A Pichia pastoris auxotroph strain that improves human lysozyme yield and activity

Abstract

This invention provides a Pichia pastoris auxotrophic strain for improving the yield and activity of human lysozyme, comprising the following steps: plasmid construction, starting strain construction, knockout plasmid construction, single knockout strain construction, and positive clone screening. The selected strain is Pichia pastoris, and the knocked-out gene is VPS10 and / or VPS10-2Δ. The processed strain obtained by this invention has high yield and enzyme activity, which can significantly improve the current situation of severely insufficient yield and enzyme activity of human lysozyme.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a Pichia pastoris auxotroph strain that improves the yield and activity of human lysozyme. Background Technology

[0002] Lysozyme has attracted widespread attention as a novel antimicrobial peptide due to its antibacterial, antiviral, and immune-enhancing properties. Unlike traditional antibiotics, lysozyme hydrolyzes the β-1,4 glycosidic bonds in bacterial cell walls, disrupting the cell wall structure and causing bacterial lysis and death, thus eliminating concerns about bacterial tolerance. Furthermore, lysozyme effectively kills microorganisms while protecting itself from damage, leading to its widespread application in animal husbandry, the food industry, and clinical medicine. It has also drawn the attention of the World Health Organization and the Food and Agriculture Organization.

[0003] Lysozyme, also known as muramidase or N-acetylmuramide glycanohydrlase, is an alkaline enzyme that hydrolyzes the mucopolysaccharides in bacteria. Lysozymes can be classified into C-type, G-type, and P-type. Human lysozyme belongs to the C-type, composed of 130 amino acids, with a relative molecular weight of 14,700. Compared to other types of lysozymes, human lysozyme has advantages such as high enzyme activity and high thermostability, and it is an endogenous protein in the human body. However, due to limitations in raw material availability and purification costs, the production volume of human lysozyme cannot meet the needs of various fields. Currently, there are several methods for producing human lysozyme using eukaryotic or prokaryotic hosts, but the enzyme activity and yield remain unsatisfactory. Summary of the Invention

[0004] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.

[0005] In view of the problems existing in the above and / or existing lysozyme production methods, the present invention is proposed.

[0006] Therefore, one of the objectives of this invention is to overcome the shortcomings of existing lysozyme production methods and provide a Pichia pastoris auxotroph strain that improves the yield and activity of human lysozyme.

[0007] To solve the above-mentioned technical problems, according to one aspect of the present invention, the present invention provides the following technical solution: a Pichia pastoris auxotroph strain for improving the yield and activity of human lysozyme, characterized by comprising the following steps:

[0008] Plasmid construction: Select the target gene and insert it into the Pichia pastoris secretory plasmid to construct the target plasmid containing the target gene.

[0009] Construction of the starting strain: The target plasmid was electroporated into Pichia pastoris, and high-copy strains were screened as the starting strains;

[0010] Knockout plasmid construction: Design the gRNA corresponding to the knockout gene and the corresponding primer, and insert the gRNA into the plasmid to form the defect plasmid;

[0011] Construction of single knockout strains: The Pichia pastoris genome was extracted, and the primers upstream and downstream of the knockout gene were fused together to prepare donner DNA. Then, the defective plasmid and donner DNA were transferred into competent cells by electroporation.

[0012] Screening for positive clones: PCR verification and purification of positive transformants.

[0013] As a preferred embodiment of the Pichia pastoris auxotroph strain for improving human lysozyme yield and activity according to the present invention, the method further includes the following steps: selecting purified positive transformants obtained from positive clone screening, and then obtaining double knockout strain positive transformants through single knockout strain construction and positive clone screening, wherein the knockout genes are not the same in the first and second single knockout strain construction.

[0014] As a preferred embodiment of the Pichia pastoris auxotroph strain for improving human lysozyme yield and activity according to the present invention, wherein: in the construction of the first single knockout strain and the construction of the second single knockout strain, the gene knocked out in the first knockout is VPS10-1Δ and the gene knocked out in the second knockout is VPS10-2Δ, or the gene knocked out in the first knockout is VPS10-2Δ and the gene knocked out in the second knockout is VPS10-1Δ.

