Actinobacillus pleuropneumoniae and use thereof

Abstract

The application belongs to the technical field of molecular biology, and provides an actinobacillus pleuropneumoniae and application thereof, the actinobacillus pleuropneumoniae is named as actinobacillus pleuropneumoniae SDHG-1, and the preservation number is CCTCC NO:M 2021204. The actinobacillus pleuropneumoniae SDHG-1 provided in the embodiment of the application is a viscous actinobacillus pleuropneumoniae strain of serum 12 type, the surface polysaccharide is relatively rich, the transcription level of a gene related to synthesis of extracellular matrix polysaccharide can be improved, it is a potential polysaccharide expression system candidate strain and vaccine candidate strain, has wide application potential, and can become one of important tools for effectively preventing and controlling porcine infectious pleuropneumonia.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and in particular relates to a type of Actinobacillus pleuropneumoniae and its applications. Background Technology

[0002] Porcine contagious pleuropneumonia, also known as necrotizing pleuropneumonia, is a highly contagious and fatal respiratory infectious disease caused by Actinobacillus pleuropneumoniae (APP). Pigs of all ages are susceptible, but it commonly affects growing and adult pigs, characterized primarily by acute hemorrhagic fibrinous pneumonia and chronic fibrinous necrotizing pleuritis. With the increasing scale and intensification of pig farming, the incidence of this disease is showing an explosive trend. The morbidity and mortality rates of the acute form are both around 50%, with the mortality rate of the most acute form reaching 80%–100%, posing an increasingly serious threat to the pig farming industry. In recent years, the clinical isolation rate of APP has been increasing annually. It often co-infects with other pathogens such as Haemophilus parasuis, Pasteurella multocida, Streptococcus suis, Escherichia coli, porcine circovirus, and porcine reproductive and respiratory syndrome virus, causing porcine respiratory syndrome (PRDC), weakening the pig's lung defense function and increasing the difficulty of treatment. Furthermore, this disease is prevalent in many pig-farming countries and has become one of the five major infectious diseases in industrialized pig farming worldwide. Therefore, the prevention and control of porcine infectious pleuropneumonia is of great significance to the healthy development of the pig industry.

[0003] In recent years, researchers have focused on using strains with unique biological characteristics as vectors to express various exogenous antigens or modifying them to prevent major human and animal infectious diseases, particularly studying the immunogenicity of polysaccharides. Due to the large number of APP serotypes—18 have been reported to date—and the lack of effective cross-immunoprotection between different serotypes, the development of multivalent vaccines has been severely hampered, making the prevention of this disease extremely difficult. Constructing attenuated strains using genetic engineering methods and utilizing them as live vectors to express exogenous antigens for the development of multivalent vaccines have become research hotspots in this field. Currently, the vaccines available on the market for preventing APP infection are mainly trivalent inactivated vaccines, which offer poor cross-protection against multiple circulating strains. Summary of the Invention

[0004] The purpose of this invention is to provide Actinobacillus pleuropneumoniae, which aims to solve the problems mentioned in the background art.

[0005] The present invention is implemented as follows: Actinobacillus pleuropneumoniae SDHG-1, with accession number CCTCC NO:M 2021204, was deposited on March 4, 2021, at the China Center for Type Culture Collection (depository address: China Center for Type Culture Collection, Wuhan University, Wuhan, Hubei Province, China).

[0006] Another objective of this invention is to provide the application of the above-mentioned Actinobacillus pleuropneumoniae in expressing extracellular matrix polysaccharides.

[0007] In a preferred embodiment of the present invention, the extracellular matrix polysaccharide is a glucose polymer.

[0008] As another preferred embodiment of the present invention, the extracellular matrix polysaccharide is poly-1,6-N-acetyl-D-glucosamine (PGA).

[0009] As a preferred embodiment of the present invention, the Actinobacillus pleuropneumoniae is used to increase the transcription level of genes related to the synthesis of extracellular matrix polysaccharides.

