Molecular marker and primer for identifying ula veredens and ula elzicsensis in heilongjiang river basin, method and application thereof
Patent Information
- Application Number
- CN202111237616.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-10-22
- Publication Date
- 2026-09-15
- Estimated Expiration
- 2041-10-22
AI Technical Summary
为了避免增殖放流过程中,江鳕增殖放流亲本的来源不明,进而导致两个流域水系的野生种质发生混杂,现急需建立一种快速准确有效区分两个流域江鳕种质资源的方法
[0018]Beneficial effects: The molecular genetic method of this invention for identifying cod germplasm resources in the Heilongjiang River Basin and the Ertis River Basin is used to identify them at the mitochondrial gene level, thereby avoiding the inaccuracy and easy confusion of judging the existence of cod germplasm in the two basins by external morphology.
Smart Images

Figure CN113930519B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetics technology for aquatic animals, specifically relating to a molecular marker and primer, as well as a method and application for identifying cod in the Heilongjiang River Basin and cod in the Ertis River Basin. Background Technology
[0002] The scourge (Lota lota) belongs to the order Gadiformes, suborder Gadidae, family Gadidae, and genus Lota. It is commonly known as the mountain catfish. Primarily distributed in cold-water rivers and lakes at high latitudes in the Northern Hemisphere, it is the only species in the Gadidae family to live in freshwater. In my country, it is mainly distributed in the Heilongjiang River and Ertis River basins. The scourge is a large fish with delicate flesh, lacking intramuscular spines, and rich in protein and lipids. Its liver is relatively large (accounting for 6-9% of its body weight) and can be used to produce cod liver oil. It is an important cold-water economic fish.
[0003] Because the river systems of the Heilongjiang and Ertis River basins are not interconnected, cod in the two basins cannot effectively exchange genes. With the prolonged geographical isolation, cod in the Heilongjiang and Ertis River basins have formed two relatively independent phylogenetic groups and germplasm resources. Germplasm resources are the foundation for breeding superior varieties and a key resource for promoting ecological protection and restoration and high-quality agricultural development. As natural water bodies are increasingly affected by human activities, such as the construction of water conservancy projects and water pollution, wild cod resources have declined sharply. To effectively restore the quantity of wild cod germplasm resources in both basins, fisheries and fishery administration departments have actively carried out stock enhancement and release programs for wild cod. To avoid the unclear origin of the parent cod released during the stock enhancement and release process, which could lead to mixing of wild germplasm from the two river systems, there is an urgent need to establish a rapid, accurate, and effective method for distinguishing cod germplasm resources between the two basins. Summary of the Invention
[0004] The purpose of this invention is to establish an accurate and rapid method for identifying cod in the Heilongjiang River Basin and cod in the Ertis River Basin.
[0005] This invention provides an SNP molecular marker for identifying cod in the Heilongjiang River Basin and cod in the Ertis River Basin, wherein the nucleotide sequence of the molecular marker is SEQ ID NO:1 or SEQ ID NO:2.
[0006] This invention provides primers for identifying cod in the Heilongjiang River Basin and cod in the Ertis River Basin. The nucleotide sequences of the primers are SEQ ID NO:3 and SEQ ID NO:4.
[0007] This invention provides a kit for identifying cod in the Heilongjiang River Basin and cod in the Ertis River Basin, containing the aforementioned primers.
[0008] This invention provides a method for distinguishing between the scourge of the Heilongjiang River basin and the scourge of the Ertis River basin, the method being as follows:
[0009] (1) Extract genomic DNA from the sample to be tested;
[0010] (2) Using the genomic DNA described in step (1) as a template, and using SEQ ID NO:3 and SEQ ID NO:4 as primers, PCR amplification was performed to obtain PCR amplification products;
[0011] (3) The PCR amplification product was digested with restriction endonuclease NlaIII to obtain the digested product. The digested product was detected by electrophoresis. If the individual had a single band of 111bp, it was a cod from the Heilongjiang River Basin. If the individual had two bands of 30bp and 81bp or a single band of 81bp, it was a cod from the Ertis River Basin.
