New antigen engineering using splicing modulating compounds

Abstract

The present invention relates to the field of immunotherapy and vaccine treatment of diseased cells by enhancing the immune response against said diseased cells. In the context of the present invention, this is accomplished by engineering novel antigens in cells via oligonucleotide-mediated production of aberrant RNA transcripts that, when transcribed into said cells, result in the production or increase of aberrant polypeptide expression. Extracellular presentation of these polypeptides, and derived peptide fragments, provides antigenic epitopes (neoantigens) for detection by the immune system.

Description

Technical Field

[0001] This invention relates to the field of immunotherapy and vaccine treatment of diseased cells by enhancing the immune response to diseased cells. In the context of this invention, this is accomplished by engineering neoantigens in cells by modulating RNA transcripts, for example through splicing regulation or RNA editing, such as through oligonucleotide-mediated production of aberrant RNA transcripts, which, when transcribed into the cells, result in the production or increase of aberrant polypeptide expression. The extracellular presentation of these polypeptides, or derived peptide fragments, provides antigenic epitopes (neoantigens) for detection by the immune system. The methods of this invention can be combined with the use of vaccines or immunotherapeutic agents to stimulate the immune system to recognize neoantigens. Background Technology

[0002] RNA-modified oligonucleotides, such as splice-regulating antisense oligonucleotides, are among the first antisense compounds approved for the treatment of genetic diseases such as Duchenne muscular dystrophy and spinal muscular atrophy. Instead of degrading RNA targets, RNA-modified oligonucleotides modify RNA transcripts to produce transcript variants that can encode altered peptides compared to unmodified RNA transcripts.

[0003] RNA-modifying oligonucleotides include splice-modifying oligonucleotides or RNA-editing oligonucleotides, which alter the splicing of target precursor mRNA and which can introduce insertions, deletions, or substitutions (such as A to G substitutions), and can therefore be used, for example, to modify or insert start and stop codons to produce transcript variants encoding altered polypeptides.

[0004] Recently, antisense oligonucleotides have been developed that recruit endogenous human ADAR (adenosine deaminase acting on RNA) in a simple and programmable manner to edit endogenous transcripts (Merkle et al., Nat Biotechnol. 2019 Feb; 37(2):133-138).

[0005] Several important biological processes are under the control of alternative splicing. Up to 95% of all human multi-exon genes undergo alternative splicing, producing proteins that may have different functions (Matlin et al., Nat Rev MolCell Biol. 2005; 6(5):386-98; et al., Nat Genet. 2008; 40(12):1413-5). For example, BCLX isoforms are anti-apoptotic and pro-apoptotic (Revil et al., Mol Cell Biol. 2007; 27(24):8431-41). Therefore, it is crucial for cells to tightly regulate and control the activity of alternative splicing. However, as previously reported, antisense oligonucleotides can be used to precisely perturb splicing to produce alternative or novel mRNA isoforms with the desired function, see, for example, Graziewicz et al., Mol Ther. 2008; 16(7):1316-22.

[0006] Vormehr et al., doi:10.1038 / nature14426 (Abstract), reported that mutant MHC class II epitopes drive therapeutic immune responses to cancer. Kahles et al., Cancer Cell 34,1–14,2018, presented a comprehensive analysis of alternative splicing in tumors from 8,705 patients.

[0007] Sahin and Tureci, Science 359, 1355–1360 (2018), reviewed the technology for personalized cancer vaccines for cancer immunotherapy: “Cancer is characterized by the accumulation of genetic alterations. Somatic mutations can generate cancer-specific novel epitopes that are recognized as foreign by the patient’s own T cells and constitute ideal targets for cancer vaccines. Each tumor has its unique mutational composition, and only a small fraction of mutations are shared among patients. Advances in genomics, data science, and cancer immunotherapy now enable the rapid localization of mutations in the genome, the rational selection of vaccine targets, and the on-demand generation of therapies for individual patient tumors.”

[0008] Sahin et al., Nature, Vol. 547, pp. 222–226 (July 13, 2017), reported that personalized RNA mutant vaccines mobilized multispecific therapeutic immunity against cancer.

[0009] Neon Therapeutics is developing neoantigen therapies based on unique cancer epitope peptides, see, for example, Pa et al., Nature. 2017 Jul 13; 547(7662):217-221.

[0010] Biontech is using mRNA technology for cancer immunotherapy.

[0011] These methods require characterizing a patient's tumor gene expression and epitope display before selecting or developing a vaccine or immunotherapy agent. This is expensive and time-consuming, and either requires developing patient-specific therapies or limiting the possibility of treating certain cancers based on the cancer treatment spectrum of already approved agents.

[0012] Therefore, there is a need for treatments using immunotherapy or cancer vaccines that are independent of the tumor's endogenous epitope characteristics, and thus can be used to treat a broader patient population than current cancer vaccines or immunotherapies. In the method of this invention, this is achieved by modifying peptide epitopes (engineered epitopes) in cancer cells or tumor cells.

[0013] This invention provides a novel use of splice-regulating oligonucleotides or RNA-editing oligonucleotides for molecularly targeted immunomodulation, enabling more effective and widespread application in cancer treatment. The novel concept of regulating splicing events in RNA transcripts or editing RNA transcripts (producing aberrant transcripts) allows for the "genetic labeling" of tumor cells with neoantigens encoded by aberrant transcripts, thereby triggering an enhanced immune system and initiating an anti-tumor response.

[0014] Splicing regulators or RNA editing agents can induce the expression of aberrant peptides in a variety of ways, either by presenting them on the cell surface (e.g., through the major histocompatibility complex mechanism) or by targeting mRNAs encoding peptide membrane-binding / transmembrane domains. Alternatively, aberrant peptides can be secreted.

[0015] Even if the efficacy of splicing regulation or RNA editing is low due to the amplification of inherent biological signals in the T-cell response, it may still result in a durable and potentially potent antitumor effect. By selecting target RNAs expressed in target cells, such as RNA transcripts whose expression is dysregulated in cancer cells (RNA transcripts that are overexpressed compared to non-cancer cells), the present invention can be used to preferentially or selectively target and attack target cells by the immune system. Summary of the Invention

[0016] The present invention provides a method for engineering peptide epitopes in cells, the method comprising administering an effective amount of RNA-modified oligonucleotides to cells, wherein the RNA modification targets target RNA to regulate RNA to produce an aberrant RNA transcript, the RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0017] For example, RNA-modifying oligonucleotides can be splicing regulatory oligonucleotides or RNA editing oligonucleotides.

[0018] The present invention provides a method for engineering peptide epitopes in cells, the method comprising administering an effective amount of RNA-modified oligonucleotides to cells, wherein the RNA-modified oligonucleotides target target RNA to modulate the coding sequence of the target RNA, thereby producing an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0019] In some embodiments, the RNA-modifying oligonucleotide is an RNA-editing oligonucleotide that can introduce nucleobase insertions, deletions, or substitutions into the target RNA, thereby altering the coding sequence of the target RNA.

[0020] In some embodiments, RNA-modified oligonucleotides can introduce single-base substitutions, such as adenosine to inosine base substitutions, into the target RNA.

[0021] In some embodiments, RNA-modified oligonucleotides can recruit human ADAR.

[0022] The present invention provides a method for engineering peptide epitopes in cells, the method comprising administering an effective amount of a splice-regulating oligonucleotide to the cells, wherein the splice-regulating oligonucleotide targets a target RNA to regulate the splicing of the target RNA, thereby producing an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0023] The present invention provides a method for engineering peptide epitopes in cells, the method comprising administering an effective amount of a splice-regulating oligonucleotide to cells, wherein the splice-regulating oligonucleotide targets a target RNA to regulate the splicing of the target RNA, producing an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope, wherein the splice-regulating oligonucleotide regulates the splicing of the target RNA (such as a precursor mRNA) to produce an aberrant RNA transcript introduced by a regulated splicing event, wherein the aberrant RNA (such as mRNA) transcript encodes an internal polypeptide deletion to produce an aberrant polypeptide containing an aberrant peptide sequence comprising a regulated splicing event (e.g., by skipping one or more exons), thereby producing a peptide epitope.

[0024] This invention provides a method for engineering peptide epitopes in cells, the method comprising administering an effective amount of a splice-regulating oligonucleotide to cells, wherein the splice-regulating oligonucleotide targets a target RNA to regulate the splicing of the target RNA, producing an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope; wherein the splice-regulating oligonucleotide regulates the splicing of the target RNA (such as a precursor mRNA) to produce an aberrant RNA transcript (such as mRNA) introduced by a regulated splicing event, wherein the aberrant RNA transcript encodes one or more codons from an intron region of the target RNA to produce an aberrant polypeptide comprising an aberrant peptide sequence, the aberrant peptide sequence comprising at least one or more peptides encoded by one or more codons derived from an intron region, thereby producing a peptide epitope.

[0025] The present invention provides a method for engineering peptide epitopes in cells, the method comprising administering an effective amount of a splice-regulating oligonucleotide to cells, wherein the splice-regulating oligonucleotide targets a target RNA to regulate the splicing of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope; wherein the splice-regulating oligonucleotide regulates the splicing of the target RNA (such as a precursor mRNA) to produce an aberrant RNA transcript comprising a codon frame shift introduced by a regulated splicing event, wherein the aberrant RNA transcript produces a polypeptide having a C-terminal region of at least one amino acid, the at least one amino acid C-terminal region being transcribed from a region of the aberrant RNA transcript at the codon frame shift or from a region of the aberrant RNA transcript at the 3' position of the codon frame shift.

[0026] This invention provides a method for engineering peptide epitopes in cells, the peptide epitopes being referred to herein as neoantigen peptides, the method comprising administering an effective amount of a splice-regulating oligonucleotide to cells, wherein the splice-regulating oligonucleotide targets RNA splicing events (splice sites or splice-regulating regions) to regulate the splicing of RNA (hereinafter referred to as target RNA) at the splice sites to produce an aberrant RNA transcript encoding an aberrant polypeptide containing the peptide epitope.

[0027] The method can be either in vitro or in vivo. For in vivo use, the expression of peptide epitopes (neoantigens) can be used to induce or enhance an immune response.

[0028] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0029] a. Vaccinate the subject using a reagent containing or encoding a peptide epitope;

[0030] b. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets a target RNA in the subject's target cells and regulates the splicing of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0031] To trigger or enhance the subject's immune response to peptide epitopes (such as target cells expressing peptide epitopes);

[0032] Steps a and b can be performed in the following order: step a first, then step b; step b first, then step a; or steps a and b simultaneously.

[0033] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0034] a. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets a target RNA in the subject's target cells and regulates RNA splicing to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0035] b. Administering antibodies to the subject, wherein the antibodies are specific for peptide epitopes.

[0036] To trigger or enhance the subject’s immune response to a peptide epitope (such as a target cell expressing a peptide epitope); wherein steps a. and b. may be performed in the order of step a. first then step b., or step b. first then step a., or steps a. and b. simultaneously.

[0037] The present invention provides a method for immunomodulating target cells of a subject, the method comprising the step of administering a splice-regulating oligonucleotide to the subject, wherein the splice-regulating oligonucleotide targets target RNA in the subject's target cells and modulates RNA splicing to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope; to trigger or enhance the subject's immune response to the peptide epitope (such as target cells expressing the peptide epitope).

[0038] This invention provides a method for treating a subject's disease with immunotherapy, the method comprising the following steps:

[0039] a. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets a target RNA in the subject's target cells and regulates the splicing of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0040] b. Administering immunotherapy antibodies to subjects, wherein the immunotherapy antibodies are specific for peptide epitopes;

[0041] Trigger or enhance the subject’s immune response to a peptide epitope (such as a peptide epitope expressed on a target cell); wherein steps a. and b. may be performed in the order of step a. first then step b., or step b. first then step a., or steps a. and b. simultaneously.

[0042] The present invention provides a method for immunomodulating target cells of a subject, the method comprising administering a splice-regulating oligonucleotide to the subject, wherein the splice-regulating oligonucleotide targets RNA splicing sites (such as intron / exon boundaries or other RNA splicing regulatory regions) in the subject's target cells and regulates RNA splicing at the splicing sites to produce an aberrant mRNA transcript encoding an aberrant polypeptide containing a peptide epitope; wherein the aberrant epitope is immunogenic to the subject; to trigger or enhance the subject's immune response to the target cells.

[0043] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0044] a. Vaccinate the subject using a reagent containing or encoding a peptide epitope;

[0045] b. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets RNA splicing sites (including RNA splice-regulating regions) in the subject's target cells and regulates RNA splicing at the splicing sites to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0046] To trigger or enhance the subject's immune response to target cells;

[0047] Steps a and b can be performed in the following order: step a first, then step b; step b first, then step a; or steps a and b simultaneously.

[0048] This method leads to the expression or enhanced expression of peptide epitopes in target cells, resulting in the triggering or enhancement of an immune response.

[0049] In some embodiments, between steps a and b or b and a, step c may be optionally waited for, for example, to allow the subject to generate an adaptive immune response to the antigenic peptide (in the order of steps a, c, b), or to allow the epitope peptide to be expressed on target cells (in the order of steps b, c, a).

[0050] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0051] a. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets an RNA splice site in the subject's target cells and regulates RNA splicing at the splice site to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0052] b. Administering antibodies to the subject, wherein the antibodies are specific for peptide epitopes.

[0053] To trigger or enhance the subject's immune response to target cells, wherein steps a. and b. may be performed in the order of step a. first then step b., or step b. first then step a., or steps a. and b. simultaneously.

[0054] This method results in the expression or enhanced expression of peptide epitopes in target cells, leading to the triggering or enhancement of an immune response, particularly when the antibody is administered in step b.

[0055] Waiting step c can be performed between steps a and b, for example, to allow the peptide epitope to be expressed in the target cells (in the order of steps a, b, c).

[0056] This invention provides the use of splicing to regulate the production of peptide epitopes from oligonucleotides in cells.

[0057] This invention provides the use of splice-regulating oligonucleotides in immunotherapy treatments (e.g., cancer), wherein the splice-regulating oligonucleotides target RNA to produce abnormal RNA transcripts encoding abnormal polypeptides containing peptide epitopes in cells (e.g., cancer cells); wherein the immunotherapy treatment comprises administering a therapeutic antibody that recognizes the peptide epitopes to a subject.

[0058] In some embodiments, more than one splice-regulating oligonucleotide, such as two splice-regulating oligonucleotides, can be used to provide efficient regulation of splicing to induce the synthesis of aberrant peptides. This use of multiple splice-regulating oligonucleotides allows targeting of more splice-regulating regions, which can provide enhanced splice-regulating potency. Multiple splice-regulating oligonucleotides can be delivered as a single oligonucleotide “poly-oligo” construct – see, for example, WO2015 / 113922). More than one splice-regulating oligonucleotide can target different splicing events (in the same or different RNA targets) and thus can lead to the production of more than one aberrant peptide. Thus, the use of multiple splice-regulating oligonucleotides can induce the synthesis of multiple novel epitopes, which may be advantageous in evoking an immune response in the subject.

[0059] This invention provides the use of splice-regulating oligonucleotides in cancer vaccine therapy, wherein the splice-regulating oligonucleotides target RNA to produce abnormal RNA transcripts encoding abnormal polypeptides containing peptide epitopes in cancer cells, wherein the vaccine therapy causes the subject to produce or enhance an immune response to the peptide epitopes.

[0060] The present invention provides an antisense oligonucleotide capable of regulating the splicing of CEMIP precursor mRNA, wherein the antisense oligonucleotide comprises a continuous nucleotide sequence of at least 10 nucleotides (such as at least 12 nucleotides) that has 100% identity with a sequence selected from SEQ ID NO 1–41.

[0061] The present invention provides an antisense oligonucleotide capable of regulating the splicing of CEMIP precursor mRNA, wherein the antisense oligonucleotide comprises a continuous nucleotide sequence of at least 10 nucleotides (such as at least 12 nucleotides) that has 100% identity with a sequence selected from SEQ ID NO 42–82.

[0062] The present invention provides an antisense oligonucleotide capable of regulating the splicing of CEMIP precursor mRNA, wherein the antisense oligonucleotide comprises a continuous nucleotide sequence of at least 10 nucleotides (such as at least 12 nucleotides) that has 100% identity with a sequence selected from SEQ ID NO 193–274.

[0063] This invention provides an antisense oligonucleotide capable of regulating the splicing of CEMIP precursor mRNA, wherein the antisense oligonucleotide is selected from compounds O1-O41.

[0064] This invention provides an antisense oligonucleotide capable of regulating the splicing of CEMIP precursor mRNA, wherein the antisense oligonucleotide is selected from compounds O42-O82.