[0010] In a preferred embodiment of the present invention, the extracellular matrix polysaccharide synthesis-related genes include pgaA, pgaB, pgaC, and pgaD; the nucleotide sequence of pgaA is shown in SEQ ID NO:1; the nucleotide sequence of pgaB is shown in SEQ ID NO:2; the nucleotide sequence of pgaC is shown in SEQ ID NO:3; and the nucleotide sequence of pgaD is shown in SEQ ID NO:4.

[0011] Another objective of this invention is to provide the application of the above-mentioned Actinobacillus pleuropneumoniae in the preparation of a drug for the prevention and treatment of porcine infectious pleuropneumonia.

[0012] Another objective of this invention is to provide the application of the above-mentioned Actinobacillus pleuropneumoniae in the preparation of a vaccine for immunizing Actinobacillus pleuropneumoniae.

[0013] As a preferred embodiment of the present invention, the vaccine has cross-immunoprotective effects against different serotypes of Actinobacillus pleuropneumoniae.

[0014] Studies have shown that APP exotoxins play an important role in its pathogenesis and immunity, with exotoxins Apx I and Apx II playing a key role in APP virulence, while Apx IV is highly conserved.

[0015] The Actinobacillus pleuropneumoniae SDHG-1 strain provided in this embodiment of the invention is a serotype 12 viscositic Actinobacillus pleuropneumoniae strain that can simultaneously secrete Apx I, Apx II, and Apx IV, and has abundant surface polysaccharides. It can improve the transcription level of genes related to the synthesis of extracellular matrix polysaccharides, making it a good candidate strain for polysaccharide expression systems and vaccines. It has great application potential and can become one of the important tools for the effective prevention and control of porcine infectious pleuropneumonia. Attached Figure Description

[0016] Figure 1 This is a graph showing the growth characteristics of SDHG-1 in BHI medium.

[0017] Figure 2 Image showing Gram staining results for SDHG-1;

[0018] Figure 3 The image shows the PCR identification results of SDHG-1.

[0019] Figure 4 Image showing the results of SDHG-1 serotype identification;

[0020] Figure 5 The figure shows the transcriptional levels of PGA synthesis-related genes pgaA, pgaC, rpoE, and hns in SDHG-1 relative to L20.

[0021] Figure 6 The graph shows the mouse survival rate results;

[0022] Figure 7 The image shows the results of antibody titers in mouse serum. Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0024] In one embodiment of the present invention, a *Actinomyces pleuropneumoniae* bacterium is provided, named *Actinomyces pleuropneumoniae* SDHG-1, with accession number CCTCC NO:M 2021204, and deposited on March 4, 2021, at the China Center for Type Culture Collection (accession address: China Center for Type Culture Collection, Wuhan University, Wuhan, Hubei Province, China).

[0025] In another embodiment of the present invention, the use of the above-mentioned Actinobacillus pleuropneumoniae in expressing extracellular matrix polysaccharides is provided.

[0026] Specifically, Actinobacillus pleuropneumoniae SDHG-1 can be used as a vector for expressing extracellular matrix polysaccharides.

[0027] In a preferred embodiment of the present invention, the extracellular matrix polysaccharide is poly-1,6-N-acetyl-D-glucosamine (PGA).

[0028] In a preferred embodiment of the present invention, the Actinobacillus pleuropneumoniae is used to increase the transcriptional level of genes related to the synthesis of extracellular matrix polysaccharides.

[0029] Specifically, the genes related to the synthesis of extracellular matrix polysaccharides include pgaA, pgaB, pgaC, and pgaD; the nucleotide sequence of pgaA is shown in SEQ ID NO:1; the nucleotide sequence of pgaB is shown in SEQ ID NO:2; the nucleotide sequence of pgaC is shown in SEQ ID NO:3; and the nucleotide sequence of pgaD is shown in SEQ ID NO:4.

[0030] In another embodiment of the present invention, the use of the above-mentioned Actinobacillus pleuropneumoniae in the preparation of a vaccine for immunizing Actinobacillus pleuropneumoniae is provided.

[0031] Specifically, the vaccine has cross-immune protection against different serotypes of Actinobacillus pleuropneumoniae. For example, the vaccine has immune protection against serotype 12 APP and also has good cross-immune protection against serotype 1 APP and other bacteria.