[0012] Further specifying, the PCR reaction conditions in step (2) are: denaturation at 95℃ for 2 min, denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, for a total of 35 cycles, followed by extension at 72℃ for 3 min, and holding at 4℃.
[0013] Further specifying, the PCR reaction system in step (2) is: DreamTaq 25μL 2×PCR MasterMix, 19μL DNA enzyme-free water, 2μL 10μM primer SEQ ID NO:3, 2μL 10μM primer SEQ ID NO:4 and 2μL 50ng / μL DNA template.
[0014] Further specifying, the enzyme digestion reaction conditions in step (3) are: 37℃ water bath for 30 min, and 80℃ water bath for 5 min to terminate the reaction.
[0015] Further specifying, the enzyme digestion reaction system in step (3) is: 17 μL of DNA enzyme-free water, 2 μL of 10×FastDigest Green buffur, 10 μL of PCR amplification product and 1 μL of NlaIII restriction endonuclease.
[0016] Further specifying, the electrophoresis in step (3) uses 3% agarose gel or 8% polyacrylamide gel.
[0017] This invention provides the application of the above-mentioned molecular markers, primers, or kits in the identification of cod germplasm resources in the Heilongjiang River Basin and the Ertis River Basin.
[0018] Beneficial effects: The molecular genetic method of this invention for identifying cod germplasm resources in the Heilongjiang River Basin and the Ertis River Basin is used to identify them at the mitochondrial gene level, thereby avoiding the inaccuracy and easy confusion of judging the existence of cod germplasm in the two basins by external morphology.
[0019] The primers for the mitochondrial molecular markers of cod designed in this invention have a good conservation type in cod from the Heilongjiang River Basin and cod from the Ertis River Basin. The PCR products are all 111 bp in length, containing only a single base difference. This difference site can be recognized by the restriction endonuclease NlaIII, which cuts the mitochondrial marker PCR product of cod from the Ertis River Basin into two DNA fragments of 30 bp and 81 bp. However, it has no effect on the mitochondrial marker PCR product of cod from the Heilongjiang River Basin.
[0020] Using the primers (SEQ ID NO:3 and SEQ ID NO:4) of this invention, with the DNA of the sample to be tested as a template, the amplified product is digested with restriction endonuclease (NlaIII). The size of the digested product fragments ranges from 30bp to 111bp. By comparing with a DNA molecular weight marker containing a length of 100bp, individuals with bands greater than 100bp can be accurately and quickly identified as cod from the Heilongjiang River Basin, while individuals with bands less than 100bp can be identified as cod from the Ertis River Basin. Attached Figure Description
[0021] Figure 1 The images shown in Example 1 are 3% agarose gel electrophoresis images of PCR amplification and enzyme digestion of samples from the Heilongjiang River Basin and the Ertis River Basin cod using primers LLC1-3F and LLC1-3R; H-1, H-2, H-3, and H-4 are electrophoresis images of the Heilongjiang River Basin cod; M is the DL2000 marker; X-1, X-2, X-3, and X-4 are electrophoresis images of the Ertis River Basin cod.
[0022] Figure 2 The images shown are from Example 1, which are 8% polyacrylamide gel electrophoresis images of PCR amplification and enzyme digestion of samples from the Heilongjiang River Basin and the Ertis River Basin using primers LLC1-3F and LLC1-3R; H-1, H-2, H-3, and H-4 are electrophoresis images of Heilongjiang River Basin scops; M is the Thermo Scientific GeneRuler 50bp DNA molecular weight standard; X-1, X-2, X-3, and X-4 are electrophoresis images of Ertis River Basin scops. Specific Implementation
[0023] Example 1. Method for identifying scops ferret from the Heilongjiang River Basin and scops ferret from the Ertis River Basin
[0024] I. The gene sequence is a mitochondrial gene.
[0025] The sequence of the Heilongjiang River cod is shown in SEQ ID NO:1.
[0026] TGTCCTCTCTATAGGAGCCGTCTTTGCTATCATAGCAGCTTTGTTCACTGATTCCCGCTGTTTTACAGGCTATACTCTCCACGACACCTGAACAAAAATCCACTTTGGGGT
[0027] The sequence of the Ertis River cod is shown in SEQ ID NO:2.
