A method of nucleic acid expression

Abstract

The present application provides a nucleic acid expression method, and in particular, the present application provides a nucleic acid construct. The present application successfully realizes gRNA guided efficient base site mutation in plants by using a nucleic acid construct driven by a specific promoter.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a method for nucleic acid expression. Background Technology

[0002] Currently, single-base editing efficiency in dicotyledonous plants is low. Most dicotyledonous plants, such as soybeans, cannot yet undergo single-base editing, while plants like Arabidopsis thaliana and tomato exhibit very low single-base editing efficiency, severely hindering the application of biotechnology breeding in agricultural production. Therefore, improving the efficiency of single-base editing in dicotyledonous plants has significant commercial value in agricultural production.

[0003] Therefore, there is an urgent need in this field to develop a method to improve the efficiency of single-base editing in plants. Summary of the Invention

[0004] The purpose of this invention is to provide a method for improving the efficiency of single-base editing in plants.

[0005] A first aspect of the present invention provides a nucleic acid construct having a 5'-3' (5' to 3') Formula I structure:

[0006] P1-S1-L1-S2-S3 (I);

[0007] In the formula,

[0008] P1, S1, L1, S2, and S3 are elements used to constitute the structure.

[0009] P1 is the first promoter sequence, and the first promoter includes promoters with extension factors;

[0010] S1 and S2 are each independently the coding sequences of one or more (a) gene editing enzymes, (b) adenine deaminases, and / or cytosine deaminases;

[0011] L1 is the coding sequence for a peptide that is absent or linked;

[0012] S3 is the coding sequence for either no or no uracil glycosidase inhibitor UGI;

[0013] Furthermore, each "-" independently represents a bond or nucleotide linkage sequence.

[0014] In another preferred embodiment, S1 is the coding sequence of adenine deaminase and / or cytosine deaminase, and S2 is the coding sequence of gene editing enzyme.

[0015] In another preferred embodiment, S1 is the coding sequence for adenine deaminase, and S3 is absent.

[0016] In another preferred embodiment, S1 is the coding sequence for cytosine deaminase and S3 is the coding sequence for uracil glycosidase inhibitor UGI.

[0017] In another preferred embodiment, the elongation factor includes a eukaryotic elongation factor or a prokaryotic elongation factor.

[0018] In another preferred embodiment, the eukaryotic elongation factors include EF1α, EF1β, and EF2.

[0019] In another preferred embodiment, the prokaryotic elongation factor includes EF-Tu, EF-Ts, and EF-G; preferably, it includes EF1α; and preferably, it includes EF1α from plants.

[0020] In another preferred embodiment, the plant is selected from the group consisting of: maize, rice, soybean, Arabidopsis thaliana, tobacco, tomato, or combinations thereof.

[0021] In another preferred embodiment, the first promoter is derived from one or more plants selected from the group consisting of: corn, rice, soybean, Arabidopsis thaliana, tobacco, and tomato.

[0022] In another preferred embodiment, the first promoter is the promoter of tomato EF1a.

[0023] In another preferred embodiment, the sequence of the first promoter is shown in SEQ ID NO.:1.

[0024] In another preferred embodiment, the length of each L1 nucleotide sequence is independently 3-120 nt, more preferably 3-96 nt, and preferably a multiple of 3.

[0025] In another preferred embodiment, the length of each L1-encoded amino acid sequence is independently 3-40 aa, more preferably 6-32 aa, more preferably 18-32 aa, and more preferably 24-32 aa.

[0026] In another preferred embodiment, the length of the nucleotide linker sequence is 1-300 nt, more preferably 1-100 nt.

[0027] In another preferred embodiment, the nucleotide linking sequence does not affect the normal transcription and translation of the elements.

[0028] In another preferred embodiment, the gene editing enzyme is an enzyme selected from the group consisting of CRISPR enzymes, TALEN enzymes, ZFN enzymes, or combinations thereof.

[0029] In another preferred embodiment, the gene-editing enzyme is derived from microorganisms; preferably from bacteria.

[0030] In another preferred embodiment, the source of the gene-editing enzyme is selected from the group consisting of Streptococcus pyogenes. pyogenes Staphylococcus aureus, Streptococcus canis, or combinations thereof.

[0031] In another preferred embodiment, the gene editing enzyme has double-stranded or single-stranded DNA cutting activity, or no cutting activity.

[0032] In another preferred embodiment, the gene editing enzyme is a CRISPR enzyme with single-stranded DNA cutting activity.

[0033] In another preferred embodiment, the gene-editing enzyme includes wild-type or mutant gene-editing enzymes.

[0034] In another preferred embodiment, the identity of the gene-editing enzyme with the mutated gene-editing enzyme is ≥80%, preferably ≥90%, more preferably ≥95%, and even more preferably ≥98% or 99%.

[0035] In another preferred embodiment, the mutated gene-editing enzyme is formed from the wild-type gene-editing enzyme by one or more, preferably 1-15, preferably 1-10, preferably 1-7, more preferably 2-5, amino acid substitutions or deletions; and / or by the addition of 1-5, preferably 1-4, more preferably 1-3, most preferably 1-2 amino acids.

[0036] In another preferred embodiment, the gene editing enzyme is selected from the group consisting of Cas9, Cas12, Cas13, Cms1, MAD7, or combinations thereof.

[0037] In another preferred embodiment, the gene editing enzyme is selected from the group consisting of nCas9, dCas9, nCas9NG, nCas9X, nCas12, nCas13, or combinations thereof.

[0038] In another preferred embodiment, the amino acid sequence of the gene-editing enzyme is shown in SEQ ID NO.:2.

[0039] In another preferred embodiment, the coding sequence of the gene-editing enzyme is selected from the group consisting of:

[0040] (i) Polynucleotides with sequences as shown in SEQ ID NO.:3;

[0041] (ii) A polynucleotide whose nucleotide sequence is ≥75% homology to the sequence shown in SEQ ID NO.:3 (preferably ≥85%, more preferably ≥90%, ≥95%, ≥98%, or ≥99%);

[0042] (iii) A polynucleotide with 1-60 (preferably 1-30, more preferably 1-10) nucleotides truncated or added to the 5' and / or 3' ends of the polynucleotide shown in SEQ ID NO.:3;

[0043] (iv) and any of the polynucleotides complementary to the polynucleotides described in (i)-(iii).

[0044] In another preferred embodiment, the coding sequence of the gene-editing enzyme is shown in SEQ ID NO.:3.

[0045] In another preferred embodiment, the adenine deaminase includes wild-type and mutant types.

[0046] In another preferred embodiment, the adenine deaminase comprises wild-type and / or mutant TadA.

[0047] In another preferred embodiment, the adenine deaminase comprises TadA.

[0048] In another preferred embodiment, the mutant of the adenine deaminase includes TadA7-10.

[0049] In another preferred embodiment, the adenine deaminase is a fusion protein formed by TadA and TadA7-10.

[0050] In another preferred embodiment, the coding sequence of the adenine deaminase is selected from the group consisting of:

[0051] (i) Polynucleotides with sequences as shown in SEQ ID NO.:5 or 19;

[0052] (ii) A polynucleotide whose nucleotide sequence is ≥75% homology to the sequence shown in SEQ ID NO.:5 or 19 (preferably ≥85%, more preferably ≥90%, ≥95%, ≥98%, or ≥99%);

[0053] (iii) A polynucleotide with 1-60 (preferably 1-30, more preferably 1-10) nucleotides truncated or added to the 5' and / or 3' ends of the polynucleotide shown in SEQ ID NO.:5 or 19;

[0054] (iv) and any of the polynucleotides complementary to the polynucleotides described in (i)-(iii).

[0055] In another preferred embodiment, the coding sequence of the adenine deaminase is as shown in SEQ ID NO.5 or 19.

[0056] In another preferred embodiment, the amino acid sequence of the adenine deaminase is shown in SEQ ID NO.:4.

[0057] In another preferred embodiment, the cytosine deaminase includes wild-type and mutant types.

[0058] In another preferred embodiment, the cytosine deaminase comprises APOBEC.

[0059] In another preferred embodiment, the APOBEC is selected from the group consisting of: APOBEC1 (A1), APOBEC2 (A2), APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3E, APOBEC3F, APOBEC3H, APOBEC4 (A4), activation-induced cytidine deaminase (AID), or combinations thereof.

[0060] In another preferred embodiment, the mutants of the cytosine deaminase include CBE2.0, CBE2.1, CBE2.2, CBE2.3, and CBE2.4.

[0061] In another preferred embodiment, the amino acid sequence of the cytosine deaminase is as shown in any one of SEQ ID NO.:6, 8-11.

[0062] In another preferred embodiment, the nucleic acid construct may also be operatively linked to one or more positioning signal sequences.

[0063] In another preferred embodiment, the localization signal is selected from the group consisting of: nuclear localization signal, chloroplast localization signal, mitochondrial localization signal, or a combination thereof.

[0064] In another preferred embodiment, the positioning signal includes a nuclear positioning signal, preferably including 1-2 nuclear positioning signals.

[0065] In another preferred embodiment, the nuclear positioning signal includes bpNLS and SV40.

[0066] In another preferred embodiment, the nucleotide sequence of the nuclear localization signal is as shown in any of SEQ ID NO.:12-14.

[0067] In another preferred embodiment, the amino acid sequence of the nuclear localization signal is shown in SEQ ID NO.:15.

[0068] In another preferred embodiment, the nucleotide sequence of the S3 element is shown in SEQ ID NO.:16.

[0069] In another preferred embodiment, the nucleic acid construct is further operably linked to one or more second nucleic acid constructs of Formula II:

[0070] P2-Y1(II)

[0071] In the formula,

[0072] P2 is the second promoter sequence;

[0073] Y1 is the coding sequence for gRNA;

[0074] Furthermore, each "-" independently represents a bond or nucleotide linkage sequence.

[0075] In another preferred embodiment, when at least two Formula II nucleic acid constructs are contained, their gRNA sequences may be different from each other.

[0076] In another preferred embodiment, the nucleic acid construct of Formula II is located at the 5' end or 3' end of the nucleic acid construct of Formula I or distributed at both ends thereof.

[0077] In another preferred embodiment, the gRNA includes crRNA, tracrRNA, and sgRNA.

[0078] In another preferred embodiment, the second promoter is derived from one or more plants selected from the group consisting of rice, corn, soybean, Arabidopsis thaliana, tobacco, or tomato.

[0079] In another preferred embodiment, the second promoter comprises an RNA polymerase III-dependent promoter.

[0080] In another preferred embodiment, the second promoter is an RNA polymerase III-dependent promoter.

[0081] In another preferred embodiment, the second promoter is selected from the group consisting of: U6, U3, U6a, U6b, U6c, U6-1, U3b, U3d, U6-26, U6-29, H1, or a combination thereof.

[0082] In another preferred embodiment, the second promoter includes the U6 promoter.

[0083] In another preferred embodiment, the nucleotide elements of the present invention are linked in-frame to express a fusion protein with the correct amino acid sequence.