[0032] Furthermore, the practical application of the above technical solutions can be referenced in the following experimental examples, but is not limited to these.

[0033] Experimental Example

[0034] I. Experimental Methods

[0035] 1. Bacterial isolation and purification: Freshly collected aseptic lung tissue samples were streaked onto BHI (brain and heart infusion agar) plates containing NAD (nicotinamide adenine dinucleotide) using an inoculation loop and incubated at 37°C for 24 hours. Single colonies with significant morphological differences were selected, isolated, cultured, and purified again for further identification. The purified bacteria were then Gram-stained and their morphology was observed under a microscope.

[0036] 2. Biochemical identification of bacteria: Prepare 1 mL of bacterial suspension (OD) according to the operating instructions of the VTTEK2 Compact bacterial identification instrument. 600≈0.8) In a 1.5 mL centrifuge tube, insert the suspension pipette of the Gram-negative bacteria identification card into the plastic tube for biochemical reaction detection to determine the type of isolated strain.

[0037] 3. Bacterial PCR and Serotype Identification: DNA was extracted from the APP isolate SDHG-1 according to the bacterial DNA extraction kit procedure and used as a template for PCR amplification using 16S rRNA universal primers. PCR amplification conditions: pre-denaturation 94℃ for 3 min, denaturation 94℃ for 30 s, annealing 56℃ for 30 s, extension 72℃ for 90 s, 30 cycles, 72℃ for 15 min, and storage at 4℃. 10 μL of PCR product was identified by 1.0% agarose gel electrophoresis. The PCR product was sequenced at Jilin Kumei Biotechnology Co., Ltd., and the sequencing results were compared with the NCBI database for homology analysis.

[0038] 4. Following the above method, amplification was performed using APP-specific primers for serum type 12 (as shown in Table 1). After electrophoresis, the PCR products were sequenced and compared to determine the serotype.

[0039] Table 1 Primer sequence information

[0040]

[0041] 4. Transcriptional Level Detection of PGA Synthesis-Related Genes pgaA, pgaC, rpoE, and hns in APP SDHG-1 and L20 (existing non-adhesive APPs). Bacterial surface polysaccharides include LPS (lipopolysaccharide), CPS (capsular polysaccharide), and PGA (poly-1,6-N-acetyl-D-glucosamine, extracellular matrix polysaccharide). LPS is primarily associated with bacterial adhesion and virulence; CPS possesses good antigenicity and is commonly used for serotype identification, and is also an important virulence factor; PGA is a major component and essential element of the APP biofilm matrix, and a key substance leading to the formation of "adhesive" bacterial colonies. Genes pgaA and pgaC play a major role in PGA synthesis. pgaA promotes PGA polymerization, while pgaC contains a cytosolic glycosyltransferase domain responsible for transport. rpoE and hns are transcriptional activators of pgaA, pgaB, pgaC, and pgaD, and inhibitors of biofilm formation, respectively. Total RNA was extracted from SDHG-1 and L20 bacterial cultures, reverse transcribed into cDNA, and then used as a template. The transcription levels of pgaA, pgaC, rpoE, and hns were detected by qRT-PCR using the corresponding primers in Table 1 (with recombinase F and recF as housekeeping genes).

[0042] 5. Preparation of immunogens

[0043] (1) Inactivated vaccine: Actinobacillus pleuropneumoniae isolate SDHG-1 was placed in BHI liquid medium and cultured in a shaker at 37°C until the logarithmic growth phase (OD2). 600 ≈1.0), at which point the bacterial concentration is 5.5×10⁻⁶. 11 CFU / mL. Formaldehyde was added to a final concentration of 0.2%, and the bacterial suspension was inactivated at 37°C for 16 hours. 200 μL was then plated onto a BHI plate to test the inactivation effect. The completely inactivated SDHG-1 was then mixed with aluminum gel saline adjuvant at a ratio of 16:1 (V / V) to prepare the immunogen.

