 900 tgatgccgcc tctgtgcgcc ggaccattga aagcctcggt attcgctctg atgatgaaat 960 ggatcggatt gtgaatgtgt ttgccaaagc cgaagccagt cccgatggtg tggtgcgtgg 1020 tatgcgtcac accatgctct ctgatagtga tattaattcc acccgtcatg cccgtgccgt 1080 gaccggtgcc gccattgcca gcgtggtggg tcacggcatg gtgtacgtgt ctggcggtgc 1140 cgaacatcaa ggtcccgccg gtggtggtcc ctttgccgtg attgcccgtg cctaagtcaa 1200 gtaggagatt aattccatga tttatagtac cgtgaatgcc aatccctatg cctggcccta 1260 cgatggctcc attgatcccg cccacaccgc cctcatcctc atcgattggc aaatcgattt 1320 ttgtggtccc ggcggttatg tggatagtat gggctacgat ctcagcctca cccgctctgg 1380 cctcgaaccc accgcccgcg tgctcgccgc cgcccgcgat accggcatga ccgtgattca 1440 cacccgcgaa ggtcatcgtc ccgatctcgc cgatctcccc cccaataaac gttggcggag 1500 tgcctccgcc ggcgccgaaa ttggcagtgt gggtccctgt ggccgcattc tcgtgcgtgg 1560 tgaacccggt tgggaaattg tgcccgaagt ggccccccgc gaaggtgaac ccattattga 1620 taaacccggt aaaggtgcct tttatgccac cgatctcgat ctcctcctcc gcacccgcgg 1680 cattacccac ctcattctca ccggcattac caccgatgtg tgtgtgcata ccaccatgcg 1740 cgaagccaat gatcggggct acgaatgtct cattctctcc gattgtaccg gtgccaccga 1800 tcggaaacac catgaagccg ccctcagcat ggtgaccatg caaggcggtg tgtttggtgc 1860 caccgcccat tctgatgatc tcctcgccgc cctcggcacc accgtgcccg ccgccgccgg 1920 cccccgtgcc cgcaccgaat aatctaatag gagacaaata ctatgaccgt gagttccgat 1980 accaccgccg aaatttctct cggctggagt atccaagatt ggatcgattt tcacaaaagc 2040 tctagttccc aagcctccct ccgcctcctc gaatccctcc tcgatagcca aaatgtggcc 2100 cccgtggata atgcctggat ttccctcatt agcaaggaaa acctcctcca tcaatttcaa 2160 attctcaagt ctcgcgaaaa caaggaaacc ctccccctct atggtgtgcc cattgccgtg 2220 aaagataata ttgatgtgcg tggcctcccc accaccgccg cctgtcccag ttttgcctac 2280 gaaccctcta aagatagtaa agtggtggaa ctcctccgca atgccggcgc cattattgtg 2340 ggtaaacca atctcgatca atttgccacc ggcctcgtgg gcacccgcag tccctatggc 2400 aaaaccccct gtgccttttc caaagaacac gtgagcggcg gtagctctgc cggctccgcc 2460 agcgtggtgg cccgcggtat tgtgcccatt gccctcggca ccgataccgc cggctctggt 2520 cgggtgcccg ccgccctcaa taatctcatt ggcctcaaac ccaccaaggg tgtgtttagt 2580 tgtcaaggcg tggtgcccgc ctgtaaatct ctcgattgtg tgagtatttt tgccctcaat 2640 ctcagcgatg ccgaacgctg ttttcggatt atgtgtcaac ccgatcccga taatgatgaa 2700 tattcccgcc cctacgtgag caatcccctc aaaaaattta gttccaatgt gaccattgcc 2760 attcccaaaa atattccctg gtatggtgaa accaaaaatc ccgtgctctt ttccaatgcc 2820 gtggaaaatc tcagccggac cggcgccaat gtgattgaaa ttgattttga acccctcctc 2880 gaactcgccc gctgtctcta tgaaggcacc tgggtggccg aacgctatca agccattcaa 2940 tcttttctcg atagtaaacc ccccaaagaa tctctcgatc ccaccgtgat tagtatcatc 3000 gaaggtgcca aaaaatactc cgccgtggat tgttttagct ttgaatacaa acgccaaggc 3060 attctccaaa aagtgcgccg gctcctcgaa tccgtggatg tgctctgtgt gcccacctgt 3120 cccctcaatc ccaccatgca acaagtggcc gatgaacccg tgctcgtgaa tagccgccaa 3180 ggcacctgga ccaattttgt gaatctcgcc gatctcgccg ccctcgccgt gcccgccggt 3240 tttcgggatg atggcctccc caatggtatt accctcattg gcaaaaaatt taccgattat 3300 gccctcctcg aactcgccaa ccgctacttt caaaacatct ttcccaacgg ctcccggacc 3360 tatggcacct ttaccagctc tagtgtgaaa cccgccaatg atcaactcgt gggccccgat 3420 tacgatccct ctaccagtat taaactcgcc gtggtgggcg cccacctcaa aggcctcccc 3480 ctccattggc aactcgaaaa agtgaatgcc acctatctct gtaccaccaa aaccagcaaa 3540 gcctaccaac tctttgccct ccccaaaat ggtcccgtgc tcaaacccgg cctccgtcgt 3600 gtgcaagatt ccaatggtag ccaaattgaa ctcgaagtgt attccgtgcc caaagaactc 3660 tttggcgcct ttattagcat ggtgcccgaa cccctcggca ttggttctgt ggaactcgaa 3720 agtggcgaat ggatcaaatc ttttatttgt gaaaagtg gctacaaagc caaaggcacc 3780 gtggatatta ccaaatatgg cggtttttcgg gcctactttg aaatgctcta aattgattag 3840 gagatataca ccatgagcat ggaaacccac tcctatgttg atgttgcgat ccgtaacgcc cgtctcgccg ataccgaagg cattgttgat attctgattc atgatggtcg gattgccagc attgtgaat ccaccaaaac caaaggttcc gtggaaattg atgcccatga aggtctcgtg accagtggcc tcgtggaacc ccacattcat ctcgataaag ccctcaccgc cgatcgcgtg cccgccggta gtattggcga tctccggacc cgccggggtc tcgaaatggc cattcgcgcc 4140 acccgcgata ttaaacgcac ctttaccgtg gaagatgtgc gggaacgcgc cattcgggcc gccctcatgg ccagtcgcgc cggcaccacc gccctccgca cccatgtgga tgtggacccc 4260 attgtgggtc tcgccggtat tcggggcgtg ctcgaagccc gcgaagtgtg tgccggtctc 4320. attgatattc aaattgtggc ctttccccaa gaaggcctct tttgtagtgc cggtgccgtg gatctcatgc gggaagccat taaactcggt gccgatgccg tgggcggtgc ccccgccctc 4440 gatgatcgcc cccaagatca tgtgcgcgcc gtgtttgatc tcgccgccga atttggtctc cccgtggata tgcacgtgga tgaaagtgat cgccgggaag attttaccct cccctttgtg 4560 attgaagccg cccgcgaacg gcgcgtgccc aatgtgaccg tggcccacat ttcctctctc 4620 agtgtgcaaa ccgatgatgt ggcccgctcc accattgccg ccctcgccga tgccgatgtg 4680 aatgtggtgg tgaatcccat tattgtgaaa attacccgcc tctctgaact cctcgatgcc 4740 ggtgtgtctg tgatgtttgg ctccgataat ctccgcgatc ccttttatcc cctcggtgcc 4800 gccaatcccc tcggtagtgc catttttgcc tgtcaaattg ccgccctcgg caccccccaa 4860 gacctccgcc gggtgtttga tgccgtgacc attaatgccg cccgcatgct cggttttccc 4920 agtctcctcg gtgtggtgga aggtgccgtg gccgatctcg ccgtgtttcc cagtgccacc 4980 cccgaagaag tggtgctcga tcaacaaagt cccctctttg tgctcaaagg tggtcgggtc 5040 gttgcgatgc ggttagcggc gggtagcacc tcctttcgtg attattcgta atatacttag 5100 gagattcata cgatgatgag cggcgaacac accctcaaag ccgtgcgcgg ttcttttatt 5160 gatgtgaccc ggaccattga taatcccgaa gaaattgcca gcgccctccg ctttattgaa 5220 gatggcctcc tcctcattaa acagggtaaa gtggaatggt ttggcgaatg