[0084] In another preferred embodiment, the nucleic acid constructs of Formula I and Formula II also each have a terminator independently.

[0085] In another preferred embodiment, the nucleic acid constructs of Formula I and Formula II share the same terminator.

[0086] In another preferred embodiment, the terminator includes a terminator suitable for plant gene editing.

[0087] In another preferred embodiment, the terminator is selected from the group consisting of NOS, Poly A, T-UBQ, rbcS, or combinations thereof.

[0088] In another preferred embodiment, the construct has a structure of formula IIIa or formula IIIb:

[0089] P1-S1-L1-S2-S3-P2-Y1 (IIIa);

[0090] P2-Y1-P1-S1-L1-S2-S3 (IIIb);

[0091] In the formula, the definitions of each element are as described above.

[0092] In another preferred embodiment, the nucleic acid construct may also be operatively linked to a first integrative element (I1) and a second integrative element (I2).

[0093] In another preferred embodiment, the first integrated element includes a 5' homologous arm sequence. In another preferred embodiment, the second integrated element includes a 3' homologous arm sequence.

[0094] In another preferred embodiment, one or more additional expression boxes are further inserted between the I1 and I2 elements.

[0095] In another preferred embodiment, the additional expression cassette is independent of the expression cassette containing the nucleic acid construct of Formula I and the expression cassette containing the nucleic acid construct of Formula II.

[0096] In another preferred embodiment, the additional expression cassette expresses a substance selected from the group consisting of marker genes.

[0097] In another preferred embodiment, the marker gene includes a resistance gene (such as a hygromycin resistance gene, a herbicide resistance gene), a fluorescent gene, or a combination thereof.

[0098] A second aspect of the present invention provides a carrier containing the nucleic acid construct described in the first aspect of the present invention.

[0099] In another preferred embodiment, the vector is a plant expression vector.

[0100] In another preferred embodiment, the vector is an expression vector that can transfect or transform plant cells.

[0101] In another preferred embodiment, the vector is an Agrobacterium Ti vector.

[0102] In another preferred embodiment, the construct is integrated into the T-DNA region of the vector.

[0103] In another preferred embodiment, the carrier is annular or linear.

[0104] A third aspect of the present invention provides a host cell containing the nucleic acid constructs described in the first aspect of the present invention, or having its genome integrated with one or more nucleic acid constructs described in the first aspect of the present invention.

[0105] In another preferred embodiment, the cell is a plant cell.

[0106] In another preferred embodiment, the plant is selected from the group consisting of monocots, dicots, gymnosperms, or combinations thereof.

[0107] In another preferred embodiment, the plant is selected from the group consisting of: grasses, legumes, cruciferous plants, solanaceae, umbelliferous plants, or combinations thereof.

[0108] In another preferred embodiment, the plant is selected from the group consisting of: Arabidopsis thaliana, wheat, barley, oats, corn, rice, sorghum, millet, soybean, peanut, tobacco, tomato, Chinese cabbage, rapeseed, spinach, lettuce, cucumber, garland chrysanthemum, water spinach, celery, romaine lettuce, or combinations thereof.

[0109] In another preferred embodiment, the host cell is introduced into the cell by means selected from the group consisting of: Agrobacterium-mediated transformation, gene gun method, microinjection method, electroporation method, ultrasound method, and polyethylene glycol (PEG) mediated method.

[0110] A fourth aspect of the present invention provides a reagent combination comprising:

[0111] (i) A first nucleic acid construct, or a first vector containing the first nucleic acid construct, wherein the first nucleic acid construct has a structure of Formula I from 5'-3':

[0112] P1-S1-L1-S2-S3 (I)

[0113] in,

[0114] P1 is the first promoter sequence, and the first promoter includes promoters with extension factors;

[0115] S1 and S2 are each independently the coding sequences of one or more (a) gene editing enzymes, (b) adenine deaminases, and / or cytosine deaminases;

[0116] L1 is the coding sequence for a peptide that is absent or linked;

[0117] S3 is the coding sequence for either no or no uracil glycosidase inhibitor UGI;

[0118] Furthermore, "-" indicates a bond or nucleotide linkage sequence;

[0119] (ii) a second nucleic acid construct, or a second vector containing the second nucleic acid construct, the second nucleic acid construct having a structure as shown in formula (II) from 5'-3':

[0120] P2-Y1 (II);

[0121] P2 is the second promoter;

[0122] Y1 is the coding sequence for gRNA;

[0123] Furthermore, "-" indicates a bond or nucleotide linkage sequence.

[0124] In another preferred embodiment, the first carrier and the second carrier are different carriers.

[0125] In another preferred embodiment, the first nucleic acid construct and the second nucleic acid construct are located on different vectors.

[0126] In another preferred embodiment, the first carrier and the second carrier are the same carrier.

[0127] In another preferred embodiment, the first nucleic acid construct and the second nucleic acid construct are located on the same vector.

[0128] A fifth aspect of the present invention provides a reagent kit containing the reagent combination described in the fourth aspect of the present invention.

[0129] In another preferred embodiment, the kit also includes a label or instructions.

[0130] The sixth aspect of this invention provides a method for gene editing in plants, comprising the steps of:

[0131] (i) Provide plants to be edited; and

[0132] (ii) Introducing the nucleic acid construct of the first aspect of the present invention, the vector of the second aspect of the present invention, or the reagent combination of the fourth aspect of the present invention into the plant cells of the plant to be edited, thereby performing gene editing in the plant cells.

[0133] In another preferred embodiment, the introduction is performed via Agrobacterium.

[0134] In another preferred embodiment, the introduction is performed via a gene gun.

[0135] In another preferred embodiment, the gene editing is a site-specific base substitution (or mutation).

[0136] In another preferred embodiment, the site-specific substitution (or mutation) includes mutating A to G.

[0137] In another preferred embodiment, the site-specific substitution (or mutation) includes mutating C to T.

[0138] In another preferred embodiment, the plant includes any type of higher plant that can be transformed, including monocots, dicots, and gymnosperms.

[0139] In another preferred embodiment, the plant is a dicotyledonous plant.

[0140] In another preferred embodiment, the plant is selected from the group consisting of: grasses, legumes, cruciferous plants, solanaceae, umbelliferous plants, or combinations thereof.

[0141] In another preferred embodiment, the plant is selected from the group consisting of: Arabidopsis thaliana, wheat, barley, oats, corn, rice, sorghum, millet, soybean, peanut, tobacco, tomato, Chinese cabbage, rapeseed, spinach, lettuce, cucumber, garland chrysanthemum, water spinach, celery, romaine lettuce, or combinations thereof.

[0142] A seventh aspect of the present invention provides a method for preparing gene-edited plant cells, comprising the steps of:

[0143] Plant cells are transfected with the nucleic acid constructs described in the first aspect of the present invention, the vectors described in the second aspect of the present invention, or the reagents described in the fourth aspect of the present invention, so that the chromosomes in the plant cells undergo site-directed substitution (or mutation), thereby obtaining the gene-edited plant cells.

[0144] In another preferred embodiment, the transfection is performed using Agrobacterium-mediated transformation or gene gun bombardment.

[0145] The eighth aspect of the present invention provides the use of the nucleic acid construct described in the first aspect of the present invention, the vector described in the second aspect of the present invention, the host cell described in the third aspect of the present invention, the reagent combination described in the fourth aspect of the present invention, and the kit described in the fifth aspect of the present invention for gene editing in plants.

[0146] A ninth aspect of the present invention provides a method for preparing gene-edited plants, comprising the steps of:

[0147] The gene-edited plant cells prepared by the method described in the seventh aspect of the present invention are regenerated into a plant body, thereby obtaining the gene-edited plant.

[0148] The tenth aspect of the present invention provides a gene-edited plant, said plant being prepared using the method described in the ninth aspect of the present invention.

[0149] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0150] Figure 1 The structure of an ABE single-base editor containing slEF1a is shown.

[0151] Figure 2 The efficiency of different promoters in single-base editing in tomato was shown.

[0152] Figure 3 The efficiency of single-base editing in soybeans using different promoters and different base editors is shown. Detailed Implementation

[0153] Through extensive and in-depth research, the inventors unexpectedly discovered for the first time a highly efficient EF promoter (such as the tomato EF promoter). This promoter was constructed in a single-base editing system of ABE and CBE to drive the expression of a fusion protein composed of (a) a gene-editing enzyme and (b) adenine deaminase and / or cytosine deaminase. This promoter significantly improved editing efficiency in plants. Based on this, the inventors completed this invention.

[0154] the term

[0155] As used in this article, the term "homologous arm" refers to the flanking sequences on the targeting vector that are completely identical to the genome sequence and are used to identify and allow recombination to occur.

[0156] As used in this article, the term "plant promoter" refers to a nucleic acid sequence that can initiate nucleic acid transcription in plant cells. A plant promoter can be derived from plants, microorganisms (such as bacteria or viruses), or animals, or it can be a synthetically produced or modified promoter.

[0157] As used herein, the terms "gene editing" or "base mutation" or "base editing" refer to the substitution, insertion, and / or deletion of a base at a specific position in a nucleotide sequence. The "editing" or "mutation" described in this invention is preferably a single-base mutation.

[0158] As used in this article, the term "base substitution" refers to a mutation of a base at a position in a nucleotide sequence into another different base, such as A mutating into G.

[0159] As used in this article, the term "AT to GC" refers to the mutation or replacement of an AT base pair with a GC base pair at a certain position in a double-stranded nucleic acid sequence (especially a genomic sequence).

[0160] As used in this article, the term "CG to TA" refers to the mutation or replacement of a CG base pair with a TA base pair at a certain position in a double-stranded nucleic acid sequence (especially a genomic sequence).

[0161] As used herein, the term "gene editing enzyme" refers to a nuclease suitable for editing tools such as CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Tanscription Activator-like (TAL) effector nucleases), and ZFN (Zinc finger nuclease). Preferably, the gene editing enzyme is a CRISPR enzyme, also known as a Cas protein, which includes, but is not limited to, Cas9, Cas12, Cas13, Cas14, Csm1, and FDK1 proteins. The Cas protein refers to a protein family that can have different structures depending on its origin, such as SpCas9 from Streptococcus pyogenes and SaCas9 from Staphylococcus aureus. It can also be classified according to structural features (such as domains), such as the Cas12 family, which includes Cas12a (also known as Cpf1), Cas12b, Cas12c, and Cas12i. The Cas protein can be double-stranded, single-stranded, or have no cleavage activity. The Cas protein of this invention can be wild-type or a mutant thereof. The mutation types of the mutant include amino acid substitution, substitution, or deletion. The mutant may or may not alter the cleavage activity of the Cas protein. Preferably, the Cas protein of this invention has only single-stranded cleavage activity or no cleavage activity, and is a mutant of the wild-type Cas protein. Preferably, the Cas protein of this invention is Cas9, Cas12, Cas13, or Cas14 with single-stranded cleavage activity. In a preferred embodiment, the Cas9 protein of the present invention includes SpCas9n(D10A), nSpCas9NG, SaCas9n, ScCas9n, and XCas9n, where "n" represents nick, i.e., a Cas protein with only single-strand cleavage activity. Mutagenesis of known Cas proteins to obtain Cas proteins with single-strand or no cleavage activity is a conventional technique in the art. As is known to those skilled in the art, various Cas proteins with nucleic acid cleavage activity have been reported in the prior art, and these known proteins or their modified variants can achieve the functions of the present invention; therefore, they are included within the scope of protection by reference.