[0044] (2) Attenuated strain: SDHG-1 highly expresses extracellular polysaccharides, exhibiting good immunogenicity. The polysaccharides can also provide protection as immune adjuvants. It has weak pathogenicity, with an LD50 of 7.1 × 10⁻⁶ in Kunming mice. 9 CFU, as an attenuated strain, offers good safety; its preparation requires no inactivation, is simple, and has high production efficiency. These characteristics indicate that SDHG-1 is a promising candidate attenuated vaccine strain, capable of providing multivalent protection through direct immunization, constructing attenuated strains lacking virulence factors, or constructing recombinant attenuated strains expressing other pathogen gene fragments with good immunogenicity.

[0045] 6. Animal Immunization and Challenge: Twenty 18-22g ICR mice were randomly divided into four groups of five each. Mice in each group were immunized subcutaneously at multiple sites on their backs with the SDHG-1 inactivated vaccine at 0, 14, and 28 days. In groups 1 and 3, each mouse was immunized with 0.2 mL of inactivated SDHG-1 immunogen (containing 2 × 10⁻⁶ mmol / L). 11 Mice in groups 2 and 4 were immunized with 0.2 mL PBS. On day 35, mice in groups 1 and 2 were intranasally infected with 30 μL APP SDHG-1, and mice in groups 3 and 4 were intranasally infected with 30 μL serum type 1 APP (S4074 strain). The survival rate of mice in each group was observed.

[0046] 7. Vaccine efficacy trials

[0047] Blood was collected from the tail vein of mice in each group at 0, 14, 28, and 35 days post-immunization. The serum was separated and stored at -80℃. The changes in serum antibody titers in each group of mice were detected by indirect ELISA using serum APP type 1 and APP isolate SDHG-1 as coating antigens, respectively.

[0048] II. Experimental Results:

[0049] 1. Results of bacterial isolation and identification:

[0050] After incubation at 37°C for 14 hours on BHI solid medium, uniform, translucent, smooth, moist, white, round colonies (APP SDHG-1) with a diameter of approximately 1 mm grew. These colonies were quite sticky. Figure 1 As shown. Gram staining observation under a microscope. Figure 2 It appears as a short, Gram-negative rod, and often clumps in liquid culture medium.

[0051] 2. Biochemical identification results:

[0052] The APP SDHG-1 can ferment and decompose various sugar alcohols, including glucose, lactose, mannitol, mannose, maltose, and sucrose, producing acidic substances and gases. It is positive for urease and phosphatase, which is consistent with the characteristics of APP. The specific results are shown in Table 2.

[0053] Table 2 Biochemical identification results of SDHG-1

[0054]

[0055] 3. Results of PCR identification and serotype identification of Actinobacillus pleuropneumoniae isolates:

[0056] PCR amplification using universal 16S rRNA primers revealed the target band at approximately 1400 bp, consistent with the expected size (e.g., ...). Figure 3 (As shown). PCR product sequencing results, after BLAST alignment, showed it to be APP, with a homology of 99.98%. Amplification of the cps12 gene using serum APP type 12 specific primers resulted in a 347 bp band (as shown). Figure 4 As shown in the figure, it is in line with expectations; its sequencing results show 100% homology with serum APP type 12 strain 1096. The above results prove that SDHG-1 is APP type 12.

[0057] 4. Transcriptional levels of PGA synthesis-related genes pgaA, pgaC, rpoE, and hns in APP SDHG-1 and L20 are as follows: Figure 5 As shown in the figure. The results showed that the transcription levels of pgaA, pgaC, and rpoE in SDHG-1 were significantly higher than those in the non-sticky strain APP L20, while the transcription level of the biofilm formation inhibitor hns showed no significant change. These results indicate that the expression levels of mRNA related to PGA synthesis in SDHG-1 cells are significantly higher than those in L20, suggesting that this strain highly expresses extracellular matrix polysaccharides and is suitable as a candidate strain for a genetic engineering expression system.

[0058] 5. The survival rates of mice in each group are as follows: Figure 6 As shown. Figure 6In this context, IBPBS-C1 refers to PBS immunization followed by serotype 1 APP infection; IBSDHG-1-CSDHG-1 refers to SDHG-1 inactivated vaccine immunization followed by SDHG-1 infection.