[0015] As a preferred embodiment of the Pichia pastoris auxotrophic strain for improving human lysozyme yield and activity according to the present invention, the plasmid is the Pichia pastoris methanol-induced secretion plasmid pPIC9K.

[0016] As a preferred embodiment of the Pichia pastoris auxotrophic strain for improving human lysozyme yield and enzyme activity according to the present invention, wherein: Pichia pastoris is Pichia pastoris GS115.

[0017] As a preferred embodiment of the Pichia pastoris auxotrophic strain for improving human lysozyme yield and activity according to the present invention, wherein the gene knocked out in the single knockout strain construction is VPS10-1Δ or VPS10-2Δ.

[0018] As a preferred embodiment of the Pichia pastoris auxotroph strain for improving human lysozyme yield and activity according to the present invention, wherein the gene knocked out in the single knockout strain construction is VPS10-2Δ.

[0019] As a preferred embodiment of the Pichia pastoris auxotroph strain for improving human lysozyme yield and activity according to the present invention, wherein the sgRNA-VPS10-1 sequence corresponding to VPS10-1Δ is GCAGGAGGTTATTACACCTG.

[0020] As a preferred embodiment of the Pichia pastoris auxotroph strain for improving human lysozyme yield and activity according to the present invention, wherein the sgRNA-VPS10-2 sequence corresponding to VPS10-2Δ is GCCATCATGGTAGACAACGC.

[0021] As a preferred embodiment of the Pichia pastoris auxotroph strain for improving the yield and activity of human lysozyme according to the present invention, wherein: the plasmid, Donner DNA and competent cells are electroporated and placed in an electroporation cup and left to stand for 5 minutes, and then transferred into competent cells by electroporation.

[0022] The technical solution provided by this invention has the following advantages compared with other technical solutions in this field:

[0023] This invention successfully knocked out the VPS10 gene in Pichia pastoris using CRISPR / Cas9 technology, providing two Pichia pastoris strains that significantly increase the yield and activity of human lysozyme. This solves the problem of low yield and high demand for human lysozyme. Furthermore, the development of these strains facilitates the industrial application of Pichia pastoris and provides a new approach for using Pichia pastoris as a host to produce exogenous proteins. Attached Figure Description

[0024] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein:

[0025] Figure 1 These are nucleic acid detection images of the gene knockout strains in Examples 2 and 3 of this invention;

[0026] Figure a shows the control between the strain obtained in Example 2 and the original strain. In Figure a, VPS10-1Δ is the agarose gel electrophoresis image of the single knockout strain VPS10-1Δ obtained in Example 2, and GS115 is the agarose gel electrophoresis image of the original strain without knockout. Figure b shows the control between the strain obtained in Example 3 and the original strain. In Figure b, VPS10-2Δ is the agarose gel electrophoresis image of the single knockout strain VPS10-2Δ obtained in Example 3, and GS115 is the agarose gel electrophoresis image of the original strain without knockout.

[0027] Figure 2 Images of the upstream and downstream primers used in Examples 2 and 3, and agarose gel electrophoresis images of DNA Donor;

[0028] Figure a shows agarose gel electrophoresis images of the upstream and downstream primers and DNA Donor used in Example 2, where M is the Marker, 1 is the upstream primer, 2 is the downstream primer, and 3 is the DNA Donor. Figure b shows agarose gel electrophoresis images of the upstream and downstream primers and DNA Donor used in Example 3, where M is the Marker, 1 is the upstream primer, 2 is the downstream primer, and 3 is the DNA Donor.

[0029] Figure 3 The images show the nucleic acid detection results of the products obtained in Examples 2 and 3 and the original strain.

[0030] In the figure, 1 is the original strain, 2 is the VPS10-1Δ knockout strain obtained in Example 2, and 3 is the VPS10-2Δ knockout strain obtained in Example 3.