[0162] As used herein, the term "coding sequence of the Cas protein" refers to the nucleotide sequence that encodes the Cas protein. When an inserted polynucleotide sequence is transcribed and translated to produce a functional Cas protein, those skilled in the art will recognize that, due to codon degeneracy, a large number of polynucleotide sequences can encode the same polypeptide. Furthermore, those skilled in the art will recognize that different species have certain codon preferences, and the codons of the Cas protein may be optimized according to the needs of expression in different species; these variants are specifically covered by the term "coding sequence of the Cas protein." In addition, the term specifically includes both the full-length sequence substantially identical to the Cas gene sequence and the sequence encoding a protein that retains the function of the Cas protein.

[0163] As used herein, "gRNA" is also referred to as guide RNA or directional RNA, and has the meaning commonly understood by those skilled in the art. Generally, guide RNA may contain a direct repeat sequence and a guide sequence, or consist essentially of or composed of a direct repeat sequence and a guide sequence (also called a spacer sequence in the context of endogenous CRISPR systems). In different CRISPR systems, depending on the Cas protein it relies on, gRNA may include crRNA and tracrRNA, or may contain only crRNA. crRNA and tracrRNA can be artificially fused to form a single guide RNA (sgRNA). The gRNA described in this invention may be natural or artificially modified or synthesized. In some cases, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence, typically having a sequence length of 17-23 nt. In some implementations, when optimal alignment is achieved, the complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining the optimal alignment is within the capabilities of a person skilled in the art. For example, publicly available and commercially available alignment algorithms and programs exist, such as, but not limited to, ClustalW, the Smith-Waterman algorithm in MATLAB, Bowtie, Geneious, Biopython, and SeqMan.

[0164] As used herein, the term "plant" includes the whole plant, plant organs (such as leaves, stems, roots, etc.), seeds, and plant cells, as well as their progeny. There are no particular limitations on the types of plants that can be used in the methods of this invention; generally, it includes any plant type capable of gene editing, including monocots, dicots, gymnosperms, and angiosperms, primarily woody plants.

[0165] As used herein, the term "expression cassette" refers to a polynucleotide sequence containing the gene to be expressed and the sequence components required for expression. The components required for expression include a promoter and a polyadenylation signal sequence. Furthermore, the expression cassette of the present invention optionally contains other sequences, including (but not limited to): enhancers, secretion signal peptide sequences, etc.

[0166] In this invention, the nucleotide sequence is described from 5' to 3' unless otherwise specified.

[0167] As used in this article, "uracil DNA glycosylase inhibitor (UGI)" can inhibit intracellular uracil DNA glycosylase from catalyzing U back to C.

[0168] EF promoter

[0169] The EF promoter refers to the promoter of elongation factors, which are protein factors that promote polypeptide chain elongation during mRNA translation. In eukaryotes, elongation factors include EF1α, EF1β, and EF2. In prokaryotes, elongation factors include EF-Tu, EF-Ts, and EF-G. EF1a is eukaryotic elongation factor 1α, a crucial component of protein biosynthesis. EF1A catalyzes the binding of aminoacyl-tRNA to the ribosome A site via a GTP-dependent mechanism. EF1A accounts for 3-10% of total soluble protein and is considered one of the most abundant soluble proteins in the cytoplasm.

[0170] In a preferred embodiment, the EF promoter includes, but is not limited to: EF1a promoter, EF1β promoter, EF2 promoter, EF-Tu, EF-Ts, and EF-G.

[0171] In a preferred embodiment, the promoter of the present invention refers to an EF1a promoter element derived from a Solanaceae plant (preferably from a tomato or similar plant).

[0172] A typical sequence of the promoter of this invention is shown in SEQ ID NO.:1.

[0173] It should be understood that the term also includes promoters homologous to the promoter shown in SEQ ID NO.:1 from other different Solanaceae plants. Furthermore, the term also includes derivative promoters or active fragments of the promoter shown in SEQ ID NO.:1 or its homologous promoters, primarily those derivative promoters or active fragments that retain highly efficient gene editing functions, for example, retaining at least 50% of the specific promotion function of the promoter shown in SEQ ID NO.:1 (expressed in terms of the expression level of the foreign gene that can be promoted).

[0174] As used in this article, the term "solanaceae" includes tomatoes, potatoes, eggplants, peppers, goji berries, and tobacco.

[0175] As used herein, the term “promoter” or “promoter region” refers to a nucleic acid sequence that accurately and effectively initiates gene transcription, guiding the transcription of the gene’s nucleic acid sequence into mRNA. It is usually located upstream (5' end) of the coding sequence of the target gene. Generally, the promoter or promoter region provides recognition sites for RNA polymerase and other factors necessary for proper transcription initiation.

[0176] In this document, the promoter or promoter region includes promoter variants, which can be obtained by inserting or deleting regulatory regions, performing random or site-directed mutations, etc.

[0177] The present invention also includes nucleic acids having 50% or more (preferably 60%, 70%, 80%, more preferably 90%, more preferably 95%, most preferably 98%, such as 99%) homology to the preferred promoter sequence of the present invention (SEQ ID NO.:1), said nucleic acids also having the function of specifically improving the efficiency of plant gene editing. "Homology" refers to the level of similarity (i.e., sequence similarity or identity) between two or more nucleic acids according to the percentage of identical positions.

[0178] It should be understood that although the examples of this invention provide promoter EF1a derived from the Solanaceae family, such as tomato, promoters derived from other similar plants (especially those belonging to the same family as tomato) that have a certain degree of homology (conservatism) with the promoters of this invention are also included within the scope of this invention, provided that those skilled in the art can easily isolate such promoters from other plants based on the information provided in this application after reading it.

[0179] As used in this article, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources. For example, if the combination of a promoter and a target gene sequence is not naturally occurring, then the promoter is exogenous to the target gene. A particular sequence is "exogenous" to the cell or organism into which it is inserted.

[0180] As used in this article, "cis-regulatory element" refers to a conserved base sequence that regulates the initiation and efficiency of gene transcription.

[0181] The promoter of this invention can be operatively linked to a foreign gene, which can be foreign (heterologous) relative to the promoter. The foreign gene (also called the target gene) described in this invention is not particularly limited and can be a gene encoding a protein with a specific function, such as (a) a gene editing enzyme and (b) adenine deaminase and / or cytosine deaminase.

[0182] Representative examples of the exogenous genes include (but are not limited to): resistance genes, selection marker genes, epitope tags, reporter gene sequences, nuclear localization signal sequences, transcriptional activation domains (e.g., transcriptional activation domains (e.g., VP64), transcriptional repression domains (e.g., KRAB domains or SID domains), nuclease domains (e.g., Fok1), viral capsid protein genes, antibody genes; and domains having activities selected from the following: nucleotide deaminase, methyltransferase activity, demethylase, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity, and nucleic acid binding activity.

[0183] The resistance genes are selected from the following group: herbicide resistance genes, virus resistance genes, cold resistance genes, heat resistance genes, drought resistance genes, flood resistance genes, or insect resistance genes. The selection marker genes are selected from the following group: gus (β-glucuronidase) gene, hygromycin gene, neomycin gene, or gfp (green fluorescent protein) gene.

[0184] The present invention also provides a gene expression cassette, wherein the expression cassette comprises, from 5' to 3', the following elements in sequence: a promoter, a gene ORF sequence, and a terminator. Preferably, the promoter sequence is as shown in SEQ ID NO.:1 or has ≥90% homology with the sequence shown in SEQ ID NO.:1, more preferably ≥95%, and even more preferably ≥98%.

[0185] This invention also provides a recombinant vector comprising the promoter and / or gene expression cassette of this invention. As a preferred embodiment, the promoter of the recombinant vector contains a multiple cloning site or at least one restriction enzyme site downstream. When expression of a target gene is required, the target gene is ligated into a suitable multiple cloning site or restriction enzyme site, thereby operatively linking the target gene to the promoter. As another preferred embodiment, the recombinant vector comprises (from 5' to 3' direction): a promoter, a target gene, and a terminator. If desired, the recombinant vector may further comprise elements selected from the group consisting of: a 3' polynucleotide signal; a non-translated nucleic acid sequence; a transport and targeting nucleic acid sequence; an resistance selection marker (dihydrofolate reductase, neomycin resistance, hygromycin resistance, and green fluorescent protein, etc.); an enhancer; or an operator.

[0186] Those skilled in the art can use well-known methods to construct expression vectors containing the promoter and / or target gene sequence described in this invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc.

[0187] The promoters, expression cassettes, or vectors of this invention can be used to transform suitable host cells to enable the host to express proteins. Host cells can be prokaryotic cells, such as *Escherichia coli*, *Streptomyces*, or *Agrobacterium*; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. Those skilled in the art will understand how to select appropriate vectors and host cells. Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote (such as *E. coli*), it can be treated with CaCl2 or electroporation. When the host is a eukaryote, DNA transfection methods such as calcium phosphate coprecipitation, conventional mechanical methods (such as microinjection, electroporation, liposome packaging, etc.) can be used. Transformation of plants can also be performed using methods such as *Agrobacterium* transformation or gene gun transformation, for example, leaf disc transformation, embryo transformation, flower bud soaking, etc. Transformed plant cells, tissues, or organs can be regenerated into plants using conventional methods to obtain transgenic plants.

[0188] As a preferred embodiment of the present invention, the method for preparing transgenic plants is as follows: a vector carrying a promoter and a target gene (operably linked together) is transferred into Agrobacterium, which then integrates the vector fragment containing the promoter and the target gene into the chromosome of the plant. Examples of transgenic recipient plants include Arabidopsis thaliana, wheat, barley, oats, corn, rice, sorghum, millet, soybean, peanut, tobacco, tomato, Chinese cabbage, rapeseed, spinach, lettuce, cucumber, garland chrysanthemum, water spinach, celery, and romaine lettuce. In an example of the present invention, the recombinant vector is the pCAMBIA1300 vector, into which the promoter of the present invention is constructed, followed by plant transformation.

[0189] In a preferred embodiment, the present invention cloned the EF promoter (such as the tomato SlEF1a promoter) and used the promoter to drive the expression of the coding sequence of the fusion protein of Cas enzyme and deaminase, ultimately obtaining a system for highly efficient single base substitution and gene knockout in dicotyledonous plants.

[0190] adenine deaminase

[0191] As used herein, the term "adenine deaminase" refers to an enzyme that catalyzes the hydrolysis and deamination of adenine to produce inosine and ammonia. Adenine A is converted to inosine I, which pairs with cytosine and is read and replicated at the DNA level as guanine (G), resulting in the conversion of A·T pairing to G·C pairing. TadA adenine deaminase, derived from *E. coli*, has been artificially modified to the ecTadA mutant. The dimer of TadA and ecTadA is the commonly used adenine deaminase.