ggaaaatggt 5280 aaacaccaaa ttcccgatac cattcgcgtg cgggattatc ggggcaaact cattgtgccc 5340 ggttttgtgg atacccacat tcattatccc caaagtgaaa tggtgggcgc ctacggtgaa 5400 caactcctcg aatggctcaa taaacatacc tttcccaccg aacgccggta tgaagaatttg 5460 gaatacgcccc gcgaaatgtc cgcctttttc attaaaac tcctccggaa tggcaccacc 5520 accgccctcg tgtttggcac cgtgcatccc caaagtgtgg atgccctctt tgaagccgcc 5580 tcccatatta atatgcgcat gattgccggc aaagtgatga tggatcggaa tgccccccgat 5640 tatctcctcg ataccgccga aagttcctac caccaatcta aagaactcat tgaacgctgg 5700 cataaaaaatg gtcggctcct ctatgccatt accccccgtt ttgcccccac cagctctccc 5760 gaacaaatgg cgatggccca acggctcaaa gaagaatacc ccgatacctg ggtgcatacc 5820 catctctgtg aaaataaga tgaaattgcc tgggtgaaaa gcctctatcc cgatcacgat 5880 ggctacctcg atgtgtatca tcaatacggc ctcaccggta aaaattgtgt gtttgcccac 5940 tgtgtgcatc tcgaagaaaa agaatgggat cgcctctctg aaaccaaaag ttccattgcc 6000 ttttgtccca ccagcaatct ctatctcggc tctggcctct ttaatctcaa aaaagcctgg 6060 cagaaaaaag tgaaagtggg catgggcacc gatattggcg ccggcaccac ctttaatatg 6120 ctccaaaccc tcaatgaagc ctataaagtg ctccaactcc aaggctacag cctctctgcc 6180 tatgaagcct tttacctcgc caccctcggc ggtgccaaaa gtctcggcct cgatgatctc 6240 attggcaatt ttctccccgg taaagaagcc gattttgtgg tgatggaacc caccgccacc 6300 cccctccaac aactccgtta tgataatagt gtgtccctcg tggataaact ctttgtgatg 6360 atgaccctcg gcgatgatcg ctccatttat cggacctacg tggatggtcg cctcgtgtac 6420 gaacggaatt aagctagtta ggagattcag accatgcaaa ccctcagcat tcaacatggc 6480 accctcgtga cgatggatca atatcgccgg gtgctcggcg atagctgggt gcatgtgcaa 6540 gatggccgca ttgtggccct cggtgtgcat gccgaatctg tgcccccccc cgccgatcgt 6600 gtgattgatg cccgcggtaa agtggtgctc cccggtttta ttaatgccca tacccacgtg 6660 aatcaaattc tcctccgtgg tggtccctct cacggtcgcc aactctatga ttggctcttt 6720 aatgtgctct accccggcca aaaagccatg cgccccgaag atgtggccgt ggccgtgcgg 6780 ctctattgtg ccgaagccgt gcgcagtggt attaccacca ttaatgataa tgccgattcc 6840 gccatttacc ccggcaatat tgaagccgcg atggccgtgt atggcgaagt gggtgtgcgg 6900 gtggtgtacg cccgcatgtt tttcgatcgc atggatggcc ggattcaagg ttatgtggat 6960 gccctcaaag cccggagccc ccaagtggaa ctctgttcta ttatggaaga aaccgccgtg 7020 gccaaagatc ggattaccgc cctcagcgat caatatcacg gcaccgccgg tggccgcatt 7080 agtgtgtggc ccgcccccgc cattaccccc gccgtgaccg tggagggtat gcgttgggcc 7140 caagcctttg cccgcgatcg ggccgtgatg tggaccctcc acatggccga aagcgatcat 7200 gatgaacggc tccactggat gtctcccgcc gaatatatgg aatgttacgg cctcctcgat 7260 gaacgcctcc aagtggccca ctgtgtgtat tttgatcgca aagatgtgcg gctcctccat 7320 cgccacaatg tgaaagtggc cagtcaagtg gtgtccaatg cctacctcgg cagtggtgtg 7380 gcccccgtgc ccgaaatggt gaaacgtggc atggccgtgg gcattggcac cgatgatggt 7440 aattgtaatg attccgtgaa tatgattggc gatatgaaat ttatggccca tattcaccgg 7500 gccgtgcatc gcgatgccga tgtgctcacc cccgaaaaaa ttctcgaaat ggccaccatt 7560 gatggcgccc gcagtctcgg tatggatcat gaaattggct ccattgaaac cggtaaacgg 7620 gccgatctca ttctcctcga tctccgccac ccccaaacca ccccccacca tcacctcgcc 7680 gccaccattg tgtttcaagc ctacggtaat gaagtggata ccgtgctcat tgatggcaat 7740 gtggtgatgg aaaatcgccg gctcagtttt ctcccccccg aacgggaact cgcctttctc 7800 gaagaagccc aaagtcgcgc caccgccatt ctccaacgcg ccaatatggt ggccaatccc 7860 gcctggcgca gcctctaaaa gggtgggcgc gccgacccag ctttcttgta caaactcggc 7920 cctgcaggag aaggccatcc tgacggatgg cctttttgaa gcttgaaa 7968 <210> 87 <211> 7968 <212> DNA <213> Artificial sequence <220> <223> Mel7 <220> <221> Promoter <222> (1)..(89) <223> Pc223 promoter <220> <221> Gene <222> (104) (1195) <223> atzD <220> <221> Gene <222> (1217) (1942) <223> trzE <220> <221> Gene <222> (1963) (3831) <223> DUR1,2 <220> <221> Gene <222> (3853)..(5091) <223> trzC <220> <221> Gene <222> (5113)...(6432) <223> guaD <220> <221> Gene <222> (6454)..(7878) <223> triA <220> <221> Termination <222> (7929)...(7957) <223> RRNB Terminator <400> 87 ttaacaaaaa agcaggaata aaattaacat gatgtaacag acataagtcc catcaccgtt 60 gtataatgtt aactgtggga ttgcaaaaga ggagattaat tcaatgtatc acattgatgt 120 gtttcgcatt ccctgtcata gccccggtga tacctctggc ctcgaagatt tgattgaaac 180 cggtcgtgtg gcccccgccg atattgtggc cgtgatgggt aaaaccgagg gtaatggctg 240 tgtgaatgat tatacccgg aatacgccac cgccatgctc gccgcctgtc tcggccgcca 300 cctccaactc cccccccatg aagtggaaaa acgggtggcc tttgtgatga gtggtggcac 360 cgaaggtgtg ctctcccccc accataccgt gtttgcccgt cgccccgcca ttgatgccca 420 ccgtcccgcc ggtaaacgtc tcaccctcgg cattgccttt acccgcgatt ttctccccga 480 agaaattggt cggcatgccc aaattaccga aaccgccggc gccgtgaaac gtgccatgcg 540 tgatgccggt attgccagta ttgatgatct ccactttgtg caagtgaaat gtcccctcct 600 caccccgcc aaaattgcct ccgcccgcag ccggggctgt gcccccgtga ccaccgatac 660 ctatgaatct atgggttaca gtcggggcgc ctccgccctc ggtattgccc tcgccaccga 720 agaagtgcc agttccatgc tcgtggatga aagtgtgctc aatgattggt ccctcagctc 780 tagtctcgcc tccgccagcg ccggcattga actcgaacac aatgtggtga ttgccattgg 840 tatgagtgaa caagccacct ccgaactcgt gattgcccac ggcgtgatga gcgatgccat 900 tgatgccgcc tctgtgcgcc ggaccattga aagcctcggt attcgctctg atgatgaaat 960 ggatcggatt gtgaatgtgt ttgccaaagc cgaagccagt cccgatggtg tggtgcgtgg 1020 tatgcgtcac accatgctct ctgatagtga tattaattcc acccgtcatg cccgtgccgt 1080 gaccggtgcc gccattgcca gcgtggtggg tcacggcatg gtgtacgtgt ctggcggtgc 1140 cgaacatcaa ggtcccgccg gtggtggtcc ctttgccgtg attgcccgtg cctaagtcaa 1200 gtaggagatt aattccatga