[0031] Figure 4 Images of inhibition zone experiments performed on the products of the VPS10-1Δ single knockout strain from Example 2, the VPS10-2Δ single knockout strain from Example 3, the original strain, and the PS10-1ΔVPS10-2Δ double knockout strain from Example 4, along with a 2 wU / mL standard and buffer solution.

[0032] Figure 5 Images of inhibition zone experiments performed on the products of the VPS10-1Δ single knockout strain from Example 2, the VPS10-2Δ single knockout strain from Example 3, the original strain, and the PS10-1ΔVPS10-2Δ double knockout strain from Example 4, along with a 2 wU / mL standard and buffer solution.

[0033] In the figure, 1 is a buffer sample, 2 is a standard, 3 is the original strain product, 4 is the VPS10-1Δ single knockout strain of Example 2, 5 is the VPS10-2Δ single knockout strain obtained in Example 3, and 6 is the product of the PS10-1Δ VPS10-2Δ double knockout strain obtained in Example 4. Figure 6 The enzyme activity of lysozyme produced by the GS115 / Hlyz, VPS10-1△, VPS10-2△, VPS10-1△, and VPS10-2△ strains prepared in the examples is measured. Detailed Implementation

[0034] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0035] Many specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.

[0036] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that is mutually exclusive with other embodiments.

[0037] Example 1

[0038] Primers F1 and R1 were designed to insert the codon-optimized human lysozyme (hLYZ) gene into the Pichia pastoris methanol-induced secretory plasmid pPIC9K. EcoR1 and Not1 The plasmid pPIC9K-hLYZ was constructed using the restriction enzyme sites.

[0039] After linearizing the plasmid pPIC9K-hLYZ using the Sal1 restriction site, the hLYZ gene was inserted into the genome of Pichia pastoris GS115 by electroporation at a voltage of 15000V and a resistance of 200 ohms. 1 ml of 1M / L D-sorbitol was quickly added, and the mixture was pre-cultured in a shaker at 30℃ for 2 h before being plated on MD plates. High-copy strains were screened using YPD plates with a high concentration of G418 (3 mg / ml) to select high-copy strains as the starting strain GS115 / hLYZ.

[0040] The target gene is VPS10. There are two VPS10 genes, located on chromosome 2 and chromosome 3, respectively. Their gRNAs are sgRNA-VPS10-1:GCAGGAGGTTATTACACCTG and sgRNA VPS10-2:GCCATCATGGTAGACAACGC. Four universal primers were designed based on these two genes: A-sgRNA-R, B-sgRNA-R, C-sgRNA-R, and D-sgRNA_F. Four specific primers were designed: sgRNA-VPS10-1-F / R and sgRNA-VPS10-2-F / R. The gRNAs were inserted into the pCas9 plasmid through the Bpi1 site to obtain the pCas9-sgRNA-VPS10-1 and pCas9-sgRNA-VPS10-2 plasmids.

[0041] Example 2

[0042] The genome of Pichia pastoris GS115 was extracted, and primers VPS10-1-upper F / R and VPS10-1-lower F / R were designed. 1000 bp upstream and downstream of the VPS10 gene were fused together to form a 2000 bp donor DNA for gene knockout. Using GS115 / hLYZ as the starting strain, 1 ng of plasmid and 5 ng of donor DNA were placed in an electroporation cuvette with 80 μl of competent cells and incubated for 5 min. The cells were then electroporated at 15000 V and 200 ohms. 1 ml of 1 M / L D-sorbitol was quickly added, and the cells were pre-cultured at 30°C on a shaker for 2 h. The culture was then plated onto YPD plates containing hygromycin and grown for 2-3 days.

[0043] Primers VPS10-1-1300-F / R were designed at 1300 bp upstream and downstream of the target gene. Positive clones were initially screened using colony PCR. The screening criteria were: using primers at 1300 bp upstream and downstream of the target gene, a PCR result of 2600 bands was considered a positive transformant; a result of 2600 plus 5400 bands of the target gene was considered a failure. The genome of this single clone was then extracted, and PCR was performed again using the same primers. The PCR product was then sent to a sequencing company for sequencing. Finally, the VPS10-1Δ single knockout strain was obtained.