[0192] In this invention, the applicable TadA includes both the wild-type form and its specific mutant form TadA7-10, or a combination of the wild-type and mutant forms. TadA7-10 is capable of deamination reactions using DNA as a substrate.

[0193] In this invention, the adenine deaminase coding sequence in the nucleic acid construct can be codon optimized in a host-preferred manner depending on the applicable host.

[0194] Cytosine deaminase

[0195] As used herein, the term "cytosine deaminase (APOBEC)" refers to an enzyme that catalyzes the deamination of cytosine within the cell to form uracil, converting cytosine C to uracil U. Damaged DNA is acted upon by polymerases during re-replication, and uracil is recognized as T during DNA replication, leading to the conversion of C·G pairing to T·A pairing. Eleven members of the APOBEC family have been identified, including APOBEC1 (A1), APOBEC2 (A2), APOBEC3A–H (3A, 3B, 3C, 3D, 3E, 3F, 3H), APOBEC4 (A4), and activation-induced cytidine deaminase (AID).

[0196] In this invention, applicable cytosine deaminases include both wild-type forms and specific mutant forms (such as CBE2.0, CBE2.1, CBE2.2, CBE2.3, CBE2.4), or combinations of wild-type and mutant forms. Mutant forms of cytosine deaminases are capable of deamination reactions using DNA as a substrate.

[0197] In this invention, the cytosine deaminase coding sequence in the nucleic acid construct can be codon optimized in a host-preferred manner depending on the applicable host.

[0198] In a preferred embodiment of the present invention, the preferred cytosine deaminases are CBE2.0, CBE2.1, CBE2.2, CBE2.3, and CBE2.4.

[0199] The amino acid sequence of CBE2.0 is shown in SEQ ID NO.:6, and its nucleotide sequence is shown in SEQ ID NO.:7.

[0200] The amino acid sequence of CBE2.1 is shown in SEQ ID NO.:8.

[0201] The amino acid sequence of CBE2.2 is shown in SEQ ID NO.:9.

[0202] The amino acid sequence of CBE2.3 is shown in SEQ ID NO.:10.

[0203] The amino acid sequence of CBE2.4 is shown in SEQ ID NO.:11.

[0204] The constructs of the present invention

[0205] This invention provides a nucleic acid construct for gene editing in plants, wherein the nucleic acid construct has a 5'-3' structure of Formula I:

[0206] P1-S1-L1-S2-S3 (I);

[0207] In the formula,

[0208] P1, S1, L1, S2, and S3 are elements used to constitute the structure.

[0209] , which is defined as described in the first aspect of the present invention;

[0210] Furthermore, each "-" represents a bond or nucleotide linkage sequence.

[0211] In a preferred embodiment, the nucleic acid construct is further operably linked to one or more second nucleic acid constructs of Formula II:

[0212] P2-Y1(II);

[0213] In the formula, P2 and Y1 are defined as described in the first aspect of the present invention.

[0214] In a preferred embodiment, the nucleic acid construct may also operatively link a first integrative element (I1) and a second integrative element (I2).

[0215] Among them, the I1 element (or left-side integrative element) and the I2 element (or right-side integrative element) can work together to integrate the element located between them (i.e., the nucleotide sequence from P1 to Y1) into the genome of the plant cell.

[0216] Representative I1 and I2 are Ti elements derived from Agrobacterium. Of course, other elements that can play a similar integrating role can also be used in this invention.

[0217] The various elements used in the constructs of this invention are either known in the art or can be prepared by methods known to those skilled in the art. For example, the corresponding elements can be obtained by conventional methods, such as PCR, fully artificial chemical synthesis, and enzymatic digestion, and then linked together using well-known DNA ligation techniques to form the constructs of this invention.

[0218] Inserting the construct of the present invention into an exogenous vector (especially a vector suitable for transgenic plant manipulation) constitutes the vector of the present invention.

[0219] The vector of the present invention is transformed into plant cells to mediate the integration of the vector of the present invention into the plant cell chromosomes and expressed in the plant, thereby obtaining gene-edited plant cells.

[0220] The gene-edited plant cells of this invention are regenerated into plant bodies, thereby obtaining gene-edited plants.

[0221] The nucleic acid constructs prepared in this invention can be introduced into plant cells using conventional plant recombination techniques (such as Agrobacterium transfer technology) to obtain plant cells carrying the nucleic acid constructs (or vectors carrying the nucleic acid constructs), or to obtain plant cells with the nucleic acid constructs integrated into their genome.

[0222] The plant individuals in this invention that integrate the nucleic acid constructs can be isolated or removed in their offspring through conventional screening or other means known in the art, thereby obtaining gene-edited plant bodies that do not contain nucleic acid constructs.

[0223] Specifically, the present invention improves gene editing efficiency by expressing the coding sequence of a specific EF promoter, such as tomato EF1a, which drives the gene editing enzyme (such as Cas9) and deaminase fusion protein.

[0224] Carrier construction

[0225] The main feature of this vector is that it links together the coding sequences of a specific EF promoter (such as tomato EF1a), a deaminase, and a Cas fusion protein, optionally also including a nuclear localization signal and a UGI coding sequence, to form the specific nucleic acid construct of this invention. When this nucleic acid construct is expressed in the cytoplasm, the fusion protein encoded by it can be very efficiently transferred to the nucleus and guided to the target site in the genome by the guide RNA encoded by the construct of Formula II, thereby performing AT-to-GC or CG-to-TA base substitutions at the target site, essentially avoiding or eliminating the risk of insertion / deletion, and significantly improving the efficiency of gene editing.

[0226] Since adenine deaminase mutates A to G and cytosine deaminase mutates C to T, the DNA double-strand cleavage activity of the Cas protein is not required. Therefore, in this invention, the Cas protein is a mutant Cas protein with no cleavage activity or single-strand cleavage activity. In a preferred embodiment, the Cas protein of this invention may be nCas9, whose amino acid sequence is shown in SEQ ID NO.:2. Generally, to increase the activity of fusion proteins, proteins are typically linked by some flexible short peptides, i.e., linkers. Preferably, the linker may be XTEN, whose coding sequence is shown in SEQ ID NO.:17 and whose amino acid sequence is shown in SEQ ID NO.:18.

[0227] Select an expression cassette suitable for plant cells and construct it in the same vector as the open expression cassette (ORF) of the aforementioned fusion protein.

[0228] In this invention, the vector can be of types such as plasmids, viruses, granules, bacteriophages, etc., which are well known to those skilled in the art and are extensively described in the field. Preferably, the expression vector in this invention is a plasmid. The expression vector may contain a promoter, a ribosome binding site for translation initiation, a polyadenylation site, a transcription terminator, an enhancer, etc. The expression vector may also contain one or more selectable marker genes for selecting host cells containing the vector. Such selectable markers include genes encoding dihydrofolate reductase, genes conferring neomycin resistance, genes conferring tetracycline or ampicillin resistance, etc.

[0229] The nucleic acid constructs of the present invention can be inserted into vectors by various methods, such as ligation after digestion of the insert and vector with appropriate restriction endonucleases. Various cloning techniques are known in the art and are within the knowledge of those skilled in the art.

[0230] The vectors applicable in this invention include plasmids that are commercially available, such as, but not limited to: pBR322 (ATCC37017), pCAMBIA1300, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA), pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174, and pBluescript II. KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharma cia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia), etc.

[0231] Genetic transformation

[0232] In this invention, there are no particular limitations on the method for introducing the Formula I construct into cells or integrating it into the genome. Conventional methods can be used, such as introducing the Formula I construct or the corresponding vector into plant cells using suitable methods. Representative introduction methods include, but are not limited to, Agrobacterium transfection, gene gun method, microinjection method, electroporation method, ultrasound method, and polyethylene glycol (PEG) mediated method, etc.

[0233] In this invention, there are no particular limitations on the recipient plant, which includes various agricultural plants (such as grasses), forestry plants, horticultural plants (such as flowering plants), etc. Representative examples include, but are not limited to: rice, soybeans, tomatoes, corn, tobacco, wheat, sorghum, potatoes, etc.

[0234] After the aforementioned DNA vector or fragment is introduced into plant cells, the DNA in the transformed plant cells expresses the fusion protein and gRNA. A gene-editing enzyme (such as Cas9 nuclease) fused with adenine deaminase and / or cytosine deaminase, guided by the corresponding gRNA, mutates A at the target site to G (leading to a T mutation to C on the complementary strand) or mutates C at the target site to T (leading to a G mutation to A on the complementary strand).

[0235] Plant cells, tissues, or organs that have undergone site-specific genome replacement using the method of this invention can be regenerated using conventional methods to obtain the corresponding gene-edited plants. For example, plants with base substitutions can be regenerated through tissue culture.

[0236] application

[0237] This invention can be used in the field of plant genetic engineering for plant research and breeding, especially for the genetic improvement of economically valuable crops, forestry crops or horticultural plants.

[0238] The main advantages of this invention include:

[0239] (1) This invention is the first to link a specific promoter (such as the Ef1a promoter) with a gene editing enzyme (such as Cas9 nuclease), adenine deaminase and / or cytosine deaminase, optionally including a nuclear localization signal and the coding sequence of UGI, thereby forming the specific nucleic acid construct of this invention. The nucleic acid construct of this invention has successfully achieved gRNA-guided site-directed mutagenesis (such as A to G) in plants, and the mutagenesis efficiency is very high (up to ≥70% or higher).

[0240] (2) The specific nucleic acid constructs of the present invention can edit gene sites that do not function in other promoters, thus overcoming the obstacle of gene editing being limited by genotype.

[0241] (3) The specific nucleic acid constructs of the present invention can edit some plants that do not function with other promoters, such as soybeans, effectively expanding the scope of use of gene editing systems and breaking down species barriers.

[0242] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. Unless otherwise specified, all experimental materials and reagents involved in this invention are commercially available.

[0243] Example 1: Single-base editing efficiency of different promoters in tomato

[0244] 1. Target selection

[0245] Solyc05g012020, which affects fruit development in tomatoes, was selected as the target gene. Six sgRNAs were designed for six target sites. The sequences of the six designed sgRNAs are as follows: sgRNA1: TACTGGAGTTGTACCTGGA (SEQ ID NO.:20), sgRNA2: GGAACAGCTTGAACGTCAAT (SEQ ID NO.:21), sgRNA3: GAACAGCCTTCTCATCATGA (SEQ ID NO.:22), sgRNA4: GGTGAGGATTTGGGACAATT (SEQ ID NO.:23), sgRNA5: CTGTGAATCTGATGAAGTTT (SEQ ID NO.:24), sgRNA6: GAAAAGTAATAACAAAGGGC (SEQ ID NO.:25).