tttatagtac cgtgaatgcc aatccctatg cctggcccta 1260 cgatggctcc attgatcccg cccacaccgc cctcatcctc atcgattggc aaatcgattt 1320 ttgtggtccc ggcggttatg tggatagtat gggctacgat ctcagcctca cccgctctgg 1380 cctcgaaccc accgcccgcg tgctcgccgc cgcccgcgat accggcatga ccgtgattca 1440 cacccgcgaa ggtcatcgtc ccgatctcgc cgatctcccc cccaataaac gttggcggag 1500 tgcctccgcc ggcgccgaaa ttggcagtgt gggtccctgt ggccgcattc tcgtgcgtgg 1560 tgaacccggt tgggaaattg tgcccgaagt ggccccccgc gaaggtgaac ccattattga 1620 taaacccggt aaaggtgcct tttatgccac cgatctcgat ctcctcctcc gcacccgcgg 1680 cattacccac ctcattctca ccggcattac caccgatgtg tgtgtgcata ccaccatgcg 1740 cgaagccaat gatcggggct acgaatgtct cattctctcc gattgtaccg gtgccaccga 1800 tcggaaacac catgaagccg ccctcagcat ggtgaccatg caaggcggtg tgtttggtgc 1860 caccgcccat tctgatgatc tcctcgccgc cctcggcacc accgtgcccg ccgccgccgg 1920 cccccgtgcc cgcaccgaat aatctaatag gagacaaata ctatgaccgt gagttccgat 1980 accaccgccg aaatttctct cggctggagt atccaagatt ggatcgattt tcacaaaagc 2040 tctagttccc aagcctccct ccgcctcctc gaatccctcc tcgatagcca aaatgtggcc 2100 cccgtggata atgcctggat ttccctcatt agcaaggaaa acctcctcca tcaatttcaa 2160 attctcaagt ctcgcgaaaa caaggaaacc ctccccctct atggtgtgcc cattgccgtg 2220 aaagataata ttgatgtgcg tggcctcccc accaccgccg cctgtcccag ttttgcctac 2280 gaaccctcta aagatagtaa agtggtggaa ctcctccgca atgccggcgc cattattgtg 2340 ggtaaacca atctcgatca atttgccacc ggcctcgtgg gcacccgcag tccctatggc 2400 aaaaccccct gtgccttttc caaagaacac gtgagcggcg gtagctctgc cggctccgcc 2460 agcgtggtgg cccgcggtat tgtgcccatt gccctcggca ccgataccgc cggctctggt 2520 cgggtgcccg ccgccctcaa taatctcatt ggcctcaaac ccaccaaggg tgtgtttagt 2580 tgtcaaggcg tggtgcccgc ctgtaaatct ctcgattgtg tgagtatttt tgccctcaat 2640 ctcagcgatg ccgaacgctg ttttcggatt atgtgtcaac ccgatcccga taatgatgaa 2700 tattcccgcc cctacgtgag caatcccctc aaaaaattta gttccaatgt gaccattgcc 2760 attcccaaaa atattccctg gtatggtgaa accaaaaatc ccgtgctctt ttccaatgcc 2820 gtggaaaatc tcagccggac cggcgccaat gtgattgaaa ttgattttga acccctcctc 2880 gaactcgccc gctgtctcta tgaaggcacc tgggtggccg aacgctatca agccattcaa 2940 tcttttctcg atagtaaacc ccccaaagaa tctctcgatc ccaccgtgat tagtatcatc 3000 gaaggtgcca aaaaatactc cgccgtggat tgttttagct ttgaatacaa acgccaaggc 3060 attctccaaa aagtgcgccg gctcctcgaa tccgtggatg tgctctgtgt gcccacctgt 3120 cccctcaatc ccaccatgca acaagtggcc gatgaacccg tgctcgtgaa tagccgccaa 3180 ggcacctgga ccaattttgt gaatctcgcc gatctcgccg ccctcgccgt gcccgccggt 3240 tttcgggatg atggcctccc caatggtatt accctcattg gcaaaaaatt taccgattat 3300 gccctcctcg aactcgccaa ccgctacttt caaaacatct ttcccaacgg ctcccggacc 3360 tatggcacct ttaccagctc tagtgtgaaa cccgccaatg atcaactcgt gggccccgat 3420 tacgatccct ctaccagtat taaactcgcc gtggtgggcg cccacctcaa aggcctcccc 3480 ctccattggc aactcgaaaa agtgaatgcc acctatctct gtaccaccaa aaccagcaaa 3540 gcctaccaac tctttgccct ccccaaaat ggtcccgtgc tcaaacccgg cctccgtcgt 3600 gtgcaagatt ccaatggtag ccaaattgaa ctcgaagtgt attccgtgcc caaagaactc 3660 tttggcgcct ttattagcat ggtgcccgaa cccctcggca ttggttctgt ggaactcgaa 3720 agtggcgaat ggatcaaatc ttttatttgt gaaaagtg gctacaaagc caaaggcacc 3780 gtggatatta ccaaatatgg cggtttttcgg gcctactttg aaatgctcta aattgattag 3840 gagatataca ccatgagcat ggaaacccac tcctatgttg atgttgcgat ccgtaacgcc cgtctcgccg ataccgaagg cattgttgat attctgattc atgatggtcg gattgccagc attgtgaat ccaccaaaac caaaggttcc gtggaaattg atgcccatga aggtctcgtg accagtggcc tcgtggaacc ccacattcat ctcgataaag ccctcaccgc cgatcgcgtg cccgccggta gtattggcga tctccggacc cgccggggtc tcgaaatggc cattcgcgcc 4140 acccgcgata ttaaacgcac ctttaccgtg gaagatgtgc gggaacgcgc cattcgggcc gccctcatgg ccagtcgcgc cggcaccacc gccctccgca cccatgtgga tgtggacccc 4260 attgtgggtc tcgccggtat tcggggcgtg ctcgaagccc gcgaagtgtg tgccggtctc 4320. attgatattc aaattgtggc ctttccccaa gaaggcctct tttgtagtgc cggtgccgtg gatctcatgc gggaagccat taaactcggt gccgatgccg tgggcggtgc ccccgccctc 4440 gatgatcgcc cccaagatca tgtgcgcgcc gtgtttgatc tcgccgccga atttggtctc cccgtggata tgcacgtgga tgaaagtgat cgccgggaag attttaccct cccctttgtg 4560 attgaagccg cccgcgaacg gcgcgtgccc aatgtgaccg tggcccacat ttcctctctc 4620 agtgtgcaaa ccgatgatgt ggcccgctcc accattgccg ccctcgccga tgccgatgtg 4680 aatgtggtgg tgaatcccat tattgtgaaa attacccgcc tctctgaact cctcgatgcc 4740 ggtgtgtctg tgatgtttgg ctccgataat ctccgcgatc ccttttatcc cctcggtgcc 4800 gccaatcccc tcggtagtgc catttttgcc tgtcaaattg ccgccctcgg caccccccaa 4860 gacctccgcc gggtgtttga tgccgtgacc attaatgccg cccgcatgct cggttttccc 4920 agtctcctcg gtgtggtgga aggtgccgtg gccgatctcg ccgtgtttcc cagtgccacc 4980 cccgaagaag tggtgctcga tcaacaaagt cccctctttg tgctcaaagg tggtcgggtc 5040 gttgcgatgc ggttagcggc gggtagcacc tcctttcgtg attattcgta atatacttag 5100 gagattcata cgatgatgag cggcgaacac accctcaaag ccgtgcgcgg ttcttttatt 5160 gatgtgaccc ggaccattga taatcccgaa gaaattgcca gcgccctccg ctttattgaa 5220 gatggcctcc tcctcattaa acagggtaaa gtggaatggt ttggcgaatg ggaaaatggt 5280 aaacaccaaa ttcccgatac cattcgcgtg cgggattatc ggggcaaact cattgtgccc 5340 ggttttgtgg atacccacat tcattatccc caaagtgaaa tggtgggcgc ctacggtgaa 5400 caactcctcg aatggctcaa taaacatacc tttcccaccg aacgccggta tgaagaatttg 5460 gaatacgcccc gcgaaatgtc cgcctttttc attaaaac tcctccggaa tggcaccacc 5520 accgccctcg tgtttggcac cgtgcatccc caaagtgtgg atgccctctt tgaagccgcc 5580 tcccatatta