[0065] This invention provides an antisense oligonucleotide capable of regulating the splicing of CEMIP precursor mRNA, wherein the antisense oligonucleotide is selected from compounds O65-O246.

[0066] The present invention provides an antisense oligonucleotide capable of regulating the splicing of ETV4 precursor mRNA, wherein the antisense oligonucleotide comprises a continuous nucleotide sequence of at least 10 nucleotides (such as at least 12 nucleotides) that has 100% identity with a sequence selected from SEQ ID NO83–123.

[0067] This invention provides an antisense oligonucleotide capable of regulating the splicing of ETV4 precursor mRNA, wherein the antisense oligonucleotide is selected from compounds O83-O123.

[0068] The present invention provides an antisense oligonucleotide capable of regulating the splicing of ETV4 precursor mRNA, wherein the antisense oligonucleotide comprises a continuous nucleotide sequence of at least 10 nucleotides (such as at least 12 nucleotides) that has 100% identity with a sequence selected from SEQ ID NO124–164.

[0069] This invention provides an antisense oligonucleotide capable of regulating the splicing of ETV4 precursor mRNA, wherein the antisense oligonucleotide is selected from compounds O124-O164.

[0070] The antisense oligonucleotides of the present invention can be used in the methods and applications of the present invention.

[0071] The present invention provides a vaccine or immunotherapeutic agent comprising peptide epitopes, such as peptide epitopes selected from the group consisting of SEQ ID NO 188, SEQ ID NO 189, SEQ ID NO 190, SEQ ID NO 191 and SEQ ID NO 192.

[0072] The present invention provides a polypeptide that is or comprises peptides, such as peptides selected from the group consisting of SEQ ID NO 188, SEQ ID NO 189, SEQ ID NO 190, SEQ ID NO 191 and SEQ ID NO 192.

[0073] The present invention provides a polypeptide, which is or comprises a peptide (such as a peptide selected from the group consisting of SEQ ID NO 188, SEQ ID NO 189, SEQ ID NO 190, SEQ ID NO 191 and SEQ ID NO 192), for use in pharmaceuticals, such as for use as a vaccine or immunotherapeutic agent.

[0074] The peptide epitopes, polypeptides, vaccines, or immunotherapeutic agents of the present invention can be used in the methods or uses of the present invention.

[0075] This invention provides splice-regulating oligonucleotides as described or claimed herein, or their use in exosome formulations. Exosome formulations can be used to enhance delivery to target tissues or target cells (e.g., cancer cells).

[0076] This invention provides conjugates comprising splice-regulating oligonucleotides as described or claimed herein, or their uses, such as conjugates comprising splice-regulating oligonucleotides covalently linked to a trivalent GalNAc moiety. GalNAc conjugation enhances delivery to target cells in the liver, such as hepatocytes.

[0077] RNA editing examples of the present invention

[0078] Recently, antisense oligonucleotides have been developed that recruit endogenous human ADAR (adenosine deaminase acting on RNA) in a simple and programmable manner to edit endogenous transcripts (Merkle et al., Nat Biotechnol. 2019 Feb; 37(2):133-138). Oligonucleotide designs that can be used to mediate RNA editing include...

[0079] It should be understood that an alternative method for altering the peptide-coding sequence of a target RNA (such as mRNA) is RNA editing, which can be used to introduce deletions, insertions, or substitutions (RNA editing events). Deletion or substitution can, for example, introduce a frameshift, resulting in a new antigenic protein sequence downstream of the RNA editing event. Stop codons in the target RNA can be targeted (through deletion, insertion, or substitution), and the removal of a stop codon can lead to the generation of a new antigenic sequence downstream of the RNA editing event. Frameshift RNA editing events can also cause stop codons to be removed from the frame, thereby also leading to the generation of a new antigenic protein sequence.

[0080] In some embodiments, the RNA editing oligonucleotide is able to recruit adenosine deaminase to the target RNA, thereby causing an adenosine deaminase event. Adenosine deaminase leads to the production of inosine bases, which is considered an A→G substitution. In some advantageous embodiments, the RNA editing event is an A to I substitution. Such A→G substitutions can be used for:

[0081] i) An AUG start codon is generated upstream of the endogenous translation initiation site – this will create a peptide epitope at the N-terminus of the protein product. For example, the AUA triplet upstream of the endogenous AUG start codon can be edited by RNA to become an alternative AUG start codon.

[0082] ii) Changing the start codon from AUG to IUG (GUG) results in the use of a new / novel AUG start codon downstream, leading to out-of-frame translation and the generation of entirely new peptide sequences.

[0083] iii) Altering the endogenous stop codon causes translation to proceed via the endogenous stop codon. Therefore, the stop codons UAG, UGA, or UAA can be edited in the RNA target to become UGG, which encodes tryptophan. Translation via the endogenous stop codon produces a peptide epitope located at the C-terminus of the protein product.

[0084] The present invention provides a method for engineering peptide epitopes in cells, the method comprising administering an effective amount of RNA-editing oligonucleotides to cells, wherein the RNA-editing oligonucleotides target target RNA to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0085] The present invention provides a method for engineering peptide epitopes in cells, the method comprising administering an effective amount of RNA-editing oligonucleotides to cells, wherein the RNA-editing oligonucleotides target target RNA to replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0086] The present invention provides a method for engineering peptide epitopes in cells, the method comprising administering an effective amount of RNA-editing oligonucleotides to cells, wherein the RNA-editing oligonucleotides target target RNA to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0087] The present invention provides a method for engineering peptide epitopes in cells, the method comprising administering an effective amount of RNA-editing oligonucleotides to cells, wherein the RNA-editing oligonucleotides target target RNA to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0088] The present invention provides a method for engineering peptide epitopes in cells, the method comprising administering an effective amount of RNA-editing oligonucleotides to cells, wherein the RNA-editing oligonucleotides target target RNA to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0089] This invention provides a method for engineering peptide epitopes in cells, the peptide epitopes being referred to herein as neoantigen peptides, the method comprising administering an effective amount of RNA-editing oligonucleotides to cells, wherein the RNA-editing oligonucleotides target target RNA to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0090] In the context of the RNA editing method of the present invention, adenosine to inosine substitution is particularly advantageous because inosine is recognized as a G nucleobase in translation*, and therefore A to I (also known as A to G*) can edit the start codon and the stop codon, allowing the introduction of a new start codon or stop codon, or the deletion of an existing start codon or stop codon.

[0091] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0092] a. Vaccinate the subject using a reagent containing or encoding a peptide epitope;

[0093] b. Administering RNA-editing oligonucleotides to the subject, wherein the RNA-editing oligonucleotides target target RNA in the subject's target cells and regulate the splicing of the target RNA to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0094] To trigger or enhance the subject's immune response to peptide epitopes (such as target cells expressing peptide epitopes);

[0095] Steps a and b can be performed in the following order: step a first, then step b; step b first, then step a; or steps a and b simultaneously.

[0096] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0097] a. Administering RNA-editing oligonucleotides to a subject, wherein the RNA-editing oligonucleotides target target RNA in the subject's target cells to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0098] b. Administering antibodies to the subject, wherein the antibodies are specific for peptide epitopes.

[0099] To trigger or enhance the subject’s immune response to a peptide epitope (such as a target cell expressing a peptide epitope); wherein steps a. and b. may be performed in the order of step a. first then step b., or step b. first then step a., or steps a. and b. simultaneously.

[0100] The present invention provides a method for immunomodulating target cells of a subject, the method comprising the step of administering an RNA-editing oligonucleotide to the subject, wherein the RNA-editing oligonucleotide targets target RNA in target cells to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope; to trigger or enhance an immune response of the subject to the peptide epitope (such as a target cell expressing the peptide epitope).

[0101] This invention provides a method for treating a subject's disease with immunotherapy, the method comprising the following steps:

[0102] a. Administering RNA-editing oligonucleotides to a subject, wherein the RNA-editing oligonucleotides target target RNA in the subject's target cells to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0103] b. Administering immunotherapy antibodies to subjects, wherein the immunotherapy antibodies are specific for peptide epitopes;

[0104] To trigger or enhance the subject’s immune response to peptide epitopes (such as peptide epitopes expressed on target cells); wherein steps a. and b. may be performed in the order of step a. first then step b., or step b. first then step a., or steps a. and b. simultaneously.

[0105] This invention provides a method for immunomodulating target cells of a subject, the method comprising administering an RNA-editing oligonucleotide to the subject, wherein the RNA-editing oligonucleotide targets RNA to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope; wherein the aberrant epitope is immunogenic to the subject; to trigger or enhance the subject's immune response to the target cells.

[0106] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0107] a. Vaccinate the subject using a reagent containing or encoding a peptide epitope;

[0108] b. Administering RNA-editing oligonucleotides to subjects, wherein the RNA-editing oligonucleotides target RNA to insert, delete, or replace nucleobases of the target RNA to produce abnormal RNA transcripts encoding abnormal polypeptides containing peptide epitopes;

[0109] To trigger or enhance the subject's immune response to target cells;

[0110] Steps a and b can be performed in the following order: step a first, then step b; step b first, then step a; or steps a and b simultaneously.

[0111] This method leads to the expression or enhanced expression of peptide epitopes in target cells, resulting in the triggering or enhancement of an immune response.

[0112] In some embodiments, between steps a and b or b and a, step c may be optionally waited for, for example, to allow the subject to generate an adaptive immune response to the antigenic peptide (in the order of steps a, c, b), or to allow the epitope peptide to be expressed on target cells (in the order of steps b, c, a).

[0113] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0114] a. Administering RNA-editing oligonucleotides to a subject, wherein the RNA-editing oligonucleotides target RNA splicing sites in the subject's target cells to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0115] b. Administering antibodies to the subject, wherein the antibodies are specific for peptide epitopes.

[0116] To trigger or enhance the subject's immune response to target cells, wherein steps a. and b. may be performed in the order of step a. first then step b., or step b. first then step a., or steps a. and b. simultaneously.

[0117] This method results in the expression or enhanced expression of peptide epitopes in target cells, leading to the triggering or enhancement of an immune response, particularly when the antibody is administered in step b.

[0118] Waiting step c can be performed between steps a and b, for example, to allow the peptide epitope to be expressed in the target cells (in the order of steps a, b, c).

[0119] This invention provides the use of RNA-edited oligonucleotides to generate peptide epitopes in cells.

[0120] This invention provides the use of RNA-editing oligonucleotides in immunotherapy (e.g., cancer), wherein the RNA-editing oligonucleotides target RNA to insert, delete, or replace nucleobases of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope in cells (e.g., cancer cells); wherein the immunotherapy treatment includes administering a therapeutic antibody that recognizes the peptide epitope to a subject.

[0121] This invention provides the use of RNA-edited oligonucleotides in cancer vaccine therapy, wherein the RNA-edited oligonucleotides target RNA to produce abnormal RNA transcripts encoding abnormal polypeptides containing peptide epitopes in cancer cells, wherein the vaccine therapy causes the subject to produce or enhance an immune response to the peptide epitopes. Attached Figure Description

[0122] Figure 1 A schematic diagram of splicing regulatory events induced by oligonucleotides in precursor mRNA. Exon connections are indicated by dashed lines, while novel peptide sequences are indicated by red circles. For simplicity, only single splicing regulatory events are depicted.

[0123] Figure 2 Novel splicing ligation between exons 6 and 8 in CEMIP mRNA is induced by specific oligonucleotides. CEMIP exon 7 skipping events are measured as a percentage of the total CEMIP transcript.

[0124] Figure 3 Novel splicing ligations between exons 27 and 29 in CEMIP mRNA are induced by specific oligonucleotides. CEMIP exon 28 skipping events are measured as a percentage of the total CEMIP transcript.

[0125] Figure 4 Novel splicing ligations between exons 7 and 9 in ETV4 mRNA are induced by specific oligonucleotides. ETV4 exon 8 skipping events are measured as a percentage of the total ETV4 transcript level.

[0126] Figure 5 Novel splicing ligations between exons 9 and 11 in ETV4 mRNA are induced by specific oligonucleotides. ETV4 exon 10 skipping events are measured as a percentage of the total ETV4 transcript level.

[0127] Figure 6 The scatter plot depicts the relative PARPBP gene expression levels in 56 clinical samples of lung squamous cell carcinoma (triangles) and normal human tissue (circles).

[0128] Figure 7 Box plots depict the gene expression level (TPM) of PARPBP in healthy human tissues from the GTEX database.

[0129] Figure 8Visualization of capillary electrophoretic immunoassay of CEMIP and GAPDH in colo-205 cells treated with oligonucleotide-induced CEMIP exon 28 skipping. The first four lanes contain lysates, followed by CEMIP protein enrichment via immunoprecipitation, as shown in the last four lanes. The measured molecular weights are shown, estimated using a WES machine.

[0130] Figure 9 Visualization of capillary electrophoretic immunoassay of the new C-terminus of CEMIP induced by oligonucleotide-induced CEMIP exon 28 skipping. The concentration of O195 is shown above the lane. The measured molecular weight is shown as estimated by a WES machine. HTPR1 antibody was used as a loading control.

[0131] Figure 10 The upper group shows the identified MS / MS spectra, corresponding to the wild-type CEMIP C-terminus of the 15 amino acids identified in O195-treated and untreated samples. IFQVVPIPVVK KKKL (SEQ ID NO 299) contains 11 amino acids. The lower set shows the predicted novel C-terminal KANGIRWLQR. QLPAHLG DTGH MS / MS spectrum of the identification of the last 11 amino acids of SEQ ID NO 189. This peptide fragment was identified only in samples treated with O195. Detailed Implementation

[0132] definition

[0133] Oligonucleotides

[0134] As used herein, the term "oligonucleotide" is defined as a molecule comprising two or more covalently linked nucleosides, as commonly understood by those skilled in the art. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically prepared in the laboratory by solid-phase chemical synthesis followed by purification. When referring to the sequence of an oligonucleotide, the meaning refers to the sequence or order of the nucleobase portion of the covalently linked nucleotide or nucleoside or its modifications. The oligonucleotides of the present invention are artificial and chemically synthesized, and are typically purified or isolated. The oligonucleotides of the present invention may comprise one or more modified nucleosides or nucleotides.

[0135] antisense oligonucleotides

[0136] As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide capable of regulating the expression of a target gene by hybridization with a target nucleic acid, particularly with adjacent sequences on the target nucleic acid. Antisense oligonucleotides are not substantially double-stranded and are therefore not siRNA or shRNA. Preferably, the antisense oligonucleotides of the present invention are single-stranded. It should be understood that the single-stranded oligonucleotides of the present invention can form hairpin or intermolecular double-stranded structures (double-stranded structures between two molecules of the same oligonucleotide), provided that the degree of self-complementarity within or between the oligonucleotides across their entire length is less than 50%.

[0137] RNA editing oligonucleotides

[0138] RNA editing oligonucleotides are oligonucleotides capable of targeting target RNA through hybridization between consecutive nucleotide sequences of the RNA editing oligonucleotide, resulting in the insertion, deletion, or substitution of one or more nucleobases within the target RNA, typically in a complementary region between the consecutive nucleotide sequence of the RNA editing oligonucleotide and the RNA target sequence. RNA editing oligonucleotides may contain additional regions (in addition to the consecutive nucleotide sequence) that allow recruitment of RRE editing enzymes. These additional regions may, for example, include double-stranded regions. An advantageous form of RNA editing oligonucleotide is the ADAR-recruiting oligonucleotide, disclosed, for example, in Merkle et al., Nat Biotechnol. 2019 Feb; 37(2):133-138 – see also WO17010556. RNA editing methods and RNA editing oligonucleotide reagents are disclosed in WO19084063, WO19071274, WO18161032, WO18134301, WO18041973, WO17220751, and WO16097212. RNA editing can also be achieved through CRISPR / Cas9-based RNA editing – see, for example, WO18208998.