[0246] 2. Carrier Construction

[0247] The expression cassette for the ABE single-base editor was obtained using homologous recombination technology (see [link]). Figure 1 The nucleotide sequence of the adenine deaminase ABE7.10 is shown in SEQ ID NO.:5 or 19, and the nucleotide sequence of the SlEF1a promoter is shown in SEQ ID NO.:1. The specific operation is as follows:

[0248] A) Using tomato genomic DNA as a template, the target fragment was amplified using forward / reverse primers pSlEF1a-F / pSlEF1a-R to obtain PCR products (approximately 1583 bp in length, primer annealing temperature of 58°C).

[0249]

[0250] The PCR reaction conditions were: 95℃ pre-denaturation for 5 minutes, 98℃ denaturation for 30 seconds, 58℃ annealing for 30 seconds, 72℃ extension for 45 seconds, 35 cycles, followed by a final extension at 72℃ for 5 minutes.

[0251] B) The vector backbone was recovered by digestion with restriction endonucleases Sbf1 and SalI.

[0252] proAtU6-gRNA-pro35S-ABE7.10-nspCas9

[0253] C) The PCR product obtained from A was ligated into the backbone vector obtained from B via homologous recombination to obtain the single-base editing vector proAtU6-gRNA-proSlEF1a-ABE7.10-nspCas9

[0254]

[0255] The PCR reaction conditions were: 50℃ for 30 min.

[0256] D) Transform E. coli, select single clones, and sequence to verify that the fragments were successfully ligated into the vector.

[0257] Single-base editing vectors containing promoters 35S, UBI, AtRPS5A, SlRPS5A1, SlRPS5A2, and SlTCTP were constructed using the same method.

[0258] 3. Genetic transformation

[0259] (A) The above-constructed plasmid was directly transformed into Agrobacterium EHA105:

[0260] (1) Plasmid DNA was added to Agrobacterium competent cells, followed by an ice bath for 30 min, a liquid nitrogen bath for 5 min, and then an immediate water bath at 37°C for 5 min, followed by an ice bath for 5 min.

[0261] (2) Take out the centrifuge tube, add 700ul of YEP medium, and shake to incubate for 2-4 hours.

[0262] (3) Take out the bacterial culture and spread it on YEP medium plates containing the corresponding antibiotics. Incubate it upside down in an incubator. Colonies will be visible in about 2 days.

[0263] (B) Genetically modified tomatoes

[0264] (1) Take 7-10 day old sterile tomato seedlings (cotyledons fully expanded, first true leaves slightly exposed), cut the cotyledons into 5 mm square leaves (cut off the leaf tip and a small part of the base, leaving the middle part), place them face up in the pre-culture medium, and incubate in the dark at 25℃ for 2 days.

[0265] (2) Streak the bacterial culture stored at -80℃ onto solid YEB medium and incubate in the dark at 28℃ for 2 days. Pick a single colony and add it to 5 ml of liquid YEB medium, incubate at 28℃ and 200 rpm for 1 day. Take 2 ml of bacterial culture and add it to 50 ml of fresh YEB medium, incubate at 28℃ and 200 rpm. Centrifuge at 4℃ and 5000 rpm for 10 min, resuspend the bacterial cells with infection buffer, and adjust the OD600 to about 0.6-0.8.

[0266] (3) Infect the cotyledons that have been pre-cultured for 2 days in the bacterial solution for 5-10 minutes. After absorbing the excess bacterial solution on the filter paper plate, place them face up on the co-culture medium (or filter paper moistened with sterile infection solution) and incubate in the dark at 25°C for 2 days.

[0267] (4) Transfer the cotyledons that have been co-cultured for 2 days to a sterile culture medium and incubate at 25°C for 7 days, with the first 2-3 days in the dark and the last 4-5 days in the light. After 7 days of co-culture, transfer the cotyledons to a selection medium and incubate for 30-45 days. Subculture every 15 days.

[0268] (5) After sterilization, perform marker gene detection (taking GUS as an example). Take several cotyledons 7 days after sterilization and perform GUS staining. Adjust the infection time according to the size of the stained area. (It is not necessary to perform this for every batch, but to check the activity of the bacteria periodically).

[0269] (6) To detect the damage of Agrobacterium to cotyledons, take a number of cotyledons after 7 days of sterilization and let them continue to grow in sterilized culture medium for about 30 days. Subculture once every 15 days, observe the cotyledon differentiation rate, judge the degree of damage of bacterial solution to cotyledons, and adjust the infection time.

[0270] (7) When the differentiated seedlings grow to about 2cm, cut them off and transfer them to a rooting medium. Culture them until roots emerge.

[0271] (8) Transfer the healthy seedlings that have differentiated to a rooting medium containing antibiotics for one week of rooting culture, harden the seedlings at room temperature for 2-3 days, and then cultivate them in a greenhouse substrate.

[0272] (9) Gene editing detection. Leaves were taken from each plant, genomic DNA was extracted, and primers were designed on both sides of the gRNA target site. The amplified fragments were then subjected to Sanger sequencing to determine the genotype of each plant.

[0273] 4. Experimental Results

[0274] The slEF1a promoter achieves editing efficiency of up to 70% in single-base editing, which is 2-20 times higher than other promoters (see [link]). Figure 2 ).

[0275] 5. Experimental Conclusions

[0276] The slEF1a promoter can efficiently drive the expression of the fusion protein of deaminase and Cas9, effectively expanding the applicability of single-base editing tools and playing an important role in plant trait improvement and variety breeding.

[0277] Example 2: Single-base editing efficiency of different promoters in soybean

[0278] The GmELF3a and GmALS1 genes from soybean were selected, and the single-base editing efficiency of different promoters and base editors was investigated. The gRNAs used are shown in the table below:

[0279]

[0280] Firstly, following the method described in Example 1, the editing efficiency of the SlEF1a promoter (pSlEF1a), CaMV35S promoter (35S), and AA6 promoter (pAA6, reference: CN101370939A) when used in conjunction with ABE7.10 (SEQ ID NO.: 5 or 19) and Cas9 was examined; such as Figure 3 As shown, the “A to G gRNA1” refers to the result of using different promoters in combination with the above-mentioned adenine deaminase. In soybeans, the editing efficiency produced by using the SlEF1a promoter is much higher than that of the CaMV35S promoter and the AA6 promoter.

[0281] In addition, using the above method, the adenine deaminase is replaced with cytosine deaminase, the amino acid sequence of which is shown in SEQ ID NO.:6, 8-11. This embodiment preferably uses the cytosine deaminase shown in SEQ ID NO.:6. The editing efficiency of different promoters when used in conjunction with cytosine deaminase and Cas9 is investigated. Figure 3 As shown, the “C to T gRNA2” refers to the result of using different promoters in combination with the above-mentioned cytosine deaminase. In soybeans, the editing efficiency produced by using the SlEF1a promoter is much higher than that of the CaMV35S promoter and the AA6 promoter.