atatgcgcat gattgccggc aaagtgatga tggatcggaa tgccccccgat 5640 tatctcctcg ataccgccga aagttcctac caccaatcta aagaactcat tgaacgctgg 5700 cataaaaaatg gtcggctcct ctatgccatt accccccgtt ttgcccccac cagctctccc 5760 gaacaaatgg cgatggccca acggctcaaa gaagaatacc ccgatacctg ggtgcatacc 5820 catctctgtg aaaataaga tgaaattgcc tgggtgaaaa gcctctatcc cgatcacgat 5880 ggctacctcg atgtgtatca tcaatacggc ctcaccggta aaaattgtgt gtttgcccac 5940 tgtgtgcatc tcgaagaaaa agaatgggat cgcctctctg aaaccaaaag ttccattgcc 6000 ttttgtccca ccagcaatct ctatctcggc tctggcctct ttaatctcaa aaaagcctgg 6060 cagaaaaaag tgaaagtggg catgggcacc gatattggcg ccggcaccac ctttaatatg 6120 ctccaaaccc tcaatgaagc ctataaagtg ctccaactcc aaggctacag cctctctgcc 6180 tatgaagcct tttacctcgc caccctcggc ggtgccaaaa gtctcggcct cgatgatctc 6240 attggcaatt ttctccccgg taaagaagcc gattttgtgg tgatggaacc caccgccacc 6300 cccctccaac aactccgtta tgataatagt gtgtccctcg tggataaact ctttgtgatg 6360 atgaccctcg gcgatgatcg ctccatttat cggacctacg tggatggtcg cctcgtgtac 6420 gaacggaatt aagctagtta ggagattcag accatgcaaa ccctcagcat tcaacatggc 6480 accctcgtga cgatggatca atatcgccgg gtgctcggcg atagctgggt gcatgtgcaa 6540 gatggccgca ttgtggccct cggtgtgcat gccgaatctg tgcccccccc cgccgatcgt 6600 gtgattgatg cccgcggtaa agtggtgctc cccggtttta ttaatgccca tacccacgtg 6660 aatcaaattc tcctccgtgg tggtccctct cacggtcgcc aactctatga ttggctcttt 6720 aatgtgctct accccggcca aaaagccatg cgccccgaag atgtggccgt ggccgtgcgg 6780 ctctattgtg ccgaagccgt gcgcagtggt attaccacca ttaatgataa tgccgattcc 6840 gccatttacc ccggcaatat tgaagccgcg atggccgtgt atggcgaagt gggtgtgcgg 6900 gtggtgtacg cccgcatgtt tttcgatcgc atggatggcc ggattcaagg ttatgtggat 6960 gccctcaaag cccggagccc ccaagtggaa ctctgttcta ttatggaaga aaccgccgtg 7020 gccaaagatc ggattaccgc cctcagcgat caatatcacg gcaccgccgg tggccgcatt 7080 agtgtgtggc ccgcccccgc cattaccccc gccgtgaccg tggagggtat gcgttgggcc 7140 caagcctttg cccgcgatcg ggccgtgatg tggaccctcc acatggccga aagcgatcat 7200 gatgaacggc tctactggat gtctcccgcc gaatatatgg aatgttacgg cctcctcgat 7260 gaacgcctcc aagtggccca ctgtgtgtat tttgatcgca aagatgtgcg gctcctccat 7320 cgccacaatg tgaaagtggc cagtcaagtg gtgtccaatg cctacctcgg cagtggtgtg 7380 gcccccgtgc ccgaaatggt ggaacgtggc atggccgtgg gcattggcac cgatgatggt 7440 aattgtaatg attccgtgaa tatgattggc gatatgaaat ttatggccca tattcaccgg 7500 gccgtgcatc gcgatgccga tgtgctcacc cccgaaaaaa ttctcgaaat ggccaccatt 7560 gatggcgccc gcagtctcgg tatggatcat gaaattggct ccattgaaac cggtaaacgg 7620 gccgatctca ttctcctcga tctccgccac ccccaaacca ccccccacca tcacctcgcc 7680 gccaccattg tgtttcaagc ctacggtaat gaagtggata ccgtgctcat tgatggcaat 7740 gtggtgatgg aaaatcgccg gctcagtttt ctcccccccg aacgggaact cgcctttctc 7800 gaagaagccc aaagtcgcgc caccgccatt ctccaacgcg ccaatatggt ggccaatccc 7860 gcctggcgca gcctctaaaa gggtgggcgc gccgacccag ctttcttgta caaactcggc 7920 cctgcaggag aaggccatcc tgacggatgg cctttttgaa gcttgaaa 7968 <210> 88 <211> 7968 <212> DNA <213> Artificial sequence <220> <223> Mel8 <220> <221> Promoter <222> (1)..(89) <223> Pc223 promoter <220> <221> Gene <222> (104) (1195) <223> atzD <220> <221> Gene <222> (1217) (1942) <223> trzE <220> <221> Gene <222> (1963) (3831) <223> DUR1,2 <220> <221> Gene <222> (3853)..(5091) <223> trzC <220> <221> Gene <222> (5113)...(6432) <223> guaD <220> <221> Gene <222> (6454)..(7878) <223> triA <220> <221> Termination <222> (7929)...(7957) <223> RRNB Terminator <400> 88 ttaacaaaaa agcaggaata aaattaacat gatgtaacag acataagtcc catcaccgtt 60 gtataatgtt aactgtggga ttgcaaaaga ggagattaat tcaatgtatc acattgatgt 120 gtttcgcatt ccctgtcata gccccggtga tacctctggc ctcgaagatt tgattgaaac 180 cggtcgtgtg gcccccgccg atattgtggc cgtgatgggt aaaaccgagg gtaatggctg 240 tgtgaatgat tatacccgg aatacgccac cgccatgctc gccgcctgtc tcggccgcca 300 cctccaactc cccccccatg aagtggaaaa acgggtggcc tttgtgatga gtggtggcac 360 cgaaggtgtg ctctcccccc accataccgt gtttgcccgt cgccccgcca ttgatgccca 420 ccgtcccgcc ggtaaacgtc tcaccctcgg cattgccttt acccgcgatt ttctccccga 480 agaaattggt cggcatgccc aaattaccga aaccgccggc gccgtgaaac gtgccatgcg 540 tgatgccggt attgccagta ttgatgatct ccactttgtg caagtgaaat gtcccctcct 600 caccccgcc aaaattgcct ccgcccgcag ccggggctgt gcccccgtga ccaccgatac 660 ctatgaatct atgggttaca gtcggggcgc ctccgccctc ggtattgccc tcgccaccga 720 agaagtgcc agttccatgc tcgtggatga aagtgtgctc aatgattggt ccctcagctc 780 tagtctcgcc tccgccagcg ccggcattga actcgaacac aatgtggtga ttgccattgg 840 tatgagtgaa caagccacct ccgaactcgt gattgcccac ggcgtgatga gcgatgccat 900 tgatgccgcc tctgtgcgcc ggaccattga aagcctcggt attcgctctg atgatgaaat 960 ggatcggatt gtgaatgtgt ttgccaaagc cgaagccagt cccgatggtg tggtgcgtgg 1020 tatgcgtcac accatgctct ctgatagtga tattaattcc acccgtcatg cccgtgccgt 1080 gaccggtgcc gccattgcca gcgtggtggg tcacggcatg gtgtacgtgt ctggcggtgc 1140 cgaacatcaa ggtcccgccg gtggtggtcc ctttgccgtg attgcccgtg cctaagtcaa 1200 gtaggagatt aattccatga tttatagtac cgtgaatgcc aatccctatg cctggcccta 1260 cgatggctcc attgatcccg cccacaccgc cctcatcctc atcgattggc aaatcgattt 1320 ttgtggtccc ggcggttatg tggatagtat gggctacgat ctcagcctca cccgctctgg 1380 cctcgaaccc accgcccgcg tgctcgccgc cgcccgcgat accggcatga ccgtgattca 1440 cacccgcgaa ggtcatcgtc ccgatctcgc cgatctcccc cccaataaac gttggcggag 1500 tgcctccgcc ggcgccgaaa ttggcagtgt gggtccctgt ggccgcattc