[0139] For example, as disclosed by Merkle et al., ADAR recruiting oligonucleotides may contain a 3' region (e.g., 10–25 nucleotides in length) of a modified nucleotide containing a nucleoside C (edited to nucleobase I, read as nucleobase G) at the base A position on the target RNA, but additionally complementary to the target RNA (completely complementary, except for a mismatch at nucleoside C). Nucleoside C, located within the 3' region, is typically not a 3' terminal nucleoside. Nucleoside C and the nucleosides flanking it can be RNA nucleotides, and the remainder of the 3' region can be, for example, a 2'-O-methyl nucleoside or other 2'-O-alkyl nucleoside. For example, nucleoside C may have an adjacent RNA nucleoside and also have 6–12 2'-O-methyl nucleosides located from the 3' to the nucleoside C. The flanking nucleoside C may be a single RNA nucleoside and also have 4–8 2'-O-methyl nucleosides. For example, the 3' end can be protected from nucleases by using phosphate thioester nucleoside bonds between the terminal 2–6 nucleosides (e.g., 2–6 2'-O-methylphosphate thioester linked nucleoside regions). The length of the 3' region can be 10–25 nucleosides, such as 15–20 (e.g., 16, 17, 18, or 19) nucleosides. RNA-editing oligonucleotides can further include a 5' ADAR recruitment region—the ADAR recruitment region is typically independent of the target sequence (i.e., not dependent on complementarity with the target RNA) and typically contains a double-stranded region of the modified nucleoside, which may contain one or two mismatched nucleotide pairs (non-base-paired nucleosides). The double-stranded region can be formed by a hairpin structure, where the oligonucleotide is a single oligonucleotide in which the 5' region forms a hairpin, thus forming the double-stranded region. Alternatively, the 5' ADAR recruitment region can be formed by two complementary oligonucleotide molecules. The length of the double-stranded region can be, for example, 15-30 base pairs (such as 22-27 or 25 base pairs), including, for example, one or two unpaired bases. Suitablely, the double-stranded region contains modified nucleosides, such as 2'-O-methyl, LNA, and / or 2'-O-MOE nucleosides. For example, see Merkle et al., Nat Biotechnol. 2019 Feb; 37(2):133-138. Figure 3 a.

[0140] Continuous nucleotide sequence

[0141] The term "continuous nucleotide sequence" refers to an oligonucleotide region complementary to a target nucleic acid. This term is used interchangeably herein with the terms "near-neighbor nucleobase sequence" and "oligonucleotide motif sequence." In some embodiments, all nucleotides of the oligonucleotide constitute a continuous nucleotide sequence. In some embodiments, the oligonucleotide comprises a continuous nucleotide sequence, such as an FG-F' nick polymer region, and may optionally comprise other nucleotides, such as nucleotide linker regions that can be used to attach functional groups to the continuous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. Riskily, the continuous nucleotide sequence is 100% complementary to the target nucleic acid.

[0142] Nucleotides

[0143] Nucleotides are the structural units of oligonucleotides and polynucleotides, and for the purposes of this invention, include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides such as DNA and RNA nucleotides comprise a ribose moiety, a nucleobase moiety, and one or more phosphate groups (which are absent in nucleosides). Nucleosides and nucleotides may also be interchangeably referred to as "units" or "monomers".

[0144] Modified nucleosides

[0145] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside modified by introducing one or more modifications to a sugar moiety or (nucleo)base moiety compared to an equivalent DNA or RNA nucleoside. In a preferred embodiment, the modified nucleoside comprises a modified sugar moiety. The term modified nucleoside may also be used interchangeably herein with the terms "nucleoside analogue" or modified "unit" or modified "monomer." Nucleosides having unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides. Nucleosides modified in the base regions of DNA or RNA nucleosides are generally still referred to as DNA or RNA if Watson Crick base pairing is permitted.

[0146] Modified nucleoside interbonds

[0147] As commonly understood by those skilled in the art, the term "modified internucleotide bond" is defined as a bond other than a phosphodiester (PO) bond that covalently couples two nucleosides together. Therefore, the oligonucleotides of the present invention may contain modified internucleotide bonds. In some embodiments, modified internucleotide bonds increase the nuclease resistance of the oligonucleotide compared to phosphodiester bonds. For naturally occurring oligonucleotides, the internucleotide bond comprises a phosphate group that forms a phosphodiester bond between adjacent nucleosides. Modified internucleotide bonds are particularly useful for stabilizing oligonucleotides for in vivo use and can protect against nuclease cleavage in DNA or RNA nucleoside regions of the oligonucleotides of the present invention (e.g., within the nick region of the nick polymer oligonucleotide) and in modified nucleoside regions (e.g., regions F and F').

[0148] In one embodiment, the oligonucleotide contains one or more nucleoside bonds modified by a natural phosphodiester, such as one or more modified nucleoside bonds, which are more resistant to nuclease attack, for example. Nuclease resistance can be determined by incubating the oligonucleotide in serum or by using a nuclease resistance assay (e.g., snake venom phosphodiesterase (SVPD)), both of which are well known in the art. Nucleoside bonds that enhance the nuclease resistance of the oligonucleotide are called anti-nuclease nucleoside bonds. In some embodiments, at least 50% of the nucleoside bonds in the oligonucleotide or its sequential nucleotide sequence are modified, such as at least 60%, at least 70%, at least 80%, or at least 90% of the nucleoside bonds in the oligonucleotide or its sequential nucleotide sequence are anti-nuclease nucleoside bonds. In some embodiments, all the nucleoside bonds in the oligonucleotide or its sequential nucleotide sequence are anti-nuclease nucleoside bonds. It should be recognized that, in some embodiments, the nucleoside linking the oligonucleotide of the present invention to a non-nucleotide functional group such as a conjugate can be a phosphodiester.

[0149] The preferred modified internucleotide bond is a thiophosphate.

[0150] Phosphophosphate internucleotide bonds are particularly useful due to nuclease resistance, beneficial pharmacokinetics, and ease of manufacture. In some embodiments, at least 50% of the internucleotide bonds in the oligonucleotide or its continuous nucleotide sequence are phosphate thioesters, such as at least 60%, at least 70%, at least 80%, or at least 90% of the internucleotide bonds in the oligonucleotide or its continuous nucleotide sequence are phosphate thioesters. In some embodiments, all internucleotide bonds in the oligonucleotide or its continuous nucleotide sequence are phosphate thioesters.

[0151] nucleobases

[0152] The term "nucleobase" includes the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds during nucleic acid hybridization. In the context of this invention, the term "nucleobase" also encompasses modified nucleobases that may differ from naturally occurring nucleobases but function during nucleic acid hybridization. In this context, "nucleobase" refers to naturally occurring nucleobases such as adenine, guanine, cytosine, thymine, uracil, xanthine, and hypoxanthine, as well as non-natural variants. Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research, Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 371.4.1.

[0153] In some embodiments, the nucleobase portion is modified by changing the purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazo-uracil, 2-thiouracil, 2'-thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0154] The nucleobase moiety can be represented by a letter code for each corresponding nucleobase, such as A, T, G, C, or U, where each letter may optionally include a modified nucleobase with equivalent function. For example, in an exemplary oligonucleotide, the nucleobase moiety is selected from A, T, G, C, and 5-methylcytosine. Optionally, for LNA-notched polymers, 5-methylcytosine LNA nucleosides can be used.

[0155] Modified oligonucleotides

[0156] The term "modified oligonucleotide" describes an oligonucleotide containing one or more sugar-modified nucleosides and / or modified nucleoside bonds. The term "chimeric" oligonucleotide is a term used in the literature to describe oligonucleotides having modified nucleosides.

[0157] Complementarity

[0158] The term “complementarity” describes the ability of a nucleoside / nucleotide to pair with Watson-Crick bases. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). It should be understood that oligonucleotides may contain nucleosides with modified nucleosides, for example, 5-methylcytosine is often used instead of cytosine; therefore, the term complementarity covers Watson-Crick base pairing between unmodified and modified nucleosides (see, for example, Hirao et al. (2012) Accounts of Chemical Research, Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0159] As used herein, the term "% complementarity" refers to the percentage of nucleotides in a continuous nucleotide sequence of a nucleic acid molecule (e.g., an oligonucleotide) where, at a given position, the nucleic acid molecule (e.g., the oligonucleotide) is complementary to (i.e., forms Watson-Crick base pairs with) a continuous nucleotide sequence of a different nucleic acid molecule (e.g., a target nucleic acid or target sequence) at that position. The percentage is calculated by counting the number of aligned base pairs between the two sequences (when aligned with the target sequence from 5'-3' and the oligonucleotide sequence from 3'-5'), dividing by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In this comparison, misaligned (forming base pairs) nucleobases / nucleotides are referred to as mismatches. Preferably, insertions and deletions are not permitted when calculating the % complementarity of a continuous nucleotide sequence.

[0160] The term "perfect complementarity" refers to 100% complementarity.

[0161] identity

[0162] As used herein, the term "identity" refers to the percentage (expressed as a percentage) of nucleotides in a continuous nucleotide sequence of a nucleic acid molecule (e.g., an oligonucleotide) that are identical to a reference sequence (e.g., a sequence motif) spanning that continuous nucleotide sequence. Therefore, the identity percentage is calculated by dividing the number of identical aligned bases (matches) in the two sequences (e.g., in the continuous nucleotide sequence of the compound of the present invention and in the reference sequence) by the total number of nucleotides in the aligned region and then multiplying by 100. Thus, the identity percentage = (number of matches x 100) / length of the aligned region (e.g., continuous nucleotide sequence). Insertions and deletions are not permitted when calculating the identity percentage of a continuous nucleotide sequence. It should be understood that, in determining identity, chemical modifications of the nucleosides (e.g., 5'-methylcytosine is considered identical to cytosine in calculating % identity) are disregarded as long as the function of forming Watson-Crick base pairing remains.

[0163] Hybridization

[0164] As used herein, the term "hybridizing" or "hybridizes" should be understood as the formation of a double helix (e.g., oligonucleotide and target nucleic acid) by hydrogen bonds between base pairs on opposite strands of two nucleic acid chains. The affinity between the two nucleic acid chains is the strength of the hybridization. It is usually described by the melting temperature (Tm), which is defined as the temperature at which half of the oligonucleotide and the target nucleic acid form a double helix. Under physiological conditions, Tm is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515–537). The standard-state Gibbs free energy ΔG° is a more precise expression of the binding affinity and is related to the dissociation constant (Kd) of the reaction by ΔG° = -RTln(Kd), where R is the gas constant and T is the absolute temperature. Therefore, the very low ΔG° of the reaction between the oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction in which the water concentration is 1 M, the pH is 7, and the temperature is 37 °C. The hybridization of oligonucleotides with target nucleic acids is a spontaneous reaction, and for spontaneous reactions, ΔG° is less than zero. ΔG° can be measured experimentally, for example, using isothermal titration calorimetry (ITC) as described by Hansen et al., 1965, Chem. Comm. 36–38, and Holdgate et al., 2005, in Drug Discov Today. Those skilled in the art will know that commercial equipment is available for measuring ΔG°. ΔG° can also be numerically estimated using the nearest neighbor model described in Santa Lucia, 1998, Proc Natl Acad Sci USA. 95:1460–1465, appropriately employing the derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211–11216, and McTigue et al., 2004, Biochemistry 43:5388–5405. To enable the possibility of modulating the intended nucleic acid target through hybridization, for oligonucleotides of 10-30 nucleotides in length, the oligonucleotides of the present invention hybridize with the target nucleic acid at a ΔG° estimate of less than -10 kcal. In some embodiments, the extent or intensity of hybridization is measured according to the standard-state Gibbs free energy ΔG°. For oligonucleotides of 8-30 nucleotides in length, the oligonucleotides may hybridize with the target nucleic acid at a ΔG° estimate of less than -10 kcal, such as less than -15 kcal, such as less than -20 kcal, and such as less than -25 kcal. In some embodiments, the oligonucleotides hybridize with the target nucleic acid at an estimated ΔG° value of about -10 to -60 kcal, such as -12 to -40, such as -15 to -30 kcal, or -16 to -27 kcal, such as -18 to -25 kcal.

[0165] target sequence

[0166] As used herein, the term "target sequence" refers to a sequence of nucleotides present in a target nucleic acid (RNA) that contains a nucleobase sequence complementary to the oligonucleotide of the present invention. In some embodiments, the target sequence comprises a region on the target nucleic acid having a nucleobase sequence complementary to the continuous nucleotide sequence of the oligonucleotide of the present invention.

[0167] The oligonucleotides of the present invention comprise a continuous nucleotide sequence that is complementary to or hybridizes with a target nucleic acid (such as a subsequence of the target nucleic acid, such as the target sequence described herein).

[0168] Oligonucleotides comprise a sequence of consecutive nucleotides complementary to a target sequence present in a target nucleic acid molecule. The consecutive nucleotide sequence (and therefore the target sequence) comprises at least 10 consecutive nucleotides, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides, such as 12-25 consecutive nucleotides, such as 14-18 consecutive nucleotides.

[0169] High affinity modified nucleosides

[0170] A high-affinity modified nucleoside is a modified nucleoside that, when incorporated into the oligonucleotide, enhances the affinity of the oligonucleotide for its complementary target, for example, by increasing the melting temperature (T0). m The high-affinity modified nucleosides of the present invention preferably increase the melting temperature of each modified nucleoside by +0.5 to +12°C, more preferably +1.5 to +10°C, and most preferably +3 to +8°C. Many high-affinity modified nucleosides are known in the art, and include, for example, many 2'-substituted nucleosides and locked nucleic acids (LNAs) (see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0171] Sugar modification

[0172] Compared to the ribosomes found in DNA and RNA, the oligomers of the present invention may contain one or more nucleosides with modified sugar moieties (i.e., modifications of the sugar moieties).

[0173] Many modified nucleosides with ribose moieties have been prepared, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0174] These modifications include alterations to the ribocyclic structure, such as substitution with a hexose ring (HNA) or a bicyclic ring, typically with a biradicle bridge between the C2 and C4 carbon atoms on the ribocyclic ring (LNA), or an unconnected ribocyclic ring (e.g., UNA) typically without bonds between the C2 and C3 carbon atoms. Other sugar-modified nucleosides include, for example, bicyclic hexosinic nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). Modified nucleosides also include those in which the sugar moiety is replaced with a non-sugar moiety, such as in the case of peptide nucleic acids (PNA) or morpholino nucleic acids.

[0175] Sugar modification also includes modifications made by changing the substituents on the ribose ring to groups other than hydrogen or to the 2'-OH group that is naturally present in DNA and RNA nucleosides. For example, substituents can be introduced at the 2', 3', 4', or 5' positions.

[0176] 2'-sugar modified nucleosides.

[0177] 2' sugar-modified nucleosides are nucleosides with substituents other than H or –OH at the 2' position (2' substituted nucleosides) or nucleosides containing a 2'-linked bimolecular group capable of forming a bridge between the 2' carbon and the second carbon in the ribose ring, such as LNA (2'–4' bimolecular bridged) nucleosides.

[0178] In fact, considerable effort has been devoted to the development of 2'-substituted nucleosides, and many 2'-substituted nucleosides have been found to possess beneficial properties when incorporated into oligonucleotides. For example, 2'-modified sugars can provide enhanced binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2'-substituted nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. For further examples, see, for instance, Freier and Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213 and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are schematic diagrams of some 2'-substituted nucleosides.

[0179]

[0180] In this invention, 2' substitutes molecules that do not include 2' bridging, such as LNA.

[0181] Locking in nucleic acid (LNA)

[0182] “LNA nucleotides” are 2’-modified nucleotides containing a C2’ and C4’ bipolar junction (also called a “2’-4’ bridge”) that links the ribose ring of the nucleotide, restricting or locking the conformation of the ribose ring. These nucleotides are also referred to in the literature as bridging nucleic acids or bicyclic nucleic acids (BNAs). When LNAs are incorporated into oligonucleotides of complementary RNA or DNA molecules, the locking of the ribose conformation is associated with enhanced hybridization affinity (double-strand stabilization). This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary double strand.

[0183] Non-limiting exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al., J. Org. Chem. 2010, Vol. 75(5)pp.1569-81 and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238 and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.

[0184] Other non-limiting exemplary LNA nucleosides are disclosed in Scheme 1.

[0185] Option 1:

[0186]

[0187] Special LNA nucleosides include β-D-oxy-LNA and 6'-methyl-β-D-oxy-LNA, such as (S)-6'-methyl-β-D-oxy-LNA (ScET) and ENA.

[0188] One particularly advantageous type of LNA is β-D-oxy-LNA.

[0189] Morpholin oligonucleotides

[0190] In some embodiments, the oligonucleotides of the present invention comprise or consist of morpholinonucleotides (i.e., morpholino oligomers and morpholino oligomers as phosphate diamino esters (PMO)). Splice-regulated morpholino oligonucleotides have been approved for clinical use—see, for example, eteplirsen, a 30nt morpholino oligonucleotide targeting frameshift mutations in DMD for the treatment of Duchenne muscular dystrophy. Morpholino oligonucleotides have nucleobases attached to a six-membered morpholino ring rather than to a ribose, such as a methylene morpholino ring linked by a phosphate diamino ester group, as illustrated by, for example, the following four consecutive morpholinonucleotides:

[0191]

[0192] In some embodiments, the length of the morpholino oligonucleotide of the present invention may be, for example, 20-40 morpholinonucleotides, such as 25-35 morpholinonucleotides.