[0044] Example 3

[0045] The genome of Pichia pastoris GS115 was extracted, and primers VPS10-2-upper F / R and VPS10-2-lower F / R were designed to fuse 1000 bp upstream and downstream of the VPS10 gene together, totaling 2000 bp, as the gene knockout donner DNA. Using GS115 / hLYZ as the starting strain, 1 ng of plasmid and 5 ng of donner DNA were placed in an electroporation cuvette with 80 μl of competent cells and incubated for 5 min. Then, the cells were electroporated at 15000 V and 200 ohms. 1 ml of 1 M / L D-sorbitol was quickly added, and the cells were pre-cultured at 30 °C on a shaker for 2 h. The cells were then plated on YPD plates containing hygromycin and grown for 2-3 days.

[0046] Primers VPS10-2-1300-F / R were designed at 1300 bp upstream and downstream of the target gene. Colony PCR was used to initially screen for positive clones. The screening criteria were: using primers at 1300 bp upstream and downstream of the target gene, a PCR result of 2600 bands was considered a positive transformant; a result of 2600 plus 5400 bands of the target gene was considered a failure. The genome of this single clone was then extracted, and PCR was performed again using the same primers. The PCR product was then sent to a sequencing company for sequencing. Finally, the VPS10-2Δ single knockout strain was obtained.

[0047] Example 4

[0048] Primers VPS10-2-1300-F / R were designed at 1300 bp upstream and downstream of the target gene in the VPS10-1Δ knockout strain obtained in Example 2. Positive clones were initially screened using colony PCR. The genome of the single clone was then extracted, and PCR was performed again using the same primers. The PCR products were then sent to a sequencing company for sequencing. Finally, the VPS10-2Δ knockout strain was obtained.

[0049] Primers VPS10-2-upper F / R and VPS10-2-lower F / R were designed to fuse 1000 bp upstream and downstream of the VPS10 gene, totaling 2000 bp, as the gene knockout donor DNA. Using GS115 / hLYZ as the starting strain, 1 ng of plasmid and 5 ng of donor DNA were added to 80 μl of competent cells and placed in an electroporation cuvette for 5 min. The mixture was then electroporated into the competent cells at 15000 V and 200 ohms. 1 ml of 1 M / L D-sorbitol was quickly added, and the mixture was pre-cultured at 30°C on a shaker for 2 h. The resulting inoculum was then plated onto YPD plates containing hygromycin and grown for 2-3 days.

[0050] Primers VPS10-2-1300-F / R were designed at 1300 bp upstream and downstream of the target gene. Colony PCR was used to initially screen for positive clones. The screening criteria were: using primers at 1300 bp upstream and downstream of the target gene, a PCR result of 2600 bands was considered a positive transformant; a result of 2600 plus 5400 bands of the target gene was considered a failure. The genome of this single clone was then extracted, and PCR was performed again using the same primers. The PCR product was then sent to a sequencing company for sequencing. Finally, the PS10-1ΔVPS10-2Δ double knockout strain was obtained.

[0051] Example 5

[0052] The knockout strains obtained in Examples 2 and 3 were subjected to nucleic acid analysis after gene knockout. The resulting agarose gel electrophoresis images are shown below. Figure 1 As shown.

[0053] Depend on Figure 1 It can be seen that the nucleic acid after gene knockout in our invention is reduced compared to the original GS115 gene. The gene knockout method used in our invention is a reliable gene knockout method. The gene before knockout is 10000bp. The results of the two single knockouts both show a trend of gene size reduction.

[0054] The primers designed in Examples 2 and 3 were subjected to agarose gel electrophoresis, and the resulting images are as follows: Figure 2 As shown, it can be confirmed that both upstream and downstream primers are 1000bp in size, and that the upstream and downstream primers can be connected, resulting in a 2000bp ligation.