tcgtgcgtgg 1560 tgaacccggt tgggaaattg tgcccgaagt ggccccccgc gaaggtgaac ccattattga 1620 taaacccggt aaaggtgcct tttatgccac cgatctcgat ctcctcctcc gcacccgcgg 1680 cattacccac ctcattctca ccggcattac caccgatgtg tgtgtgcata ccaccatgcg 1740 cgaagccaat gatcggggct acgaatgtct cattctctcc gattgtaccg gtgccaccga 1800 tcggaaacac catgaagccg ccctcagcat ggtgaccatg caaggcggtg tgtttggtgc 1860 caccgcccat tctgatgatc tcctcgccgc cctcggcacc accgtgcccg ccgccgccgg 1920 cccccgtgcc cgcaccgaat aatctaatag gagacaaata ctatgaccgt gagttccgat 1980 accaccgccg aaatttctct cggctggagt atccaagatt ggatcgattt tcacaaaagc 2040 tctagttccc aagcctccct ccgcctcctc gaatccctcc tcgatagcca aaatgtggcc 2100 cccgtggata atgcctggat ttccctcatt agcaaggaaa acctcctcca tcaatttcaa 2160 attctcaagt ctcgcgaaaa caaggaaacc ctccccctct atggtgtgcc cattgccgtg 2220 aaagataata ttgatgtgcg tggcctcccc accaccgccg cctgtcccag ttttgcctac 2280 gaaccctcta aagatagtaa agtggtggaa ctcctccgca atgccggcgc cattattgtg 2340 ggtaaacca atctcgatca atttgccacc ggcctcgtgg gcacccgcag tccctatggc 2400 aaaaccccct gtgccttttc caaagaacac gtgagcggcg gtagctctgc cggctccgcc 2460 agcgtggtgg cccgcggtat tgtgcccatt gccctcggca ccgataccgc cggctctggt 2520 cgggtgcccg ccgccctcaa taatctcatt ggcctcaaac ccaccaaggg tgtgtttagt 2580 tgtcaaggcg tggtgcccgc ctgtaaatct ctcgattgtg tgagtatttt tgccctcaat 2640 ctcagcgatg ccgaacgctg ttttcggatt atgtgtcaac ccgatcccga taatgatgaa 2700 tattcccgcc cctacgtgag caatcccctc aaaaaattta gttccaatgt gaccattgcc 2760 attcccaaaa atattccctg gtatggtgaa accaaaaatc ccgtgctctt ttccaatgcc 2820 gtggaaaatc tcagccggac cggcgccaat gtgattgaaa ttgattttga acccctcctc 2880 gaactcgccc gctgtctcta tgaaggcacc tgggtggccg aacgctatca agccattcaa 2940 tcttttctcg atagtaaacc ccccaaagaa tctctcgatc ccaccgtgat tagtatcatc 3000 gaaggtgcca aaaaatactc cgccgtggat tgttttagct ttgaatacaa acgccaaggc 3060 attctccaaa aagtgcgccg gctcctcgaa tccgtggatg tgctctgtgt gcccacctgt 3120 cccctcaatc ccaccatgca acaagtggcc gatgaacccg tgctcgtgaa tagccgccaa 3180 ggcacctgga ccaattttgt gaatctcgcc gatctcgccg ccctcgccgt gcccgccggt 3240 tttcgggatg atggcctccc caatggtatt accctcattg gcaaaaaatt taccgattat 3300 gccctcctcg aactcgccaa ccgctacttt caaaacatct ttcccaacgg ctcccggacc 3360 tatggcacct ttaccagctc tagtgtgaaa cccgccaatg atcaactcgt gggccccgat 3420 tacgatccct ctaccagtat taaactcgcc gtggtgggcg cccacctcaa aggcctcccc 3480 ctccattggc aactcgaaaa agtgaatgcc acctatctct gtaccaccaa aaccagcaaa 3540 gcctaccaac tctttgccct ccccaaaat ggtcccgtgc tcaaacccgg cctccgtcgt 3600 gtgcaagatt ccaatggtag ccaaattgaa ctcgaagtgt attccgtgcc caaagaactc 3660 tttggcgcct ttattagcat ggtgcccgaa cccctcggca ttggttctgt ggaactcgaa 3720 agtggcgaat ggatcaaatc ttttatttgt gaaaagtg gctacaaagc caaaggcacc 3780 gtggatatta ccaaatatgg cggtttttcgg gcctactttg aaatgctcta aattgattag 3840 gagatataca ccatgagcat ggaaacccac tcctatgttg atgttgcgat ccgtaacgcc cgtctcgccg ataccgaagg cattgttgat attctgattc atgatggtcg gattgccagc attgtgaat ccaccaaaac caaaggttcc gtggaaattg atgcccatga aggtctcgtg accagtggcc tcgtggaacc ccacattcat ctcgataaag ccctcaccgc cgatcgcgtg cccgccggta gtattggcga tctccggacc cgccggggtc tcgaaatggc cattcgcgcc 4140 acccgcgata ttaaacgcac ctttaccgtg gaagatgtgc gggaacgcgc cattcgggcc gccctcatgg ccagtcgcgc cggcaccacc gccctccgca cccatgtgga tgtggacccc 4260 attgtgggtc tcgccggtat tcggggcgtg ctcgaagccc gcgaagtgtg tgccggtctc 4320. attgatattc aaattgtggc ctttccccaa gaaggcctct tttgtagtgc cggtgccgtg gatctcatgc gggaagccat taaactcggt gccgatgccg tgggcggtgc ccccgccctc 4440 gatgatcgcc cccaagatca tgtgcgcgcc gtgtttgatc tcgccgccga atttggtctc cccgtggata tgcacgtgga tgaaagtgat cgccgggaag attttaccct cccctttgtg 4560 attgaagccg cccgcgaacg gcgcgtgccc aatgtgaccg tggcccacat ttcctctctc 4620 agtgtgcaaa ccgatgatgt ggcccgctcc accattgccg ccctcgccga tgccgatgtg 4680 aatgtggtgg tgaatcccat tattgtgaaa attacccgcc tctctgaact cctcgatgcc 4740 ggtgtgtctg tgatgtttgg ctccgataat ctccgcgatc ccttttatcc cctcggtgcc 4800 gccaatcccc tcggtagtgc catttttgcc tgtcaaattg ccgccctcgg caccccccaa 4860 gacctccgcc gggtgtttga tgccgtgacc attaatgccg cccgcatgct cggttttccc 4920 agtctcctcg gtgtggtgga aggtgccgtg gccgatctcg ccgtgtttcc cagtgccacc 4980 cccgaagaag tggtgctcga tcaacaaagt cccctctttg tgctcaaagg tggtcgggtc 5040 gttgcgatgc ggttagcggc gggtagcacc tcctttcgtg attattcgta atatacttag 5100 gagattcata cgatgatgag cggcgaacac accctcaaag ccgtgcgcgg ttcttttatt 5160 gatgtgaccc ggaccattga taatcccgaa gaaattgcca gcgccctccg ctttattgaa 5220 gatggcctcc tcctcattaa acagggtaaa gtggaatggt ttggcgaatg ggaaaatggt 5280 aaacaccaaa ttcccgatac cattcgcgtg cgggattatc ggggcaaact cattgtgccc 5340 ggttttgtgg atacccacat tcattatccc caaagtgaaa tggtgggcgc ctacggtgaa 5400 caactcctcg aatggctcaa taaacatacc tttcccaccg aacgccggta tgaagaatttg 5460 gaatacgcccc gcgaaatgtc cgcctttttc attaaaac tcctccggaa tggcaccacc 5520 accgccctcg tgtttggcac cgtgcatccc caaagtgtgg atgccctctt tgaagccgcc 5580 tcccatatta atatgcgcat gattgccggc aaagtgatga tggatcggaa tgccccccgat 5640 tatctcctcg ataccgccga aagttcctac caccaatcta aagaactcat tgaacgctgg 5700 cataaaaaatg gtcggctcct ctatgccatt accccccgtt ttgcccccac cagctctccc 5760 gaacaaatgg cgatggccca acggctcaaa gaagaatacc ccgatacctg ggtgcatacc 5820 catctctgtg aaaataaga tgaaattgcc tgggtgaaaa gcctctatcc cgatcacgat 5880 ggctacctcg atgtgtatca tcaatacggc