[0193] Ribonuclease H activity and recruitment

[0194] The ribonuclease H activity of an antisense oligonucleotide refers to its ability to recruit ribonuclease H when forming a double strand with a complementary RNA molecule. WO01 / 23613 provides an in vitro method for determining ribonuclease H activity, which can be used to determine the ability to recruit ribonuclease H. Ribonuclease H is generally considered to be recruitable if the initial rate of the oligonucleotide, when given a complementary target nucleic acid sequence, is at least 5%, such as at least 10% or more than 20%, of the initial rate of the oligonucleotide having the same base sequence as the tested modified oligonucleotide but containing only DNA monomers in which all monomers are phosphate-thioester bonded, as measured using the method provided in Examples 91 to 95 of WO01 / 23613 (incorporated herein by reference). For the purpose of determining ribonuclease H activity, recombinant human ribonuclease H1 is available from Lubio Science GmbH, Lucerne, Switzerland.

[0195] splicing regulatory oligonucleotides

[0196] Splice regulation refers to the ability of a reagent (such as an antisense oligonucleotide) to alter splicing events in a target RNA (such as a precursor mRNA). Splice-regulating oligonucleotides can hybridize with and complement intron / exon boundaries or cis-elements (which regulate or control splicing events), collectively referred to herein as splice sites or splice-regulating elements, regions, or sequences. Splice-switching oligonucleotides are a term commonly used in the art to refer to splice-regulating oligonucleotides.

[0197] Many designs for splice-regulating oligonucleotides are known in the art, for example, see WO2007 / 028065, which discloses chimeric oligonucleotides of length 13 to 80 nucleotides; and WO2007 / 058894, which relates to LNA hybrid antisense oligonucleotides for splice-regulating TNFR2 transcripts, resulting in a soluble form of TNFR2. Further splicing regulator designs using antisense oligonucleotides have been disclosed, for example: Sazani et al., Antisense and Nucleic Acid Drug Dev. 13:119–128 (2003); Childs et al., PNAS August 20, 2002:99 11091–11096, disclose an LNA / DNA hybrid for targeted inhibition of intron splicing in Candida albicans Group I by oligonucleotides; Sazani et al., Nature Biotechnology 2002 1228–1233, disclose a fully 2'-O-MOE modified phosphate thioester splicing regulator that corrects splicing of abnormal GFP reporter genes in mice; Roberts et al., MOLECULAR THERAPY Vol. 14, No. 4, October 2006, pp. 471–475, report the splicing regulation of abnormal GFP reporter genes in mice by LNA hybrids. Aartsma-Rus et al., Gene Therapy (2004) 11, 1391–1398, discuss a comparative analysis of antisense oligonucleotide analogs for DDM exon 46 skipping in muscle cells, using LNA, 2-O-methyl, and morpholine exon skipping antisense oligonucleotides. Hua et al., PLoS Biology April 2007 | Volume 5 | Issue 4 | e73, discusses enhancement of SMN2 exon 7 inclusion by targeting exon with antisense oligonucleotides. Havens and Hastings NucleicAcids Research, 2016 1 doi:10.1093 / Nar / gkw533 reviews antisense regulatory splicing; WO2007 / 047913 discusses methods for identifying cis-splicing elements that can be target sites for regulating splicing events.

[0198] Antisense oligonucleotides used to regulate splicing preferably function through non-RNaseH-mediated mechanisms (therefore, they can be advantageously referred to as RNaseH-independent). In some embodiments, antisense oligonucleotide splicing regulators do not recruit RNaseH. In some embodiments, antisense oligonucleotide splicing regulators do not contain more than 3 consecutive DNA nucleotides or more than 4 consecutive DNA nucleotides.

[0199] Oligonucleotides used for splicing regulation can, for example, consist of a continuous nucleotide sequence of 8–40 nucleotides complementary to the target RNA.

[0200] Oligonucleotides used for splicing regulation can, for example, consist of a continuous nucleotide sequence of 8-30 nucleotides complementary to the target RNA.

[0201] The length of the splice-regulating oligonucleotide or its continuous nucleotide sequence can be, for example, 8 to 30 nucleotides, such as 12 to 24 nucleotides, such as 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.

[0202] LNA splicing modifier

[0203] Due to their significantly high affinity for RNA targets, LNA oligonucleotides have become highly efficient splicing regulators.

[0204] In some embodiments, the antisense oligonucleotide comprises at least one LNA nucleoside – these may be referred to as LNA splicing regulators. In some embodiments, the antisense oligonucleotide comprises both DNA and LNA nucleosides, optionally further comprising one or more 2-O-MOE nucleosides (referred to herein as LNA hybrids). In some embodiments, the antisense oligonucleotide comprises both a 2'-O-methoxyethyl nucleoside and an LNA nucleoside, optionally further comprising one or more DNA nucleosides. In some embodiments, the LNA antisense oligonucleotide does not comprise DNA or RNA nucleotides (holometabolites). In some embodiments, all nucleosides having the antisense oligonucleotide or its continuous nucleotide sequence are independently LNA, 2'-O-methoxyethyl, or DNA nucleosides. In some embodiments, all nucleosides having the antisense oligonucleotide or its continuous nucleotide sequence are independently LNA or DNA nucleosides. Some antisense oligonucleotides or their continuous nucleotide sequences contain both LNA and DNA nucleosides, or all nucleotides of the continuous nucleotide sequence are LNA or DNA nucleotides.

[0205] The LNA splicing regulators described herein may further comprise one or more phosphate thioester nucleoside internucleotides. In some embodiments, all nucleoside internucleotides in the antisense oligonucleotide or its continuous nucleotide sequence are phosphate thioester nucleoside internucleotides. In some embodiments, the 2'-O-MOE splicing regulator is 10-30 nucleotides in length, such as 12-20 nucleotides.

[0206] 2'-O-MOE splice modifier

[0207] In some embodiments, the antisense oligonucleotide comprises at least one 2'-O-methoxyethyl nucleoside—these may be referred to as 2'-O-MOE splicing regulators. In some embodiments, the antisense oligonucleotide comprises both a 2'-O-methoxyethyl nucleoside and an LNA nucleoside, optionally further comprising one or more DNA nucleosides. In some embodiments, all nucleosides having the antisense oligonucleotide or its continuous nucleotide sequence thereof are 2'-O-methoxyethyl nucleosides. In some embodiments, all nucleosides having the antisense oligonucleotide or its continuous nucleotide sequence thereof are 2'-O-methoxyethyl nucleosides. The 2'-O-MOE splicing regulators described herein may further comprise one or more phosphate thioester nucleoside internucleotides. In some embodiments, all nucleoside internucleotides in the antisense oligonucleotide or its continuous nucleotide sequence thereof are phosphate thioester nucleoside internucleotides. In some embodiments, the 2'-O-MOE splicing regulator is 12-30 nucleotides in length. For a full 2-O-MOE oligonucleotide, a length of at least 18 nucleotides is preferred to provide sufficient affinity for the target RNA.

[0208] polymer

[0209] In some embodiments, the oligomer or its continuous nucleotide sequence consists of a continuous sequence of a nucleotide nucleoside analog, such as an affinity-enhanced nucleotide nucleoside analog, referred to herein as a "holomembrane".

[0210] Holomers are single-stranded oligomers or their continuous nucleotide sequences that do not contain DNA or RNA nucleosides, and therefore contain only nucleoside analogs, or only non-naturally occurring nucleotides.

[0211] Oligomers, or their continuous nucleotide sequences, can be holopolymers—in fact, various holopolymers are designed to be highly effective as therapeutic oligomers, especially when used as splice-switching oligomers (SSOs).

[0212] In some embodiments, the holopolymer comprises at least one XYX or YXY sequence motif, such as or composed of repeating sequences XYX or YXY, wherein X is an LNA and Y is a substitute (i.e., non-LNA) nucleotide analog, such as a 2'-OMe RNA unit and a 2'-fluoroDNA unit. In some embodiments, the above sequence motif may be, for example, XXY, XYX, YXY, or YYX.

[0213] In some embodiments, the polymer may comprise or consist of a continuous nucleotide sequence between 8 and 16 nucleotides, such as 9, 10, 11, 12, 13, 14, or 15 nucleotides (such as between 8 and 12 nucleotides).

[0214] In some embodiments, the continuous nucleotide sequence of the holopolymer comprises at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as 95%, such as 100% LNA units. The remaining units may be selected from non-LNA nucleotide analogs mentioned herein, such as those selected from the group consisting of: 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, PNA units, HNA units, INA units and 2'-MOE RNA units, or the group consisting of 2'-OMe RNA units and 2'-fluoro-DNA units.

[0215] In some embodiments, the polymer consists of or contains a continuous nucleotide sequence consisting only of LNA units.

[0216] Mixtures

[0217] The term "hybrid" refers to an oligomer or a continuous nucleotide sequence thereof that contains DNA nucleosides and nucleoside analogs (both naturally occurring and non-naturally occurring nucleotides), wherein, unlike nicked polymers, tailed polymers, headed polymers and block polymers, it does not contain a continuous sequence of more than five naturally occurring DNA nucleotide nucleosides (such as DNA units).

[0218] The oligomers or their continuous nucleotide sequences according to the invention can be hybrids – in fact, various hybrids are designed to be highly effective as therapeutic oligomers, especially when used as splice regulation / splicing switching oligomers (SSO).

[0219] In some embodiments, the oligomer or its continuous nucleotide sequence may also be a hybrid, and in fact, the use of hybrids as therapeutic oligomers is considered particularly effective for reducing target RNA due to their ability to bind efficiently and specifically to their targets.

[0220] In some embodiments, the hybrid comprises a continuous nucleotide sequence of a nucleotide analog and a naturally occurring nucleotide repeat pattern, or a nucleotide analog of one type and a second type, or both. The repeat pattern may, for example, be a nucleotide analog such as LNA for each second or third nucleotide, and the remaining nucleotide may be a naturally occurring nucleotide such as DNA, or may be a 2'-substituted nucleotide analog, such as the 2' MOE of a 2' fluorinated analog as mentioned herein, or, in some embodiments, selected from the group of nucleotide analogs mentioned herein. It should be appreciated that the repeat pattern of the nucleotide analog such as LNA unit may be combined with a nucleotide analog at a fixed position (e.g., the 5' or 3' end).

[0221] In some embodiments, counting from the 3' end, the first nucleotide of the oligomer or blend is a nucleotide analog, such as an LNA nucleotide.

[0222] In some embodiments, they may be the same or different, counting from the 3' end, the second nucleotide of the oligomer or blend is a nucleotide analog, such as an LNA nucleotide.

[0223] In some embodiments, they may be the same or different, counting from the 3' end, the seventh and / or eighth nucleotides of the oligomer or blend are nucleotide analogs, such as LNA nucleotides.

[0224] In some embodiments, they may be the same or different, counting from the 3' end, the ninth and / or tenth nucleotides of the oligomer or blend are nucleotide analogs, such as LNA nucleotides.

[0225] In some embodiments, they may be the same or different, with the 5' end of the oligomer or blend being a nucleotide analog, such as an LNA nucleotide.

[0226] In some embodiments, the above design features can be incorporated into the design of hybrids, such as hybrid splicing-regulated oligonucleotides.

[0227] In some embodiments, the polymer does not contain regions of more than four consecutive DNA nucleotide units or three consecutive DNA nucleotide units. In some embodiments, the polymer does not contain regions of more than two consecutive DNA nucleotide units.

[0228] In some embodiments, the polymer comprises at least one region consisting of at least two consecutive nucleotide analog units (such as at least two consecutive LNA units).

[0229] In some embodiments, the polymer comprises at least one region consisting of at least three consecutive nucleotide analog units (such as at least three consecutive LNA units).

[0230] In some embodiments, the polymers of the present invention do not contain regions of more than 7 consecutive nucleotide analog units (such as LNA units). In some embodiments, the polymers of the present invention do not contain regions of more than 6 consecutive nucleotide analog units (such as LNA units). In some embodiments, the polymers of the present invention do not contain regions of more than 5 consecutive nucleotide analog units (such as LNA units). In some embodiments, the polymers of the present invention do not contain regions of more than 4 consecutive nucleotide analog units (such as LNA units). In some embodiments, the polymers of the present invention do not contain regions of more than 3 consecutive nucleotide analog units (such as LNA units). In some embodiments, the polymers of the present invention do not contain regions of more than 2 consecutive nucleotide analog units (such as LNA units).

[0231] Conjugate

[0232] As used herein, the term “conjugate” refers to an oligonucleotide covalently linked to a nonnucleotide moiety (conjugate moiety or region C or third region).

[0233] The conjugation of the oligonucleotide of the present invention to one or more non-nucleotide moieties can improve the pharmacology of the oligonucleotide, for example, by influencing the oligonucleotide's activity, cellular distribution, cellular uptake, or stability. In some embodiments, the conjugation moieties modify or enhance the pharmacokinetic properties of the oligonucleotide by improving its cellular distribution, bioavailability, metabolism, excretion, permeability, and / or cellular uptake. In particular, the conjugation can target the oligonucleotide to a specific organ, tissue, or cell type, thereby enhancing the oligonucleotide's effectiveness in such organ, tissue, or cell type. Simultaneously, the conjugation can be used to reduce the activity of the oligonucleotide in non-target cell types, tissues, or organs, such as off-target activity or activity in non-target cell types, tissues, or organs.

[0234] In one embodiment, the non-nucleotide portion (conjugated portion) is selected from the group consisting of carbohydrates, cell surface receptor ligands, pharmaceutical substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g., bacterial toxins), vitamins, viral proteins (e.g., capsids), or combinations thereof.

[0235] GalNAc conjugates

[0236] Conjugate moieties capable of binding to the desialyl glycoprotein receptor (ASGPRr) are particularly useful for targeting hepatocytes in the liver and are therefore advantageous. In some embodiments, the present invention provides a conjugate comprising the oligonucleotide of the present invention and the desialyl glycoprotein receptor targeting conjugate moieties. The desialyl glycoprotein receptor (ASGPR) conjugate moieties comprise one or more carbohydrate moieties capable of binding to the desialyl glycoprotein receptor (ASGPR targeting moieties) with an affinity equal to or greater than that of galactose. The affinity of many galactose derivatives for the desialyl glycoprotein receptor has been studied (e.g., Jobst, ST and Drickamer, K. JB. C. 1996, 271, 6686) or readily determined using methods typical in the art.

[0237] In one embodiment, the conjugate portion comprises at least one desialylate glycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-butyryl-galactosamine, and N-isobutyryl-galactosamine. Preferably, the desialylate glycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0238] To generate the ASGPR conjugate moiety, an ASPGR targeting moiety (preferably GalNAc) can be attached to the conjugate scaffold. Typically, the ASGPR targeting moiety can be located at the same end of the scaffold. In one embodiment, the conjugate moiety consists of two to four terminal GalNAc moieties attached to spacers that link each GalNAc moiety to a branched molecule that can conjugate with an antisense oligonucleotide.

[0239] In another embodiment, the conjugated portion is monovalent, divalent, trivalent, or tetravalent relative to the desialylate glycoprotein receptor-targeting portion. Preferably, the desialylate glycoprotein receptor-targeting portion comprises an N-acetylgalactosamine (GalNAc) portion.

[0240] The ASPGR targeting scaffold constituting the conjugate moiety can be generated, for example, by linking the GalNAc moiety to a spacer via its Cl carbon. A preferred spacer is a flexible hydrophilic spacer (US Patent 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39, pp. 1538-1546). A preferred flexible hydrophilic spacer is a PEG spacer. A preferred PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows two to three GalNAc moieties or other desialyl glycoprotein receptor targeting moieties to connect, and further allows the branch point to connect to an oligonucleotide; such constructs are called GalNAc clusters or GalNAc conjugate moieties. An exemplary branch point group is dilysine. A dilysine molecule contains three amine groups and a carboxyl reactive group; three GalNAc moieties or other desialyl glycoprotein receptor targeting moieties can be linked via the three amine groups, while the dilysine can be linked to an oligomer via the carboxyl reactive group. Khorev et al., 2008, Bioorg. Med. Chem. Vol. 16, page 5216, also describe the synthesis of suitable trivalent branching agents. Other commercially available branching agents are 1,3-bis-[5-(4,4'-dimethoxytriphenylmethoxy)pentylamino]propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramide (Glen Research catalog number: 10-1920-xx); tris-2,2,2-[3-(4,4'-dimethoxytriphenylmethoxy)propyloxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramide (Glen Research catalog number: 10-1922-xx); and tris-2,2,2-[3-(4,4'-dimethoxytriphenylmethoxy)propoxymethyl]methyleneoxypropyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide; and 1-[5-(4,4'-dimethoxytriphenylmethoxy)pentamido]-3-[5-fluorenmethoxy-carbonyl-oxy-pentamido]-propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide (Glen Research catalog number: 10-1925-xx).