[0059] Figure 6 The results showed significant differences between the SDHG-1 inactivated vaccine immunization group and the PBS immunization group. Within 24 hours of challenge, all mice in group 2 died, while only one mouse in group 1 died; within 48 hours, one mouse in group 3 died, while three mice in group 4 died. These results indicate that immunization with the SDHG-1 inactivated vaccine provides strong protection for the mice and offers some cross-immune protection against serum type 1 APP. The specific protective efficacy results of the inactivated vaccine are shown in Table 3.

[0060] Table 3 Results of the protective efficacy of inactivated vaccines

[0061]

[0062] 6. Serum antibody titer test results as follows Figure 7 As shown. Among them, IBSDHG-1-APP1: Antibodies against APP1 are produced in the serum of mice immunized with SDHG-1 inactivated vaccine; IBSDHG-1-SDHG-1: Antibodies against SDHG-1 are produced in the serum of mice immunized with SDHG-1 inactivated vaccine. Figure 7 The results showed that antibodies against serum APP type 1 and SDHG-1 could be detected simultaneously in mice in the SDHG-1 inactivated immunization group, with antibody titers reaching their peak on day 35, while unimmunized mice did not have antibodies against serum APP type 1 and SDHG-1.

[0063] In summary, the transcription levels of pgaA, pgaC, and rpoE, genes related to the synthesis of the extracellular polysaccharide PGA, in the APP strain SDHG-1 were significantly higher than those in the "non-sticky" strain L20, suggesting that the bacterial cell surface is richly expressed with PGA, making it suitable as a vector for modification in gene engineering expression systems. Furthermore, immunization of mice with the SDHG-1 inactivated vaccine protected them from infection with serum APP type 12 and provided good cross-immune protection against APP type 1 infection.

[0064] It should be noted that PGA is a major component and essential element of the APP biomembrane matrix, encoded by the pgaA, pgaB, pgaC, and pgaD operons, with pgaA and pgaC playing a major role in PGA synthesis. The above results indicate that the transcriptional levels of pgaA and pgaC in SDHG-1 are significantly higher than those in the L20 strain. Although the transcriptional levels of pgaB and pgaD were not detected, due to the holistic nature of pgaABCD and the necessity of their functional coordination, pgaA, pgaB, pgaC, and pgaD are all within the scope of protection of this invention.