ctcaccggta aaaattgtgt gtttgcccac 5940 tgtgtgcatc tcgaagaaaa agaatgggat cgcctctctg aaaccaaaag ttccattgcc 6000 ttttgtccca ccagcaatct ctatctcggc tctggcctct ttaatctcaa aaaagcctgg 6060 cagaaaaaag tgaaagtggg catgggcacc gatattggcg ccggcaccac ctttaatatg 6120 ctccaaaccc tcaatgaagc ctataaagtg ctccaactcc aaggctacag cctctctgcc 6180 tatgaagcct tttacctcgc caccctcggc ggtgccaaaa gtctcggcct cgatgatctc 6240 attggcaatt ttctccccgg taaagaagcc gattttgtgg tgatggaacc caccgccacc 6300 cccctccaac aactccgtta tgataatagt gtgtccctcg tggataaact ctttgtgatg 6360 atgaccctcg gcgatgatcg ctccatttat cggacctacg tggatggtcg cctcgtgtac 6420 gaacggaatt aagctagtta ggagattcag accatgcaaa ccctcagcat tcaacatggc 6480 accctcgtga cgatggatca atatcgccgg gtgctcggcg atagctgggt gcatgtgcaa 6540 gatggccgca ttgtggccct cggtgtgcat gccgaatctg tgcccccccc cgccgatcgt 6600 gtgattgatg cccgcggtaa agtggtgctc cccggtttta ttaatgccca tacccacgtg 6660 aatcaaattc tcctccgtgg tggtccctct cacggtcgcc aactctatga ttggctcttt 6720 aatgtgctct accccggcca aaaagccatg cgccccgaag atgtggccgt ggccgtgcgg 6780 ctctattgtg ccgaagccgt gcgcagtggt attaccacca ttaatgataa tgccgattcc 6840 gccatttacc ccggcaatat tgaagccgcg atggccgtgt atggcgaagt gggtgtgcgg 6900 gtggtgtacg cccgcatgtt tttcgatcgc atggatggcc ggattcaagg ttatgtggat 6960 gccctcaaag cccggagccc ccaagtggaa ctctgttcta ttatggaaga aaccgccgtg 7020 gccaaagatc ggattaccgc cctcagcgat caatatcacg gcaccgccgg tggccgcatt 7080 agtgtgtggc ccgcccccgc cattaccccc gccgtgaccg tggagggtat gcgttgggcc 7140 caagcctttg cccgcgatcg ggccgtgatg tggaccctcc acatggccga aagcgatcat 7200 gatgaacggc tccactggat gtctcccgcc gaatatatgg aatgttacgg cctcctcgat 7260 gaacgcctcc aagtggccca ctgtgtgtat tttgatcgca aagatgtgcg gctcctccat 7320 cgccacaatg tgaaagtggc cagtcaagtg gtgtccaatg cctacctcgg cagtggtgtg 7380 gcccccgtgc ccgaaatggt ggaacgtggc atggccgtgg gcattggcac cgatgatggt 7440 aattgtaatg attccgtgaa tatgattggc gatatgaaat ttatggccca tattcaccgg 7500 gccgtgcatc gcgatgtcga tgtgctcacc cccgaaaaaa ttctcgaaat ggccaccatt 7560 gatggcgccc gcagtctcgg tatggatcat gaaattggct ccattgaaac cggtaaacgg 7620 gccgatctca ttctcctcga tctccgccac ccccaaacca ccccccacca tcacctcgcc 7680 gccaccattg tgtttcaagc ctacggtaat gaagtggata ccgtgctcat tgatggcaat 7740 gtggtgatgg aaaatcgccg gctcagtttt ctcccccccg aacgggaact cgcctttctc 7800 gaagaagccc aaagtcgcgc caccgccatt ctccaacgcg ccaatatggt ggccaatccc 7860 gcctggcgca gcctctaaaa gggtgggcgc gccgacccag ctttcttgta caaactcggc 7920 cctgcaggag aaggccatcc tgacggatgg cctttttgaa gcttgaaa 7968 <210> 89 <211> 1011 <212> DNA <213> Artificial sequence <220> <223> Original ptxD sequence <400> 89 atgctgccga aactcgttat aactcaccga gtacacgatg agatcctgca actgctggcg 60 ccacattgcg agctgatgac caaccagacc gacagcacgc tgacgcgcga ggaaattctg 120 cgccgctgtc gcgatgctca ggcgatgatg gcgttcatgc ccgatcgggt cgatgcagac 180 tttcttcaag cctgccctga gctgcgtgta gtcggctgcg cgctcaaggg cttcgacaat 240 ttcgatgtgg acgcctgtac tgcccgcggg gtctggctga ccttcgtgcc tgatctgttg 300 acggtcccga ctgccgagct ggcgatcgga ctggcggtgg ggctggggcg gcatctgcgg 360 gcagcagatg cgttcgtccg ctctggcgag ttccagggct ggcaaccaca gttctacggc 420 acggggctgg ataacgctac ggtcggcatc cttggcatgg gcgccatcgg actggccatg 480 gctgatcgct tgcagggatg gggcgcgacc ctgcagtacc acgaggcgaa ggctctggat 540 acacaaaccg agcaacggct cggcctgcgc caggtggcgt gcagcgaact cttcgccagc 600 tcggacttca tcctgctggc gcttcccttg aatgccgata cccagcatct ggtcaacgcc 660 gagctgcttg ccctcgtacg gccgggcgct ctgcttgtaa acccctgtcg tggttcggta 720 gtggatgaag ccgccgtgct cgcggcgctt gagcgaggcc agctcggcgg gtatgcggcg 780 gatgtattcg aaatggaaga ctgggctcgc gcggaccggc cgcggctgat cgatcctgcg 840 ctgctcgcgc atccgaatac gctgttcact ccgcacatag ggtcggcagt gcgcgcggtg 900 cgcctggaga ttgaacgttg tgcagcgcag aacatcatcc aggtattggc aggtgcgcgc 960 ccaatcaacg ctgcgaaccg tctgcccaag gccgagcctg ccgcatgttg a 1011 <210> 90 <211> 1011 <212> DNA <213> Artificial sequence <220> <223> Codon-optimized ptxD <400> 90 atgctgccca aactggtcat cacccaccgc gtccatgatg aaattctgca gctgctggcc 60 ccgcactgtg agctgatgac caaccaaacc gatagcaccc tgacgcgcga agagatcctg 120 cgccgctgcc gcgatgctca ggccatgatg gcttttatgc ccgatcgcgt ggatgcggat 180 ttcctgcaag cttgtcccga actgcgcgtg gtgggttgtg ccctgaaggg ttttgataat 240 tttgatgtgg atgcctgcac ggcccgcggc gtgtggctga cctttgtccc cgatctgctg 300 accgtgccga ccgctgaact ggccattggc ctggcggtgg gtctgggtcg ccatctgcgc 360 gcggccgatg cgtttgtgcg cagcggcgag ttccagggtt ggcagcccca attctatggc 420 accggcctgg ataatgccac ggtgggcatc ctgggtatgg gtgctattgg cctggccatg 480 gctgatcgcc tgcagggttg gggcgccacc ctgcaatatc acgaagccaa agcgctggat 540 acgcaaacgg aacagcgcct gggtctgcgc caggtggctt gcagcgaact gtttgccagc 600 agcgatttca tcctgctggc cctgccgctg aacgcggata cccaacatct ggtcaatgct 660 gaactgctgg ctctggtgcg ccccggtgct ctgctggtca atccgtgtcg cggcagcgtg 720 gtggatgaag cggctgtgct ggccgctctg gagcgcggtc aactgggcgg ctacgccgcg 780 gatgtctttg aaatggagga ttgggctcgc gcggatcgcc cacgcctgat cgatcccgcc 840 ctgctggctc acccaaacac cctgttcacc ccgcatattg gcagcgccgt gcgcgcggtc 900 cgcctggaaa ttgagcgctg cgctgcccag aatatcattc aagtgctggc cggtgctcgc 960 cccattaacg ccgctaatcg cctgcccaag gccgaaccgg ccgcgtgcta g 1011 <210> 91 <211> 1011 <212> DNA <213> Artificial sequence <220> <223> Codon-optimized ptxD NADP+ <400> 91 atgctgccca aactggtcat cacccaccgc