[0282] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. sequence list <110> Shandong Shunfeng Biotechnology Co., Ltd. <120> A method for nucleic acid expression <130> P2020-0390 <160> 27 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1583 <212> DNA <213> Artificial sequence <400> 1 gattagtttg tcaaatagta gagttcattt aaaattcttc agccatatag ttctattttt 60 aagctagtcg actttttttt tcttactgaa aattaatatt tttttctttt tgaaatacta 120 atacatctaa atttaacaat tgccaaagtg attttaatt agcttgctgg ctaatcacaa 180 taaaaattac tctcctttac tatataagta aatttttat gctatatttg ttattattat 240 tattattatt aatatttatt ttctacaaat ttaataatat tttattttat atcattttaa 300 aaagataagt aatgaaatat taagaattcg tttataattc ttttgcaggt gggtttctat 360 ttgtaagcta atctttttca gttatccttt ttttaaaatc tttattatta ttatagctat 420 atcttttatc tttaaaatt aacattatct attaaagata atttcaataa aagagtaaaa 480 attaatttag agttctactg tcttcaaatt tctattttaa aaaatacttt taaaacttga 540 tgtatttttt acgtggtttt tcactatgac ttaatttctg ttttattata atatgtataa 600 atataaaaat agattttcca taacatatta taaaaaatgt aaggggcatt tacgtaaata 660 gatagactta aaagaggcac cgagtgaacc ctaattctca tcgttgagac tataaaatgc 720 ccattatccc attcgcacag tctcttcatt acttttgctg ttattctcc tcagctgtgc 780 cgcatatcgc ctaatttttc ttctctaagg tttcatcatc ttcaccaatt tctttaatct 840 cgattcaatt tttatgttt gatctgttat tgttctgtca ctacatgtgt ttttcagttg 900 ttttactaga tgattttcac tgtcttcttg ttagatcata catatattga aaatgttttg 960 gattgacttt tttgtattgt gaatatctgt tattgtttga ttgttgttca gtatttacac 1020 acccgatctg tgttatgagc ttggtcataa ctatttctct gtatgtaaat acagatctgt 1080 taatgtttgt aatcaatttt tcatatgcac tgttgatatt gttctctctc ctgtcctgtt 1140 atatgttgat atgattcggt ttttgtataa cttgaactaa acactagtcc taaatgtttt 1200 ttttactatt taagatttat ataataatgga tagatttttt gagttcctag tctctgaaga 1260 ggttaagctt gctgtagttg tttaccagtt gaggtgcaat actaaaaatc aattcaatta 1320 ctgatatttt ttgctgttta ggtttttgac aaagtacttt aatttgcttt attgaactaa 1380 aaacgtagtc ctgaattcat tgcaagtgtg aaagctatag ttcattgttt ttgttgcaat 1440 tcttgaaaaa ttaatttgtc aagctataat ggattttact tttctgtt taatattgaa 1500 ttgctgaat ttatgaatgg gttgcatggt tttgaaata tgttgttgtg tgttgtgtaa 1560 atgcagtttc ttagtgtctc aag 1583 <210> 2 <211> 1368 <212> PRT <213> Streptococcus pyogenes <400> 2 Met Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 1 5 10 15 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 20 25 30 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Asn Leu Ile 35 40 45 Gly Ala Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 50 55 60 Lys Arg Thr Ala Arg Arg Tyr Thr Arg Arg Lys Asn Arg With Cys 65 70 75 80 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Asp Ser 85 90 95 Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 100 105 110 His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 115 120 125 His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp 130 135 140 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 145 150 155 160 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 165 170 175 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 180 185 190 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 195 200 205 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 210 215 220 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 225 230 235 240 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 245 250 255 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 260 265 270 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 275 280 285 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 290 295 300 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 305 310 315 320 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 325 330 335 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345 350 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360 365 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 370 375 380 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg 385 390 395 400 Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu 405 410 415 Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe 420 425 430 Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 435 440 445 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 450 455 460 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 465 470 475 480 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 485 490 495 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 500 505 510 Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys 515 520 525 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 530 535 540 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 545 550 555 560 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 565 570 575 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580 585 590 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595 600 605 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 610 615 620 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 625 630 635 640 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 645 650 655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 660 665 670 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680 685 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 690 695 700 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 705 710 715 720 His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 725 730 735 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 740 745 750 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 755 760 765 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile 770 775 780 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro 785 790 795 800 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 805 810 815 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 820 825 830 Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys 835 840 845 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 850 855 860 Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 865 870 875 880 Arg Tyr Asn To Lys Arg Asn With Thr Gln Arg Lys 885,890,895 Phe Asp Asp With Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu With Asp 900 905 910 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 915,920,925 Lys Tyr Asp Ser Arg Met Asn Thr Lys Tyr Asp 930,935,940 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Lys Ser 945 950 955 960 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 965,970,975 Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu Asn Ala Val 980,985,990 Val Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu Ser Glu Phe 995 1000 1005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys 1010 1015 1020 Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser 1025 1030 1035 1040 Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu 1045 1050 1055 Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile 1060 1065 1070 Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser 1075 1080 1085 Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly 1090 1095 1100 Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile 1105 1110 1115 1120 Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser 1125 1130 1135 Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly 1140 1145 1150 Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile 1155 1160 1165 Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala 1170 1175 1180 Lys Gly Tyr Lys Glu Val Lys Asp Leu Ile Ile Lys Leu Pro Lys 1185 1190 1195 1200 Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser 1205 1210 1215 Gly Glu Leu Gln Lys Gly Asn Leu Glu Ala Pro Ser Lys Tyr 1220 1225 1230 Validity of Tyr Leu Ala Ser in Tyr Glu Lys Leu Lys Gly Ser 1235 1240 1245 Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His 1250 1255 1260 Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val 1265 1270 1275 1280 There Is No Asp There Is No Asn There Is Asp Lys There Is There Is Tyr Asn Lys 1285 1290 1295 His Arg Asp Lys Pro With Arg Glu Gln Ala Glu Asn With His Leu 1300 1305 1310 Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp 1315 1320 1325 Thr Ile Asp Arg Lys Arg Tyr Thr Served Thr Lys Glu Val Leu Asp 1330 1335 1340 Only Gln Ser Ile and Gly and Tyr Glu Thr Arg Ile 1345 1350 1355 1360 Asp Leu Ser Gln Leu Gly Gly Asp 1365 <210> 3 <211> 4101 <212> DNA <213> Streptococcus pyogenes <400> 3 gatagaagt acagcatcgg cctggccatc ggcaccact ctgtggggctg ggccgtgatc 60 accgacgagt acaggtgcc cagcagaaa ttcaggtgc tgggcacac cgaccggcac 120 agcatcaaga agaacctgat cggagccctg ctgttcgaca gcggcgaac agccgaggcc 180 acccggctga agagaaccgc cagagaga tacaccagac ggaagaccg gatctgctat 240 ctgcaagaga tcttcagcaa cgagatggcc aaggtggacg acagctctt ccacagactg 300 gaagagtcct tcctggtgga agaggataag aagcacgagc ggcacccat cttcggcaac 360 atcgtggacg aggtggccta ccacgagaag taccccacca tctaccacct gagaaagaaa 420 ctggtggaca gcaccgacaa ggccgacctg cggctgatct atctggccct ggccacatg 480 atcaagttcc ggggccactt cctgatcgag ggcgacctga accccgacaa cagcgacgtg 540 gacaagctgt tcatccagct ggtgcagacc tacaaccagc tgttcgagga aaaccccatc 600 aacgccagcg gcgtggacgc caaggccatc ctgtctgcca gactgagcaa gagcagacgg 660 ctggaaaatc tgatcgccca gctgcccggc gagaagaaga atggcctgtt cggaaacctg 720 attgccctga gcctgggcct gacccccaac ttcaagagca acttcgacct ggccgaggat 780 gccaaactgc agctgagcaa ggacacctac gacgacgacc tggacaacct gctggcccag 840 atcggcgacc agtacgccga cctgtttctg gccgccaaga acctgtccga cgccatcctg 900 ctgagcgaca tcctgagagt gaacaccgag atcaccaagg cccccctgag cgcctctatg 960 atcaagagat acgacgagca ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag 1020 cagctgcctg agaagtacaa agagattttc ttcgaccaga gcaagaacgg ctacgccggc 1080 tacattgacg gcggagccag ccaggaagag ttctacaagt tcatcaagcc catcctggaa 1140 aagatggacg gcaccgagga actgctcgtg aagctgaaca gagaggacct gctgcggaag 1200 cagcggacct tcgacaacgg cagcatcccc caccagatcc acctgggaga gctgcacgcc 1260 attctgcggc ggcaggaagaa tttttaccca ttcctgaagg acaaccggga aaagatcgag 1320 aagatcctga ccttccgcat cccctactac gtgggccctc tggccagggg aaacgcaga 1380 1440 gtggacaagg gcgcttccgc ccagagcttc atcgagcgga tgaccaactt cgataagaac 1500 ctgcccaacg agaaggtgct gcccaagcac agcctgctgt acgagtactt caccgtgtat 1560 aacgagctga ccaaagtgaa atacgtgacc gaggaatga gaaagcccgc cttcctgagc 1620 ggcgagcaga aaaaggccat cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg 1680 aagcagctga aagaggacta cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc 1740 ggcgtggaag atcggttcaa cgcctccctg ggcacatacc acgatctgct gaaaattatc 1800 aagcaagg acttcctgga caatgaggaa aacgagca ttctgggaaga tatcgtgctg 1860 accctgacac tgtttgagga cagagagatg atcgaggaac ggctgaaaac ctatgcccac 1920 ctgttcgacg acaaagtgat gaagcagctg aagcggcgga gatacaccgg ctggggcagg 1980 ctgagccgga agctgatcaa cggcatccgg gacaagcagt ccggcaagac aatcctggat 2040 ttcctgaagt ccgacggctt cgccaacaga aacttcatgc agctgatcca cgacgacagc 2100 ctgaccttta aagaggacat ccagaaagcc caggtgtccg gccagggcga tagcctgcac 2160 gagcacattg ccaatctggc cggcagcccc gccattaaga agggcatcct gcagacagtg 2220 aaggtggtgg acgagctcgt gaaagtgatg ggccggcaca agcccgagaa catcgtgatc 2280 gaaatggcca gagagaacca gaccacccag aaggacaga agaacagccg cgagagaatg 2340 aagcggatcg aagagggcat caaagagctg ggcagccaga tcctgaaaga acaccccgtg 2400 gaaaaccc agctgcagaa cgagaagctg tacctgtact acctgcagaa tgggcgggat 2460 atgtacgtgg accaggaact ggacatcaac cggctgtccg actacgatgt ggacatatc 2520 gtgcctcaga gctttctgaa ggacgactcc atcgacaaca aggtgctgac cagaagcgac 2580 aagaaccggg ccaagagcga caacgtgccc tccgaagagg tcgtgaaa gatgaaac 2640 tactggcggc agctgctgaa cgccaagctg attacccaga gaaagttcga caatctgacc 2700 aaggccgaga gaggcggcct gagcgaactg gataaggccg gcttcatcaa gagacagctg 2760 gtggaaaccc ggcagatcac aaagcacgtg gcacagatcc tggactcccg gatgaacact 2820 aagtacgacg agaatgacaa gctgatccgg gaagtgaaag tgatcaccct gaagtccaag 2880 ctggtgtccg atttccggaa ggatttccag ttttacaaag tgcgcgagat caacaactac 2940 caccacgccc acgacgccta cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac 3000 cctaagctgg aaagcgagtt cgtgtacggc gactacaagg tgtacgacgt gcggaagatg 3060 atcgccaaga gcgagcagga aatcggcaag gctaccgcca agtacttctt ctacagcaac 3120 atcatgaact ttttcaagac cgagattacc ctggccaacg gcgagatccg gaagcggcct 3180 ctgatcgaga caaacggcga aaccggggag atcgtgtggg ataagggccg ggattttgcc 3240 accgtgcgga aagtgctgag catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag 3300 acaggcggct tcagcaaaga gtctatcctg cccaagagga acagcgataa gctgatcgcc 3360 agaaagaagg actgggaccc taagaagtac ggcggcttcg acagccccac cgtggcctat 3420 3480 gagctgctgg ggatcaccat catggaaaga agcagcttcg agaagaatcc catcgacttt 3540 ctggaagcca agggctacaa agaagtgaaa aaggacctga tcatcaagct gcctaagtac 3600 tccctgttcg agctggaaaa cggccggaag agaatgctgg cctctgccgg cgaactgcag 3660 aagggaaacg aactggccct gccctccaaa tatgtgaact tcctgtacct ggccagccac 3720 tatgagaagc tgaagggctc ccccgaggat aatgagcaga aacagctgtt tgtggaacag 3780 caaagcact acctggacga gatcatcgag cagatcagcg agttctccaa gagagtgatc 3840 ctggccgacg ctaatctgga caaagtgctg tccgcctaca acaagcaccg ggataagccc 3900 atcagagagc aggccgagaa tatcatccac ctgtttaccc tgaccaatct gggagcccct 3960 gccgccttca agtactttga caccaccatc gaccgga ggtacaccag caccaaagag 4020 gtgctggacg ccaccctgat ccaccagagc atcaccggcc tgtacgagac acggatcgac 4080 ctgtctcagc tgggaggcga c 4101 <210> 4 <211> 364 <212> PRT <213> Artificial Sequence <400> 4 Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu Thr 1 5 10 15 Leu