[0241] Other GalNAc conjugate moieties may include, for example, those described in WO 2014 / 179620 and WO 2016 / 055601 and PCT / EP2017 / 059080 (incorporated herein by reference), as well as small peptides attached to GalNAc moieties, such as Tyr-Glu-Glu-(aminohexylGalNAc)3 (YEE(ahGalNAc)3; a glycotripeptide that binds to the desialyl glycoprotein receptor on hepatocytes, see, for example, Duff et al., Methods Enzymol, 2000, 313, 297); lysine-based galactose clusters (e.g., L3G4; Biessen et al., Cardovasc. Med., 1999, 214); and cholane-based galactose clusters (e.g., carbohydrate recognition motifs of the desialyl glycoprotein receptor).

[0242] The ASGPR conjugate moiety, particularly the trivalent GalNAc conjugate moiety, can be attached to the 3' or 5' end of an oligonucleotide using methods known in the art. In one embodiment, the ASGPR conjugate moiety is attached to the 5' end of the oligonucleotide.

[0243] In some embodiments, the conjugation moiety is trivalent N-acetylgalactosamine (GalNAc), such as those shown below:

[0244]

[0245] connector

[0246] A bond or linker is a connection between two atoms that links one target chemical group or segment to another via one or more covalent bonds. The conjugate portion can be attached to an oligonucleotide directly or through a linker portion (e.g., a linker or tie). Linkers are used to covalently link a third region, such as the conjugate portion (region C), to a first region, which is, for example, an oligonucleotide or a continuous nucleotide sequence or a notched polymer FG-F' (region A).

[0247] In some embodiments of the present invention, the conjugates or oligonucleotide conjugates of the present invention may optionally include a linker region (second region or region B and / or region Y) located between an oligonucleotide or continuous nucleotide sequence complementary to the target nucleic acid (region A or first region) and a conjugate portion (region C or third region).

[0248] Region B refers to a biocleavable linker containing physiologically unstable bonds or those composed of which are cleavable under conditions commonly encountered in mammals or similar conditions. Conditions under which a physiologically unstable linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reducing conditions or reagents, and salt concentrations encountered in mammalian cells or similar salt concentrations. Intracellular mammalian conditions also include enzymatic activities commonly present in mammalian cells, such as enzymatic activities from proteolytic enzymes or hydrolases or nucleases. In one embodiment, the biocleavable linker is sensitive to S1 nuclease cleavage. Biocleavable linkers containing DNA phosphodiester are described in detail in WO 2014 / 076195 (incorporated herein by reference), and also see Region D' or D' herein.

[0249] Region Y refers to a linker that is not necessarily bio-cleavable but primarily used to covalently link the conjugate portion (Region C or the third region) to the oligonucleotide (Region A or the first region). The Region Y linker may comprise repeating units such as ethylene glycol, amino acid units, or aminoalkyl chain structures or oligomers. The oligonucleotide conjugates of the present invention may be composed of the following regiomeric elements: AC, ABC, ABYC, AYBC, or AYC. In some embodiments, the linker (Region Y) is an aminoalkyl group such as a C2-C36 aminoalkyl group, including, for example, C6 to C12 aminoalkyl groups. In a preferred embodiment, the linker (Region Y) is a C6 aminoalkyl group.

[0250] treat

[0251] As used herein, the term "treatment" means treating an existing disease (such as the disease or ailment mentioned herein) or preventing a disease, i.e., prevention. Therefore, it should be understood that in some embodiments, the treatment referred to herein may be preventative.

[0252] application

[0253] The oligonucleotide or pharmaceutical compositions of the present invention can be administered topically, intravenously, or parenterally (such as intravenously, subcutaneously, intramuscularly, intracerebrally, intravenously, or intrathecally).

[0254] In a preferred embodiment, the oligonucleotide or pharmaceutical composition of the present invention is administered via a parenteral route, including intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, intrathecal or intracranial administration, such as intracerebral or intraventricular or intravitreal administration. In one embodiment, the active oligonucleotide or oligonucleotide conjugate is administered intravenously. In another embodiment, the active oligonucleotide or oligonucleotide conjugate is administered subcutaneously.

[0255] In some embodiments, the oligonucleotides, oligonucleotide conjugates, or pharmaceutical compositions of the present invention are administered at doses of 0.1–15 mg / kg, such as 0.2–10 mg / kg, or such as 0.25–5 mg / kg. Administration may be once weekly, once every two weeks, once every three weeks, or even once monthly.

[0256] This invention provides a method for engineering peptide epitopes in cells, the peptide epitopes being referred to herein as neoantigen peptides, the method comprising administering an effective amount of a splice-regulating oligonucleotide to cells, wherein the splice-regulating oligonucleotide targets RNA splicing events to regulate the splicing of RNA (hereinafter referred to as target RNA) at splice sites to produce an aberrant RNA transcript encoding an aberrant polypeptide containing the peptide epitope.

[0257] The method can be an in vitro method or an in vivo method.

[0258] For in vivo use, the expression of peptide epitopes (neoantigens) can be used to induce or enhance immune responses.

[0259] peptide epitopes

[0260] Peptide epitopes can be displayed on the cell surface, for example, via major histocompatibility complexes (e.g., MHC class I or II) or via membrane anchoring domains within anomalous peptides, or in some embodiments, they can be part of secretory peptides.

[0261] In some embodiments, the peptide epitope may be a novel peptide epitope that the cell does not synthesize if the splicing event is not regulated. However, it is also conceivable that the peptide epitope may be expressed at low levels in the cell (potentially a rare event or below detectable levels), and the method or use of the present invention can effectively enhance the expression of the regulated splicing event and the generation of the peptide epitope. In this case, the regulated splicing event in the method or use of the present invention is typically generally undetectable or rare. In some embodiments, in the absence of splice-regulating oligonucleotides, the aberrant RNA is not present in the cell, or represents less than 0.1% of the RNA population derived from the target gene, such as less than 0.01% or less than 0.001%.

[0262] In some embodiments, peptide epitopes are secreted from cells.

[0263] In some embodiments, peptide epitopes are presented on cells as MHCI class I or II molecules (or both).

[0264] In some embodiments, the polypeptide containing the peptide epitope also includes a membrane-binding domain. The use of target RNA encoding a membrane-binding domain (such as a transmembrane domain) can be to present the peptide epitope on the outer surface of the cell.

[0265] It should be understood that the presentation of peptide epitopes on cells or their secretion from cells can occur through the mechanisms described above or a combination of any other mechanisms.

[0266] In some embodiments, the peptide epitope is SEQ ID NO 188:RTSRLCCCPGIQIVP DR AWRIFQCFFV Q.

[0267] In some embodiments, the peptide epitope is SEQ ID NO 189: KANGIRWLQRQLPAH LG DTGH

[0268] In some embodiments, the peptide epitope is SEQ ID NO 190: QEQTDFAYDSGYGYE KP LRP

[0269] In some embodiments, the peptide epitope is SEQ ID NO 191: GRQALGHPEEPASHE LR QAEPLAPILL.

[0270] In some embodiments, the peptide epitope is SEQ ID NO 192: HCRGSNTVSDKDATD

[0271] The present invention provides a vaccine comprising peptide epitopes, such as peptide epitopes selected from the group consisting of SEQ ID NO 188, SEQ ID NO 189, SEQ ID NO 190, SEQ ID NO 191 and SEQ ID NO 192.

[0272] The present invention provides a polypeptide that is or comprises a peptide (such as a peptide selected from the group consisting of SEQ ID NO 188, SEQ ID NO 189, SEQ ID NO 190, SEQ ID NO 191 and SEQ ID NO 192); it can be used for treatment, such as as a vaccine or for immunotherapy.

[0273] target RNA

[0274] The target RNA can be any peptide or polypeptide encoding RNA, such as, advantageously, a precursor mRNA. It is well known that certain cancers are associated with the production of fusion transcripts (e.g., certain sarcomas, see, for example, Hofvander et al., Laboratory Investigation, Vol. 95, pp. 603-609 (2015)). In some embodiments, the target RNA can be a fusion transcript.

[0275] Although lncRNAs are generally considered non-coding, they apparently often encode short peptides (see, for example, Rion et al., Cell Research, Vol. 27, pp. 604-605 (2017)). In some embodiments, the target RNA is a lncRNA that encodes a peptide, or a lncRNA in which splicing regulation results in a peptide that is translated aberrantly.

[0276] In some embodiments, the RNA target is a precursor mRNA that is overexpressed in cancer cells (e.g., Cancer Genome Atlas TCGA).

[0277] Examples of target RNAs (and non-limiting examples of cancer types overexpressed): CEMIP (colon cancer), ETV4 (colon cancer), LRG5 (colon cancer), NOX1 (colon cancer), FOXP3 (T-REGS), IGF2BP3 (general cancer), MAGE-A4 (general cancer), NY-ESO-1 (general cancer), EWSR1 (sarcoma, aberrant splicing), FUS (sarcoma, aberrant splicing), SS18 (sarcoma, aberrant splicing).

[0278] splicing adjustment

[0279] Splicing regulation can be achieved by using antisense oligonucleotides that target intron / exon splicing sites or regions adjacent to splicing sites, or cis-acting elements or other splicing control regions (collectively and interchangeably referred to as splicing regulatory elements, regions or sequences).

[0280] With the advent of global RNA sequencing technology, potential splicing regulatory oligonucleotides can be screened in suitable cellular systems to identify splicing regulatory oligonucleotides that can effectively regulate splicing events and those that lead to the production of abnormal RNA encoding aberrant polypeptides.

[0281] Splicing regulation can be achieved by using antisense oligonucleotides targeting splicing sites on RNA targets. These oligonucleotides regulate alternative splicing by hybridizing with the precursor mRNA sequence involved in splicing; they are also known as splice-switching oligonucleotides. To regulate splicing of target RNAs, splicing regulators can be engineered to be complementary to or close to intron / exon boundaries or cis-elements that regulate splicing events (see, for example, [link to relevant documentation]). Figure 1 The diagram illustrates splicing regulatory events that can be achieved by antisense oligonucleotides.

[0282] Example of splicing adjustment: (See example for details) Figure 1 )

[0283] Many examples of splicing adjustment events are represented in Figure 1Non-limiting examples of splicing regulatory events that lead to changes in the peptide sequence encoded by the target RNA include splice skipping, splice addition, and splice shifting.

[0284] Splice skipping: Splice skipping refers to the regulation of splicing by skipping at least one exon region (or a portion of an exon) and optionally an intron region of a target RNA (e.g., precursor mRNA), resulting in a novel or aberrant polypeptide sequence encoded by the RNA region (e.g., mRNA). Skipping can be achieved by activating cryptic splice sites or other 3' or 5' splice sites.

[0285] In some embodiments, splicing regulatory oligonucleotides regulate the splicing of target RNAs (such as precursor mRNAs) to produce aberrant RNA transcripts introduced by regulated splicing events, wherein the aberrant RNA (such as mRNA) transcripts encode internal polypeptide deletions to produce aberrant polypeptides containing aberrant peptide sequences of regulated splicing events (e.g., by skipping one or more exons) to produce peptide epitopes.

[0286] Addition by splicing: Addition by splicing refers to the regulation of splicing by including at least one codon from an intron region, resulting in the addition of the codon to the polypeptide chain, thereby resulting in a new or aberrant polypeptide sequence encoded by an RNA region (e.g., mRNA). Addition by splicing can be achieved by activating a cryptic splice site or other 3' or 5' splice sites. In some embodiments, addition results in a codon frame shift (see Shift) or may result in the retention of the same codon frame.

[0287] In some embodiments, splicing regulatory oligonucleotides regulate the splicing of target RNA (such as precursor mRNA) to produce aberrant RNA transcripts (such as mRNA) introduced by regulated splicing events, wherein the aberrant RNA transcripts encode one or more codons from an intron region of the target RNA to produce aberrant polypeptides containing aberrant peptide sequences (the aberrant peptide sequences containing at least one or more peptides encoded by one or more codons from an intron region) to produce peptide epitopes.

[0288] Splice shift: Splice shift refers to a modulation in which splicing is regulated by including or deleting a portion of a codon, resulting in the introduction of a frame shift. In and downstream of the frame shift, this leads to the production of an aberrant polypeptide sequence, and optionally, further downstream, the generation of a stop codon (which can be an early stop codon or a "delayed" stop codon).

[0289] In some embodiments, splicing regulatory oligonucleotides regulate the splicing of target RNAs (such as precursor mRNAs) to produce aberrant RNA transcripts comprising a codon frameshift introduced by a regulated splicing event, wherein the aberrant RNA transcript produces a polypeptide having a C-terminal region of at least one amino acid, said at least one amino acid C-terminal region being transcribed from a region of the aberrant RNA transcript at the codon frameshift or from a region of the aberrant RNA transcript at the 3' of the codon frameshift. Peptide epitopes derived from codon frameshifts (splicing shifts).

[0290] In some embodiments, splicing of a precursor mRNA with a splicing regulatory oligonucleotide (e.g., at a splice site or splice regulatory region) is used to produce an aberrant mRNA transcript and introduce a codon frameshift at the regulated splice site, wherein the aberrant mRNA transcript produces a polypeptide having a C-terminal region of at least one amino acid, said at least one amino acid C-terminal region being transcribed from the region of the aberrant mRNA transcript at the codon frameshift or from the region of the aberrant mRNA transcript at the 3' end of the codon frameshift. In some embodiments, the length of the C-terminal region is transcribed from the region of the aberrant mRNA transcript at the codon frameshift or from the region of the aberrant mRNA transcript at the 3' end of the codon frameshift, and is at least 8 amino acids long, such as at least 9 or at least 10 amino acids, such as 8, 9, 10, 11, 12, 13, or 14 amino acids. It should be understood that in some embodiments, the peptide epitope can be formed by a combination of the N-terminal region of a polypeptide encoded by the aberrant RNA region upstream of the codon frameshift and the C-terminal region encoded downstream of the codon frameshift. Alternatively, peptide epitopes can be formed from C-terminal regions located in or downstream of the codon frame shift.

[0291] Peptide epitopes can be presented on the cell surface (e.g., via the major histocompatibility complex or by using target RNA encoding an upstream membrane-binding domain). Alternatively, peptide epitopes can be secreted. The use of splice-regulated oligonucleotides to enhance the secretion of peptide isoforms is well known (e.g., TNFR2), so it is conceivable that the methods of the present invention could also result in the simultaneous presentation and secretion of peptide epitopes on the cell surface—indeed, this could be highly advantageous when triggering or enhancing an immune response to peptide epitopes.

[0292] cell

[0293] In the context of this invention, the cells may be in vitro or in vivo, and may be cells associated with a disease phenotype, such as cancer cells expressing the target RNA. In some embodiments, the cell overexpresses the target RNA compared to cells derived from the same tissue unrelated to the disease phenotype. Examples provide illustrative methods for identifying such target RNAs.

[0294] In some embodiments, the cell is a cancer cell, such as a tumor cell, such as a colon cancer cell, a metastatic colon cancer cell, or a metastatic colon cancer cell in the liver.

[0295] In some embodiments, cancer or cancer cells are selected from the group consisting of: bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer, kidney cancer, leukemia, liver cancer, lung cancer, melanoma, lymphoma, pancreatic cancer, prostate cancer, thyroid cancer, soft tissue sarcoma, brain cancer, cervical cancer, skin cancer, bone cancer, bile duct cancer, esophageal cancer, stomach cancer, testicular cancer, and head and neck cancer.

[0296] Another advantage of targeting cancer cells is that the nonsense-mediated decay (NMD) mechanism of aberrant RNA is usually reduced or inactivated in tumor cells (which is also common in cells infected with viruses, for example).

[0297] It is well known that antisense oligonucleotides are preferentially taken up in the liver and kidneys. In some embodiments, the cells are hepatocytes or kidney cells.

[0298] However, for use in the methods of the present invention, where the method results in gain of function (generation of peptide epitopes), efficient uptake into target cells may not be necessary, only that sufficient oligonucleotides enter the cells to modulate splicing events of the target RNA. Given the amplification provided by the immune system, for example, 0.5% or more of splicing regulation can effectively generate functional amounts of peptide epitopes. Therefore, the methods of the present invention are not limited to use in liver or kidney cells, but are generally applicable to any tissue or cell type. Furthermore, recent results from the inventors' laboratory indicate that, in contrast to RNaseH-recruiting nick polymers, very low cellular uptake of oligonucleotides for splice-switching oligonucleotides can and often does lead to significant modulation of splicing events.