gtccatgatg aaattctgca gctgctggcc 60 ccgcactgtg agctgatgac caaccaaacc gatagcaccc tgacgcgcga agagatcctg 120 cgccgctgcc gcgatgctca ggccatgatg gcttttatgc ccgatcgcgt ggatgcggat 180 ttcctgcaag cttgtcccga actgcgcgtg gtgggttgtg ccctgaaggg ttttgataat 240 tttgatgtgg atgcctgcac ggcccgcggc gtgtggctga cctttgtccc cgatctgctg 300 accgtgccga ccgctgaact ggccattggc ctggcggtgg gtctgggtcg ccatctgcgc 360 gcggccgatg cgtttgtgcg cagcggcgag ttccagggtt ggcagcccca attctatggc 420 accggcctgg ataatgccac ggtgggcatc ctgggtatgg gtgctattgg cctggccatg 480 gctgatcgcc tgcagggttg gggcgccacc ctgcaatatc acgctcgtaa agcgctggat 540 acgcaaacgg aacagcgcct gggtctgcgc caggtggctt gcagcgaact gtttgccagc 600 agcgatttca tcctgctggc cctgccgctg aacgcggata cccaacatct ggtcaatgct 660 gaactgctgg ctctggtgcg ccccggtgct ctgctggtca atccgtgtcg cggcagcgtg 720 gtggatgaag cggctgtgct ggccgctctg gagcgcggtc aactgggcgg ctacgccgcg 780 gatgtctttg aaatggagga ttgggctcgc gcggatcgcc cacgcctgat cgatcccgcc 840 ctgctggctc acccaaacac cctgttcacc ccgcatattg gcagcgccgt gcgcgcggtc 900 cgcctggaaa ttgagcgctg cgctgcccag aatatcattc aagtgctggc cggtgctcgc 960 cccattaacg ccgctaatcg cctgcccaag gccgaaccgg ccgcgtgcta g 1011 <210> 92 <211> 61 <212> DNA <213> Artificial sequence <220> <223> psbA promoter <400> 92 gatctcaatg aatattggtt gacacgggcg tataagacat gttatactgt tgaataacaa 60 g 61 <210> 93 <211> 1236 <212> DNA <213> Artificial sequence <220> <223> ptxD operator <220> <221> promoter <222> (1)..(61) <223> psbA promoter <220> <221> Gene <222> (84)..(1091) <223> ptxD <220> <221> terminator <222> (1107)..(1194) <400> 93 gatctcaatg aatattggtt gacacgggcg tataagacat gttatactgt tgaataacaa 60 gactagatag tggaggtact agaatgctgc ccaaactggt catcacccac cgcgtccatg 120 atgaaattct gcagctgctg gccccgcact gtgagctgat gaccaaccaa accgatagca 180 ccctgacgcg cgaagagatc ctgcgccgct gccgcgatgc tcaggccatg atggctttta 240 tgcccgatcg cgtggatgcg gatttcctgc aagcttgtcc cgaactgcgc gtggtgggtt 300 gtgccctgaa gggttttgat aattttgatg tggatgcctg cacggcccgc ggcgtgtggc 360 tgacctttgt ccccgatctg ctgaccgtgc cgaccgctga actggccatt ggcctggcgg 420 tgggtctggg tcgccatctg cgcgcggccg atgcgtttgt gcgcagcggc gagttccagg 480 gttggcagcc ccaattctat ggcaccggcc tggataatgc cacggtgggc atcctgggta 540 tgggtgctat tggcctggcc atggctgatc gcctgcaggg ttggggcgcc accctgcaat 600 atcacgaagc caaagcgctg gatacgcaaa cggaacagcg cctgggtctg cgccaggtgg 660 cttgcagcga actgtttgcc agcagcgatt tcatcctgct ggccctgccg ctgaacgcgg 720 atacccaaca tctggtcaat gctgaactgc tggctctggt gcgccccggt gctctgctgg 780 tcaatccgtg tcgcggcagc gtggtggatg aagcggctgt gctggccgct ctggagcgcg 840 gtcaactggg cggctacgcc gcggatgtct ttgaaatgga ggattgggct cgcgcggatc 900 gcccacgcct gatcgatccc gccctgctgg ctcacccaaa caccctgttc accccgcata 960 ttggcagcgc cgtgcgcgcg gtccgcctgg aaattgagcg ctgcgctgcc cagaatatca 1020 ttcaagtgct ggccggtgct cgccccatta acgccgctaa tcgcctgccc aaggccgaac 1080 cggccgcgtg ctagttaaac ctcagcggtt tagtgaccga ctaacacttt tctcataaaa 1140 tcccagggag gtttcggcct cccttttttt cacttgctaa gctctctttc gtttgattgt 1200 ctgacttggt tcacgtagaa aaaccagaag ggacgc 1236 <210> 94 <211> 1443 <212> DNA <213> Artificial sequence <220> <223> pSJ051 <220> <221> RBS <222> (5)..(10) <220> <221> gene <222> (19)..(1443) <223> triA gene sequence <400> 94 agttaggaga ttcagaccat gcaaacgctc agcatccagc acggtaccct cgtcacgatg 60 gatcagtacc gcagagtcct tggggatagc tgggttcacg tgcaggatgg acggatcgtc 120 gcgctcggag tgcacgccga gtcggtgcct ccgccagcgg atcgggtgat cgatgcacgc 180 ggcaaggtcg tgttacccgg tttcatcaat gcccacaccc atgtgaacca gatcctcctg 240 cgcggagggc cctcgcacgg gcgtcaactc tatgactggc tgttcaacgt tttgtatccg 300 ggacaaaagg cgatgagacc ggaggacgta gcggtggcgg tgaggttgta ttgtgcggaa 360 gctgtgcgca gcgggattac gacgatcaac gacaacgccg attcggccat ctacccaggc 420 aacatcgagg ccgcgatggc ggtctatggt gaggtgggtg tgagggtcgt ctacgcccgc 480 atgttctttg atcggatgga cgggcgcatt caagggtatg tggacgcctt gaaggctcgc 540 tctccccaag tcgaactgtg ctcgatcatg gaggaaacgg ctgtggccaa agatcggatc 600 acagccctgt cagatcagta tcatggcacg gcaggaggtc gtatatcagt ttggcccgct 660 cctgccatta ccccggcggt gacagttgaa ggaatgcgat gggcacaagc cttcgcccgt 720 gatcgggcgg taatgtggac gcttcacatg gcggagagcg atcatgatga gcggcttcat 780 tggatgagtc ccgccgagta catggagtgt tacggactct tggatgagcg tctgcaggtc 840 gcgcattgcg tgtactttga ccggaaggat gttcggctgc tgcaccgcca caatgtgaag 900 gtcgcgtcgc aggttgtgag caatgcctac ctcggctcag gggtggcccc cgtgccagag 960 atggtggagc gcggcatggc cgtgggcatt ggaacagatg acgggaattg taatgactcc 1020 gtaaacatga tcggagacat gaagtttatg gcccatattc accgcgcggt gcatcgggat 1080 gcggacgtgc tgaccccaga gaagattctt gaaatggcga cgatcgatgg ggcgcgttcg 1140 ttgggaatgg accacgagat tggttccatc gaaaccggca agcgcgcgga ccttatcctg 1200 cttgacctgc gtcaccctca gacgactcct caccatcatt tggcggccac gatcgtgttt 1260 caggcttacg gcaatgaggt ggacactgtc ctgattgacg gaaacgttgt gatggagaac 1320 cgccgcttga gctttcttcc ccctgaacgt gagttggcgt tccttgagga agcgcagagc 1380 cgcgccacag ctattttgca gcgggcgaac atggtggcta acccagcttg gcgcagcctc 1440 tag 1443 <210> 95 <211> 35 <212> DNA <213> Artificial sequence <220> <223> RF_ptxD_F <400> 95 ggcgccaccc tgcaatatca cgctcgtaaa gcgct 35 <210> 96 <211> 34 <212> DNA <213> Artificial sequence <220> <223> RF_ptxD_R <400> 96 ccgtttgcgt atccagcgct ttacgagcgt gata 34