Ala Lys Arg Ala Trp Asp Glu Arg Glu Val Pro Val Gly Ala Val 20 25 30 Leu Val His Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Pro Ile 35 40 45 Gly Arg His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg Gln 50 55 60 Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu Tyr 65 70 75 80 Val Thr Leu Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His Ser 85 90 95 Arg Ile Gly Arg Val Val Phe Gly Ala Arg Asp Ala Lys Thr Gly Ala 100 105 110 Ala Gly Ser Leu Met Asp Val Leu His His Pro Gly Met Asn His Arg 115 120 125 Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu Leu 130 135 140 Ser Asp Phe Phe Arg Met Arg Arg Gln Glu Ile Lys Ala Gln Lys Lys 145 150 155 160 Ala Gln Ser Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser Gly 165 170 175 Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly 180 185 190 Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr Trp 195 200 205 Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg Glu 210 215 220 Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg Val Ile Gly Glu 225 230 235 240 Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro Thr Ala His Ala Glu 245 250 255 Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu 260 265 270 Ile Asp Ala Thr Leu Tyr Val Thr Phe Glu Pro Cys Val Met Cys Ala 275 280 285 Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Val Arg 290 295 300 Asn Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His Tyr 305 310 315 320 Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp 325 330 335 Glu Cys Ala Ala Leu Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln Val 340 345 350 Phe Asn Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp 355 360 <210> 5 <211> 1092 <212> DNA <213> artificial sequence <400> 5 tctgaagtcg agtttagcca cgagtattgg atgaggcacg cactgaccct ggcaaagcga 60 gcatgggatg aaagagaagt ccccgtgggc gccgtgctgg tgcacaacaa tagagtgatc 120 ggagagggat ggaacaggcc aatcggccgc cacgacccta ccgcacacgc agagatcatg 180 gcactgaggc agggaggcct ggtcatgcag aattaccgcc tgatcgatgc caccctgtat 240 gtgacactgg agccatgcgt gatgtgcgca ggagcaatga tccacagcag gatcggaaga 300 gtggtgttcg gagcacggga cgccaagacc ggcgcagcag gctccctgat ggatgtgctg 360 caccaccccg gcatgaacca ccgggtggag atcacagagg gaatcctggc agacgagtgc 420 gccgccctgc tgagcgattt ctttagaatg cggagacagg agatcaaggc ccagaagaag 480 gcacagagct ccaccgactc tggaggatct agcggaggtt cctctggaag cgagacacca 540 ggcacaagcg agtccgccac accagagagc tccggcggct cctccggagg ctcctctgag 600 gtggagtttt cccacgagta ctggatgaga catgccctga ccctggccaa gagggcacgc 660 gatgagaggg aggtgcctgt gggagccgtg ctggtgctga acaatagagt gatcggcgag 720 ggctggaaca gagccatcgg cctgcacgac ccaacagccc atgccgaaat tatggccctg 780 agacagggcg gcctggtcat gcagaactac agactgattg acgccaccct gtacgtgaca 840 ttcgagcctt gcgtgatgtg cgccggcgcc atgatccact ctaggatcgg ccgcgtggtg 900 tttggcgtga ggaacgcaaa aaccggcgcc gcaggctccc tgatggacgt gctgcactac 960 cccggcatga atcaccgcgt cgaaattacc gagggaatcc tggcagatga atgtgccgcc 1020 ctgctgtgct atttctttcg gatgcctaga caggtgttca atgctcagaa gaaggcccag 1080 agctccaccg ac 1092 <210> 6 <211> 228 <212> PRT <213> Artificial Sequence <400> 6 Ser Ser Glu Thr Gly Pro Val Ala Val Asp Pro Thr Leu Arg Arg Arg 1 5 10 15 Ile Glu Pro His Glu Phe Glu Val Phe Phe Asp Pro Arg Glu Leu Arg 20 25 30 Lys Glu Thr Cys Leu Leu Tyr Glu Ile Lys Trp Gly Thr Ser His Lys 35 40 45 Ile Trp Arg His Ser Ser Lys Asn Thr Thr Lys His Val Glu Val Asn 50 55 60 Phe Ile Glu Lys Phe Thr Ser Glu Arg His Phe Cys Pro Ser Thr Ser 65 70 75 80 Cys Ser Ile Thr Trp Phe Leu Ser Trp Ser Pro Cys Gly Glu Cys Ser 85 90 95 Lys Ala Ile Thr Glu Phe Leu Ser Gln His Pro Asn Val Thr Leu Val 100 105 110 Ile Tyr Val Ala Arg Leu Tyr His His Met Asp Gln Gln Asn Arg Gln 115 120 125 Gly Leu Arg Asp Leu Val Asn Ser Gly Val Thr Ile Gln Ile Met Thr 130 135 140 Ala Pro Glu Tyr Asp Tyr Cys Trp Arg Asn Phe Val Asn Tyr Pro Pro 145 150 155 160 Gly Lys Glu Ala His Trp Pro Arg Tyr Pro Pro Leu Trp Met Lys Leu 165 170 175 Tyr Ala Leu Glu Leu His Ala Gly Ile Leu Gly Leu Pro Pro Cys Leu 180 185 190 Asn Ile Leu Arg Arg Lys Gln Pro Gln Leu Thr Phe Phe Thr Ile Ala 195 200 205 Leu Gln Ser Cys His Tyr Gln Arg Leu Pro Pro His Ile Leu Trp Ala 210 215 220 Thr Gly Leu Lys 225 <210> 7 <211> 684 <212> DNA <213> Artificial sequence <400> 7 agcagtgaaa ccggaccagt ggcagtggac ccaaccctga ggagacggat tgagccccat 60 gaatttgaag tgttctttga cccaagggag ctgaggaagg agacatgcct gctgtacgag 120 atcaagtggg gcacaagcca caagatctgg cgccacagct ccaagaacac cacaaagcac 180 gtggaagtga atttcatcga gaagtttacc tccgagcggc acttctgccc ctctaccagc 240 tgttccatca catggtttct gtcttggagc ccttgcggcg agtgttccaa ggccatcacc 300 gagttcctgt ctcagcaccc taacgtgacc ctggtcatct acgtggcccg gctgtatcac 360 cacatggacc agcagaacag gcagggcctg cgcgatctgg tgaattctgg cgtgaccatc 420 cagatcatga cagccccaga gtacgactat tgctggcgga acttcgtgaa ttatccacct 480 ggcaaggagg cacactggcc aagataccca cccctgtgga tgaagctgta tgcactggag 540 ctgcacgcag gaatcctggg cctgcctcca tgtctgaata tcctgcggag aaagcagccc 600 cagctgacat ttttcaccat tgctctgcag tcttgtcact atcagcggct gcctcctcat 660 attctgtggg ctacaggcct taaa 684 <210> 8 <211> 228 <212> PRT <213> Artificial Sequence <400> 8 Ser Ser Glu Thr Gly Pro Val Ala Val Asp Pro Thr Leu Arg Arg Arg 1 5 10 15 Ile Glu Pro His Glu Phe Glu Val Phe Phe Asp Pro Arg Glu Leu Arg 20 25 30 Lys Glu Ala Cys Leu Leu Tyr Glu Ile Lys Trp Gly Thr Ser His Lys 35 40 45 Ile Trp Arg Asn Ser Gly Lys Asn Thr Thr Lys His Val Glu Val Asn 50 55 60 Phe Ile Glu Lys Phe Thr Ser Glu Arg His Phe Cys Pro Ser Ile Ser 65 70 75 80 Cys Ser Ile Thr Trp Phe Leu Ser Trp Ser Pro Cys Trp Glu Cys Ser 85 90 95 Lys Ala Ile Arg Glu Phe Leu Ser Gln His Pro Asn Val Thr Leu Val 100 105 110 Ile Tyr Val Ala Arg Leu Phe Gln His Met Asp Gln Gln Asn Arg Gln 115 120 125 Gly Leu Arg Asp Leu Val Asn Ser Gly Val Thr Ile Gln Ile Met Thr 130 135 140 Ala Ser Glu Tyr Asp His Cys Trp Arg Asn Phe Val Asn Tyr Pro Pro 145 150 155 160 Gly Lys Glu Ala His Trp Pro Arg Tyr Pro Pro Leu Trp Met Lys Leu 165 170 175 Tyr Ala Leu Glu Leu His Ala Gly Ile Leu Gly Leu Pro Pro Cys Leu 180 185 190 Asn Ile Leu Arg Arg Lys Gln Pro Gln Leu Thr Phe Phe Thr Ile Ala 195 200 205 Leu Gln Ser Cys His Tyr Gln Arg Leu Pro Pro His Ile Leu Trp Ala 210 215 220 Thr Gly Leu Lys 225 <210> 9 <211> 150 <212> PRT <213> Artificial sequence <400> 9 Ser Ser Glu Thr Gly Pro Val Ala Val Asp Pro Thr Leu Arg Arg Arg 1 5 10 15 Ile Glu Pro Glu Phe Phe Asn Arg Asn Tyr Asp Pro Arg Glu Leu Arg 20 25 30 Lys Glu Thr Tyr Leu Leu Tyr Glu Ile Lys Trp Gly Lys Glu Ser Lys 35 40 45 Ile Trp Arg His Thr Ser Asn Asn Arg Thr Gln His Ala Glu Val Asn 50 55 60 Phe Leu Glu Asn Phe Phe Asn Glu Leu Tyr Phe Asn Pro Ser Thr His 65 70 75 80 Cys Ser Ile Thr Trp Phe Leu Ser Trp Ser Pro Cys Gly Glu Cys Ser 85 90 95 Lys Ala Ile Val Glu Phe Leu Lys Glu His Pro Asn Val Asn Leu Glu 100 105 110 Ile Tyr Val Ala Arg Leu Tyr Leu Cys Glu Asp Glu Arg Asn Arg Gln 115 120 125 Gly Leu Arg Asp Leu Val Asn Ser Gly Val Thr Ile Arg Ile Met Asn 130 135 140 Leu Pro Asp Tyr Asn Tyr 145 150 <210> 10 <211> 228 <212> PRT <213> Artificial sequence <400> 10 Ser Ser Glu Thr Gly Pro Val Ala Val Asp Pro Thr Leu Arg Arg Arg 1 5 10 15 Ile Glu Pro Phe Tyr Phe Gln Phe Asn Asn Asp Pro Arg Ala Cys Arg 20 25 30 Arg Lys Thr Tyr Leu Cys Tyr Glu Leu Lys Gln Asp Gly Ser Thr Trp 35 40 45 Val Trp Lys Arg Thr Leu His Asn Lys Gly Arg His Ala Glu Ile Cys 50 55 60 Phe Leu Glu Lys Ile Ser Ser Leu Glu Lys Leu Asp Pro Ala Gln His 65 70 75 80 Tyr Arg Ile Thr Trp Tyr Met Ser Trp Ser Pro Cys Ser Asn Cys Ala 85 90 95 Gln Lys Ile Val Asp Phe Leu Lys Glu His Pro His Val Asn Leu Arg 100 105 110 Ile Tyr Val Ala Arg Leu Tyr Tyr His Glu Glu Glu Arg Tyr Gln Glu 115 120 125 Gly Leu Arg Asn Leu Arg Arg Ser Gly Val Ser Ile Arg Val Met Asp 130 135 140 Leu Pro Asp Phe Glu His Cys Trp Glu Thr Phe Val Asp Asn Gly Gly 145 150 155 160 Gly Pro Phe Gln Pro Trp Pro Gly Leu Glu Glu Leu Asn Ser Lys Gln 165 170 175 Leu Ser Arg Arg Leu Gln Ala Gly Ile Leu Gly Leu Pro Pro Cys Leu 180 185 190 Asn Ile Leu Arg Arg Lys Gln Pro Gln Leu Thr Phe Phe Thr Ile Ala 195 200 205 Leu Gln Ser Cys His Tyr Gln Arg Leu Pro Pro His Ile Leu Trp Ala 210 215 220 Thr Gly Leu Lys 225 <210> 11 <211> 228 <212> PRT <213> Artificial sequence <400> 11 Ser Ser Glu Thr Gly Pro Val Ala Val Asp Pro Thr Leu Arg Arg Arg 1 5 10 15 Ile Glu Pro Phe His Phe Gln Phe Asn Asn Asp Pro Arg Ala Tyr Arg 20 25 30 Arg Lys Thr Tyr Leu Cys Tyr Glu Leu Lys Gln Asp Gly Ser Thr Trp 35 40 45 Val Leu Asp Arg Thr Leu Arg Asn Lys Gly Arg His Ala Glu Ile Cys 50 55 60 Phe Leu Asp Lys Ile Asn Ser Trp Glu Arg Leu Asp Pro Ala Gln His 65 70 75 80 Tyr Arg Val Thr Trp Tyr Met Ser Trp Ser Pro Cys Ser Asn Cys Ala 85 90 95 Gln Gln Val Val Asp Phe Leu Lys Glu His Pro His Val Asn Leu Arg 100 105 110 Ile Phe Ala Ala Arg Leu Tyr Tyr His Glu Gln Arg Arg Tyr Gln Glu 115 120 125 Gly Leu Arg Ser Leu Arg Gly Ser Gly Val Pro Val Ala Val Met Thr 130 135 140 Leu Pro Asp Phe Glu His Cys Trp Glu Thr Phe Val Asp His Gly Gly 145 150 155 160 Arg Pro Phe Gln Pro Trp Asp Gly Leu Glu Glu Leu Asn Ser Arg Ser 165 170 175 Leu Ser Arg Arg Leu Gln Ala Gly Ile Leu Gly Leu Pro Pro Cys Leu 180 185 190 Asn Ile Leu Arg Arg Lys Gln Pro Gln Leu Thr Phe Phe Thr Ile Ala 195 200 205 Leu Gln Ser Cys His Tyr Gln Arg Leu Pro Pro His Ile Leu Trp Ala 210 215 220 Thr Gly Leu Lys 225 <210> 12 <211> 57 <212> DNA <213> artificial sequence <400> 12 atgaaacgga cagccgacgg aagcgagttc gagtcaccaa agaagaagcg gaaagtc 57 <210> 13 <211> 51 <212> DNA <213> singular sequence (artificial sequence) <400> 13 aaaagaaccg ccgacggcag cgaattcgag cccaagaaga agaggaagt c <210> 14 <211> 66 <212> DNA <213> singular sequence (artificial sequence) <400> 14 gcttctccaa agcgtccgcg tgaccgtcac gatggagaat tgggtggacg caaacgtgca agaggt 66 <210> 15 <211> 22 <212> PRT <213> singular sequence (artificial sequence) <400> 15 Ala Ser Pro Lys Arg Pro Arg Asp Arg His Asp Gly Glu Leu Gly Gly 1 5 10 15 Arg Light Arg Sky Arg Gly 20 <210> 16 <211> 579 <212> DNA <213> singular sequence (artificial sequence) <400> 16 agcggcggga gcggcggggag cggcggggagc ggggggagca ctaatctgag cgacatcatt gagaaggaga ctgggaaaca gctggtcatt gaggagtcca tcctgatgct gcctgaggag 180. gtggaggag tgatcggcaa caagccagag tctgacatcc tggtgcacac cgcctacgac gagtccacag atgagaatgt gatgctgctg acctctgacg cccccgagta tagccttgg 240 gccctggtca tccaggattc taacggcgag aataagatca agatgctgag cggaggctcc ggaggatctg gaggcagcac caacctgtct gacatcatcg agaaggagac aggcaagcag ctggtcatcc aggagagcat cctgatgctg cccgaagaag tcgaagaagt gatcggaaac 420 aagcctgaga gcgatatcct ggtccatacc gcctacgacg agagtaccga cgaaaatgtg 480 atgctgctga catccgacgc cccagagtat aagccctggg ctctggtcat ccaggattcc 540 aacggagaga acaaaatcaa aatgctgtct ggcggctca <210> 17 <211> 96 <212> DNA <213> singular sequence (artificial sequence) <400> 17 tctggagggt cctccggcgg atcgtccggc agcgagacgc caggcacctc cgagagcgct 60 acgcctgaat cctccgggggg atcttcagga ggatca <210> 18 <211> 32 <212> PRT <213> singular sequence (artificial sequence) <400> 18 Ser Gly Gly Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr 1 5 10 15 Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser 20 25 30 <210> 19 <211> 1092 <212> DNA <213> Artificial Sequence <400> 19 tccgaagtcg agttttccca tgagtactgg atgagacacg cattgactct cgcaaagagg 60 gcttgggatg aacgcgaggt gcccgtgggg gcagtactcg tgcataacaa tcgcgtaatc 120 ggcgaaggtt ggaataggcc gatcggacgc cacgacccca ctgcacatgc ggaaatcatg 180 gcccttcgac agggagggct tgtgatgcag aattatcgac ttatcgatgc gacgctgtac 240 gtcacgcttg aaccttgcgt aatgtgcgcg ggagctatga ttcactcccg cattggacga 300 gttgtattcg gtgcccgcga cgccaagacg ggtgccgcag gttcactgat ggacgtgctg 360 catcacccag gcatgaacca ccgggtagaa atcacagaag gcatattggc ggacgaatgt 420 gcggcgctgt tgtccgactt ttttcgcatg cggaggcagg agatcaaggc ccagaaaaaa 480 gcacaatcct ctactgactc tggagggtcc tccggcggat cgtccggcag cgagacgcca 540 ggcacctccg agagcgctac gcctgaatcc tccgggggat cttcaggagg atcatccgaa 600 gtcgagtttt cccatgagta ctggatgaga cacgcattga ctctcgcaaa gagggctcgg 660 gatgaacgcg aggtgcccgt gggggcagta ctcgtgctta acaatcgcgt aatcggcgaa 720 ggttggaata gggcgatcgg actccacgac cccactgcac atgcggaaat catggccctt 780 cgacagggag ggcttgtgat gcagaattat cgacttatcg atgcgacgct gtacgtcacg 840 tttgaacctt gcgtaatgtg cgcgggagct atgattcact cccgcattgg acgagttgta 900 ttcggtgtcc gcaacgccaa gacgggtgcc gcaggttcac tgatggacgt gctgcattac 960 ccaggcatga accaccgggt agaaatcaca gaaggcatat tggcggacga atgtgcggcg 1020 ctgttgtgct acttttttcg catgccgagg caggtgttca atgcccagaa aaaagcacaa 1080 tcctctactg ac 1092 <210> 20 <211> 19 <212> DNA <213> Artificial sequence <400> 20 tactggagtt gtacctgga 19 <210> twenty one <211> 20 <212> DNA <213> Artificial sequence <400> twenty one ggaacagctt gaacgtcaat 20 <210> twenty two <211> 20 <212> DNA <213> Artificial sequence <400> twenty two gaacagcctt ctcatcatga 20 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <400> twenty three ggtgaggatt tgggacaatt 20 <210> twenty four <211> 20 <212> DNA <213> Artificial sequence <400> twenty four ctgtgaatct gatgaagttt 20 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <400> 25 gaaaagtaat aacaaagggc 20 <210> 26 <211> twenty two <212> DNA <213> Artificial sequence <400> 26 aaatatccac accttactaa gg <210> 27 <211> 22 <212> DNA <213> singular sequence (artificial sequence) <400> 27 aggtcccccg ccggatgatc gg