[0028] TGTCCTCTCTATAGGAGCCGTCTTTGCTATCATAGCAGCTTTGTTCACTGATTCCCGCTGTTTTACAGGCTATACTCTCCATGACACCTGAACAAAAATCCACTTTGGGGT
[0029] Primers were designed based on the mitochondrial genes of cod from the Heilongjiang River Basin and cod from the Ertis River Basin:
[0030] LLC1-3F: 5'-TGTCCTCTCTATAGGAGCCGT-3' as SEQ ID NO:3
[0031] LLC1-3R: 5'-ACCCCAAAGTGGATTTTTGTTCA-3' as SEQ ID NO:4
[0032] II. Identification Methods
[0033] In this embodiment, the experimental samples selected were fin samples from 20 ferrets in the Heilongjiang River Basin and 20 ferrets in the Ertis River Basin. The following method was used to verify the accuracy of the molecular genetic method of the present invention in identifying the 20 ferrets in the Heilongjiang River Basin and the 20 ferrets in the Ertis River Basin.
[0034] 1. Extract genomic DNA from the fin rays of the cod to be tested, and set aside for later use; the specific method is as follows:
[0035] (1) Take the fin tissue of the sample to be identified (about 60 mg per fish), cut it into pieces and put it into a 1.5 mL EP tube. Add 600 μL of tissue extract and 10 μL of proteinase K, and digest it overnight on a shaker at 56℃ and 150 rpm.
[0036] (2) Add 600 μL of Tris-saturated phenol and invert for 10 minutes, then centrifuge at 12000 rpm for 10 minutes. Take the upper aqueous phase and add an equal volume of phenol-chloroform-isoamyl alcohol (24:23:1). Mix for 10 minutes.
[0037] (3) Centrifuge at 12000 rpm for 10 minutes, take the upper aqueous phase, add an equal volume of chloroform-isoamyl alcohol (23:1), and mix for 10 minutes;
[0038] (4) Centrifuge at 12000 rpm for 10 minutes, take the upper aqueous phase, add 2 volumes of anhydrous ice ethanol (stored at -20℃), shake horizontally until white flocculent matter appears;
[0039] (5) Centrifuge at 10,000 rpm for 10 minutes. A white DNA precipitate will be visible at the bottom of the tube. Discard the ethanol and allow it to air dry.
[0040] (6) Add an appropriate amount of 100 μL TE buffer, place it in a water bath at 55°C for 4 hours to dissolve the DNA, and store it at -20°C for later use.
[0041] 2. Using the extracted genomic DNA as a template, PCR amplification was performed using LLC1-3F and LLC1-3R as primers. The PCR amplification conditions were as follows: denaturation at 95℃ for 2 min, denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, for a total of 35 cycles, followed by extension at 72℃ for 3 min, and incubation at 4℃ to obtain the PCR product.
[0042] LLC1-3F: 5'-TGTCCTCTCTATAGGAGCCGT-3' as SEQ ID NO:3
[0043] LLC1-3R: 5'-ACCCCAAAGTGGATTTTTGTTCA-3' as SEQ ID NO:4
[0044] Table 1 PCR system
[0045] Dream Taq PCR Master Mix 2× 25μL DNA enzyme-free water 19μL 10μM primer LLC-3F 2μL 10μM primer LLC-3R 2μL 50 ng / μL DNA template 2μL
[0046] 3. The PCR product was digested with the restriction endonuclease Nla1II;
[0047] The enzyme digestion reaction system is shown in Table 2 below:
[0048] Table 2 Enzyme digestion system
[0049] DNA enzyme-free water 17μL 10×FastDigest Green buffur 2μL PCR products 10μL FASTDIGEST HIN1II 1μL
[0050] Enzyme digestion conditions: 37℃ water bath for 30 min, 80℃ water bath for 5 min to terminate the reaction.