[0299] In some embodiments, the cells may be selected from the group consisting of: hepatocytes, kidney cells, mesenteric lymph node cells, bone marrow cells, immune cells, monocytes, macrophages, T cells, B cells, spleen cells, uterine cells, ovarian cells, duodenal cells, colon cells, ileal cells, jejunal cells, adipocytes, lung cells, muscle cells, gastric cells, pancreatic cells, heart cells, retinal cells, brain cells, neurons, dendritic cells, or dorsal root ganglion cells.

[0300] Splice-switching oligonucleotides can be administered to cells by any suitable means, including in vitro use, via gymnosis, transfection, or electroporation. For in vivo use, administration can be via systemic or local delivery. In some embodiments, the cells may be tissues or cells that have been isolated from the subject and then processed by the method of the present invention before reintroduction into the subject (ex vivo administration).

[0301] Cancer target RNA

[0302] The method of this invention is particularly useful for targeting cancer cells. First, it is well known that the transcriptional control of several RNA transcripts is dysregulated in cancer cells, such as the Cancer Genome Atlas (TCGA).

[0303] In some embodiments, the precursor mRNA is selected from the group consisting of: CEMIP, ETV4, LRG5, NOX1, FOXP3, IGF2BP3, MAGE-A4, NY-ESO-1, EWSR1, FUS, and SS18.

[0304] Internal and therapeutic uses

[0305] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0306] a. Vaccinate the subject using a reagent containing or encoding a peptide epitope;

[0307] b. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets a target RNA in the subject's target cells and regulates the splicing of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0308] To trigger or enhance the subject's immune response to peptide epitopes (such as target cells expressing peptide epitopes);

[0309] Steps a and b can be performed in the following order: step a first, then step b; step b first, then step a; or steps a and b simultaneously.

[0310] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0311] a. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets a target RNA in the subject's target cells and regulates RNA splicing to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0312] b. Administering antibodies to the subject, wherein the antibodies are specific for peptide epitopes.

[0313] To trigger or enhance the subject’s immune response to a peptide epitope (such as a target cell expressing a peptide epitope); wherein steps a. and b. may be performed in the order of step a. first then step b., or step b. first then step a., or steps a. and b. simultaneously.

[0314] The present invention provides a method for immunomodulating target cells of a subject, the method comprising the step of administering a splice-regulating oligonucleotide to the subject, wherein the splice-regulating oligonucleotide targets target RNA in the subject's target cells and modulates RNA splicing to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope; to trigger or enhance the subject's immune response to the peptide epitope (such as target cells expressing the peptide epitope).

[0315] This invention provides a method for treating a subject's disease with immunotherapy, the method comprising the following steps:

[0316] a. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets a target RNA in the subject's target cells and regulates the splicing of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0317] b. Administering immunotherapy antibodies to subjects, wherein the immunotherapy antibodies are specific for peptide epitopes;

[0318] To trigger or enhance the subject’s immune response to peptide epitopes (such as peptide epitopes expressed on target cells); wherein steps a. and b. may be performed in the order of step a. first then step b., or step b. first then step a., or steps a. and b. simultaneously.

[0319] The present invention provides a method for immunomodulating target cells of a subject, the method comprising administering a splice-regulating oligonucleotide to the subject, wherein the splice-regulating oligonucleotide targets an RNA splicing site or splicing regulatory element in the subject's target cells and modulates RNA splicing at the splicing site or splicing regulatory element to produce an aberrant mRNA transcript encoding an aberrant polypeptide containing a peptide epitope; wherein the aberrant epitope is immunogenic to the subject; to trigger or enhance the subject's immune response to the target cells.

[0320] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0321] a. Vaccinate the subject using a reagent containing or encoding a peptide epitope;

[0322] b. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets an RNA splice site or splice-regulating element in the subject's target cells and regulates RNA splicing at the splice site or splice-regulating element to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0323] To trigger or enhance the subject's immune response to target cells;

[0324] Steps a and b can be performed in the following order: step a first, then step b; step b first, then step a; or steps a and b simultaneously.

[0325] This method leads to the expression or enhanced expression of peptide epitopes in target cells, resulting in the triggering or enhancement of an immune response.

[0326] In some embodiments, between steps a and b or b and a, step c may be optionally waited for, for example, to allow the subject to generate an adaptive immune response to the antigenic peptide (in the order of steps a, c, b), or to allow the epitope peptide to be expressed on target cells (in the order of steps b, c, a).

[0327] This invention provides a method for immunomodulating target cells in a subject, the method comprising the following steps:

[0328] a. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets an RNA splice site or splice-regulating element in the subject's target cells and regulates RNA splicing at the splice site or splice-regulating element to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0329] b. Administering antibodies to the subject, wherein the antibodies are specific for peptide epitopes.

[0330] To trigger or enhance the subject's immune response to target cells, wherein steps a. and b. may be performed in the order of step a. first then step b., or step b. first then step a., or steps a. and b. simultaneously.

[0331] This method results in the expression or enhanced expression of peptide epitopes in target cells, leading to the triggering or enhancement of an immune response, particularly when the antibody is administered in step b.

[0332] Waiting step c can be performed between steps a and b, for example, to allow the peptide epitope to be expressed in the target cells (in the order of steps a, b, c).

[0333] This invention provides the use of splicing to regulate the production of peptide epitopes from oligonucleotides in cells.

[0334] This invention provides the use of splice-switching oligonucleotides in immunotherapy treatments (e.g., for cancer), wherein the splice-switching oligonucleotides target RNA to produce abnormal RNA transcripts encoding abnormal polypeptides containing peptide epitopes in cells (e.g., cancer cells); wherein the immunotherapy treatment comprises administering a therapeutic antibody that recognizes the peptide epitopes to a subject.

[0335] This invention provides the use of splice-switching oligonucleotides in cancer vaccine therapy, wherein the splice-switching oligonucleotides target RNA to produce abnormal RNA transcripts encoding abnormal polypeptides containing peptide epitopes in cancer cells, wherein the vaccine therapy causes the subject to produce or enhance an immune response to the peptide epitopes.

[0336] Immunotherapy

[0337] Immunotherapy is a treatment that utilizes and enhances the adaptive immune system of a subject (patient) to treat a disease, and it is widely used in cancer treatment, where it is referred to as cancer immunotherapy. In some embodiments, immunotherapy uses antibody therapeutics, which may be, for example, antibodies specific to peptide epitopes, or antibodies that enhance the subject's immune response to a disease such as cancer.

[0338] Vaccines and vaccination

[0339] Vaccination refers to the treatment with a vaccine to produce immunity against a disease. Vaccination causes the adaptive immune system to activate against an antigen, which may be present in the vaccine or encoded in a nucleic acid present in the vaccine (such as in the form of DNA, RNA, or viral vaccines – collectively referred to herein as nucleic acid vaccines). In some embodiments, the vaccine comprises a peptide epitope, or a nucleic acid vaccine encoding a peptide epitope. Delivery of a nucleic acid vaccine to a subject results in the expression of the peptide epitope in the subject, thereby leading to an immune response to the peptide epitope. Vaccines typically contain an adjuvant that enhances the development of the subject's immunity.

[0340] In some embodiments, the vaccine is used to treat a subject's cancer, such as cancer cells. Such a vaccine is called a cancer vaccine.

[0341] medicinal salt

[0342] The splice-regulating oligonucleotides used in this invention can exist in the form of their pharmaceutical salts. The term "pharmaceutical salt" refers to a conventional acid-addition salt or base-addition salt that retains the biological efficacy and properties of the compounds of this invention and is formed from a suitable non-toxic organic or inorganic acid or organic or inorganic base. Acid-addition salts include, for example, salts derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, aminosulfonic acid, phosphoric acid, and nitric acid, as well as salts derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, fumaric acid, etc. Base-addition salts include salts derived from ammonium, potassium, sodium, and quaternary ammonium hydroxides, such as tetramethylammonium hydroxide. Chemically modifying pharmaceutical compounds into salts is a well-known technique in medicinal chemists to obtain improvements in the physical and chemical stability, hygroscopicity, flowability, and solubility of the compounds. For example, see Bastin, Organic Process Research & Development 2000, 4, 427-435, or Ansel, In: Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th Edition (1995), pp. 196 and 1456-1457. For example, the pharmaceutical salts of the compounds provided herein may be sodium salts.

[0343] In another aspect, the present invention utilizes pharmaceutical salts of the aforementioned antisense oligonucleotides or their conjugates. In a preferred embodiment, the pharmaceutical salt is a sodium or potassium salt.

[0344] Pharmaceutical Composition

[0345] In another aspect, the pharmaceutical compositions used in this invention comprise any of the aforementioned oligonucleotides and / or oligonucleotide conjugates or their salts, as well as a pharmaceutical diluent, carrier, salt, and / or adjuvant. The pharmaceutical diluent includes phosphate-buffered saline (PBS), and the pharmaceutical salt includes, but is not limited to, sodium and potassium salts. In some embodiments, the pharmaceutical diluent is sterile phosphate-buffered saline. In some embodiments, the oligonucleotide is used in the pharmaceutical diluent at a concentration of 50 to 300 μM solution. In some embodiments, the oligonucleotides of this invention are administered at a dose of 10-1000 μg.

[0346] Formulations suitable for use in this invention can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th edition, 1985. For a brief overview of drug delivery methods, see, for example, Langer (Science 249:1527-1533, 1990). WO 2007 / 031091 further provides suitable and preferred examples of pharmaceutical diluents, carriers, and adjuvants (incorporated herein by reference). WO 2007 / 031091 also discusses appropriate dosages, formulations, routes of administration, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations.

[0347] Exosomal preparations are advantageous agents for splicing-regulating oligonucleotides.

[0348] Oligonucleotides or oligonucleotide conjugates can be mixed with pharmaceutically active or inert substances to prepare pharmaceutical compositions or formulations. The composition and the method of forming the pharmaceutical composition formulation depend on several criteria, including but not limited to, route of administration, disease severity, or dosage to be administered.

[0349] These compositions can be sterilized using conventional sterilization techniques or by filtration. The aqueous solutions thus prepared can be packaged for use or lyophilized, with the lyophilized formulation bound to a sterile aqueous carrier before application. The pH of the formulation is typically between 3 and 11, more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting solid compositions can be packaged into multiple single-dose units, each containing a fixed amount of one or more of the above-mentioned reagents, such as in sealed packages of tablets or capsules. The solid compositions can also be packaged in containers to allow for flexible dosage adjustments, such as in squeeze tubes for topical application of creams or ointments.

[0350] In some embodiments, the oligonucleotide or oligonucleotide conjugate of the present invention is a precursor drug. In particular, for oligonucleotide conjugates, in some embodiments, after the precursor drug is delivered to a site of action such as a target cell, the conjugate portion can be cleaved from the oligonucleotide.

[0351] Application of oligonucleotides

[0352] The oligonucleotides or pharmaceutical compositions used in this invention can be administered topically, intravenously, or parenterally (e.g., intravenously, subcutaneously, intramuscularly, intracerebrally, intravenously, or intrathecally).

[0353] In a preferred embodiment, the oligonucleotide or pharmaceutical composition of the present invention is administered via a parenteral route, including intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, intrathecal or intracranial administration, such as intracerebral or intraventricular or intravitreal administration. In one embodiment, the active oligonucleotide or oligonucleotide conjugate is administered intravenously. In another embodiment, the active oligonucleotide or oligonucleotide conjugate is administered subcutaneously.

[0354] In some embodiments, the oligonucleotides, oligonucleotide conjugates, or pharmaceutical compositions of the present invention are administered at doses of 0.1–15 mg / kg, such as 0.2–10 mg / kg, or such as 0.25–5 mg / kg. Administration may be once weekly, once every two weeks, once every three weeks, or even once monthly.

[0355] In some embodiments, oligonucleotides are administered as exosome preparations.

[0356] exosomes

[0357] Exosomes are natural biological nanovesicles, typically ranging from 30 to 500 nm in size, that participate in intercellular communication through functionally active substances such as miRNA, mRNA, DNA, and proteins.

[0358] Exosomes are secreted by all types of cells and are also found in abundance in bodily fluids such as saliva, blood, urine, and milk. The primary function of exosomes is to carry information by transferring various effectors or signaling molecules between specific cells (Acta Pol Pharm. 2014 Jul-Aug; 71(4):537-43.). Such effectors or signaling molecules can be, for example, proteins, miRNAs, or mRNAs. Currently, exosomes are being explored as delivery vectors for various drug molecules, including RNA therapeutic molecules, to expand the therapeutic and diagnostic applications of these molecules. Existing literature in the field of exosome technology has shown that exosomes loaded with synthetic molecules (such as siRNA, antisense oligonucleotides, and small molecules) have advantages in molecular delivery and efficacy compared to free drug molecules (see, for example, Andaloussi et al 2013 Advanced Drug Delivery Reviews 65:391-397, WO2014 / 168548, WO2016 / 172598, WO2017 / 173034, and WO 2018 / 102397).

[0359] Exosomes can be isolated from biological sources, such as milk (milk exosomes), and bovine milk is a particularly rich source for isolating bovine milk exosomes. See, for example, Manca et al., Scientific Reports (2018) 8: 11321.

[0360] In some embodiments of the invention, splicing regulatory oligonucleotides are encapsulated in exosomes (exosomal formulations). Examples of loading exosomes with single-stranded antisense oligonucleotides are described in European Application No. 18192614.8. In the methods of the invention, splicing regulatory oligonucleotides can be administered to cells or subjects in the form of exosomal formulations, and oral administration of exosomal formulations is particularly envisioned.

[0361] In some embodiments, splice-regulating oligonucleotides can be conjugated with, for example, lipophilic conjugates such as cholesterol, which can be covalently linked to the splice-regulating oligonucleotide via a biocompatible linker (e.g., a phosphodiester-linked DNA nucleotide region). Such lipophilic conjugates can facilitate the formulation of splice-regulating oligonucleotides into exosomes and can further enhance delivery to target cells.

[0362] Checkpoint inhibitors

[0363] Therapeutic approved immune checkpoint inhibitors (which can be used in the treatments and uses of this invention) include, for example,

[0364] Ipilimumab CTLA-4 2011 Nivolumab PD-1 2014 Pembrolizumab PD-1 2014 Atezolizumab PD-L1 2016 Acimenone PD-L1 2017 durvalumab PD-L1 2017

[0365] treat

[0366] As used herein, the term "treatment" means treating an existing disease (such as the disease or ailment mentioned herein) or preventing a disease, i.e., prevention. Therefore, it should be understood that in some embodiments, the treatment referred to herein may be preventative.

[0367] application

[0368] The oligonucleotide or pharmaceutical compositions of the present invention can be administered topically, intravenously, or parenterally (such as intravenously, subcutaneously, intramuscularly, intracerebrally, intravenously, or intrathecally).

[0369] In a preferred embodiment, the oligonucleotide or pharmaceutical composition of the present invention is administered via a parenteral route, including intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, intrathecal or intracranial administration, such as intracerebral or intraventricular or intravitreal administration. In one embodiment, the active oligonucleotide or oligonucleotide conjugate is administered intravenously. In another embodiment, the active oligonucleotide or oligonucleotide conjugate is administered subcutaneously.

[0370] In some embodiments, the oligonucleotides, oligonucleotide conjugates, or pharmaceutical compositions of the present invention are administered at doses of 0.1–15 mg / kg, such as 0.2–10 mg / kg, or such as 0.25–5 mg / kg. Administration may be once weekly, once every two weeks, once every three weeks, or even once monthly.

[0371] Splice adjustment example

[0372] The following embodiments of the present invention relate to the splicing adjustment aspect of the present invention.

[0373] 1. A method for engineering a peptide epitope in a cell, the method comprising administering an effective amount of a splice-regulating oligonucleotide to the cell, wherein the splice-regulating oligonucleotide targets a target RNA to regulate the splicing of the target RNA, thereby producing an aberrant RNA transcript encoding an aberrant polypeptide containing the peptide epitope.