[0055] The original strain and the single knockout strains prepared in Examples 2-3 were subjected to nucleic acid detection, and the resulting images are shown below. Figure 3 As shown, Figure 3 Due to the edge effect, it can be vaguely inferred that the nucleic acid sequences of Examples 2 and 3 are identical to those of the original strain. Figure 3 b clearly shows that the single knockout strains obtained in Examples 2 and 3 of our invention have the same nucleic acid sequence as the original strain.

[0056] Example 6

[0057] The gene knockout strains obtained in Examples 2, 3, and 4 were cultured with the original strains in YPD medium for 12 hours, then transferred to BMGY medium and cultured for 24 hours until the OD600 reached 15. The cultures were then resuspended in BMGY medium, with 0.5% methanol added every 12 hours. An inhibition zone experiment was performed, with standards and the original strain product added as controls. The enzyme activity of the corresponding products of the strains obtained in each example was determined. The results of the inhibition zone experiment are shown below. Figure 4 and Figure 5 As shown.

[0058] Depend on Figure 4 and Figure 5 As can be seen from the figure, the inhibition zone of the single knockout strain prepared in Example 3 is the largest, the inhibition zone of the single knockout strain prepared in Example 2 is the second largest, the standard is the third largest, the original strain is the fourth largest, and the double knockout strain is the fifth largest. The control group with buffer solution has no inhibition zone.

[0059] The enzyme activity of the products from the gene knockout strains obtained in Examples 2, 3, and 4, and the original strains, was determined. The enzyme activity determination method was as follows: Micrococcus lysate was resuspended in phosphate buffer with an OD450 of 0.7. 2.9 mL of the bacterial suspension was added to 0.1 mL of diluted fermentation broth. Each decrease of 0.001 μL was considered 1 U of enzyme activity. The results were recorded in [the table / document / etc.]. Figure 6 middle.

[0060] Depend on Figure 6 The data shows that the enzyme activity of the original strain GS115 / hLYZ was 16400U, the enzyme activity of the single knockout strain prepared in Example 2 was 36400U, the enzyme activity of the single knockout strain prepared in Example 3 was 39300U, and the enzyme activity of the double knockout strain prepared in Example 4 was 4950U. The single knockout method in Examples 2 and 3 has a significant effect on improving the enzyme activity of the product, with the enzyme activity of the product in Example 3 being the highest.

[0061] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention. sequence list <110> Jiangnan University <120> A Pichia pastoris auxotroph strain that improves human lysozyme yield and activity <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 15 <212> DNA <213> Artificial Sequence <400> 1 gcaggaggaa caccg 15 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 gccatcatgg tagacaacgc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 gcaggaggtt attacacctg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 gcaggaggtt attacacctg 20

Claims

1. A Pichia pastoris deficient strain for improving the production and enzyme activity of human lysozyme, characterized in that The method for constructing the Pichia pastoris auxotype strain includes the following steps: Plasmid construction: Select the target gene and insert it into the Pichia pastoris secretory plasmid to construct the target plasmid containing the target gene; The target gene is human lysozyme, and the plasmid is Pichia pastoris methanol-induced secretory plasmid pPIC9K. Starting strain construction: The target plasmid was electroporated into Pichia pastoris, and high-copy strains were screened as starting strains; Knockout plasmid construction: Design the gRNA corresponding to the knockout gene and the corresponding primers, and insert the gRNA into the plasmid to construct the defect plasmid; Construction of single knockout strains: Pichia pastoris genome was extracted, and primers upstream and downstream of the knockout gene were fused together to prepare donner DNA. Then, the defective plasmid and donner DNA were transferred into competent cells by electroporation. The gene knocked out in the single knockout strain construction is VPS10-2△, and the gRNA is the sgRNA-VSP10-2 corresponding to VSP10-2△, with the sequence GCCATCATGGTAGACAACGC. Positive clone screening: PCR verification and purification of positive transformants; The Pichia pastoris is Pichia pastoris GS115.

2. The Pichia pastoris deficient strain for improving the yield and enzyme activity of human lysozyme according to claim 1, characterized in that The electroporated plasmid, Donner DNA, and competent cells were placed in an electroporation cuvette and left to stand for 5 minutes before being transferred into competent cells by electroporation.

Images