[0065] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims. sequence list <110> Jilin University <120> Actinobacillus pleuropneumoniae and its application <160> 18 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2429 <212> DNA <213> Actinobacillus pleuropneumoniae <400> 1 atggagataa aatttaattc tttagcgctt tgtctattat ctacaacgtt cctcaatact 60 gctttggcca atgcatcgcc gatagatata aagcgggaag aaattgtgat tttttctcgt 120 caaggagaca gccaattaac acaagcgatt tctcaactat ctgatttata taaaaaaaca 180 ggtgatagaa aagttagaga cgatttaatc gcattaatga tgcgaaaagg cgaatttaag 240 catgcgatta atgtttgtgc agattgtaat attaatcatt tttccgaaag tgaattggaa 300 aatttagcca aggcgtatcg taattagtaaa gacttcccta aagcacttca gttatataga 360 aaattaagtc aaaaatatcc taataatccg aacggtttat taggaagcag cttggttgaa 420 gttgaactaa gtaaatatgc ggatgcgaaa aaacatctta cgcaatataa aagtaaaattc 480 ggcgcagata atagttatcg agaggcatct aattattac tggatcatac cgaaccgaat 540 ctttcaaaat taggtcgttg gcatcaacaa ttacaagccg aacctaactc tgaacttgcc 600 ttaaaacttt atcgtctggc aacgaaatta aatgtacttc ccattcaatc cgaattagtt 660 aaacgttatc cgaatttatt ttctcaaaaa gatttaaatt ggttggaaca tggtcaagta 720 atatcttcaa ttaaaggaga cgataattta aaaatgtctg ggttaaagtc cggatatatg 780 cgtctgacaa atatcatcga ttcgctggaa caagataatc ctttatatcg ccaagcggtt 840 caagatcgca tgatattagc gaataaaatg aataataagg cgctcgtaat aaaagattac 900 gagattctga aatccttgaa tcaggaaatg ccgaattatg tgcaagaggc ttatgccgat 960 atgctgttaa aagacggttc gccgtttaaa gcattagaaa tttatcaaa attagccgaa 1020 tcggaacagg cgaataataa gcatataagt acggccttat tattaatt atcaatgcg 1080 tcaagcgatg cgggttattt tgaacaggct CAatatatc aagatcaat taagagagt 1140 aaaaaattt gggattttac cagagaact cgcctatta atcctatta tgagcaagca 1200 ttctatagcc aagtcaattt acatattgg agaggcaata aatcaaagc ggttgccgtg 1260 ttagaagatc gtttaactaa ttgactccg ggtgatcctt gggcaatgtt ggcattaagc 1320 gatttggaat cgtccagaaa taaccatgac cgagcaacg tttagtgga taaagcaagc 1380 cagttcttag gtaggatca agcgctctat aaacatcaa gtgcgaat cgccttaat 1440 caggaattt tcgctaggc ttcaatt atcgaagtt atcggcgga agaaaaagaa 1500 tcggcggaag cggtcttgaa gcgatacgat gaagccagaa gaggcggtttt taccccatca 1560 ttcggtattt ctcatcaac ggcgcctagt ataagcaga gtaatgaatt tagtcaggaa 1620 tattatta attcggcaa aactaccgaa gggcattacg cttatgtgca ttattcggag 1680 gataaagtac cgaccgaagg ggaagtgctt aagcaacgta gaatcggtgc cggtagttat 1740 ctgaatttct ttccgtttaa ccttacgctt gaagcgggta aggggattaa attaaatgaa 1800 aaaggatatg tttcggtaaa ttccggttac gtattgaacg aaaactggaa gtttgaactg 1860 tccggtaata ttaacggcag ctcgaccccg attaaagcga taaatcaaaa agtttatacc 1920 aaagatatcg gattcggcac cacttatacc tatcgagatc ttgtgcaagt gggaaccggt 1980 gtgaatgcaa tgaagtttga tgacgataat atgcgtaagt cattctattt atgggcgtct 2040 tcacaaacgt tccaacacga tcgctgggcg ttgaacaacg gtattcgttt tgattatcag 2100 cgtaataaaa acattgcgtc cgcttggtat tataacccgg ataaaagtcg aaatatcgaa 2160 ttcagtacgg atttaagtta tcgccaaccg atgaattacg ggctggtttt aacccaccat 2220 ttaaagggtt tggtcgggaa atataagcaa caaaatcata aagccgaaca ttcatgggcg 2280 gttagttacg gacatgactg gcgtattacc aaaaaaatca atttatctta tgaaatcggt 2340 cgtaagaaaa atatttatga cggtgcggcc gaatttaata actacggtaa cgtgaatttt 2400 tcgtattctt tttaatttag gtaataaca <210> 2 <211> 1781 <212> DNA <213> Anti-inflammatory strain (Actinobacillus pleuropneumoniae) <400> 2 atgatattta aaaaatttag tcgaataatt atcgcttgtt tgtcttttttt atcaataaac gtattggcga father tagcgtattg gcttaccatt ccgttgtcga tgaaagtgcg cccaaagata aaagattata tgtctcgcag acgatttctt ccgatcaatt aatcgcgcat 240. tttaattggt ttaaaagtca aggatataac attgtaagct ggcaacaaat tgttgatgct gaaaagggga aaaccaaact tccgaataaa gcggtattac tgtctttcga tgacggttat gaaacgatgt atagcgttat ttaatccgcta ttaaaggctt ataactatcc ggcggtcttt gcgcccgttt caagttggat tagcacgccg atgggacaaa aaatccaata cggtaatgaa aaactggatc gcgagaaatt ctttgcgact tggcaacaaa tcgatgaaat gcaaaacagc 480 ggtttagttg aaattgcctc gcacactcat gatttacacc acggtataaa agcaaatccc 540 ggcggtagcc agctggcggc gatgattgcg ccggaataca aaaacggtaa atacgaaacg gaagaacaat ataaatcccg tattctgaat gatatgaaaa tatcttccgg acttattaag 660 aaacacacgg gcaaagcgcc gcaaattatg gtttggcctt atggcgcttt taccgaaaca 720 780 aatcgtgtcg gcgatgcgca tgtaggacgt tttctcgttg atgcggaatc taatttctcc 840 gtaatggcac gttatttgaa tcgagtggcg gatacggata acgaatcctt tgtacagaga 900 aaattacata ttaatttaga cttcgtatat agtccggatc