[0374] 2. The method according to Example 1, wherein:

[0375] a) The splicing regulatory oligonucleotide regulates the splicing of the target RNA (e.g., precursor mRNA) to produce an aberrant RNA transcript introduced by a regulated splicing event, wherein the aberrant RNA (e.g., mRNA) transcript encodes an internal polypeptide deletion to produce an aberrant polypeptide containing an aberrant peptide sequence under the regulated splicing event (e.g., by skipping one or more exons), thereby generating the peptide epitope; and / or

[0376] b) Splice-regulating oligonucleotides regulate the splicing of target RNAs (such as precursor mRNAs) to produce aberrant RNA transcripts (such as mRNAs) introduced by regulated splicing events, wherein the aberrant RNA transcripts encode one or more codons from an intron region of the target RNA to produce aberrant polypeptides containing aberrant peptide sequences (the aberrant peptide sequences containing at least one or more peptides encoded by one or more codons from an intron region) to produce peptide epitopes; and / or

[0377] c) The splicing regulatory oligonucleotide regulates the splicing of the target RNA (e.g., precursor mRNA) to produce an aberrant RNA transcript comprising a codon frame shift introduced by the regulated splicing event, wherein the aberrant RNA transcript produces a polypeptide having a C-terminal region having at least one amino acid, the C-terminal region being transcribed from a region of the aberrant RNA transcript at the codon frame shift or from a region of the aberrant RNA transcript at the 3' position of the codon frame shift.

[0378] 3. The method according to any one of Examples 1 or 2, wherein the cell is a cancer cell, such as a tumor, lung cancer cell, breast cancer cell, colon cancer cell, metastatic colon cancer cell, or metastatic colon cancer cell in the liver.

[0379] 4. The method according to any one of Examples 1-3, wherein the method is an in vitro method or an in vivo method.

[0380] 5. The method according to any one of Examples 1-4, wherein the target RNA is an RNA overexpressed in cancer cells.

[0381] 6. The method according to any one of Examples 1-5, wherein the peptide epitope is secreted from the cell.

[0382] 7. The method according to any one of Examples 1-6, wherein the peptide epitope is presented on the cell as an MHC class I or II molecule.

[0383] 8. The method according to any one of Examples 1-7, wherein the polypeptide containing the peptide epitope further comprises a membrane-binding domain.

[0384] 9. The method according to any one of Examples 1-7, wherein the RNA is a precursor mRNA, such as (e.g., human) precursor mRNA selected from the group consisting of: CEMIP, ETV4, LRG5, NOX1, FOXP3, IGF2BP3, MAGE-A4, NY-ESO-1, EWSR1, FUS, PARPBP and SS18.

[0385] 10. The method according to any one of Examples 1-7, wherein:

[0386] a) The precursor mRNA is CEMIP, wherein the antisense oligonucleotide comprises a continuous nucleotide sequence of at least 10 nucleotides (such as at least 12 nucleotides) that is 100% identical to a sequence selected from 1-82 or 193-274.

[0387] b) The precursor mRNA is ETV4, wherein the antisense oligonucleotide comprises a continuous nucleotide sequence of at least 10 nucleotides (such as at least 12 nucleotides) that is 100% identical to a sequence selected from 83-164.

[0388] 11. The method according to any one of Examples 1-10, wherein the splicing regulatory oligonucleotide comprises a 2' sugar-modified nucleoside, such as a 2' sugar-modified nucleoside independently selected from: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleoside, and LNA nucleoside.

[0389] 12. The method according to any one of Examples 1-11, wherein the splice-regulating oligonucleotide comprises a modified nucleoside internucleotide bond, such as a phosphate thioside internucleotide bond.

[0390] 13. The method according to any one of Examples 1-12, wherein the splicing regulatory oligonucleotide is a 2'-O-MOE oligonucleotide.

[0391] 14. The method according to any one of Examples 1-13, wherein the splicing regulatory oligonucleotide is an LNA oligonucleotide, such as an LNA polymer.

[0392] 15. The method according to any one of Examples 1-10, wherein the splicing regulatory oligonucleotide is a morpholino oligonucleotide.

[0393] 16. A method for immunomodulating target cells of a subject, the method comprising the steps of:

[0394] a. Vaccinate the subject using a reagent containing or encoding a peptide epitope;

[0395] b. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets a target RNA in the subject's target cells and regulates the splicing of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope.

[0396] To trigger or enhance the subject's immune response to peptide epitopes (such as target cells expressing peptide epitopes);

[0397] Steps a and b can be performed in the following order: step a first, then step b; step b first, then step a; or steps a and b simultaneously.

[0398] 17. A method for immunomodulating target cells of a subject, the method comprising the following steps:

[0399] a. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets a target RNA in the subject's target cells and regulates RNA splicing to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0400] b. Administering antibodies to the subject, wherein the antibodies are specific for peptide epitopes.

[0401] To trigger or enhance the subject’s immune response to a peptide epitope (such as a target cell expressing a peptide epitope); wherein steps a. and b. may be performed in the order of step a. first then step b., or step b. first then step a., or steps a. and b. simultaneously.

[0402] 18. A method for immunomodulating target cells of a subject, the method comprising the step of administering a splice-regulating oligonucleotide to the subject, wherein the splice-regulating oligonucleotide targets target RNA in the subject's target cells and modulates RNA splicing to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope; to trigger or enhance an immune response of the subject to the peptide epitope (such as target cells expressing the peptide epitope).

[0403] 19. The method according to any one of Examples 16-18, wherein the method further comprises the step of administering a checkpoint inhibitor (such as a PDL1 inhibitor, PD1 inhibitor, or CTLA-4 inhibitor) to the subject.

[0404] 20. A method of treating a subject's disease with immunotherapy, the method comprising the following steps:

[0405] a. Administering a splice-regulating oligonucleotide to a subject, wherein the splice-regulating oligonucleotide targets a target RNA in the subject's target cells and regulates the splicing of the target RNA to produce an aberrant RNA transcript encoding an aberrant polypeptide containing a peptide epitope;

[0406] b. Administering immunotherapy antibodies to subjects, wherein the immunotherapy antibodies are specific for peptide epitopes;

[0407] To trigger or enhance the subject’s immune response to peptide epitopes (such as peptide epitopes expressed on target cells); wherein steps a. and b. may be performed in the order of step a. first then step b., or step b. first then step a., or steps a. and b. simultaneously.

[0408] 21. The method according to any one of Examples 16-20, wherein the method is a method for treating cancer.

[0409] 22. The method according to any one of Examples 16-21, wherein the cell is a cancer cell, such as a tumor, lung cancer cell, breast cancer cell, colon cancer cell, metastatic colon cancer cell, or metastatic colon cancer cell in the liver.

[0410] 23. The method according to any one of Embodiments 16-22, wherein step a) comprises the method according to any one of Embodiments 1-15; or the method according to Embodiment 16, or any one of Embodiments 20 or 21 depending on Embodiment 16, wherein step c comprises the method according to any one of Embodiments 1-15.

[0411] 24. The use of splicing-regulated oligonucleotides for the generation of peptide epitopes in cells.

[0412] 25. Use of splice-regulating oligonucleotides in immunotherapy for cancer treatment, wherein the splice-regulating oligonucleotides target RNA to produce abnormal RNA transcripts encoding abnormal polypeptides containing peptide epitopes in cancer cells; wherein the immunotherapy treatment comprises the administration of a therapeutic antibody that recognizes the peptide epitopes.

[0413] 26. Use of splice-regulating oligonucleotides in cancer vaccine therapy, wherein splice-regulating oligonucleotides target RNA to produce abnormal RNA transcripts encoding abnormal polypeptides containing peptide epitopes, wherein the vaccine therapy induces or enhances an immune response to the peptide epitopes in the subject.

[0414] 27. An antisense oligonucleotide capable of regulating the splicing of CEMIP precursor mRNA, wherein the antisense oligonucleotide comprises a continuous nucleotide sequence of at least 10 nucleotides (such as at least 12 nucleotides) having 100% identity with a sequence selected from SEQ ID NO 1-82 or SEQ ID NO 193-274.

[0415] 28. An antisense oligonucleotide capable of regulating the splicing of ETV4 precursor mRNA, wherein the antisense oligonucleotide comprises a continuous nucleotide sequence of at least 10 nucleotides (such as at least 12 nucleotides) having 100% identity with a sequence selected from SEQ ID NO 83-164.

[0416] 29. A splicing regulatory antisense oligonucleotide comprising or consisting of sequences 1-164, or selected from the group consisting of O1-O164 or O165-O246.

[0417] 30. A vaccine or immunotherapeutic agent comprising a peptide epitope, such as a peptide epitope selected from group 188, 189, 190, 191 or 192.

[0418] 31. A polypeptide that is or comprises a peptide, such as a peptide selected from group 188, 189, 190, 191 or 192.

[0419] 32. A polypeptide, which is or comprises a peptide (such as a peptide selected from group 188, 189, 190, 191 or 192), for use in pharmaceuticals, such as as a vaccine or immunotherapeutic agent.

[0420] Example

[0421] Example 1. The novel splicing ligation between exon 6 and exon 8 in CEMIP mRNA is induced by specific oligonucleotides. (Results are as follows) Figure 2 As shown):

[0422] To induce novel splicing between exon 6 and exon 8 based on the transcript isoform CEMIP-201 transcript (ENST00000220244.7), we designed oligonucleotides targeting the CEMIP exon 7 sequence.

[0423] 4x10 3Colo-205 cells were seeded in 96-well plates and cultured in RPMI medium supplemented with 10% FBS and 1% pen / strep. Forty-one different oligonucleotides (or loaders only, PBS) targeting the CEMIP precursor mRNA sequence were added to the cells at a final concentration of 25 μM. After 4 days, cells were harvested, and RNA was extracted using the RNeasy Mini Extraction Kit (Qiagen). cDNA was generated using the iScript Advanced cDNA Synthesis Kit and analyzed by ddPCR (Biorad). The expression level of CEMIP mRNA containing induced exon 6 / exon 8 splicing is expressed as a percentage of total CEMIP transcripts. Analysis was performed using QuantaSoft software (Biorad). The following probe-based assays were used to detect splicing events: CEMIP exon 6 / exon 8 ligation (forward primer GCGATGAACCAAATTGGGAAG (SEQ ID NO 167), reverse primer GCCATGCTCTGTCTGGAA (SEQ ID NO 168), probe / 56-FAM / CACCTTGGA / ZEN / TTTAGGACATCGAGGCTC / 3IABkFQ / - (SEQ ID NO 169)); total CEMIP (forward primer CTCGGTGCTGAGGTTAACTC (SEQ ID NO 170), reverse primer TCAGACTAAAGGTGGGGAGAA (SEQ ID NO 171), probe / 5HEX / TCAGACCTC / ZEN / TGGAAAGCTCACCCA / 3IABkFQ / SEQ ID NO 172). Compared to wild-type CEMIP mRNA, the induced exon 6 / exon 8 linker caused a frameshift in the mRNA coding sequence, followed by the appearance of a new 28-amino acid polypeptide (RTSRLCCCPGIQIVPD RA WRIFQCFFVQ, SEQ ID NO 188) in the C-terminal region of CEMIP.

[0424] The following oligonucleotides containing LNA are used to induce changes in splicing events. All internucleotide bonds are phosphate thioesters. Uppercase and lowercase letters represent LNA and DNA nucleobases, respectively.

[0425]

[0426]

[0427] Example 2. The novel splicing ligation between exon 27 and exon 29 in CEMIP mRNA is induced by specific oligonucleotides. (Results are shown below) Figure 3 (As shown)

[0428] To induce novel splicing between exon 27 and exon 29 based on the transcript isoform CEMIP-201 transcript (ENST00000220244.7), we designed oligonucleotides to target CEMIP precursor mRNA at flanking or overlapping sites of the CEMIP exon 28 sequence: catgcccactttctccagtttgctctctccctctggtctaattggtttcttctcacacagTTCCATAGTGCTTATGGCATCAAAGGGAAGATACGTCTCCAGAGGCCCATGGACCAGAGTGCTGGAAAAGCTTGGGGCAGACAGGGGTCTCAAGTTGAAAGgtaagggtttgaactggggtttaaactgaccccaaaaccagagaaggcaaatgc (SEQ ID NO 297, where exon 28 nucleotides are represented by uppercase letters and lowercase letters represent flanking intron sequences).

[0429] 4x10 3Colo-205 cells were seeded in 96-well plates and cultured in RPMI medium supplemented with 10% FBS and 1% pen / strep. Forty-one different oligonucleotides (or loaders only, PBS) targeting the CEMIP precursor mRNA sequence were added to the cells at a final concentration of 25 μM. After 4 days, cells were harvested, and RNA was extracted using the RNeasy Mini Extraction Kit (Qiagen). cDNA was generated using the iScript Advanced cDNA Synthesis Kit and analyzed by ddPCR (Biorad). The expression level of CEMIP mRNA containing induced exon 27 / exon 29 splicing is expressed as a percentage of total CEMIP transcripts. Analysis was performed using QuantaSoft software (Biorad). The following probe-based assays were used to detect splicing events: CEMIP exon 27 / exon 29 ligation (forward primer GGAACTCCATTCTGCAAGG (SEQ ID NO 173), reverse primer CCTCAGTGTCCAGTGTCA (SEQ ID NO 174), / 56-FAM / CCA TCCCTG / ZEN / ACAAAGCAAATGGCATTC / 3IABkFQ / (SEQ ID NO 175)); total CEMIP (forward primer CTCGGTGCTGAGGTTAACTC (SEQ ID NO 176), reverse primer TCAGACTAAAGGTGGGGAGAA (SEQ ID NO 177), probe / 5HEX / TCAGACCTC / ZEN / TGGAAAGCTCACCCA / 3IABkFQ / (SEQ ID NO 172)). Compared to wild-type CEMIP mRNA, the induced exon 27 / exon 29 linking resulted in a frameshift in the mRNA coding sequence, followed by the appearance of a new 21-amino acid polypeptide (KANGIRWLQRQLPAH LG DTGH, SEQ ID NO 189) in the C-terminal region of CEMIP.

[0430] The following oligonucleotides containing LNA are used to induce changes in splicing events. All internucleotide bonds are phosphate thioesters. Uppercase and lowercase letters represent LNA and DNA nucleobases, respectively.

[0431]

[0432]

[0433] Example 3. The novel splicing ligation between exon 7 and exon 9 in ETV4 mRNA is induced by specific oligonucleotides. (Results are shown below) Figure 4(As shown)

[0434] 4x10 3 Colo-205 cells were seeded in 96-well plates and cultured in RPMI medium supplemented with 10% FBS and 1% pen / strep. Forty-one different oligonucleotides (or loaders only, PBS) targeting the ETV4 precursor mRNA sequence were added to the cells at a final concentration of 25 μM. After 4 days, cells were harvested, and RNA was extracted using the RNeasy Mini Extraction Kit (Qiagen). cDNA was generated using the iScript Advanced cDNA Synthesis Kit and analyzed by ddPCR (Biorad). The expression level of ETV4 mRNA containing induced exon 7 / exon 9 splicing is expressed as a percentage of total ETV4 transcripts. Analysis was performed using QuantaSoft software (Biorad). The following probe-based assays were used to detect splicing events: ETV4 exon 7 / exon 9 ligation: (forward primer GGTGATCAAACAGGAACAGAC, reverse primer GGGACAACGCAGACATCSEQ ID NO 178, / 56-FAM / CCTACGACT / ZEN / CAGGCTATGGCTATGAG / 3IABkFQ / (SEQ ID NO 179)); total ETV4 (forward primer CGCTCGCTCCGATACTATTATG(SEQ ID NO 180), reverse primer CAAACTCAGCCTTGAGAGCTG(SEQ ID NO 181), probe / 5HEX / CATCATGCA / ZEN / GAAGGTGGCTGGTGA / 3IABkFQ / (SEQ ID NO 182)). Compared to wild-type ETV4 mRNA, induced exon 7 / exon 9 linking resulted in a 25-amino acid-long polypeptide encoded by the in-frame deletion of exon 8, which in turn generated a new polypeptide link within the ETV4 protein. (QEQTDFAYD) SG YGYEKPLRP, SEQ ID NO 190 (the underlined part is the new connection site).

[0435] The following oligonucleotides containing LNA are used to induce changes in splicing events. All internucleotide bonds are phosphate thioesters. Uppercase and lowercase letters represent LNA and DNA nucleobases, respectively.