Claims

1. A nucleic acid construct, characterized in that, The nucleic acid construct has a 5' to 3' Formula I structure: P1-S1-L1-S2-S3(I); In Formula I: P1, S1, L1, S2, and S3 are elements used to constitute the structure. P1 is the first promoter sequence, the first promoter is an extension factor promoter, and the sequence of the first promoter is shown in SEQ ID NO.:1; S1 and S2 are each independently the coding sequences of one or more (a) gene editing enzymes, (b) adenine deaminases, and / or cytosine deaminases; S1 is the coding sequence of adenine deaminase and / or cytosine deaminase, S2 is the coding sequence of gene editing enzyme, the amino acid sequence of the gene editing enzyme is shown in SEQ ID NO.:2; the amino acid sequence of the adenine deaminase is shown in SEQ ID NO.:4; the amino acid sequence of the cytosine deaminase is shown in SEQ ID NO.:6; L1 is a non-linking peptide; S3 is the coding sequence for either no or no uracil glycosidase inhibitor UGI; Furthermore, each "-" independently represents a bond or nucleotide linkage sequence.

2. The nucleic acid construct as described in claim 1, characterized in that, The nucleotide sequence of the S3 element is shown in SEQ ID NO.:

16.

3. The nucleic acid construct according to any one of claims 1-2, characterized in that, The nucleic acid construct is also operatively linked to one or more localization signal sequences, the amino acid sequences of which are shown in SEQ ID NO.:

15.

4. A carrier, characterized in that, The vector contains the nucleic acid construct according to any one of claims 1-3.

5. A host cell, characterized in that, The cell contains the nucleic acid construct according to any one of claims 1-3, or its genome is integrated with one or more nucleic acid constructs according to any one of claims 1-3.

6. A reagent combination, characterized in that, include: (i) A first nucleic acid construct, or a first vector containing the first nucleic acid construct, wherein the first nucleic acid construct has a structure of Formula I from 5'-3': P1-S1-L1-S2-S3(I) in, P1 is the first promoter sequence, the first promoter is an extension factor promoter, and the sequence of the first promoter is shown in SEQ ID NO.:1; S1 and S2 are each independently a coding sequence for one or more (a) gene editing enzymes, (b) adenine deaminases, and / or cytosine deaminases, wherein S1 is a coding sequence for adenine deaminase and / or cytosine deaminase, and S2 is a coding sequence for a gene editing enzyme. The amino acid sequence of the gene editing enzyme is shown in SEQ ID NO.:2; the amino acid sequence of the adenine deaminase is shown in SEQ ID NO.:4; and the amino acid sequence of the cytosine deaminase is shown in SEQ ID NO.:

6. L1 is a non-linking peptide; S3 is the coding sequence for either no or no uracil glycosidase inhibitor UGI; Furthermore, "-" represents a bond or nucleotide linkage sequence; (ii) A second nucleic acid construct, or a second vector containing the second nucleic acid construct, wherein the second nucleic acid construct has a structure as shown in formula (II) from 5'-3': P2-Y1 (II); P2 is the second promoter; Y1 is the coding sequence for gRNA; Furthermore, "-" represents a bond or nucleotide linkage sequence.

7. A reagent kit, characterized in that, The kit contains the reagent combination as described in claim 6.

8. A method for gene editing in plants, characterized in that, Including the following steps: (i) Provide plants to be edited; and (ii) Introducing the nucleic acid construct of any one of claims 1-3, the vector of claim 4, or the reagent combination of claim 6 into the plant cells of the plant to be edited, thereby performing gene editing in the plant cells; the plant is selected from the group consisting of: tomato and soybean.

9. A method for preparing gene-edited plant cells, characterized in that, Including the following steps: Plant cells are transfected with the nucleic acid construct of any one of claims 1-3, the vector of claim 4, or the reagent of claim 6, so that the chromosomes in the plant cells undergo site-directed substitution or mutation, thereby obtaining the gene-edited plant cells; the plant is selected from the group consisting of tomato and soybean.

10. The use of any one of the nucleic acid constructs according to claims 1-3, the vector according to claim 4, the host cell according to claim 5, the reagent combination according to claim 6, and the kit according to claim 7, characterized in that, Used for gene editing in plants; the plants are selected from the following group: tomato, soybean.

11. A method for preparing gene-edited plants, characterized in that, Including the following steps: The gene-edited plant cells prepared by the method of claim 9 are regenerated into a plant body to obtain the gene-edited plant; the plant is selected from the group consisting of: tomato and soybean.

Images