Claims

1. An isolated genetically engineered cyanobacterium, wherein, The cyanobacteria have been transformed with at least one polynucleotide molecule; the at least one polynucleotide molecule includes a heterologous melamine utilization pathway gene operatively linked to at least one promoter. atzD , trzE , DUR1,2 , trzC , guaD and triA ,in; i) The above triA The gene encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 58, 60, 62, 64, and 66; or ii) The triA Genes have the characteristics of AG G AGA to AG A The AGA mutation forms the ribosome binding site RBS, which encodes the amino acid sequence shown in SEQ ID NO: 56, or iii) The above triA Genes have the characteristics of AG G AGA to AG A The AGA mutation forms the ribosome binding site RBS, which encodes the amino acid sequence shown in SEQ ID NO:

68. The genetically engineered cyanobacteria do not possess heterologous antibiotic resistance genes.

2. The isolated genetically engineered cyanobacteria according to claim 1, wherein... triA The gene comprises a polynucleotide sequence selected from the group consisting of: SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69 and SEQ ID NO:

70.

3. The isolated genetically engineered cyanobacterium according to claim 1, wherein the heterologous gene... trzE Including the polynucleotide sequence shown in SEQ ID NO: 71 or SEQ ID NO: 72; trzC Including the polynucleotide sequence shown in SEQ ID NO: 73 or SEQ ID NO: 74; DUR1,2 Including the polynucleotide sequence shown in SEQ ID NO: 75 or SEQ ID NO: 76; atzD Including the polynucleotide sequence shown in SEQ ID NO: 77 or SEQ ID NO: 78; guaD This includes the polynucleotide sequences shown in SEQ ID NO: 79, SEQ ID NO: 80, or SEQ ID NO:

81.

4. The isolated genetically engineered cyanobacterium according to claim 1, wherein, Each of the genes in the melamine utilization pathway has a ribosome binding site (RBS).

5. The isolated genetically engineered cyanobacteria according to claim 1, wherein, The at least one promoter is a constitutive promoter.

6. The isolated genetically engineered cyanobacteria according to claim 5, wherein, The constitutive promoter is P trc P psbA P cpcB P cpt or P c223 Promoter.

7. The isolated genetically engineered cyanobacterium according to claim 1, wherein, The heterologous melamine utilization pathway gene is expressed from a single promoter as part of a gene operon.

8. The isolated genetically engineered cyanobacterium according to claim 7, wherein, The gene operon polynucleotide sequence is selected from the group consisting of: SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87 and SEQ ID NO:

88.

9. The isolated genetically engineered cyanobacterium according to claim 1, wherein, The at least one polynucleotide molecule further comprises: a heterologous phosphite dehydrogenase operably linked to a promoter. ptxD Gene polynucleotides.

10. The isolated genetically engineered cyanobacterium according to claim 9, wherein... ptxD The gene includes the polynucleotide sequence shown in SEQ ID NO: 89, SEQ ID NO: 90 or SEQ ID NO:

91.

11. The isolated genetically engineered cyanobacterium according to claim 9, wherein the heterologous phosphite dehydrogenase ptxD Genes are expressed from a single promoter, as part of a gene operon, in which... The operon polynucleotide sequence is shown in SEQ ID NO:

93.

12. The isolated genetically engineered cyanobacteria according to any one of claims 1 to 11, further comprising: This includes exogenous polynucleotides that can be expressed as RNA and / or protein products.

13. The isolated genetically engineered cyanobacteria according to any one of claims 1 to 11, wherein, The cyanobacterium in question is Synechococcus.

14. A recombinant vector comprising a melamine pathway gene operatively linked to at least one promoter. triA , DUR1,2 , atzD , trzC , trzE and guaD ,in i) triA The gene encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 58, 60, 62, 64, and 66; or ii) The triA Genes have the characteristics of AG G AGA to AG A The AGA mutation forms the ribosome binding site RBS, which encodes the amino acid sequence shown in SEQ ID NO: 56, or iii) The triA Genes have the characteristics of AG G AGA to AG A The AGA mutation forms the ribosome binding site RBS, which encodes the amino acid sequence shown in SEQ ID NO:

68. in, The vector lacks the antibiotic resistance gene.

15. The recombinant vector according to claim 14, wherein, The triA The gene comprises a polynucleotide sequence selected from the group consisting of: SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69 and SEQ ID NO:

70.

16. The recombinant vector according to claim 14, wherein, The heterologous gene trzE Including the polynucleotide sequence shown in SEQ ID NO: 71 or SEQ ID NO: 72; trzC Including the polynucleotide sequence shown in SEQ ID NO: 73 or SEQ ID NO: 74; DUR1,2 Including the polynucleotide sequence shown in SEQ ID NO: 75 or SEQ ID NO: 76; atzD Including the polynucleotide sequence shown in SEQ ID NO: 77 or SEQ ID NO: 78; guaD This includes the polynucleotide sequences shown in SEQ ID NO: 79, SEQ ID NO: 80, or SEQ ID NO:

81.

17. The recombinant vector according to claim 14, wherein, Each of the genes for the melamine utilization pathway has a ribosome binding site (RBS).

18. The recombinant vector according to claim 14, wherein, The at least one promoter is a constitutive promoter.

19. The recombinant vector according to claim 18, wherein, The constitutive promoter is P trc P psbA P cpcB P cpt or P c223 Promoter.

20. The recombinant vector according to claim 14, wherein, The heterologous melamine utilization pathway gene is expressed from a single promoter as part of a gene operon.

21. The recombinant vector according to claim 20, wherein, The gene operon polynucleotide sequence is selected from the group consisting of: SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87 and SEQ ID NO:

88.

22. The recombinant vector according to claim 14, wherein, The at least one polynucleotide molecule further comprises: a heterologous phosphite dehydrogenase operably linked to a promoter. ptxD Gene polynucleotides.

23. The recombinant vector according to claim 22, wherein, The ptxD The gene includes the polynucleotide sequence shown in SEQ ID NO: 89, SEQ ID NO: 90 or SEQ ID NO:

91.

24. The recombinant vector according to any one of claims 14 to 23, further comprising: This includes exogenous polynucleotides that can be expressed as RNA and / or protein products.

25. A method for expressing a product in genetically engineered cyanobacterial cells, comprising the steps of: a) Culturing multiple genetically engineered cyanobacterial cells according to any one of claims 1 to 8 in an antibiotic-free culture medium with melamine as the nitrogen source, wherein, The process involves cultivating cyanobacterial cells that promote the metabolism of melamine; and wherein the engineered cyanobacterial cells further comprise: at least one exogenous polynucleotide encoding an expressible polynucleotide that encodes RNA and / or a protein product. b) Culture the genetically engineered cyanobacterial cells under conditions suitable for expressing the product.

26. A method for expressing a product in genetically engineered cyanobacterial cells, comprising the steps of: a) Culturing multiple genetically engineered cyanobacterial cells according to any one of claims 9 to 11 in a culture medium free of antibiotics, with melamine as the nitrogen source and phosphite as the phosphorus source, wherein, The process involves cultivating cyanobacterial cells that promote the metabolism of melamine and phosphite; wherein the engineered cyanobacterial cells further comprise: at least one exogenous polynucleotide encoding an expressible polynucleotide that encodes RNA and / or a protein product. b) Culture the genetically engineered cyanobacterial cells under conditions suitable for expressing the product.

27. The method according to claim 25 or 26, wherein, The culture medium contains at least 2 mM of melamine.

28. The method of claim 25 or 26, further comprising isolating the product expressed in the genetically engineered cyanobacterial cells.

Images