[0436]

[0437]

[0438] Example 4. The novel splicing ligation between exon 9 and exon 11 in ETV4 mRNA is induced by specific oligonucleotides. (Results are shown below) Figure 5 (As shown)

[0439] 4x10 3 Colo-205 cells were seeded in 96-well plates and cultured in RPMI medium supplemented with 10% FBS and 1% pen / strep. Forty-one different oligonucleotides (or loaders only, PBS) targeting the ETV4 precursor mRNA sequence were added to the cells at a final concentration of 25 μM. After 4 days, cells were harvested, and RNA was extracted using the RNeasy Mini Extraction Kit (Qiagen). cDNA was generated using the iScript Advanced cDNA Synthesis Kit and analyzed by ddPCR (Biorad). The expression level of ETV4 mRNA containing induced exon 9 / exon 11 splicing is expressed as a percentage of total ETV4 transcripts. Analysis was performed using QuantaSoft software (Biorad). The following probe-based assays were used to detect splicing events: ETV4 exon 9 / exon 11 ligation: (forward primer CCTGCGACCATTCCCA (SEQ ID NO 183), reverse primer GCTCAGCCTTGTCGTAATTCATG (SEQ ID NO 184) / 56-FAM / TTG TCCCTG / ZEN / AGAGTCGCCAGG / 3IABkFQ / (SEQ ID NO 298)); total ETV4 (forward primer CGCTCGCTCCGATACTATTATG (SEQ ID NO 185), reverse primer CAAACTCAGCCTTGAGAGCTG (SEQ ID NO 186), probe / 5HEX / CATCATGCA / ZEN / GAAGGTGGCTGGTGA / 3IABkFQ / (SEQ ID NO 187)). Compared to wild-type ETV4 mRNA, the induced exon 9 / exon 11 linker caused a frameshift in the mRNA coding sequence, followed by the appearance of a new 27-amino acid polypeptide (GRQALGHPEEPASHELRQAEP LAPILL, SEQ ID NO190) in the C-terminal region of ETV4.

[0440] The following oligonucleotides containing LNA are used to induce changes in splicing events. All internucleotide bonds are phosphate thioesters. Uppercase and lowercase letters represent LNA and DNA nucleobases, respectively.

[0441]

[0442]

[0443]

[0444] Example 5. Searching for candidate RNAs for generating engineered new epitopes

[0445] Candidate RNAs for generating engineered novel epitopes can be identified through comparative analysis of gene expression data, such as RNA-seq and microarray analysis. Specifically, subsets (or isoforms) of transcripts that are specifically or highly upregulated in diseased cells are selected by comparing the expression profiles of diseased cells of interest with those of normal tissues (and / or normal cells). A comprehensive analysis of all possible splicing switching events is performed on a computer to define which events are likely to generate novel epitopes upon exposure to splicing-switching oligonucleotides. Examples of transcripts identified using this method are: CEMIP (colon cancer), ETV4 (colon cancer), LRG5 (colon cancer), NOX1 (colon cancer), FOXP3 (T-REGS), IGF2BP3 (general cancer), MAGE-A4 (general cancer), NY-ESO-1 (general cancer), EWSR1 (sarcoma, aberrant splicing), FUS (sarcoma, aberrant splicing), and SS18 (sarcoma, aberrant splicing).

[0446] Example 6. Searching for candidate RNAs for generating engineered novel epitopes in lung squamous cell carcinoma.

[0447] (like Figure 6 and 7 (As shown)

[0448] Gene expression profiles were compared between two groups in 56 clinical samples of lung squamous cell carcinoma from normal human tissues (adrenal cortex, n=4; bladder, n=3; breast, n=30; cervix, n=3; colon, n=8; esophagus, n=4; kidney, n=37; liver, n=22; lung, n=6; lung epithelium, n=21; ovary, n=4; pancreas, n=37; prostate, n=24; skeletal muscle, n=14; skin, n=4; small intestine, n=3; stomach, n=19; testis, n=11; thyroid, n=10). Measurements were performed using Affymetrix U133 with two arrays and 54,676 probes. PARPBP was one of the most differentially expressed genes (p=3.857e). -69 The figure below illustrates the expression data measured by the PARPBP probe 220060_s_at. Pink triangles represent lung squamous cell carcinoma samples, and blue dots represent normal tissue. To further validate the previous analysis, PARPBP expression was examined in the GTEX database. https: / / gtexportal.org / home / gene / PARPBPConsistent with the microarray data, PARPBP expression was negligible in most healthy human tissues, thus confirming its potential use as a target transcript for neoantigen engineering.

[0449] PARPBP-201 ENST00000327680.6

[0450]

[0451]

[0452]

[0453]

[0454] Encoded sequence: (SEQ ID 165)

[0455]

[0456] Skipping exon 6 of PARPBP results in a frame shift, which creates a new peptide of 15 amino acids at the C-terminus of the PARPBP protein and an early stop codon (SEQ ID NO 166).

[0457] Met AVFNQKSVSD Met IKEFRKNWRALCNSERTTLC GA DS Met LLALQLS Met AENNKQHSGEFTVSLSDVLLT WKY LL HEKLNLPVEN Met DVTDHYEDVRKIYDDFLKNSN Met LD LI DVYQKCRALTSNCENYNTVSP SQLLDFLSGKQYAVGD ET DLSIPTSPTSKYNRDNEKVQL LARKIIFSYLNLLVNS KN DLAVAYILNIPDRGLGREAFT DLKHAAREKQ Met SIFL H CRGSNTVSDKDATD Terminate SEQ ID NO 192: HCRGSNTVSDKDATD

[0458] Example 7. The novel splicing ligation between exons 27 and 29 in CEMIP mRNA was induced by specific oligonucleotides, expanding the screening to identify more effective compounds compared to Example 2. (Results are shown in Table 1)

[0459] To induce a novel splicing connection between exons 27 and 29 based on the transcriptional isoform CEMIP-201 transcript (ENST00000220244.7), we designed oligonucleotides to target the CEMIP precursor mRNA at flanking or overlapping sites of the CEMIP exon 28 sequence (exon 28 is the underlined sequence – ununderlined sequences are upstream or downstream intron sequences). TTCCATA GTGCTTATGGCATCAAAGGGAAGATACGTCTCCAGAGGCCCATGGACCAGAGTGCTGGAAAAGCTTGGGGCAGACA GGGGTCTCAAGTTGAAAGgtaagggtttgaactggggtttaaactgaccccaaaaccagagaaggcaaatgc(SEQID NO 297)

[0460] 4x10 3 Colo-205 cells were seeded in 96-well plates and cultured in RPMI medium supplemented with 10% FBS and 1% pen / strep. Eighty-two different oligonucleotides (or loaders only, PBS) targeting the CEMIP precursor mRNA sequence were added to the cells at final concentrations of 5 μM and 25 μM. After 4 days, cells were harvested, and RNA was extracted using the RNeasy Mini Extraction Kit (Qiagen). cDNA was generated using the iScript Advanced cDNA Synthesis Kit and analyzed by ddPCR (Biorad). The expression level of CEMIP mRNA containing induced exon 27 / exon 29 splicing is expressed as a percentage of total CEMIP transcripts. Analysis was performed using QuantaSoft software (Biorad). The following probe-based assays were used to detect splicing events: CEMIP exon 27 / exon 29 ligation (forward primer GGAACTCCATTCTGCAAGG (SEQ ID NO 173), reverse primer CCTCAGTGTCCAGTGTCA (SEQ ID NO 174), / 56-FAM / CCA TCCCTG / ZEN / ACAAAGCAAATGGCATTC / 3IABkFQ / (SEQ ID NO 175)); total CEMIP (forward primer CTCGGTGCTGAGGTTAACTC (SEQ ID NO 176), reverse primer TCAGACTAAAGGTGGGGAGAA (SEQ ID NO 177), probe / 5HEX / TCAGACCTC / ZEN / TGGAAAGCTCACCCA / 3IABkFQ / (SEQ ID NO 172)). Compared to wild-type CEMIP mRNA, the induced exon 27 / exon 29 linking resulted in a frameshift in the mRNA coding sequence, followed by the appearance of a new 21-amino acid polypeptide (KANGIRWLQRQLPAH LG DTGH, SEQ ID NO 189) in the C-terminal region of CEMIP.

[0461] The following oligonucleotides containing LNA were used to induce alterations in splicing events. All internucleotide bonds are phosphate thioesters. Uppercase and lowercase letters represent LNA and DNA nucleobases, respectively. Oligonucleotides and results are shown in the table below.

[0462] Table 1:

[0463] The data showed the percentile of CEMIP mRNAs containing the new exon 27 / exon 29 linker.

[0464]

[0465]

[0466]

[0467] Example 8. Next-generation sequencing validation of precise nucleotide linkages between exons 27 and 29 in O195-induced CEMIP mRNA.

[0468] Validation of the precise nucleotide ligation between CEMIP exon 27 and CEMIP exon 29 using next-generation sequencing: 1.5 x 10 6 Colo-205 cells were seeded in 6-well plates and incubated for 4 days with either 50 μM of the carrier (n=2) or O195 (n=2). Cells were harvested, and RNA was extracted using the RNeasy Mini Extraction Kit (Qiagen). cDNA synthesis was performed, followed by enrichment of CEMIP cDNA using capture probes. RNA-seq was then performed using Illumina NGS sequencing. Sequencing confirmed that the predicted ligations were indeed induced by O195. The novel splicing ligations induced by antisense oligonucleotide treatment were quantified as the ratio between reads matching exon 27–exon 29 ligations and reads matching wild-type exon 27–exon 28 ligations. O195 was able to induce exon 28 skipping with an efficiency of 84%, while no exon 28 skipping was detected in the carrier-treated samples.

[0469] Example 9. O195-induced changes in the molecular weight of CEMIP protein (see Figure 8 )

[0470] 1.5x10 6Colo-205 cells were seeded in 6-well plates and incubated for 4 days with either 25 μM load (n=2) or O195 (n=2). Cells were collected, washed with PBS, and lysed in 500 μl of IP lysis buffer (#87787, ThermoFisher) containing protease and phosphatase inhibitors (#78446). 10% of the lysate was reserved as an input control, and the remainder was incubated with 2 μg of anti-CEMIP antibody (NBP1-58029, Novus Biologicals) overnight at 4°C. 10 μl of Protein A / G agarose beads (#20421, ThermoFisher) was added to the lysate, and the mixture was incubated at 4°C for 1.5 h. The beads were washed three times with ice-cold IP lysis buffer and then resuspended in WES loading buffer for immunoblotting analysis. GAPDH signal was used as a loading control and to confirm immunoprecipitation efficiency. CEMIP was easily detected and successfully identified in all biological samples. This indicates that splicing CEMIP mRNA does not impair protein translation. Furthermore, treatment with O195 significantly reduced the molecular weight of CEMIP from 172 kDa to 164 kDa compared to samples treated with the carrier. These results suggest that O195 treatment may result in a novel C-terminal sequence for the CEMIP protein.

[0471] Example 10. Antibody recognition induces the formation of new C-termini in CEMIP mRNA after exon 27-exon 29 ligation (see...) Figure 9 )

[0472] A polyclonal antibody targeting the novel C-terminus of CEMIP (KA NGIRWLQRQLPAHLGDTGH,189) was generated by immunizing rabbits with a peptide corresponding to the predicted novel C-terminus of CEMIP. 4 x 10 3 Colo-205 cells were seeded in 96-well plates and cultured in RPMI medium supplemented with 10% FBS and 1% pen / strep. Cells were incubated with oligonucleotides 195(223) at concentrations of 7.5 μM and 22.5 μM. After 4 days, cells were harvested in 50 μL RIPA buffer (Themoscientific). Cell lysates were analyzed by capillary electrophoresis using the Wes system for proteins, simply following the manufacturer’s instructions. An antibody targeting HPRT1 was included as a loading control (Abcam ab109021). Results were shown in... Figure 9 The study showed that treatment of cells with oligonucleotide 195 induced a strong band of approximately 164 kDa. This corresponds to the predicted size of the truncated CEMIP protein with a new C-terminus.

[0473] Example 11: Mass spectrometry verification of the novel C-terminal peptide sequence induced by O195 (see Figure 10 ).

[0474] Samples submitted with CEMIP immunoprecipitation (as described in Example 9) were used for mass spectrometry analysis. As expected, both the carrier-treated and O195-treated samples contained the wild-type CEMIP protein sequence. Notably, only the O195-treated sample also exhibited a novel C-terminal peptide, predicted by exon 28 skipping. These data indicate that the isoform of exon 28 skipping induced by O195 is efficiently translated and generates the predicted novel C-terminus.

[0475] Sample preparation

[0476] The immunoprecipitated samples were boiled in 60 μL of 1.5X LDS buffer for 15 minutes. Using an MES buffer system, half of each eluent was processed by SDS-PAGE with 10% Bis-Tris NuPAGE (Invitrogen). The active region was cut into 10 equal-sized fragments, and each fragment was digested in the gel using a robotic system (ProGest, DigiLab) according to the following protocol:

[0477] • Wash with 25mM ammonium bicarbonate, then wash with acetonitrile.

[0478] • Reduced with 10 mM dithiothreitol at 60 °C, then alkylated with 50 mM iodoacetamide at RT.

[0479] • Digest with sequencing-grade trypsin (Promega) at 37°C for 4 hours.

[0480] • Quenching with formic acid allows for direct analysis of the supernatant without further treatment.

[0481] mass spectrometry

[0482] Half of each gel digest was analyzed by nano LC-MS / MS using a Waters NanoAcquity HPLC system with an interface connected to a ThermoFisher Fusion Lumos mass spectrometer. Peptides were loaded onto a trap column and eluted at 350 nL / min onto a 75 μm analytical column; both columns were packed with Luna C18 resin (Phenomenex). The mass spectrometer was operated in data-dependent mode, with the Orbitrap running at 60,000 FWHM and 15,000 FWHM MS, corresponding to MS and MS / MS, respectively. The instrument ran MS and MS / MS at 3-second cycles.

[0483] Each sample requires 5 hours of instrument time.

[0484] Data processing

[0485] Search for data using a local Mascot copy with the following parameters:

[0486] Enzyme: Trypsin / P

[0487] Database: SwissProt human plus custom sequences* (linked forward and reverse sequences plus common contaminants)

[0488] Fixed modification: carbamoylmethyl (C)

[0489] Variable modifications: oxidation (M), acetyl (N-term), Pyro-Glu (N-term Q), deamidation (N,Q)

[0490] Mass value: monoisotope

[0491] Peptide quality tolerance: 10 ppm

[0492] Fragment quality tolerance: 0.02 Da

[0493] Maximum missing cut: 2

Claims

1. An in vitro method for engineering peptide epitopes in cells, the method comprising administering an effective amount of a splice-regulating oligonucleotide to the cells, wherein the splice-regulating oligonucleotide targets a target RNA to regulate the splicing of the target RNA, thereby producing an aberrant RNA transcript encoding an aberrant polypeptide containing the peptide epitope, wherein the cells are cancer cells, wherein the target RNA is a precursor mRNA overexpressed in the cancer cells, and wherein the peptide epitope is presented on the cells as an MHC class I or II molecule. in: a. The precursor mRNA is CEMIP precursor mRNA, wherein the splicing regulatory oligonucleotide is selected from the sequences shown in SEQ ID NO 22, 24, 26, 45, 46, 47, 48, 49, and the amino acid sequence of the peptide epitope is the sequence shown in SEQ ID NO 188 or 189; b. The precursor mRNA is ETV4 precursor mRNA, wherein the splicing regulatory oligonucleotide is selected from the sequences shown in SEQ ID NO 112, 120, 122, 123, 149, and the amino acid sequence of the peptide epitope is the sequence shown in SEQ ID NO 190.

2. The in vitro method according to claim 1, wherein the splicing regulatory oligonucleotide comprises a 2' sugar-modified nucleoside independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-F-ANA nucleoside, and LNA nucleoside.

3. The in vitro method according to claim 1, wherein the splicing regulatory oligonucleotide comprises a phosphate thioester nucleoside internucleotide bond.

4. The in vitro method according to claim 1, wherein the splicing regulatory oligonucleotide is an oligonucleotide of 2'-O-methoxyethyl-RNA.

5. The in vitro method according to any one of claims 1-4, wherein the splicing regulatory oligonucleotide is an LNA polymer.

6. The in vitro method according to claim 1, wherein the splicing regulatory oligonucleotide is a morpholino oligonucleotide.

7. The in vitro method according to claim 1, wherein the cancer cells are lung cancer cells, breast cancer cells, or colon cancer cells.

8. The in vitro method according to claim 7, wherein the colon cancer cells are metastatic colon cancer cells.

9. The in vitro method according to claim 8, wherein the metastatic colon cancer cells are metastatic colon cancer cells in the liver.

10. The in vitro method according to claim 1, wherein the peptide epitope is secreted from the cell.

11. The in vitro method of claim 1, wherein the polypeptide containing the peptide epitope further comprises a membrane-binding domain.

12. An antisense oligonucleotide capable of regulating the splicing of CEMIP precursor mRNA, wherein the sequence is selected from the sequences shown in SEQ ID NO 22, 24, 26, 45, 46, 47, 48, 49.

13. An antisense oligonucleotide capable of regulating the splicing of ETV4 precursor mRNA, wherein the sequence is selected from the sequences shown in SEQ ID NO 112, 120, 122, 123, 149.

Images