cgattaagtt taaggcgaat 960 tacgatgcct tgattagtaa tgtcgctaa tacggcgtaa cggcggtgta cttaaaagcg 1020 1080 ccggtaagag cggatatttt tagtcaggtg gcttggcaat tacgtacgcg tgccggggtg 1140 aaagtttata cgtggatgcc ggcttcgctc gagagcttac ctgagaattt acgtcaagtg 1200 aatgtgatgc aatcgcttta ccgagattta tcgctttatt caaaacgga cggattattc 1260 tttgacagca aaatcggcaa acataaatgg atcgataatt cgaaagaaac gatggcgctg 1320 acgaaattgt ggacggaagc ggcggaacct tacttcttct ttaatcgata tacgcaaaga 1380 atttccagaa atattcaccc gttagatacg aattttactc aaaatttagt cgagtttagt 1440 aagaattacg acagtatttt aattgaggtg cgcccttatt cgttaggcgg tgtgacgact 1500 aagcaggaag ctaaaattg gttatcgat atcgttcagc gagtgaaaga ttctaatgtt 1560 gagaagaaac tgattttatt cgatttctcg gtagtgaatc ccaaaacatc ggaaaatcta 1620 tcgtcggaag agttgatcag ctggattaaa ttattagaaa aacatcaaat aataagtttc 1680 ggttattacc cgaatagata tttatttgat gaaaaaatgc tgcaaaaaat gaaaccttat 1740 gtttcaagta atagagatat cacaaggaag taggcggata t 1781 <210> 3 <211> 1237 <212> DNA <213> Actinobacillus pleuropneumoniae <400> 3 atgattctag aaatattcag tttatttgta tttgcttatc cggcggtaat ggcattttat 60 tgggcttttg cagggcttac atatttttta tttaaagaaa agttaaaagt accgccgaat 120 tttgatcaaa tgaagcatga agaagtaccg ttagtcagct taatggtgcc ttgctataac 180 gaatcggata acttagacga agcgattccg catttgctca atctaaaata tccgaattac 240 gaactgattt ttattaatga cggcagtaaa gatcataccg gagagattat cgataagtgg 300 gcgaaaagag ataagcgcat cgttgcgtta caccaagcga actccggtaa agccagcgcg 360 ttaaataacg gtctgcgaat cgcaagaggt aagtatgtcg gttgcataga cggtgatgcg 420 gtattggatt acaaggcgtt ggattatatg gtgcaggcgt tggaatctaa tcctcgatac 480 ggtgcggtga ccggtaatcc gcgagtacgt aatcgaagca cgattttagg acgcttacaa 540 gtgtccgaat tcagctcgat tatcggttta attaaacgtg cgcaatgttt aatgggaacc 600 atctttaccg tgtcgggcgt gtgttgttta ttcagaaaag acataatgtt cgagatcggc 660 ggttggagta cgaacatgat tacggaagat attgacgtca gttggaaaat ccaaacgtct 720 ggttatgaca tcttctacga accgagagcg ctatgctggg tattgatgcc ggaaaccata 780 aacggtctgt ttaaacaacg tcttcgttgg gcgcaaggcg gtgcggaaac catgatgaaa 840 tattttccgc aaatttggcg ttaaaaaat cgccgttgt ggccgatgtt tatcgaatat 900 attgtgaccg caatttgggc gtcgttactt ttagtttcaa ttttactgag tatatataac 960 ctgatctttg ataccaaat cggtttgttg gattgggccg agttaaacc gagcattgcg 1020 atactgttta tcgcttttt cactcatta agtatcagtc ttatatcga taatcgctat 1080 gaaaaaggcg tagtgaaata tgcattttct tgtatttggt atccttggct gtattggagc 1140 ctaaatacga ctactttact gtgcggtatc ccgaagcga ttttccgaa taaaaccaaa 1200 ttagcggtat ggaccagtcc tgatagagga gtttaat 1237 <210> 4 <211> 285 <212> DNA <213> Actinobacillus pleuropneumoniae (Actinobacillus pleuropneumoniae) <400> 4 atgtcggtgc aaaattaca gaaattaatg attackaca aaactaaca actcggttgg 60 tggattcgtt taaaagctt gtttatcact tgggcacttg gttagtgatg 120 gcatttatga tttggcaata tcgaaacagc cttttagatt caccggtcat tgatatttat 180 tatatcggag aggttatattct gtttatcttt gccgtggtgt ttactttgat ctttttgacg 240 gtgtgttggt cgtatctggc taaaagtcgc cataaaaaac cttaa 285 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 agagtttgat cmtggctcag 20 <210> 6 <211> twenty two <212> DNA <213> Artificial Sequence <400> 6 tacggytacc ttgttacgac tt 22 <210> 7 <211> twenty four <212> DNA <213> Artificial Sequence <400> 7 taaaggtatt ataacgccgg ctct 24 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <400> 8 ctcccatctg ttgtctaagt agtag 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <400> 9 tataccgagttttatagctg ttggg 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <400> 10 aaactgacag gttttctcaa tttcc 25 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <400> 11 caagcattct atagccaagt caatttacat 30 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <400> 12 acccggagtc aaattagtta aacga 25 <210> 13 <211> twenty one <212> DNA <213> Artificial Sequence <400> 13 gattccgcat ttgctcaatc t 21 <210> 14 <211> twenty two <212> DNA <213> Artificial Sequence <400> 14 caataccgca tcaccgtcta tg 22 <210> 15 <211> twenty three <212> DNA <213> Artificial Sequence <400> 15 gggaagacgt cctcctaaag aag 23 <210> 16 <211> twenty one <212> DNA <213> Artificial Sequence <400> 16 ttgaccccca acatcaaagc t 21 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <400> 17 gtcatggaag gactaaagaa atataaggag tt 32 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <400> 18 cttgtgttcc gtggcattat tcaat 25