[0051] 4. Identification was performed using a 3% agarose gel ( Figure 1 (as shown) or 8% polyacrylamide gel ( Figure 2 As shown in the figure, the enzyme digestion products were detected by electrophoresis. As shown in the figure, the individuals with double bands of 30bp and 81bp were Irtysh River cod (the 81bp band observed by agarose gel electrophoresis can also identify them as Irtysh River cod). The individuals with only a single band of 111bp in the electrophoresis results were Irtysh River cod. All 40 fish were identified. The identification results were compared with the actual species of the sample corresponding to each lane. It was found that the identification results of the method of the present invention were completely consistent with the actual fish species corresponding to each sample, indicating that the accuracy of the identification method of the present invention is as high as 100%. SEQUENCE LISTING <110> Heilongjiang Fisheries Research Institute, Chinese Academy of Fishery Sciences <120> Molecular markers, primers, and methods for identifying cod in the Heilongjiang River Basin and the Ertis River Basin, and their applications. use <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 111 <212> DNA <213> Artificial synthesis <400> 1 tgtcctctct ataggagccg tctttgctat catagcagct tttgttcact gattcccgct 60 gtttacaggc tatactctcc acgacacctg aacaaaaatc cactttgggg t 111 <210> 2 <211> 111 <212> DNA <213> Artificial synthesis <400> 2 tgtcctctct ataggagccg tctttgctat catagcagct tttgttcact gattcccgct 60 gtttacaggc tatactctcc atgacacctg aacaaaaatc cactttgggg t 111 <210> 3 <211> twenty one <212> DNA <213> Artificial synthesis <400> 3 tgtcctctct ataggagccg t 21 <210> 4 <211> twenty three <212> DNA <213> Artificial synthesis <400> 4 accccaaagt ggatttttgt tca 23
Claims
1. A method for distinguishing between the scops ferret of the Heilongjiang River basin and the scops ferret of the Ertis River basin, characterized in that, The method is as follows: (1) Extract genomic DNA from the sample to be tested; (2) Using the genomic DNA described in step (1) as a template, and using SEQ ID NO:3 and SEQ ID NO:4 as primers, PCR amplification was performed to obtain PCR amplification products; (3) The PCR amplification product was digested with restriction endonuclease NlaIII to obtain the digested product. The digested product was detected by electrophoresis. If the individual had a single band of 111bp, it was a cod from the Heilongjiang River Basin. If the individual had two bands of 30bp and 81bp or a single band of 81bp, it was a cod from the Ertis River Basin.
2. The method according to claim 1, characterized in that, The PCR reaction conditions in step (2) are: denaturation at 95℃ for 2 min, denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, for a total of 35 cycles, followed by extension at 72℃ for 3 min, and holding at 4℃.
3. The method according to claim 1, characterized in that, The PCR reaction system in step (2) is as follows: DreamTaq 25μL 2×PCR Master Mix, 19μL DNA enzyme-free water, 2μL 10μM primer SEQ ID NO:3, 2μL 10μM primer SEQ ID NO:4 and 2μL 50ng / μL DNA template.
4. The method according to claim 1, characterized in that, The enzyme digestion reaction conditions in step (3) are: 37℃ water bath for 30 min, and 80℃ water bath for 5 min to terminate the reaction.
5. The method according to claim 1, characterized in that, The enzyme digestion reaction system in step (3) is: 17 μL of DNA enzyme-free water, 2 μL of 10×FastDigest Green buffur, 10 μL of PCR amplification product and 1 μL of NlaIII restriction endonuclease.
6. The method according to claim 1, characterized in that, The electrophoresis in step (3) uses 3% agarose gel or 8% polyacrylamide gel.
7. Application of primer sequences with molecular marker nucleotide sequences of SEQ ID NO:1 or SEQ ID NO:2, or SEQ ID NO:3 and SEQ ID NO:4 in the identification of cod germplasm resources in the Heilongjiang River Basin and the Ertis River Basin.
Citation Information
Patent Citations
Universal primers and the use thereof for the detection and identification of vertebrate species
EP2714930A1
Roe and fry quick classification and determination methods based on CoI DNA bar codes
CN105349645A
Molecular biological method for rapidly identifying Sinkiang Lota lota Linnaeus and Heilongjiang Lota lota Linnaeus
CN107988348A
Burbot mitochondrial genome complete sequence amplification primer and designing and amplifying method thereof
CN108085366A