Claims

1. A type of Actinobacillus pleuropneumoniae, characterized in that, The Actinobacillus pleuropneumoniae was named Actinobacillus pleuropneumoniae (… Actinobacillus pleuropneumoniae SDHG-1, with accession number CCTCC NO:M 2021204.

2. The application of Actinobacillus pleuropneumoniae as described in claim 1 in the expression of extracellular matrix polysaccharides, characterized in that, The extracellular matrix polysaccharide is poly(1,6-N-acetyl-D-glucosamine).

3. The application of Actinobacillus pleuropneumoniae according to claim 2 in the expression of extracellular matrix polysaccharides, characterized in that, The Actinobacillus pleuropneumoniae is used to increase the transcription level of extracellular matrix polysaccharide synthesis-related genes; the extracellular matrix polysaccharide synthesis-related genes include pgaA and pgaC; the nucleotide sequence of pgaA is shown in SEQ ID NO:1 of the sequence listing; the nucleotide sequence of pgaC is shown in SEQ ID NO:3 of the sequence listing.

4. The use of Actinobacillus pleuropneumoniae as described in claim 1 in the preparation of a medicament for the prevention and treatment of infectious pleuropneumonia in pigs.

5. The use of Actinobacillus pleuropneumoniae as described in claim 1 in the preparation of a vaccine for immunizing Actinobacillus pleuropneumoniae.

6. The application of Actinobacillus pleuropneumoniae according to claim 5 in the preparation of a vaccine for immunizing against Actinobacillus pleuropneumoniae, characterized in that, The vaccine provides cross-immunoprotection against serotypes 1 and 12 of Actinobacillus pleuropneumoniae.

Images